Qualité des eaux de la station de traitement de la ville de Skikda, Algérie Essais d'optimisation de la clarification

NASA Astrophysics Data System (ADS)

Meghzili, B.; Medjram, M. S.; Achour, S.

2005-05-01

A cause de la sécheresse qui a sévit durant une décennie, la station de traitement de l'eau potable de la ville de Skikda Algérie, en vue de combler le déficit en eau, utilise un mélange des eaux de surface (barrage) et des eaux souterraines (forage). Les résultats des analyses physico-chimiques de ces eaux montrent la présence de micropolluants, notamment le mercure, avec une concentration de 0.035 mg/l pour les eaux de surface et une concentration de 0.02 mg/l pour les eaux souterraines. Ces résultats obtenus, montrent également que la concentration en matières organiques dépasse, pour les deux sources, les normes OMS. Afin de réduire les effets de cette pollution, nous avons calculé les doses nécessaires des différents réactifs utilisés sur la base des essais d'optimisation réalisés en laboratoire. Les résultats obtenus nous ont permis de conclure que les doses de 30 à 60 mg/l de sulfate d'aluminium (S.A) sont nécessaires à une bonne élimination de la turbidité et des matières organiques (M.O) et que l'utilisation du charbon active en poudre (C.A.P) permet la réduction de la teneur en mercure au dessous du seuil admissible. L'utilisation d'un adjuvant (chaux vive) permet d'améliorer les résultats surtout pour la turbidité (4 mg/l). Une préchloration au break point semble intéressante pour améliorer la phase de floculation.

Human Factors Implications and Issues in Network Enabled Operations

DTIC Science & Technology

2006-08-28

même par des soldats individuels. L’armée de mer, quant à elle, évolue dans un environnement de complexité moyenne comparativement aux forces...approach found in most of the derivatives of NCW because the FORCEnet paper states that in the design of this new approach to warfare and other...defects mentality, risk aversion, poorly designed war fighting experiments, and widespread contentment with current performance, expectations for NCW will

Nouvelles morphologies de fibres electrofilees de polymere thermosensible =

NASA Astrophysics Data System (ADS)

Sta, Marwa

Ce memoire presente une etude sur la possibilite d'obtenir des membranes a base de polymeres thermosensibles avec differentes morphologies pour des applications d'administration de medicaments. Ces membranes ont ete obtenues par electrofilage du Poly (N vinylcaprolactame) (PNVCL), un polymere thermosensible, soit seul ou en melange avec du Polycaprolactone (PCL), un polymere biodegradable. Les parametres de procede ainsi que les proprietes de la solution a electrofiler ont ete optimises dans le but de creer des fibres de PNVCL lisses, continues et sans perles. Des solutions du melange (PNVCL) / (PCL) ont ete ensuite preparees en suivant quatre methodes differentes de preparation. Ces methodes se basent sur l'emploi de solvants distincts, eau distillee et chloroforme, avec differentes concentrations de polymere, 42wt% et 30wt% respectivement. Ces solutions ont ete electrofilees en utilisant les parametres de procede qui correspondaient aux meilleures conditions pour l'electrofilage du PNVCL. Ensuite, le ketophofene, un medicament hydrophobe, a ete ajoute au PNVCL et au melange PNVCL/PCL avant l'electrofilage afin d'etudier la capacite des fibres de PNVCL et de melanges de retenir le medicament hydrophobe et a en faire sa liberation. Enfin, des fibres noyau-enveloppes ont ete obtenues par electrofilage coaxial, en utilisant une solution aqueuse du melange PNVCL/PCL (42 wt%) pour l'enveloppe et une solution aqueuse du PEG (30 wt%) pour le noyau. Les morphologies des membranes resultantes et de leurs fibres ont ete caracterisees par microscopie electronique a balayage (MEB). La temperature de solution critique inferieure (LCST) de ces fibres, qui est la temperature en dessous de laquelle le polymere est soluble dans l'eau et au-dessus duquel il precipite, a ete evaluee par calorimetrie differentielle a balayage (DSC). L'efficacite d'encapsulation (EE) et la liberation du medicament ont ete evaluees en utilisant la technique de spectrophotometrie UV-visible. Des coupes transversales des fibres du melange (PNVCL) / (PCL) et des fibres preparees par electrofilage coaxial ont ete caracterisees par microscopie electronique a balayage (MEB) a haute resolution dans le but de determiner la taille des particules de PCL a l'interieur des fibres et de visualiser la morphologie noyau/enveloppe des fibres resultantes. Une membrane a nanofibres lisses et continues a ete obtenue par l'optimisation de l'electrofilage de PNVCL. L'addition de PCL au melange a conduit a un controle de la LCST et de l'hydrophobicite de la membrane. Il a egalement ete demontre que la liberation de medicament hydrophobe peut etre controlee par la morphologie de ce melange PCL/PNVCL. Finalement, il a ete possible de fabriquer des fibres noyau-enveloppe par l'electrofilage coaxial de PNVCL.

The Paul-Emile Victor group. to the rescue of the sea (in French)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The Paul-Emile Victor Group, which includes P. E. Victor, J. Auriol, A. Bombard, J. Y. Consteau, J. Debat, L. Leprince-Ringuet, and H. Tazieff, was formed to protect man and his environment, and for about a year has been prepared to deal with problems caused by marine pollution. Eight industrial firms, including the Compagnie Francaise des Petroles, supply chemical, financial, and scientific assistance. The Service d'Action and d'Assistance Marine d'Urgence and de Recherche (SAMUR), has three functions: corrective action, research and prevention, and education; it is divided into two sections: one comprising several rapid-action units (UNIR), and the other constituting amore » center for marine bioecological study and research (''cerber-mer''). The UNIR includes professional divers, pollution-control technicians, and biologists and goes into action immediately. The ''cerber-mer'' section will constitute a 24 hr information-exchange center for all of Europe.« less

Post-Deployment Reintegration Measure: Psychometric Replication and Preliminary Validation Results

DTIC Science & Technology

2006-02-01

soudain au pays et la reprise des fonctions et activités « normales » peuvent engendrer un stress significatif chez le personnel militaire. Notre...Contexte : Après un séjour prolongé outre-mer, le retour soudain aux fonctions et activités normales peut engendrer un stress significatif chez...Johnson et al ., 1997; Wilson & Krause, 1985). For instance, participants in a focus group study of Canadian Forces (CF) personnel indicated that it

Post-deployment Reintegration Measure: Psychometric Replication and Preliminary Validation Results

DTIC Science & Technology

2006-02-01

soudain au pays et la reprise des fonctions et activités « normales » peuvent engendrer un stress significatif chez le personnel militaire. Notre...Contexte : Après un séjour prolongé outre-mer, le retour soudain aux fonctions et activités normales peut engendrer un stress significatif chez...Johnson et al ., 1997; Wilson & Krause, 1985). For instance, participants in a focus group study of Canadian Forces (CF) personnel indicated that it

Current State of Bioabsorbable Polymer-Coated Drug-Eluting Stents

PubMed Central

Akinapelli, Abhilash; Chen, Jack P.; Roy, Kristine; Donnelly, Joseph; Dawkins, Keith; Huibregtse, Barbara; Hou, Dongming

2017-01-01

Drug-eluting stents (DES) have been shown to significantly reduce clinical and angiograph-ic restenosis compared to bare metal stents (BMS). The polymer coatings on DES elute antiproliferative drugs to inhibit intimal proliferation and prevent restenosis after stent implantation. Permanent poly-mers which do not degrade in vivo may increase the likelihood of stent-related delayed arterial healing or polymer hypersensitivity. In turn, these limitations may contribute to an increased risk of late clinical events. Intuitively, a polymer which degrades after completion of drug release, leaving an inert metal scaffold in place, may improve arterial healing by removing a chronic source of inflammation, neoath-erosclerosis, and/or late thrombosis. In this way, a biodegradable polymer may reduce late ischemic events. Additionally, improved healing after stent implantation could reduce the requirement for long-term dual antiplatelet therapy and the associated risk of bleeding and cost. This review will focus on bioabsorbable polymer-coated DES currently being evaluated in clinical trials.

Mid-wave IR Signatures of CFAV Quest in the North Atlantic Summer and Winter Climates

DTIC Science & Technology

2008-05-01

hiver, ce qui laisse supposer qu’elle pose un plus grand risque de détection du navire. DRDC Atlantic TM 2007-312 i This page intentionally left blank...consacrer ses efforts de gestion des signatures infrarouge. L’objectif final de l’obtention d’un moyen d’optimiser la signature infrarouge des navires...que représentée par le ministre de la Défense nationale, 2008 Original signed by Zahir A. Daya Original signed by Dave Hopkin Original signed by Ron

Caractérisation et optimisation d'états intriqués générés par un Oscillateur Paramétrique Optique à auto-verrouillage de phase

NASA Astrophysics Data System (ADS)

Laurat, J.; Keller, G.; Oliveira-Huguenin, J.-A.; Fabre, C.; Coudreau, T.

2006-10-01

Nous générons et caractérisons des faisceaux intriqués dégénérés en fréquence à l'aide d'un dispositif original appelé Oscillateur Paramétrique Optique à auto-verrouillage de phase. Nous avons ainsi obtenu des faisceaux intriqués pour lesquels ”l'inséparabilité" vaut 0.33 ± 0.02. Nous avons utilisé le formalisme des matrices de covariance pour déterminer la transformation ”non-locale" à appliquer à ces faisceaux afin d'en extraire le maximum d'intrication.

Optimisation des proprietes fonctionnelles des alliages a memoire de forme suite a l'application de traitements thermomecaniques

NASA Astrophysics Data System (ADS)

Demers, Vincent

L'objectif de ce projet est de determiner les conditions de laminage et la temperature de traitement thermique maximisant les proprietes fonctionnelles de l'alliage a memoire de forme Ti-Ni. Les specimens sont caracterises par des mesures de calorimetrie, de microscopie optique, de gene ration de contrainte, de deformation recuperable et des essais mecaniques. Pour un cycle unique, l'utilisation d'un taux d'ecrouissage e=1.5 obtenu avec l'application d'une force de tension FT = 0.1sigma y et d'une huile minerale resulte en un echantillon droit, sans microfissure et qui apres un recuit a 400°C, produit un materiau nanostructure manifestant des proprietes fonctionnelles deux fois plus grandes que le meme materiau ayant une structure polygonisee. Pour des cycles repetes, les memes conditions de laminage sont valables mais le niveau de deformation optimal est situe entre e=0.75-2, et depend particulierement du mode de sollicitation, du niveau de stabilisation et du nombre de cycles a la rupture requis par l'application.

Potentiation by a novel alkaloid glycoside adjuvant of a protective cytotoxic T cell immune response specific for a preerythrocytic malaria vaccine candidate antigen.

PubMed

Heal, K G; Sheikh, N A; Hollingdale, M R; Morrow, W J; Taylor-Robinson, A W

2001-07-20

We have recently demonstrated that the novel glycoalkaloid tomatine, derived from leaves of the wild tomato Lycopersicon pimpinellifolium, can act as a powerful adjuvant for the elicitation of antigen-specific CD8+ T cell responses. Here, we have extended our previous investigation with the model antigen ovalbumin to an established malaria infection system in mice and evaluated the cellular immune response to a major preerythrocytic stage malaria vaccine candidate antigen when administered with tomatine. The defined MHC H-2kd class I-binding 9-mer peptide (amino acids 252-260) from Plasmodium berghei circumsporozoite (CS) protein was prepared with tomatine to form a molecular aggregate formulation and this used to immunise BALB/c (H-2kd) mice. Antigen-specific IFN-gamma secretion and cytotoxic T lymphocyte activity in vitro were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunised control mice. Moreover, when challenged with P. berghei sporozoites, mice immunised with the CS 9-mer-tomatine preparation had a significantly delayed onset of erythrocytic infection compared to controls. The data presented validate the use of tomatine to potentiate a cellular immune response to antigenic stimulus by testing in an important biologically relevant system. Specifically, the processing of the P. berghei CS 9-mer as an exogenous antigen and its presentation via MHC class I molecules to CD8+ T cells led to an immune response that is an in vitro correlate of protection against preerythrocytic malaria. This was confirmed by the protective capacity of the 9-mer-tomatine combination upon in vivo immunisation. These findings merit further work to optimise the use of tomatine as an adjuvant in malaria vaccine development.

LRIT and AIS: An Analysis of October 2010 Data

DTIC Science & Technology

2014-10-01

Reine (en droit du Canada), telle que représentée par le ministre de la Défense nationale, 2014 DRDC Atlantic TM 2012-234 i Abstract...There have been amendments in the recent decade to Chapter V of the 1974 International Convention for the Safety of Life at Sea (SOLAS) which is...des modifications ont été apportées au chapitre V de la Convention internationale de 1974 pour la sauvegarde de la vie humaine en mer (SOLAS), qui

Inertial dissipation method applied to derive turbulent fluxes over the ocean during the Surface of the Ocean, Fluxes and Interactions with the Atmosphere/Atlantic Stratocumulus Transition Experiment (SOFIA/ASTEX) and Structure des Echanges Mer-Atmosphere, Proprietes des Heterogeneites Oceaniques: Recherche Experimentale (SEMAPHORE) experiments with low to moderate wind speeds

NASA Astrophysics Data System (ADS)

Dupuis, HéLèNe; Taylor, Peter K.; Weill, Alain; Katsaros, K.

1997-09-01

The transfer coefficients for momentum and heat have been determined for 10 m neutral wind speeds (U10n) between 0 and 12 m/s using data from the Surface of the Ocean, Fluxes and Interactions with the Atmosphere (SOFIA) and Structure des Echanges Mer-Atmosphere, Proprietes des Heterogeneites Oceaniques: Recherche Experimentale (SEMAPHORE) experiments. The inertial dissipation method was applied to wind and pseudo virtual temperature spectra from a sonic anemometer, mounted on a platform (ship) which was moving through the turbulence field. Under unstable conditions the assumptions concerning the turbulent kinetic energy (TKE) budget appeared incorrect. Using a bulk estimate for the stability parameter, Z/L (where Z is the height and L is the Obukhov length), this resulted in anomalously low drag coefficients compared to neutral conditions. Determining Z/L iteratively, a low rate of convergence was achieved. It was concluded that the divergence of the turbulent transport of TKE was not negligible under unstable conditions. By minimizing the dependence of the calculated neutral drag coefficient on stability, this term was estimated at about -0.65Z/L. The resulting turbulent fluxes were then in close agreement with other studies at moderate wind speed. The drag and exchange coefficients for low wind speeds were found to be Cen × 103 = 2.79U10n-1 + 0.66 (U10n < 5.2 m/s), Cen × 103 = Chn × 103 = 1.2 (U10n ≥ 5.2 m/s), and Cdn × 103 = 11.710n-2 + 0.668 (U10n < 5.5 m/s), which imply a rapid increase of the coefficient values as the wind decreased within the smooth flow regime. The frozen turbulence hypothesis and the assumptions of isotropy and an inertial subrange were found to remain valid at these low wind speeds for these shipboard measurements. Incorporation of a free convection parameterization had little effect.

Integrated Design Analysis and Optimisation of Aircraft Structures (L’Analyse pour la Conception Integree et l’Optimisation des Structures d’Aeronefs)

DTIC Science & Technology

1992-02-01

Division (Code RM) ONERA Office of Aeronautics & Space Technology 29 ave de la Division Leclerc NASA Hq 92320 Chfitillon Washington DC 20546 France United...Vector of thickness variables. V’ = [ t2 ........ tN Vector of thickness changes. AV ’= [rt, 5t2 ......... tNJ TI 7-9 Vector of strain derivatives. F...ds, ds, I d, 1i’,= dt, dr2 ........ dt--N Vector of buckling derivatives. dX d). , dt1 dt2 dtN Then 5F= Vs’i . AV and SX V,’. AV The linearised

A Two-Ended Shooting Technique for Calculating Normal Modes in Underwater Acoustic Propagation,

DTIC Science & Technology

1985-09-01

tnad~ I’or Public rL.00uq cmd ina ts 85 12 _ 8 126 UNLIMITED DISTRIBUTION * I ’ National Defence Defense Nationale Research and Bureau de Recherche...d6crit un algorithme de calcul des modes acoustiques normaux en mer. L’algoritbme est applicable & un prof il arbitraire do densit6 et do vitesse du son... profondeur do roncontre au milieu, habituellement pr&s du point do vitesse du son minimum. on amfiliore par it~ration la solution dlesaai jusqu’& ce

Les Cicatrices Retractiles Post-Brulures Du Membre Inferieur Chez L’Enfant

PubMed Central

Sankale, A.A.; Manyacka Ma Nyemb, P.; Coulibaly, N.F.; Ndiaye, A.; Ndoye, M.

2010-01-01

Summary Il s'agit d'une étude faisant ressortir les aspects épidémiologiques, cliniques et thérapeutiques des séquelles de brûlures du membre inférieur chez l'enfant, à propos de 42 cas colligés au service de chirurgie infantile de l'Hôpital Aristide Le Dantec (Sénégal). L'âge moyen retrouvé est de 5 ans et 3 mois, et le sex-ratio garçons/filles de 1,8/1. La brûlure thermique est causée par une flamme dans 33% des cas, par un liquide chaud dans 21% des cas, et par des braises dans 21% des cas. Les cicatrices rétractiles intéressent le genou et le creux poplité dans 47% des cas et le pied dans 45% des cas. Elles sont bilatérales dans 21% des cas, et concernent une autre localisation associée dans 21% des cas. Quant aux brides, 21% ont bénéficié d'une chirurgie, avec un délai moyen de 3 ans et 2 mois après la brûlure. Cette procédure chirurgicale consiste en une plastie en Z dans 91% des cas, à laquelle est associée une greffe de peau dans 54% des cas. Une rééducation fonctionnelle est pratiquée chez 54% des opérés. Parallèlement aux données de la littérature, nos résultats montrent que l'optimisation de la prise en charge passe par une meilleure prévention des accidents domestiques et une bonne codification thérapeutique. PMID:21991202

Meddy trajectories in the Canary Basin measured during the SEMAPHORE experiment, 1993-1995

NASA Astrophysics Data System (ADS)

Richardson, Philip L.; Tychensky, Aude

1998-10-01

As part of the Structures des Echanges Mer-Atmosphere, Proprietes des Heterogeneites Oceaniques: Recherche Experimentale (SEMAPHORE) experiment, four Mediterranean water eddies (Meddies) were identified in the Canary Basin and tracked with freely drifting RAFOS floats. One large and energetic Meddy, discovered 1700 km west of Cape Saint Vincent, Portugal, set a distance and speed record as it translated another 1700 km southwestward at 3.9 cm/s during 1.5 years. This Meddy traveled 57% of the distance from Cape Saint Vincent toward the spot McDowell and Rossby [1978] found a possible Meddy north of the Dominican Republic. Two Meddies were observed to interact with the Azores Current as they passed underneath or through it. Three Meddies collided with tall seamounts, which seemed to disrupt the normal swirl velocity, perhaps fatally in two cases. One Meddy appeared to bifurcate when it collided with seamounts.

Evaluation experimentale et theorique du comportement a la flexion de nouveaux poteaux en materiaux composites

NASA Astrophysics Data System (ADS)

Metiche, Slimane

La demande croissante en poteaux pour les differents reseaux d'electricite et de telecommunications a rendu necessaire l'utilisation de materiaux innovants, qui preservent l'environnement. La majorite des poteaux electriques existants au Canada ainsi qu'a travers le monde, sont fabriques a partir de materiaux traditionnels tel que le bois, le beton ou l'acier. Les motivations des industriels et des chercheurs a penser a d'autres solutions sont diverses, citons entre autre: La limitation en longueur des poteaux en bois ainsi que la vulnerabilite des poteaux fabriques en beton ou en acier aux agressions climatiques. Les nouveaux poteaux en materiaux composites se presentent comme de bons candidats a cet effet, cependant; leur comportement structural n'est pas connu et des etudes theoriques et experimentales approfondies sont necessaires avant leur mise en marche a grande echelle. Un programme de recherche intensif comportant plusieurs projets experimentaux, analytiques et numeriques est en cours a l'Universite de Sherbrooke afin d'evaluer le comportement a court et a long termes de ces nouveaux poteaux en Polymeres Renforces de Fibres (PRF). C'est dans ce contexte que s'inscrit la presente these, et notre recherche vise a evaluer le comportement a la flexion de nouveaux poteaux tubulaires coniques fabriques en materiaux composites par enroulement filamentaire et ce, a travers une etude theorique, ainsi qu'a travers une serie d'essais de flexion en "grandeur reelle" afin de comprendre le comportement structural de ces poteaux, d'optimiser la conception et de proposer une procedure de dimensionnement pour les utilisateurs. Les poteaux en Polymeres Renforces de Fibres (PRF) etudies dans cette these sont fabriques avec une resine epoxyde renforcee de fibres de verre type E. Chaque type poteaux est constitue principalement de trois zones ou les proprietes geometriques (epaisseur, diametre) et les proprietes mecaniques sont differentes d'une zone a l'autre. La difference entre ces proprietes est due au nombre de couches utilisees dans chaque zone ainsi qu'a l'orientation des fibres de chaque couche. Un total de vingt-trois prototypes de dimensions differentes; ont ete testes en flexion jusqu'a la rupture. Deux types de fibres de verre de masses lineaires differentes, ont ete utilisees afin d'evaluer l'effet du type de fibres sur le comportement a la flexion. Un nouveau montage experimental permettant de tester tous les types de poteaux en PRF a ete dimensionne et fabrique selon les recommandations decrites dans les normes ASTM D 4923-01 et ANSI C 136.20-2005. Un modele analytique base sur la theorie des poutres en elasticite lineaire est propose dans cette these. Ce modele predit avec une bonne precision le comportement experimental charge---deflexion ainsi que la deflexion maximale au sommet des poteaux en PRF; constitues de plusieurs zones de caracteristiques geometriques et mecaniques differentes. Une procedure de dimensionnement des poteaux en PRF, basee sur les resultats experimentaux obtenus dans le cadre de la presente these, est egalement proposee. Les resultats obtenus dans le cadre de la presente these permettront le developpement et l'amelioration des regles de conception utiles et pratiques a l'usage des concepteurs et des industriels du domaine des poteaux en PRF. Les retombees de cette recherche sont a la fois economiques et technologiques, car les resultats obtenus constitueront une banque de donnees qui contribueront au developpement des normes de calcul, et par consequent a l'optimisation des materiaux utilises, et serviront a valider de futurs resultats et modeles theoriques.

Optimisation de l'émission du continuum femtoseconde de lumière blanche entre 600 nm et 800 nm

NASA Astrophysics Data System (ADS)

Ramstein, S.; Mottin, S.

2005-06-01

Un dispositif de spectroscopie avec résolution du temps de vol des photons en milieu diffus a été développé. Celui-ci repose sur l'utilisation d'un continuum de lumière blanche généré par focalisation d'un laser amplifié (830 nm, 1 kHz, 0.5 W, 170 fs) dans de l'eau déminéralisée. Afin d'optimiser spectralement et en puissance la source blanche sur la fenêtre spectrale 600 800 nm, une étude de la mise en forme spatio-temporelle avant autofocalisation de l'impulsion laser par le milieu a été menée. Cette mise en forme est effectuée de manière spatiale en changeant la focale de la lentille de focalisation et de manière temporelle en changeant le taux de compression de l'impulsion. L'étude montre que le cône de lumière émise possède plus de puissance dans la fenêtre spectrale d'intérêt pour des focales longues. Sur la fenêtre 600-800 nm, le rendement énergétique intégré varie de 5%, avec une focalef=6cm, à 15%, avec une focale f = 30 cm. La mise en forme temporelle montre des effets similaires avec les mêmes ordres de grandeur.

Comparaison de méthodes d'identification des paramètres d'une machine asynchrone

NASA Astrophysics Data System (ADS)

Bellaaj-Mrabet, N.; Jelassi, K.

1998-07-01

Interests, in Genetic Algorithms (G.A.) expands rapidly. This paper consists initially to apply G.A. for identifying induction motor parameters. Next, we compare the performances with classical methods like Maximum Likelihood and classical electrotechnical methods. These methods are applied on three induction motors of different powers to compare results following a set of criteria. Les algorithmes génétiques sont des méthodes adaptatives de plus en plus utilisée pour la résolution de certains problèmes d'optimisation. Le présent travail consiste d'une part, à mettre en œuvre un A.G sur des problèmes d'identification des machines électriques, et d'autre part à comparer ses performances avec les méthodes classiques tels que la méthode du maximum de vraisemblance et la méthode électrotechnique basée sur des essais à vides et en court-circuit. Ces méthodes sont appliquées sur des machines asynchrones de différentes puissances. Les résultats obtenus sont comparés selon certains critères, permettant de conclure sur la validité et la performance de chaque méthode.

Approaches to S&T Cost Modeling at the U.S. Air Force Research Laboratory/Vehicle Aeronautics Directorate

DTIC Science & Technology

2000-09-01

fassent, si rien ne change par ailleurs. plus proche de l’ing~ni~rie du vivant . Une vdritable optimisation des 6ldinents de soutien logistique A bord...s souvent dans les arbres l’utilisation en service. fonctionnels, peuvent 8tre recueillies plus facilement dans un tableau crois6 avec les divers syst

Effet de l'énergie du faisceau d'ions servant à l'assistance du dépôt de matériaux organiques utilisés pour réaliser des diodes électroluminescentes

NASA Astrophysics Data System (ADS)

Antony, R.; Moliton, A.; Ratier, B.

1998-06-01

Light emitting diode based on the structure ITO/Alq3/Ca-Al lead to enhanced quantum efficiency when the Alq3 active layer is obtained by IBAD (Ion Beam Assisted Deposition): with Iodine ions, the optimization (quantum efficiency multiplied by a factor10) is obtained for an ion energy equal to 100eV. La réalisation de diodes électroluminescentes basées sur la structure ITO/Alq3/Ca-Al conduit à des performances améliorées lorsque le dépôt de la couche active Alq3 est effectué avec l'assistance d'un faisceau d'ions; l'optimisation (rendement quantique interne accru d'un ordre de grandeur) correspond à des ions Iode d'énergie 100eV.

Ocean Color Patterns Help to Predict Depth of Optical Layers in Coastal Marine Waters

DTIC Science & Technology

2012-02-09

Space Center, NASA, MS 39529, USA 3Institut des Sciences de la Mer, Universite du Quebec a Rimouski, Canada, *E-mail: martin_montes@uqar. qc. ca...depth was derived from CTD variables (i.e., temperature and conductivity without pressure correction) and using the standard UNESCO polynomial equation... la y *,es^ S Si es ti m at ed nt er re y B a n an d up ), th e up pe r te d in w h i 5112 ^ "a :*J ? tf?^ •a Mis a a •S M ^ « a fo

Revetements nanostructures pour la protection des metaux dans les environnements marins

NASA Astrophysics Data System (ADS)

Brassard, Jean-Denis

L'objectif de cette recherche est de verifier qu'un materiau superhydrophobe peut diminuer l'adherence et l'accumulation de la glace tout en conservant de bonnes proprietes anticorrosion. Afin de verifier cette assertion, trois familles de nouveaux revetements micros et nanostructures, identifiees par les lettres A, B, et C, ont ete developpes de facon a pouvoir en determiner l'efficacite glaciophobe en relation avec l'angle de contact particulier a chaque structure obtenue. Les revetements ont tous ete optimises pour que l'angle de contact et l'adherence au substrat soient maximaux. Les trois revetements optimises sont les suivants: Le revetement A a ete developpe pour application sur l'acier galvanise. Les microrugosites creees sont celles de la structure de la couche du zinc electrodepose en surface et les nanorugosites sont celles creees par le film de silicone copolymerise nanostructure. Un temps optimal de 10 min a ete retenu pour l'electrodeposition du zinc, ce dernier maximisant l'angle de contact a 155° lorsqu'enduit d'un film de silicone de 100 nm d'epaisseur. Le revetement B a ete developpe pour application sur un alliage d'aluminium. Les microrugosites creees sont celles de la microstructure granulaire obtenue par gravure de l'aluminium immerge dans un bain de HCl et les nanorugosites sont celles creees d'un meme film nanostructure de silicone copolymerise. La valeur optimale du temps de gravure est de 8 minutes et donne l'angle de contact le plus eleve a 154°, lorsqu'enduit du meme film de silicone de 100 nm d'epaisseur depose sur le revetement A. Le revetement C a ete developpe pour etre applique indifferemment sur tout substrat degraisse d'aluminium ou d'acier. Les microrugosites et les nanorugosites sont celles creees par les agregats de nanoparticules de ZnO rendues hydrophobes melangees au silicone qui sont pulverisees sur une couche d'appret composee de silicone et de polymethylhydrosiloxane. On obtient alors un produit composite rigide ou les nanoparticules de ZnO enrobees de silane sont imbriquees dans le reseau nanostructure de silicone copolymerise. Le revetement C produit de cette facon satisfaisait a la norme ASTM d'adherence a un substrat, mais n'est pas superhydrophobe, restant seulement hydrophobe avec un angle de contact reduit de 123°. Tous les revetements optimises developpes montrent un niveau de resistance a la corrosion beaucoup plus eleve que leur substrat tant en polarisation qu'en impedance electrochimique. Toutefois aucune relation entre l'hydrophobicite et le niveau de resistance a la corrosion n'a ete etablie. Il a seulement ete determine que ce sont la nature chimique de l'interface, a savoir ses proprietes electriques en isolation, son hydrophobicite et la presence d'air, de meme que l'epaisseur qui sont les deux aspects essentiels a respecter pour avoir de bonnes proprietes anticorrosion. Les trois revetements A, B, et C ont ete evalues quant a la reduction d'adherence et d'accumulation evaluee dans les environnements givrants rencontres en mer arctique. En premiere position, le revetement superhydrophobe B avec un angle de contact de 154°et un facteur de reduction l'adherence (ARF) de la glace sur l'aluminium de 14 et de la quantite accumulee 5% moindre. En seconde position, le revetement superhydrophobe A avec un angle de contact de 155° et un facteur ARF de 6, lequel n'a pas ete evalue en accumulation; et en troisieme position le revetement hydrophobe C avec un facteur de reduction de 3, lequel ne reduit pas la masse de glace accumulee. Deux mecanismes ont ete trouves responsables de l'adherence a la glace sur les revetements developpes soient: 1. l'effet d'ancrage diminue par la presence de nanorugosites hydrophobes recouvrant les microrugosites pouvant adsorber de l'air et 2. L'effet de la quantite d'air adsorbe dans la structure de l'interface, a savoir que pour des angles de contact egaux, si la quantite d'air augmente dans la microstructure, donc un Rrms plus eleve, ferait que l'adherence serait diminuee. Le fait que le revetement B possede un ARF plus eleve que le revetement A, alors qu'ils ont un angle de contact semblable, a 1° pres, est explique par le fait que la valeur des hauteurs des microrugosites Rrms y est plus elevee. Les essais d'accumulation en embruns marins ont permis d'observer que le revetement superhydrophobe accumulait moins de glace que ceux hydrophobe et hydrophile. Cette diminution peut s'expliquer par le fait que les gouttelettes d'eau surfondues vont rouler sans y adherer a cause de la nature superhydrophobe. (Abstract shortened by ProQuest.).

Etude de la transmission sonore a travers un protecteur de type "coquilles" : modelisation numerique et validation experimentale

NASA Astrophysics Data System (ADS)

Boyer, Sylvain

On estime que sur les 3,7 millions des travailleurs au Quebec, plus de 500 000 sont exposes quotidiennement a des niveaux de bruits pouvant causer des lesions de l'appareil auditif. Lorsqu'il n'est pas possible de diminuer le niveau de bruit environnant, en modifiant les sources de bruits, ou en limitant la propagation du son, le port de protecteurs auditifs individualises, telles que les coquilles, demeure l'ultime solution. Bien que vue comme une solution a court terme, elle est communement employee, du fait de son caractere peu dispendieux, de sa facilite d'implantation et de son adaptabilite a la plupart des operations en environnement bruyant. Cependant les protecteurs auditifs peuvent etre a la fois inadaptes aux travailleurs et a leur environnement et inconfortables ce qui limite leur temps de port, reduisant leur protection effective. Afin de palier a ces difficultes, un projet de recherche sur la protection auditive intitule : " Developpement d'outils et de methodes pour ameliorer et mieux evaluer la protection auditive individuelle des travailleur ", a ete mis sur pied en 2010, associant l'Ecole de technologie superieure (ETS) et l'Institut de recherche Robert-Sauve en sante et en securite du travail (IRSST). S'inscrivant dans ce programme de recherche, le present travail de doctorat s'interesse specifiquement a la protection auditive au moyen de protecteurs auditifs " passifs " de type coquille, dont l'usage presente trois problematiques specifiques presentees dans les paragraphes suivants. La premiere problematique specifique concerne l'inconfort cause par exemple par la pression statique induite par la force de serrage de l'arceau, qui peut reduire le temps de port recommande pour limiter l'exposition au bruit. Il convient alors de pouvoir donner a l'utilisateur un protecteur confortable, adapte a son environnement de travail et a son activite. La seconde problematique specifique est l'evaluation de la protection reelle apportee par le protecteur. La methode des seuils auditifs REAT (Real Ear Attenuation Threshold) aussi vu comme un "golden standard" est utilise pour quantifier la reduction du bruit mais surestime generalement la performance des protecteurs. Les techniques de mesure terrains, telles que la F-MIRE (Field Measurement in Real Ear) peuvent etre a l'avenir de meilleurs outils pour evaluer l'attenuation individuelle. Si ces techniques existent pour des bouchons d'oreilles, elles doivent etre adaptees et ameliorees pour le cas des coquilles, en determinant l'emplacement optimal des capteurs acoustiques et les facteurs de compensation individuels qui lient la mesure microphonique a la mesure qui aurait ete prise au tympan. La troisieme problematique specifique est l'optimisation de l'attenuation des coquilles pour les adapter a l'individu et a son environnement de travail. En effet, le design des coquilles est generalement base sur des concepts empiriques et des methodes essais/erreurs sur des prototypes. La piste des outils predictifs a ete tres peu etudiee jusqu'a present et meriterait d'etre approfondie. L'utilisation du prototypage virtuel, permettrait a la fois d'optimiser le design avant production, d'accelerer la phase de developpement produit et d'en reduire les couts. L'objectif general de cette these est de repondre a ces differentes problematiques par le developpement d'un modele de l'attenuation sonore d'un protecteur auditif de type coquille. A cause de la complexite de la geometrie de ces protecteurs, la methode principale de modelisation retenue a priori est la methode des elements finis (FEM). Pour atteindre cet objectif general, trois objectifs specifiques ont ete etablis et sont presentes dans les trois paragraphes suivants. (Abstract shortened by ProQuest.).

Amelioration de l'efficacite energetique du procede d'electrolyse de l'aluminium conception d'un nouveau bloc cathodique

NASA Astrophysics Data System (ADS)

Blais, Mathieu

Au Quebec, les alumineries sont de grandes consommatrices d'energie electrique, soit pres de 14 % de la puissance installee d'Hydro-Quebec. Dans ce contexte, des petits gains en efficacite energetique des cuves d'electrolyse pourraient avoir un impact important sur la reduction globale de la consommation d'electricite. Le projet de maitrise decrit dans cette etude repond a la problematique suivante : comment l'optimisation de la geometrie d'un bloc cathodique en vue d'uniformiser la densite de courant peut augmenter l'efficacite energetique et la duree de vie de la cuve d'aluminium? Le but premier du projet est de modifier la geometrie en vue d'ameliorer le comportement thermoelectrique des blocs cathodiques et d'accroitre par le fait meme l'efficacite energetique du procede de production d'aluminium. La mauvaise distribution de la densite de courant dans la cuve est responsable de certains problemes energetiques ayant des impacts negatifs sur l'economie et l'environnement. Cette non-uniformite de la distribution du courant induit une usure prematuree de la surface de la cathode et contribue a reduire la stabilite magnetohydrodynamique de la nappe de metal liquide. Afin de quantifier les impacts que peut avoir l'uniformisation de la densite de courant a travers le bloc cathodique, un modele d'un bloc cathodique d'une cuve de la technologie AP-30 a ete concu et analyse par elements finis. A partir de son comportement thermoelectrique et de donnees experimentales d'une cuve AP-30 tirees de la litterature, une correlation entre le profil de densite de courant a la surface du bloc et le taux d'erosion local au meme endroit a ete creee. Cette relation correspond au modele predictif de la duree de vie de tout bloc du meme materiau a partir de son profil de densite de courant. Ensuite, une programmation a ete faite incorporant dans une meme fonction cout les impacts economiques de la duree de vie, de la chute de voltage cathodique et de l'utilisation de nouveaux materiaux. Ceci a permis d'evaluer les benefices faits a partir d'un bloc modifie par rapport au bloc de reference. Plusieurs parametres geometriques du bloc sont variables sur un domaine realiste et l'integration d'un composant en materiau plus conducteur y a egalement ete etudiee. Utilisant des outils mathematiques d'optimisation, un design de bloc optimal a pu etre trouve. Les resultats demontrent qu'il est possible de generer des economies a partir de la modification du bloc. Il est egalement prouve que l'uniformisation de la densite de courant a travers le bloc peut apporter de grands avantages economiques et environnementaux dans le procede d'electrolyse de l'aluminium. Les resultats de cette etude serviront d'arguments pour les chercheurs dans l'industrie a savoir s'il vaut la peine d'investir ou non dans la fabrication d'un prototype experimental souvent tres couteux. Mots-cles : Efficacite energetique, electrolyse de l'aluminium, cathode, simulation thermoelectrique, uniformisation de la densite de courant, optimisation.

Aircraft to aircraft intercomparison during SEMAPHORE

NASA Astrophysics Data System (ADS)

Lambert, Dominique; Durand, Pierre

1998-10-01

During the Structure des Echanges Mer-Atmosphère, Propriétés des Hétérogénéités Océaniques: Recherche Expérimentale (SEMAPHORE) experiment, performed in the Azores region in 1993, two French research aircraft were simultaneously used for in situ measurements in the atmospheric boundary layer. We present the results obtained from one intercomparison flight between the two aircraft. The mean parameters generally agree well, although the temperature has to be slightly shifted in order to be in agreement for the two aircraft. A detailed comparison of the turbulence parameters revealed no bias. The agreement is good for variances and is satisfactory for fluxes and skewness. A thorough study of the errors involved in flux computation revealed that the greatest accuracy is obtained for latent heat flux. Errors in sensible heat flux are considerably greater, and the worst results are obtained for momentum flux. The latter parameter, however, is more accurate than expected from previous parameterizations.

Contrôle cohérent de la dynamique de fragmentation d'agrégats alcalins

NASA Astrophysics Data System (ADS)

Lindinger, A.; Lupulescu, C.; Le Roux, J.; Bartelt, A.; Vajda, Š.; Wöste, L.

2004-11-01

Les agrégats métalliques présentent des propriétés extraordinaires, en particulier chimiques et catalytiques, qui dépendent fortement de leur taille. Ce comportement en fait des candidats idéaux pour l'analyse en temps réel de processus photo-induits ultrarapides, le but ultime étant la conduite de scénarios de contrôle cohérent. Nous avons réalisé des expériences d'ionisation multiphotonique non stationnaire sur de petits agrégats alcalins de différentes tailles et dans différents états électroniques rovibrationnels, y compris leur état fondamental, sondant ainsi leur dynamique ondulatoire, leur orientation structurelle, leur transfert de charge et leur dissociation. Les processus observés dépendent grandement des paramètres du faisceau laser d'excitation, tels que sa phase, son amplitude et sa durée ; cette sensibilité plaide pour l'emploi d'un système de contrôle rétroactif permettant de générer les formes d'impulsion optimales. Les caractéristiques spectrales et temporelles de ces dernières reflètent les propriétés du système étudié ainsi que les processus photochimiques que l'irradiation y induit. Nous présentons d'abord la dynamique vibrationelle d'états électroniques excités, liés, dissociatifs et prédissociatifs, des dimères et trimères alcalins. Suit une description du principe d'observation par pompage optique par effet Raman stimulé de la dynamique d'un paquet d'onde dans l'état électronique fondamental. Puisque les paramètres de l'impulsion d'excitation influencent de façon significative le poids des différentes trajectoires dans l'espace des phases, nous avons mené des expériences sur les canaux de fragmentation concurrents d'une réaction photo-induite, en étudiant les différents embranchements des voies d'ionisation et de fragmentation de Na{2}K excité électroniquement. L'utilisation d'un algorithme évolutif, pour l'optimisation de la phase et de l'amplitude de l'onde électromagnétique appliquée, permit d'influencer significativement la quantité résultante d'ions parents ou fragments. Des propriétés intéressantes sont déduites de la forme des impulsions laser optimales obtenues, qui révèlent la période de vibration moléculaire et qui, combinées aux courbes de potentiel, permettent de proposer les trajectoires que l'optimisation impose aux paquets d'onde. Pour finir, nous avons étudié comment une variété plus grande d'agrégats, en contribuant au canal de fragmentation NaK, influe sur la forme optimale d'impulsion. Là encore, la structure de cette dernière apporte des éclaircissements sur les canaux de fragmentation empruntés durant le processus de contrôle.

Modelisation de photodetecteurs a base de matrices de diodes avalanche monophotoniques pour tomographie d'emission par positrons

NASA Astrophysics Data System (ADS)

Corbeil Therrien, Audrey

La tomographie d'emission par positrons (TEP) est un outil precieux en recherche preclinique et pour le diagnostic medical. Cette technique permet d'obtenir une image quantitative de fonctions metaboliques specifiques par la detection de photons d'annihilation. La detection des ces photons se fait a l'aide de deux composantes. D'abord, un scintillateur convertit l'energie du photon 511 keV en photons du spectre visible. Ensuite, un photodetecteur convertit l'energie lumineuse en signal electrique. Recemment, les photodiodes avalanche monophotoniques (PAMP) disposees en matrice suscitent beaucoup d'interet pour la TEP. Ces matrices forment des detecteurs sensibles, robustes, compacts et avec une resolution en temps hors pair. Ces qualites en font un photodetecteur prometteur pour la TEP, mais il faut optimiser les parametres de la matrice et de l'electronique de lecture afin d'atteindre les performances optimales pour la TEP. L'optimisation de la matrice devient rapidement une operation difficile, car les differents parametres interagissent de maniere complexe avec les processus d'avalanche et de generation de bruit. Enfin, l'electronique de lecture pour les matrices de PAMP demeure encore rudimentaire et il serait profitable d'analyser differentes strategies de lecture. Pour repondre a cette question, la solution la plus economique est d'utiliser un simulateur pour converger vers la configuration donnant les meilleures performances. Les travaux de ce memoire presentent le developpement d'un tel simulateur. Celui-ci modelise le comportement d'une matrice de PAMP en se basant sur les equations de physique des semiconducteurs et des modeles probabilistes. Il inclut les trois principales sources de bruit, soit le bruit thermique, les declenchements intempestifs correles et la diaphonie optique. Le simulateur permet aussi de tester et de comparer de nouvelles approches pour l'electronique de lecture plus adaptees a ce type de detecteur. Au final, le simulateur vise a quantifier l'impact des parametres du photodetecteur sur la resolution en energie et la resolution en temps et ainsi optimiser les performances de la matrice de PAMP. Par exemple, l'augmentation du ratio de surface active ameliore les performances, mais seulement jusqu'a un certain point. D'autres phenomenes lies a la surface active, comme le bruit thermique, provoquent une degradation du resultat. Le simulateur nous permet de trouver un compromis entre ces deux extremes. Les simulations avec les parametres initiaux demontrent une efficacite de detection de 16,7 %, une resolution en energie de 14,2 % LMH et une resolution en temps de 0.478 ns LMH. Enfin, le simulateur propose, bien qu'il vise une application en TEP, peut etre adapte pour d'autres applications en modifiant la source de photons et en adaptant les objectifs de performances. Mots-cles : Photodetecteurs, photodiodes avalanche monophotoniques, semiconducteurs, tomographie d'emission par positrons, simulations, modelisation, detection monophotonique, scintillateurs, circuit d'etouffement, SPAD, SiPM, Photodiodes avalanche operees en mode Geiger

Identification des parametres du moteur de l'avion Cessna Citation X pour la phase de croisiere a partir des tests en vol et a base des reseaux de neurones =

NASA Astrophysics Data System (ADS)

Zaag, Mahdi

La disponibilite des modeles precis des avions est parmi les elements cles permettant d'assurer leurs ameliorations. Ces modeles servent a ameliorer les commandes de vol et de concevoir de nouveaux systemes aerodynamiques pour la conception des ailes deformables des avions. Ce projet consiste a concevoir un systeme d'identification de certains parametres du modele du moteur de l'avion d'affaires americain Cessna Citation X pour la phase de croisiere a partir des essais en vol. Ces essais ont ete effectues sur le simulateur de vol concu et fabrique par CAE Inc. qui possede le niveau D de la dynamique de vol. En effet, le niveau D est le plus haut niveau de precision donne par l'autorite federale de reglementation FAA de l'aviation civile aux Etats-Unis. Une methodologie basee sur les reseaux de neurones optimises a l'aide d'un algorithme intitule le "grand deluge etendu" est utilisee dans la conception de ce systeme d'identification. Plusieurs tests de vol pour differentes altitudes et differents nombres de Mach ont ete realises afin de s'en servir comme bases de donnees pour l'apprentissage des reseaux de neurones. La validation de ce modele a ete realisee a l'aide des donnees du simulateur. Malgre la nonlinearite et la complexite du systeme, les parametres du moteur ont ete tres bien predits pour une enveloppe de vol determinee. Ce modele estime pourrait etre utilise pour des analyses de fonctionnement du moteur et pourrait assurer le controle de l'avion pendant cette phase de croisiere. L'identification des parametres du moteur pourrait etre realisee aussi pour les autres phases de montee et de descente afin d'obtenir son modele complet pour toute l'enveloppe du vol de l'avion Cessna Citation X (montee, croisiere, descente). Cette methode employee dans ce travail pourrait aussi etre efficace pour realiser un modele pour l'identification des coefficients aerodynamiques du meme avion a partir toujours des essais en vol. None None None

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

Transport aérien longue distance des brûlés graves: revue de la littérature et application pratique

PubMed Central

Leclerc, T.; Hoffmann, C.; Forsans, E.; Cirodde, A.; Boutonnet, M.; Jault, P.; Tourtier, J.-P.; Bargues, L.; Donat, N.

2015-01-01

Summary Les brûlés graves nécessitent une prise en charge multidisciplinaire dans des centres hautement spécialisés. La rareté de ces centres impose souvent le transport aérien médicalisé longue distance. Cependant, il y a peu de données publiées sur ces transferts. Dans cette mise au point, pour optimiser la prise en charge des brûlés dès qu’un transport aérien est décidé ou même seulement envisagé, nous proposons d’extraire de cette littérature limitée des principes simples s’appuyant aussi sur l’expérience pratique du Service de Santé des Armées françaises. Nous décrivons d’abord comment les contraintes aéronautiques peuvent affecter le transport de brûlés graves à bord d’aéronefs. Nous abordons ensuite la régulation de ces missions, en analysant les risques associés au transport aérien des brûlés graves et leurs implications sur les indications, la chronologie et les modalités du transport. Enfin, nous développons la conduite de la mission, comprenant la préparation du matériel et des consommables avant le vol, l’évaluation et la mise en condition du patient avant l’embarquement, et la poursuite de la prise en charge en vol. PMID:26668564

Fabrication et caracterisation de nanocristaux de silicium localises, realises par gravure electrochimique pour des applications nanoelectroniques

NASA Astrophysics Data System (ADS)

Ayari-Kanoun, Asma

Ce travail de these porte sur le developpement d'une nouvelle approche pour la localisation et l'organisation de nanocristaux de silicium realises par gravure electrochimique. Cette derniere represente une technique simple et peu couteuse par rapport aux autres techniques couramment utilisees pour la fabrication de nanocristaux de silicium. L'idee de ce travail a ete d'etudier la nanostructuration de minces couches de nitrure de silicium, d'environ 30 nm d'epaisseur pour permettre par la suite un arrangement periodique des nanocristaux de silicium. Cette pre-structuration est obtenue de facon artificielle en imposant un motif periodique via une technique de lithographie par faisceau d'electrons combinee avec une gravure plasma. Une optimisation des conditions de lithographie et de gravure plasma ont permis d'obtenir des reseaux de trous de 30 nm de diametre debouchant sur le silicium avec un bon controle de leur morphologie (taille, profondeur et forme). En ajustant les conditions de gravure electrochimique (concentration d'acide, temps de gravure et densite de courant), nous avons obtenu des reseaux -2D ordonnes de nanocristaux de silicium de 10 nm de diametre a travers ces masques de nanotrous avec le controle parfait de leur localisation, la distance entre les nanocristaux et leur orientation cristalline. Des etudes electriques preliminaires sur ces nanocristaux ont permis de mettre en evidence des effets de chargement. Ces resultats tres prometteurs confirment l'interet des nanocristaux de silicium realises par gravure electrochimique dans le futur pour la fabrication a grande echelle de dispositifs nanoelectroniques. Mots-cles : localisation, organisation, nanocristaux de silicium, gravure electrochimique, lithographie electronique, gravure plasma, nitrure de silicium.

Strategies facilitant les tests en pre-certification pour la robustesse a l'egard des radiations =

NASA Astrophysics Data System (ADS)

Souari, Anis

Les effets des radiations cosmiques sur l'electronique embarquee preoccupent depuis. quelques decennies les chercheurs interesses par la robustesse des circuits integres. Plusieurs. recherches ont ete menees dans cette direction, principalement pour les applications spatiales. ou l’environnement de leur deploiement est hostile. En effet, ces environnements sont denses. en termes de particules qui, lorsqu’elles interagissent avec les circuits integres, peuvent. mener a leur dysfonctionnement, voir meme a leur destruction. De plus, les effets des. radiations s’accentuent pour les nouvelles generations des circuits integres ou la diminution. de la taille des transistors et l’augmentation de la complexite de ces circuits augmentent la. probabilite d’apparition des anomalies et par consequence la croissance des besoins de test. L’expansion de l’electronique grand public (commercial off-the-shelf, COTS) et l’adoption. de ces composants pour des applications critiques comme les applications avioniques et. spatiales incitent egalement les chercheurs a doubler les efforts de verification de la fiabilite. de ces circuits. Les COTS, malgre leurs meilleures caracteristiques en comparaison avec les. circuits durcis tolerants aux radiations qui sont couteux et en retard en termes de technologie. utilisee, sont vulnerables aux radiations. Afin d’ameliorer la fiabilite de ces circuits, une evaluation de leur vulnerabilite dans les. differents niveaux d’abstraction du flot de conception est recommandee. Ceci aide les. concepteurs a prendre les mesures de mitigation necessaires sur le design au niveau. d’abstraction en question. Enfin, afin de satisfaire les exigences de tolerance aux pannes, des. tests tres couteux de certification, obtenus a l’aide de bombardement de particules (protons, neutrons, etc.), sont necessaires. Dans cette these, nous nous interessons principalement a definir une strategie de precertification. permettant d’evaluer d’une facon realiste la sensibilite des circuits integres face. aux effets des radiations afin d’eviter d’envoyer des circuits non robustes a la phase tres. couteuse de la certification. Les circuits cibles par nos travaux sont les circuits integres. programmables par l’usager (FPGA) a base de memoire SRAM et le type de pannes ciblees, causees par les radiations, est les SEU (single event upset) consistant a un basculement de. l’etat logique d’un element de memoire a son complementaire. En effet, les FPGA a base de. memoire SRAM sont de plus en plus demandes par la communaute de l’aerospatial grace a. leurs caracteristiques de prototypage rapide et de reconfiguration sur site mais ils sont. vulnerables face aux radiations ou les SEU sont les pannes les plus frequentes dans les. elements de memoire de type SRAM. Nous proposons une nouvelle approche d’injection de. pannes par emulation permettant de mimer les effets des radiations sur la memoire de. configuration des FPGA et de generer des resultats les plus fideles possibles des resultats des. tests de certification. Cette approche est basee sur la consideration de la difference de. sensibilite des elements de memoire de configuration lorsqu’ils sont a l’etat '1' et a l’etat '0', observee sous des tests acceleres sous faisceaux de protons au renomme laboratoire. TRIUMF, dans la procedure de generation des sequences de test dans le but de mimer la. distribution des pannes dans la memoire de configuration. Les resultats des experimentations. de validation montrent que la strategie proposee est efficace et genere des resultats realistes. Ces resultats revelent que ne pas considerer la difference de sensibilite peut mener a une. sous-estimation de la sensibilite des circuits face aux radiations. Dans la meme optique d’optimisation de la procedure d’injection des pannes par emulation, a. savoir le test de pre-certification, nous proposons une methodologie permettant de maximiser. la detection des bits critiques (bits provoquant une defaillance fonctionnelle s’ils changent. d’etat) pour un nombre bien determine de SEU (qui est le modele de pannes adopte) ou de. maximiser la precision de l’estimation de nombre des bits critiques. Pour ce faire, une. classification des bits de configuration en differents ensembles est tout d’abord mise en. oeuvre, selon leur contenu, les ressources qu’ils configurent et leur criticite. Ensuite, une. evaluation de la sensibilite de chaque ensemble est accomplie. Enfin, la priorisation. d’injection des pannes dans les ensembles les plus sensibles est recommandee. Plusieurs. scenarios d’optimisation d’injection des pannes sont proposes et les resultats sont compares. avec ceux donnes par la methode conventionnelle d’injection aleatoire des pannes. La. methodologie d’optimisation proposee assure une amelioration de plus de deux ordres de. grandeur. Une derniere approche facilitant l’evaluation de la sensibilite des bits configurant les LUT. (look up table) de FPGA, les plus petites entites configurables du FPGA permettant. d’implementer des fonctions combinatoires, utilises par un design est presentee. Elle permet. l’identification facile et sans cout en termes d’utilisation du materiel ou d’outils externes des. bits des LUT. L’approche proposee est simple et efficace, offrant une couverture de pannes. de 100 % et applicable aux nouvelles generations des FPGA de Xilinx. Les approches proposees contribuent a repondre aux exigences du cahier des charges de cette. these et a achever les objectifs definis. Le realisme et la maximisation de l’estimation de la. vulnerabilite des circuits sous test offerts par les nouvelles approches assurent le. developpement d’une strategie de test en pre-certification efficace. En effet, la premiere. approche d’injection de pannes considerant la difference de sensibilite relative des elements. de memoire selon leur contenu genere des resultats donnant une erreur relative atteignant. 3.1 % quand compares aux resultats obtenus a TRIUMF alors que l’erreur relative donnee. par la comparaison des resultats d’une injection conventionnelle aleatoire de pannes avec. ceux de TRIUMF peut atteindre la valeur de 75 %. De plus, l’application de cette approche a. des circuits plus conventionnels montre que 2.3 fois plus d’erreurs sont detectees en. comparaison avec l’injection aleatoire des pannes. Ceci suggere que ne pas considerer la. difference de sensibilite relative dans la procedure d’emulation peut mener a une sousestimation. de la sensibilite du design face aux radiations. Les resultats de la deuxieme. approche proposee ont ete aussi compares aux resultats d’une injection aleatoire de pannes. L’approche proposee, maximisant le nombre des bits critiques inverses, permet d’atteindre. un facteur d’acceleration de 108 de la procedure d’injection des pannes en comparaison a. l’approche aleatoire. Elle permet aussi de minimiser l’erreur d’estimation du nombre des bits. critiques pour atteindre une valeur de ±1.1 % calculee pour un intervalle de confiance de. 95 % tandis que la valeur d’erreur d’estimation des bits critiques generee par l’approche. aleatoire d’injection des pannes pour le meme intervalle de confiance peut atteindre ±8.6 %. Enfin, la derniere approche proposee d’injection de pannes dans les LUT se distingue des. autres approches disponibles dans la litterature par sa simplicite tout en assurant une. couverture maximale de pannes de 100 %. En effet, l’approche proposee est independante. des outils externes permettant d’identifier les bits configurant les LUT qui sont obsoletes ou. ne supportent pas les nouvelles generations des FPGA. Elle agit directement sur les fichiers. generes par l’outil de synthese adopte.

Détection et prise en charge efficace à l’urgence d’une luxation de Lisfranc à faible vélocité

PubMed Central

Mayich, D. Joshua; Mayich, Michael S.; Daniels, Timothy R.

2012-01-01

Résumé Objectif Améliorer la capacité des médecins de soins primaires de reconnaître les mécanismes et les présentations courantes des luxations de Lisfranc à basse vélocité (LLF) et mieux faire comprendre le rôle de l’imagerie et les principes des soins primaires dans les cas de LLF à basse vélocité. Sources des données Une recension des ouvrages spécialisés dans MEDLINE a été effectuée et les résultats ont été résumés, concernant notamment l’anatomie et les mécanismes, les diagnostics cliniques et par imagerie et les principes de la prise en charge en milieu de soins primaires. Message principal Les LLF à basse vélocité sont le résultat de divers mécanismes et, à l’examen clinique et à l’imagerie, les signes révélateurs sont très peu perceptibles. Il faut donc un fort degré de suspicion et de prudence dans la prise en charge de ce type de blessure. Conclusion Si on met en pratique quelques principes thérapeutiques dans la prise en charge des LLF à basse vélocité, qui sont potentiellement dévastatrices si elles ne sont pas reconnues, et ce, dès leur présentation, il est possible d’optimiser l’issue de telles blessures.

Principes et réalisation d'une chaîne laser femtoseconde haute intensité basée sur le saphir dopé au titane

NASA Astrophysics Data System (ADS)

Le Blanc, Catherine

We present the initial study, the realisation and the characterisation of a high intensity femtosecond laser chain. This chain is able to produce intensities higher than 10^18 W/cm2 on target, at a 10 Hertz repetition rate. We present first fondamentals principles of chirped pulse propagation mechanisms: group velocity dispersion, self-phase modulation, self-focusing, and gain saturation. Then after describing the spectroscopic properties of titanium doped sapphire (Ti:S), we discuss near infrared femtosecond oscillators able to be amplified in Ti:S medium, and describe our home made Kerr Lens mode locked femtosecond Ti:S oscillator. The high intensity laser chain is based on the Chirped Pulse Amplification concept, which consists in stretching the pulse before its amplification in order to avoid non-linear effects such self-focusing or breakdown, and then recompressing it to its initial pulse duration. We have developed two compact and efficient multipass amplifiers for femtosecond chirped pulse amplification. With only two of these devices, we obtain an amplification factor of 10^8, which corresponds to a peak power of ˜ 0.5 terawatt after compression. We analyse in details the performances of this system and its advantages in terms of its high quantum yield (0.3), flexibility, and optical quality. Some observed spectral distortion on chirped pulses is simply explained by a gain saturation model. High dynamic pulse temporal control is crucial for interaction experiments. For this reason, we have developed a third order sampling autocorrelator. This device is able to measure 100 fs pulses with more than 8 orders of magnitude. I compare our obtained performances to other femtosecond systems and I analyse the best way to increase the energy, reduce the pulse duration and optimise focusing in order to reach the 10^19 W/cm2 regime. Ce mémoire présente les études préliminaires, la réalisation et la caractérisation d'une chaîne dite "de haute intensité" en régime femtosecondes. Cette installation est capable de produire sur cible des intensités supérieures à 10^18 W/cm2 à une récurrence de 10 tirs par seconde. Nous présentons tout d'abord les principes fondamentaux de la propagation d'impulsions étirées dans un milieu amplificateur en mettant en évidence les principaux mécanismes mis en jeu dans ce processus : la dispersion de vitesse de groupe, l'automodulation de phase, l'autofocalisation et la saturation du gain. Une analyse des différentes possibilités quant au choix de la source initiale capable d'émettre des impulsions de durée femtoseconde dans le domaine du proche infrarouge est réalisée après la présentation des caractéristiques spectroscopiques du saphir dopé au titane. Sont en particulier décrits en détail le principe et le fonctionnement de l'oscillateur au saphir dopé au titane à autoblocage de modes que nous avons construit à cet effet. L'amplification jusqu'aux puissances de l'ordre du terawatt repose sur le concept "CPA" d'amplification d'impulsions à dérive de fréquence. Nous explorons ici la voie des amplificateurs à multipassages suivant des configurations déjà développées pour les amplificateurs à colorants. Une attention particulière a été portée sur les méthodes de réglage, la fiabilité, la stabilité et la qualité du profil spatial du faisceau. D'autre part, une modélisation rend parfaitement compte des effets de saturation dans les amplificateurs. Les impulsions obtenues après compression ont une énergie de l'ordre de 60 mJ et une durée de l'ordre de 130 fs. La partie suivante est consacrée à une étude des problèmes d'étirement et de recompression pour tenter d'expliquer les raisons de cette recompression imparfaite. Finalement, un paramètre encore plus crucial pour la physique de l'interaction sur cible solide sans création d'un préplasma est le contraste des impulsions. Nous décrivons donc l'appareil de mesure capable d'effectuer des autocorrélations avec une dynamique dépassant 10^8 permettant d'observer un éventuel pied d'énergie à ce niveau. Les problèmes de propagation d'impulsions lumineuses ultra intenses sont ensuite abordés, pour optimiser la focalisation du faisceau jusqu'à des intensités de 10^18 W/cm2. Dans une discussion finale, les performances de cette installation sont comparées à celles des systèmes développés par ailleurs et nous réalisons une étude plus prospective des étapes à mettre en oeuvre afin d'augmenter l'énergie amplifiée, diminuer la durée des impulsions et optimiser la focalisation, le but à atteindre étant le régime des 10^19 W/cm2.

Caracterisation des melanges developpes pour le moulage basse pression des poudres metalliques (LPIM) =

NASA Astrophysics Data System (ADS)

Fareh, Fouad

Le moulage par injection basse pression des poudres metalliques est une technique de fabrication qui permet de fabriquer des pieces possedant la complexite des pieces coulees mais avec les proprietes mecaniques des pieces corroyees. Cependant, l'optimisation des etapes de deliantage et de frittage a ete jusqu'a maintenant effectuee a l'aide de melange pour lesquels la moulabilite optimale n'a pas encore ete demontree. Ainsi, la comprehension des proprietes rheologiques et de la segregation des melanges est tres limitee et cela presente le point faible du processus de LPIM. L'objectif de ce projet de recherche etait de caracteriser l'influence des liants sur le comportement rheologique des melanges en mesurant la viscosite et la segregation des melanges faible viscosite utilises dans le procede LPIM. Afin d'atteindre cet objectif, des essais rheologiques et thermogravimetriques ont ete conduits sur 12 melanges. Ces melanges ont ete prepares a base de poudre d'Inconel 718 de forme spherique (chargement solide constant a 60%) et de cires, d'agents surfactants ou epaississants. Les essais rheologiques ont ete utilises entre autre pour calculer l'indice d'injectabilite ?STV des melanges, tandis que les essais thermogravimetriques ont permis d'evaluer precisement la segregation des poudres dans les melanges. Il a ete demontre que les trois (3) melanges contenant de la cire de paraffine et de l'acide stearique presentent des indices alpha STV plus eleves qui sont avantageux pour le moulage par injection des poudres metalliques (MIM), mais segregent beaucoup trop pour que la piece fabriquee produise de bonnes caracteristiques mecaniques. A l'oppose, le melange contenant de la cire de paraffine et de l'ethylene-vinyle acetate ainsi que le melange contenant seulement de la cire de carnauba segregent peu voire pas du tout, mais possedent de tres faibles indices alphaSTV : ils sont donc difficilement injectables. Le meilleur compromis semble donc etre les melanges contenant de la cire (de paraffine, d'abeille et de carnauba) et de faible teneur en acide stearique et en ethylene-vinyle acetate. Par ailleurs, les lois physiques preexistantes ont permis de confirmer les resultats des essais rheologiques et thermogravimetriques, mais aussi de mettre en evidence l'influence de la segregation sur les proprietes rheologiques des melanges. Ces essais ont aussi montre l'effet de constituants de liant et du temps passe a l'etat fondu sur l'intensite de la segregation dans les melanges. Les melanges contenants de l'acide stearique segregent rapidement. La caracterisation des melanges developpes pour le moulage basse pression des poudres metalliques doit etre obtenue a l'aide d'une methode de courte duree pour eviter la segregation et de mesurer precisement l'aptitude a l'ecoulement de ces melanges.

Technology Insertion and Management: Options for the Canadian Forces

DTIC Science & Technology

2010-01-01

Minister of National Defence, 2010 © Sa Majesté la Reine ( en droit du Canada), telle que représentée par le ministre de la Défense nationale, 2010...semble indiquer qu’un changement de paradigme est en cours dans la façon dont les militaires élaborent et emploient la technologie à utiliser avec leurs...coûts-avantages fondée sur l’optimisation des options en matière d’insertion technologique. ii DRDC CORA TM 2010-015 This page

L’évaluation du risque cardiaque avant l’utilisation de stimulants chez les enfants et les adolescents

PubMed Central

Bélanger, SA; Warren, AE; Hamilton, RM; Gray, C; Gow, RM; Sanatani, S; Côté, J-M; Lougheed, J; LeBlanc, J; Martin, S; Miles, B; Mitchell, C; Gorman, DA; Weiss, M; Schachar, R

2009-01-01

Les décisions en matière de réglementation et les documents scientifiques au sujet de la prise en charge du trouble de déficit de l’attention avec hyperactivité (TDAH) soulèvent des questions quant à l’innocuité des médicaments et à l’évaluation convenable à effectuer avant le traitement afin de déterminer la pertinence d’une pharmacothérapie. Ce constat est particulièrement vrai en présence de cardiopathies structurelles ou fonctionnelles. Le présent article contient l’analyse des données disponibles, y compris les publications révisées par des pairs, des données tirées du site Web de la Food and Drug Administration des États-Unis au sujet des réactions indésirables déclarées chez des enfants qui prennent des stimulants, ainsi que des données de Santé Canada sur le même problème. Des lignes directrices consensuelles sur l’évaluation pertinente sont proposées d’après l’apport des membres de la Société canadienne de pédiatrie, de la Société canadienne de cardiologie et de l’Académie canadienne de psychiatrie de l’enfant et de l’adolescent, qui possèdent notamment des compétences et des connaissances précises tant dans le secteur du TDAH que de la cardiologie pédiatrique. Le présent document de principes prône une anamnèse et un examen physique détaillés avant la prescription de stimulants et s’attarde sur le dépistage des facteurs de risque de mort subite, mais il ne contient pas de recommandations systématiques de dépistage électrocardiographique ou de consultations avec un spécialiste en cardiologie, à moins que les antécédents ou que l’examen physique ne le justifient. Le document contient un questionnaire pour repérer les enfants potentiellement vulnérables à une mort subite (quel que soit le type de TDAH ou les médicaments utilisés pour le traiter). Même si les recommandations dépendent des meilleures données probantes disponibles, le comité s’entend pour affirmer que d’autres recherches s’imposent pour optimiser l’approche de ce scénario clinique courant.

Modélisation de matériaux chiraux à structures hétérogènes (modèle MTWC) : théorie, validations expérimentales et applications

NASA Astrophysics Data System (ADS)

Mariotte, F.; Sauviac, B.; Héliot, J. Ph.

1995-10-01

After a brief overview of the concept of electromagnetic chirality, this paper deals with a numerical simulation of isotropic composites with metallic chiral inclusions: computations of permittivity, permeability and chirality parameter as functions of frequency are presented. The theoretical results are, step by step, compared with measurements of chiral composites at microwave frequencies. The application of such media in Radar Cross-Section (RCS) management and control is discussed. The introduction of chiral inclusions seems to make impedance matching possible and may lead to attractive shields with lower reflectivity and larger bandwidth. However the optimization of material characteristics necessary to get a specific absorber remains a difficult task. Après un bref rappel du principe de la chiralité, cet article présente une modélisation des propriétés effectives des matériaux hétérogènes à inclusions chirales métalliques : calcul de la permittivité, perméabilité et coefficient de chiralité du composite en fonction de la fréquence. Les résultats théoriques sont validés, pas à pas, par des mesures effectuées sur des composites chiraux de natures différentes. L'application de tels matériaux à la conception de matériaux absorbant les ondes électromagnétiques est ensuite envisagée. Les inclusions chirales semblent offrir la possibilité de régler l'impédance à l'interface air-milieu absorbant permettant ainsi de concevoir des absorbants micro-ondes plus performants en terme d'atténuation ou de largeur de bande. L'optimisation des caractéristiques des matériaux pour obtenir des performances données restent néanmoins très délicate.

Non-linearite et couplages lumiere-matiere en electrodynamique quantique en circuit

NASA Astrophysics Data System (ADS)

Bourassa, Jerome

L'électrodynamique quantique en circuit est un contexte unique pour l'optique quantique et le calcul quantique. Dans cette architecture où des qubits supraconducteurs, composés de jonctions Josephson, sont fortement couplés au champ électromagnétique de résonateurs coplanaires, la dynamique du système est semblable à celle des atomes dans des cavités optiques. La polyvalence de la conception des circuits supraconducteurs permet d'étudier l'interaction lumière-matière de différents régimes et manières. Ainsi, plusieurs qubits peuvent être couplés à un seul résonateur afin de les enchevêtrer. Une jonction Josephson peut également être intégrée directement au résonateur afin de produire une interaction non linéaire entre les photons. De la même manière, il a été suggéré que le couplage qubitrésonateur pourrait devenir l'échelle d'énergie dominante du système : le régime de couplage ultrafort. Malgré que la dynamique qubit-résonateur soit bien comprise, les modèles actuels ne permettent pas de prédire correctement les effets dispersifs du résonateur sur les qubits tels : le décalage de Lamb, l'interaction d'échange virtuelle et le temps de relaxation. Comme il n'y a pas non plus de modèle général permettant de déterminer les caractéristiques d'un résonateur non linéaire, on comprend mal comment rendre la non-linéarité plus forte, ni même si le régime de couplage ultrafort peut être physiquement réalisé dans ces circuits. Dans le cadre de ma thèse, je me suis intéressé à la modélisation de qubits et de résonateurs afin de mieux comprendre l'interaction lumière-matière en circuits, dans le but de développer des conceptions alternatives d'architectures plus performantes ou qui explorent des régimes d'interactions méconnus. Pour ce faire, j'ai développé une méthode analytique générale permettant de trouver l'hamiltonien exact de circuits distribués non linéaires, une méthode basée sur la mécanique lagrangienne et la représentation des modes propres d'oscillation. La grande qualité de la méthode réside dans la description analytique détaillée des paramètres de l'hamiltonien du système en fonction de la géométrie et des caractéristiques électromagnétiques du circuit. Non seulement le formalisme développé réconcilie le modèle quantique avec l'électromagnétisme classique et la théorie des circuits, mais va bien au-delà en formulant d'importantes prédictions sur la nature des interactions et l'influence des fluctuations du vide du résonateur sur la dynamique des qubits supraconducteurs. À l'aide d'exemples numériques réalistes et compatibles avec les technologies actuelles, je montre comment de simples optimisations de conception permettraient d'augmenter grandement l'efficacité et la rapidité d'exécution de calculs quantiques avec l'architecture, en plus d'atteindre des régimes de non-linéarité et de couplage lumière-matière inédits. En permettant de mieux comprendre l'interaction lumière-matière dans les circuits et d'optimiser l'architecture afin d'atteindre de nouveaux régimes de couplages, la méthode d'analyse de circuit développée dans cette thèse permettra de tester et raffiner nos connaissances sur l'électrodynamique quantique et la physique quantique. Mots-clés: Information quantique, électrodynamique quantique, supraconductivité, électromagnétisme, qubit supraconducteur, résonateur non linéaire, couplage ultrafort, effet Kerr.

Patient-tailored Drug-eluting Stent Choice - A Solution for Patients with Diabetes: Proceedings of Two Satellite Symposia Held at EuroPCR in May 2015 in Paris.

PubMed

Mountfort, Katrina; Mehran, Roxana; Colombo, Antonio; Stella, Pieter; Romaguera, Rafael; Sardella, Gennaro

2015-09-01

Although second-generation drug-eluting stents (DES) have improved outcomes in percutaneous coronary interventions (PCIs), important unmet needs remain. Two symposia at EuroPCR 2015 focused on two challenging scenarios. First, patients with diabetes mellitus (DM) have generally inferior outcomes following PCI. The Cre8™ stent (manufactured by CID Spa, member of Alvimedica Group) has shown unique efficacy in subpopulations of patients with DM during clinical trials. A live case in a patient with diabetes illustrated the challenges of complex multivessel disease. Second, optimising stent selection towards devices that have demonstrated complete and early endothelialisation offers the potential to reduce the duration of dual antiplatelet therapy. The Cre8™ DES features a polymer-free platform and has been associated with low rates of in-stent thrombosis.

Algorithmes de couplage RANS et ecoulement potentiel

NASA Astrophysics Data System (ADS)

Gallay, Sylvain

Dans le processus de developpement d'avion, la solution retenue doit satisfaire de nombreux criteres dans de nombreux domaines, comme par exemple le domaine de la structure, de l'aerodynamique, de la stabilite et controle, de la performance ou encore de la securite, tout en respectant des echeanciers precis et minimisant les couts. Les geometries candidates sont nombreuses dans les premieres etapes de definition du produit et de design preliminaire, et des environnements d'optimisations multidisciplinaires sont developpes par les differentes industries aeronautiques. Differentes methodes impliquant differents niveaux de modelisations sont necessaires pour les differentes phases de developpement du projet. Lors des phases de definition et de design preliminaires, des methodes rapides sont necessaires afin d'etudier les candidats efficacement. Le developpement de methodes ameliorant la precision des methodes existantes tout en gardant un cout de calcul faible permet d'obtenir un niveau de fidelite plus eleve dans les premieres phases de developpement du projet et ainsi grandement diminuer les risques associes. Dans le domaine de l'aerodynamisme, les developpements des algorithmes de couplage visqueux/non visqueux permettent d'ameliorer les methodes de calcul lineaires non visqueuses en methodes non lineaires prenant en compte les effets visqueux. Ces methodes permettent ainsi de caracteriser l'ecoulement visqueux sur les configurations et predire entre autre les mecanismes de decrochage ou encore la position des ondes de chocs sur les surfaces portantes. Cette these se focalise sur le couplage entre une methode d'ecoulement potentiel tridimensionnelle et des donnees de section bidimensionnelles visqueuses. Les methodes existantes sont implementees et leurs limites identifiees. Une methode originale est ensuite developpee et validee. Les resultats sur une aile elliptique demontrent la capacite de l'algorithme a de grands angles d'attaques et dans la region post-decrochage. L'algorithme de couplage a ete compare a des donnees de plus haute fidelite sur des configurations issues de la litterature. Un modele de fuselage base sur des relations empiriques et des simulations RANS a ete teste et valide. Les coefficients de portance, de trainee et de moment de tangage ainsi que les coefficients de pression extraits le long de l'envergure ont montre un bon accord avec les donnees de soufflerie et les modeles RANS pour des configurations transsoniques. Une configuration a geometrie hypersustentatoire a permis d'etudier la modelisation des surfaces hypersustentees de la methode d'ecoulement potentiel, demontrant que la cambrure peut etre prise en compte uniquement dans les donnees visqueuses.

Intensité thérapeutique optimale : comment mesurer l'intensité d'une association radiothérapie-chimiothérapie ?

NASA Astrophysics Data System (ADS)

Ganem, G.; Dubray, B.

1998-04-01

Treatment intensification is needed to overcome the disappointing efficacy of anticancer treatments used as a single modality. The conception, comparison and optimization of radiotherapy - chemotherapy combinations is hampered by the lack of a common tool enabling the clinicians to quantify the effects of the association of different treatment modalities. Such a difficulty is mainly due to chemotherapy (large array of drugs, pharmacological uncertainties), but is also the consequence of end-point multiplicity (tumour control, normal tissue injury) and tumour biology complexity. L'intensification thérapeutique est une nécessité face à l'efficacité insuffisante des traitements anticancéreux utilisés séparément. La conception, la comparaison, et l'optimisation des modalités possibles d'association de radiothérapie et de chimiothérapie est considérablement gênée par l'absence d'un outil permettant de mesurer l'efficacitéé résultante de la combinaison d'agents thérapeutiques différents. Cette difficulté provient essentiellement de l'usage de la chimiothérapie (nombreuses drogues, pharmacocinétique mal connue), mais aussi de la multiplicité des critères de jugement (action anti-tumorale, lésions des tissus sains) et de la complexité de la biologie tumorale.

Identification de lois constitutives et de lois de frottement adaptées aux grandes vitesses de sollicitation

NASA Astrophysics Data System (ADS)

Dalverny, O.; Capéraa, S.; Pantalé, O.; Sattouf, C.

2002-12-01

Cet article présente une méthodologie d'identification de lois constitutives et de lois de contact adaptées aux matériaux métalliques sous chargement dynamique à grande vitesse de déformation. Les essais sont effectués à partir de montages expérimentaux adaptés à un lanceur à gaz permettant d'obtenir une vitesse de projectile de l'ordre de 350m/s pour une masse totale de 30gr. Le premier essai consiste en un impact de Taylor correspondant à un chargement mécanique de type compression. Le second essai de type “extrusion conique" permet la détermination des lois de frottement à grande vitesse. La procédure générale d'identification des lois de comportement à partir d'essais dynamiques se fait au moyen d'une analyse post-mortem des échantillons et de la corrélation entre ces résultats expérimentaux et un modèle numérique des essais. Pour les deux cas précédemment cités, nous présentons la configuration optimale d'essai ainsi que les résultats obtenus à partir d'un algorithme d'optimisation de type Levenberg-Marquard.

Conception de lois de pilotage robustes et sequencement de gains par l'approche de systemes lineaires a parametres variants

NASA Astrophysics Data System (ADS)

Hentabli, Kamel

Cette recherche s'inscrit dans le cadre du projet de recherche Active Control Technology entre l'Ecole de Technologie Superieure et le constructeur Bombardier Aeronautique . Le but est de concevoir des strategies de commandes multivariables et robustes pour des modeles dynamiques d'avions. Ces strategies de commandes devraient assurer a l'avion une haute performance et satisfaire des qualites de vol desirees en l'occurrence, une bonne manoeuvrabilite, de bonnes marges de stabilite et un amortissement des mouvements phugoides et rapides de l'avion. Dans un premier temps, nous nous sommes principalement interesses aux methodes de synthese LTI et plus exactement a l'approche Hinfinity et la mu-synthese. Par la suite, nous avons accorde un interet particulier aux techniques de commande LPV. Pour mener a bien ce travail, nous avons envisage une approche frequentielle, typiquement Hinfinity. Cette approche est particulierement interessante, dans la mesure ou le modele de synthese est construit directement a partir des differentes specifications du cahier des charges. En effet, ces specifications sont traduites sous forme de gabarits frequentiels, correspondant a des ponderations en entree et en sortie que l'on retrouve dans la synthese Hinfinity classique. Par ailleurs, nous avons utilise une representation de type lineaire fractionnelle (LFT), jugee mieux adaptee pour la prise en compte des differents types d'incertitudes, qui peuvent intervenir sur le systeme. De plus, cette representation s'avere tres appropriee pour l'analyse de la robustesse via les outils de la mu-analyse. D'autre part, afin d'optimiser le compromis entre les specifications de robustesse et de performance, nous avons opte pour une structure de commande a 2 degres de liberte avec modele de reference. Enfin, ces techniques sont illustrees sur des applications realistes, demontrant ainsi la pertinence et l'applicabilite de chacune d'elle. Mots cles. Commande de vol, qualites de vol et manoeuvrabilite, commande robuste, approche Hinfinity , mu-synthese, systemes lineaires a parametres variants, sequencement de gains, transformation lineaire fractionnelle, inegalite matricielle lineaire.

Evaluation des prescriptions antibiotiques au service des urgences de l’Hôpital Militaire d’Instruction Mohammed V (HMIMV)

PubMed Central

Elbouti, Anass; Rafai, Mostafa; Chouaib, Naoufal; Jidane, Said; Belkouch, Ahmed; Bakkali, Hicham; Belyamani, Lahcen

2016-01-01

Cette étude à pour objectifs de décrire les pratiques des prescriptions, évaluer leur pertinence et leur conformité aux règles d’utilisations et étudier les facteurs susceptibles de les influencer. Il s’agit d’une étude transversale d’évaluation des prescriptions antibiotiques portant sur 105 patients réalisée au service des urgences médico-chirurgicales de l’H.M.I.Med V de Rabat sur une période d’un mois. Le recueil des données était fait à l’aide d’un questionnaire rapportant les données démographiques et anamnestiques, les antécédents, la notion d’allergie, les données spécifiques de l’examen clinique, les données para cliniques, la prescription détaillée de l’antibiotique. Les données récoltées ont été ensuite évaluées par un médecin référent, chargé d’indiquer les éventuelles erreurs de traitement. Parmi les infections ayant motivé la prescription des antibiotiques, les affections des systèmes respiratoires et urinaires étaient au premier rang, les familles d’antibiotiques les plus couramment employées sont les pénicillines, les quinolones et les céphalosporines. 74 prescriptions soit (70,5%) étaient à la fois pertinentes et conformes contre 9 prescriptions soit (8,6%) justifiées mais non pertinentes et 6 prescriptions soit (5,7%) étaient jugées injustifiées par le médecin référent par absence d’infection. Les évaluations des pratiques médicales sont rarement menées dans les établissements de santé; c’est dans ce cadre que nous avons voulu nous inscrire en produisant cette étude afin d’améliorer la pertinence de nos prescriptions antibiotiques et d’optimiser leur conformité aux différentes recommandations. PMID:28292124

Elaboration de nouvelles approches micromecaniques pour l'optimisation des performances mecaniques des materiaux heterogenes

NASA Astrophysics Data System (ADS)

Aboutajeddine, Ahmed

Les modeles micromecaniques de transition d'echelles qui permettent de determiner les proprietes effectives des materiaux heterogenes a partir de la microstructure sont consideres dans ce travail. L'objectif est la prise en compte de la presence d'une interphase entre la matrice et le renforcement dans les modeles micromecaniques classiques, de meme que la reconsideration des approximations de base de ces modeles, afin de traiter les materiaux multiphasiques. Un nouveau modele micromecanique est alors propose pour tenir compte de la presence d'une interphase elastique mince lors de la determination des proprietes effectives. Ce modele a ete construit grace a l'apport de l'equation integrale, des operateurs interfaciaux de Hill et de la methode de Mori-Tanaka. Les expressions obtenues pour les modules globaux et les champs dans l'enrobage sont de nature analytique. L'approximation de base de ce modele est amelioree par la suite dans un nouveau modele qui s'interesse aux inclusions enrobees avec un enrobage mince ou epais. La resolution utilisee s'appuie sur une double homogeneisation realisee au niveau de l'inclusion enrobee et du materiau. Cette nouvelle demarche, permettra d'apprehender completement les implications des approximations de la modelisation. Les resultats obtenus sont exploites par la suite dans la solution de l'assemblage de Hashin. Ainsi, plusieurs modeles micromecaniques classiques d'origines differentes se voient unifier et rattacher, dans ce travail, a la representation geometrique de Hashin. En plus de pouvoir apprecier completement la pertinence de l'approximation de chaque modele dans cette vision unique, l'extension correcte de ces modeles aux materiaux multiphasiques est rendue possible. Plusieurs modeles analytiques et explicites sont alors proposee suivant des solutions de differents ordres de l'assemblage de Hashin. L'un des modeles explicite apparait comme une correction directe du modele de Mori-Tanaka, dans les cas ou celui ci echoue a donner de bons resultats. Finalement, ce modele de Mori-Tanaka corrige est utilise avec les operateurs de Hill pour construire un modele de transition d'echelle pour les materiaux ayant une interphase elastoplastique. La loi de comportement effective trouvee est de nature incrementale et elle est conjuguee a la relation de la plasticite de l'interphase. Des simulations d'essais mecaniques pour plusieurs proprietes de l'interphase plastique a permis de dresser des profils de l'enrobage octroyant un meilleur comportement au materiau.

Algorithmes et architectures pour ordinateurs quantiques supraconducteurs

NASA Astrophysics Data System (ADS)

Blais, Alexandre

Depuis sa formulation, la theorie de l'information a ete basee, implicitement, sur les lois de la physique classique. Une telle formulation est toutefois incomplete puisqu'elle ne tient pas compte de la realite quantique. Au cours des vingt dernieres annees, l'expansion de la theorie de l'information englobant les effets purement quantiques a connu un interet grandissant. La realisation d'un systeme de traitement de l'information quantique, un ordinateur quantique, presente toutefois de nombreux defis. Dans ce document, on s'interesse a differents aspects concernant ces defis. On commence par presenter des concepts algorithmiques comme l'optimisation de calculs quantiques et le calcul quantique geometrique. Par la suite, on s'interesse au design et a differents aspects de l'utilisation de qubits bases sur les jonctions Josephson. En particulier, un nouveau design de qubit supraconducteur est suggere. On presente aussi une approche originale pour l'interaction entre qubits. Cette approche est tres generale puisqu'elle peut etre appliquee a differents designs de qubits. Finalement, on s'interesse a la lecture des qubits supraconducteurs de flux. Le detecteur suggere ici a l'avantage de pouvoir etre decouple du qubit lorsqu'il n'y a pas de mesure en cours.

Les psychoses de l’épileptique: approche clinique à propos d'un cas

PubMed Central

Charfi, Nada; Trigui, Dorsaf; Ben Thabet, Jihène; Zouari, Nasreddine; Zouari, Lobna; Maalej, Mohamed

2014-01-01

Pour discuter les liens entre épilepsie et psychose, les auteurs rapportent l'observation d'une fille âgée de 22 ans, traitée pour épilepsie fronto-temporale, adressée en psychiatrie pour des hallucinations sensorielles et cénesthésiques et un délire mystique et d'influence, apparus secondairement et non améliorés par le traitement antiépileptique. Les symptômes psychotiques, chez l’épileptique, peuvent entrer dans le cadre de psychoses intercritiques, post-critiques ou alternatives. Pour le cas rapporté, les symptômes psychotiques étaient intercritiques et chroniques. Il s'agissait vraisemblablement d'une psychose schizophréniforme. Dans ce type de psychose, une indifférence affective et une restriction des activités sont rarement rencontrés, alors que les fluctuations rapides de l'humeur sont fréquentes. Les thématiques délirantes sont assez souvent mystiques, alimentées par des hallucinations auditives et par des hallucinations visuelles inhabituelles. Les troubles négatifs sont rares. Les psychoses épileptiques n'ont pas été identifiées comme des entités nosographiques dans les systèmes de classification psychiatrique (DSM-IV et CIM-10), ce qui pose un problème de reconnaissance de ces troubles. Une collaboration entre psychiatre et neurologue devient ainsi nécessaire pour mieux comprendre cette comorbidité complexe, éviter les erreurs diagnostiques et optimiser la prise en charge. PMID:25309665

[Volunteers in Refugee Help: is Health Promotion (by Public Health Services) Necessary?

PubMed

Andrees, Valerie; Freyer, Beke; Borgmeier, Ingrid; Galle, Hans-Jürgen; Westenhöfer, Joachim

2018-03-01

To investigate health-related strains and resources of volunteers in refugee help. Qualitative interviews with 10 volunteers in refugee help as well as 11 interviews with experts involved in coordinative tasks were conducted, transcribed and analysed using qualitative content analysis. Volunteers' work in refugee help is experienced as a strong resource. Volunteers receive a lot of thankfulness and appreciation and experience their work as enriching and enhancing self-worth. On the other hand, they also experience several stresses and problems. Difficulties in setting up appropriate boundaries regarding time and emotional involvement are mentioned as important reasons for the experienced stresses. Support for volunteers in refugee help should be optimised and expanded in order to protect the volunteers from health-related strains. Public Health Services could play an important role in such improvements. Eigentümer und Copyright ©Georg Thieme Verlag KG 2018.

Implementation of hierarchical clustering using k-mer sparse matrix to analyze MERS-CoV genetic relationship

NASA Astrophysics Data System (ADS)

Bustamam, A.; Ulul, E. D.; Hura, H. F. A.; Siswantining, T.

2017-07-01

Hierarchical clustering is one of effective methods in creating a phylogenetic tree based on the distance matrix between DNA (deoxyribonucleic acid) sequences. One of the well-known methods to calculate the distance matrix is k-mer method. Generally, k-mer is more efficient than some distance matrix calculation techniques. The steps of k-mer method are started from creating k-mer sparse matrix, and followed by creating k-mer singular value vectors. The last step is computing the distance amongst vectors. In this paper, we analyze the sequences of MERS-CoV (Middle East Respiratory Syndrome - Coronavirus) DNA by implementing hierarchical clustering using k-mer sparse matrix in order to perform the phylogenetic analysis. Our results show that the ancestor of our MERS-CoV is coming from Egypt. Moreover, we found that the MERS-CoV infection that occurs in one country may not necessarily come from the same country of origin. This suggests that the process of MERS-CoV mutation might not only be influenced by geographical factor.

Identification of a Novel Inhibitor against Middle East Respiratory Syndrome Coronavirus

PubMed Central

Sun, Yaping; Zhang, Huaidong; Shi, Jian; Zhang, Zhe; Gong, Rui

2017-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) was first isolated in 2012, and circulated worldwide with high mortality. The continual outbreaks of MERS-CoV highlight the importance of developing antiviral therapeutics. Here, we rationally designed a novel fusion inhibitor named MERS-five-helix bundle (MERS-5HB) derived from the six-helix bundle (MERS-6HB) which was formed by the process of membrane fusion. MERS-5HB consists of three copies of heptad repeat 1 (HR1) and two copies of heptad repeat 2 (HR2) while MERS-6HB includes three copies each of HR1 and HR2. As it lacks one HR2, MERS-5HB was expected to interact with viral HR2 to interrupt the fusion step. What we found was that MERS-5HB could bind to HR2P, a peptide derived from HR2, with a strong affinity value (KD) of up to 0.24 nM. Subsequent assays indicated that MERS-5HB could inhibit pseudotyped MERS-CoV entry effectively with 50% inhibitory concentration (IC50) of about 1 μM. In addition, MERS-5HB significantly inhibited spike (S) glycoprotein-mediated syncytial formation in a dose-dependent manner. Further biophysical characterization showed that MERS-5HB was a thermo-stable α-helical secondary structure. The inhibitory potency of MERS-5HB may provide an attractive basis for identification of a novel inhibitor against MERS-CoV, as a potential antiviral agent. PMID:28906430

Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen

PubMed Central

BANNAI, Hiroshi; NEMOTO, Manabu; TSUJIMURA, Koji; YAMANAKA, Takashi; MAEDA, Ken; KONDO, Takashi

2015-01-01

To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA. PMID:26424485

Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen.

PubMed

Bannai, Hiroshi; Nemoto, Manabu; Tsujimura, Koji; Yamanaka, Takashi; Maeda, Ken; Kondo, Takashi

2016-02-01

To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA.

Robust k-mer frequency estimation using gapped k-mers

PubMed Central

Ghandi, Mahmoud; Mohammad-Noori, Morteza

2013-01-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome. PMID:23861010

Robust k-mer frequency estimation using gapped k-mers.

PubMed

Ghandi, Mahmoud; Mohammad-Noori, Morteza; Beer, Michael A

2014-08-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome.

Elaboration de revetements nanocomposites avec des proprietes superhydrophobes, semi-conductrices et photocatalytiques

NASA Astrophysics Data System (ADS)

Madidi, Fatima Zahra

Les lignes aeriennes de transport et de distribution de l'energie electrique sont souvent exposees a diverses contraintes. Parmi celles-ci, la pollution des isolateurs constitue l'un des facteurs de premiere importance dans la fiabilite du transport d'energie. En effet, la presence de pollution sur les isolateurs lorsqu'elle est humidifiee entraine la diminution de leur performance electrique en favorisant l'apparition d'arcs de contournement. De telles pannes peuvent parfois causer des impacts socioeconomiques importants. Par ailleurs, le developpement de nouveaux revetements pour ces isolateurs peut s'averer un moyen efficace pour les proteger contre l'apparition de l'arc de contournement. Les revetements superhydrophobes ont fait l'objet de nombreuses etudes au cours de ces dernieres annees. Ces surfaces sont preparees en combinant une rugosite nano-microstructuree avec une faible energie de surface. En outre, de telles surfaces ont de nombreuses applications si elles sont durables et n'ont pas d'effets nocifs sur l'environnement. L'objectif principal de la presente etude vise d'abord l'elaboration de revetements superhydrophobes, puis l'etude de leur duree de vie, leurs proprietes dielectriques et photocatalytiques. Une grande variete de materiaux a faible energie de surface peuvent etre utilises pour le developpement de ces revetements. Dans cette recherche, le caoutchouc de silicone (CS) est employe car il presente de nombreuses proprietes, notamment une forte hydrophobie, une resistance aux rayonnements ultraviolets, et une bonne tenue au feu sans degagement de produits toxiques. Toutefois, le point faible de ces materiaux est la degradation de leurs proprietes hydrophobes. Afin d'ameliorer certaines proprietes du caoutchouc de silicone, des nanoparticules seront additionnees au polymere de base. La technique d'elaboration des revetements consiste a ajouter des nanoparticules de dioxyde de titane (TiO2) au polymere de base, par des methodes ayant un potentiel d'applications industrielles. Les parametres d'elaboration ont ete optimises afin d'obtenir des revetements stables presentant des angles de contact eleves avec des gouttelettes d'eau et de faibles hysteresis. Apres avoir obtenu des surfaces superhydrophobes, des tests de stabilite ont ete effectues dans des conditions de vieillissement accelere tels que l'immersion dans des solutions aqueuses avec differents pH et conductivites ou la degradation par rayonnement UV. Les resultats obtenus ont montre que l'ajout de nanoparticules de dioxyde de titane au caoutchouc de silicone permet d'ameliorer l'hydrophobie et la stabilite de ce polymere. Les revetements superhydrophobes obtenus ont pu maintenir leur superhydrophobicite apres plusieurs jours d'immersion dans differentes solutions aqueuses. Ils presentent aussi une bonne stabilite lorsqu'ils sont exposes aux rayons UV ainsi qu'une stabilite mecanique. De plus, on a pu developper des revetements nanocomposites et microcomposites avec de bonnes proprietes dielectriques. L'etude des proprietes photocatalytiques des revetements superhydrophobes ont montre que l'adsorption des molecules reactives (polluants) sur la surface du catalyseur (TiO2) est le parametre cle de l'activite photocatalytique. L'augmentation de la concentration de TiO2 conduit a une diminution de la concentration du polluant et par consequent a un excellent rendement photocatalytique.

Development of a transgenic tobacco plant for phytoremediation of methylmercury pollution.

PubMed

Nagata, Takeshi; Morita, Hirofumi; Akizawa, Toshifumi; Pan-Hou, Hidemitsu

2010-06-01

To develop the potential of plant for phytoremediation of methylmercury pollution, a genetically engineered tobacco plant that coexpresses organomercurial lyase (MerB) with the ppk-specified polyphosphate (polyP) and merT-encoding mercury transporter was constructed by integrating a bacterial merB gene into ppk/merT-transgenic tobacco. A large number of independent transgenic tobaccos was obtained, in some of which the merB gene was stably integrated in the plant genome and substantially translated to the expected MerB enzyme in the transgenic tobacco. The ppk/merT/merB-transgenic tobacco callus showed more resistance to methylmercury (CH3Hg+) and accumulated more mercury from CH3Hg+-containing medium than the ppk/merT-transgenic and wild-type progenitors. These results suggest that the MerB enzyme encoded by merB degraded the incorporated CH3Hg+ to Hg2+, which then accumulated as a less toxic Hg-polyP complex in the tobacco cells. Phytoremediation of CH3Hg+ and Hg2+ in the environment with this engineered ppk/merT/merB-transgenic plant, which prevents the release mercury vapor (Hg0) into the atmosphere in addition to generating potentially recyclable mercury-rich plant residues, is believed to be more acceptable to the public than other competing technologies, including phytovolatilization.

Détermination de la vitesse de coupe en usinage à l'aide des réseaux de neurones

NASA Astrophysics Data System (ADS)

Amor, Noureddine; Noureddine, Ali; Kherfane, Riad Lakhdar

2018-02-01

En usinage par enlèvement de copeaux, il est nécessaire de connaître des éléments tels que la géométrie à obtenir, la matière à usiner, le type d'opération, la machine-outil, l'outil de coupe, la profondeur de passe, l'avance, la vitesse de coupe. Ces trois derniers éléments quantifiables sont déterminés à l'aide de tables, abaques, logiciel informatique dédié, ou système CFAO, offrant une large gamme de choix mais manquant de transparence et de flexibilité. La contribution de cet article est d'appliquer les techniques d'intelligence artificielle basées sur les réseaux de neurones artificiels (RNA) au développement d'un système de décision pour le choix des paramètres de coupe. Pour modéliser la vitesse de coupe, nous utilisons un RNA avec un algorithme de rétro-propagation. Des valeurs expérimentales provenant d'un abaque source serviront à construire et établir le RNA pour estimer la valeur de la vitesse de coupe, utilisant comme données un certain nombre de paramètres d'influence. La validité des résultats obtenus montre que cette méthode peut être appliquée avec succès et que son utilisation dans le domaine de l'usinage peut contribuer à optimiser les conditions de coupe par un choix plus précis et plus rapide de la vitesse de coupe.

Endommagement d'un composite polypropylène renforcé par des fibres de verre courtes : approche expérimentale

NASA Astrophysics Data System (ADS)

Laksimi, Abdelouahed; Bounouas, Lahsen; Benmedakhene, Salim; Azari, Zitoun; Imad, Abdellatif

To obtain good mechanical performance of the composite material, it is important to optimise the fibres ratio as well as the fibre/matrix interface quality which have influence on the damage. The main objective of this study is to determine the structural parameters influence on damage evolution concerning two types of polypropylene glass fibres composites. With a classical approach of damage mechanical theory which consists of load-unload tensile tests, acoustic emission permits to detect and follow damage mechanisms during loading. Fractographic analysis highlights the different assumptions and conclusions for this study.

Professional tennis players' serve: correlation between segmental angular momentums and ball velocity.

PubMed

Martin, Caroline; Kulpa, Richard; Delamarche, Paul; Bideau, Benoit

2013-03-01

The purpose of the study was to identify the relationships between segmental angular momentum and ball velocity between the following events: ball toss, maximal elbow flexion (MEF), racket lowest point (RLP), maximal shoulder external rotation (MER), and ball impact (BI). Ten tennis players performed serves recorded with a real-time motion capture. Mean angular momentums of the trunk, upper arm, forearm, and the hand-racket were calculated. The anteroposterior axis angular momentum of the trunk was significantly related with ball velocity during the MEF-RLP, RLP-MER, and MER-BI phases. The strongest relationships between the transverse-axis angular momentums and ball velocity followed a proximal-to-distal timing sequence that allows the transfer of angular momentum from the trunk (MEF-RLP and RLP-MER phases) to the upper arm (RLP-MER phase), forearm (RLP-MER and MER-BI phases), and the hand-racket (MER-BI phase). Since sequence is crucial for ball velocity, players should increase angular momentums of the trunk during MEF-MER, upper arm during RLP-MER, forearm during RLP-BI, and the hand-racket during MER-BI.

Preventing cleavage of Mer promotes efferocytosis and suppresses acute lung injury in bleomycin treated mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ye-Ji; Tissue Injury Defense Research Center, School of Medicine, Ewha Womans University, Seoul; Lee, Seung-Hae

2012-08-15

Mer receptor tyrosine kinase (Mer) regulates macrophage activation and promotes apoptotic cell clearance. Mer activation is regulated through proteolytic cleavage of the extracellular domain. To determine if membrane-bound Mer is cleaved during bleomycin-induced lung injury, and, if so, how preventing the cleavage of Mer enhances apoptotic cell uptake and down-regulates pulmonary immune responses. During bleomycin-induced acute lung injury in mice, membrane-bound Mer expression decreased, but production of soluble Mer and activity as well as expression of disintegrin and metalloproteinase 17 (ADAM17) were enhanced . Treatment with the ADAM inhibitor TAPI-0 restored Mer expression and diminished soluble Mer production. Furthermore, TAPI-0more » increased Mer activation in alveolar macrophages and lung tissue resulting in enhanced apoptotic cell clearance in vivo and ex vivo by alveolar macrophages. Suppression of bleomycin-induced pro-inflammatory mediators, but enhancement of hepatocyte growth factor induction were seen after TAPI-0 treatment. Additional bleomycin-induced inflammatory responses reduced by TAPI-0 treatment included inflammatory cell recruitment into the lungs, levels of total protein and lactate dehydrogenase activity in bronchoalveolar lavage fluid, as well as caspase-3 and caspase-9 activity and alveolar epithelial cell apoptosis in lung tissue. Importantly, the effects of TAPI-0 on bleomycin-induced inflammation and apoptosis were reversed by coadministration of specific Mer-neutralizing antibodies. These findings suggest that restored membrane-bound Mer expression by TAPI-0 treatment may help resolve lung inflammation and apoptosis after bleomycin treatment. -- Highlights: ►Mer expression is restored by TAPI-0 treatment in bleomycin-stimulated lung. ►Mer signaling is enhanced by TAPI-0 treatment in bleomycin-stimulated lung. ►TAPI-0 enhances efferocytosis and promotes resolution of lung injury.« less

Developpement et validation d'un outil base sur l'acoustique geometrique pour le diagnostic du bruit de nacelle

NASA Astrophysics Data System (ADS)

Minard, Benoit

De nos jours, la problématique du bruit généré par les avions est devenue un point de développement important dans le domaine de l'aéronautique. C'est ainsi que de nombreuses études sont faites dans le domaine et une première approche consiste à modéliser de façon numérique ce bruit de manière à réduire de façon conséquente les coûts lors de la conception. C'est dans ce contexte qu'un motoriste a demandé à l'université de Sherbrooke, et plus particulièrement au groupe d'acoustique de l'Université de Sherbrooke (GAUS), de développer un outil de calcul de la propagation des ondes acoustiques dans les nacelles mais aussi pour l'étude des effets d'installation. Cet outil de prédiction leur permet de réaliser des études afin d'optimiser les traitements acoustiques (« liners »), la géométrie de ces nacelles pour des études portant sur l'intérieur de la nacelle et des études de positionnement des moteurs et de design pour les effets d'installation. L'objectif de ce projet de maîtrise était donc de poursuivre le travail réalisé par [gousset, 2011] sur l'utilisation d'une méthode de lancer de rayons pour l'étude des effets d'installation des moteurs d'avion. L'amélioration du code, sa rapidité, sa fiabilité et sa généralité étaient les objectifs principaux. Le code peut être utilisé avec des traitements acoustiques de surfaces («liners») et peut prendre en compte le phénomène de la diffraction par les arêtes et enfin peut être utilisé pour réaliser des études dans des environnements complexes tels que les nacelles d'avion. Le code développé fonctionne en 3D et procéde en 3 étapes : (1) Calcul des faisceaux initiaux (division d'une sphère, demi-sphère, maillage des surfaces de la géométrie) (2) Propagation des faisceaux dans l'environnement d'étude : calcul de toutes les caractéristiques des rayons convergents (amplitude, phase, nombre de réflexions, ...) (3) Reconstruction du champ de pression en un ou plusieurs points de l'espace à partir de rayons convergents (sommation des contributions de chaque rayon) : sommation cohérente. Le code (GA3DP) permet de prendre en compte les traitements de surface des parois, la directivité de la source, l'atténuation atmosphérique et la diffraction d'ordre 1. Le code a été validé en utilisant différentes méthodes telles que la méthode des sources-images, la méthode d'analyse modale ou encore la méthode des éléments finis de frontière. Un module Matlab a été créé spécialement pour l'étude des effets d'installation et intégré au code existant chez Pratt & Whitney Canada. Mots-clés : Acoustique géométrique - Ray-Tracing - Lancer de faisceaux - Diffraction - Sommation Cohérente - Niveau de Pression.

A Novel Role of MerC in Methylmercury Transport and Phytoremediation of Methylmercury Contamination.

PubMed

Sone, Yuka; Uraguchi, Shimpei; Takanezawa, Yasukazu; Nakamura, Ryosuke; Pan-Hou, Hidemitsu; Kiyono, Masako

2017-01-01

MerC, encoded by merC in the transposon Tn21 mer operon, is a heavy metal transporter with potential applications for phytoremediation of heavy metals such as mercuric ion and cadmium. In this study, we demonstrate that MerC also acts as a transporter for methylmercury. When MerC was expressed in Escherichia coli XL1-Blue, cells became hypersensitive to CH 3 Hg(I) and the uptake of CH 3 Hg(I) by these cells was higher than that by cells of the isogenic strain. Moreover, transgenic Arabidopsis plants expressing bacterial MerC or MerC fused to plant soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) accumulated CH 3 Hg(I) effectively and their growth was comparable to the wild-type plants. These results demonstrate that when the bacterium-derived merC gene is ectopically introduced in genetically modified plants, MerC expression in the transgenic plants promotes the transport and sequestration of methylmercury. Thus, our results show that the expression of merC in Arabidopsis results in transgenic plants that could be used for the phytoremediation and elimination of toxic methylmercury from the environment.

The Mercury Resistance Operon: From an Origin in a Geothermal Environment to an Efficient Detoxification Machine

PubMed Central

Boyd, Eric S.; Barkay, Tamar

2012-01-01

Mercuric mercury (Hg[II]) is a highly toxic and mobile element that is likely to have had a pronounced and adverse effect on biology since Earth’s oxygenation ∼2.4 billion years ago due to its high affinity for protein sulfhydryl groups, which upon binding destabilize protein structure and decrease enzyme activity, resulting in a decreased organismal fitness. The central enzyme in the microbial mercury detoxification system is the mercuric reductase (MerA) protein, which catalyzes the reduction of Hg(II) to volatile Hg(0). In addition to MerA, mer operons encode for proteins involved in regulation, Hg binding, and organomercury degradation. Mer-mediated approaches have had broad applications in the bioremediation of mercury-contaminated environments and industrial waste streams. Here, we examine the composition of 272 individual mer operons and quantitatively map the distribution of mer-encoded functions on both taxonomic SSU rRNA gene and MerA phylogenies. The results indicate an origin and early evolution of MerA among thermophilic bacteria and an overall increase in the complexity of mer operons through evolutionary time, suggesting continual gene recruitment and evolution leading to an improved efficiency and functional potential of the Mer detoxification system. Consistent with a positive relationship between the evolutionary history and topology of MerA and SSU rRNA gene phylogenies (Mantel R = 0.81, p < 0.01), the distribution of the majority of mer functions, when mapped on these phylograms, indicates an overall tendency to inherit mer-encoded functions through vertical descent. However, individual mer functions display evidence of a variable degree of vertical inheritance, with several genes exhibiting strong evidence for acquisition via lateral gene transfer and/or gene loss. Collectively, these data suggest that (i) mer has evolved from a simple system in geothermal environments to a widely distributed and more complex and efficient detoxification system, and (ii) merA is a suitable biomarker for examining the functional diversity of Hg detoxification and for predicting the composition of mer operons in natural environments. PMID:23087676

An Integrated Approach to Estimate Instantaneous Near-Surface Air Temperature and Sensible Heat Flux Fields during the SEMAPHORE Experiment.

NASA Astrophysics Data System (ADS)

Bourras, Denis; Eymard, Laurence; Liu, W. Timothy; Dupuis, Hélène

2002-03-01

A new technique was developed to retrieve near-surface instantaneous air temperatures and turbulent sensible heat fluxes using satellite data during the Structure des Echanges Mer-Atmosphere, Proprietes des Heterogeneites Oceaniques: Recherche Experimentale (SEMAPHORE) experiment, which was conducted in 1993 under mainly anticyclonic conditions. The method is based on a regional, horizontal atmospheric temperature advection model whose inputs are wind vectors, sea surface temperature fields, air temperatures around the region under study, and several constants derived from in situ measurements. The intrinsic rms error of the method is 0.7°C in terms of air temperature and 9 W m2 for the fluxes, both at 0.16° × 0.16° and 1.125° × 1.125° resolution. The retrieved air temperature and flux horizontal structures are in good agreement with fields from two operational general circulation models. The application to SEMAPHORE data involves the First European Remote Sensing Satellite (ERS-1) wind fields, Advanced Very High Resolution Radiometer (AVHRR) SST fields, and European Centre for Medium-Range Weather Forecasts (ECMWF) air temperature boundary conditions. The rms errors obtained by comparing the estimations with research vessel measurements are 0.3°C and 5 W m2.

Effective inhibition of MERS-CoV infection by resveratrol.

PubMed

Lin, Shih-Chao; Ho, Chi-Tang; Chuo, Wen-Ho; Li, Shiming; Wang, Tony T; Lin, Chi-Chen

2017-02-13

Middle East Respiratory Syndrome coronavirus (MERS-CoV) is an emerging viral pathogen that causes severe morbidity and mortality. Up to date, there is no approved or licensed vaccine or antiviral medicines can be used to treat MERS-CoV-infected patients. Here, we analyzed the antiviral activities of resveratrol, a natural compound found in grape seeds and skin and in red wine, against MERS-CoV infection. We performed MTT and neutral red uptake assays to assess the survival rates of MERS-infected Vero E6 cells. In addition, quantitative PCR, western blotting, and immunofluorescent assays determined the intracellular viral RNA and protein expression. For viral productivity, we utilized plaque assays to confirm the antiviral properties of resveratrol against MERS-CoV. Resveratrol significantly inhibited MERS-CoV infection and prolonged cellular survival after virus infection. We also found that the expression of nucleocapsid (N) protein essential for MERS-CoV replication was decreased after resveratrol treatment. Furthermore, resveratrol down-regulated the apoptosis induced by MERS-CoV in vitro. By consecutive administration of resveratrol, we were able to reduce the concentration of resveratrol while achieving inhibitory effectiveness against MERS-CoV. In this study, we first demonstrated that resveratrol is a potent anti-MERS agent in vitro. We perceive that resveratrol can be a potential antiviral agent against MERS-CoV infection in the near future.

Etude energetique et modelisation d'un Systeme Hybride Eolien-Diesel avec stockage d'Air Comprime (SHEDAC)

NASA Astrophysics Data System (ADS)

Martinez, Nicolas

Actuellement le Canada et plus specialement le Quebec, comptent une multitude de sites isoles dont !'electrification est assuree essentiellement par des generatrices diesel a cause, principalement, de l'eloignement du reseau central de disuibution electrique. Bien que consideree comme une source fiable et continue, 1 'utilisation des generatrices diesel devient de plus en plus problematique d'un point de vue energetique, economique et environnemental. Dans le but d'y resoudre et de proposer une methode d'approvisionnement plus performante, mains onereuse et plus respectueuse de l'environnement, l'usage des energies renouvelables est devenu indispensable. Differents travaux ont alors demontre que le couplage de ces energies avec des generauices diesel, formant des systemes hybrides, semble etre une des meilleures solutions. Parmi elles, le systeme hybride eolien-diesel avec stockage par air comprime (SHEDAC) se presente comme une configuration optimale pour 1 'electrification des sites isoles. En effet, differentes etudes ont permis de mettre en avant l'efficacite du stockage par air comprime, par rapport a d'autres technologies de stockage, en complement d'un systeme hybride eolien-diesel. Plus precisement, ce systeme se compose de sous-systemes qui sont: des eoliennes, des generatrices diesel et une chaine de compression et de stockage d'air comprime qui est ensuite utilisee pour suralimenter les generatrices. Ce processus permet ainsi de reduire Ia consommation en carburant tout en agrandissant la part d'energie renouvelable dans Ia production electrique. A ce jour, divers travaux de recherche ont pennis de demontrer I' efficacite d 'un tel systeme et de presenter une variete de configurations possibles. A travers ce memoire, un logiciel de dimensionnement energetique y est elabore dans le but d'unifom1iser !'approche energetique de cette technologie. Cet outil se veut etre une innovation dans le domaine puisqu'il est actuellement impossible de dimensionner un SHEDAC avec les outils existants. Un etat de l'art specifique associe a une validation des resultats a ete realise dans le but de proposer un logiciel fiable et performant. Dans une logique visant !'implantation d'un SHEDAC sur un site isole du Nord-du-Quebec, le logiciel developpe a ete, ensuite, utilise pour realiser une etude energetique permettant d' en degager la solution optimale a mettre en place. Enfin, a l' aide des outils et des resultats obtenus precedemment, !'elaboration de nouvelles strategies d'operation est presentee dans le but de demontrer comment le systeme pourrait etre optimise afm de repondre a differentes contraintes techniques. Le contenu de ce memoire est presente sous forme de trois articles originaux, soumis a des joumaux scientifiques avec cornite de lecture, et d'un chapitre specifique presentant les nouvelles strategies d 'operation. Ils relatent des travaux decrits dans le paragraphe precedent et permettent d'en deduire un usage concluant et pertinent du SHEDAC dans un site isole nordique.

Structural and Biochemical Characterization of a Copper-Binding Mutant of the Organomercurial Lyase MerB: Insight into the Key Role of the Active Site Aspartic Acid in Hg-Carbon Bond Cleavage and Metal Binding Specificity.

PubMed

Wahba, Haytham M; Lecoq, Lauriane; Stevenson, Michael; Mansour, Ahmed; Cappadocia, Laurent; Lafrance-Vanasse, Julien; Wilkinson, Kevin J; Sygusch, Jurgen; Wilcox, Dean E; Omichinski, James G

2016-02-23

In bacterial resistance to mercury, the organomercurial lyase (MerB) plays a key role in the detoxification pathway through its ability to cleave Hg-carbon bonds. Two cysteines (C96 and C159; Escherichia coli MerB numbering) and an aspartic acid (D99) have been identified as the key catalytic residues, and these three residues are conserved in all but four known MerB variants, where the aspartic acid is replaced with a serine. To understand the role of the active site serine, we characterized the structure and metal binding properties of an E. coli MerB mutant with a serine substituted for D99 (MerB D99S) as well as one of the native MerB variants containing a serine residue in the active site (Bacillus megaterium MerB2). Surprisingly, the MerB D99S protein copurified with a bound metal that was determined to be Cu(II) from UV-vis absorption, inductively coupled plasma mass spectrometry, nuclear magnetic resonance, and electron paramagnetic resonance studies. X-ray structural studies revealed that the Cu(II) is bound to the active site cysteine residues of MerB D99S, but that it is displaced following the addition of either an organomercurial substrate or an ionic mercury product. In contrast, the B. megaterium MerB2 protein does not copurify with copper, but the structure of the B. megaterium MerB2-Hg complex is highly similar to the structure of the MerB D99S-Hg complexes. These results demonstrate that the active site aspartic acid is crucial for both the enzymatic activity and metal binding specificity of MerB proteins and suggest a possible functional relationship between MerB and its only known structural homologue, the copper-binding protein NosL.

One-Health: a Safe, Efficient, Dual-Use Vaccine for Humans and Animals against Middle East Respiratory Syndrome Coronavirus and Rabies Virus.

PubMed

Wirblich, Christoph; Coleman, Christopher M; Kurup, Drishya; Abraham, Tara S; Bernbaum, John G; Jahrling, Peter B; Hensley, Lisa E; Johnson, Reed F; Frieman, Matthew B; Schnell, Matthias J

2017-01-15

Middle East respiratory syndrome coronavirus (MERS-CoV) emerged in 2012 and is a highly pathogenic respiratory virus. There are no treatment options against MERS-CoV for humans or animals, and there are no large-scale clinical trials for therapies against MERS-CoV. To address this need, we developed an inactivated rabies virus (RABV) that contains the MERS-CoV spike (S) protein expressed on its surface. Our initial recombinant vaccine, BNSP333-S, expresses a full-length wild-type MERS-CoV S protein; however, it showed significantly reduced viral titers compared to those of the parental RABV strain and only low-level incorporation of full-length MERS-CoV S into RABV particles. Therefore, we developed a RABV-MERS vector that contained the MERS-CoV S1 domain of the MERS-CoV S protein fused to the RABV G protein C terminus (BNSP333-S1). BNSP333-S1 grew to titers similar to those of the parental vaccine vector BNSP333, and the RABV G-MERS-CoV S1 fusion protein was efficiently expressed and incorporated into RABV particles. When we vaccinated mice, chemically inactivated BNSP333-S1 induced high-titer neutralizing antibodies. Next, we challenged both vaccinated mice and control mice with MERS-CoV after adenovirus transduction of the human dipeptidyl peptidase 4 (hDPP4) receptor and then analyzed the ability of mice to control MERS-CoV infection. Our results demonstrated that vaccinated mice were fully protected from the MERS-CoV challenge, as indicated by the significantly lower MERS-CoV titers and MERS-CoV and mRNA levels in challenged mice than those in unvaccinated controls. These data establish that an inactivated RABV-MERS S-based vaccine may be effective for use in animals and humans in areas where MERS-CoV is endemic. Rabies virus-based vectors have been proven to be efficient dual vaccines against rabies and emergent infectious diseases such as Ebola virus. Here we show that inactivated rabies virus particles containing the MERS-CoV S1 protein induce potent immune responses against MERS-CoV and RABV. This novel vaccine is easy to produce and may be useful to protect target animals, such as camels, as well as humans from deadly MERS-CoV and RABV infections. Our results indicate that this vaccine approach can prevent disease, and the RABV-based vaccine platform may be a valuable tool for timely vaccine development against emerging infectious diseases. Copyright © 2017 American Society for Microbiology.

Real-time and label-free ring-resonator monitoring of solid-phase recombinase polymerase amplification.

PubMed

Sabaté Del Río, Jonathan; Steylaerts, Tim; Henry, Olivier Y F; Bienstman, Peter; Stakenborg, Tim; Van Roy, Wim; O'Sullivan, Ciara K

2015-11-15

In this work we present the use of a silicon-on-insulator (SOI) chip featuring an array of 64 optical ring resonators used as refractive index sensors for real-time and label-free DNA detection. Single ring functionalisation was achieved using a click reaction after precise nanolitre spotting of specific hexynyl-terminated DNA capture probes to link to an azido-silanised chip surface. To demonstrate detectability using the ring resonators and to optimise conditions for solid-phase amplification, hybridisation between short 25-mer single stranded DNA (ssDNA) fragments and a complementary capture probe immobilised on the surface of the ring resonators was carried out and detected through the shift in the resonant wavelength. Using the optimised conditions demonstrated via the solid-phase hybridisation, a 144-bp double stranded DNA (dsDNA) was then detected directly using recombinase and polymerase proteins through on-chip target amplification and solid-phase elongation of immobilised forward primers on specific rings, at a constant temperature of 37°C and in less than 60min, achieving a limit of detection of 7.8·10(-13)M (6·10(5) copies in 50µL). The use of an automatic liquid handler injection instrument connected to an integrated resealable chip interface (RCI) allowed programmable multiple injection protocols. Air plugs between different solutions were introduced to prevent intermixing and a proportional-integral-derivative (PID) temperature controller minimised temperature based drifts. Published by Elsevier B.V.

Mise en oeuvre et caracterisation de pieces autotrempantes elaborees avec de nouveaux alliages meres

NASA Astrophysics Data System (ADS)

Bouchemit, Arslane Abdelkader

: L'autotrempabilite des aciers en metallurgie des poudres (MP) permet d'obtenir des pieces ayant une microstructure de trempe (martensite et/ou bainite), et ce, directement lors du refroidissement a la sortie du four de frittage (frittage industriel : 10 45 °C/min [550 a 350 °C]). Cela permet entre autres d'eliminer les traitements thermiques d'austenisation et de trempe (a l'eau : ≈ 2700 °C/min ou a l'huile : ≈ 1100 °C/min [550 a 350 °C] [17]) generalement requis apres le frittage afin d'obtenir une microstructure martensitique. Ainsi, le procede de fabrication est simplifie, moins couteux et la distorsion des pieces due au refroidissement rapide lors de la trempe est evitee. De plus, l'utilisation des bains d'huile est eliminee ce qui rend le procede plus securitaire et ecologique. Les principaux parametres commandant l'autotrempabilite sont : le taux de refroidissement et la composition chimique de l'acier. De nos jours, les systemes de refroidissement a convection forcee combines aux fours industriels permettent d'obtenir des taux de refroidissement eleves a la sortie des fours (60 300 °C/min [550 a 350 °C]) [18, 19]. De plus, le taux de refroidissement critique induisant la formation de la structure de trempe est largement influence par la composition chimique de l'acier. Ainsi, plus l'acier est allie (jusqu'a une certaine limite), plus ce taux de refroidissement critique est moindre. Le molybdene, le nickel et le cuivre sont les elements usuellement utilises en MP. Cependant, le manganese et le chrome sont moins couteux et ont un impact plus marque sur l'autotrempabilite, malgre cela, ils sont rarement utilises a cause de leur susceptibilite a l'oxydation et la degradation de la compressibilite causee par le manganese. L'objectif principal de ce projet est de developper des melanges autotrempants en ajoutant des alliages meres (MA : MA1, MA2 et MA4) fortement allies au manganese (5 15 %m) et au chrome (5 15 %m) qui contiennent beaucoup de carbone (≈ 4 %m) developpes par Ian Bailon-Poujol lors de sa maitrise [20]. La haute teneur en carbone de ces alliages meres assure la protection des elements d'alliage susceptibles a l'oxydation durant toutes les etapes du procede : dans le bain liquide lors de la fusion et l'atomisation a l'eau, pendant le broyage ainsi que lors du frittage des pieces contenant ces alliages meres. Precedemment, Ian Bailon-Poujol avait etudie le broyage de certains alliages meres atomises a l'eau et avait amorce le developpement de melanges autotrempants ainsi que des etudes de diffusion des elements d'alliage. Pour ce projet, le developpement des melanges autotrempants a implique l'optimisation de toutes les etapes de la mise en oeuvre afin d'obtenir les meilleures proprietes possibles des melanges avant frittage (ecoulement, resistance a cru...) et apres frittage (durete, microstructure...), et ce, pour des alliages meres atomises a l'eau par Ian Bailon-Poujol ainsi qu'un alliage mere de chimie similaire qui fut atomise au gaz. (Abstract shortened by ProQuest.).

Molecular basis for methoxyamine initiated mutagenesis. 1H nuclear magnetic resonance studies of base-modified oligodeoxynucleotides.

PubMed

Stone, M J; Nedderman, A N; Williams, D H; Lin, P K; Brown, D M

1991-12-05

In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2'-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the N-O bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2'/H2" protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(+/- 2) degrees C (8mer-AT), 51(+/- 2) degrees C (8mer-AP), 32(+/- 2) degrees C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A.M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.

Analysis of mercuric reductase (merA) gene diversity in an anaerobic mercury-contaminated sediment enrichment.

PubMed

Ní Chadhain, Sinéad M; Schaefer, Jeffra K; Crane, Sharron; Zylstra, Gerben J; Barkay, Tamar

2006-10-01

The reduction of ionic mercury to elemental mercury by the mercuric reductase (MerA) enzyme plays an important role in the biogeochemical cycling of mercury in contaminated environments by partitioning mercury to the atmosphere. This activity, common in aerobic environments, has rarely been examined in anoxic sediments where production of highly toxic methylmercury occurs. Novel degenerate PCR primers were developed which span the known diversity of merA genes in Gram-negative bacteria and amplify a 285 bp fragment at the 3' end of merA. These primers were used to create a clone library and to analyse merA diversity in an anaerobic sediment enrichment collected from a mercury-contaminated site in the Meadowlands, New Jersey. A total of 174 sequences were analysed, representing 71 merA phylotypes and four novel MerA clades. This first examination of merA diversity in anoxic environments suggests an untapped resource for novel merA sequences.

Discovery of Novel Bat Coronaviruses in South China That Use the Same Receptor as Middle East Respiratory Syndrome Coronavirus.

PubMed

Luo, Chu-Ming; Wang, Ning; Yang, Xing-Lou; Liu, Hai-Zhou; Zhang, Wei; Li, Bei; Hu, Ben; Peng, Cheng; Geng, Qi-Bin; Zhu, Guang-Jian; Li, Fang; Shi, Zheng-Li

2018-07-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has represented a human health threat since 2012. Although several MERS-related CoVs that belong to the same species as MERS-CoV have been identified from bats, they do not use the MERS-CoV receptor, dipeptidyl peptidase 4 (DPP4). Here, we screened 1,059 bat samples from at least 30 bat species collected in different regions in south China and identified 89 strains of lineage C betacoronaviruses, including Tylonycteris pachypus coronavirus HKU4 , Pipistrellus pipistrellus coronavirus HKU5 , and MERS-related CoVs. We sequenced the full-length genomes of two positive samples collected from the great evening bat, Ia io , from Guangdong Province. The two genomes were highly similar and exhibited genomic structures identical to those of other lineage C betacoronaviruses. While they exhibited genome-wide nucleotide identities of only 75.3 to 81.2% with other MERS-related CoVs, their gene-coding regions were highly similar to their counterparts, except in the case of the spike proteins. Further protein-protein interaction assays demonstrated that the spike proteins of these MERS-related CoVs bind to the receptor DPP4. Recombination analysis suggested that the newly discovered MERS-related CoVs have acquired their spike genes from a DPP4-recognizing bat coronavirus HKU4. Our study provides further evidence that bats represent the evolutionary origins of MERS-CoV. IMPORTANCE Previous studies suggested that MERS-CoV originated in bats. However, its evolutionary path from bats to humans remains unclear. In this study, we discovered 89 novel lineage C betacoronaviruses in eight bat species. We provide evidence of a MERS-related CoV derived from the great evening bat that uses the same host receptor as human MERS-CoV. This virus also provides evidence for a natural recombination event between the bat MERS-related CoV and another bat coronavirus, HKU4. Our study expands the host ranges of MERS-related CoV and represents an important step toward establishing bats as the natural reservoir of MERS-CoV. These findings may lead to improved epidemiological surveillance of MERS-CoV and the prevention and control of the spread of MERS-CoV to humans. Copyright © 2018 American Society for Microbiology.

Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

PubMed

Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

Subcellular Targeting of Methylmercury Lyase Enhances Its Specific Activity for Organic Mercury Detoxification in Plants1

PubMed Central

Bizily, Scott P.; Kim, Tehryung; Kandasamy, Muthugapatti K.; Meagher, Richard B.

2003-01-01

Methylmercury is an environmental pollutant that biomagnifies in the aquatic food chain with severe consequences for humans and other animals. In an effort to remove this toxin in situ, we have been engineering plants that express the bacterial mercury resistance enzymes organomercurial lyase MerB and mercuric ion reductase MerA. In vivo kinetics experiments suggest that the diffusion of hydrophobic organic mercury to MerB limits the rate of the coupled reaction with MerA (Bizily et al., 2000). To optimize reaction kinetics for organic mercury compounds, the merB gene was engineered to target MerB for accumulation in the endoplasmic reticulum and for secretion to the cell wall. Plants expressing the targeted MerB proteins and cytoplasmic MerA are highly resistant to organic mercury and degrade organic mercury at 10 to 70 times higher specific activity than plants with the cytoplasmically distributed wild-type MerB enzyme. MerB protein in endoplasmic reticulum-targeted plants appears to accumulate in large vesicular structures that can be visualized in immunolabeled plant cells. These results suggest that the toxic effects of organic mercury are focused in microenvironments of the secretory pathway, that these hydrophobic compartments provide more favorable reaction conditions for MerB activity, and that moderate increases in targeted MerB expression will lead to significant gains in detoxification. In summary, to maximize phytoremediation efficiency of hydrophobic pollutants in plants, it may be beneficial to target enzymes to specific subcellular environments. PMID:12586871

Déterminants de l'utilisation des méthodes contraceptives dans la zone de santé Mumbunda à Lubumbashi, République Démocratique du Congo

PubMed Central

Matungulu, Charles Matungulu; Kandolo, Simon Ilunga; Mukengeshayi, Abel Ntambue; Nkola, Angèle Musau; Mpoyi, Dorcas Ilunga; Mumba, Sylvie Katanga; Kabamba, Julie Ndayi; Cowgill, Karen; Kaj, Françoise Malonga

2015-01-01

Introduction Augmenter la prévalence contraceptive s'incarne dans les objectifs des tous les acteurs des programmes qui visent de réduire la mortalité maternelle et infantile, d'améliorer la santé reproductive des adolescents, de lutter contre le VIH/SIDA et les infections sexuellement transmissible (IST), de promouvoir le bien-être familial et de ralentir la croissance démographique. L'objectif de cette étude était de déterminer la prévalence contraceptive moderne et identifier les facteurs qui sont liés à l'utilisation des méthodes contraceptives dans la zone de santé de Mumbunda. Méthodes Une étude transversale à visé analytique a été effectuée auprès des femmes âgées de 15 à 49 ans en union maritale, de Mai à Juin 2014. Grâce à un questionnaire pré testé et validé, nous avons récolté les données par interview sur les caractéristiques sociodémographiques, obstétricales ainsi que sur la pratique contraceptive. Le logiciel SPSS version 21 nous a permis d'analyser les données. Résultats Au total 500 femmes ont été incluses dans cette étude dont l’âge moyen était de 27,9±6,1 ans. La prévalence contraceptive moderne était de 27,6%. L'attitude (ORa= 4,79; IC95%: 1,59-14,43; p<0,001), le niveau de connaissance des méthodes contraceptives (ORa=1,87; IC95%: 1,22-2,87; p<0,001), le soutien du conjoint (ORa=1,87; IC95%: 1,22-2,87; p<0,001) étaient significativement associés à l'utilisation des méthodes contraceptives modernes. Conclusion Tout effort d'augmentation de la prévalence contraceptive devrait cibler l'attitude, le niveau de connaissance de méthodes et le soutien du conjoint afin d'optimiser l'utilisation de la contraception moderne dans la zone de santé (ZS) Mumbunda. PMID:26977237

High correlation of Middle East respiratory syndrome spread with Google search and Twitter trends in Korea.

PubMed

Shin, Soo-Yong; Seo, Dong-Woo; An, Jisun; Kwak, Haewoon; Kim, Sung-Han; Gwack, Jin; Jo, Min-Woo

2016-09-06

The Middle East respiratory syndrome coronavirus (MERS-CoV) was exported to Korea in 2015, resulting in a threat to neighboring nations. We evaluated the possibility of using a digital surveillance system based on web searches and social media data to monitor this MERS outbreak. We collected the number of daily laboratory-confirmed MERS cases and quarantined cases from May 11, 2015 to June 26, 2015 using the Korean government MERS portal. The daily trends observed via Google search and Twitter during the same time period were also ascertained using Google Trends and Topsy. Correlations among the data were then examined using Spearman correlation analysis. We found high correlations (>0.7) between Google search and Twitter results and the number of confirmed MERS cases for the previous three days using only four simple keywords: "MERS", " ("MERS (in Korean)"), " ("MERS symptoms (in Korean)"), and " ("MERS hospital (in Korean)"). Additionally, we found high correlations between the Google search and Twitter results and the number of quarantined cases using the above keywords. This study demonstrates the possibility of using a digital surveillance system to monitor the outbreak of MERS.

Increase methylmercury accumulation in Arabidopsis thaliana expressing bacterial broad-spectrum mercury transporter MerE

PubMed Central

2013-01-01

The bacterial merE gene derived from the Tn21 mer operon encodes a broad-spectrum mercury transporter that governs the transport of methylmercury and mercuric ions across bacterial cytoplasmic membranes, and this gene is a potential molecular tool for improving the efficiency of methylmercury phytoremediation. A transgenic Arabidopsis engineered to express MerE was constructed and the impact of expression of MerE on methylmercury accumulation was evaluated. The subcellular localization of transiently expressed GFP-tagged MerE was examined in Arabidopsis suspension-cultured cells. The GFP-MerE was found to localize to the plasma membrane and cytosol. The transgenic Arabidopsis expressing MerE accumulated significantly more methymercury and mercuric ions into plants than the wild-type Arabidopsis did. The transgenic plants expressing MerE was significantly more resistant to mercuric ions, but only showed more resistant to methylmercury compared with the wild type Arabidopsis. These results demonstrated that expression of the bacterial mercury transporter MerE promoted the transport and accumulation of methylmercury in transgenic Arabidopsis, which may be a useful method for improving plants to facilitate the phytoremediation of methylmercury pollution. PMID:24004544

Mild encephalitis/encephalopathy with reversible splenial lesion (MERS) in adults-a case report and literature review.

PubMed

Yuan, Junliang; Yang, Shuna; Wang, Shuangkun; Qin, Wei; Yang, Lei; Hu, Wenli

2017-05-25

Mild encephalitis/encephalopathy with reversible splenial lesion (MERS) is a rare clinico-radiological entity characterized by the magnetic resonance imaging (MRI) finding of a reversible lesion in the corpus callosum, sometimes involved the symmetrical white matters. Many cases of child-onset MERS with various causes have been reported. However, adult-onset MERS is relatively rare. The clinical characteristics and pathophysiologiccal mechanisms of adult-onset MERS are not well understood. We reviewed the literature on adult-onset MERS in order to describe the characteristics of MERS in adults and to provide experiences for clinician. We reported a case of adult-onset MERS with acute urinary retension and performed literature search from PubMed and web of science databases to identify other adult-onset MERS reports from Januarary 2004 to March 2016. Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guideline was followed on selection process. And then we summarized the clinico-radiological features of adult-onset MERS. Twenty-nine adult-onset MERS cases were reviewed from available literature including the case we have. 86.2% of the cases (25/29) were reported in Asia, especially in Japan. Ages varied between 18 and 59 years old with a 12:17 female-to-male ratio. The major cause was infection by virus or bacteria. Fever and headache were the most common clinical manifestation, and acute urinary retention was observed in 6 patients. All patients recovered completely within a month. Adult-onset MERS is an entity with a broad clinico-radiological spectrum because of the various diseases and conditions. There are similar characteristics between MERS in adults and children, also some differences.

Extensive Viable Middle East Respiratory Syndrome (MERS) Coronavirus Contamination in Air and Surrounding Environment in MERS Isolation Wards.

PubMed

Kim, Sung-Han; Chang, So Young; Sung, Minki; Park, Ji Hoon; Bin Kim, Hong; Lee, Heeyoung; Choi, Jae-Phil; Choi, Won Suk; Min, Ji-Young

2016-08-01

The largest outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) outside the Middle East occurred in South Korea in 2015 and resulted in 186 laboratory-confirmed infections, including 36 (19%) deaths. Some hospitals were considered epicenters of infection and voluntarily shut down most of their operations after nearly half of all transmissions occurred in hospital settings. However, the ways that MERS-CoV is transmitted in healthcare settings are not well defined. We explored the possible contribution of contaminated hospital air and surfaces to MERS transmission by collecting air and swabbing environmental surfaces in 2 hospitals treating MERS-CoV patients. The samples were tested by viral culture with reverse transcription polymerase chain reaction (RT-PCR) and immunofluorescence assay (IFA) using MERS-CoV Spike antibody, and electron microscopy (EM). The presence of MERS-CoV was confirmed by RT-PCR of viral cultures of 4 of 7 air samples from 2 patients' rooms, 1 patient's restroom, and 1 common corridor. In addition, MERS-CoV was detected in 15 of 68 surface swabs by viral cultures. IFA on the cultures of the air and swab samples revealed the presence of MERS-CoV. EM images also revealed intact particles of MERS-CoV in viral cultures of the air and swab samples. These data provide experimental evidence for extensive viable MERS-CoV contamination of the air and surrounding materials in MERS outbreak units. Thus, our findings call for epidemiologic investigation of the possible scenarios for contact and airborne transmission, and raise concern regarding the adequacy of current infection control procedures. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Mouse-adapted MERS coronavirus causes lethal lung disease in human DPP4 knockin mice.

PubMed

Li, Kun; Wohlford-Lenane, Christine L; Channappanavar, Rudragouda; Park, Jung-Eun; Earnest, James T; Bair, Thomas B; Bates, Amber M; Brogden, Kim A; Flaherty, Heather A; Gallagher, Tom; Meyerholz, David K; Perlman, Stanley; McCray, Paul B

2017-04-11

The Middle East respiratory syndrome (MERS) emerged in Saudi Arabia in 2012, caused by a zoonotically transmitted coronavirus (CoV). Over 1,900 cases have been reported to date, with ∼36% fatality rate. Lack of autopsies from MERS cases has hindered understanding of MERS-CoV pathogenesis. A small animal model that develops progressive pulmonary manifestations when infected with MERS-CoV would advance the field. As mice are restricted to infection at the level of DPP4, the MERS-CoV receptor, we generated mice with humanized exons 10-12 of the mouse Dpp4 locus. Upon inoculation with MERS-CoV, human DPP4 knockin (KI) mice supported virus replication in the lungs, but developed no illness. After 30 serial passages through the lungs of KI mice, a mouse-adapted virus emerged (MERS MA ) that grew in lungs to over 100 times higher titers than the starting virus. A plaque-purified MERS MA clone caused weight loss and fatal infection. Virus antigen was observed in airway epithelia, pneumocytes, and macrophages. Pathologic findings included diffuse alveolar damage with pulmonary edema and hyaline membrane formation associated with accumulation of activated inflammatory monocyte-macrophages and neutrophils in the lungs. Relative to the parental MERS-CoV, MERS MA viruses contained 13-22 mutations, including several within the spike (S) glycoprotein gene. S-protein mutations sensitized viruses to entry-activating serine proteases and conferred more rapid entry kinetics. Recombinant MERS MA bearing mutant S proteins were more virulent than the parental virus in hDPP4 KI mice. The hDPP4 KI mouse and the MERS MA provide tools to investigate disease causes and develop new therapies.

Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.

PubMed

Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni

2015-12-21

Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

La fragilité

PubMed Central

Lee, Linda; Heckman, George; Molnar, Frank J.

2015-01-01

Résumé Objectif Aider les médecins de famille à mieux reconnaître la fragilité et ses répercussions sur la prise en charge des patients âgés. Sources des données Une recension a été effectuée dans PubMed-MEDLINE de 1990 à 2013 pour trouver des articles rédigés en anglais exclusivement, à l’aide des groupes suivants de mots clés et d’en-têtes MeSH : frail elderly, frail, frailty; aged, geriatrics, geriatric assessment, health services for the aged; primary health care, community health services et family practice. Message principal La fragilité est fréquente, en particulier chez les personnes âgées atteintes de maladies chroniques complexes comme l’insuffisance cardiaque et la bronchopneumopathie chronique obstructive. De nouvelles données probantes démontrent l’importance de la fragilité comme facteur de prédiction d’issues indésirables chez les personnes plus âgées. Quoiqu’on ne s’entende actuellement pas sur les meilleures façons d’évaluer et de diagnostiquer la fragilité en soins primaires, des marqueurs individuels de la fragilité comme la lenteur de la démarche offrent des moyens pratiques prometteurs de dépister la fragilité. La détection de la fragilité en soins primaires peut offrir la possibilité de retarder la progression de la fragilité au moyen d’interventions proactives comme l’exercice. La reconnaissance de l’existence de la fragilité peut orienter un counseling approprié et la prise de mesures préventives anticipatoires pour les patients lorsqu’on envisage des interventions médicales. Elle peut aussi aider à cerner des problèmes concomitants qui contribuent à la fragilité et l’influencent et à en optimiser la prise en charge. Les recherches futures devraient se pencher sur la détermination de moyens pratiques et efficaces pour évaluer et prendre en charge de manière appropriée ces patients vulnérables au niveau des soins primaires. Conclusion En dépit de son importance, on a accordé peu d’attention au concept de la fragilité en médecine familiale. La fragilité peut aisément passer inaperçue parce que ses manifestations sont souvent subtiles, de progression lente et, par conséquent, elle peut être méprise pour un vieillissement normal. La formation des médecins a insisté sur des maladies médicales spécifiques plutôt que sur la vulnérabilité globale. Pour les médecins en soins primaires, la reconnaissance de la fragilité peut les aider à offrir un counseling approprié aux patients et aux membres de leur famille au sujet des risques des interventions médicales.

Replication and shedding of MERS-CoV in Jamaican fruit bats (Artibeus jamaicensis)

PubMed Central

Munster, Vincent J.; Adney, Danielle R.; van Doremalen, Neeltje; Brown, Vienna R.; Miazgowicz, Kerri L.; Milne-Price, Shauna; Bushmaker, Trenton; Rosenke, Rebecca; Scott, Dana; Hawkinson, Ann; de Wit, Emmie; Schountz, Tony; Bowen, Richard A.

2016-01-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) highlights the zoonotic potential of Betacoronaviruses. Investigations into the origin of MERS-CoV have focused on two potential reservoirs: bats and camels. Here, we investigated the role of bats as a potential reservoir for MERS-CoV. In vitro, the MERS-CoV spike glycoprotein interacted with Jamaican fruit bat (Artibeus jamaicensis) dipeptidyl peptidase 4 (DPP4) receptor and MERS-CoV replicated efficiently in Jamaican fruit bat cells, suggesting there is no restriction at the receptor or cellular level for MERS-CoV. To shed light on the intrinsic host-virus relationship, we inoculated 10 Jamaican fruit bats with MERS-CoV. Although all bats showed evidence of infection, none of the bats showed clinical signs of disease. Virus shedding was detected in the respiratory and intestinal tract for up to 9 days. MERS-CoV replicated transiently in the respiratory and, to a lesser extent, the intestinal tracts and internal organs; with limited histopathological changes observed only in the lungs. Analysis of the innate gene expression in the lungs showed a moderate, transient induction of expression. Our results indicate that MERS-CoV maintains the ability to replicate in bats without clinical signs of disease, supporting the general hypothesis of bats as ancestral reservoirs for MERS-CoV. PMID:26899616

The MER/CIP Portal for Ground Operations

NASA Technical Reports Server (NTRS)

Chan, Louise; Desai, Sanjay; DOrtenzio, Matthew; Filman, Robtert E.; Heher, Dennis M.; Hubbard, Kim; Johan, Sandra; Keely, Leslie; Magapu, Vish; Mak, Ronald

2003-01-01

We developed the Mars Exploration Rover/Collaborative Information Portal (MER/CIP) to facilitate MER operations. MER/CIP provides a centralized, one-stop delivery platform integrating science and engineering data from several distributed heterogeneous data sources. Key issues for MER/CIP include: 1) Scheduling and schedule reminders; 2) Tracking the status of daily predicted outputs; 3) Finding and analyzing data products; 4) Collaboration; 5) Announcements; 6) Personalization.

Comparative Epidemiology of Human Infections with Middle East Respiratory Syndrome and Severe Acute Respiratory Syndrome Coronaviruses among Healthcare Personnel

PubMed Central

Chu, Yu-Tseng; Wu, Joseph Tsung-Shu; Geng, Xingyi; Zhao, Na; Cheng, Wei; Chen, Enfu; King, Chwan-Chuen

2016-01-01

The largest nosocomial outbreak of Middle East respiratory syndrome (MERS) occurred in South Korea in 2015. Health Care Personnel (HCP) are at high risk of acquiring MERS-Coronavirus (MERS-CoV) infections, similar to the severe acute respiratory syndrome (SARS)-Coronavirus (SARS-CoV) infections first identified in 2003. This study described the similarities and differences in epidemiological and clinical characteristics of 183 confirmed global MERS cases and 98 SARS cases in Taiwan associated with HCP. The epidemiological findings showed that the mean age of MERS-HCP and total MERS cases were 40 (24~74) and 49 (2~90) years, respectively, much older than those in SARS [SARS-HCP: 35 (21~68) years, p = 0.006; total SARS: 42 (0~94) years, p = 0.0002]. The case fatality rates (CFR) was much lower in MERS-HCP [7.03% (9/128)] or SARS-HCP [12.24% (12/98)] than the MERS-non-HCP [36.96% (34/92), p<0.001] or SARS-non-HCP [24.50% (61/249), p<0.001], however, no difference was found between MERS-HCP and SARS-HCP [p = 0.181]. In terms of clinical period, the days from onset to death [13 (4~17) vs 14.5 (0~52), p = 0.045] and to discharge [11 (5~24) vs 24 (0~74), p = 0.010] and be hospitalized days [9.5 (3~22) vs 22 (0~69), p = 0.040] were much shorter in MERS-HCP than SARS-HCP. Similarly, days from onset to confirmation were shorter in MERS-HCP than MERS-non-HCP [6 (1~14) vs 10 (1~21), p = 0.044]. In conclusion, the severity of MERS-HCP and SARS-HCP was lower than that of MERS-non-HCP and SARS-non-HCP due to younger age and early confirmation in HCP groups. However, no statistical difference was found in MERS-HCP and SARS-HCP. Thus, prevention of nosocomial infections involving both novel Coronavirus is crucially important to protect HCP. PMID:26930074

Amélioration des performances du procédé de soudage TIG sur un acier au carbone et un alliage d'aluminium par dépôt de silice

NASA Astrophysics Data System (ADS)

Sire, Stéphane; Marya, Surendar

This Note presents ways to improve the weld penetration potential of TIG process by optimising silica application around the joints in a plain carbon steel and an aluminium alloy 5086. Whereas for plain carbon steels, full coverage of joint improves penetration, the presence of a blank zone around the joint in the flux coating on aluminium 5086 using AC-TIG seems to be the best solution for cosmetic and deep welds. To cite this article: S. Sire, S. Marya, C. R. Mecanique 330 (2002) 83-89.

Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction

PubMed Central

Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

2017-01-01

Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination–initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria. However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome–axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. PMID:29021238

Middle East respiratory syndrome coronavirus (MERS-CoV): animal to human interaction

PubMed Central

Omrani, Ali S.; Al-Tawfiq, Jaffar A.

2015-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel enzootic betacoronavirus that was first described in September 2012. The clinical spectrum of MERS-CoV infection in humans ranges from an asymptomatic or mild respiratory illness to severe pneumonia and multi-organ failure; overall mortality is around 35.7%. Bats harbour several betacoronaviruses that are closely related to MERS-CoV but more research is needed to establish the relationship between bats and MERS-CoV. The seroprevalence of MERS-CoV antibodies is very high in dromedary camels in Eastern Africa and the Arabian Peninsula. MERS-CoV RNA and viable virus have been isolated from dromedary camels, including some with respiratory symptoms. Furthermore, near-identical strains of MERS-CoV have been isolated from epidemiologically linked humans and camels, confirming inter-transmission, most probably from camels to humans. Though inter-human spread within health care settings is responsible for the majority of reported MERS-CoV cases, the virus is incapable at present of causing sustained human-to-human transmission. Clusters can be readily controlled with implementation of appropriate infection control procedures. Phylogenetic and sequencing data strongly suggest that MERS-CoV originated from bat ancestors after undergoing a recombination event in the spike protein, possibly in dromedary camels in Africa, before its exportation to the Arabian Peninsula along the camel trading routes. MERS-CoV serosurveys are needed to investigate possible unrecognized human infections in Africa. Amongst the important measures to control MERS-CoV spread are strict regulation of camel movement, regular herd screening and isolation of infected camels, use of personal protective equipment by camel handlers and enforcing rules banning all consumption of unpasteurized camel milk and urine. PMID:26924345

Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site

PubMed Central

Song, Lingyun; Caguiat, Jonathan; Li, Zhongrui; Shokes, Jacob; Scott, Robert A.; Olliff, Lynda; Summers, Anne O.

2004-01-01

The repressor-activator MerR that controls transcription of the mercury resistance (mer) operon is unusual for its high sensitivity and specificity for Hg(II) in in vivo and in vitro transcriptional assays. The metal-recognition domain of MerR resides at the homodimer interface in a novel antiparallel arrangement of α-helix 5 that forms a coiled-coil motif. To facilitate the study of this novel metal binding motif, we assembled this antiparallel coiled coil into a single chain by directly fusing two copies of the 48-residue α-helix 5 of MerR. The resulting 107-residue polypeptide, called the metal binding domain (MBD), and wild-type MerR were overproduced and purified, and their metal-binding properties were determined in vivo and in vitro. In vitro MBD bound ca. 1.0 equivalent of Hg(II) per pair of binding sites, just as MerR does, and it showed only a slightly lower affinity for Hg(II) than did MerR. Extended X-ray absorption fine structure data showed that MBD has essentially the same Hg(II) coordination environment as MerR. In vivo, cells overexpressing MBD accumulated 70 to 100% more 203Hg(II) than cells bearing the vector alone, without deleterious effects on cell growth. Both MerR and MBD variously bound other thiophilic metal ions, including Cd(II), Zn(II), Pb(II), and As(III), in vitro and in vivo. We conclude that (i) it is possible to simulate in a single polypeptide chain the in vitro and in vivo metal-binding ability of dimeric, full-length MerR and (ii) MerR's specificity in transcriptional activation does not reside solely in the metal-binding step. PMID:14996817

Engineering tobacco to remove mercury from polluted soil.

PubMed

Chang, S; Wei, F; Yang, Y; Wang, A; Jin, Z; Li, J; He, Y; Shu, H

2015-04-01

Tobacco is an ideal plant for modification to remove mercury from soil. Although several transgenic tobacco strains have been developed, they either release elemental mercury directly into the air or are only capable of accumulating small quantities of mercury. In this study, we constructed two transgenic tobacco lines: Ntk-7 (a tobacco plant transformed with merT-merP-merB1-merB2-ppk) and Ntp-36 (tobacco transformed with merT-merP-merB1-merB2-pcs1). The genes merT, merP, merB1, and merB2 were obtained from the well-known mercury-resistant bacterium Pseudomonas K-62. Ppk is a gene that encodes polyphosphate kinase, a key enzyme for synthesizing polyphosphate in Enterobacter aerogenes. Pcs1 is a tobacco gene that encodes phytochelatin synthase, which is the key enzyme for phytochelatin synthesis. The genes were linked with LP4/2A, a sequence that encodes a well-known linker peptide. The results demonstrate that all foreign genes can be abundantly expressed. The mercury resistance of Ntk-7 and Ntp-36 was much higher than that of the wild type whether tested with organic mercury or with mercuric ions. The transformed plants can accumulate significantly more mercury than the wild type, and Ntp-36 can accumulate more mercury from soil than Ntk-7. In mercury-polluted soil, the mercury content in Ntp-36's root can reach up to 251 μg/g. This is the first report to indicate that engineered tobacco can not only accumulate mercury from soil but also retain this mercury within the plant. Ntp-36 has good prospects for application in bioremediation for mercury pollution.

Five years of beach drainage survey on a macrotidal beach (Quend-Plage, northern France)

NASA Astrophysics Data System (ADS)

Bain, Olivier; Toulec, Renaud; Combaud, Anne; Villemagne, Guillaume; Barrier, Pascal

2016-07-01

A drainage system was installed in 2008 on the macrotidal beach of Quend-Plage, close to Abbeville (Somme, northern France), following a period of significant erosion of recreational areas. The "Direction départementale des territoires et de la mer" (French Coastal Department Authority) has requested a biannual survey in order to validate the beach drainage setup and its efficiency. This paper presents the methodology used for this survey, and the response of the coastal system to this soft engineering method for preventing erosion. These five years of drainage operation have strongly modified the morphology of the beach. Three main modifications occurred: (i) accretion of the upper beach and foredune, (ii) erosion of the lower and middle beach and (iii) a slight shift in directions of the beach bars and troughs. These morphological changes finally led to the stabilization of the beach.

Reverse genetics with a full-length infectious cDNA of the Middle East respiratory syndrome coronavirus.

PubMed

Scobey, Trevor; Yount, Boyd L; Sims, Amy C; Donaldson, Eric F; Agnihothram, Sudhakar S; Menachery, Vineet D; Graham, Rachel L; Swanstrom, Jesica; Bove, Peter F; Kim, Jeeho D; Grego, Sonia; Randell, Scott H; Baric, Ralph S

2013-10-01

Severe acute respiratory syndrome with high mortality rates (~50%) is associated with a novel group 2c betacoronavirus designated Middle East respiratory syndrome coronavirus (MERS-CoV). We synthesized a panel of contiguous cDNAs that spanned the entire genome. Following contig assembly into genome-length cDNA, transfected full-length transcripts recovered several recombinant viruses (rMERS-CoV) that contained the expected marker mutations inserted into the component clones. Because the wild-type MERS-CoV contains a tissue culture-adapted T1015N mutation in the S glycoprotein, rMERS-CoV replicated ~0.5 log less efficiently than wild-type virus. In addition, we ablated expression of the accessory protein ORF5 (rMERS•ORF5) and replaced it with tomato red fluorescent protein (rMERS-RFP) or deleted the entire ORF3, 4, and 5 accessory cluster (rMERS-ΔORF3-5). Recombinant rMERS-CoV, rMERS-CoV•ORF5, and MERS-CoV-RFP replicated to high titers, whereas MERS-ΔORF3-5 showed 1-1.5 logs reduced titer compared with rMERS-CoV. Northern blot analyses confirmed the associated molecular changes in the recombinant viruses, and sequence analysis demonstrated that RFP was expressed from the appropriate consensus sequence AACGAA. We further show dipeptidyl peptidase 4 expression, MERS-CoV replication, and RNA and protein synthesis in human airway epithelial cell cultures, primary lung fibroblasts, primary lung microvascular endothelial cells, and primary alveolar type II pneumocytes, demonstrating a much broader tissue tropism than severe acute respiratory syndrome coronavirus. The availability of a MERS-CoV molecular clone, as well as recombinant viruses expressing indicator proteins, will allow for high-throughput testing of therapeutic compounds and provide a genetic platform for studying gene function and the rational design of live virus vaccines.

Molecular interaction study of commercial cyclic peptides and MERS-COV papain-like protease as novel drug candidate for MERS-COV

NASA Astrophysics Data System (ADS)

Nasution, M. A. F.; Azzuhdi, M. G.; Tambunan, U. S. F.

2017-07-01

Middle-east respiratory syndrome coronavirus (MERS-CoV) has become the current outbreak, MERS-CoV infection results in illness at the respiratory system, digestive, and even lead to death with an average mortality caused by MERS-CoV infection reaches 50 %. Until now, there is not any effective vaccine or drug to ward off MERS-CoV infection. Papain-like protease (PLpro) is responsible for cleavage of a nonstructural protein that is essential for viral maturation. Inhibition of PLpro with a ligand will block the cleavage process of nonstructural protein, thus reduce the infection of MERS-CoV. Through of bioinformatics study with molecular docking and binding interaction analysis of commercial cyclic peptides, aldosterone secretion inhibiting factor (1-35) (bovine) was obtained as an inhibitor for PLpro. Thus, aldosterone secretion inhibiting factor (1-35) (bovine) has a potential as a novel candidate drug for treating MERS-CoV.

Middle East respiratory syndrome in children. Dental considerations.

PubMed

Al-Sehaibany, Fares S

2017-04-01

As of January 2016, 1,633 laboratory-confirmed cases of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infection and 587 MERS-related deaths have been reported by the World Health Organization globally. Middle East Respiratory Syndrome Coronavirus  may occur sporadically in communities or may be transmitted within families or hospitals. The number of confirmed MERS-CoV cases among healthcare workers has been increasing. Middle East Respiratory Syndrome Coronavirus may also spread through aerosols generated during various dental treatments, resulting in transmission between patients and dentists. As MERS-CoV cases have also been reported among children, pediatric dentists are at risk of MERS-CoV infection. This review discusses MERS-CoV infection in children and healthcare workers, especially pediatric dentists, and considerations pertaining to pediatric dentistry. Although no cases of MERS-CoV transmission between a patient and a dentist have yet been reported, the risk of MERS-CoV transmission from an infected patient may be high due to the unique work environment of dentists (aerosol generation).

KAnalyze: a fast versatile pipelined K-mer toolkit

PubMed Central

Audano, Peter; Vannberg, Fredrik

2014-01-01

Motivation: Converting nucleotide sequences into short overlapping fragments of uniform length, k-mers, is a common step in many bioinformatics applications. While existing software packages count k-mers, few are optimized for speed, offer an application programming interface (API), a graphical interface or contain features that make it extensible and maintainable. We designed KAnalyze to compete with the fastest k-mer counters, to produce reliable output and to support future development efforts through well-architected, documented and testable code. Currently, KAnalyze can output k-mer counts in a sorted tab-delimited file or stream k-mers as they are read. KAnalyze can process large datasets with 2 GB of memory. This project is implemented in Java 7, and the command line interface (CLI) is designed to integrate into pipelines written in any language. Results: As a k-mer counter, KAnalyze outperforms Jellyfish, DSK and a pipeline built on Perl and Linux utilities. Through extensive unit and system testing, we have verified that KAnalyze produces the correct k-mer counts over multiple datasets and k-mer sizes. Availability and implementation: KAnalyze is available on SourceForge: https://sourceforge.net/projects/kanalyze/ Contact: fredrik.vannberg@biology.gatech.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24642064

KAnalyze: a fast versatile pipelined k-mer toolkit.

PubMed

Audano, Peter; Vannberg, Fredrik

2014-07-15

Converting nucleotide sequences into short overlapping fragments of uniform length, k-mers, is a common step in many bioinformatics applications. While existing software packages count k-mers, few are optimized for speed, offer an application programming interface (API), a graphical interface or contain features that make it extensible and maintainable. We designed KAnalyze to compete with the fastest k-mer counters, to produce reliable output and to support future development efforts through well-architected, documented and testable code. Currently, KAnalyze can output k-mer counts in a sorted tab-delimited file or stream k-mers as they are read. KAnalyze can process large datasets with 2 GB of memory. This project is implemented in Java 7, and the command line interface (CLI) is designed to integrate into pipelines written in any language. As a k-mer counter, KAnalyze outperforms Jellyfish, DSK and a pipeline built on Perl and Linux utilities. Through extensive unit and system testing, we have verified that KAnalyze produces the correct k-mer counts over multiple datasets and k-mer sizes. KAnalyze is available on SourceForge: https://sourceforge.net/projects/kanalyze/. © The Author 2014. Published by Oxford University Press.

MER SPICE Interface

NASA Technical Reports Server (NTRS)

Sayfi, Elias

2004-01-01

MER SPICE Interface is a software module for use in conjunction with the Mars Exploration Rover (MER) mission and the SPICE software system of the Navigation and Ancillary Information Facility (NAIF) at NASA's Jet Propulsion Laboratory. (SPICE is used to acquire, record, and disseminate engineering, navigational, and other ancillary data describing circumstances under which data were acquired by spaceborne scientific instruments.) Given a Spacecraft Clock value, MER SPICE Interface extracts MER-specific data from SPICE kernels (essentially, raw data files) and calculates values for Planet Day Number, Local Solar Longitude, Local Solar Elevation, Local Solar Azimuth, and Local Solar Time (UTC). MER SPICE Interface was adapted from a subroutine, denoted m98SpiceIF written by Payam Zamani, that was intended to calculate SPICE values for the Mars Polar Lander. The main difference between MER SPICE Interface and m98SpiceIf is that MER SPICE Interface does not explicitly call CHRONOS, a time-conversion program that is part of a library of utility subprograms within SPICE. Instead, MER SPICE Interface mimics some portions of the CHRONOS code, the advantage being that it executes much faster and can efficiently be called from a pipeline of events in a parallel processing environment.

Coupling two mercury resistance genes in Eastern cottonwood enhances the processing of organomercury.

PubMed

Lyyra, Satu; Meagher, Richard B; Kim, Tehryung; Heaton, Andrew; Montello, Paul; Balish, Rebecca S; Merkle, Scott A

2007-03-01

Eastern cottonwood (Populus deltoides Bartr. ex Marsh.) trees were engineered to express merA (mercuric ion reductase) and merB (organomercury lyase) transgenes in order to be used for the phytoremediation of mercury-contaminated soils. Earlier studies with Arabidopsis thaliana and Nicotiana tabacum showed that this gene combination resulted in more efficient detoxification of organomercurial compounds than did merB alone, but neither species is optimal for long-term field applications. Leaf discs from in vitro-grown merA, nptII (neomycin phosphotransferase) transgenic cottonwood plantlets were inoculated with Agrobacterium tumefaciens strain C58 carrying the merB and hygromycin resistance (hptII) genes. Polymerase chain reaction of shoots regenerated from the leaf discs under selection indicated an overall transformation frequency of 20%. Western blotting of leaves showed that MerA and MerB proteins were produced. In vitro-grown merA/merB plants were highly resistant to phenylmercuric acetate, and detoxified organic mercury compounds two to three times more rapidly than did controls, as shown by mercury volatilization assay. This indicates that these cottonwood trees are reasonable candidates for the remediation of organomercury-contaminated sites.

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012.

PubMed

Johnson, Reed F; Bagci, Ulas; Keith, Lauren; Tang, Xianchun; Mollura, Daniel J; Zeitlin, Larry; Qin, Jing; Huzella, Louis; Bartos, Christopher J; Bohorova, Natasha; Bohorov, Ognian; Goodman, Charles; Kim, Do H; Paulty, Michael H; Velasco, Jesus; Whaley, Kevin J; Johnson, Joshua C; Pettitt, James; Ork, Britini L; Solomon, Jeffrey; Oberlander, Nicholas; Zhu, Quan; Sun, Jiusong; Holbrook, Michael R; Olinger, Gene G; Baric, Ralph S; Hensley, Lisa E; Jahrling, Peter B; Marasco, Wayne A

2016-03-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10(6) PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a human anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. Published by Elsevier Inc.

Efficacy of a Mer and Flt3 tyrosine kinase small molecule inhibitor, UNC1666, in acute myeloid leukemia

PubMed Central

Lee-Sherick, Alisa B.; Zhang, Weihe; Menachof, Kelly K.; Hill, Amanda A.; Rinella, Sean; Kirkpatrick, Gregory; Page, Lauren S.; Stashko, Michael A.; Jordan, Craig T.; Wei, Qi; Liu, Jing; Zhang, Dehui; DeRyckere, Deborah; Wang, Xiaodong; Frye, Stephen; Earp, H. Shelton; Graham, Douglas K.

2015-01-01

Mer and Flt3 receptor tyrosine kinases have been implicated as therapeutic targets in acute myeloid leukemia (AML). In this manuscript we describe UNC1666, a novel ATP-competitive small molecule tyrosine kinase inhibitor, which potently diminishes Mer and Flt3 phosphorylation in AML. Treatment with UNC1666 mediated biochemical and functional effects in AML cell lines expressing Mer or Flt3 internal tandem duplication (ITD), including decreased phosphorylation of Mer, Flt3 and downstream effectors Stat, Akt and Erk, induction of apoptosis in up to 98% of cells, and reduction of colony formation by greater than 90%, compared to treatment with vehicle. These effects were dose-dependent, with inhibition of downstream signaling and functional effects correlating with the degree of Mer or Flt3 kinase inhibition. Treatment of primary AML patient samples expressing Mer and/or Flt3-ITD with UNC1666 also inhibited Mer and Flt3 intracellular signaling, induced apoptosis, and inhibited colony formation. In summary, UNC1666 is a novel potent small molecule tyrosine kinase inhibitor that decreases oncogenic signaling and myeloblast survival, thereby validating dual Mer/Flt3 inhibition as an attractive treatment strategy for AML. PMID:25762638

Human Centered Design and Development for NASA's MerBoard

NASA Technical Reports Server (NTRS)

Trimble, Jay

2003-01-01

This viewgraph presentation provides an overview of the design and development process for NASA's MerBoard. These devices are large interactive display screens which can be shown on the user's computer, which will allow scientists in many locations to interpret and evaluate mission data in real-time. These tools are scheduled to be used during the 2003 Mars Exploration Rover (MER) expeditions. Topics covered include: mission overview, Mer Human Centered Computers, FIDO 2001 observations and MerBoard prototypes.

A mouse model for MERS coronavirus-induced acute respiratory distress syndrome.

PubMed

Cockrell, Adam S; Yount, Boyd L; Scobey, Trevor; Jensen, Kara; Douglas, Madeline; Beall, Anne; Tang, Xian-Chun; Marasco, Wayne A; Heise, Mark T; Baric, Ralph S

2016-11-28

Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel virus that emerged in 2012, causing acute respiratory distress syndrome (ARDS), severe pneumonia-like symptoms and multi-organ failure, with a case fatality rate of ∼36%. Limited clinical studies indicate that humans infected with MERS-CoV exhibit pathology consistent with the late stages of ARDS, which is reminiscent of the disease observed in patients infected with severe acute respiratory syndrome coronavirus. Models of MERS-CoV-induced severe respiratory disease have been difficult to achieve, and small-animal models traditionally used to investigate viral pathogenesis (mouse, hamster, guinea-pig and ferret) are naturally resistant to MERS-CoV. Therefore, we used CRISPR-Cas9 gene editing to modify the mouse genome to encode two amino acids (positions 288 and 330) that match the human sequence in the dipeptidyl peptidase 4 receptor, making mice susceptible to MERS-CoV infection and replication. Serial MERS-CoV passage in these engineered mice was then used to generate a mouse-adapted virus that replicated efficiently within the lungs and evoked symptoms indicative of severe ARDS, including decreased survival, extreme weight loss, decreased pulmonary function, pulmonary haemorrhage and pathological signs indicative of end-stage lung disease. Importantly, therapeutic countermeasures comprising MERS-CoV neutralizing antibody treatment or a MERS-CoV spike protein vaccine protected the engineered mice against MERS-CoV-induced ARDS.

Intratracheal exposure of common marmosets to MERS-CoV Jordan-n3/2012 or MERS-CoV EMC/2012 isolates does not result in lethal disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Via, Laura E.; Kumar, Mia R.

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) continues to be a threat to human health in the Middle East. Development of countermeasures is ongoing; however, an animal model that faithfully recapitulates human disease has yet to be defined. A recent study indicated that inoculation of common marmosets resulted in inconsistent lethality. Based on these data we sought to compare two isolates of MERS-CoV. We followed disease progression in common marmosets after intratracheal exposure with: MERS-CoV-EMC/2012, MERS-CoV-Jordan-n3/2012, media, or inactivated virus. Our data suggest that common marmosets developed a mild to moderate non-lethal respiratory disease, which was quantifiable by computed tomography (CT),more » with limited other clinical signs. Based on CT data, clinical data, and virological data, MERS-CoV inoculation of common marmosets results in mild to moderate clinical signs of disease that are likely due to manipulations of the marmoset rather than as a result of robust viral replication. - Highlights: • Common marmosets infected with MERS-EMC and MERS-JOR did not develop lethal disease. • Infected subjects developed transient signs of clinical disease. • CT indicated few differences between the infected and control groups. • Marmosets do not faithfully replicate human MERS pathogenesis.« less

Enhanced Regulatory Sequence Prediction Using Gapped k-mer Features

PubMed Central

Mohammad-Noori, Morteza; Beer, Michael A.

2014-01-01

Abstract Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem. PMID:25033408

Enhanced regulatory sequence prediction using gapped k-mer features.

PubMed

Ghandi, Mahmoud; Lee, Dongwon; Mohammad-Noori, Morteza; Beer, Michael A

2014-07-01

Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

Transmission characteristics of MERS and SARS in the healthcare setting: a comparative study.

PubMed

Chowell, Gerardo; Abdirizak, Fatima; Lee, Sunmi; Lee, Jonggul; Jung, Eunok; Nishiura, Hiroshi; Viboud, Cécile

2015-09-03

The Middle East respiratory syndrome (MERS) coronavirus has caused recurrent outbreaks in the Arabian Peninsula since 2012. Although MERS has low overall human-to-human transmission potential, there is occasional amplification in the healthcare setting, a pattern reminiscent of the dynamics of the severe acute respiratory syndrome (SARS) outbreaks in 2003. Here we provide a head-to-head comparison of exposure patterns and transmission dynamics of large hospital clusters of MERS and SARS, including the most recent South Korean outbreak of MERS in 2015. To assess the unexpected nature of the recent South Korean nosocomial outbreak of MERS and estimate the probability of future large hospital clusters, we compared exposure and transmission patterns for previously reported hospital clusters of MERS and SARS, based on individual-level data and transmission tree information. We carried out simulations of nosocomial outbreaks of MERS and SARS using branching process models rooted in transmission tree data, and inferred the probability and characteristics of large outbreaks. A significant fraction of MERS cases were linked to the healthcare setting, ranging from 43.5 % for the nosocomial outbreak in Jeddah, Saudi Arabia, in 2014 to 100 % for both the outbreak in Al-Hasa, Saudi Arabia, in 2013 and the outbreak in South Korea in 2015. Both MERS and SARS nosocomial outbreaks are characterized by early nosocomial super-spreading events, with the reproduction number dropping below 1 within three to five disease generations. There was a systematic difference in the exposure patterns of MERS and SARS: a majority of MERS cases occurred among patients who sought care in the same facilities as the index case, whereas there was a greater concentration of SARS cases among healthcare workers throughout the outbreak. Exposure patterns differed slightly by disease generation, however, especially for SARS. Moreover, the distributions of secondary cases per single primary case varied highly across individual hospital outbreaks (Kruskal-Wallis test; P < 0.0001), with significantly higher transmission heterogeneity in the distribution of secondary cases for MERS than SARS. Simulations indicate a 2-fold higher probability of occurrence of large outbreaks (>100 cases) for SARS than MERS (2 % versus 1 %); however, owing to higher transmission heterogeneity, the largest outbreaks of MERS are characterized by sharper incidence peaks. The probability of occurrence of MERS outbreaks larger than the South Korean cluster (n = 186) is of the order of 1 %. Our study suggests that the South Korean outbreak followed a similar progression to previously described hospital clusters involving coronaviruses, with early super-spreading events generating a disproportionately large number of secondary infections, and the transmission potential diminishing greatly in subsequent generations. Differences in relative exposure patterns and transmission heterogeneity of MERS and SARS could point to changes in hospital practices since 2003 or differences in transmission mechanisms of these coronaviruses.

Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction.

PubMed

Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

2017-09-15

Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination-initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome-axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. © 2017 Tessé et al.; Published by Cold Spring Harbor Laboratory Press.

Optimizing Hybrid de Novo Transcriptome Assembly and Extending Genomic Resources for Giant Freshwater Prawns (Macrobrachium rosenbergii): The Identification of Genes and Markers Associated with Reproduction.

PubMed

Jung, Hyungtaek; Yoon, Byung-Ha; Kim, Woo-Jin; Kim, Dong-Wook; Hurwood, David A; Lyons, Russell E; Salin, Krishna R; Kim, Heui-Soo; Baek, Ilseon; Chand, Vincent; Mather, Peter B

2016-05-07

The giant freshwater prawn, Macrobrachium rosenbergii, a sexually dimorphic decapod crustacean is currently the world's most economically important cultured freshwater crustacean species. Despite its economic importance, there is currently a lack of genomic resources available for this species, and this has limited exploration of the molecular mechanisms that control the M. rosenbergii sex-differentiation system more widely in freshwater prawns. Here, we present the first hybrid transcriptome from M. rosenbergii applying RNA-Seq technologies directed at identifying genes that have potential functional roles in reproductive-related traits. A total of 13,733,210 combined raw reads (1720 Mbp) were obtained from Ion-Torrent PGM and 454 FLX. Bioinformatic analyses based on three state-of-the-art assemblers, the CLC Genomic Workbench, Trans-ABySS, and Trinity, that use single and multiple k-mer methods respectively, were used to analyse the data. The influence of multiple k-mers on assembly performance was assessed to gain insight into transcriptome assembly from short reads. After optimisation, de novo assembly resulted in 44,407 contigs with a mean length of 437 bp, and the assembled transcripts were further functionally annotated to detect single nucleotide polymorphisms and simple sequence repeat motifs. Gene expression analysis was also used to compare expression patterns from ovary and testis tissue libraries to identify genes with potential roles in reproduction and sex differentiation. The large transcript set assembled here represents the most comprehensive set of transcriptomic resources ever developed for reproduction traits in M. rosenbergii, and the large number of genetic markers predicted should constitute an invaluable resource for future genetic research studies on M. rosenbergii and can be applied more widely on other freshwater prawn species in the genus Macrobrachium.

Optimizing Hybrid de Novo Transcriptome Assembly and Extending Genomic Resources for Giant Freshwater Prawns (Macrobrachium rosenbergii): The Identification of Genes and Markers Associated with Reproduction

PubMed Central

Jung, Hyungtaek; Yoon, Byung-Ha; Kim, Woo-Jin; Kim, Dong-Wook; Hurwood, David A.; Lyons, Russell E.; Salin, Krishna R.; Kim, Heui-Soo; Baek, Ilseon; Chand, Vincent; Mather, Peter B.

2016-01-01

The giant freshwater prawn, Macrobrachium rosenbergii, a sexually dimorphic decapod crustacean is currently the world’s most economically important cultured freshwater crustacean species. Despite its economic importance, there is currently a lack of genomic resources available for this species, and this has limited exploration of the molecular mechanisms that control the M. rosenbergii sex-differentiation system more widely in freshwater prawns. Here, we present the first hybrid transcriptome from M. rosenbergii applying RNA-Seq technologies directed at identifying genes that have potential functional roles in reproductive-related traits. A total of 13,733,210 combined raw reads (1720 Mbp) were obtained from Ion-Torrent PGM and 454 FLX. Bioinformatic analyses based on three state-of-the-art assemblers, the CLC Genomic Workbench, Trans-ABySS, and Trinity, that use single and multiple k-mer methods respectively, were used to analyse the data. The influence of multiple k-mers on assembly performance was assessed to gain insight into transcriptome assembly from short reads. After optimisation, de novo assembly resulted in 44,407 contigs with a mean length of 437 bp, and the assembled transcripts were further functionally annotated to detect single nucleotide polymorphisms and simple sequence repeat motifs. Gene expression analysis was also used to compare expression patterns from ovary and testis tissue libraries to identify genes with potential roles in reproduction and sex differentiation. The large transcript set assembled here represents the most comprehensive set of transcriptomic resources ever developed for reproduction traits in M. rosenbergii, and the large number of genetic markers predicted should constitute an invaluable resource for future genetic research studies on M. rosenbergii and can be applied more widely on other freshwater prawn species in the genus Macrobrachium. PMID:27164098

Etude critique de la prise en charge de 159 personnes âgées en consultation de psychiatrie

PubMed Central

Ben Thabet, Jihène; Ammar, Yousra; Charfi, Nada; Zouari, Lobna; Zouari, Nasreddine; Gaha, Lotfi; Maalej, Mohamed

2014-01-01

Introduction Le phénomène de vieillissement des populations est associé à une augmentation de la prévalence de la morbidité liée à l’âge. La prescription des psychotropes chez le sujet âgé est de plus en plus fréquente dans les institutions, les doses sont de plus en plus élevées, avec un recours fréquent à une poly pharmacothérapie. Nous nous sommes proposé de décrire les conduites thérapeutiques chez le sujet âgé consultant en psychiatrie, en vue de les confronter aux dernières recommandations en la matière. Méthodes L’étude était de type rétrospectif et descriptif. Elle a concerné les sujets âgés d'au moins 60 ans ayant consulté pour la première fois en psychiatrie, au CHU Hédi Chaker à Sfax, en 2010 ou 2011. Résultats Nous avons colligé 159 dossiers. L’âge moyen était de 73 ans. La démence et les troubles de l'humeur étaient les diagnostics les plus fréquents. Sur le plan thérapeutique, une poly thérapie faite d'au moins deux psychotropes de familles différentes a été prescrite pour 55,9%. Chez 60.3% des sujets, le traitement a été prescrit d'emblée à dose complète. Aucun dossier ne faisait état d'une prise en charge psychothérapeutique. Conclusion La prise en charge des malades de notre étude n’était pas conforme aux recommandations, notamment en matière d'association médicamenteuse, de progression des doses et d'association de la psychothérapie à la pharmacothérapie. L'information des médecins et leur sensibilisation aux particularités du sujet âgé contribuerait à optimiser les soins qui leur sont prodigués, y compris en psychiatrie. PMID:25120873

Using max entropy ratio of recurrence plot to measure electrocorticogram changes in epilepsy patients

NASA Astrophysics Data System (ADS)

Yan, Jiaqing; Wang, Yinghua; Ouyang, Gaoxiang; Yu, Tao; Li, Xiaoli

2016-02-01

A maximum entropy ratio (MER) method is firstly adapted to investigate the high-dimensional Electrocorticogram (ECoG) data from epilepsy patients. MER is a symbolic analysis approach for the detection of recurrence domains of complex dynamical systems from time series. Data were chosen from eight patients undergoing pre-surgical evaluation for drug-resistant temporal lobe epilepsy. MERs for interictal and ictal data were calculated and compared. A statistical test was performed to evaluate the ability of MER to separate the interictal state from the ictal state. MER showed significant changes from the interictal state into the ictal state, where MER was low at the ictal state and is significantly different with that at the interictal state. These suggest that MER is able to separate the ictal state from the interictal state based on ECoG data. It has the potential of detecting the transition between normal brain activity and the ictal state.

KENNEDY SPACE CENTER, FLA. - The overhead crane settles the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - The overhead crane settles the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

Les inconvénients de perdre du poids

PubMed Central

Bosomworth, N. John

2012-01-01

Résumé Objectif Explorer les raisons pour lesquelles la perte de poids à long terme échoue la plupart du temps et évaluer les conséquences de diverses trajectoires pondérales, y compris la stabilité, la perte et le gain. Source des données Les études qui évaluent les paramètres pondéraux dans la population sont en majorité observationnelles. Des données probantes de niveau I ont été publiées pour évaluer l’influence des interventions relatives au poids sur la mortalité et la qualité de vie. Message principal Seulement un petit pourcentage des personnes qui désirent perdre du poids réussissent à le faire de manière durable. La mortalité est la plus faible chez les personnes se situant dans la catégorie de poids élevé-normal et surpoids. La trajectoire pondérale la plus sécuritaire est la stabilité du poids avec une optimisation de la condition physique et métabolique. Il est démontré que la mortalité est plus faible chez les personnes ayant des comorbidités reliées à l’obésité si elles perdent du poids. Il est aussi établi que la qualité de vie sur le plan de la santé est meilleure chez les personnes obèses qui perdent du poids. Par contre, la perte de poids chez une personne obèse autrement en santé est associée à une mortalité accrue. Conclusion La perte de poids est recommandable seulement chez les personnes qui ont des comorbidités reliées à l’obésité. Les personnes obèses en santé qui veulent perdre du poids devraient être informées qu’il peut y avoir des risques à le faire. Une stratégie qui se traduit par un indice de masse corporelle stable avec une condition physique et métabolique optimisée, peu importe le poids, est l’option d’intervention la plus sécuritaire en ce qui concerne le poids.

Allostery and the dynamic oligomerization of porphobilinogen synthase

PubMed Central

Jaffe, Eileen K.; Lawrence, Sarah H.

2011-01-01

The structural basis for allosteric regulation of porphobilinogen synthase (PBGS) is modulation of a quaternary structure equilibrium between octamer and hexamer (via dimers), which is represented schematically as 8mer ⇔ 2mer ⇔ 2mer* ⇔ 6mer*. The “*” represents a reorientation between two domains of each subunit that occurs in the dissociated state because it is sterically forbidden in the larger multimers. Allosteric effectors of PBGS are both intrinsic and extrinsic and are phylogenetically variable. In some species this equilibrium is modulated intrinsically by magnesium which binds at a site specific to the 8mer. In other species this equilibrium is modulated intrinsically by pH; the guanidinium group of an arginine being spatially equivalent to the allosteric magnesium ion. In humans, disease associated variants all shift the equilibrium toward the 6mer* relative to wild type. The 6mer* has a surface cavity that is not present in the 8mer and is proposed as a small molecule allosteric binding site. In silico and in vitro approaches have revealed species-specific allosteric PBGS inhibitors that stabilize the 6mer*. Some of these inhibitors are drugs in clinical use leading to the hypothesis that extrinsic allosteric inhibition of human PBGS could be a mechanism for drug side effects. PMID:22037356

Deterministic and stochastic models for middle east respiratory syndrome (MERS)

NASA Astrophysics Data System (ADS)

Suryani, Dessy Rizki; Zevika, Mona; Nuraini, Nuning

2018-03-01

World Health Organization (WHO) data stated that since September 2012, there were 1,733 cases of Middle East Respiratory Syndrome (MERS) with 628 death cases that occurred in 27 countries. MERS was first identified in Saudi Arabia in 2012 and the largest cases of MERS outside Saudi Arabia occurred in South Korea in 2015. MERS is a disease that attacks the respiratory system caused by infection of MERS-CoV. MERS-CoV transmission occurs directly through direct contact between infected individual with non-infected individual or indirectly through contaminated object by the free virus. Suspected, MERS can spread quickly because of the free virus in environment. Mathematical modeling is used to illustrate the transmission of MERS disease using deterministic model and stochastic model. Deterministic model is used to investigate the temporal dynamic from the system to analyze the steady state condition. Stochastic model approach using Continuous Time Markov Chain (CTMC) is used to predict the future states by using random variables. From the models that were built, the threshold value for deterministic models and stochastic models obtained in the same form and the probability of disease extinction can be computed by stochastic model. Simulations for both models using several of different parameters are shown, and the probability of disease extinction will be compared with several initial conditions.

KENNEDY SPACE CENTER, FLA. - In the foreground, three solid rocket boosters (SRBs) suspended in the launch tower flank the Delta II rocket (in the background) that will launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the foreground, three solid rocket boosters (SRBs) suspended in the launch tower flank the Delta II rocket (in the background) that will launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Integration of a splicing regulatory network within the meiotic gene expression program of Saccharomyces cerevisiae

PubMed Central

Munding, Elizabeth M.; Igel, A. Haller; Shiue, Lily; Dorighi, Kristel M.; Treviño, Lisa R.; Ares, Manuel

2010-01-01

Splicing regulatory networks are essential components of eukaryotic gene expression programs, yet little is known about how they are integrated with transcriptional regulatory networks into coherent gene expression programs. Here we define the MER1 splicing regulatory network and examine its role in the gene expression program during meiosis in budding yeast. Mer1p splicing factor promotes splicing of just four pre-mRNAs. All four Mer1p-responsive genes also require Nam8p for splicing activation by Mer1p; however, other genes require Nam8p but not Mer1p, exposing an overlapping meiotic splicing network controlled by Nam8p. MER1 mRNA and three of the four Mer1p substrate pre-mRNAs are induced by the transcriptional regulator Ume6p. This unusual arrangement delays expression of Mer1p-responsive genes relative to other genes under Ume6p control. Products of Mer1p-responsive genes are required for initiating and completing recombination and for activation of Ndt80p, the activator of the transcriptional network required for subsequent steps in the program. Thus, the MER1 splicing regulatory network mediates the dependent relationship between the UME6 and NDT80 transcriptional regulatory networks in the meiotic gene expression program. This study reveals how splicing regulatory networks can be interlaced with transcriptional regulatory networks in eukaryotic gene expression programs. PMID:21123654

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Bagci, Ulas; Center for Research in Computer Vision

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10{sup 6} PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a humanmore » anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. - Highlights: • MERS-CoV Jordan-n3/2012 challenge of rhesus monkeys results in a mild disease. • CT can be used to monitor disease progression to aid models of human disease. • Treatment with the human monoclonal antibody 3B11-N resulted in decreased disease.« less

The receptor tyrosine kinase MerTK activates phospholipase C γ2 during recognition of apoptotic thymocytes by murine macrophages

PubMed Central

Todt, Jill C.; Hu, Bin; Curtis, Jeffrey L.

2008-01-01

Apoptotic leukocytes must be cleared efficiently by macrophages (Mø). Apoptotic cell phagocytosis by Mø requires the receptor tyrosine kinase (RTK) MerTK (also known as c-Mer and Tyro12), the phosphatidylserine receptor (PS-R), and the classical protein kinase C (PKC) isoform βII, which translocates to Mø membrane and cytoskeletal fractions in a PS-R-dependent fashion. How these molecules cooperate to induce phagocytosis is unknown. Because the phosphatidylinositol-specific phospholipase (PI-PLC) PLC γ2 is downstream of RTKs in some cell types and can activate classical PKCs, we hypothesized that MerTK signals via PLC γ2. To test this hypothesis, we examined the interaction of MerTK and PLC γ2 in resident murine PMø and in the murine Mø cell line J774A.1 (J774) following exposure to apoptotic thymocytes. We found that, as with PMø, J774 phagocytosis of apoptotic thymocytes was inhibited by antibody against MerTK. Western blotting and immunoprecipitation showed that exposure to apoptotic cells produced three time-dependent changes in PMø and J774: (1) tyrosine phosphorylation of MerTK; (2) association of PLC γ2 with MerTK; and (3) tyrosine phosphorylation of PLC γ2. Phosphorylation of PLC γ2 and its association with MerTK was also induced by cross-linking MerTK using antibody. A PI-PLC appears to be required for phagocytosis of apoptotic cells because the PI-PLC inhibitor Et-18-OCH3 and the PLC inhibitor U73122, but not the inactive control U73343, blocked phagocytosis without impairing adhesion. On apoptotic cell adhesion to Mø, MerTK signals at least in part via PLC γ2. PMID:14704368

Environmental Conditions Constrain the Distribution and Diversity of Archaeal merA in Yellowstone National Park, Wyoming, U.S.A.

USGS Publications Warehouse

Wang, Y.; Boyd, E.; Crane, S.; Lu-Irving, P.; Krabbenhoft, D.; King, S.; Dighton, J.; Geesey, G.; Barkay, T.

2011-01-01

The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient. ?? 2011 Springer Science+Business Media, LLC.

Environmental conditions constrain the distribution and diversity of archaeal merA in Yellowstone National Park, Wyoming, U.S.A.

PubMed

Wang, Yanping; Boyd, Eric; Crane, Sharron; Lu-Irving, Patricia; Krabbenhoft, David; King, Susan; Dighton, John; Geesey, Gill; Barkay, Tamar

2011-11-01

The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient.

3-O sulfation of heparin leads to hepatotropism and longer circulatory half-life.

PubMed

Miller, Colton M; Xu, Yongmei; Kudrna, Katrina M; Hass, Blake E; Kellar, Brianna M; Egger, Andrew W; Liu, Jian; Harris, Edward N

2018-05-17

Heparins are common blood anticoagulants that are critical for many surgical and biomedical procedures used in modern medicine. In contrast to natural heparin derived from porcine gut mucosa, synthetic heparins are homogenous by mass, polymer length, and chemistry. Stable cell lines expressing the human and mouse Stabilin receptors were used to evaluate endocytosis of natural and synthetic heparin. We chemoenzymatically produced synthetic heparin consisting of 12 sugars (dodecamers) containing 14 sulfate groups resulting in a non-3-O sulfated structure (n12mer). Half of the n12mer was modified with a 3-O sulfate on a single GlcNS sugar producing the 3-O sulfated heparin (12mer). Wildtype (WT), Stabilin-1 knock-out (KO), and Stabilin-2 KO C57BL/6 mice were developed and used for metabolic studies and provided as a source for primary liver sinusoidal endothelial cells. Human and mouse Stabilin-2 receptors had very similar endocytosis rates of both the 12mer and n12mer, suggesting that they are functionally similar in primary cells. Subcutaneous injections of the n12mer and 12mer revealed that the 12mer had a much longer half-life in circulation and a higher accumulation in liver. The n12mer never accumulated in circulation and was readily excreted by the kidneys before liver accumulation could occur. Liver sinusoidal endothelial cells from the Stabilin-2 KO mice had lower uptake rates for both dodecamers, whereas, the Stabilin-1 KO mice had lower endocytosis rates for the 12mer than the n12mer. 3-O sulfation of heparin is correlated to both a longer circulatory half-life and hepatotropism which is largely performed by the Stabilin receptors. Copyright © 2018 Elsevier Ltd. All rights reserved.

Comparing fixed sampling with minimizer sampling when using k-mer indexes to find maximal exact matches.

PubMed

Almutairy, Meznah; Torng, Eric

2018-01-01

Bioinformatics applications and pipelines increasingly use k-mer indexes to search for similar sequences. The major problem with k-mer indexes is that they require lots of memory. Sampling is often used to reduce index size and query time. Most applications use one of two major types of sampling: fixed sampling and minimizer sampling. It is well known that fixed sampling will produce a smaller index, typically by roughly a factor of two, whereas it is generally assumed that minimizer sampling will produce faster query times since query k-mers can also be sampled. However, no direct comparison of fixed and minimizer sampling has been performed to verify these assumptions. We systematically compare fixed and minimizer sampling using the human genome as our database. We use the resulting k-mer indexes for fixed sampling and minimizer sampling to find all maximal exact matches between our database, the human genome, and three separate query sets, the mouse genome, the chimp genome, and an NGS data set. We reach the following conclusions. First, using larger k-mers reduces query time for both fixed sampling and minimizer sampling at a cost of requiring more space. If we use the same k-mer size for both methods, fixed sampling requires typically half as much space whereas minimizer sampling processes queries only slightly faster. If we are allowed to use any k-mer size for each method, then we can choose a k-mer size such that fixed sampling both uses less space and processes queries faster than minimizer sampling. The reason is that although minimizer sampling is able to sample query k-mers, the number of shared k-mer occurrences that must be processed is much larger for minimizer sampling than fixed sampling. In conclusion, we argue that for any application where each shared k-mer occurrence must be processed, fixed sampling is the right sampling method.

Comparing fixed sampling with minimizer sampling when using k-mer indexes to find maximal exact matches

PubMed Central

Torng, Eric

2018-01-01

Bioinformatics applications and pipelines increasingly use k-mer indexes to search for similar sequences. The major problem with k-mer indexes is that they require lots of memory. Sampling is often used to reduce index size and query time. Most applications use one of two major types of sampling: fixed sampling and minimizer sampling. It is well known that fixed sampling will produce a smaller index, typically by roughly a factor of two, whereas it is generally assumed that minimizer sampling will produce faster query times since query k-mers can also be sampled. However, no direct comparison of fixed and minimizer sampling has been performed to verify these assumptions. We systematically compare fixed and minimizer sampling using the human genome as our database. We use the resulting k-mer indexes for fixed sampling and minimizer sampling to find all maximal exact matches between our database, the human genome, and three separate query sets, the mouse genome, the chimp genome, and an NGS data set. We reach the following conclusions. First, using larger k-mers reduces query time for both fixed sampling and minimizer sampling at a cost of requiring more space. If we use the same k-mer size for both methods, fixed sampling requires typically half as much space whereas minimizer sampling processes queries only slightly faster. If we are allowed to use any k-mer size for each method, then we can choose a k-mer size such that fixed sampling both uses less space and processes queries faster than minimizer sampling. The reason is that although minimizer sampling is able to sample query k-mers, the number of shared k-mer occurrences that must be processed is much larger for minimizer sampling than fixed sampling. In conclusion, we argue that for any application where each shared k-mer occurrence must be processed, fixed sampling is the right sampling method. PMID:29389989

Sulforaphane rescues amyloid-β peptide-mediated decrease in MerTK expression through its anti-inflammatory effect in human THP-1 macrophages.

PubMed

Jhang, Kyoung A; Park, Jin-Sun; Kim, Hee-Sun; Chong, Young Hae

2018-03-12

Mer tyrosine kinase (MerTK) activity necessary for amyloid-stimulated phagocytosis strongly implicates that MerTK dysregulation might contribute to chronic inflammation implicated in Alzheimer's disease (AD) pathology. However, the precise mechanism involved in the regulation of MerTK expression by amyloid-β (Aβ) in proinflammatory environment has not yet been ascertained. The objective of this study was to determine the underlying mechanism involved in Aβ-mediated decrease in MerTK expression through Aβ-mediated regulation of MerTK expression and its modulation by sulforaphane in human THP-1 macrophages challenged with Aβ1-42. We used protein preparation, Ca 2+ influx fluorescence imaging, nuclear fractionation, Western blotting techniques, and small interfering RNA (siRNA) knockdown to perform our study. Aβ1-42 elicited a marked decrease in MerTK expression along with increased intracellular Ca 2+ level and induction of proinflammatory cytokines such as IL-1β and TNF-α. Ionomycin A and thapsigargin also increased intracellular Ca 2+ levels and production of IL-1β and TNF-α, mimicking the effect of Aβ1-42. In contrast, the Aβ1-42-evoked responses were attenuated by depletion of Ca 2+ with ethylene glycol tetraacetic acid. Furthermore, recombinant IL-1β or TNF-α elicited a decrease in MerTK expression. However, immunodepletion of IL-1β or TNF-α with neutralizing antibodies significantly inhibited Aβ1-42-mediated downregulation of MerTK expression. Notably, sulforaphane treatment potently inhibited Aβ1-42-induced intracellular Ca 2+ level and rescued the decrease in MerTK expression by blocking nuclear factor-κB (NF-κB) nuclear translocation, thereby decreasing IL-1β and TNF-α production upon Aβ1-42 stimulation. Such adverse effects of sulforaphane were replicated by BAY 11-7082, a NF-κB inhibitor. Moreover, sulforaphane's anti-inflammatory effects on Aβ1-42-induced production of IL-1β and TNF-α were significantly diminished by siRNA-mediated knockdown of MerTK, confirming a critical role of MerTK in suppressing Aβ1-42-induced innate immune response. These findings implicate that targeting of MerTK with phytochemical sulforaphane as a mechanism for preventing Aβ1-42-induced neuroinflammation has potential to be applied in AD therapeutics.

Characterization and Demonstration of the Value of a Lethal Mouse Model of Middle East Respiratory Syndrome Coronavirus Infection and Disease.

PubMed

Tao, Xinrong; Garron, Tania; Agrawal, Anurodh Shankar; Algaissi, Abdullah; Peng, Bi-Hung; Wakamiya, Maki; Chan, Teh-Sheng; Lu, Lu; Du, Lanying; Jiang, Shibo; Couch, Robert B; Tseng, Chien-Te K

2016-01-01

Characterized animal models are needed for studying the pathogenesis of and evaluating medical countermeasures for persisting Middle East respiratory syndrome-coronavirus (MERS-CoV) infections. Here, we further characterized a lethal transgenic mouse model of MERS-CoV infection and disease that globally expresses human CD26 (hCD26)/DPP4. The 50% infectious dose (ID50) and lethal dose (LD50) of virus were estimated to be <1 and 10 TCID50 of MERS-CoV, respectively. Neutralizing antibody developed in the surviving mice from the ID50/LD50 determinations, and all were fully immune to challenge with 100 LD50 of MERS-CoV. The tissue distribution and histopathology in mice challenged with a potential working dose of 10 LD50 of MERS-CoV were subsequently evaluated. In contrast to the overwhelming infection seen in the mice challenged with 10(5) LD50 of MERS-CoV, we were able to recover infectious virus from these mice only infrequently, although quantitative reverse transcription-PCR (qRT-PCR) tests indicated early and persistent lung infection and delayed occurrence of brain infection. Persistent inflammatory infiltrates were seen in the lungs and brain stems at day 2 and day 6 after infection, respectively. While focal infiltrates were also noted in the liver, definite pathology was not seen in other tissues. Finally, using a receptor binding domain protein vaccine and a MERS-CoV fusion inhibitor, we demonstrated the value of this model for evaluating vaccines and antivirals against MERS. As outcomes of MERS-CoV infection in patients differ greatly, ranging from asymptomatic to overwhelming disease and death, having available both an infection model and a lethal model makes this transgenic mouse model relevant for advancing MERS research. Fully characterized animal models are essential for studying pathogenesis and for preclinical screening of vaccines and drugs against MERS-CoV infection and disease. When given a high dose of MERS-CoV, our transgenic mice expressing hCD26/DPP4 viral receptor uniformly succumbed to death within 6 days, making it difficult to evaluate host responses to infection and disease. We further characterized this model by determining both the ID50 and the LD50 of MERS-CoV in order to establish both an infection model and a lethal model for MERS and followed this by investigating the antibody responses and immunity of the mice that survived MERS-CoV infection. Using the estimated LD50 and ID50 data, we dissected the kinetics of viral tissue distribution and pathology in mice challenged with 10 LD50 of virus and utilized the model for preclinical evaluation of a vaccine and drug for treatment of MERS-CoV infection. This further-characterized transgenic mouse model will be useful for advancing MERS research. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

MerCat: a versatile k-mer counter and diversity estimator for database-independent property analysis obtained from metagenomic and/or metatranscriptomic sequencing data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Richard A.; Panyala, Ajay R.; Glass, Kevin A.

MerCat is a parallel, highly scalable and modular property software package for robust analysis of features in next-generation sequencing data. MerCat inputs include assembled contigs and raw sequence reads from any platform resulting in feature abundance counts tables. MerCat allows for direct analysis of data properties without reference sequence database dependency commonly used by search tools such as BLAST and/or DIAMOND for compositional analysis of whole community shotgun sequencing (e.g. metagenomes and metatranscriptomes).

Sparse evidence of MERS-CoV infection among animal workers living in Southern Saudi Arabia during 2012

PubMed Central

Memish, Ziad A; Alsahly, Ahmad; Masri, Malak al; Heil, Gary L; Anderson, Benjamin D; Peiris, Malik; Khan, Salah Uddin; Gray, Gregory C

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging viral pathogen that primarily causes respiratory illness. We conducted a seroprevalence study of banked human serum samples collected in 2012 from Southern Saudi Arabia. Sera from 300 animal workers (17% with daily camel exposure) and 50 non-animal-exposed controls were examined for serological evidence of MERS-CoV infection by a pseudoparticle MERS-CoV spike protein neutralization assay. None of the sera reproducibly neutralized the MERS-CoV-pseudotyped lentiviral vector. These data suggest that serological evidence of zoonotic transmission of MERS-CoV was not common among animal workers in Southern Saudi Arabia during July 2012. PMID:25470665

Double protection passive pour les equipages de l’helicoptere d’attaque Tigre : Concept et etude experimentale (Design and Experimental Study of the Passive Double Hearing Protection for the Crew of the Attack Helicopter Tiger)

DTIC Science & Technology

2005-04-01

alain.leger@fr.thalesgroup.com THALES Aerospace Rue Toussaint Catros 33187 Le Haillan FRANCE RESUME Les coques des écouteurs du casque Topowl ont...déjà fait l’objet d’une étude visant à optimiser leur protection auditive dans les stricts budgets de masse et de volume impartis. La présente...techniques audio (p. 17-1 – 17-14). Compte rendu de réunion RTO-MP-HFM-123, Communication 17. Neuilly-sur-Seine, France : RTO. Disponible sur le site

Expert Opinion: Optimising Stent Deployment in Contemporary Practice: The Role of Intracoronary Imaging and Non-compliant Balloons.

PubMed

Seth, Ashok; Gupta, Sajal; Pratap Singh, Vivudh; Kumar, Vijay

2017-09-01

Final stent dimensions remain an important predictor of restenosis, target vessel revascularisation (TVR) and subacute stent thrombosis (ST), even in the drug-eluting stent (DES) era. Stent balloons are usually semi-compliant and thus even high-pressure inflation may not achieve uniform or optimal stent expansion. Post-dilatation with non-compliant (NC) balloons after stent deployment has been shown to enhance stent expansion and could reduce TVR and ST. Based on supporting evidence and in the absence of large prospective randomised outcome-based trials, post-dilatation with an NC balloon to achieve optimal stent expansion and maximal luminal area is a logical technical recommendation, particularly in complex lesion subsets.

Reticulation des fibres lignocellulosiques

NASA Astrophysics Data System (ADS)

Landrevy, Christel

Pour faire face à la crise économique la conception de papier à valeur ajoutée est développée par les industries papetières. Le but de se projet est l'amélioration des techniques actuelles de réticulation des fibres lignocellulosiques de la pâte à papier visant à produire un papier plus résistant. En effet, lors des réactions de réticulation traditionnelles, de nombreuses liaisons intra-fibres se forment ce qui affecte négativement l'amélioration anticipée des propriétés physiques du papier ou du matériau produit. Pour éviter la formation de ces liaisons intra-fibres, un greffage sur les fibres de groupements ne pouvant pas réagir entre eux est nécessaire. La réticulation des fibres par une réaction de « click chemistry » appelée cycloaddition de Huisgen entre un azide et un alcyne vrai, catalysée par du cuivre (CuAAC) a été l'une des solutions trouvée pour remédier à ce problème. De plus, une adaptation de cette réaction en milieux aqueux pourrait favoriser son utilisation en milieu industriel. L'étude que nous désirons entreprendre lors de ce projet vise à optimiser la réaction de CuAAC et les réactions intermédiaires (propargylation, tosylation et azidation) sur la pâte kraft, en milieu aqueux. Pour cela, les réactions ont été adaptées en milieu aqueux sur la cellulose microcristalline afin de vérifier sa faisabilité, puis transférée à la pâte kraft et l'influence de différents paramètres comme le temps de réaction ou la quantité de réactifs utilisée a été étudiée. Dans un second temps, une étude des différentes propriétés conférées au papier par les réactions a été réalisée à partir d'une série de tests papetiers optiques et physiques. Mots Clés Click chemistry, Huisgen, CuAAC, propargylation, tosylation, azidation, cellulose, pâte kraft, milieu aqueux, papier.

Assessment of the risk posed to Singapore by the 2015 Middle East respiratory syndrome outbreak in the Republic of Korea

PubMed Central

Zhang, Emma Xuxiao; Oh, Olivia Seen Huey; See, Wanhan; Raj, Pream; James, Lyn; Khan, Kamran

2016-01-01

Objective To assess the public health risk to Singapore posed by the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea in 2015. Methods The likelihood of importation of MERS cases and the magnitude of the public health impact in Singapore were assessed to determine overall risk. Literature on the epidemiology and contextual factors associated with MERS coronavirus infection was collected and reviewed. Connectivity between the Republic of Korea and Singapore was analysed. Public health measures implemented by the two countries were reviewed. Results The epidemiology of the 2015 MERS outbreak in the Republic of Korea remained similar to the MERS outbreaks in Saudi Arabia. In addition, strong infection control and response measures were effective in controlling the outbreak. In view of the air traffic between Singapore and MERS-affected areas, importation of MERS cases into Singapore is possible. Nonetheless, the risk of a serious public health impact to Singapore in the event of an imported case of MERS would be mitigated by its strong health-care system and established infection control practices. Discussion The MERS outbreak was sparked by an exported case from the Middle East, which remains a concern as the reservoir of infection (thought to be camels) continues to exist in the Middle East, and sporadic cases in the community and outbreaks in health-care settings continue to occur there. This risk assessment highlights the need for Singapore to stay vigilant and to continue enhancing core public health capacities to detect and respond to MERS coronavirus. PMID:27508087

Assessment of the risk posed to Singapore by the 2015 Middle East respiratory syndrome outbreak in the Republic of Korea.

PubMed

Zhang, Emma Xuxiao; Oh, Olivia Seen Huey; See, Wanhan; Raj, Pream; James, Lyn; Khan, Kamran; Tey, Jeannie Su Hui

2016-01-01

To assess the public health risk to Singapore posed by the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea in 2015. The likelihood of importation of MERS cases and the magnitude of the public health impact in Singapore were assessed to determine overall risk. Literature on the epidemiology and contextual factors associated with MERS coronavirus infection was collected and reviewed. Connectivity between the Republic of Korea and Singapore was analysed. Public health measures implemented by the two countries were reviewed. The epidemiology of the 2015 MERS outbreak in the Republic of Korea remained similar to the MERS outbreaks in Saudi Arabia. In addition, strong infection control and response measures were effective in controlling the outbreak. In view of the air traffic between Singapore and MERS-affected areas, importation of MERS cases into Singapore is possible. Nonetheless, the risk of a serious public health impact to Singapore in the event of an imported case of MERS would be mitigated by its strong health-care system and established infection control practices. The MERS outbreak was sparked by an exported case from the Middle East, which remains a concern as the reservoir of infection (thought to be camels) continues to exist in the Middle East, and sporadic cases in the community and outbreaks in health-care settings continue to occur there. This risk assessment highlights the need for Singapore to stay vigilant and to continue enhancing core public health capacities to detect and respond to MERS coronavirus.

Characterization of novel monoclonal antibodies against the MERS-coronavirus spike protein and their application in species-independent antibody detection by competitive ELISA.

PubMed

Fukushi, Shuetsu; Fukuma, Aiko; Kurosu, Takeshi; Watanabe, Shumpei; Shimojima, Masayuki; Shirato, Kazuya; Iwata-Yoshikawa, Naoko; Nagata, Noriyo; Ohnishi, Kazuo; Ato, Manabu; Melaku, Simenew Keskes; Sentsui, Hiroshi; Saijo, Masayuki

2018-01-01

Since discovering the Middle East respiratory syndrome coronavirus (MERS-CoV) as a causative agent of severe respiratory illness in the Middle East in 2012, serological testing has been conducted to assess antibody responses in patients and to investigate the zoonotic reservoir of the virus. Although the virus neutralization test is the gold standard assay for MERS diagnosis and for investigating the zoonotic reservoir, it uses live virus and so must be performed in high containment laboratories. Competitive ELISA (cELISA), in which a labeled monoclonal antibody (MAb) competes with test serum antibodies for target epitopes, may be a suitable alternative because it detects antibodies in a species-independent manner. In this study, novel MAbs against the spike protein of MERS-CoV were produced and characterized. One of these MAbs was used to develop a cELISA. The cELISA detected MERS-CoV-specific antibodies in sera from MERS-CoV-infected rats and rabbits immunized with the spike protein of MERS-CoV. The MAb-based cELISA was validated using sera from Ethiopian dromedary camels. Relative to the neutralization test, the cELISA detected MERS-CoV-specific antibodies in 66 Ethiopian dromedary camels with a sensitivity and specificity of 98% and 100%, respectively. The cELISA and neutralization test results correlated well (Pearson's correlation coefficients=0.71-0.76, depending on the cELISA serum dilution). This cELISA may be useful for MERS epidemiological investigations on MERS-CoV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

Restructuring the vocal fold lamina propria with endoscopic microdissection.

PubMed

Bartlett, Rebecca S; Hoffman, Henry T; Dailey, Seth H; Bock, Jonathan M; Klemuk, Sarah A; Askeland, Ryan W; Ahlrichs-Hanson, Jan S; Heaford, Andrew C; Thibeault, Susan L

2013-11-01

The purposes of this preclinical study were to investigate histologic and rheologic outcomes of Microendoscopy of Reinke's space (MERS)-guided minithyrotomy and to assess its instrumentation. Human cadaveric and in vivo animal study. Three human cadaveric larynges were treated with MERS-guided placement of Radiesse VoiceGel and immediately evaluated histologically for biomaterial location. In the second part of this investigation, two scarred porcine larynges were treated with MERS-guided placement of HyStem-VF and rheologically evaluated 6 weeks later. Student t tests determined differences in viscoelastic properties of treated/untreated vocal folds. Sialendoscopes and microendoscopes were subjectively compared for their visualization capacity. MERS imaged the subepithelial area and vocal ligament, guiding both tissue dissection and biomaterial positioning. Sialendoscopes provided adequate visualization and feature incorporated working channels. Enhanced image clarity was created in a gas-filled rather than saline-filled environment, per rater judgment. Histological analysis revealed desirable biomaterial positioning with MERS. Per rheological analysis, viscoelastic properties of the MERS-treated porcine vocal folds compared to uninjured vocal folds 6 weeks following treatment did not statistically differ. MERS-guided laryngoplasty using sialendoscopes yielded satisfactory biomaterial positioning in the short-term and normalized rheologic tissue properties in the long-term, contributing to proof of concept for MERS in the treatment of scarring. Strengths of MERS include direct, real-time visualization of Reinke's space and an ability to manipulate surgical instruments parallel to the vocal fold edge while maintaining an intact epithelium. Future work will explore the clinical utility of MERS for addressing scarring, sulcus vocalis, and other intracordal processes. Copyright © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors

PubMed Central

Linger, Rachel M.A.; Keating, Amy K.; Earp, H. Shelton

2010-01-01

Importance of the field Axl and/or Mer expression correlates with poor prognosis in several cancers. Until recently, the specific role of these receptor tyrosine kinases (RTKs) in the development and progression of cancer remained unexplained. Studies demonstrating that Axl and Mer contribute to mechanisms of cell survival, migration, invasion, metastasis, and chemosensitivity justify further investigation of Axl and Mer as novel therapeutic targets in cancer. Areas covered in this review Axl and Mer signaling pathways in cancer cells are summarized and evidence validating these RTKs as therapeutic targets in glioblastoma multiforme, non-small cell lung cancer, and breast cancer is examined. A comprehensive discussion of Axl and/or Mer inhibitors in development is also provided. What the reader will gain Potential toxicities associated with Axl or Mer inhibition are addressed. We hypothesize that the probable action of Mer and Axl inhibitors on cells within the tumor microenvironment will provide a unique therapeutic opportunity to target both tumor cells and the stromal components which facilitate disease progression. Take home message Axl and Mer mediate multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Targeted inhibition of these RTKs may be effective as anti-tumor and/or anti-metastatic therapy, particularly if combined with standard cytotoxic therapies. PMID:20809868

Pedagogical Affordances of Multiple External Representations in Scientific Processes

NASA Astrophysics Data System (ADS)

Wu, Hsin-Kai; Puntambekar, Sadhana

2012-12-01

Multiple external representations (MERs) have been widely used in science teaching and learning. Theories such as dual coding theory and cognitive flexibility theory have been developed to explain why the use of MERs is beneficial to learning, but they do not provide much information on pedagogical issues such as how and in what conditions MERs could be introduced and used to support students' engagement in scientific processes and develop competent scientific practices (e.g., asking questions, planning investigations, and analyzing data). Additionally, little is understood about complex interactions among scientific processes and affordances of MERs. Therefore, this article focuses on pedagogical affordances of MERs in learning environments that engage students in various scientific processes. By reviewing literature in science education and cognitive psychology and integrating multiple perspectives, this article aims at exploring (1) how MERs can be integrated with science processes due to their different affordances, and (2) how student learning with MERs can be scaffolded, especially in a classroom situation. We argue that pairing representations and scientific processes in a principled way based on the affordances of the representations and the goals of the activities is a powerful way to use MERs in science education. Finally, we outline types of scaffolding that could help effective use of MERs including dynamic linking, model progression, support in instructional materials, teacher support, and active engagement.

Kmerind: A Flexible Parallel Library for K-mer Indexing of Biological Sequences on Distributed Memory Systems.

PubMed

Pan, Tony; Flick, Patrick; Jain, Chirag; Liu, Yongchao; Aluru, Srinivas

2017-10-09

Counting and indexing fixed length substrings, or k-mers, in biological sequences is a key step in many bioinformatics tasks including genome alignment and mapping, genome assembly, and error correction. While advances in next generation sequencing technologies have dramatically reduced the cost and improved latency and throughput, few bioinformatics tools can efficiently process the datasets at the current generation rate of 1.8 terabases every 3 days. We present Kmerind, a high performance parallel k-mer indexing library for distributed memory environments. The Kmerind library provides a set of simple and consistent APIs with sequential semantics and parallel implementations that are designed to be flexible and extensible. Kmerind's k-mer counter performs similarly or better than the best existing k-mer counting tools even on shared memory systems. In a distributed memory environment, Kmerind counts k-mers in a 120 GB sequence read dataset in less than 13 seconds on 1024 Xeon CPU cores, and fully indexes their positions in approximately 17 seconds. Querying for 1% of the k-mers in these indices can be completed in 0.23 seconds and 28 seconds, respectively. Kmerind is the first k-mer indexing library for distributed memory environments, and the first extensible library for general k-mer indexing and counting. Kmerind is available at https://github.com/ParBLiSS/kmerind.

Mercuric ion reduction and resistance in transgenic Arabidopsis thaliana plants expressing a modified bacterial merA gene.

PubMed Central

Rugh, C L; Wilde, H D; Stack, N M; Thompson, D M; Summers, A O; Meagher, R B

1996-01-01

With global heavy metal contamination increasing, plants that can process heavy metals might provide efficient and ecologically sound approaches to sequestration and removal. Mercuric ion reductase, MerA, converts toxic Hg2+ to the less toxic, relatively inert metallic mercury (Hg0) The bacterial merA sequence is rich in CpG dinucleotides and has a highly skewed codon usage, both of which are particularly unfavorable to efficient expression in plants. We constructed a mutagenized merA sequence, merApe9, modifying the flanking region and 9% of the coding region and placing this sequence under control of plant regulatory elements. Transgenic Arabidopsis thaliana seeds expressing merApe9 germinated, and these seedlings grew, flowered, and set seed on medium containing HgCl2 concentrations of 25-100 microM (5-20 ppm), levels toxic to several controls. Transgenic merApe9 seedlings evolved considerable amounts of Hg0 relative to control plants. The rate of mercury evolution and the level of resistance were proportional to the steady-state mRNA level, confirming that resistance was due to expression of the MerApe9 enzyme. Plants and bacteria expressing merApe9 were also resistant to toxic levels of Au3+. These and other data suggest that there are potentially viable molecular genetic approaches to the phytoremediation of metal ion pollution. Images Fig. 2 Fig. 3 Fig. 4 PMID:8622910

Middle East Respiratory Syndrome (MERS)

MedlinePlus

Middle East Respiratory Syndrome Coronavirus; MERS-CoV; Novel coronavirus; nCoV ... for Disease Control and Prevention website. Middle East Respiratory Syndrome (MERS): Frequently asked questions and answers. www. ...

Deciphering MERS-CoV Evolution in Dromedary Camels.

PubMed

Du, Lin; Han, Guan-Zhu

2016-02-01

The emergence of the Middle East respiratory syndrome coronavirus (MERS-CoV) poses a potential threat to global public health. Many aspects of the evolution and transmission of MERS-CoV in its animal reservoir remain unclear. A recent study provides new insights into the evolution and transmission of MERS-CoV in dromedary camels. Copyright © 2015 Elsevier Ltd. All rights reserved.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

KENNEDY SPACE CENTER, FLA. - An overhead crane lifts the Mars Exploration Rover 2 (MER-2) entry vehicle from its stand to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane lifts the Mars Exploration Rover 2 (MER-2) entry vehicle from its stand to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - With help from workers, the overhead crane lowers the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - With help from workers, the overhead crane lowers the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - An overhead crane moves the Mars Exploration Rover 2 (MER-2) entry vehicle across the Payload Hazardous Servicing Facility toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane moves the Mars Exploration Rover 2 (MER-2) entry vehicle across the Payload Hazardous Servicing Facility toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility help guide the Mars Exploration Rover 2 (MER-2) entry vehicle toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility help guide the Mars Exploration Rover 2 (MER-2) entry vehicle toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - An overhead crane is in place to lift the Mars Exploration Rover 2 (MER-2) entry vehicle to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane is in place to lift the Mars Exploration Rover 2 (MER-2) entry vehicle to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

The LIA history of the "Glacier des Bossons" (Mont Blanc area, France): a new high-resolution glacier length curve based on historical documents

NASA Astrophysics Data System (ADS)

Nussbaumer, Samuel U.; Zumbühl, Heinz J.

2010-05-01

Historical and proxy-records have documented a partly asynchronous evolution in temperature, precipitation and glacial variations between European regions during the Little Ice Age (LIA), and the causes of these temporal anomalies are yet being poorly understood. To address this question, highly resolved glacier reconstructions going far back in time based on historical documents (for the last 500 years) or on dendrochronological and radiocarbon dating (for the Holocene) are very important as they give valuable insights in past climate. However, such reconstructions exist only for few glaciers worldwide, depending on the public perception and the accessibility of the corresponding glacier and its surrounding area. One of these regions of interest is the well-documented Mont Blanc area. Here, we present a new high-resolution reconstruction of length changes for the "Glacier des Bossons", situated in the French part of the Mont Blanc area. This reconstruction is based on historical material newly discovered, that has not been evaluated so far for glacier reconstructions. More than 200, often unpublished, artworks (paintings, drawings, prints), photographs, maps and written accounts have been critically analysed and give an univocal picture of the glacier's history. Especially noteworthy are the drawings by Jean-Antoine Linck, Samuel Birmann and Eugène Viollet-le-Duc which depict meticulously the glacier's extent during the vast advance and subsequent retreat during the 19th century. The new reconstruction dates back to AD 1580. Maxima of the "Glacier des Bossons" are proved around 1610/1643, 1685, 1712, 1780, 1818, 1854, 1892, 1921, 1941, and 1983. The LIA maximum extent was reached in 1818. Until the present, the glacier has lost about 1.5 kilometres in length, and it is nowadays shorter than at any time during the reconstruction period. The length curve of the "Glacier des Bossons" is finally analysed regarding climate data and also compared with the nearby "Mer de Glace" (glacier reconstruction back to AD 1570 available) and the two Grindelwald glaciers in the Swiss Alps (reconstructions existing back to AD 1535, and 1590, respectively). These two regions are likely the best-documented areas regarding historical glacier data.

Development of Animal Models Against Emerging Coronaviruses: From SARS to MERS coronavirus

PubMed Central

Sutton, Troy C; Subbarao, Kanta

2016-01-01

Two novel coronaviruses have emerged to cause severe disease in humans. While bats may be the primary reservoir for both viruses, SARS coronavirus (SARS-CoV) likely crossed into humans from civets in China, and MERS coronavirus (MERS-CoV) has been transmitted from camels in the Middle East. Unlike SARS-CoV that resolved within a year, continued introductions of MERS-CoV present an on-going public health threat. Animal models are needed to evaluate countermeasures against emerging viruses. With SARS-CoV, several animal species were permissive to infection. In contrast, most laboratory animals are refractory or only semi-permissive to infection with MERS-CoV. This host-range restriction is largely determined by sequence heterogeneity in the MERS-CoV receptor. We describe animal models developed to study coronaviruses, with a focus on host-range restriction at the level of the viral receptor and discuss approaches to consider in developing a model to evaluate countermeasures against MERS-CoV. PMID:25791336

Development of animal models against emerging coronaviruses: From SARS to MERS coronavirus.

PubMed

Sutton, Troy C; Subbarao, Kanta

2015-05-01

Two novel coronaviruses have emerged to cause severe disease in humans. While bats may be the primary reservoir for both viruses, SARS coronavirus (SARS-CoV) likely crossed into humans from civets in China, and MERS coronavirus (MERS-CoV) has been transmitted from camels in the Middle East. Unlike SARS-CoV that resolved within a year, continued introductions of MERS-CoV present an on-going public health threat. Animal models are needed to evaluate countermeasures against emerging viruses. With SARS-CoV, several animal species were permissive to infection. In contrast, most laboratory animals are refractory or only semi-permissive to infection with MERS-CoV. This host-range restriction is largely determined by sequence heterogeneity in the MERS-CoV receptor. We describe animal models developed to study coronaviruses, with a focus on host-range restriction at the level of the viral receptor and discuss approaches to consider in developing a model to evaluate countermeasures against MERS-CoV. Copyright © 2015. Published by Elsevier Inc.

Antibodies against MERS coronavirus in dromedary camels, United Arab Emirates, 2003 and 2013.

PubMed

Meyer, Benjamin; Müller, Marcel A; Corman, Victor M; Reusken, Chantal B E M; Ritz, Daniel; Godeke, Gert-Jan; Lattwein, Erik; Kallies, Stephan; Siemens, Artem; van Beek, Janko; Drexler, Jan F; Muth, Doreen; Bosch, Berend-Jan; Wernery, Ulrich; Koopmans, Marion P G; Wernery, Renate; Drosten, Christian

2014-04-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has caused an ongoing outbreak of severe acute respiratory tract infection in humans in the Arabian Peninsula since 2012. Dromedary camels have been implicated as possible viral reservoirs. We used serologic assays to analyze 651 dromedary camel serum samples from the United Arab Emirates; 151 of 651 samples were obtained in 2003, well before onset of the current epidemic, and 500 serum samples were obtained in 2013. Recombinant spike protein-specific immunofluorescence and virus neutralization tests enabled clear discrimination between MERS-CoV and bovine CoV infections. Most (632/651, 97.1%) camels had antibodies against MERS-CoV. This result included all 151 serum samples obtained in 2003. Most (389/651, 59.8%) serum samples had MERS-CoV-neutralizing antibody titers >1,280. Dromedary camels from the United Arab Emirates were infected at high rates with MERS-CoV or a closely related, probably conspecific, virus long before the first human MERS cases.

Thermal Protection System Mass Estimating Relationships For Blunt-Body, Earth Entry Spacecraft

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Samareh, Jamshid A.

2015-01-01

Mass estimating relationships (MERs) are developed to predict the amount of thermal protection system (TPS) necessary for safe Earth entry for blunt-body spacecraft using simple correlations that are non-ITAR and closely match estimates from NASA's highfidelity ablation modeling tool, the Fully Implicit Ablation and Thermal Analysis Program (FIAT). These MERs provide a first order estimate for rapid feasibility studies. There are 840 different trajectories considered in this study, and each TPS MER has a peak heating limit. MERs for the vehicle forebody include the ablators Phenolic Impregnated Carbon Ablator (PICA) and Carbon Phenolic atop Advanced Carbon-Carbon. For the aftbody, the materials are Silicone Impregnated Reusable Ceramic Ablator (SIRCA), Acusil II, SLA- 561V, and LI-900. The MERs are accurate to within 14% (at one standard deviation) of FIAT prediction, and the most any MER can under predict FIAT TPS thickness is 18.7%. This work focuses on the development of these MERs, the resulting equations, model limitations, and model accuracy.

Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) in dromedary camels in Abu Dhabi Emirate, United Arab Emirates.

PubMed

Yusof, Mohammed F; Eltahir, Yassir M; Serhan, Wissam S; Hashem, Farouk M; Elsayed, Elsaeid A; Marzoug, Bahaaeldin A; Abdelazim, Assem Si; Bensalah, Oum Keltoum A; Al Muhairi, Salama S

2015-06-01

High seroprevalence of Middle East respiratory syndrome corona virus (MERS-CoV) in dromedary camels has been previously reported in United Arab Emirates (UAE). However, the molecular detection of the virus has never been reported before in UAE. Of the 7,803 nasal swabs tested in the epidemiological survey, MERS-CoV nucleic acid was detected by real-time PCR in a total of 126 (1.6 %) camels. Positive camels were detected at the borders with Saudi Arabia and Oman and in camels' slaughter houses. MERS-CoV partial sequences obtained from UAE camels were clustering with human- and camel-derived MERS-CoV sequences in the same geographic area. Results provide further evidence of MERS-CoV zoonosis.

Middle East respiratory syndrome: obstacles and prospects for vaccine development

PubMed Central

Papaneri, Amy B.; Johnson, Reed F.; Wada, Jiro; Bollinger, Laura; Jahrling, Peter B.; Kuhn, Jens H.

2016-01-01

Summary The recent emergence of Middle East respiratory syndrome (MERS) highlights the need to engineer new methods for expediting vaccine development against emerging diseases. However, several obstacles prevent pursuit of a licensable MERS vaccine. First, the lack of a suitable animal model for MERS complicates in vivo testing of candidate vaccines. Second, due to the low number of MERS cases, pharmaceutical companies have little incentive to pursue MERS vaccine production as the costs of clinical trials are high. In addition, the timeline from bench research to approved vaccine use is 10 years or longer. Using novel methods and cost-saving strategies, genetically engineered vaccines can be produced quickly and cost-effectively. Along with progress in MERS animal model development, these obstacles can be circumvented or at least mitigated. PMID:25864502

An assessment of the level of concern among hospital-based health-care workers regarding MERS outbreaks in Saudi Arabia.

PubMed

Abolfotouh, Mostafa A; AlQarni, Ali A; Al-Ghamdi, Suliman M; Salam, Mahmoud; Al-Assiri, Mohammed H; Balkhy, Hanan H

2017-01-03

Middle East Respiratory Syndrome (MERS) is caused by MERS coronavirus (MERS-CoV). More than 80% of reported cases have occurred in Saudi Arabia, with a mortality exceeding 50%. Health-care workers (HCWs) are at risk of acquiring and transmitting this virus, so the concerns of HCWs in Saudi Arabia regarding MERS were evaluated. An anonymous, self-administered, previously validated questionnaire was given to 1031 HCWs at three tertiary hospitals in Saudi Arabia from October to December, 2014. Concerns regarding the disease, its severity and governmental efforts to contain it, as well as disease outcomes were assessed using 31 concern statements in five distinct domains. A total concern score was calculated for each HCW. Multiple regression analyses were used to identify predictors of high concern scores. The average age of participants was 37.1 ± 9.0 years, 65.8% were married and 59.1% were nurses. The majority of respondents (70.4%) felt at risk of contracting a MERS-CoV infection at work, 69.1% felt threatened if a colleague contracted MERS-CoV, 60.9% felt obliged to care for patients infected with MERS-CoV and 87.8% did not feel safe at work using standard precautions. In addition, 87.7% believed that the government should isolate patients with MERS in specialized hospitals, 73.7% agreed with travel restriction to and from areas affected by MERS and 65.3% agreed with avoiding inviting expatriates from such areas. After adjustment for covariates, high concern scores were significantly associated with being a Saudi national (p < 0.001), a non-physician (p < 0.001) and working in the central region (p < 0.001). The majority of respondents reported concern regarding MERS-CoV infection from exposure at work. The overall level of concern may be influenced by previous experience of MERS outbreaks and related cultural issues. The concerns of HCWs may affect their overall effectiveness in an outbreak and should be addressed by incorporating management strategies in outbreak planning.

Pigment Epithelium Derived Factor Peptide Protects Murine Hepatocytes from Carbon Tetrachloride-Induced Injury

PubMed Central

Shih, Shou-Chuan; Ho, Tsung-Chuan; Chen, Show-Li; Tsao, Yeou-Ping

2016-01-01

Fibrogenesis is induced by repeated injury to the liver and reactive regeneration and leads eventually to liver cirrhosis. Pigment epithelium derived factor (PEDF) has been shown to prevent liver fibrosis induced by carbon tetrachloride (CCl4). A 44 amino acid domain of PEDF (44-mer) was found to have a protective effect against various insults to several cell types. In this study, we investigated the capability of synthetic 44-mer to protect against liver injury in mice and in primary cultured hepatocytes. Acute liver injury, induced by CCl4, was evident from histological changes, such as cell necrosis, inflammation and apoptosis, and a concomitant reduction of glutathione (GSH) and GSH redox enzyme activities in the liver. Intraperitoneal injection of the 44-mer into CCl4-treated mice abolished the induction of AST and ALT and markedly reduced histological signs of liver injury. The 44-mer treatment can reduce hepatic oxidative stress as evident from lower levels of lipid hydroperoxide, and higher levels of GSH. CCl4 caused a reduction of Bcl-xL, PEDF and PPARγ, which was markedly restored by the 44-mer treatment. Consequently, the 44-mer suppressed liver fibrosis induced by repeated CCl4 injury. Furthermore, our observations in primary culture of rat hepatocytes showed that PEDF and the 44-mer protected primary rat hepatocytes against apoptosis induced by serum deprivation and TGF-β1. PEDF/44-mer induced cell protective STAT3 phosphorylation. Pharmacological STAT3 inhibition prevented the antiapoptotic action of PEDF/44-mer. Among several PEDF receptor candidates that may be responsible for hepatocyte protection, we demonstrated that PNPLA2 was essential for PEDF/44-mer-mediated STAT3 phosphorylation and antiapoptotic activity by using siRNA to selectively knockdown PNPLA2. In conclusion, the PEDF 44-mer protects hepatocytes from single and repeated CCl4 injury. This protective effect may stem from strengthening the counter oxidative stress capacity and induction of hepatoprotective factors. PMID:27384427

Middle East Respiratory Syndrome (MERS)

MedlinePlus

... Controls Cancel Submit Search The CDC Middle East Respiratory Syndrome (MERS) Note: Javascript is disabled or is ... Recommend on Facebook Tweet Share Compartir Middle East Respiratory Syndrome (MERS) is viral respiratory illness that was ...

MERS transmission and risk factors: a systematic review.

PubMed

Park, Ji-Eun; Jung, Soyoung; Kim, Aeran; Park, Ji-Eun

2018-05-02

Since Middle East respiratory syndrome (MERS) infection was first reported in 2012, many studies have analysed its transmissibility and severity. However, the methodology and results of these studies have varied, and there has been no systematic review of MERS. This study reviews the characteristics and associated risk factors of MERS. We searched international (PubMed, ScienceDirect, Cochrane) and Korean databases (DBpia, KISS) for English- or Korean-language articles using the terms "MERS" and "Middle East respiratory syndrome". Only human studies with > 20 participants were analysed to exclude studies with low representation. Epidemiologic studies with information on transmissibility and severity of MERS as well as studies containing MERS risk factors were included. A total of 59 studies were included. Most studies from Saudi Arabia reported higher mortality (22-69.2%) than those from South Korea (20.4%). While the R 0 value in Saudi Arabia was < 1 in all but one study, in South Korea, the R 0 value was 2.5-8.09 in the early stage and decreased to < 1 in the later stage. The incubation period was 4.5-5.2 days in Saudi Arabia and 6-7.8 days in South Korea. Duration from onset was 4-10 days to confirmation, 2.9-5.3 days to hospitalization, 11-17 days to death, and 14-20 days to discharge. Older age and concomitant disease were the most common factors related to MERS infection, severity, and mortality. The transmissibility and severity of MERS differed by outbreak region and patient characteristics. Further studies assessing the risk of MERS should consider these factors.

Activated Microglia Desialylate and Phagocytose Cells via Neuraminidase, Galectin-3, and Mer Tyrosine Kinase

PubMed Central

Nomura, Koji; Vilalta, Anna; Allendorf, David H.; Hornik, Tamara C.

2017-01-01

Activated microglia can phagocytose dying, stressed, or excess neurons and synapses via the phagocytic receptor Mer tyrosine kinase (MerTK). Galectin-3 (Gal-3) can cross-link surface glycoproteins by binding galactose residues that are normally hidden below terminal sialic acid residues. Gal-3 was recently reported to opsonize cells via activating MerTK. We found that LPS-activated BV-2 microglia rapidly released Gal-3, which was blocked by calcineurin inhibitors. Gal-3 bound to MerTK on microglia and to stressed PC12 (neuron-like) cells, and it increased microglial phagocytosis of PC12 cells or primary neurons, which was blocked by inhibition of MerTK. LPS-activated microglia exhibited a sialidase activity that desialylated PC12 cells and could be inhibited by Tamiflu, a neuraminidase (sialidase) inhibitor. Sialidase treatment of PC12 cells enabled Gal-3 to bind and opsonize the live cells for phagocytosis by microglia. LPS-induced microglial phagocytosis of PC12 was prevented by small interfering RNA knockdown of Gal-3 in microglia, lactose inhibition of Gal-3 binding, inhibition of neuraminidase with Tamiflu, or inhibition of MerTK by UNC569. LPS-induced phagocytosis of primary neurons by primary microglia was also blocked by inhibition of MerTK. We conclude that activated microglia release Gal-3 and a neuraminidase that desialylates microglial and PC12 surfaces, enabling Gal-3 binding to PC12 cells and their phagocytosis via MerTK. Thus, Gal-3 acts as an opsonin of desialylated surfaces, and inflammatory loss of neurons or synapses may potentially be blocked by inhibiting neuraminidases, Gal-3, or MerTK. PMID:28500071

KENNEDY SPACE CENTER, FLA. - At right is the Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, that will launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - At right is the Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, that will launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, is having solid rocket boosters (SRBs) installed that will help launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - The Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, is having solid rocket boosters (SRBs) installed that will help launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2) is installed around the Mars Exploration Rover 2 (MER-2). MER-2 is one of NASA's twin Mars Exploration Rovers designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch no earlier than June 8 as MER-A, with two launch opportunities each day during the launch period that closes on June 19.

NASA Image and Video Library

2003-05-31

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2) is installed around the Mars Exploration Rover 2 (MER-2). MER-2 is one of NASA's twin Mars Exploration Rovers designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch no earlier than June 8 as MER-A, with two launch opportunities each day during the launch period that closes on June 19.

KENNEDY SPACE CENTER, FLA. - Workers on the launch tower of Complex 17-A, Cape Canaveral Air Force Station, stand by while a solid rocket booster (SRB) is lifted to vertical. It is one of nine that will help launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers on the launch tower of Complex 17-A, Cape Canaveral Air Force Station, stand by while a solid rocket booster (SRB) is lifted to vertical. It is one of nine that will help launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Diffusion-driven self-assembly of rodlike particles: Monte Carlo simulation on a square lattice

NASA Astrophysics Data System (ADS)

Lebovka, Nikolai I.; Tarasevich, Yuri Yu.; Gigiberiya, Volodymyr A.; Vygornitskii, Nikolai V.

2017-05-01

The diffusion-driven self-assembly of rodlike particles was studied by means of Monte Carlo simulation. The rods were represented as linear k -mers (i.e., particles occupying k adjacent sites). In the initial state, they were deposited onto a two-dimensional square lattice of size L ×L up to the jamming concentration using a random sequential adsorption algorithm. The size of the lattice, L , was varied from 128 to 2048, and periodic boundary conditions were applied along both x and y axes, while the length of the k -mers (determining the aspect ratio) was varied from 2 to 12. The k -mers oriented along the x and y directions (kx-mers and ky-mers, respectively) were deposited equiprobably. In the course of the simulation, the numbers of intraspecific and interspecific contacts between the same sort and between different sorts of k -mers, respectively, were calculated. Both the shift ratio of the actual number of shifts along the longitudinal or transverse axes of the k -mers and the electrical conductivity of the system were also examined. For the initial random configuration, quite different self-organization behavior was observed for short and long k -mers. For long k -mers (k ≥6 ), three main stages of diffusion-driven spatial segregation (self-assembly) were identified: the initial stage, reflecting destruction of the jamming state; the intermediate stage, reflecting continuous cluster coarsening and labyrinth pattern formation; and the final stage, reflecting the formation of diagonal stripe domains. Additional examination of two artificially constructed initial configurations showed that this pattern of diagonal stripe domains is an attractor, i.e., any spatial distribution of k -mers tends to transform into diagonal stripes. Nevertheless, the time for relaxation to the steady state essentially increases as the lattice size growth.

Increased Circulating and Urinary Levels of Soluble TAM Receptors in Diabetic Nephropathy.

PubMed

Ochodnicky, Peter; Lattenist, Lionel; Ahdi, Mohamed; Kers, Jesper; Uil, Melissa; Claessen, Nike; Leemans, Jaklien C; Florquin, Sandrine; Meijers, Joost C M; Gerdes, Victor E A; Roelofs, Joris J T H

2017-09-01

TAM receptors (Tyro3, Axl, and Mer) have been implicated in innate immunity. Circulating TAM receptor soluble forms (sTyro3, sAxl, sMer) are related to autoimmune disorders. We investigated TAM and their ligand protein S in patients with diabetes. Urinary and plasma levels of protein S, sTyro3, sAxl, and sMer were determined in 126 patients with diabetes assigned to a normoalbuminuric or macroalbuminuric (urinary albumin excretion <30 mg/24 hours and >300 mg/24 hours, respectively) study group and 18 healthy volunteers. TAM and protein S immunostaining was performed on kidney biopsy specimens from patients with diabetic nephropathy (n = 9) and controls (n = 6). TAM expression and shedding by tubular epithelial cells were investigated by PCR and enzyme-linked immunosorbent assay in an in vitro diabetes model. Patients with macroalbuminuria diabetes had higher circulating levels of sMer and more urinary sTyro3 and sMer than normoalbuminuric diabetics. Increased clearance of sTyro3 and sMer was associated with loss of tubular Tyro3 and Mer expression in diabetic nephropathy tissue and glomerular depositions of protein S. During in vitro diabetes, human kidney cells had down-regulation of Tyro3 and Mer mRNA and increased shedding of sTyro3 and sMer. Renal injury in diabetes is associated with elevated systemic and urine levels of sMer and sTyro3. This is the first study reporting excretion of sTAM receptors in urine, identifying the kidney as a source of sTAM. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Case characteristics among Middle East respiratory syndrome coronavirus outbreak and non-outbreak cases in Saudi Arabia from 2012 to 2015.

PubMed

Alhamlan, F S; Majumder, M S; Brownstein, J S; Hawkins, J; Al-Abdely, H M; Alzahrani, A; Obaid, D A; Al-Ahdal, M N; BinSaeed, A

2017-01-12

As of 1 November 2015, the Saudi Ministry of Health had reported 1273 cases of Middle East respiratory syndrome (MERS); among these cases, which included 9 outbreaks at several hospitals, 717 (56%) patients recovered, 14 (1%) remain hospitalised and 543 (43%) died. This study aimed to determine the epidemiological, demographic and clinical characteristics that distinguished cases of MERS contracted during outbreaks from those contracted sporadically (ie, non-outbreak) between 2012 and 2015 in Saudi Arabia. Data from the Saudi Ministry of Health of confirmed outbreak and non-outbreak cases of MERS coronavirus (CoV) infections from September 2012 through October 2015 were abstracted and analysed. Univariate and descriptive statistical analyses were conducted, and the time between disease onset and confirmation, onset and notification and onset and death were examined. A total of 1250 patients (aged 0-109 years; mean, 50.825 years) were reported infected with MERS-CoV. Approximately two-thirds of all MERS cases were diagnosed in men for outbreak and non-outbreak cases. Healthcare workers comprised 22% of all MERS cases for outbreak and non-outbreak cases. Nosocomial infections comprised one-third of all Saudi MERS cases; however, nosocomial infections occurred more frequently in outbreak than non-outbreak cases (p<0.001). Patients contracting MERS during an outbreak were significantly more likely to die of MERS (p<0.001). To date, nosocomial infections have fuelled MERS outbreaks. Given that the Kingdom of Saudi Arabia is a worldwide religious travel destination, localised outbreaks may have massive global implications and effective outbreak preventive measures are needed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Case characteristics among Middle East respiratory syndrome coronavirus outbreak and non-outbreak cases in Saudi Arabia from 2012 to 2015

PubMed Central

Alhamlan, F S; Majumder, M S; Brownstein, J S; Hawkins, J; Al-Abdely, H M; Alzahrani, A; Obaid, D A; Al-Ahdal, M N; BinSaeed, A

2017-01-01

Objectives As of 1 November 2015, the Saudi Ministry of Health had reported 1273 cases of Middle East respiratory syndrome (MERS); among these cases, which included 9 outbreaks at several hospitals, 717 (56%) patients recovered, 14 (1%) remain hospitalised and 543 (43%) died. This study aimed to determine the epidemiological, demographic and clinical characteristics that distinguished cases of MERS contracted during outbreaks from those contracted sporadically (ie, non-outbreak) between 2012 and 2015 in Saudi Arabia. Design Data from the Saudi Ministry of Health of confirmed outbreak and non-outbreak cases of MERS coronavirus (CoV) infections from September 2012 through October 2015 were abstracted and analysed. Univariate and descriptive statistical analyses were conducted, and the time between disease onset and confirmation, onset and notification and onset and death were examined. Results A total of 1250 patients (aged 0–109 years; mean, 50.825 years) were reported infected with MERS-CoV. Approximately two-thirds of all MERS cases were diagnosed in men for outbreak and non-outbreak cases. Healthcare workers comprised 22% of all MERS cases for outbreak and non-outbreak cases. Nosocomial infections comprised one-third of all Saudi MERS cases; however, nosocomial infections occurred more frequently in outbreak than non-outbreak cases (p<0.001). Patients contracting MERS during an outbreak were significantly more likely to die of MERS (p<0.001). Conclusions To date, nosocomial infections have fuelled MERS outbreaks. Given that the Kingdom of Saudi Arabia is a worldwide religious travel destination, localised outbreaks may have massive global implications and effective outbreak preventive measures are needed. PMID:28082362

Low-maintenance energy requirements of obese dogs after weight loss.

PubMed

German, Alexander J; Holden, Shelley L; Mather, Nicola J; Morris, Penelope J; Biourge, Vincent

2011-10-01

Weight rebound after successful weight loss is a well-known phenomenon in humans and dogs, possibly due to the fact that energy restriction improves metabolic efficiency, reducing post-weight-loss maintenance energy requirements (MER). The aim of the present study was to estimate post-weight-loss MER in obese pet dogs that had successfully lost weight and did not subsequently rebound. A total of twenty-four obese dogs, successfully completing a weight management programme at the Royal Canin Weight Management Clinic, University of Liverpool (Wirral, UK), were included. In all dogs, a period of >14 d of stable weight ( < 1 % change) was identified post-weight loss, when food intake was constant and activity levels were stable (assessed via owners' diary records). Post-weight-loss MER was indirectly estimated by determining dietary energy consumption during this stable weight period. Multivariable linear regression was used to identify factors that were associated with post-weight-loss MER. The mean length of stable weight after weight loss was 54 (SD 34.1) d. During this time, MER was 285 (SD 54.8) kJ/kg(0.75) per d. The rate of prior weight loss and food intake during the weight-loss phase was positively associated with post-weight-loss MER, while the amount of lean tissue lost was negatively associated with post-weight-loss MER. MER are low after weight loss in obese pet dogs (typically only 10 % more than required during weight-loss MER), which has implications for what should constitute the optimal diet during this period. Preserving lean tissue during weight loss may maximise post-weight-loss MER and help prevent rebound.

Up-Regulation of Soluble Axl and Mer Receptor Tyrosine Kinases Negatively Correlates with Gas6 in Established Multiple Sclerosis Lesions

PubMed Central

Weinger, Jason G.; Omari, Kakuri M.; Marsden, Kurt; Raine, Cedric S.; Shafit-Zagardo, Bridget

2009-01-01

Multiple sclerosis is a disease that is characterized by inflammation, demyelination, and axonal damage; it ultimately forms gliotic scars and lesions that severely compromise the function of the central nervous system. Evidence has shown previously that altered growth factor receptor signaling contributes to lesion formation, impedes recovery, and plays a role in disease progression. Growth arrest-specific protein 6 (Gas6), the ligand for the TAM receptor tyrosine kinase family, consisting of Tyro3, Axl, and Mer, is important for cell growth, survival, and clearance of debris. In this study, we show that levels of membrane-bound Mer (205 kd), soluble Mer (∼150 kd), and soluble Axl (80 kd) were all significantly elevated in homogenates from established multiple sclerosis lesions comprised of both chronic active and chronic silent lesions. Whereas in normal tissue Gas6 positively correlated with soluble Axl and Mer, there was a negative correlation between Gas6 and soluble Axl and Mer in established multiple sclerosis lesions. In addition, increased levels of soluble Axl and Mer were associated with increased levels of mature ADAM17, mature ADAM10, and Furin, proteins that are associated with Axl and Mer solubilization. Soluble Axl and Mer are both known to act as decoy receptors and block Gas6 binding to membrane-bound receptors. These data suggest that in multiple sclerosis lesions, dysregulation of protective Gas6 receptor signaling may prolong lesion activity. PMID:19541935

Inactivation and safety testing of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Kumar, Mia; Mazur, Steven; Ork, Britini L.; Postnikova, Elena; Hensley, Lisa E.; Jahrling, Peter B.; Johnson, Reed; Holbrook, Michael R.

2015-01-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is a recently emerged virus that has caused a number of human infections and deaths, primarily in the Middle East. The transmission of MERS-CoV to humans has been proposed to be as a result of contact with camels, but evidence of human-to-human transmission also exists. In order to work with MERS-CoV in a laboratory setting, the US Centers for Disease Control and Prevention (CDC) has determined that MERS-CoV should be handled at a biosafety level (BSL) 3 (BSL-3) biocontainment level. Many processes and procedures used to characterize MERS-CoV and to evaluate samples from MERS-CoV infected animals are more easily and efficiently completed at BSL-2 or lower containment. In order to complete experimental work at BSL-2, demonstration or proof of inactivation is required before removal of specimens from biocontainment laboratories. In the studies presented here, we evaluated typical means of inactivating viruses prior to handling specimens at a lower biocontainment level. We found that Trizol, AVL buffer and gamma irradiation were effective at inactivating MERS-CoV, that formaldehyde-based solutions required at least 30 minutes of contact time in a cell culture system while a mixture of methanol and acetone required 60 minutes to inactivate MERS-CoV. Together, these data provide a foundation for safely inactivating MERS-CoV, and potentially other coronaviruses, prior to removal from biocontainment facilities. PMID:26190637

28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

PubMed

Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

2015-01-01

Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

2013-01-01

The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

Korean Society for Laboratory Medicine Practice Guidelines for the Molecular Diagnosis of Middle East Respiratory Syndrome During an Outbreak in Korea in 2015.

PubMed

Ki, Chang Seok; Lee, Hyukmin; Sung, Heungsup; Kim, Sinyoung; Seong, Moon Woo; Yong, Dongeun; Kim, Jae Seok; Lee, Mi Kyung; Kim, Mi Na; Choi, Jong Rak; Kim, Jeong Ho

2016-05-01

For two months between May and July 2015, a nationwide outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) occurred in Korea. On June 3, 2015, the Korean Society for Laboratory Medicine (KSLM) launched a MERS-CoV Laboratory Response Task Force (LR-TF) to facilitate clinical laboratories to set up the diagnosis of MERS-CoV infection. Based on the WHO interim recommendations, the Centers for Disease Control and Prevention of United States guidelines for MERS-CoV laboratory testing, and other available resources, the KSLM MERS-CoV LR-TF provided the first version of the laboratory practice guidelines for the molecular diagnosis of MERS-CoV to the clinical laboratories on June 12, 2015. The guidelines described here are an updated version that includes case definition, indications for testing, specimen type and protocols for specimen collection, specimen packing and transport, specimen handling and nucleic acid extraction, molecular detection of MERS-CoV, interpretation of results and reporting, and laboratory safety. The KSLM guidelines mainly focus on the molecular diagnosis of MERS-CoV, reflecting the unique situation in Korea and the state of knowledge at the time of publication.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, a crane is in place to lift the fairing for the Mars Exploration Rover 2 (MER-2/MER-A). The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, a crane is in place to lift the fairing for the Mars Exploration Rover 2 (MER-2/MER-A). The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - The fairing for the Mars Exploration Rover 2 (MER-2/MER-A) arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - The fairing for the Mars Exploration Rover 2 (MER-2/MER-A) arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

[A Case of Clinically Mild Encephalitis/encephalopathy with a Reversible Splenial Lesion due to Dengue Fever].

PubMed

Saito, Nobuo; Kitashouji, Emi; Kojiro, Maiko; Furumoto, Akitugu; Morimoto, Konosuke; Morita, Kouichi; Ariyoshi, Koya

2015-07-01

Clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) has been recently proposed as a clinical-radiological syndrome. Several causes of MERS have been reported including infectious diseases. We present herein on a case of MERS induced by dengue fever in a Japanese traveler. A 48-year-old male returning from Thailand and Cambodia was admitted for an unknown fever. Following admission, the dengue virus was diagnosed with a positive RT-PCR result. On day 5 of the illness, regardless of reduced fever, weakness suddenly developed in both upper limbs. A cerebral MRI showed hyperintensities in the splenium of the corpus callosum on T2-weighted and diffusion-weighted images. The symptoms resolved completely within two days of onset. The patient was diagnosed as having MERS due to the MRI features and the mild clinical course. Although only a few cases of MERS caused by dengue fever have been reported, the condition is possibly underdiagnosed. It is hypothesized that dengue fever can induce MERS as dengue fever can cause increased endothelium permeability and hypo-sodium which have been proposed in the pathogenesis of MERS. However, there is currently limited evidence for this. Further research is recommended to demonstrate a causal association between dengue fever and MERS.

Thermal Protection System Mass Estimating Relationships for Blunt-Body, Earth Entry Spacecraft

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Samareh, Jamshid A.

2015-01-01

System analysis and design of any entry system must balance the level fidelity for each discipline against the project timeline. One way to inject high fidelity analysis earlier in the design effort is to develop surrogate models for the high-fidelity disciplines. Surrogate models for the Thermal Protection System (TPS) are formulated as Mass Estimating Relationships (MERs). The TPS MERs are presented that predict the amount of TPS necessary for safe Earth entry for blunt-body spacecraft using simple correlations that closely match estimates from NASA's high-fidelity ablation modeling tool, the Fully Implicit Ablation and Thermal Analysis Program (FIAT). These MERs provide a first order estimate for rapid feasibility studies. There are 840 different trajectories considered in this study, and each TPS MER has a peak heating limit. MERs for the vehicle forebody include the ablators Phenolic Impregnated Carbon Ablator (PICA) and Carbon Phenolic atop Advanced Carbon-Carbon. For the aftbody, the materials are Silicone Impregnated Reusable Ceramic Ablator (SIRCA), Acusil II, SLA-561V, and LI-900. The MERs are accurate to within 14% (at one standard deviation) of FIAT prediction, and the most any MER under predicts FIAT TPS thickness is 18.7%. This work focuses on the development of these MERs, the resulting equations, model limitations, and model accuracy.

Debate on MERS-CoV respiratory precautions: surgical mask or N95 respirators?

PubMed Central

Chung, Jasmine Shimin; Ling, Moi Lin; Seto, Wing Hong; Ang, Brenda Sze Peng; Tambyah, Paul Anantharajah

2014-01-01

Since the emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in mid-2012, there has been controversy over the respiratory precaution recommendations in different guidelines from various international bodies. Our understanding of MERS-CoV is still evolving. Current recommendations on infection control practices are heavily influenced by the lessons learnt from severe acute respiratory syndrome. A debate on respiratory precautions for MERS-CoV was organised by Infection Control Association (Singapore) and the Society of Infectious Disease (Singapore). We herein discuss and present the evidence for surgical masks for the protection of healthcare workers from MERS-CoV. PMID:25017402

Middle East respiratory syndrome coronavirus: current situation and travel-associated concerns.

PubMed

Al-Tawfiq, Jaffar A; Omrani, Ali S; Memish, Ziad A

2016-06-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 brought back memories of the occurrence of severe acute respiratory syndrome coronavirus (SARS-CoV) in 2002. More than 1500 MERS-CoV cases were recorded in 42 months with a case fatality rate (CFR) of 40%. Meanwhile, 8000 cases of SARS-CoV were confirmed in six months with a CFR of 10%. The clinical presentation of MERS-CoV ranges from mild and non-specific presentation to progressive and severe pneumonia. No predictive signs or symptoms exist to differentiate MERS-CoV from community-acquired pneumonia in hospitalized patients. An apparent heterogeneity was observed in transmission. Most MERS-CoV cases were secondary to large outbreaks in healthcare settings. These cases were secondary to community-acquired cases, which may also cause family outbreaks. Travel-associated MERS infection remains low. However, the virus exhibited a clear tendency to cause large outbreaks outside the Arabian Peninsula as exemplified by the outbreak in the Republic of Korea. In this review, we summarize the current knowledge about MERS-CoV and highlight travel-related issues.

A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform

PubMed Central

Malczyk, Anna H.; Kupke, Alexandra; Prüfer, Steffen; Scheuplein, Vivian A.; Hutzler, Stefan; Kreuz, Dorothea; Beissert, Tim; Bauer, Stefanie; Hubich-Rau, Stefanie; Tondera, Christiane; Eldin, Hosam Shams; Schmidt, Jörg; Vergara-Alert, Júlia; Süzer, Yasemin; Seifried, Janna; Hanschmann, Kay-Martin; Kalinke, Ulrich; Herold, Susanne; Sahin, Ugur; Cichutek, Klaus; Waibler, Zoe; Eickmann, Markus; Becker, Stephan

2015-01-01

ABSTRACT In 2012, the first cases of infection with the Middle East respiratory syndrome coronavirus (MERS-CoV) were identified. Since then, more than 1,000 cases of MERS-CoV infection have been confirmed; infection is typically associated with considerable morbidity and, in approximately 30% of cases, mortality. Currently, there is no protective vaccine available. Replication-competent recombinant measles virus (MV) expressing foreign antigens constitutes a promising tool to induce protective immunity against corresponding pathogens. Therefore, we generated MVs expressing the spike glycoprotein of MERS-CoV in its full-length (MERS-S) or a truncated, soluble variant of MERS-S (MERS-solS). The genes encoding MERS-S and MERS-solS were cloned into the vaccine strain MVvac2 genome, and the respective viruses were rescued (MVvac2-CoV-S and MVvac2-CoV-solS). These recombinant MVs were amplified and characterized at passages 3 and 10. The replication of MVvac2-CoV-S in Vero cells turned out to be comparable to that of the control virus MVvac2-GFP (encoding green fluorescent protein), while titers of MVvac2-CoV-solS were impaired approximately 3-fold. The genomic stability and expression of the inserted antigens were confirmed via sequencing of viral cDNA and immunoblot analysis. In vivo, immunization of type I interferon receptor-deficient (IFNAR−/−)-CD46Ge mice with 2 × 105 50% tissue culture infective doses of MVvac2-CoV-S(H) or MVvac2-CoV-solS(H) in a prime-boost regimen induced robust levels of both MV- and MERS-CoV-neutralizing antibodies. Additionally, induction of specific T cells was demonstrated by T cell proliferation, antigen-specific T cell cytotoxicity, and gamma interferon secretion after stimulation of splenocytes with MERS-CoV-S presented by murine dendritic cells. MERS-CoV challenge experiments indicated the protective capacity of these immune responses in vaccinated mice. IMPORTANCE Although MERS-CoV has not yet acquired extensive distribution, being mainly confined to the Arabic and Korean peninsulas, it could adapt to spread more readily among humans and thereby become pandemic. Therefore, the development of a vaccine is mandatory. The integration of antigen-coding genes into recombinant MV resulting in coexpression of MV and foreign antigens can efficiently be achieved. Thus, in combination with the excellent safety profile of the MV vaccine, recombinant MV seems to constitute an ideal vaccine platform. The present study shows that a recombinant MV expressing MERS-S is genetically stable and induces strong humoral and cellular immunity against MERS-CoV in vaccinated mice. Subsequent challenge experiments indicated protection of vaccinated animals, illustrating the potential of MV as a vaccine platform with the potential to target emerging infections, such as MERS-CoV. PMID:26355094

From SARS to MERS: evidence and speculation.

PubMed

Gao, Hainv; Yao, Hangping; Yang, Shigui; Li, Lanjuan

2016-12-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel zoonotic pathogen. In 2012, the infectious outbreak caused by MERS-CoV in Saudi Arabia has spread to more than 1600 patients in 26 countries, resulting in over 600 deaths.Without a travel history, few clinical and radiological features can reliably differentiate MERS from SARS. But in real world, comparing with SARS, MERS presents more vaguely defined epidemiology, more severe symptoms, and higher case fatality rate. In this review, we summarize the recent findings in the field of MERS-CoV, especially its molecular virology, interspecies mechanisms, clinical features, antiviral therapies, and the further investigation into this disease. As a newly emerging virus, many questions are not fully answered, including the exact mode of transmission chain, geographical distribution, and animal origins. Furthermore, a new protocol needs to be launched to rapidly evaluate the effects of unproven antiviral drugs and vaccine to fasten the clinical application of new drugs.

Transmission of Middle East Respiratory Syndrome Coronavirus Infections in Healthcare Settings, Abu Dhabi

PubMed Central

Nguyen, Duc; Aden, Bashir; Al Bandar, Zyad; Al Dhaheri, Wafa; Abu Elkheir, Kheir; Khudair, Ahmed; Al Mulla, Mariam; El Saleh, Feda; Imambaccus, Hala; Al Kaabi, Nawal; Sheikh, Farrukh Amin; Sasse, Jurgen; Turner, Andrew; Abdel Wareth, Laila; Weber, Stefan; Al Ameri, Asma; Abu Amer, Wesal; Alami, Negar N.; Bunga, Sudhir; Haynes, Lia M.; Hall, Aron J.; Kallen, Alexander J.; Kuhar, David; Pham, Huong; Pringle, Kimberly; Tong, Suxiang; Whitaker, Brett L.; Gerber, Susan I.; Al Hosani, Farida Ismail

2016-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) infections sharply increased in the Arabian Peninsula during spring 2014. In Abu Dhabi, United Arab Emirates, these infections occurred primarily among healthcare workers and patients. To identify and describe epidemiologic and clinical characteristics of persons with healthcare-associated infection, we reviewed laboratory-confirmed MERS-CoV cases reported to the Health Authority of Abu Dhabi during January 1, 2013–May 9, 2014. Of 65 case-patients identified with MERS-CoV infection, 27 (42%) had healthcare-associated cases. Epidemiologic and genetic sequencing findings suggest that 3 healthcare clusters of MERS-CoV infection occurred, including 1 that resulted in 20 infected persons in 1 hospital. MERS-CoV in healthcare settings spread predominantly before MERS-CoV infection was diagnosed, underscoring the importance of increasing awareness and infection control measures at first points of entry to healthcare facilities. PMID:26981708

Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus.

PubMed

Hsin, Wei-Chen; Chang, Chan-Hua; Chang, Chi-You; Peng, Wei-Hao; Chien, Chung-Liang; Chang, Ming-Fu; Chang, Shin C

2018-05-24

Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome. A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712-19969) ME ), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712-19969) ME interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome. A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712-19969) ME with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.

The proprotein convertase SKI-1/S1P. In vitro analysis of Lassa virus glycoprotein-derived substrates and ex vivo validation of irreversible peptide inhibitors.

PubMed

Pasquato, Antonella; Pullikotil, Philomena; Asselin, Marie-Claude; Vacatello, Manuela; Paolillo, Livio; Ghezzo, Francesca; Basso, Federica; Di Bello, Carlo; Dettin, Monica; Seidah, Nabil G

2006-08-18

Herein we designed, synthesized, tested, and validated fluorogenic methylcoumarinamide (MCA) and chloromethylketone-peptides spanning the Lassa virus GPC cleavage site as substrates and inhibitors for the proprotein convertase SKI-1/S1P. The 7-mer MCA (YISRRLL-MCA) and 8-mer MCA (IYISRRLL-MCA) are very efficiently cleaved with respect to both the 6-mer MCA (ISRRLL-MCA) and point mutated fluorogenic analogues, except for the 7-mer mutant Y253F. The importance of the P7 phenylic residue was confirmed by digestions of two 16-mer non-fluorogenic peptidyl substrates that differ by a single point mutation (Y253A). Because NMR analysis of these 16-mer peptides did not reveal significant structural differences at recognition motif RRLL, the P7 Tyr residue is likely important in establishing key interactions within the catalytic pocket of SKI-1. Based on these data, we established through analysis of pro-ATF6 and pro-SREBP-2 cellular processing that decanoylated chloromethylketone 7-mer, 6-mer, and 4-mer peptides containing the core RRLL sequence are irreversible and potent ex vivo SKI-1 inhibitors. Although caution must be exercised in using these inhibitors in in vitro reactions, as they can also inhibit the basic amino acid-specific convertase furin, within cells and when used at concentrations < or = 100 microM these inhibitors are relatively specific for inhibition of SKI-1 processing events, as opposed to those performed by furin-like convertases.

Public response to MERS-CoV in the Middle East: iPhone survey in six countries.

PubMed

Alqahtani, Amani S; Rashid, Harunor; Basyouni, Mada H; Alhawassi, Tariq M; BinDhim, Nasser F

Gulf Cooperation Council (GCC) countries bear the heaviest brunt of MERS-CoV. This study aims to compare public awareness and practice around MERS-CoV across GCC countries. A cross-sectional survey was conducted using the Gulf Indicators (GI) smartphone app among people in the six GCC countries, namely Saudi Arabia, Kuwait, the United Arab Emirates, Qatar, Bahrain, and Oman. A total of 1812 participants recruited. All were aware of MERS-CoV, yet the perception and practice around MERS-CoV varied widely between countries. Over two thirds were either "not concerned" or "slightly concerned" about contracting MERS-CoV; believing that they were under Allah's (God's) protection (40%) was the most cited reason. While 79% were aware that the disease can transmit through droplet from infected person, only 12% stated that MERS-CoV transmits via camels; people in Saudi Arabia were better aware of the transmission. Nevertheless, only 22% of respondents believed that camels are the zoonotic reservoir of MERS-CoV. Those who were concerned about contracting MERS-CoV (aOR: 1.6, 95% CI: 1.2-2.1, p<0.01) and those who thought MERS-CoV to be a severe disease only for those with high-risk conditions (aOR: 1.5, 95% CI: 1.1-2.1, p<0.01) were more likely to believe that camels are the zoonotic source. However, residents of KSA (aOR: 0.03, 95% CI: 0.01-0.07, p<0.01), UAE (aOR: 0.01, 95% CI: 0.004-0.02, p<0.01) and Kuwait (aOR: 0.03, 95% CI: 0.01-0.07, p<0.01) were less likely to believe that camels are the main zoonotic source compared to respondents from the other countries. Hygienic measures were more commonly adopted than avoidance of camels or their raw products, yet there was a discrepancy between the countries. This study highlights that despite being aware of the ongoing MERS-CoV epidemic; many people lack accurate understanding about MERS-CoV transmission, prevention, and are not fully compliant with preventive measures. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Computational modeling of the bat HKU4 coronavirus 3CLpro inhibitors as a tool for the development of antivirals against the emerging Middle East respiratory syndrome (MERS) coronavirus.

PubMed

Abuhammad, Areej; Al-Aqtash, Rua'a A; Anson, Brandon J; Mesecar, Andrew D; Taha, Mutasem O

2017-11-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging virus that poses a major challenge to clinical management. The 3C-like protease (3CL pro ) is essential for viral replication and thus represents a potential target for antiviral drug development. Presently, very few data are available on MERS-CoV 3CL pro inhibition by small molecules. We conducted extensive exploration of the pharmacophoric space of a recently identified set of peptidomimetic inhibitors of the bat HKU4-CoV 3CL pro . HKU4-CoV 3CL pro shares high sequence identity (81%) with the MERS-CoV enzyme and thus represents a potential surrogate model for anti-MERS drug discovery. We used 2 well-established methods: Quantitative structure-activity relationship (QSAR)-guided modeling and docking-based comparative intermolecular contacts analysis. The established pharmacophore models highlight structural features needed for ligand recognition and revealed important binding-pocket regions involved in 3CL pro -ligand interactions. The best models were used as 3D queries to screen the National Cancer Institute database for novel nonpeptidomimetic 3CL pro inhibitors. The identified hits were tested for HKU4-CoV and MERS-CoV 3CL pro inhibition. Two hits, which share the phenylsulfonamide fragment, showed moderate inhibitory activity against the MERS-CoV 3CL pro and represent a potential starting point for the development of novel anti-MERS agents. To the best of our knowledge, this is the first pharmacophore modeling study supported by in vitro validation on the MERS-CoV 3CL pro . MERS-CoV is an emerging virus that is closely related to the bat HKU4-CoV. 3CL pro is a potential drug target for coronavirus infection. HKU4-CoV 3CL pro is a useful surrogate model for the identification of MERS-CoV 3CL pro enzyme inhibitors. dbCICA is a very robust modeling method for hit identification. The phenylsulfonamide scaffold represents a potential starting point for MERS coronavirus 3CL pro inhibitors development. Copyright © 2017 John Wiley & Sons, Ltd.

Active screening and surveillance in the United Kingdom for Middle East respiratory syndrome coronavirus in returning travellers and pilgrims from the Middle East: a prospective descriptive study for the period 2013-2015.

PubMed

Atabani, Sowsan F; Wilson, Steven; Overton-Lewis, Clare; Workman, Judith; Kidd, I Michael; Petersen, Eskild; Zumla, Alimuddin; Smit, Erasmus; Osman, Husam

2016-06-01

Over 25000 pilgrims from the UK visit Saudi Arabia every year for the Umrah and Hajj pilgrimages. The recent outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in South Korea and the continuing reports of MERS-CoV cases from Saudi Arabia highlight the need for active surveillance for MERS-CoV in returning pilgrims or travellers from the Middle East. Public Health England Birmingham Laboratory (PHEBL) is one of a few selected UK public health laboratories responsible for MERS-CoV screening in travellers returning to the UK from the Middle East who present to hospital with severe respiratory symptoms. The results of the PHEBL MERS-CoV screening and surveillance over the past 3 years is presented. UK travellers/pilgrims who returned from the Middle East and presented to a hospital with respiratory symptoms were studied over the period February 1, 2013 to December 31, 2015. Patients with respiratory symptoms, who satisfied the Public Health England MERS-CoV case algorithm, were tested for MERS-CoV and other respiratory tract viruses on admission to hospital. Two hundred and two patients suspected of having MERS-CoV were tested. None of them had a laboratory-confirmed MERS-CoV infection. A viral aetiology was detected in half (50.3%) of the cases, with rhinoviruses, influenza A (H1N1 and H3N2), and influenza B being most frequent. Peak testing occurred following the annual Hajj season and in other periods of raised national awareness. Respiratory tract infections in travellers/pilgrims returning to the UK from the Middle East are mainly due to rhinoviruses, influenza A, and influenza B. Whilst MERS-CoV was not detected in the 202 patients studied, heightened awareness of the possibility of MERS-CoV and continuous proactive surveillance are essential to rapidly identify cases of MERS-CoV and other seasonal respiratory tract viruses such as avian influenza, in patients presenting to hospital. Early identification and isolation may prevent outbreaks in nosocomial settings. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Serological Evidence of MERS-CoV Antibodies in Dromedary Camels (Camelus dromedaries) in Laikipia County, Kenya

PubMed Central

Deem, Sharon L.; Fèvre, Eric M.; Kinnaird, Margaret; Browne, A. Springer; Muloi, Dishon; Godeke, Gert-Jan; Koopmans, Marion; Reusken, Chantal B.

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a recently identified virus causing severe viral respiratory illness in people. Little is known about the reservoir in the Horn of Africa. In Kenya, where no human MERS cases have been reported, our survey of 335 dromedary camels, representing nine herds in Laikipia County, showed a high seroprevalence (46.9%) to MERS-CoV antibodies. Between herd differences were present (14.3%– 82.9%), but was not related to management type or herd isolation. Further research should focus on identifying similarity between MERS-CoV viral isolates in Kenya and clinical isolates from the Middle East and elsewhere. PMID:26473733

Serological Evidence of MERS-CoV Antibodies in Dromedary Camels (Camelus dromedaries) in Laikipia County, Kenya.

PubMed

Deem, Sharon L; Fèvre, Eric M; Kinnaird, Margaret; Browne, A Springer; Muloi, Dishon; Godeke, Gert-Jan; Koopmans, Marion; Reusken, Chantal B

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a recently identified virus causing severe viral respiratory illness in people. Little is known about the reservoir in the Horn of Africa. In Kenya, where no human MERS cases have been reported, our survey of 335 dromedary camels, representing nine herds in Laikipia County, showed a high seroprevalence (46.9%) to MERS-CoV antibodies. Between herd differences were present (14.3%- 82.9%), but was not related to management type or herd isolation. Further research should focus on identifying similarity between MERS-CoV viral isolates in Kenya and clinical isolates from the Middle East and elsewhere.

Successful recovery of MERS CoV pneumonia in a patient with acquired immunodeficiency syndrome: a case report.

PubMed

Shalhoub, Sarah; AlZahrani, Abdulwahab; Simhairi, Raed; Mushtaq, Adnan

2015-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) may cause severe pneumonia with significant morbidity and mortality, particularly in patients with multiple comorbid condition. MERS CoV pneumonia has not been previously reported in patients with Human Immunodeficiency Virus (HIV). Herein, we report a case of MERS CoV pneumonia with a successful outcome in a patient recently diagnosed with HIV. Copyright © 2014 Elsevier B.V. All rights reserved.

Monte Carlo simulation of evaporation-driven self-assembly in suspensions of colloidal rods

NASA Astrophysics Data System (ADS)

Lebovka, Nikolai I.; Vygornitskii, Nikolai V.; Gigiberiya, Volodymyr A.; Tarasevich, Yuri Yu.

2016-12-01

The vertical drying of a colloidal film containing rodlike particles was studied by means of kinetic Monte Carlo (MC) simulation. The problem was approached using a two-dimensional square lattice, and the rods were represented as linear k -mers (i.e., particles occupying k adjacent sites). The initial state before drying was produced using a model of random sequential adsorption (RSA) with isotropic orientations of the k -mers (orientation of the k -mers along horizontal x and vertical y directions are equiprobable). In the RSA model, overlapping of the k -mers is forbidden. During the evaporation, an upper interface falls with a linear velocity of u in the vertical direction and the k -mers undergo translation Brownian motion. The MC simulations were run at different initial concentrations, pi, (pi∈[0 ,pj] , where pj is the jamming concentration), lengths of k -mers (k ∈[1 ,12 ] ), and solvent evaporation rates, u . For completely dried films, the spatial distributions of k -mers and their electrical conductivities in both x and y directions were examined. Significant evaporation-driven self-assembly and orientation stratification of the k -mers oriented along the x and y directions were observed. The extent of stratification increased with increasing value of k . The anisotropy of the electrical conductivity of the film can be finely regulated by changes in the values of pi, k , and u .

The Synechocystis PCC6803 MerA-like enzyme operates in the reduction of both mercury and uranium under the control of the glutaredoxin 1 enzyme.

PubMed

Marteyn, Benoit; Sakr, Samer; Farci, Sandrine; Bedhomme, Mariette; Chardonnet, Solenne; Decottignies, Paulette; Lemaire, Stéphane D; Cassier-Chauvat, Corinne; Chauvat, Franck

2013-09-01

In a continuing effort to analyze the selectivity/redundancy of the three glutaredoxin (Grx) enzymes of the model cyanobacterium Synechocystis PCC6803, we have characterized an enzyme system that plays a crucial role in protection against two toxic metal pollutants, mercury and uranium. The present data show that Grx1 (Slr1562 in CyanoBase) selectively interacts with the presumptive mercuric reductase protein (Slr1849). This MerA enzyme plays a crucial role in cell defense against both mercuric and uranyl ions, in catalyzing their NADPH-driven reduction. Like MerA, Grx1 operates in cell protection against both mercury and uranium. The Grx1-MerA interaction requires cysteine 86 (C86) of Grx1 and C78 of MerA, which is critical for its reductase activity. MerA can be inhibited by glutathionylation and subsequently reactivated by Grx1, likely through deglutathionylation. The two Grx1 residues C31, which belongs to the redox active site (CX(2)C), and C86, which operates in MerA interactions, are both required for reactivation of MerA. These novel findings emphasize the role of glutaredoxins in tolerance to metal stress as well as the evolutionary conservation of the glutathionylation process, so far described mostly for eukaryotes.

The Synechocystis PCC6803 MerA-Like Enzyme Operates in the Reduction of Both Mercury and Uranium under the Control of the Glutaredoxin 1 Enzyme

PubMed Central

Marteyn, Benoit; Sakr, Samer; Farci, Sandrine; Bedhomme, Mariette; Chardonnet, Solenne; Decottignies, Paulette; Lemaire, Stéphane D.; Cassier-Chauvat, Corinne

2013-01-01

In a continuing effort to analyze the selectivity/redundancy of the three glutaredoxin (Grx) enzymes of the model cyanobacterium Synechocystis PCC6803, we have characterized an enzyme system that plays a crucial role in protection against two toxic metal pollutants, mercury and uranium. The present data show that Grx1 (Slr1562 in CyanoBase) selectively interacts with the presumptive mercuric reductase protein (Slr1849). This MerA enzyme plays a crucial role in cell defense against both mercuric and uranyl ions, in catalyzing their NADPH-driven reduction. Like MerA, Grx1 operates in cell protection against both mercury and uranium. The Grx1-MerA interaction requires cysteine 86 (C86) of Grx1 and C78 of MerA, which is critical for its reductase activity. MerA can be inhibited by glutathionylation and subsequently reactivated by Grx1, likely through deglutathionylation. The two Grx1 residues C31, which belongs to the redox active site (CX2C), and C86, which operates in MerA interactions, are both required for reactivation of MerA. These novel findings emphasize the role of glutaredoxins in tolerance to metal stress as well as the evolutionary conservation of the glutathionylation process, so far described mostly for eukaryotes. PMID:23852862

KENNEDY SPACE CENTER, FLA. - After arriving at Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off its transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - After arriving at Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off its transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) reaches the top of the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) reaches the top of the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off the transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off the transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is moved inside the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5..

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is moved inside the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5..

Etude des phenomenes dynamiques ultrarapides et des caracteristiques impulsionnelles d'emission terahertz du supraconducteur YBCO

NASA Astrophysics Data System (ADS)

Savard, Stephane

Les premieres etudes d'antennes a base de supraconducteurs a haute temperature critique emettant une impulsion electromagnetique dont le contenu en frequence se situe dans le domaine terahertz remontent a 1996. Une antenne supraconductrice est formee d'un micro-pont d'une couche mince supraconductrice sur lequel un courant continu est applique. Un faisceau laser dans le visible est focalise sur le micro-pont et place le supraconducteur dans un etat hors-equilibre ou des paires sont brisees. Grace a la relaxation des quasiparticules en surplus et eventuellement de la reformation des paires supraconductrices, nous pouvons etudier la nature de la supraconductivite. L'analyse de la cinetique temporelle du champ electromagnetique emis par une telle antenne terahertz supraconductrice s'est averee utile pour decrire qualitativement les caracteristiques de celle-ci en fonction des parametres d'operation tels que le courant applique, la temperature et la puissance d'excitation. La comprehension de l'etat hors-equilibre est la cle pour comprendre le fonctionnement des antennes terahertz supraconductrices a haute temperature critique. Dans le but de comprendre ultimement cet etat hors-equilibre, nous avions besoin d'une methode et d'un modele pour extraire de facon plus systematique les proprietes intrinseques du materiau qui compose l'antenne terahertz a partir des caracteristiques d'emission de celle-ci. Nous avons developpe une procedure pour calibrer le spectrometre dans le domaine temporel en utilisant des antennes terahertz de GaAs bombarde aux protons H+ comme emetteur et detecteur. Une fois le montage calibre, nous y avons insere une antenne emettrice dipolaire de YBa 2Cu3O7-delta . Un modele avec des fonctions exponentielles de montee et de descente du signal est utilise pour lisser le spectre du champ electromagnetique de l'antenne de YBa 2Cu3O7-delta, ce qui nous permet d'extraire les proprietes intrinseques de ce dernier. Pour confirmer la validite du modele choisi, nous avons mesure les proprietes intrinseques du meme echantillon de YBa2Cu3O7- delta avec la technique pompe-visible et sonde-terahertz donnant, elle aussi, acces aux temps caracteristiques regissant l'evolution hors-equilibre de ce materiau. Dans le meilleur scenario, ces temps caracteristiques devraient correspondre a ceux evalues grace a la modelisation des antennes. Un bon controle des parametres de croissance des couches minces supraconductrices et de fabrication du dispositif nous a permis de realiser des antennes d'emission terahertz possedant d'excellentes caracteristiques en terme de largeur de bande d'emission (typiquement 3 THz) exploitables pour des applications de spectroscopie resolue dans le domaine temporel. Le modele developpe et retenu pour le lissage du spectre terahertz decrit bien les caracteristiques de l'antenne supraconductrice pour tous les parametres d'operation. Toutefois, le lien avec la technique pompe-sonde lors de la comparaison des proprietes intrinseques n'est pas direct malgre que les deux techniques montrent que le temps de relaxation des porteurs augmente pres de la temperature critique. Les donnees en pompe-sonde indiquent que la mesure du temps de relaxation depend de la frequence de la sonde, ce qui complique la correspondance des proprietes intrinseques entre les deux techniques. De meme, le temps de relaxation extrait a partir du spectre de l'antenne terahertz augmente en s'approchant de la temperature critique (T c) de YBa2Cu 3O7-delta. Le comportement en temperature du temps de relaxation correspond a une loi de puissance qui est fonction de l'inverse du gap supraconducteur avec un exposant 5 soit 1/Delta 5(T). Le travail presente dans cette these permet de mieux decrire les caracteristiques des antennes supraconductrices a haute temperature critique et de les relier aux proprietes intrinseques du materiau qui les compose. De plus, cette these presente les parametres a ajuster comme le courant applique, la puissance de la pompe, la temperature d'operation, etc, afin d'optimiser l'emission et les performances de ces antennes supraconductrices entre autres pour maximiser leur etendue en frequence dans une perspective d'application en spectroscopie terahertz. Cependant, plusieurs des resultats obtenus soulevent la difficulte de decrire l'etat hors-equilibre et la necessite de developper une theorie pour le supraconducteur YBa2 Cu3O7-delta

Error discrimination of an operational hydrological forecasting system at a national scale

NASA Astrophysics Data System (ADS)

Jordan, F.; Brauchli, T.

2010-09-01

The use of operational hydrological forecasting systems is recommended for hydropower production as well as flood management. However, the forecast uncertainties can be important and lead to bad decisions such as false alarms and inappropriate reservoir management of hydropower plants. In order to improve the forecasting systems, it is important to discriminate the different sources of uncertainties. To achieve this task, reanalysis of past predictions can be realized and provide information about the structure of the global uncertainty. In order to discriminate between uncertainty due to the weather numerical model and uncertainty due to the rainfall-runoff model, simulations assuming perfect weather forecast must be realized. This contribution presents the spatial analysis of the weather uncertainties and their influence on the river discharge prediction of a few different river basins where an operational forecasting system exists. The forecast is based on the RS 3.0 system [1], [2], which is also running the open Internet platform www.swissrivers.ch [3]. The uncertainty related to the hydrological model is compared to the uncertainty related to the weather prediction. A comparison between numerous weather prediction models [4] at different lead times is also presented. The results highlight an important improving potential of both forecasting components: the hydrological rainfall-runoff model and the numerical weather prediction models. The hydrological processes must be accurately represented during the model calibration procedure, while weather prediction models suffer from a systematic spatial bias. REFERENCES [1] Garcia, J., Jordan, F., Dubois, J. & Boillat, J.-L. 2007. "Routing System II, Modélisation d'écoulements dans des systèmes hydrauliques", Communication LCH n° 32, Ed. Prof. A. Schleiss, Lausanne [2] Jordan, F. 2007. Modèle de prévision et de gestion des crues - optimisation des opérations des aménagements hydroélectriques à accumulation pour la réduction des débits de crue, thèse de doctorat n° 3711, Ecole Polytechnique Fédérale, Lausanne [3] Keller, R. 2009. "Le débit des rivières au peigne fin", Revue Technique Suisse, N°7/8 2009, Swiss engineering RTS, UTS SA, Lausanne, p. 11 [4] Kaufmann, P., Schubiger, F. & Binder, P. 2003. Precipitation forecasting by a mesoscale numerical weather prediction (NWP) model : eight years of experience, Hydrology and Earth System

Challenges presented by MERS corona virus, and SARS corona virus to global health.

PubMed

Al-Hazmi, Ali

2016-07-01

Numerous viral infections have arisen and affected global healthcare facilities. Millions of people are at severe risk of acquiring several evolving viral infections through several factors. In the present article we have described about risk factors, chance of infection, and prevention methods of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and severe acute respiratory syndrome (SARS-CoV), human coronaviruses (CoVs) frequently cause a normal cold which is mild and self-restricting. Zoonotic transmission of CoVs such as the newly discovered MERS-CoV and SARS-CoV, may be associated with severe lower respiratory tract infection. The present review provides the recent clinical and pathological information on MERS and SARS. The task is to transform these discoveries about MERS and SARS pathogenesis and to develop intervention methods that will eventually allow the effective control of these recently arising severe viral infections. Global health sector has learnt many lessons through the recent outbreak of MERS and SARS, but the need for identifying new antiviral treatment was not learned. In the present article we have reviewed the literature on the several facets like transmission, precautions and effectiveness of treatments used in patients with MERS-CoV and SARS infections.

Influence of anisotropy on percolation and jamming of linear k-mers on square lattice with defects

NASA Astrophysics Data System (ADS)

Tarasevich, Yu Yu; Laptev, V. V.; Burmistrov, A. S.; Shinyaeva, T. S.

2015-09-01

By means of the Monte Carlo simulation, we study the layers produced by the random sequential adsorption of the linear rigid objects (k-mers also known as rigid or stiff rods, sticks, needles) onto the square lattice with defects in the presence of an external field. The value of k varies from 2 to 32. The point defects randomly and uniformly placed on the substrate hinder adsorption of the elongated objects. The external field affects isotropic deposition of the particles, consequently the deposited layers are anisotropic. We study the influence of the defect concentration, the length of the objects, and the external field on the percolation threshold and the jamming concentration. Our main findings are (i) the critical defect concentration at which the percolation never occurs even at jammed state decreases for short k-mers (k < 16) and increases for long k-mers (k > 16) as anisotropy increases, (ii) the corresponding critical k-mer concentration decreases with anisotropy growth, (iii) the jamming concentration decreases drastically with growth of k-mer length for any anisotropy, (iv) for short k-mers, the percolation threshold is almost insensitive to the defect concentration for any anisotropy.

Facteurs de risque de l'inobservance thérapeutique chez les patients schizophrènes: étude cas- témoins'

PubMed Central

Aarab, Chadya; Elghazouani, Fatima; Aalouane, Rachid; Rammouz, Ismail

2015-01-01

Les progrès réalisés dans le traitement de la schizophrénie n'ont jusqu'ici pas modifié de manière radicale l'importance de l'adhésion des patients à leur médication. L'objectif de ce travail est d'identifier les facteurs de risque de l'abandon du traitement sur un échantillon marocain de malades schizophrènes. C'est une étude transversale menée au centre psychiatrique universitaire de Fès sur une période de 4 mois. Les malades inclus présentaient une schizophrénie ou un trouble schizo-affectif, sélectionnés en deux groupes observant et non observant. L’évaluation de l'observance a été faite par un hétéro-questionnaire comprenant une liste de causes d'abandon du traitement avec des réponses par oui ou non et à l'aide de l’échelle MARS (Medication Adherence Rating Scale). Le traitement statistique des résultats a été réalisé par le logiciel Epi Info version 3.5.1. On a recruté 164 participants, 112 étaient des malades non observants à leur traitement (cas) et 52 patients bien observants (témoins). L’âge moyen est 31 ans, avec une prédominance masculine. Les facteurs de risque d'inobservance thérapeutique sont: l’âge jeune, le sexe masculin, le célibat, les troubles addictifs. Les principales raisons d'abandon du traitement sont le changement fréquent du médecin, le manque d'informations sur la maladie, un mauvais insight et les effets secondaires des antipsychotiques. Le groupe de schizophrènes non adhérents à leur traitement pharmacologique avait un score élevé à l’échelle MARS dans 80% cas. Ces résultats doivent être pris en considération par le personnel soignant pour optimiser l'observance thérapeutique chez les patients souffrant de schizophrénie. PMID:26161196

Identification des objets et detection de leur alignement en utilisant la technologie RFID

NASA Astrophysics Data System (ADS)

Rahma, Zayoud

De nos jours, les vehicules motorises sont essentiels dans notre vie quotidienne, d'ou la necessite de leur approvisionnement en carburant. L'approvisionnement en carburant peut entrainer certains inconvenients, tels que: les files d'attente, la disponibilite non-continuelle du carburant et les fraudes. Les problemes d'attente et de disponibilite non-continuelle du carburant peuvent etre facilement resolus en allant a une autre station d'essence aux alentours si disponibles. Par contre le probleme de fraudes est plus difficile a resoudre. De ce fait, decoule notre solution qui consiste a developper un systeme intelligent pour la gestion d'approvisionnement en carburant afin de remedier a ce probleme de fraudes. Pour des raisons de surete, il faut eviter les risques d'etincelles dans l'environnement du carburant. En particulier, il convient de ne pas utiliser un systeme utilisant 1'electricite proche de la pompe, du tuyau ou du reservoir du carburant du vehicule. Nous avons choisi la technologie RFID (Radio Frequency IDentification) et avons opte pour l'utilisation des etiquettes passives, etant donne que les etiquettes semi-passives ou actives contiennent une batterie electrique et sont nettement plus cheres. Un vehicule motorise sera identifie avec une etiquette RFID passive collee au-dessus du goulot de son reservoir. Deux autres etiquettes RFID seront placees sur le pistolet de sorte que le flux du carburant ne sera autorise que lorsque les trois etiquettes sont alignees. Notre travail etait a la demande d'une entreprise petroliere ayant une chaine internationale de stations de carburant. Le travail consiste en la conception, par la recherche, du systeme requis et s'articule sur l'optimisation de la topologie des antennes et des etiquettes de sorte que le systeme juge qu'il y a alignement lorsque le bec du pistolet est fonce dans le goulot du reservoir, et par consequent autorise le versement du carburant. Dans tous les autres cas, le systeme doit juger qu'il n'y a pas alignement et par consequent le flux du carburant n'est pas autorise. Mots cles: RFID, identification, localisation, alignement, fraudes, station-service.

High Prevalence of Middle East Respiratory Coronavirus in Young Dromedary Camels in Jordan.

PubMed

van Doremalen, Neeltje; Hijazeen, Zaidoun S K; Holloway, Peter; Al Omari, Bilal; McDowell, Chester; Adney, Danielle; Talafha, Hani A; Guitian, Javier; Steel, John; Amarin, Nadim; Tibbo, Markos; Abu-Basha, Ehab; Al-Majali, Ahmad M; Munster, Vincent J; Richt, Juergen A

2017-02-01

Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) was determined in 45 dromedary camels from two geographically separated herds in Jordan. Virus shedding was only detected in swabs obtained from the respiratory tract and primarily observed in camels younger than 3 years. MERS-CoV seroprevalence increased with age of camels. Bovine and sheep sera were seronegative. Phylogenetic analysis of partial S2 clustered the Jordanian MERS-CoV strains with contemporary MERS-CoV strains associated with nosocomial outbreaks.

A phylogenetically distinct Middle East respiratory syndrome coronavirus detected in a dromedary calf from a closed dairy herd in Dubai with rising seroprevalence with age

PubMed Central

Wernery, Ulrich; Rasoul, IHassab El; Wong, Emily YM; Joseph, Marina; Chen, Yixin; Jose, Shanty; Tsang, Alan KL; Patteril, Nissy Annie Georgy; Chen, Honglin; Elizabeth, Shyna K; Yuen, Kwok-Yung; Joseph, Sunitha; Xia, Ningshao; Wernery, Renate; Lau, Susanna KP; Woo, Patrick CY

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) was detected by monoclonal antibody-based nucleocapsid protein-capture enzyme-linked immunosorbent assay (ELISA), RNA detection, and viral culture from the nasal sample of a 1-month-old dromedary calf in Dubai with sudden death. Whole genome phylogeny showed that this MERS-CoV strain did not cluster with the other MERS-CoV strains from Dubai that we reported recently. Instead, it formed a unique branch more closely related to other MERS-CoV strains from patients in Qatar and Hafr-Al-Batin in Saudi Arabia, as well as the MERS-CoV strains from patients in the recent Korean outbreak, in which the index patient acquired the infection during travel in the eastern part of the Arabian Peninsula. Non-synonymous mutations, resulting in 11 unique amino acid differences, were observed between the MERS-CoV genome from the present study and all the other available MERS-CoV genomes. Among these 11 unique amino acid differences, four were found in ORF1ab, three were found in the S1 domain of the spike protein, and one each was found in the proteins encoded by ORF4b, ORF5, envelope gene, and ORF8. MERS-CoV detection for all other 254 dromedaries in this closed dairy herd was negative by nucleocapsid protein-capture ELISA and RNA detection. MERS-CoV IgG sero-positivity gradually increased in dromedary calves with increasing age, with positivity rates of 75% at zero to three months, 79% at four months, 89% at five to six months, and 90% at seven to twelve months. The development of a rapid antigen detection kit for instantaneous diagnosis is warranted. PMID:26632876

Mitogenic signals and transforming potential of Nyk, a newly identified neural cell adhesion molecule-related receptor tyrosine kinase.

PubMed Central

Ling, L; Kung, H J

1995-01-01

Nyk/Mer is a recently identified receptor tyrosine kinase with neural cell adhesion molecule-like structure (two immunoglobulin G-like domains and two fibronectin III-like domains) in its extracellular region and belongs to the Ufo/Axl family of receptors. The ligand for Nyk/Mer is presently unknown, as are the signal transduction pathways mediated by this receptor. We constructed and expressed a chimeric receptor (Fms-Nyk) composed of the extracellular domain of the human colony-stimulating factor 1 receptor (Fms) and the transmembrane and cytoplasmic domains of human Nyk/Mer in NIH 3T3 fibroblasts in order to investigate the mitogenic signaling and biochemical properties of Nyk/Mer. Colony-stimulating factor 1 stimulation of the Fms-Nyk chimeric receptor in transfected NIH 3T3 fibroblasts leads to a transformed phenotype and generates a proliferative response in the absence of other growth factors. We show that phospholipase C gamma, phosphatidylinositol 3-kinase/p70 S6 kinase, Shc, Grb2, Raf-1, and mitogen-activated protein kinase are downstream components of the Nyk/Mer signal transduction pathways. In addition, Nyk/Mer weakly activates p90rsk, while stress-activated protein kinase, Ras GTPase-activating protein (GAP), and GAP-associated p62 and p190 proteins are not activated or tyrosine phosphorylated by Nyk/Mer. An analysis comparing the Nyk/Mer signal cascade with that of the epidermal growth factor receptor indicates substrate preferences by these two receptors. Our results provide a detailed description of the Nyk/Mer signaling pathways. Given the structural similarity between the Ufo/Axl family receptors, some of the information may also be applied to other members of this receptor tyrosine kinase family. PMID:8524223

Immunodominant epitopes in herpes simplex virus type 2 glycoprotein D are recognized by CD4 lymphocytes from both HSV-1 and HSV-2 seropositive subjects.

PubMed

Kim, Min; Taylor, Janette; Sidney, John; Mikloska, Zorka; Bodsworth, Neil; Lagios, Katerina; Dunckley, Heather; Byth-Wilson, Karen; Denis, Martine; Finlayson, Robert; Khanna, Rajiv; Sette, Alessandro; Cunningham, Anthony L

2008-11-01

In human recurrent cutaneous herpes simplex, there is a sequential infiltrate of CD4 and then CD8 lymphocytes into lesions. CD4 lymphocytes are the major producers of the key cytokine IFN-gamma in lesions. They recognize mainly structural proteins and especially glycoproteins D and B (gD and gB) when restimulated in vitro. Recent human vaccine trials using recombinant gD showed partial protection of HSV seronegative women against genital herpes disease and also, in placebo recipients, showed protection by prior HSV1 infection. In this study, we have defined immunodominant peptide epitopes recognized by 8 HSV1(+) and/or 16 HSV2(+) patients using (51)Cr-release cytotoxicity and IFN-gamma ELISPOT assays. Using a set of 39 overlapping 20-mer peptides, more than six immunodominant epitopes were defined in gD2 (two to six peptide epitopes were recognized for each subject). Further fine mapping of these responses for 4 of the 20-mers, using a panel of 9 internal 12-mers for each 20-mers, combined with MHC II typing and also direct in vitro binding assay of these peptides to individual DR molecules, showed more than one epitope per 20-mers and promiscuous binding of individual 20-mers and 12-mers to multiple DR types. All four 20-mer peptides were cross-recognized by both HSV1(+)/HSV2(-) and HSV1(-)/HSV2(+) subjects, but the sites of recognition differed within the 20-mers where their sequences were divergent. This work provides a basis for CD4 lymphocyte cross-recognition of gD2 and possibly cross-protection observed in previous clinical studies and in vaccine trials.

Epidemiological investigation of Middle East respiratory syndrome coronavirus in dromedary camel farms linked with human infection in Abu Dhabi Emirate, United Arab Emirates.

PubMed

Muhairi, Salama Al; Hosani, Farida Al; Eltahir, Yassir M; Mulla, Mariam Al; Yusof, Mohammed F; Serhan, Wissam S; Hashem, Farouq M; Elsayed, Elsaeid A; Marzoug, Bahaaeldin A; Abdelazim, Assem S

2016-12-01

The objective of this research was to investigate the prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) infection primarily in dromedary camel farms and the relationship of those infections with infections in humans in the Emirate of Abu Dhabi. Nasal swabs from 1113 dromedary camels (39 farms) and 34 sheep (1 farm) and sputum samples from 2 MERS-CoV-infected camel farm owners and 1 MERS-CoV-infected sheep farm owner were collected. Samples from camels and humans underwent real-time reverse-transcription quantitative PCR screening to detect MERS-CoV. In addition, sequencing and phylogenetic analysis of partially characterized MERS-CoV genome fragments obtained from camels were performed. Among the 40 farms, 6 camel farms were positive for MERS-CoV; the virus was not detected in the single sheep farm. The maximum duration of viral shedding from infected camels was 2 weeks after the first positive test result as detected in nasal swabs and in rectal swabs obtained from infected calves. Three partial camel sequences characterized in this study (open reading frames 1a and 1ab, Spike1, Spike2, and ORF4b) together with the corresponding regions of previously reported MERS-CoV sequence obtained from one farm owner were clustering together within the larger MERS-CoV sequences cluster containing human and camel isolates reported for the Arabian Peninsula. Data provided further evidence of the zoonotic potential of MERS-CoV infection and strongly suggested that camels may have a role in the transmission of the virus to humans.

Abelson Kinase Inhibitors Are Potent Inhibitors of Severe Acute Respiratory Syndrome Coronavirus and Middle East Respiratory Syndrome Coronavirus Fusion

PubMed Central

Coleman, Christopher M.; Sisk, Jeanne M.; Mingo, Rebecca M.; Nelson, Elizabeth A.; White, Judith M.

2016-01-01

ABSTRACT The highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) cause significant morbidity and morality. There is currently no approved therapeutic for highly pathogenic coronaviruses, even as MERS-CoV is spreading throughout the Middle East. We previously screened a library of FDA-approved drugs for inhibitors of coronavirus replication in which we identified Abelson (Abl) kinase inhibitors, including the anticancer drug imatinib, as inhibitors of both SARS-CoV and MERS-CoV in vitro. Here we show that the anti-CoV activity of imatinib occurs at the early stages of infection, after internalization and endosomal trafficking, by inhibiting fusion of the virions at the endosomal membrane. We specifically identified the imatinib target, Abelson tyrosine-protein kinase 2 (Abl2), as required for efficient SARS-CoV and MERS-CoV replication in vitro. These data demonstrate that specific approved drugs can be characterized in vitro for their anticoronavirus activity and used to identify host proteins required for coronavirus replication. This type of study is an important step in the repurposing of approved drugs for treatment of emerging coronaviruses. IMPORTANCE Both SARS-CoV and MERS-CoV are zoonotic infections, with bats as the primary source. The 2003 SARS-CoV outbreak began in Guangdong Province in China and spread to humans via civet cats and raccoon dogs in the wet markets before spreading to 37 countries. The virus caused 8,096 confirmed cases of SARS and 774 deaths (a case fatality rate of ∼10%). The MERS-CoV outbreak began in Saudi Arabia and has spread to 27 countries. MERS-CoV is believed to have emerged from bats and passed into humans via camels. The ongoing outbreak of MERS-CoV has resulted in 1,791 cases of MERS and 640 deaths (a case fatality rate of 36%). The emergence of SARS-CoV and MERS-CoV provides evidence that coronaviruses are currently spreading from zoonotic sources and can be highly pathogenic, causing serious morbidity and mortality in humans. Treatment of SARS-CoV and MERS-CoV infection is limited to providing supportive therapy consistent with any serious lung disease, as no specific drugs have been approved as therapeutics. Highly pathogenic coronaviruses are rare and appear to emerge and disappear within just a few years. Currently, MERS-CoV is still spreading, as new infections continue to be reported. The outbreaks of SARS-CoV and MERS-CoV and the continuing diagnosis of new MERS cases highlight the need for finding therapeutics for these diseases and potential future coronavirus outbreaks. Screening FDA-approved drugs streamlines the pipeline for this process, as these drugs have already been tested for safety in humans. PMID:27466418

Occurrence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) across the Gulf Corporation Council countries: Four years update.

PubMed

Aly, Mahmoud; Elrobh, Mohamed; Alzayer, Maha; Aljuhani, Sameera; Balkhy, Hanan

2017-01-01

The emergence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infections has become a global issue of dire concerns. MERS-CoV infections have been identified in many countries all over the world whereas high level occurrences have been documented in the Middle East and Korea. MERS-CoV is mainly spreading across the geographical region of the Middle East, especially in the Arabian Peninsula, while some imported sporadic cases were reported from the Europe, North America, Africa, and lately Asia. The prevalence of MERS-CoV infections across the Gulf Corporation Council (GCC) countries still remains unclear. Therefore, the objective of the current study was to report the prevalence of MERS-CoV in the GCC countries and to also elucidate on its demographics in the Arabian Peninsula. To date, the World Health Organization (WHO) has reported 1,797 laboratory-confirmed cases of MERS-CoV infection since June 2012, involving 687 deaths in 27 different countries worldwide. Within a time span of 4 years from June 2012 to July 2016, we collect samples form MERS-CoV infected individuals from National Guard Hospital, Riyadh, and Ministry of health Saudi Arabia and other GCC countries. Our data comprise a total of 1550 cases (67.1% male and 32.9% female). The age-specific prevalence and distribution of MERS-CoV was as follow: <20 yrs (36 cases: 3.28%), 20-39 yrs (331 cases: 30.15%), 40-59 yrs (314 cases: 28.60%), and the highest-risk elderly group aged ≥60 yrs (417 cases: 37.98%). The case distribution among GCC countries was as follows: Saudi Arabia (1441 cases: 93%), Kuwait (4 cases: 0.3%), Bahrain (1 case: 0.1%), Oman (8 cases: 0.5%), Qatar (16 cases: 1.0%), and United Arab Emirates (80 cases: 5.2%). Thus, MERS-CoV was found to be more prevalent in Saudi Arabia especially in Riyadh, where 756 cases (52.4%) were the worst hit area of the country identified, followed by the western region Makkah where 298 cases (20.6%) were recorded. This prevalence update indicates that the Arabian Peninsula, particularly Saudi Arabia, is the hardest hit region regarding the emerging MERS-CoV infections worldwide. GCC countries including Saudi Arabia now have the infrastructure in place that allows physicians and scientific community to identify and immediately respond to the potential risks posed by new outbreaks of MERS-CoV infections in the region. Given the continuum of emergence and the large magnitude of the disease in our region, more studies will be required to bolster capabilities for timely detection and effective control and prevention of MERS-CoV in our region.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and Mars Exploration Rover 2 (MER-A) are ready for the third launch attempt after weather concerns postponed earlier attempts. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and Mars Exploration Rover 2 (MER-A) are ready for the third launch attempt after weather concerns postponed earlier attempts. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) nears the top of the launch tower. The fairing will be installed around the payload for protection during launch on a Delta II rocket. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) nears the top of the launch tower. The fairing will be installed around the payload for protection during launch on a Delta II rocket. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

Representational Competence: Towards a Distributed and Embodied Cognition Account

ERIC Educational Resources Information Center

Pande, Prajakt; Chandrasekharan, Sanjay

2017-01-01

Multiple external representations (MERs) are central to the practice and learning of science, mathematics and engineering, as the phenomena and entities investigated and controlled in these domains are often not available for perception and action. MERs therefore play a twofold constitutive role in reasoning in these domains. Firstly, MERs stand…

High Prevalence of Middle East Respiratory Coronavirus in Young Dromedary Camels in Jordan

PubMed Central

van Doremalen, Neeltje; Hijazeen, Zaidoun S.K.; Holloway, Peter; Al Omari, Bilal; McDowell, Chester; Adney, Danielle; Talafha, Hani A.; Guitian, Javier; Steel, John; Amarin, Nadim; Tibbo, Markos; Abu-Basha, Ehab; Al-Majali, Ahmad M.

2017-01-01

Abstract Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) was determined in 45 dromedary camels from two geographically separated herds in Jordan. Virus shedding was only detected in swabs obtained from the respiratory tract and primarily observed in camels younger than 3 years. MERS-CoV seroprevalence increased with age of camels. Bovine and sheep sera were seronegative. Phylogenetic analysis of partial S2 clustered the Jordanian MERS-CoV strains with contemporary MERS-CoV strains associated with nosocomial outbreaks. PMID:28009529

SARS and MERS: recent insights into emerging coronaviruses.

PubMed

de Wit, Emmie; van Doremalen, Neeltje; Falzarano, Darryl; Munster, Vincent J

2016-08-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 marked the second introduction of a highly pathogenic coronavirus into the human population in the twenty-first century. The continuing introductions of MERS-CoV from dromedary camels, the subsequent travel-related viral spread, the unprecedented nosocomial outbreaks and the high case-fatality rates highlight the need for prophylactic and therapeutic measures. Scientific advancements since the 2002-2003 severe acute respiratory syndrome coronavirus (SARS-CoV) pandemic allowed for rapid progress in our understanding of the epidemiology and pathogenesis of MERS-CoV and the development of therapeutics. In this Review, we detail our present understanding of the transmission and pathogenesis of SARS-CoV and MERS-CoV, and discuss the current state of development of measures to combat emerging coronaviruses.

Prophylaxis With a Middle East Respiratory Syndrome Coronavirus (MERS-CoV)–Specific Human Monoclonal Antibody Protects Rabbits From MERS-CoV Infection

PubMed Central

Houser, Katherine V.; Gretebeck, Lisa; Ying, Tianlei; Wang, Yanping; Vogel, Leatrice; Lamirande, Elaine W.; Bock, Kevin W.; Moore, Ian N.; Dimitrov, Dimiter S.; Subbarao, Kanta

2016-01-01

With >1600 documented human infections with Middle East respiratory syndrome coronavirus (MERS-CoV) and a case fatality rate of approximately 36%, medical countermeasures are needed to prevent and limit the disease. We examined the in vivo efficacy of the human monoclonal antibody m336, which has high neutralizing activity against MERS-CoV in vitro. m336 was administered to rabbits intravenously or intranasally before infection with MERS-CoV. Prophylaxis with m336 resulted in a reduction of pulmonary viral RNA titers by 40–9000-fold, compared with an irrelevant control antibody with little to no inflammation or viral antigen detected. This protection in rabbits supports further clinical development of m336. PMID:26941283

The impact of multichannel microelectrode recording (MER) in deep brain stimulation of the basal ganglia.

PubMed

Kinfe, Thomas M; Vesper, Jan

2013-01-01

Deep brain stimulation (DBS) of the basal ganglia (Ncl. subthalamicus, Ncl. ventralis intermedius thalami, globus pallidus internus) has become an evidence-based and well-established treatment option in otherwise refractory movement disorders. The Ncl. subthalamicus (STN) is the target of choice in Parkinson's disease.However, a considerable discussion is currently ongoing with regard to the necessity for micro-electrode recording (MER) in DBS surgery.The present review provides an overview on deep brain stimulation and (MER) of the STN in patients with Parkinson's disease. Detailed description is given concerning the multichannel MER systems nowadays available for DBS of the basal ganglia, especially of the STN, as a useful tool for target refinement. Furthermore, an overview is given of the historical aspects, spatial mapping of the STN by MER, and its impact for accuracy and precision in current functional stereotactic neurosurgery.The pros concerning target refinement by MER means on the one hand, and cons including increased bleeding risk, increased operation time, local or general anesthesia, and single versus multichannel microelectrode recording are discussed in detail. Finally, the authors favor the use of MER with intraoperative testing combined with imaging to achieve a more precise electrode placement, aiming to ameliorate clinical outcome in therapy-resistant movement disorders.

Conserved antigenic sites between MERS-CoV and Bat-coronavirus are revealed through sequence analysis.

PubMed

Sharmin, Refat; Islam, Abul B M M K

2016-01-01

MERS-CoV is a newly emerged human coronavirus reported closely related with HKU4 and HKU5 Bat coronaviruses. Bat and MERS corona-viruses are structurally related. Therefore, it is of interest to estimate the degree of conserved antigenic sites among them. It is of importance to elucidate the shared antigenic-sites and extent of conservation between them to understand the evolutionary dynamics of MERS-CoV. Multiple sequence alignment of the spike (S), membrane (M), enveloped (E) and nucleocapsid (N) proteins was employed to identify the sequence conservation among MERS and Bat (HKU4, HKU5) coronaviruses. We used various in silico tools to predict the conserved antigenic sites. We found that MERS-CoV shared 30 % of its S protein antigenic sites with HKU4 and 70 % with HKU5 bat-CoV. Whereas 100 % of its E, M and N protein's antigenic sites are found to be conserved with those in HKU4 and HKU5. This sharing suggests that in case of pathogenicity MERS-CoV is more closely related to HKU5 bat-CoV than HKU4 bat-CoV. The conserved epitopes indicates their evolutionary relationship and ancestry of pathogenicity.

Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

PubMed

Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

2017-08-01

The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.

Knowledge and Attitude of Dental Health Professionals about Middle East Respiratory Syndrome in Saudi Arabia

PubMed Central

Althomairy, Sameer Abdullah; Baseer, Mohammad Abdul; Assery, Mansour; Alsaffan, Abdulrahman Dahham

2018-01-01

Aim and Objective: This study aims to evaluate the knowledge and attitude of practicing dental health professionals (DHPs) (dentist and dental auxiliaries) toward Middle East Respiratory Syndrome coronavirus (MERS-CoV) in Saudi Arabia. Materials and Methods: A cross-sectional descriptive study was undertaken among practicing DHPs in Saudi Arabia. A total of 202 DHPs participated in this study. Knowledge and attitude were assessed using self-administered and pretested questionnaire. The questionnaire was administered online through Survey Monkey® program by sending link to the registered E-mail. Descriptive statistics were performed on demographic data. Mean knowledge and mean attitude scores of DHPs were calculated. Mann–Whitney U-test and Kruskal–Wallis tests were used to disclose the differences between study variables. Chi-square tests and Spearman's correlation tests were applied to find the associations between the variables. Results: The study participants showed mean knowledge score of 12.26 ± 2.27 (based on 17 knowledge questions) and attitude score of 8.63 ± 1.68 (based on 10 attitude questions). The spearman's test showed the positive correlation between knowledge and attitude of DHPs about MERS (r = 0.093, P = 0.188). Knowledge gaps were reflected in questions related to the duration of infectivity (47.5%), treatment of MERS (39.6%), reservoir of MERS-CoV (38.1%), availability of vaccination against MERS-CoV (25.2%), the likelihood of infection (24.3%), and the type of MERS-CoV (23.3%). DHPs showed a positive attitude toward adherence to universal precautions given by CDC and WHO (0.94 ± 0.25), active participation infection control program (0.94 ± 0.24), and use of gowns, gloves, mask, and goggles while dealing with MERS-CoV patients (0.97 ± 0.17). Male DHPs showed significantly higher knowledge and positive attitude toward MERS-CoV infection compared to females. Conclusion: DHPs participated in this study showed good knowledge and positive attitude toward MERS. However, still few lacunae in the knowledge and attitudes toward MERS-CoV were found requiring extensive educational programs. PMID:29780739

Rapid detection of MERS coronavirus-like viruses in bats: pote1ntial for tracking MERS coronavirus transmission and animal origin.

PubMed

Woo, Patrick C Y; Lau, Susanna K P; Chen, Yixin; Wong, Emily Y M; Chan, Kwok-Hung; Chen, Honglin; Zhang, Libiao; Xia, Ningshao; Yuen, Kwok-Yung

2018-03-07

Recently, we developed a monoclonal antibody-based rapid nucleocapsid protein detection assay for diagnosis of MERS coronavirus (MERS-CoV) in humans and dromedary camels. In this study, we examined the usefulness of this assay to detect other lineage C betacoronaviruses closely related to MERS-CoV in bats. The rapid MERS-CoV nucleocapsid protein detection assay was tested positive in 24 (88.9%) of 27 Tylonycteris bat CoV HKU4 (Ty-BatCoV-HKU4) RNA-positive alimentary samples of Tylonycteris pachypus and 4 (19.0%) of 21 Pipistrellus bat CoV HKU5 (Pi-BatCoV-HKU5) RNA-positive alimentary samples of Pipistrellus abramus. There was significantly more Ty-BatCoV-HKU4 RNA-positive alimentary samples than Pi-BatCoV-HKU5 RNA-positive alimentary samples that were tested positive by the rapid MERS-CoV nucleocapsid protein detection assay (P < 0.001 by Chi-square test). The rapid assay was tested negative in all 51 alimentary samples RNA-positive for alphacoronaviruses (Rhinolophus bat CoV HKU2, Myotis bat CoV HKU6, Miniopterus bat CoV HKU8 and Hipposideros batCoV HKU10) and 32 alimentary samples positive for lineage B (SARS-related Rhinolophus bat CoV HKU3) and lineage D (Rousettus bat CoV HKU9) betacoronaviruses. No significant difference was observed between the viral loads of Ty-BatCoV-HKU4/Pi-BatCoV-HKU5 RNA-positive alimentary samples that were tested positive and negative by the rapid test (Mann-Witney U test). The rapid MERS-CoV nucleocapsid protein detection assay is able to rapidly detect lineage C betacoronaviruses in bats. It detected significantly more Ty-BatCoV-HKU4 than Pi-BatCoV-HKU5 because MERS-CoV is more closely related to Ty-BatCoV-HKU4 than Pi-BatCoV-HKU5. This assay will facilitate rapid on-site mass screening of animal samples for ancestors of MERS-CoV and tracking transmission in the related bat species.

Electrical conductivity of a monolayer produced by random sequential adsorption of linear k -mers onto a square lattice

NASA Astrophysics Data System (ADS)

Tarasevich, Yuri Yu.; Goltseva, Valeria A.; Laptev, Valeri V.; Lebovka, Nikolai I.

2016-10-01

The electrical conductivity of a monolayer produced by the random sequential adsorption (RSA) of linear k -mers (particles occupying k adjacent adsorption sites) onto a square lattice was studied by means of computer simulation. Overlapping with predeposited k -mers and detachment from the surface were forbidden. The RSA process continued until the saturation jamming limit, pj. The isotropic (equiprobable orientations of k -mers along x and y axes) and anisotropic (all k -mers aligned along the y axis) depositions for two different models—of an insulating substrate and conducting k -mers (C model) and of a conducting substrate and insulating k -mers (I model)—were examined. The Frank-Lobb algorithm was applied to calculate the electrical conductivity in both the x and y directions for different lengths (k =1 - 128) and concentrations (p =0 - pj) of the k -mers. The "intrinsic electrical conductivity" and concentration dependence of the relative electrical conductivity Σ (p ) (Σ =σ /σm for the C model and Σ =σm/σ for the I model, where σm is the electrical conductivity of substrate) in different directions were analyzed. At large values of k the Σ (p ) curves became very similar and they almost coincided at k =128 . Moreover, for both models the greater the length of the k -mers the smoother the functions Σx y(p ) ,Σx(p ) and Σy(p ) . For the more practically important C model, the other interesting findings are (i) for large values of k (k =64 ,128 ), the values of Σx y and Σy increase rapidly with the initial increase of p from 0 to 0.1; (ii) for k ≥16 , all the Σx y(p ) and Σx(p ) curves intersect with each other at the same isoconductivity points; (iii) for anisotropic deposition, the percolation concentrations are the same in the x and y directions, whereas, at the percolation point the greater the length of the k -mers the larger the anisotropy of the electrical conductivity, i.e., the ratio σy/σx (>1 ).

Outbreak of Middle East respiratory syndrome coronavirus in Saudi Arabia: a retrospective study.

PubMed

Aleanizy, Fadilah Sfouq; Mohmed, Nahla; Alqahtani, Fulwah Y; El Hadi Mohamed, Rania Ali

2017-01-05

The Middle East respiratory syndrome (MERS) is proposed to be a zoonotic disease. Dromedary camels have been implicated due to reports that some confirmed cases were exposed to camels. Risk factors for MERS coronavirus (MERS-CoV) infections in humans are incompletely understood. This study aimed to describe the demographic characteristics, mortality rate, clinical manifestations and comorbidities with confirmed cases of MERS-CoV. Retrospective chart review were performed to identify all laboratory-confirmed cases of MERS-CoV in Saudi Arabia who reported to the Ministry of Health (MOH) of Saudi Arabia and WHO between April 23, 2014 and August 31, 2015. Patients' charts were also reviewed for demographic information, mortality, comorbidities, clinical presentations, health care facility and presented with descriptive and comparative statistics using non parametric binomial test and Chi-square test. Confirmed cases of male patients (61.1%) exceeded those of female patients (38.9%). Infections among Saudi patients (62.6%) exceeded those among non-Saudi patients (37.4%; P = 0.001). The majority of the patients were aged 21-40 years (37.4%) or 41-60 years (35.8%); 43 (22.6%) were aged >61 years, and (8) 4.2% were aged 0-20 years. There was a difference in mortality between confirmed MERS-CoV cases (63.7% alive versus 36.3% dead cases, respectively). Furthermore, fever with cough and shortness of breath (SOB) (n = 39; 20.5%), fever with cough (n = 29; 15.3%), fever (n = 18; 9.5%), and fever with SOB (n = 13; 6.8%), were the most common clinical manifestations associated with confirmed MERS-CoV cases. MERS-CoV is considered an epidemic in Saudi Arabia. The results of the present study showed that the frequency of cases is higher among men than women, in Saudi patients than non-Saudi, and those between 21 to 60 years are most affected. Further studies are required to improve the surveillance associated with MERS-CoV to get definite and clear answers and better understanding of the MERS-CoV outbreak as well the source, and route of infection transmission in Saudi Arabia.

Préface

NASA Astrophysics Data System (ADS)

Moncorgé, R.

2006-12-01

Cette nouvelle édition du Colloque UVX avait pour objectifs de : - réunir les chercheurs et les industriels intéressés par les applications et les développements les plus récents obtenus sur les sources UV, VUV et X, cohérentes ou incohérentes, et les optiques et matériaux associés ; - dresser un bilan des sources de photons à haute énergie et de leurs applications courantes et futures ; - susciter de nouvelles collaborations ; - ouvrir de nouveaux champs disciplinaires. Elle a été organisée par le laboratoire CIRIL au VVF de Colleville-sur-Mer, dans le département du Calvados, du 6 au 9 juin 2006, la journée du 5 juin ayant été consacrée à une réunion de travail du GDR CNRS SAXO, ce GDR regroupant une majorité de scientifiques concernés par le Colloque UVX. La manifestation a réuni ainsi une centaine de participants dont une dizaine d'exposants industriels. Parmi ces participants, trente étaient invités à donner une conférence orale. Une sélection a été faite également parmi les meilleures communications soumises par affiches pour qu'elles soient présentées oralement. Une trentaine de ces communications ont été préparées sous la forme d'articles de 6 à 12 pages et font l'objet de cet ouvrage. De nombreux travaux récents ont été exposés tant au niveau des sources que des techniques de caractérisation et des applications, ceci dans des domaines très divers allant de la physique des lasers et de la mise en forme spatiale et temporelle des faisceaux au domaine de l'imagerie médicale et biologiques en passant par les techniques de fabrication des cristaux, fibres et films minces organiques et inorganiques. Plusieurs résultats marquants en sont ressortis. Dans le domaine des sources, la mise en forme spatiale du faisceau laser utilisé pour la production d'harmoniques d'ordre élevé dans les gaz, ceci à l'aide de lames de phase peu onéreuses et simples d'utilisation, semble être une bonne solution pour accroître les efficacités de conversion et pour produire des impulsions UVX de quelques dizaines de microjoules. Parallèlement, des progrès notables ont été effectués dans la génération d'impulsions sub-100 as isolées accordables et de large bande spectrale en utilisant des impulsions de pompe ultracourtes bien contrôlée en phase. Il apparaît que la gamme spectrale accessible peut être encore largement étendue en jouant sur la longueur d'onde excitatrice et sur le milieu générateur pour pouvoir atteindre des impulsions de moins de 10 as. Des premiers résultats ont été aussi exposés concernant l'obtention d'un laser X à 18,9 nm pompé en incidence rasante (technique GRIP) à partir d'une cible de molybdène nickelloide et d'un laser Ti:Sa produisant des impulsions de plus de 2 microjoules. L'intérêt des milieux gazeux à excimères a été également de nouveau démontré pour l'amplification d'impulsions ultracourtes intenses TW dans le proche UV avec un contraste élevé (>1011). Bien qu'encore marginale, il faut enfin signaler l'arrivée des fibres optiques microstructurées avec la génération de supercontinuum de longueurs d'onde (spectre blanc) jusque dans le proche UV. Du côté des processus fondamentaux et des applications, sont particulièrement ressortis la caractérisation de plasmas denses utilisant des harmoniques élevées à l'aide d'une expérience interférométrique originale, la caractérisation de plasmas de taille nanométrique émetteurs de rayonnement X produits par interaction d'impulsions laser ultracourtes avec des agrégats de gaz rares ainsi que le dépôt de couches minces de biomolécules à l'aide de la technique MAPLE, technique susceptible d'améliorer la conservation des molécules, en particulier des protéines. Enfin, dans le domaine de la métrologie et de l'imagerie, l'importance des lames de phase dans la mise en forme spatiale des faisceaux, en particulier pour le projet Mega-Joule, a été de nouveau souligné, des progrès significatifs (réflectivité, bande passante, stabilité temporelle et thermique) ont été obtenus dans le domaine des revêtements interférentiels multicouches pour laser EUV autour de 40 nm, et des améliorations significatives, en particulier au niveau des détecteurs, ont été signalées dans le domaine de l'imagerie X du petit animal, la conception de sources dédiées à microfoyers délivrant des rayons X de basses énergies très rapides pour éviter le flou inhérent aux mouvements de l'animal restant encore nécessaire. Le Colloque a permis des échanges très fructueux entre laséristes et utilisateurs et entre scientifiques et industriels commercialisant sources, systèmes et détecteurs. Il a permis également de donner la parole à des intervenants très jeunes et souvent très brillants (doctorants et jeunes chercheurs) qui seront sans aucun doute les futurs responsables de nos laboratoires, centres de recherche et entreprises. Les progrès constatés résultant de travaux portant souvent sur les deux années écoulées (puisque c'est la fréquence choisie pour ce Colloque) et les résultats obtenus comme les perspectives annoncées montrant de nouveau toute la pertinence de cette manifestation, celle-ci sera reconduite en 2008.

Viral peptides-MHC interaction: Binding probability and distance from human peptides.

PubMed

Santoni, Daniele

2018-05-23

Identification of peptides binding to MHC class I complex can play a crucial role in retrieving potential targets able to trigger an immune response. Affinity binding of viral peptides can be estimated through effective computational methods that in the most of cases are based on machine learning approach. Achieving a better insight into peptide features that impact on the affinity binding rate is a challenging issue. In the present work we focused on 9-mer peptides of Human immunodeficiency virus type 1 and Human herpes simplex virus 1, studying their binding to MHC class I. Viral 9-mers were partitioned into different classes, where each class is characterized by how far (in terms of mutation steps) the peptides belonging to that class are from human 9-mers. Viral 9-mers were partitioned in different classes, based on the number of mutation steps they are far from human 9-mers. We showed that the overall binding probability significantly differs among classes, and it typically increases as the distance, computed in terms of number of mutation steps from the human set of 9-mers, increases. The binding probability is particularly high when considering viral 9-mers that are far from all human 9-mers more than three mutation steps. A further evidence, providing significance to those special viral peptides and suggesting a potential role they can play, comes from the analysis of their distribution along viral genomes, as it revealed they are not randomly located, but they preferentially occur in specific genes. Copyright © 2018 Elsevier B.V. All rights reserved.

Worry experienced during the 2015 Middle East Respiratory Syndrome (MERS) pandemic in Korea

PubMed Central

Ro, Jun-Soo; Lee, Jin-Seok; Kang, Sung-Chan; Jung, Hye-Min

2017-01-01

Background Korea failed in its risk communication during the early stage of the Middle East Respiratory Syndrome (MERS) outbreak; consequently, it faced difficulties in managing MERS, while disease-related worry increased. Disease-related worry can help disease prevention and management, but can also have a detrimental effect. This study measured the overall level of disease-related worry during the MERS outbreak period in Korea and the influencing factors and levels of disease-related worry during key outbreak periods. Methods The cross-sectional survey included 1,000 adults who resided in Korea. An ordinal logistic regression was performed for the overall level of MERS-related worry, and influencing factors of worry were analyzed. A reliability test was performed on the levels of MERS-related worry during key outbreak periods. Results The overall level of MERS-related worry was 2.44. Multivariate analysis revealed that women and respondents w very poor subjective health status had higher levels of worry. Respondents with very high stress in daily life had higher levels of worry than those who reported having little stress. The reliability test results on MERS-related worry scores during key outbreak periods showed consistent scores during each period. Conclusion Level of worry increased in cases having higher perceived susceptibility and greater trust in informal information, while initial stage of outbreak was closely associated with that at later stages. These findings suggest the importance of managing the level of worry by providing timely and accurate disease-related information during the initial stage of disease outbreak. PMID:28273131

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

KENNEDY SPACE CENTER, FLA. - A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the outside of the launch tower. Visible on another side is the Delta II rocket that will carry the payload into space. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the outside of the launch tower. Visible on another side is the Delta II rocket that will carry the payload into space. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

Effect of parallel radiofrequency transmission on arterial input function selection in dynamic contrast-enhanced 3 Tesla pelvic MRI.

PubMed

Chafi, Hatim; Elias, Saba N; Nguyen, Huyen T; Friel, Harry T; Knopp, Michael V; Guo, BeiBei; Heymsfield, Steven B; Jia, Guang

2016-01-01

To evaluate whether parallel radiofrequency transmission (mTX) can improve the symmetry of the left and right femoral arteries in dynamic contrast enhanced magnetic resonance imaging (DCE-MRI) of prostate and bladder cancer. Eighteen prostate and 24 bladder cancer patients underwent 3.0 Tesla DCE-MRI scan with a single transmission channel coil. Subsequently, 21 prostate and 21 bladder cancer patients were scanned using the dual channel mTX upgrade. The precontrast signal ( S0) and the maximum enhancement ratio (MER) were measured in both the left and the right femoral arteries. Within the patient cohort, the ratio of S0 and MER in the left artery to that in the right artery ( S0_LR, MER_LR) was calculated with and without the use of mTX. Left to right asymmetry indices for S0 ( S0_LRasym) and MER ( MER_LRasym) were defined as the absolute values of the difference between S0_LR and 1, and the difference between MER_LR and 1, respectively. S0_LRasym, and MER_LRasym were 0.21 and 0.19 for prostate cancer patients with mTX, and 0.43 and 0.45 for the ones imaged without it (P < 0.001). Also, for the bladder cancer patients, S0_LRasym, and MER_LRasym were 0.11 and 0.9 with mTX, while imaging without it yielded 0.52 and 0.39 (P < 0.001). mTX can significantly improve left-to-right symmetry of femoral artery precontrast signal and contrast enhancement. © 2015 Wiley Periodicals, Inc.

Intrinsic mechanical properties and strengthening methods in inorganic crystalline materials

NASA Astrophysics Data System (ADS)

Mecking, H.; Hartig, Ch.; Seeger, J.

1991-06-01

The paper deals with strength and fracture in metals, ceramics and intermetallic compounds. The emphasis is on the interrelation between microstructure and macroscopic behavior and how the concepts for alloy design are mirroring this interrelationship. The three materials classes are distinguished by the physical nature of the atomic bonding forces. In metals metallic bonding predominates which causes high ductility but poor strength. Accordingly material development concentrates on production of microstructures which optimize the yield strength without unacceptable loss in ductility. In ceramics covalent bonding prevails which results in high hardness and high elastic stiffness but at the same time extreme brittleness. Contrary to the metal-ease material development aims at a kind of pseudo ductility in order to rise the fracture toughness to sufficiently high levels. In intermetallic phases the atomic bonds are a mixture of metallic and covalent bonding where depending on the alloying system the balance between the two contributions may be quite different. Accordingly the properties of intermetallics are in the range between metals and ceramics. By a variety of microstructural measures their properties can be changed in direction. either towards metallic or ceramic behavior. General rules for alloy design are not available, rather every system demands very specific experience since properties depend to a considerable part on intrinsic properties of lattice defects such as dislocations, antiphase boundaries, stacking faults and grain boundaries. Cet article traite de la résistance et de la fracture des métaux, des céramiques et des composés intermétalliques. L'accent est mis sur les correspondances entre la microstructure et le comportement macroscopique ainsi que sur la façon dont de tels concepts se reflètent dans la création de nouveaux alliages. C'est la nature des forces de liaisons qui distingue chaque type de matériaux. Dans les métaux, les liaisons métalliques dominent, ce qui entraîne une grande ductilité mais une médiocre résistance. En conséquence, dans le développement de nouveaux matériaux on cherche préférentiellement à produire des microstructures qui optimisent la résistance élastique sans perte inacceptable de ductilité. Dans les céramiques, les liaisons covalentes prédominent; ceci entraîne une dureté élevée, une grande rigidité, mais en même temps une extrême fragilité. Au contraire des métaux, le développement de ces matériaux vise à obtenir une pseudoductilité afin d'amener la tenacité à des niveaux suffisamment élevés. Dans les phases intermétalliques les liaisons atomiques correspondent à un mélange de liaisons métalliques et covalentes. La contribution de chacune d'entre elles varie en fonction du système allié. En conséquence, les propriétés des intermétalliques se situent entre celles des métaux et des céramiques. Par divers changements microstructuraux des propriétés peuvent être déplacées pour se rapprocher d'un comportement de type métallique ou de type céramique. Donner des règles générales pour la création de nouveaux alliages n'est pas possible car chaque système demande à être testé, les propriétés dépendent en effet, pour une part considérable, des propriétés intrinsèques des défauts de réseau comme les dislocations, les parois d'antiphase ou les joints de grains.

Evaluation of candidate vaccine approaches for MERS-CoV

DOE PAGES

Wang, Lingshu; Shi, Wei; Joyce, M. Gordon; ...

2015-07-28

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less

Large supramolecular structures of 33-mer gliadin peptide activate toll-like receptors in macrophages.

PubMed

Herrera, María Georgina; Pizzuto, Malvina; Lonez, Caroline; Rott, Karsten; Hütten, Andreas; Sewald, Norbert; Ruysschaert, Jean-Marie; Dodero, Veronica Isabel

2018-04-22

Gliadin, an immunogenic protein present in wheat, is not fully degraded by humans and after the normal gastric and pancreatic digestion, the immunodominant 33-mer gliadin peptide remains unprocessed. The 33-mer gliadin peptide is found in human faeces and urine, proving not only its proteolytic resistance in vivo but more importantly its transport through the entire human body. Here, we demonstrate that 33-mer supramolecular structures larger than 220 nm induce the overexpression of nuclear factor kappa B (NF-κB) via a specific Toll-like Receptor (TLR) 2 and (TLR) 4 dependent pathway and the secretion of pro-inflammatory cytokines such as IP-10/CXCL10 and TNF-α. Using helium ion microscopy, we elucidated the initial stages of oligomerisation of 33-mer gliadin peptide, showing that rod-like oligomers are nucleation sites for protofilament formation. The relevance of the 33-mer supramolecular structures in the early stages of the disease is paving new perspectives in the understanding of gluten-related disorders. Copyright © 2018. Published by Elsevier Inc.

Inactivation of Ebola virus and Middle East respiratory syndrome coronavirus in platelet concentrates and plasma by ultraviolet C light and methylene blue plus visible light, respectively.

PubMed

Eickmann, Markus; Gravemann, Ute; Handke, Wiebke; Tolksdorf, Frank; Reichenberg, Stefan; Müller, Thomas H; Seltsam, Axel

2018-05-06

Ebola virus (EBOV) and Middle East respiratory syndrome coronavirus (MERS-CoV) have been identified as potential threats to blood safety. This study investigated the efficacy of the THERAFLEX UV-Platelets and THERAFLEX MB-Plasma pathogen inactivation systems to inactivate EBOV and MERS-CoV in platelet concentrates (PCs) and plasma, respectively. PCs and plasma were spiked with high titers of cell culture-derived EBOV and MERS-CoV, treated with various light doses of ultraviolet C (UVC; THERAFLEX UV-Platelets) or methylene blue (MB) plus visible light (MB/light; THERAFLEX MB-Plasma), and assessed for residual viral infectivity. UVC reduced EBOV (≥4.5 log) and MERS-CoV (≥3.7 log) infectivity in PCs to the limit of detection, and MB/light decreased EBOV (≥4.6 log) and MERS-CoV (≥3.3 log) titers in plasma to nondetectable levels. Both THERAFLEX UV-Platelets (UVC) and THERAFLEX MB-Plasma (MB/light) effectively reduce EBOV and MERS-CoV infectivity in platelets and plasma, respectively. © 2018 AABB.

Biochemical and Structural Properties of a Thermostable Mercuric Ion Reductase from Metallosphaera sedula

PubMed Central

Artz, Jacob H.; White, Spencer N.; Zadvornyy, Oleg A.; Fugate, Corey J.; Hicks, Danny; Gauss, George H.; Posewitz, Matthew C.; Boyd, Eric S.; Peters, John W.

2015-01-01

Mercuric ion reductase (MerA), a mercury detoxification enzyme, has been tuned by evolution to have high specificity for mercuric ions (Hg2+) and to catalyze their reduction to a more volatile, less toxic elemental form. Here, we present a biochemical and structural characterization of MerA from the thermophilic crenarchaeon Metallosphaera sedula. MerA from M. sedula is a thermostable enzyme, and remains active after extended incubation at 97°C. At 37°C, the NADPH oxidation-linked Hg2+ reduction specific activity was found to be 1.9 μmol/min⋅mg, increasing to 3.1 μmol/min⋅mg at 70°C. M. sedula MerA crystals were obtained and the structure was solved to 1.6 Å, representing the first solved crystal structure of a thermophilic MerA. Comparison of both the crystal structure and amino acid sequence of MerA from M. sedula to mesophillic counterparts provides new insights into the structural determinants that underpin the thermal stability of the enzyme. PMID:26217660

Evaluation of candidate vaccine approaches for MERS-CoV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingshu; Shi, Wei; Joyce, M. Gordon

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less

Epidémiologie et facteurs de risque des complications respiratoires majeures après chirurgie de l'aorte abdominale au CHU Ibn Sina, Maroc

PubMed Central

Awab, Almahdi; Elahmadi, Brahim; Lamkinsi, Tarik; El Moussaoui, Rachid; El Hijri, Ahmed; Azzouzi, Abderrahim; Alilou, Mustapha

2013-01-01

Introduction L'incidence des complications respiratoires postopératoires (CRPO) reste très diversement appréciées selon les critères diagnostiques retenues dans les différentes études, ce qui la fait varier de 5 à plus de 50%. Les CRPO majeurs après chirurgie de l'aorte abdominale sont responsables d'une grande morbi-mortalité pouvant aller jusqu’à 36%, d'une durée d'hospitalisation et d'un coût plus importants. Ainsi dans l'optique d'améliorer notre prise en charge périopératoire de la chirurgie de l'aorte, nous avons décidé de mener une étude pour dresser le profil épidémiologique et déterminer les facteurs de risque des complications respiratoires dans notre contexte Méthodes Il s'agit d'une étude de cohorte rétrospective du mois de Janvier 2007 au mois de décembre 2011 portant sur l'ensemble des patients opérés pour pathologie aortique au bloc opératoire central de l'hôpital Ibn Sina de Rabat, Maroc. Résultats Cent vingt cinq patients ont été inclus dans notre étude, 24 patients ont été opérés pour anévrysme de l'aorte abdominale et 101 patients pour lésion occlusive aortoiliaque. Dans notre série 22 malades soit 17,6% ont présenté une complication respiratoire majeure avec, une reventilation dans 4,8% des cas, une difficulté de sevrage de la ventilation artificielle dans 3,2% des cas, une pneumopathie dans 4% des cas, un syndrome de détresse respiratoire aigue (SDRA) dans 4% des cas et une nécessité de fibroaspiration bronchique dans 1,6% des cas. En analyse univariée: l’âge, la présence d'une BPCO avec dyspnée stade 3 ou 4, la présence d'une anomalie à l'EFR préopératoire, la présence d'un stade avancé (III ou IV) de LOAI et la reprise chirurgicale étaient statistiquement associés à la survenue d'une complication respiratoire postopératoire. En analyse multivariée, seule une anomalie à l'EFR en préopératoire constituait un facteur de risque indépendant de survenue d'une complication respiratoire postopératoire dans notre série avec un Odds Ratio (OR): 11,5; un Intervalle de Confiance (IC) à 95% de (1,6 - 85,2) et un p = 0,016. Conclusion Au terme de notre étude, il nous parait donc nécessaire pour diminuer l'incidence des CRPO majeurs dans notre population, d'agir sur les facteurs que nous jugeons modifiables tel l'amélioration de l’état respiratoire basal moyennant une préparation respiratoire préopératoire, s'intégrant dans un véritable programme de réhabilitation et associant une rééducation à l'effort, une kinésithérapie incitative ainsi qu'une optimisation des thérapeutiques habituelles. PMID:23504435

A phylogenetically distinct Middle East respiratory syndrome coronavirus detected in a dromedary calf from a closed dairy herd in Dubai with rising seroprevalence with age.

PubMed

Wernery, Ulrich; El Rasoul, I Hassab; Wong, Emily Y M; Joseph, Marina; Chen, Yixin; Jose, Shanty; Tsang, Alan K L; Patteril, Nissy Annie Georgy; Chen, Honglin; Elizabeth, Shyna K; Yuen, Kwok-Yung; Joseph, Sunitha; Xia, Ningshao; Wernery, Renate; Lau, Susanna K P; Woo, Patrick C Y

2015-12-02

Middle East respiratory syndrome coronavirus (MERS-CoV) was detected by monoclonal antibody-based nucleocapsid protein-capture enzyme-linked immunosorbent assay (ELISA), RNA detection, and viral culture from the nasal sample of a 1-month-old dromedary calf in Dubai with sudden death. Whole genome phylogeny showed that this MERS-CoV strain did not cluster with the other MERS-CoV strains from Dubai that we reported recently. Instead, it formed a unique branch more closely related to other MERS-CoV strains from patients in Qatar and Hafr-Al-Batin in Saudi Arabia, as well as the MERS-CoV strains from patients in the recent Korean outbreak, in which the index patient acquired the infection during travel in the eastern part of the Arabian Peninsula. Non-synonymous mutations, resulting in 11 unique amino acid differences, were observed between the MERS-CoV genome from the present study and all the other available MERS-CoV genomes. Among these 11 unique amino acid differences, four were found in ORF1ab, three were found in the S1 domain of the spike protein, and one each was found in the proteins encoded by ORF4b, ORF5, envelope gene, and ORF8. MERS-CoV detection for all other 254 dromedaries in this closed dairy herd was negative by nucleocapsid protein-capture ELISA and RNA detection. MERS-CoV IgG sero-positivity gradually increased in dromedary calves with increasing age, with positivity rates of 75% at zero to three months, 79% at four months, 89% at five to six months, and 90% at seven to twelve months. The development of a rapid antigen detection kit for instantaneous diagnosis is warranted.Emerging Microbes & Infections (2015) 4, e74; doi:10.1038/emi.2015.74; published online 2 December 2015.

Improved modified energy ratio method using a multi-window approach for accurate arrival picking

NASA Astrophysics Data System (ADS)

Lee, Minho; Byun, Joongmoo; Kim, Dowan; Choi, Jihun; Kim, Myungsun

2017-04-01

To identify accurately the location of microseismic events generated during hydraulic fracture stimulation, it is necessary to detect the first break of the P- and S-wave arrival times recorded at multiple receivers. These microseismic data often contain high-amplitude noise, which makes it difficult to identify the P- and S-wave arrival times. The short-term-average to long-term-average (STA/LTA) and modified energy ratio (MER) methods are based on the differences in the energy densities of the noise and signal, and are widely used to identify the P-wave arrival times. The MER method yields more consistent results than the STA/LTA method for data with a low signal-to-noise (S/N) ratio. However, although the MER method shows good results regardless of the delay of the signal wavelet for signals with a high S/N ratio, it may yield poor results if the signal is contaminated by high-amplitude noise and does not have the minimum delay. Here we describe an improved MER (IMER) method, whereby we apply a multiple-windowing approach to overcome the limitations of the MER method. The IMER method contains calculations of an additional MER value using a third window (in addition to the original MER window), as well as the application of a moving average filter to each MER data point to eliminate high-frequency fluctuations in the original MER distributions. The resulting distribution makes it easier to apply thresholding. The proposed IMER method was applied to synthetic and real datasets with various S/N ratios and mixed-delay wavelets. The results show that the IMER method yields a high accuracy rate of around 80% within five sample errors for the synthetic datasets. Likewise, in the case of real datasets, 94.56% of the P-wave picking results obtained by the IMER method had a deviation of less than 0.5 ms (corresponding to 2 samples) from the manual picks.

Maintenance energy requirements in miniature colony dogs.

PubMed

Serisier, S; Weber, M; Feugier, A; Fardet, M-O; Garnier, F; Biourge, V; German, A J

2013-05-01

There are numerous reports of maintenance energy requirements (MER) in dogs, but little information is available about energy requirements of miniature dog breeds. In this prospective, observational, cohort study, we aimed to determine MER in dogs from a number of miniature breeds and to determine which factors were associated with it. Forty-two dogs participated in the study. MER was calculated by determining daily energy intake (EI) during a period of 196 days (28-359 days) when body weight did not change significantly (e.g. ±2% in 12 weeks). Estimated median MER was 473 kJ/kg(0.75) /day (285-766 kJ/kg(0.75) /day), that is, median 113 kcal/kg(0.75) /day (68-183 kcal/kg(0.75) /day). In the obese dogs that lost weight, median MER after weight loss was completed was 360 kJ/kg(0.75) /day (285-515 kJ/kg(0.75) /day), that is, 86 kcal/kg(0.75) /day, (68-123 kcal/kg(0.75) /day). Simple linear regression analysis suggested that three breeds (e.g. Chihuahua, p = 0.002; Yorkshire terrier, p = 0.039; dachshund, p = 0.035) had an effect on MER. In addition to breed, simple linear regression revealed that neuter status (p = 0.079) and having previously been overweight (p = 0.002) were also of significance. However, with multiple linear regression analysis, only previous overweight status (MER less in dogs previously overweight p = 0.008) and breed (MER greater in Yorkshire terriers [p = 0.029] and less in Chihuahuas [p = 0.089]) remained in the final model. This study is the first to estimate MER in dogs of miniature breeds. Although further information from pet dogs is now needed, the current work will be useful for setting energy and nutrient requirement in such dogs for the future. Journal of Animal Physiology and Animal Nutrition © 2013 Blackwell Verlag GmbH.

K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features

PubMed Central

Sievers, Aaron; Bosiek, Katharina; Bisch, Marc; Dreessen, Chris; Riedel, Jascha; Froß, Patrick; Hausmann, Michael; Hildenbrand, Georg

2017-01-01

In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers) was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4) on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B) of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs), which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST) and the high pace of standard k-mer analysis. PMID:28422050

Structural and Biochemical Characterization of Organotin and Organolead Compounds Binding to the Organomercurial Lyase MerB Provide New Insights into Its Mechanism of Carbon–Metal Bond Cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahba, Haytham M.; Stevenson, Michael J.; Mansour, Ahmed

2017-01-03

The organomercurial lyase MerB has the unique ability to cleave carbon–Hg bonds, and structural studies indicate that three residues in the active site (C96, D99, and C159 in E. coli MerB) play important roles in the carbon–Hg bond cleavage. However, the role of each residue in carbon–metal bond cleavage has not been well-defined. To do so, we have structurally and biophysically characterized the interaction of MerB with a series of organotin and organolead compounds. Studies with two known inhibitors of MerB, dimethyltin (DMT) and triethyltin (TET), reveal that they inhibit by different mechanisms. In both cases the initial binding ismore » to D99, but DMT subsequently binds to C96, which induces a conformation change in the active site. In contrast, diethyltin (DET) is a substrate for MerB and the SnIV product remains bound in the active site in a coordination similar to that of HgII following cleavage of organomercurial compounds. The results with analogous organolead compounds are similar in that trimethyllead (TML) is not cleaved and binds only to D99, whereas diethyllead (DEL) is a substrate and the PbIV product remains bound in the active site. Binding and cleavage is an exothermic reaction, while binding to D99 has negligible net heat flow. These results show that initial binding of organometallic compounds to MerB occurs at D99 followed, in some cases, by cleavage and loss of the organic moieties and binding of the metal ion product to C96, D99, and C159. The N-terminus of MerA is able to extract the bound PbVI but not the bound SnIV. These results suggest that MerB could be utilized for bioremediation applications, but certain organolead and organotin compounds may present an obstacle by inhibiting the enzyme.« less

Rapid and Effective Virucidal Activity of Povidone-Iodine Products Against Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and Modified Vaccinia Virus Ankara (MVA).

PubMed

Eggers, Maren; Eickmann, Markus; Zorn, Juergen

2015-12-01

Since the first case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) infection was reported in 2012, the virus has infected more than 1300 individuals in 26 countries, and caused more than 480 deaths. Human-to-human transmission requires close contact, and has typically occurred in the healthcare setting. Improved global awareness, together with improved hygiene practices in healthcare facilities, has been highlighted as key strategies in controlling the spread of MERS-CoV. This study tested the in vitro efficacy of three formulations of povidone iodine (PVP-I: 4% PVP-I skin cleanser, 7.5% PVP-I surgical scrub, and 1% PVP-I gargle/mouthwash) against a reference virus (Modified vaccinia virus Ankara, MVA) and MERS-CoV. According to EN14476, a standard suspension test was used to assess virucidal activity against MVA and large volume plating was used for MERS-CoV. All products were tested under clean (0.3 g/L bovine serum albumin, BSA) and dirty conditions (3.0 g/L BSA + 3.0 mL/L erythrocytes), with application times of 15, 30, and 60 s for MVA, and 15 s for MERS-CoV. The products were tested undiluted, 1:10 and 1:100 diluted against MVA, and undiluted against MERS-CoV. A reduction in virus titer of ≥4 log10 (corresponding to an inactivation of ≥99.99%) was regarded as evidence of virucidal activity. This was achieved versus MVA and MERS-CoV, under both clean and dirty conditions, within 15 s of application of each undiluted PVP-I product. These data indicate that PVP-I-based hand wash products for potentially contaminated skin, and PVP-I gargle/mouthwash for reduction of viral load in the oral cavity and the oropharynx, may help to support hygiene measures to prevent transmission of MERS-CoV. Mundipharma Research GmbH & Co.

Effects of Human Recombinant PEDF Protein and PEDF-Derived Peptide 34-mer on Choroidal Neovascularization

PubMed Central

Amaral, Juan

2010-01-01

Purpose. Pigment epithelium-derived factor (PEDF) is a serpin with antiangiogenic properties. Previously, the authors showed that PEDF injected into the subconjunctiva reaches the choroid. Here, they examined the effects of PEDF polypeptide fragments on vessel sprouting and on choroidal neovascularization (CNV) after subconjunctival administration. Methods. Recombinant human PEDF (rhuPEDF) was cleaved at its serpin-exposed loop by limited chymotrypsin proteolysis. Synthetic PEDF peptides 34-mer (Asp44-Asn77) and 44-mer (Val78-Thr121) were used. Ex vivo chick aortic vessel sprouting assays were performed. CNV was induced in rats by laser injury of Bruch's membrane. Daily subconjunctival injections (0.01–10 pmol/d protein) were performed for 5 days starting at day of injury or at the seventh day after injury. New vessel volumes were quantified using optical sections of choroid/RPE flat-mounts labeled with isolectin-Ib4. PEDF distribution was evaluated by immunofluorescence of choroid/RPE/retina cross-sections. Results. Full-length rhuPEDF, cleaved rhuPEDF, or peptide 34-mer exhibited ex vivo antiangiogenic activity, but peptide 44-mer was inefficient. PEDF immunostaining around CNV lesions diminished after laser injury. Subconjunctival administration of rhuPEDF or 34-mer at 0.1 pmol/d decreased CNV lesion volumes by 52% and 47%, respectively, whereas those of 44-mer were similar to vehicle injections. Doses of 0.1 and 1 pmol/d rhuPEDF decreased fully developed CNV complex volumes by 45% and 50%, respectively, compared with vehicle injections. Conclusions. A functional region for the inhibition of vessel sprouting and CNV resides within the 34-mer region of PEDF. Furthermore, subconjunctival administration of optimal range dosages of rhuPEDF or 34-mer can suppress and regress rat CNV lesions, demonstrating that these agents reach the choroid/RPE complex as functionally active molecules. PMID:19850839

Supervised segmentation of microelectrode recording artifacts using power spectral density.

PubMed

Bakstein, Eduard; Schneider, Jakub; Sieger, Tomas; Novak, Daniel; Wild, Jiri; Jech, Robert

2015-08-01

Appropriate detection of clean signal segments in extracellular microelectrode recordings (MER) is vital for maintaining high signal-to-noise ratio in MER studies. Existing alternatives to manual signal inspection are based on unsupervised change-point detection. We present a method of supervised MER artifact classification, based on power spectral density (PSD) and evaluate its performance on a database of 95 labelled MER signals. The proposed method yielded test-set accuracy of 90%, which was close to the accuracy of annotation (94%). The unsupervised methods achieved accuracy of about 77% on both training and testing data.

Disulfiram can inhibit MERS and SARS coronavirus papain-like proteases via different modes.

PubMed

Lin, Min-Han; Moses, David C; Hsieh, Chih-Hua; Cheng, Shu-Chun; Chen, Yau-Hung; Sun, Chiao-Yin; Chou, Chi-Yuan

2018-02-01

Severe acute respiratory syndrome coronavirus (SARS-CoV) emerged in southern China in late 2002 and caused a global outbreak with a fatality rate around 10% in 2003. Ten years later, a second highly pathogenic human CoV, MERS-CoV, emerged in the Middle East and has spread to other countries in Europe, North Africa, North America and Asia. As of November 2017, MERS-CoV had infected at least 2102 people with a fatality rate of about 35% globally, and hence there is an urgent need to identify antiviral drugs that are active against MERS-CoV. Here we show that a clinically available alcohol-aversive drug, disulfiram, can inhibit the papain-like proteases (PL pro s) of MERS-CoV and SARS-CoV. Our findings suggest that disulfiram acts as an allosteric inhibitor of MERS-CoV PL pro but as a competitive (or mixed) inhibitor of SARS-CoV PL pro . The phenomenon of slow-binding inhibition and the irrecoverability of enzyme activity after removing unbound disulfiram indicate covalent inactivation of SARS-CoV PL pro by disulfiram, while synergistic inhibition of MERS-CoV PL pro by disulfiram and 6-thioguanine or mycophenolic acid implies the potential for combination treatments using these three clinically available drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

Histopathology of Middle East respiratory syndrome coronovirus (MERS-CoV) infection - clinicopathological and ultrastructural study.

PubMed

Alsaad, Khaled O; Hajeer, Ali H; Al Balwi, Mohammed; Al Moaiqel, Mohammed; Al Oudah, Nourah; Al Ajlan, Abdulaziz; AlJohani, Sameera; Alsolamy, Sami; Gmati, Giamal E; Balkhy, Hanan; Al-Jahdali, Hamdan H; Baharoon, Salim A; Arabi, Yaseen M

2018-02-01

The pathogenesis, viral localization and histopathological features of Middle East respiratory syndrome - coronavirus (MERS-CoV) in humans are not described sufficiently. The aims of this study were to explore and define the spectrum of histological and ultrastructural pathological changes affecting various organs in a patient with MERS-CoV infection and represent a base of MERS-CoV histopathology. We analysed the post-mortem histopathological findings and investigated localisation of viral particles in the pulmonary and extrapulmonary tissue by transmission electron microscopic examination in a 33-year-old male patient of T cell lymphoma, who acquired MERS-CoV infection. Tissue needle biopsies were obtained from brain, heart, lung, liver, kidney and skeletal muscle. All samples were collected within 45 min from death to reduce tissue decomposition and artefact. Histopathological examination showed necrotising pneumonia, pulmonary diffuse alveolar damage, acute kidney injury, portal and lobular hepatitis and myositis with muscle atrophic changes. The brain and heart were histologically unremarkable. Ultrastructurally, viral particles were localised in the pneumocytes, pulmonary macrophages, renal proximal tubular epithelial cells and macrophages infiltrating the skeletal muscles. The results highlight the pulmonary and extrapulmonary pathological changes of MERS-CoV infection and provide the first evidence of the viral presence in human renal tissue, which suggests tissue trophism for MERS-CoV in kidney. © 2017 John Wiley & Sons Ltd.

Middle East respiratory syndrome.

PubMed

Zumla, Alimuddin; Hui, David S; Perlman, Stanley

2015-09-05

Middle East respiratory syndrome (MERS) is a highly lethal respiratory disease caused by a novel single-stranded, positive-sense RNA betacoronavirus (MERS-CoV). Dromedary camels, hosts for MERS-CoV, are implicated in direct or indirect transmission to human beings, although the exact mode of transmission is unknown. The virus was first isolated from a patient who died from a severe respiratory illness in June, 2012, in Jeddah, Saudi Arabia. As of May 31, 2015, 1180 laboratory-confirmed cases (483 deaths; 40% mortality) have been reported to WHO. Both community-acquired and hospital-acquired cases have been reported with little human-to-human transmission reported in the community. Although most cases of MERS have occurred in Saudi Arabia and the United Arab Emirates, cases have been reported in Europe, the USA, and Asia in people who travelled from the Middle East or their contacts. Clinical features of MERS range from asymptomatic or mild disease to acute respiratory distress syndrome and multiorgan failure resulting in death, especially in individuals with underlying comorbidities. No specific drug treatment exists for MERS and infection prevention and control measures are crucial to prevent spread in health-care facilities. MERS-CoV continues to be an endemic, low-level public health threat. However, the virus could mutate to have increased interhuman transmissibility, increasing its pandemic potential. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-09-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between -35 and -10 elements.

Coding, modulation, and relays for deep space communication Mars Rovers Case Study

NASA Technical Reports Server (NTRS)

Statman, Joseph I.; Edwards, Charles D.

2004-01-01

This paper presents the communications challenges for the MER mission, the use of DSN and MER tools to maximize the science return, and the application of standards-based relays to the problem. To date, more than 90% of the data returned from MER has been returned via relays, not direct-to-Earath (DTE).

Nordic Winter and Cold: Their Correspondence with Tomas Tranströmer's Poetry

ERIC Educational Resources Information Center

Hosian, Mohammad Akbar

2015-01-01

The Nobel Prize winning poet Tomas Tranströmer was born and bred in Sweden, a remarkably Scandinavian country. Topographically, Scandinavian countries are locations of extreme cold and snowing. This distinguishing climatic condition has had a dominant influence and impact on almost all Scandinavian art and literature, including Tomas Tranströmer's…

78 FR 33842 - Determination and Declaration Regarding Emergency Use of In Vitro Diagnostics for Detection of...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-05

... In Vitro Diagnostics for Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) AGENCY... Middle East respiratory syndrome coronavirus (MERS-CoV). On the basis of this determination, she also... detection of Middle East respiratory syndrome coronavirus (MERS-CoV) pursuant to section 564 of the FD&C Act...

Effets perturbateurs endocriniens des pesticides organochlores.

PubMed

Charlier, C; Plomteux, G

2002-01-01

Xenoestrogens such organochlorine pesticides are known to induce changes in reproductive development, function or behaviour in wildlife. Because these compounds are able to modify the estrogens metabolism, or to compete with estradiol for binding to the estrogen receptor, it may be possible that these products affect the risk of developing impaired fertility, precocious puberty or some kinds of cancer in man. Le plus ancien récit de lutte contre la pollution remonte à une légende indienne racontant que la divinité Sing-bonga était incommodée par les émanations des fours dans lesquels les Asuras fondaient leurs métaux (1). Evidemment depuis, la problématique n-a cessé de s-accroître et la contamination de la Terre par de nombreux polluants est devenue aujourd-hui un problème majeur de notre Société. La protection de notre environnement est une question capitale qui doit être respectée malgré la pression économique actuelle et qui ne cessera de croître au cours des prochaines années même si l-identification objective et indiscutable de ce qui est essentiel - donc devant être prioritairement garanti sur la planète - est difficile à cerner (2). « Un oiseau en mauvais état ne pond pas de bons oeufs » disait un proverbe grec. Mais ce n-est qu-à partir de la seconde moitié du XXème siècle que les toxicologues ont commencé à identifier les effets qu-avaient entraînés à l-échelle mondiale les pollutions émises aux XIXème siècle sur la faune sauvage et sur le cheptel (3). L-histoire contemporaine des pesticides industriels commence vers 1874 (synthèse des organochlorés) et se poursuit tout au long de ces 2 siècles en passant par la synthèse des organophosphorés (1950), des carbamates (1970) et des pyréthroïdes (1975) (4). Le dichlorodiphényltrichloroéthane (DDT) a été synthétisé pour la première fois par un étudiant en cours de préparation de sa thèse de doctorat : Othmer Zeidler. La production, reprise par les entreprises F.Mayo puis par la Geigy Co. a d-abord intéressé l-armée, puis l-agriculture. Dès la fin de la 2(ème) guerre mondiale, des mises en garde furent lancées à propos des effets nocifs du produit (4). Un déclin des populations de grives, d-aigles chauves, d-orfaies et de mammifères consommateurs de poissons fut constaté à partir des années 50 et dénoncé par Rachel Carson dans son célèbre appel du « Silent Spring » de 1962. Bien qu-il soit interdit en Occident depuis les années 70, ce produit a été tellement utilisé et présente une rémanence si longue qu-une contamination ubiquitaire existe aujourd-hui encore. De plus, ce produit continue à être produit aux USA pour être utilisé à des fins de démoustification dans les pays en voie de développement. Il en va de même de l-Hexachlorobenzène (HCB), un autre organochloré dont l-usage est interdit sous nos latitudes, mais reste fréquent dans d-autres pays. Ces deux exemples indiquent que le problème de la contamination continue à nous concerner, même pour des produits dont l-usage est aujourd-hui strictement réglementé ou interdit. Des effets sur la faune semblent encore actuellement devoir être attribués à ces produits. La diminution de la population des phoques dans la mer de Wadden pourrait être due à la forte contamination en composants organochlorés des poissons dont ces phoques se nourrissent (5). Exposé au DDT et à son métabolite dichlorodiphenyldichloroéthylène (DDE), le Seratherodon mossambicus présente une réduction de la sécrétion de cortisol par une action toxique cytospécifique sur l-axe hypothalamo-hypophysaire (6). Des travaux récents ont montré que le DDT et le DDE se lient chez les oiseaux et les mammifères au moyen de liaisons covalentes aux cellules de la zona fasciculata - homologue du tissu interrénal du poisson - induisant des microhémorragies. Cette « défaillance » cortisolique peut s-accompagner d-une perturbation du métabolisme glucidique et notamment d-un taux élevé de glycogène hépatique (7). Les pesticides organochlorés (DDT, DDE) entraînent également des perturbations d-ordre métabolique chez certaines espèces d-oiseaux, notamment le faucon pèlerin en Grande Bretagne et les oiseaux piscivores des grands lacs nord américains où l-on a constaté au cours des années 1960 que leur reproduction était menacée et qu-une des manifestations les plus évidentes des perturbations observées était le taux élevé de malformations (8). Des mortalités élevées de poissons ou de coquillages ont été rapportées dans des élevages situés à proximité des zones d-épandage de pesticides organophosphorés et de carbamates. En 1991, la dispersion aérienne de fenitrothion dans le but de provoquer la démoustication en Languedoc a été à l-origine de la perte de plusieurs tonnes de crevettes japonaises. L-utilisation de trichlorfon et de dichlorvos comme antiparasitaires dans des fermes d-élevages de saumons a provoqué des épisodes de mortalité importante (9).

Infection control and prevention practices implemented to reduce transmission risk of Middle East respiratory syndrome-coronavirus in a tertiary care institution in Saudi Arabia.

PubMed

Butt, Taimur S; Koutlakis-Barron, Irene; AlJumaah, Suliman; AlThawadi, Sahar; AlMofada, Saleh

2016-05-01

Transmission of Middle East respiratory syndrome-coronavirus (MERS-CoV) among health care workers (HCWs) and patients has been documented with mortality rate approximating 36%. We propose advanced infection control measures (A-IC) used in conjunction with basic infection control measures (B-IC) help reduce pathogen transmission. B-IC include standard and transmission-based precautions. A-IC are initiatives implemented within our center to enhance effectiveness of B-IC. Study effectiveness of combining B-IC and A-IC to prevent transmission of MERS-CoV to HCWs. A retrospective observational study was undertaken. A-IC measures include administrative support with daily rounds; infection control risk assessment; timely screening, isolation, and specimen analysis; collaboration; epidemic planning; stockpiling; implementation of contingency plans; full personal protective equipment use for advanced airway management; use of a real-time electronic isolation flagging system; infection prevention and control team on-call protocols; pretransfer MERS-CoV testing; and education. A total of 874 real-time polymerase chain reaction MERS-CoV tests were performed during the period beginning July 1, 2013, and ending January 31, 2015. Six hundred ninety-four non-HCWs were tested, of these 16 tested positive for MERS-CoV and their infection was community acquired. Sixty-nine percent of the confirmed MERS-CoV-positive cases were men, with an average age of 56 years (range, 19-84 years). Of the total tested for MERS-CoV, 180 individuals were HCWs with zero positivity. Adhering to a combination of B-IC and A-IC reduces the risk of MERS-CoV transmission to HCWs. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

MERS coronaviruses from camels in Africa exhibit region-dependent genetic diversity.

PubMed

Chu, Daniel K W; Hui, Kenrie P Y; Perera, Ranawaka A P M; Miguel, Eve; Niemeyer, Daniela; Zhao, Jincun; Channappanavar, Rudragouda; Dudas, Gytis; Oladipo, Jamiu O; Traoré, Amadou; Fassi-Fihri, Ouafaa; Ali, Abraham; Demissié, Getnet F; Muth, Doreen; Chan, Michael C W; Nicholls, John M; Meyerholz, David K; Kuranga, Sulyman A; Mamo, Gezahegne; Zhou, Ziqi; So, Ray T Y; Hemida, Maged G; Webby, Richard J; Roger, Francois; Rambaut, Andrew; Poon, Leo L M; Perlman, Stanley; Drosten, Christian; Chevalier, Veronique; Peiris, Malik

2018-03-20

Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of zoonotic infection. Although MERS-CoV infection is ubiquitous in dromedaries across Africa as well as in the Arabian Peninsula, zoonotic disease appears confined to the Arabian Peninsula. MERS-CoVs from Africa have hitherto been poorly studied. We genetically and phenotypically characterized MERS-CoV from dromedaries sampled in Morocco, Burkina Faso, Nigeria, and Ethiopia. Viruses from Africa (clade C) are phylogenetically distinct from contemporary viruses from the Arabian Peninsula (clades A and B) but remain antigenically similar in microneutralization tests. Viruses from West (Nigeria, Burkina Faso) and North (Morocco) Africa form a subclade, C1, that shares clade-defining genetic signatures including deletions in the accessory gene ORF4b Compared with human and camel MERS-CoV from Saudi Arabia, virus isolates from Burkina Faso (BF785) and Nigeria (Nig1657) had lower virus replication competence in Calu-3 cells and in ex vivo cultures of human bronchus and lung. BF785 replicated to lower titer in lungs of human DPP4-transduced mice. A reverse genetics-derived recombinant MERS-CoV (EMC) lacking ORF4b elicited higher type I and III IFN responses than the isogenic EMC virus in Calu-3 cells. However, ORF4b deletions may not be the major determinant of the reduced replication competence of BF785 and Nig1657. Genetic and phenotypic differences in West African viruses may be relevant to zoonotic potential. There is an urgent need for studies of MERS-CoV at the animal-human interface. Copyright © 2018 the Author(s). Published by PNAS.

In vitro and in vivo characterization of a reversible synthetic heparin analog.

PubMed

Whelihan, Matthew F; Cooley, Brian; Xu, Yongmei; Pawlinski, Rafal; Liu, Jian; Key, Nigel S

2016-02-01

The global supply of unfractionated heparin (UFH) and all commercially available low molecular weight heparins (LMWH) remain dependent on animal sources, such as porcine intestine or bovine lung. Recent experience has shown that contamination of the supply chain (with over-sulfated chondroitin sulfates) can result in lethal toxicity. Fondaparinux is currently the only commercially available synthetic analog of heparin. We recently described a new class of chemoenzymatically synthesized heparin analogs. One of these compounds (S12-mer) is a dodecasaccharide consisting of an antithrombin-binding moiety with repeating units of IdoA2S-GlcNS6S and two 3-O-sulfate groups that confer the ability to bind protamine. We sought to further characterize this new compound in vitro using biochemical and global coagulation assays and in vivo using thrombosis and hemostasis assays. The anticoagulant activities of the Super 12-mer (S12-mer) and Enoxaparin in anti-factor Xa and plasma-based thrombin generation assays were roughly equivalent with a 50% reduction in peak thrombin generation occurring at approximately 325nM. When protamine was titrated against a fixed concentration of S12-mer in plasma or blood, the S12-mer displayed a significant restitution of thrombin generation and clot formation. In vivo, S12-mer inhibited venous thrombosis to a similar extent as Enoxaparin, with similar bleeding profiles. These data show that the S12-mer has almost identical efficacy to Enoxaparin in terms of FXa inhibition, while displaying significant reversibility with protamine. Taken together with the ability to ensure purity and homogeneity from batch to batch, the S12-mer is a promising new synthetic heparin analog with a potentially enhanced safety profile. Copyright © 2015 Elsevier Ltd. All rights reserved.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, clears the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, clears the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are in the clear after tower rollback in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are in the clear after tower rollback in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - With smoke and steam billowing beneath, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With smoke and steam billowing beneath, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Leaving smoke and steam behind, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Leaving smoke and steam behind, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower (right) and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower (right) and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are viewed as the launch tower overhead rolls back. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are viewed as the launch tower overhead rolls back. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload breaks forth from the smoke and steam into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload breaks forth from the smoke and steam into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

KENNEDY SPACE CENTER, FLA. - The Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload is viewed from under the launch tower as it moves away on Launch Complex 17-A, Cape Canaveral Air Force Station. This will be a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload is viewed from under the launch tower as it moves away on Launch Complex 17-A, Cape Canaveral Air Force Station. This will be a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The launch tower (right) on Launch Complex 17-A, Cape Canaveral Air Force Station, has been rolled back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload (left) in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The launch tower (right) on Launch Complex 17-A, Cape Canaveral Air Force Station, has been rolled back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload (left) in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Amid billows of smoke and steam, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Amid billows of smoke and steam, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload waits for rollback of the launch tower in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload waits for rollback of the launch tower in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower rolls back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts, June 8 and June 9, were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower rolls back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts, June 8 and June 9, were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Blue sky and sun give a dramatic backdrop for the launch of the Delta II rocket with its Mars Exploration Rover (MER-A) payload. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Blue sky and sun give a dramatic backdrop for the launch of the Delta II rocket with its Mars Exploration Rover (MER-A) payload. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study.

PubMed

Reusken, Chantal B E M; Haagmans, Bart L; Müller, Marcel A; Gutierrez, Carlos; Godeke, Gert-Jan; Meyer, Benjamin; Muth, Doreen; Raj, V Stalin; Smits-De Vries, Laura; Corman, Victor M; Drexler, Jan-Felix; Smits, Saskia L; El Tahir, Yasmin E; De Sousa, Rita; van Beek, Janko; Nowotny, Norbert; van Maanen, Kees; Hidalgo-Hermoso, Ezequiel; Bosch, Berend-Jan; Rottier, Peter; Osterhaus, Albert; Gortázar-Schmidt, Christian; Drosten, Christian; Koopmans, Marion P G

2013-10-01

A new betacoronavirus-Middle East respiratory syndrome coronavirus (MERS-CoV)-has been identified in patients with severe acute respiratory infection. Although related viruses infect bats, molecular clock analyses have been unable to identify direct ancestors of MERS-CoV. Anecdotal exposure histories suggest that patients had been in contact with dromedary camels or goats. We investigated possible animal reservoirs of MERS-CoV by assessing specific serum antibodies in livestock. We took sera from animals in the Middle East (Oman) and from elsewhere (Spain, Netherlands, Chile). Cattle (n=80), sheep (n=40), goats (n=40), dromedary camels (n=155), and various other camelid species (n=34) were tested for specific serum IgG by protein microarray using the receptor-binding S1 subunits of spike proteins of MERS-CoV, severe acute respiratory syndrome coronavirus, and human coronavirus OC43. Results were confirmed by virus neutralisation tests for MERS-CoV and bovine coronavirus. 50 of 50 (100%) sera from Omani camels and 15 of 105 (14%) from Spanish camels had protein-specific antibodies against MERS-CoV spike. Sera from European sheep, goats, cattle, and other camelids had no such antibodies. MERS-CoV neutralising antibody titres varied between 1/320 and 1/2560 for the Omani camel sera and between 1/20 and 1/320 for the Spanish camel sera. There was no evidence for cross-neutralisation by bovine coronavirus antibodies. MERS-CoV or a related virus has infected camel populations. Both titres and seroprevalences in sera from different locations in Oman suggest widespread infection. European Union, European Centre For Disease Prevention and Control, Deutsche Forschungsgemeinschaft. Copyright © 2013 Elsevier Ltd. All rights reserved.

Host cell entry of Middle East respiratory syndrome coronavirus after two-step, furin-mediated activation of the spike protein

PubMed Central

Millet, Jean Kaoru; Whittaker, Gary R.

2014-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a newly identified betacoronavirus causing high morbidity and mortality in humans. The coronavirus spike (S) protein is the main determinant of viral entry, and although it was previously shown that MERS-CoV S can be activated by various proteases, the details of the mechanisms of proteolytic activation of fusion are still incompletely characterized. Here, we have uncovered distinctive characteristics of MERS-CoV S. We identify, by bioinformatics and peptide cleavage assays, two cleavage sites for furin, a ubiquitously expressed protease, which are located at the S1/S2 interface and at the S2′ position of the S protein. We show that although the S1/S2 site is proteolytically processed by furin during protein biosynthesis, the S2′ site is cleaved upon viral entry. MERS-CoV pseudovirion infection was shown to be enhanced by elevated levels of furin expression, and entry could be decreased by furin siRNA silencing. Enhanced furin activity appeared to partially override the low pH-dependent nature of MERS-CoV entry. Inhibition of furin activity was shown to decrease MERS-CoV S-mediated entry, as well as infection by the virus. Overall, we show that MERS-CoV has evolved an unusual two-step furin activation for fusion, suggestive of a role during the process of emergence into the human population. The ability of MERS-CoV to use furin in this manner, along with other proteases, may explain the polytropic nature of the virus. PMID:25288733

Mapping Potential Amplification and Transmission Hotspots for MERS-CoV, Kenya.

PubMed

Gikonyo, Stephen; Kimani, Tabitha; Matere, Joseph; Kimutai, Joshua; Kiambi, Stella G; Bitek, Austine O; Juma Ngeiywa, K J Z; Makonnen, Yilma J; Tripodi, Astrid; Morzaria, Subhash; Lubroth, Juan; Rugalema, Gabriel; Fasina, Folorunso Oludayo

2018-03-16

Dromedary camels have been implicated consistently as the source of Middle East respiratory syndrome coronavirus (MERS-CoV) human infections and attention to prevent and control it has focused on camels. To understanding the epidemiological role of camels in the transmission of MERS-CoV, we utilized an iterative empirical process in Geographic Information System (GIS) to identify and qualify potential hotspots for maintenance and circulation of MERS-CoV, and produced risk-based surveillance sites in Kenya. Data on camel population and distribution were used to develop camel density map, while camel farming system was defined using multi-factorial criteria including the agro-ecological zones (AEZs), production and marketing practices. Primary and secondary MERS-CoV seroprevalence data from specific sites were analyzed, and location-based prevalence matching with camel densities was conducted. High-risk convergence points (migration zones, trade routes, camel markets, slaughter slabs) were profiled and frequent cross-border camel movement mapped. Results showed that high camel-dense areas and interaction (markets and migration zones) were potential hotspot for transmission and spread. Cross-border contacts occurred with in-migrated herds at hotspot locations. AEZ differential did not influence risk distribution and plausible risk factors for spatial MERS-CoV hotspots were camel densities, previous cases of MERS-CoV, high seroprevalence and points of camel convergences. Although Kenyan camels are predisposed to MERS-CoV, no shedding is documented to date. These potential hotspots, determined using anthropogenic, system and trade characterizations should guide selection of sampling/surveillance sites, high-risk locations, critical areas for interventions and policy development in Kenya, as well as instigate further virological examination of camels.

Inhibitor recognition specificity of MERS-CoV papain-like protease may differ from that of SARS-CoV.

PubMed

Lee, Hyun; Lei, Hao; Santarsiero, Bernard D; Gatuz, Joseph L; Cao, Shuyi; Rice, Amy J; Patel, Kavankumar; Szypulinski, Michael Z; Ojeda, Isabel; Ghosh, Arun K; Johnson, Michael E

2015-06-19

The Middle East Respiratory Syndrome coronavirus (MERS-CoV) papain-like protease (PLpro) blocking loop 2 (BL2) structure differs significantly from that of SARS-CoV PLpro, where it has been proven to play a crucial role in SARS-CoV PLpro inhibitor binding. Four SARS-CoV PLpro lead inhibitors were tested against MERS-CoV PLpro, none of which were effective against MERS-CoV PLpro. Structure and sequence alignments revealed that two residues, Y269 and Q270, responsible for inhibitor binding to SARS-CoV PLpro, were replaced by T274 and A275 in MERS-CoV PLpro, making critical binding interactions difficult to form for similar types of inhibitors. High-throughput screening (HTS) of 25 000 compounds against both PLpro enzymes identified a small fragment-like noncovalent dual inhibitor. Mode of inhibition studies by enzyme kinetics and competition surface plasmon resonance (SPR) analyses suggested that this compound acts as a competitive inhibitor with an IC50 of 6 μM against MERS-CoV PLpro, indicating that it binds to the active site, whereas it acts as an allosteric inhibitor against SARS-CoV PLpro with an IC50 of 11 μM. These results raised the possibility that inhibitor recognition specificity of MERS-CoV PLpro may differ from that of SARS-CoV PLpro. In addition, inhibitory activity of this compound was selective for SARS-CoV and MERS-CoV PLpro enzymes over two human homologues, the ubiquitin C-terminal hydrolases 1 and 3 (hUCH-L1 and hUCH-L3).

KENNEDY SPACE CENTER, FLA. - A third solid rocket booster (SRB) is lifted up the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station. They are three of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - A third solid rocket booster (SRB) is lifted up the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station. They are three of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, workers complete raising a solid rocket booster to a vertical position. It will be lifted up the launch tower and mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, workers complete raising a solid rocket booster to a vertical position. It will be lifted up the launch tower and mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is raised off the transporter. When vertical, it will be lifted up the launch tower and mated to the Delta rocket (in the background) to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is raised off the transporter. When vertical, it will be lifted up the launch tower and mated to the Delta rocket (in the background) to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is moved into position to raise to vertical and lift up the launch tower. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is moved into position to raise to vertical and lift up the launch tower. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Impact of defects on percolation in random sequential adsorption of linear k-mers on square lattices.

PubMed

Tarasevich, Yuri Yu; Laptev, Valeri V; Vygornitskii, Nikolai V; Lebovka, Nikolai I

2015-01-01

The effect of defects on the percolation of linear k-mers (particles occupying k adjacent sites) on a square lattice is studied by means of Monte Carlo simulation. The k-mers are deposited using a random sequential adsorption mechanism. Two models L(d) and K(d) are analyzed. In the L(d) model it is assumed that the initial square lattice is nonideal and some fraction of sites d is occupied by nonconducting point defects (impurities). In the K(d) model the initial square lattice is perfect. However, it is assumed that some fraction of the sites in the k-mers d consists of defects, i.e., is nonconducting. The length of the k-mers k varies from 2 to 256. Periodic boundary conditions are applied to the square lattice. The dependences of the percolation threshold concentration of the conducting sites p(c) vs the concentration of defects d are analyzed for different values of k. Above some critical concentration of defects d(m), percolation is blocked in both models, even at the jamming concentration of k-mers. For long k-mers, the values of d(m) are well fitted by the functions d(m)∝k(m)(-α)-k(-α) (α=1.28±0.01 and k(m)=5900±500) and d(m)∝log(10)(k(m)/k) (k(m)=4700±1000) for the L(d) and K(d) models, respectively. Thus, our estimation indicates that the percolation of k-mers on a square lattice is impossible even for a lattice without any defects if k⪆6×10(3).

Turtle: identifying frequent k-mers with cache-efficient algorithms.

PubMed

Roy, Rajat Shuvro; Bhattacharya, Debashish; Schliep, Alexander

2014-07-15

Counting the frequencies of k-mers in read libraries is often a first step in the analysis of high-throughput sequencing data. Infrequent k-mers are assumed to be a result of sequencing errors. The frequent k-mers constitute a reduced but error-free representation of the experiment, which can inform read error correction or serve as the input to de novo assembly methods. Ideally, the memory requirement for counting should be linear in the number of frequent k-mers and not in the, typically much larger, total number of k-mers in the read library. We present a novel method that balances time, space and accuracy requirements to efficiently extract frequent k-mers even for high-coverage libraries and large genomes such as human. Our method is designed to minimize cache misses in a cache-efficient manner by using a pattern-blocked Bloom filter to remove infrequent k-mers from consideration in combination with a novel sort-and-compact scheme, instead of a hash, for the actual counting. Although this increases theoretical complexity, the savings in cache misses reduce the empirical running times. A variant of method can resort to a counting Bloom filter for even larger savings in memory at the expense of false-negative rates in addition to the false-positive rates common to all Bloom filter-based approaches. A comparison with the state-of-the-art shows reduced memory requirements and running times. The tools are freely available for download at http://bioinformatics.rutgers.edu/Software/Turtle and http://figshare.com/articles/Turtle/791582. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Developpement d'une commande pour une hydrolienne de riviere et optimisation =

NASA Astrophysics Data System (ADS)

Tetrault, Philippe

Suivant le developpement des energies renouvelables, la presente etude se veut une base theorique quant aux principes fondamentaux necessaires au bon fonctionnement et a l'implementation d'une hydrolienne de riviere. La problematique derriere ce nouveau type d'appareil est d'abord presentee. La machine electrique utilisee dans l'application, c'est-a-dire la machine synchrone a aimants permanents, est etudiee : ses equations dynamiques mecaniques et electriques sont developpees, introduisant en meme temps le concept de referentiel tournant. Le fonctionnement de l'onduleur utilise, soit un montage en pont complet a deux niveaux a semi-conducteurs, est explique et mit en equation pour permettre de comprendre les strategies de modulation disponibles. Un bref historique de ces strategies est fait avant de mettre l'emphase sur la modulation vectorielle qui sera celle utilisee pour l'application en cours. Les differents modules sont assembles dans une simulation Matlab pour confirmer leur bon fonctionnement et comparer les resultats de la simulation avec les calculs theoriques. Differents algorithmes permettant de traquer et maintenir un point de fonctionnement optimal sont presentes. Le comportement de la riviere est etudie afin d'evaluer l'ampleur des perturbations que le systeme devra gerer. Finalement, une nouvelle approche est presentee et comparee a une strategie plus conservatrice a l'aide d'un autre modele de simulation Matlab.

Middle East Respiratory Syndrome Infection Control and Prevention Guideline for Healthcare Facilities

PubMed Central

Kim, Jin Yong; Song, Joon Young; Yoon, Young Kyung; Choi, Seong-Ho; Song, Young Goo; Kim, Sung-Ran; Son, Hee-Jung; Jeong, Sun-Young; Choi, Jung-Hwa; Kim, Kyung Mi; Yoon, Hee Jung; Choi, Jun Yong; Kim, Tae Hyong; Choi, Young Hwa; Kim, Hong Bin; Yoon, Ji Hyun; Lee, Jacob; Eom, Joong Sik; Lee, Sang-Oh; Oh, Won Sup; Choi, Jung-Hyun; Yoo, Jin-Hong; Kim, Woo Joo

2015-01-01

Middle East Respiratory Syndrome (MERS) is an acute viral respiratory illness with high mortality caused by a new strain of betacoronavirus (MERS-CoV). Since the report of the first patient in Saudi Arabia in 2012, large-scale outbreaks through hospital-acquired infection and inter-hospital transmission have been reported. Most of the patients reported in South Korea were also infected in hospital settings. Therefore, to eliminate the spread of MERS-CoV, infection prevention and control measures should be implemented with rigor. The present guideline has been drafted on the basis of the experiences of infection control in the South Korean hospitals involved in the recent MERS outbreak and on domestic and international infection prevention and control guidelines. To ensure efficient MERS-CoV infection prevention and control, care should be taken to provide comprehensive infection control measures including contact control, hand hygiene, personal protective equipment, disinfection, and environmental cleaning. PMID:26788414

Dromedary camels and the transmission of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

PubMed Central

Hemida, Maged G; Elmoslemany, Ahmed; Al-Hizab, Fahad; Alnaeem, Abdulmohsen; Almathen, Faisal; Faye, Bernard; Chu, Daniel KW; Perera, Ranawaka A; Peiris, Malik

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is an existential threat to global public health. The virus has been repeatedly detected in dromedary camels (Camelus dromedarius). Adult animals in many countries in the Middle East as well as in North and East Africa showed high (>90%) sero-prevalence to the virus. MERS-CoV isolated from dromedaries is genetically and phenotypically similar to viruses from humans. We summarise current understanding of the ecology of MERS-CoV in animals and transmission at the animal-human interface. We review aspects of husbandry, animal movements and trade and the use and consumption of camel dairy and meat products in the Middle East that may be relevant to the epidemiology of MERS. We also highlight the gaps in understanding the transmission of this virus in animals and from animals to humans. PMID:26256102

Response to Emergence of Middle East Respiratory Syndrome Coronavirus, Abu Dhabi, United Arab Emirates, 2013-2014.

PubMed

Al Hosani, Farida Ismail; Pringle, Kimberly; Al Mulla, Mariam; Kim, Lindsay; Pham, Huong; Alami, Negar N; Khudhair, Ahmed; Hall, Aron J; Aden, Bashir; El Saleh, Feda; Al Dhaheri, Wafa; Al Bandar, Zyad; Bunga, Sudhir; Abou Elkheir, Kheir; Tao, Ying; Hunter, Jennifer C; Nguyen, Duc; Turner, Andrew; Pradeep, Krishna; Sasse, Jurgen; Weber, Stefan; Tong, Suxiang; Whitaker, Brett L; Haynes, Lia M; Curns, Aaron; Gerber, Susan I

2016-07-01

In January 2013, several months after Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in Saudi Arabia, Abu Dhabi, United Arab Emirates, began surveillance for MERS-CoV. We analyzed medical chart and laboratory data collected by the Health Authority-Abu Dhabi during January 2013-May 2014. Using real-time reverse transcription PCR, we tested respiratory tract samples for MERS-CoV and identified 65 case-patients. Of these patients, 23 (35%) were asymptomatic at the time of testing, and 4 (6%) showed positive test results for >3 weeks (1 had severe symptoms and 3 had mild symptoms). We also identified 6 clusters of MERS-CoV cases. This report highlights the potential for virus shedding by mildly ill and asymptomatic case-patients. These findings will be useful for MERS-CoV management and infection prevention strategies.

Middle East Respiratory Syndrome Infection Control and Prevention Guideline for Healthcare Facilities.

PubMed

Kim, Jin Yong; Song, Joon Young; Yoon, Young Kyung; Choi, Seong-Ho; Song, Young Goo; Kim, Sung-Ran; Son, Hee-Jung; Jeong, Sun-Young; Choi, Jung-Hwa; Kim, Kyung Mi; Yoon, Hee Jung; Choi, Jun Yong; Kim, Tae Hyong; Choi, Young Hwa; Kim, Hong Bin; Yoon, Ji Hyun; Lee, Jacob; Eom, Joong Sik; Lee, Sang-Oh; Oh, Won Sup; Choi, Jung-Hyun; Yoo, Jin-Hong; Kim, Woo Joo; Cheong, Hee Jin

2015-12-01

Middle East Respiratory Syndrome (MERS) is an acute viral respiratory illness with high mortality caused by a new strain of betacoronavirus (MERS-CoV). Since the report of the first patient in Saudi Arabia in 2012, large-scale outbreaks through hospital-acquired infection and inter-hospital transmission have been reported. Most of the patients reported in South Korea were also infected in hospital settings. Therefore, to eliminate the spread of MERS-CoV, infection prevention and control measures should be implemented with rigor. The present guideline has been drafted on the basis of the experiences of infection control in the South Korean hospitals involved in the recent MERS outbreak and on domestic and international infection prevention and control guidelines. To ensure efficient MERS-CoV infection prevention and control, care should be taken to provide comprehensive infection control measures including contact control, hand hygiene, personal protective equipment, disinfection, and environmental cleaning.

Response to Emergence of Middle East Respiratory Syndrome Coronavirus, Abu Dhabi, United Arab Emirates, 2013–2014

PubMed Central

Al Hosani, Farida Ismail; Al Mulla, Mariam; Kim, Lindsay; Pham, Huong; Alami, Negar N.; Khudhair, Ahmed; Hall, Aron J.; Aden, Bashir; El Saleh, Feda; Al Dhaheri, Wafa; Al Bandar, Zyad; Bunga, Sudhir; Abou Elkheir, Kheir; Tao, Ying; Hunter, Jennifer C.; Nguyen, Duc; Turner, Andrew; Pradeep, Krishna; Sasse, Jurgen; Weber, Stefan; Tong, Suxiang; Whitaker, Brett L.; Haynes, Lia M.; Curns, Aaron; Gerber, Susan I.

2016-01-01

In January 2013, several months after Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in Saudi Arabia, Abu Dhabi, United Arab Emirates, began surveillance for MERS-CoV. We analyzed medical chart and laboratory data collected by the Health Authority–Abu Dhabi during January 2013–May 2014. Using real-time reverse transcription PCR, we tested respiratory tract samples for MERS-CoV and identified 65 case-patients. Of these patients, 23 (35%) were asymptomatic at the time of testing, and 4 (6%) showed positive test results for >3 weeks (1 had severe symptoms and 3 had mild symptoms). We also identified 6 clusters of MERS-CoV cases. This report highlights the potential for virus shedding by mildly ill and asymptomatic case-patients. These findings will be useful for MERS-CoV management and infection prevention strategies. PMID:27314227

L’alimentation des enfants ayant une déficience neurologique

PubMed Central

2009-01-01

La malnutrition, qu’il s’agisse de sous-alimentation ou de suralimentation, est courante chez les enfants ayant une déficience neurologique. Les besoins en énergie sont difficiles à définir au sein de cette population hétérogène. De plus, on manque d’information sur ce qui constitue la croissance normale chez ces enfants. Des facteurs non nutritionnels peuvent influer sur la croissance, mais des facteurs nutritionnels, tels qu’un apport calorique insuffisant, des pertes excessives d’éléments nutritifs et un métabolisme énergétique anormal, contribuent également au retard de croissance de ces enfants. La malnutrition est liée à une importante morbidité, tandis que la réadaptation nutritionnelle améliore l’état de santé global. Le soutien nutritionnel doit faire partie intégrante de la prise en charge des enfants ayant une déficience nutritionnelle et viser non seulement à améliorer l’état nutritionnel, mais également la qualité de vie des patients et de leur famille. Au moment d’envisager une intervention nutritionnelle, il faut tenir compte du dysfonctionnement oromoteur, du reflux gastro-œsophagien et de l’aspiration pulmonaire, et une équipe multidisciplinaire doit se concerter. Il faut repérer rapidement les enfants vulnérables à des troubles nutritionnels et procéder à une évaluation de leur état nutritionnel au moins une fois par année, et plus souvent chez les nourrissons et les jeunes enfants ou chez les enfants qui risquent de souffrir de malnutrition. Il faut optimiser l’apport oral s’il est sécuritaire, mais entreprendre une alimentation entérale chez les enfants ayant un dysfonctionnement oromoteur qui provoque une aspiration marquée ou chez ceux qui sont incapables de maintenir un état nutritionnel suffisant au moyen de l’apport oral. Il faut réserver l’alimentation par sonde nasogastrique aux interventions à court terme, mais si une intervention nutritionnelle prolongée s’impose, il faut envisager la gastrostomie. Il faut réserver les mesures antireflux aux enfants présentant un reflux gastro-œsophagien considérable. Il faut surveiller étroitement la réponse du patient à l’intervention nutritionnelle afin d’éviter une prise de poids excessive après l’amorce de l’alimentation entérale, et privilégier les préparations pédiatriques afin d’éviter les carences en micronutriments. PMID:20592968

Identification of Information Types and Sources by the Public for Promoting Awareness of Middle East Respiratory Syndrome Coronavirus in Saudi Arabia

ERIC Educational Resources Information Center

Hoda, Jradi

2016-01-01

Middle East Respiratory Syndrome (MERS) is a viral respiratory disease of serious consequences caused by MERS Coronavirus (MERS-CoV). Saudi communities still lack awareness of available protective measures to prevent the transmission of the virus. It is necessary to explore the current information-seeking strategies and preferences for…

Monoclonal Antibody Shows Promise as Potential Therapeutic for MERS | Poster

Cancer.gov

A monoclonal antibody has proven effective in preventing Middle Eastern Respiratory Syndrome (MERS) in lab animals, suggesting further development as a potential intervention for the deadly disease in humans, according to new research. MERS is a newly emerged coronavirus first detected in humans in 2012. Most cases have occurred in the Middle East, but the disease has appeared

The Mars Exploration Rovers Entry Descent and Landing and the Use of Aerodynamic Decelerators

NASA Technical Reports Server (NTRS)

Steltzner, Adam; Desai, Prasun; Lee, Wayne; Bruno, Robin

2003-01-01

The Mars Exploration Rovers (MER) project, the next United States mission to the surface of Mars, uses aerodynamic decelerators in during its entry, descent and landing (EDL) phase. These two identical missions (MER-A and MER-B), which deliver NASA s largest mobile science suite to date to the surface of Mars, employ hypersonic entry with an ablative energy dissipating aeroshell, a supersonic/subsonic disk-gap-band parachute and an airbag landing system within EDL. This paper gives an overview of the MER EDL system and speaks to some of the challenges faced by the various aerodynamic decelerators.

Monoclonal Antibody Shows Promise as Potential Therapeutic for MERS | Poster

Cancer.gov

A monoclonal antibody has proven effective in preventing Middle Eastern Respiratory Syndrome (MERS) in lab animals, suggesting further development as a potential intervention for the deadly disease in humans, according to new research. MERS is a newly emerged coronavirus first detected in humans in 2012. Most cases have occurred in the Middle East, but the disease has appeared elsewhere. In all, MERS has infected more than 1,700 individuals and killed more than 600, according to the World Health Organization. No vaccines or antiviral therapies currently exist. Several candidate vaccines are being developed, and some have been tested in animal models, a prerequisite to human clinical trials.

Two deletion variants of Middle East respiratory syndrome coronavirus found in a patient with characteristic symptoms.

PubMed

Xie, Qian; Cao, Yujuan; Su, Juan; Wu, Jie; Wu, Xianbo; Wan, Chengsong; He, Mingliang; Ke, Changwen; Zhang, Bao; Zhao, Wei

2017-08-01

Significant sequence variation of Middle East respiratory syndrome coronavirus (MERS CoV) has never been detected since it was first reported in 2012. A MERS patient came from Korea to China in late May 2015. The patient was 44 years old and had symptoms including high fever, dry cough with a little phlegm, and shortness of breath, which are roughly consistent with those associated with MERS, and had had close contact with individuals with confirmed cases of MERS.After one month of therapy with antiviral, anti-infection, and immune-enhancing agents, the patient recovered in the hospital and was discharged. A nasopharyngeal swab sample was collected for direct sequencing, which revealed two deletion variants of MERS CoV. Deletions of 414 and 419 nt occurred between ORF5 and the E protein, resulting in a partial protein fusion or truncation of ORF5 and the E protein. Functional analysis by bioinformatics and comparison to previous studies implied that the two variants might be defective in their ability to package MERS CoV. However, the mechanism of how these deletions occurred and what effects they have need to be further investigated.

Technique distribuee de gestion de la charge sur le reseau electrique et ring-tree: Un nouveau systeme de communication P2P

NASA Astrophysics Data System (ADS)

Ayoub, Simon

Le reseau de distribution et de transport de l'electricite se modernise dans plusieurs pays dont le Canada. La nouvelle generation de ce reseau que l'on appelle smart grid, permet entre autre l'automatisation de la production, de la distribution et de la gestion de la charge chez les clients. D'un autre cote, des appareils domestiques intelligents munis d'une interface de communication pour des applications du smart grid commencent a apparaitre sur le marche. Ces appareils intelligents pourraient creer une communaute virtuelle pour optimiser leurs consommations d'une facon distribuee. La gestion distribuee de ces charges intelligentes necessite la communication entre un grand nombre d'equipements electriques. Ceci represente un defi important a relever surtout si on ne veut pas augmenter le cout de l'infrastructure et de la maintenance. Lors de cette these deux systemes distincts ont ete concus : un systeme de communication peer-to-peer, appele Ring-Tree, permettant la communication entre un nombre important de noeuds (jusqu'a de l'ordre de grandeur du million) tel que des appareils electriques communicants et une technique distribuee de gestion de la charge sur le reseau electrique. Le systeme de communication Ring-Tree inclut une nouvelle topologie reseau qui n'a jamais ete definie ou exploitee auparavant. Il inclut egalement des algorithmes pour la creation, l'exploitation et la maintenance de ce reseau. Il est suffisamment simple pour etre mis en oeuvre sur des controleurs associes aux dispositifs tels que des chauffe-eaux, chauffage a accumulation, bornes de recharges electriques, etc. Il n'utilise pas un serveur centralise (ou tres peu, seulement lorsqu'un noeud veut rejoindre le reseau). Il offre une solution distribuee qui peut etre mise en oeuvre sans deploiement d'une infrastructure autre que les controleurs sur les dispositifs vises. Finalement, un temps de reponse de quelques secondes pour atteindre 1'ensemble du reseau peut etre obtenu, ce qui est suffisant pour les besoins des applications visees. Les protocoles de communication s'appuient sur un protocole de transport qui peut etre un de ceux utilises sur l'Internet comme TCP ou UDP. Pour valider le fonctionnement de de la technique de controle distribuee et le systeme de communiction Ring-Tree, un simulateur a ete developpe; un modele de chauffe-eau, comme exemple de charge, a ete integre au simulateur. La simulation d'une communaute de chauffe-eaux intelligents a montre que la technique de gestion de la charge combinee avec du stockage d'energie sous forme thermique permet d'obtenir, sans affecter le confort de l'utilisateur, des profils de consommation varies dont un profil de consommation uniforme qui represente un facteur de charge de 100%. Mots-cles : Algorithme Distribue, Demand Response, Gestion de la Charge Electrique, M2M (Machine-to-Machine), P2P (Peer-to-Peer), Reseau Electrique Intelligent, Ring-Tree, Smart Grid

Fibrose kystique atypique

PubMed Central

Schram, Carrie A.

2012-01-01

Résumé Objectif Passer en revue le diagnostic des patients atteints de fibrose kystique (FK) atypique. Sources des données On a procédé à une recension exhaustive dans MEDLINE (de 1950 à la troisième semaine de mai 2009), dans MEDLINE In-Process and Other Non-Indexed Citations and Cases (de 1950 à la troisième semaine de 2009) et dans EMBASE (de 1980 à la quatrième semaine de mars 2009). On a aussi passé en revue le site web de Fibrose kystique Canada et on a consulté son plus récent rapport des inscriptions de données sur les patients. Message principal La FK atypique est une forme moins intense du trouble de la FK, qui est associée à des mutations du gène régulateur de la conductance transmembranaire de la fibrose kystique. Au lieu d’avoir les symptômes classiques, les personnes atteintes d’une FK atypique pourraient avoir une légère dysfonction d’un seul système organique et avoir ou non des concentrations de chlorure élevées dans la sueur. La FK atypique est un trouble très diversifié affectant différents systèmes organiques à divers degrés. Les symptômes du patient peuvent aussi fluctuer avec le temps; par ailleurs, certains signes et symptômes cliniques touchant les systèmes respiratoire, gastro-intestinal, endocrinien et métabolique et génito-urinaire devraient signaler aux médecins la possibilité d’une FK. Les patients atteints d’une FK atypique ont moins d’hospitalisations durant l’enfance que ceux qui ont une FK classique et le diagnostic peut passer inaperçu pendant de nombreuses années, parfois même jusqu’à l’âge adulte. Conclusion Même si les patients atteints d’une FK atypique ont une espérance de vie plus longue que les personnes atteintes de la forme classique, les issues à long terme pour de nombreuses personnes qui ont la forme atypique sont inconnues. Il est important de conseiller les patients à propos de la possibilité d’une manifestation future de la maladie. Renseigner les patients à propos de la FK peut les aider à comprendre leurs symptômes, à modifier leur mode de vie pour optimiser leur santé, à réduire l’incidence des complications et à recevoir au besoin du counseling sur la planification familiale.

Methods for automatic detection of artifacts in microelectrode recordings.

PubMed

Bakštein, Eduard; Sieger, Tomáš; Wild, Jiří; Novák, Daniel; Schneider, Jakub; Vostatek, Pavel; Urgošík, Dušan; Jech, Robert

2017-10-01

Extracellular microelectrode recording (MER) is a prominent technique for studies of extracellular single-unit neuronal activity. In order to achieve robust results in more complex analysis pipelines, it is necessary to have high quality input data with a low amount of artifacts. We show that noise (mainly electromagnetic interference and motion artifacts) may affect more than 25% of the recording length in a clinical MER database. We present several methods for automatic detection of noise in MER signals, based on (i) unsupervised detection of stationary segments, (ii) large peaks in the power spectral density, and (iii) a classifier based on multiple time- and frequency-domain features. We evaluate the proposed methods on a manually annotated database of 5735 ten-second MER signals from 58 Parkinson's disease patients. The existing methods for artifact detection in single-channel MER that have been rigorously tested, are based on unsupervised change-point detection. We show on an extensive real MER database that the presented techniques are better suited for the task of artifact identification and achieve much better results. The best-performing classifiers (bagging and decision tree) achieved artifact classification accuracy of up to 89% on an unseen test set and outperformed the unsupervised techniques by 5-10%. This was close to the level of agreement among raters using manual annotation (93.5%). We conclude that the proposed methods are suitable for automatic MER denoising and may help in the efficient elimination of undesirable signal artifacts. Copyright © 2017 Elsevier B.V. All rights reserved.

PEDF and PEDF-derived peptide 44mer inhibit oxygen-glucose deprivation-induced oxidative stress through upregulating PPARγ via PEDF-R in H9c2 cells.

PubMed

Zhuang, Wei; Zhang, Hao; Pan, Jiajun; Li, Zhimin; Wei, Tengteng; Cui, Huazhu; Liu, Zhiwei; Guan, Qiuhua; Dong, Hongyan; Zhang, Zhongming

2016-04-08

Pigment epithelial-derived factor (PEDF) is a glycoprotein with broad biological activities including inhibiting oxygen-glucose deprivation(OGD)-induced cardiomyocytes apoptosis through its anti-oxidative properties. PEDF derived peptide-44mer shows similar cytoprotective effect to PEDF. However, the molecular mechanisms mediating cardiomyocytes apoptosis have not been fully established. Here we found that PEDF and 44mer decreased the content of ROS. This content was abolished by either PEDF-R small interfering RNA (siRNA) or PPARγ antagonist. The level of Lysophosphatidic acid (LPA) and phospholipase A2 (PLA2) was observed as drawn from the ELISA assays. PEDF and 44mer sequentially induced PPARγ expression was observed both in qPCR and Western blot assays. The level of LPA and PLA2 and PPARγ expression increased by PEDF and 44mer was significantly attenuated by PEDF-R siRNA. However, PEDF and 44mer inhibited the H9c2 cells and cultured neonatal rat myocardial cells apoptosis rate. On the other hand, TUNEL assay and cleavage of procaspase-3 showed that PEDF-R siRNA or PPARγ antagonist increased the apoptosis again. We conclude that under OGD condition, PEDF and 44mer reduce H9c2 cells apoptosis and inhibit OGD-induced oxidative stress via its receptor PEDF-R and the PPARγ signaling pathway. Copyright © 2016 Elsevier Inc. All rights reserved.

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

PubMed Central

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-01-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between −35 and −10 elements. PMID:27641146

First confirmed cases of Middle East respiratory syndrome coronavirus (MERS-CoV) infection in the United States, updated information on the epidemiology of MERS-CoV infection, and guidance for the public, clinicians, and public health authorities - May 2014.

PubMed

Bialek, Stephanie R; Allen, Donna; Alvarado-Ramy, Francisco; Arthur, Ray; Balajee, Arunmozhi; Bell, David; Best, Susan; Blackmore, Carina; Breakwell, Lucy; Cannons, Andrew; Brown, Clive; Cetron, Martin; Chea, Nora; Chommanard, Christina; Cohen, Nicole; Conover, Craig; Crespo, Antonio; Creviston, Jeanean; Curns, Aaron T; Dahl, Rebecca; Dearth, Stephanie; DeMaria, Alfred; Echols, Fred; Erdman, Dean D; Feikin, Daniel; Frias, Mabel; Gerber, Susan I; Gulati, Reena; Hale, Christa; Haynes, Lia M; Heberlein-Larson, Lea; Holton, Kelly; Ijaz, Kashef; Kapoor, Minal; Kohl, Katrin; Kuhar, David T; Kumar, Alan M; Kundich, Marianne; Lippold, Susan; Liu, Lixia; Lovchik, Judith C; Madoff, Larry; Martell, Sandra; Matthews, Sarah; Moore, Jessica; Murray, Linda R; Onofrey, Shauna; Pallansch, Mark A; Pesik, Nicki; Pham, Huong; Pillai, Satish; Pontones, Pam; Pringle, Kimberly; Pritchard, Scott; Rasmussen, Sonja; Richards, Shawn; Sandoval, Michelle; Schneider, Eileen; Schuchat, Anne; Sheedy, Kristine; Sherin, Kevin; Swerdlow, David L; Tappero, Jordan W; Vernon, Michael O; Watkins, Sharon; Watson, John

2014-05-16

Since mid-March 2014, the frequency with which cases of Middle East respiratory syndrome coronavirus (MERS-CoV) infection have been reported has increased, with the majority of recent cases reported from Saudi Arabia and United Arab Emirates (UAE). In addition, the frequency with which travel-associated MERS cases have been reported and the number of countries that have reported them to the World Health Organization (WHO) have also increased. The first case of MERS in the United States, identified in a traveler recently returned from Saudi Arabia, was reported to CDC by the Indiana State Department of Health on May 1, 2014, and confirmed by CDC on May 2. A second imported case of MERS in the United States, identified in a traveler from Saudi Arabia having no connection with the first case, was reported to CDC by the Florida Department of Health on May 11, 2014. The purpose of this report is to alert clinicians, health officials, and others to increase awareness of the need to consider MERS-CoV infection in persons who have recently traveled from countries in or near the Arabian Peninsula. This report summarizes recent epidemiologic information, provides preliminary descriptions of the cases reported from Indiana and Florida, and updates CDC guidance about patient evaluation, home care and isolation, specimen collection, and travel as of May 13, 2014.

Transformation of a transposon into a derived prolactin promoter with function during human pregnancy

PubMed Central

Emera, Deena; Wagner, Günter P.

2012-01-01

Transposable elements (TEs) are known to provide DNA for host regulatory functions, but the mechanisms underlying the transformation of TEs into cis-regulatory elements are unclear. In humans two TEs—MER20 and MER39—contribute the enhancer/promoter for decidual prolactin (dPRL), which is dramatically induced during pregnancy. We show that evolution of the strong human dPRL promoter was a multistep process that took millions of years. First, MER39 inserted near MER20 in the primate/rodent ancestor, and then there were two phases of activity enhancement in primates. Through the mapping of causal nucleotide substitutions, we demonstrate that strong promoter activity in apes involves epistasis between transcription factor binding sites (TFBSs) ancestral to MER39 and derived sites. We propose a mode of molecular evolution that describes the process by which MER20/MER39 was transformed into a strong promoter, called “epistatic capture.” Epistatic capture is the stabilization of a TFBS that is ancestral but variable in outgroup lineages, and is fixed in the ingroup because of epistatic interactions with derived TFBSs. Finally, we note that evolution of human promoter activity coincides with the emergence of a unique reproductive character in apes, highly invasive placentation. Because prolactin communicates with immune cells during pregnancy, which regulate fetal invasion into maternal tissues, we speculate that ape dPRL promoter activity evolved in response to increased invasiveness of ape fetal tissue. PMID:22733751

Thermally induced defluorination during a mer to fac transformation of a blue-green phosphorescent cyclometalated iridium(III) complex.

PubMed

Zheng, Yonghao; Batsanov, Andrei S; Edkins, Robert M; Beeby, Andrew; Bryce, Martin R

2012-01-02

The new homoleptic tris-cyclometalated [Ir(C^N)(3)] complexes mer-8, fac-8, and fac-9 incorporating γ-carboline ligands are reported. Reaction of 3-(2,4-difluorophenyl)-5-(2-ethylhexyl)-pyrido[4,3-b]indole 6 with iridium(III) chloride under standard cyclometalating conditions gave the homoleptic complex mer-8 in 63% yield. The X-ray crystal structure of mer-8 is described. The Ir-C and Ir-N bonds show the expected bond length alternations for the differing trans influence of phenyl and pyridyl ligands. mer-8 quantitatively isomerized to fac-8 upon irradiation with UV light. However, heating mer-8 at 290 °C in glycerol led to an unusual regioselective loss of one fluorine atom from each of the ligands, yielding fac-9 in 58% yield. fac-8 is thermally very stable: no decomposition was observed when fac-8 was heated in glycerol at 290 °C for 48 h. The γ-carboline system of fac-8 enhances thermal stability compared to the pyridyl analogue fac-Ir(46dfppy)(3)10, which decomposes extensively upon being heated in glycerol at 290 °C for 2 h. Complexes mer-8, fac-8, and fac-9 are emitters of blue-green light (λ(max)(em) = 477, 476, and 494 nm, respectively). The triplet lifetimes for fac-8 and fac-9 are ~4.5 μs at room temperature; solution Φ(PL) values are 0.31 and 0.22, respectively.

On the Five-Moment Hamburger Maximum Entropy Reconstruction

NASA Astrophysics Data System (ADS)

Summy, D. P.; Pullin, D. I.

2018-05-01

We consider the Maximum Entropy Reconstruction (MER) as a solution to the five-moment truncated Hamburger moment problem in one dimension. In the case of five monomial moment constraints, the probability density function (PDF) of the MER takes the form of the exponential of a quartic polynomial. This implies a possible bimodal structure in regions of moment space. An analytical model is developed for the MER PDF applicable near a known singular line in a centered, two-component, third- and fourth-order moment (μ _3 , μ _4 ) space, consistent with the general problem of five moments. The model consists of the superposition of a perturbed, centered Gaussian PDF and a small-amplitude packet of PDF-density, called the outlying moment packet (OMP), sitting far from the mean. Asymptotic solutions are obtained which predict the shape of the perturbed Gaussian and both the amplitude and position on the real line of the OMP. The asymptotic solutions show that the presence of the OMP gives rise to an MER solution that is singular along a line in (μ _3 , μ _4 ) space emanating from, but not including, the point representing a standard normal distribution, or thermodynamic equilibrium. We use this analysis of the OMP to develop a numerical regularization of the MER, creating a procedure we call the Hybrid MER (HMER). Compared with the MER, the HMER is a significant improvement in terms of robustness and efficiency while preserving accuracy in its prediction of other important distribution features, such as higher order moments.

Identifying Monoclonal Antibodies that Potently Inhibit MERS-CoV | Center for Cancer Research

Cancer.gov

The Middle East respiratory syndrome coronavirus (MERS-CoV), first isolated in September 2012, infects cells lining the human airway, causing severe flu-like symptoms that, in some cases, lead to death. As of July 2, 2014, 824 confirmed cases of MERS-CoV infection, including at least 286 related deaths, have been reported to the World Health Organization. While there are

Risk of global spread of Middle East respiratory syndrome coronavirus (MERS-CoV) via the air transport network.

PubMed

Gardner, Lauren M; Chughtai, Abrar A; MacIntyre, C Raina

2016-06-01

Middle East respiratory syndrome coronavirus (MERS-CoV) emerged from the Kingdom of Saudi Arabia (KSA) in 2012 and has since spread to 26 countries. All cases reported so far have either been in the Middle East or linked to the region through passenger air travel, with the largest outbreak outside KSA occurring in South Korea. Further international spread is likely due to the high travel volumes of global travel, as well as the occurrence of large annual mass gathering such as the Haj and Umrah pilgrimages that take place in the region. In this study, a transport network modelling framework was used to quantify the risk of MERS-CoV spreading internationally via air travellers. All regions connected to MERS-CoV affected countries via air travel are considered, and the countries at highest risk of travel-related importations of MERS-CoV were identified, ranked and compared with actual spread of MERS cases. The model identifies all countries that have previously reported a travel acquired case to be in the top 50 at-risk countries. India, Pakistan and Bangladesh are the highest risk countries which have yet to report a case, and should be prepared for the possibility of (pilgrims and general) travellers returning infected with MERS-CoV. In addition, the UK, Egypt, Turkey and the USA are at risk of more cases. We have demonstrated a risk-analysis approach, using travel patterns, to prioritize countries at highest risk for MERS-CoV importations. In order to prevent global outbreaks such as the one seen in South Korea, it is critical for high-risk countries to be prepared and have appropriate screening and triage protocols in place to identify travel-related cases of MERS-CoV. The results from the model can be used by countries to prioritize their airport and hospital screening and triage protocols. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

Determining geographical spread pattern of MERS-CoV by distance method using Kimura model

NASA Astrophysics Data System (ADS)

Amiroch, Siti; Rohmatullah, Arif

2017-03-01

MERS-CoV or generally called as Middle East Respiratory Syndrome Coronavirus, a respiratory disease syndrome caused by a corona virus that attacks the respiratory tract ranging from mild to severe acute indication of fever, cough and shortness of breath. The cases happened relate to the countries in the Arabian Peninsula (Middle East) and there were 356 deaths have been reported due to the spread of the epidemic MERS. The data used in the case of MERS are the data DNA sequences taken from Genbank, the online database of the United States that stores the results of molecular biological experiments from all over the world (http://www.ncbi.nlm.nih.gov). In this case, bioinformatics plays an important role of reading sequences of DNA and genetic information by using the main device in the form of software that is supported by the availability of the Internet, while the analysis there in made and proven with mathematical methods. In similar research conducted by molecular biologists and physicians, the process of DNA sequencing is done with software that is already available like BLAST. In order to determine the MERS geographical distribution patterns in the Arabian Peninsula is done with program Clustal W, Bayesian, Phylip, etc. In this study, the writer use the Matlab simulation for all processes starting sequence alignment, counting the number of transitions and transversion substitutions for each sequence and its location up to the process of forming a phylogenetic tree that figures out the pattern of spread of the epidemic MERS. Mathematical analysis performed on a decline in the formula is to find Kimura evolutionary models and the process of forming a phylogenetic tree (the pattern of the epidemic MERS distribution) with neighbor joining algorithm. Finally it was obtained the pattern of geographical spread with 6 groups epidemic of MERS which ultimately turns out that all the MERS viruses that were spread in the Arabian Peninsula everything are almost the same as the virus sequence found in al-Hasa.

Estimation of basic reproduction number of the Middle East respiratory syndrome coronavirus (MERS-CoV) during the outbreak in South Korea, 2015.

PubMed

Chang, Hyuk-Jun

2017-06-13

In South Korea, an outbreak of Middle East respiratory syndrome (MERS) occurred in 2015. It was the second largest MERS outbreak. As a result of the outbreak in South Korea, 186 infections were reported, and 36 patients died. At least 16,693 people were isolated with suspicious symptoms. This paper estimates the basic reproduction number of the MERS coronavirus (CoV), using data on the spread of MERS in South Korea. The basic reproduction number of an epidemic is defined as the average number of secondary cases that an infected subject produces over its infectious period in a susceptible and uninfected population. To estimate the basic reproduction number of the MERS-CoV, we employ data from the 2015 South Korea MERS outbreak and the susceptible-infected-removed (SIR) model, a mathematical model that uses a set of ordinary differential equations (ODEs). We fit the model to the epidemic data of the South Korea outbreak minimizing the sum of the squared errors to identify model parameters. Also we derive the basic reproductive number as the terms of the parameters of the SIR model. Then we determine the basic reproduction number of the MERS-CoV in South Korea in 2015 as 8.0977. It is worth comparing with the basic reproductive number of the 2014 Ebola outbreak in West Africa including Guinea, Sierra Leone, and Liberia, which had values of 1.5-2.5. There was no intervention to control the infection in the early phase of the outbreak, thus the data used here provide the best conditions to evaluate the epidemic characteristics of MERS, such as the basic reproduction number. An evaluation of basic reproduction number using epidemic data could be problematic if there are stochastic fluctuations in the early phase of the outbreak, or if the report is not accurate and there is bias in the data. Such problems are not relevant to this study because the data used here were precisely reported and verified by Korea Hospital Association.

Prevalence of Diabetes in the 2009 Influenza A (H1N1) and the Middle East Respiratory Syndrome Coronavirus: A Systematic Review and Meta-Analysis.

PubMed

Badawi, Alaa; Ryoo, Seung Gwan

2016-12-09

Over the past two decades a number of severe acute respiratory infection outbreaks such as the 2009 influenza A (H1N1) and the Middle East respiratory syndrome coronavirus (MERS-CoV) have emerged and presented a considerable global public health threat. Epidemiologic evidence suggests that diabetic subjects are more susceptible to these conditions. However, the prevalence of diabetes in H1N1 and MERS-CoV has not been systematically described. The aim of this study is to conduct a systematic review and meta-analysis of published reports documenting the prevalence of diabetes in H1N1 and MERS-CoV and compare its frequency in the two viral conditions. Meta-analysis for the proportions of subjects with diabetes was carried out in 29 studies for H1N1 ( n =92,948) and 9 for MERS-CoV ( n =308). Average age of H1N1 patients (36.2±6.0 years) was significantly younger than that of subjects with MERS-CoV (54.3±7.4 years, P<0.05). Compared to MERS-CoV patients, subjects with H1N1 exhibited 3-fold lower frequency of cardiovascular diseases and 2- and 4-fold higher prevalence of obesity and immunosuppression, respectively. The overall prevalence of diabetes in H1N1 was 14.6% (95% CI: 12.3-17.0%; P<0.001), a 3.6-fold lower than in MERS-CoV (54.4%; 95% CI: 29.4-79.5; P<0.001). The prevalence of diabetes among H1N1 cases from Asia and North America was ~two-fold higher than those from South America and Europe. The prevalence of diabetes in MERS-CoV cases is higher than in H1N1. Regional comparisons suggest that an etiologic role of diabetes in MERS-CoV may exist distinctive from that in H1N1.

Peptide synthesis on glass substrate using acoustic droplet ejector.

PubMed

Youngki Choe; Shih-Jui Chen; Eun Sok Kim

2014-03-01

This paper describes the synthesis of a 9-mers-long peptide ladder structure of glycine on a modified glass surface using a nanoliter droplet ejector. To synthesize peptide on a glass substrate, SPOT peptide synthesis protocol was followed with a nozzleless acoustic droplet ejector being used to eject about 300 droplets of preactivated amino acid solution to dispense 60 nL of the solution per mer. The coupling efficiency of each mer was measured with FITC fluorescent tag to be 96%, resulting in net 70% efficiency for the whole 9-mer-long peptide of glycine. Usage of a nanoliter droplet ejector for SPOT peptide synthesis increases the density of protein array on a chip.

Photochemistry of Iron and Ruthenium Carbonyl Complexes: Evidence for Light-Induced Loss of Carbon Monoxide and Reductive Elimination of Triethylsilane from cis-mer-HM(SiEt3)(CO)3(PPh3).

DTIC Science & Technology

1983-05-21

JEOL FX9OQ Fourier transform or Bruker 250 or 270 MHz Fourier transform spectrometer. Irradiations. Photochemical reactions were carried out using a...Ph 3 ) 3nd -t-Etin V,- a 313 nm quantum yield of -0.6. The process is photochemically everse if the cis-mer-HM(SiPh 3 )(CO) 3 (PPh 3) is irradiated...process is photochemically reversed if the cis-mer-HM(SiPh 3 )(CO)3 (PPh 3 ) is irradiated in t.e presence of excess Et3SiH. Irradiation of cis-mer-HM

NCI Researchers Discover Exceptionally Potent Antibodies with Potential for Prophylaxis and Therapy of MERS-Coronavirus Infections | Poster

Cancer.gov

By Andrea Frydl, Contributing Writer In a recent article published in the Journal of Virology, Tianlei Ying, Ph.D., Dimiter Dimitrov, Ph.D., and their colleagues in the Laboratory of Experimental Immunology (LEI), Cancer and Inflammation Program, NCI Center for Cancer Research, reported the identification of three human monoclonal antibodies (m336, m337, and m338) that target the part of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) that is responsible for binding to its receptor. These antibodies are exceptionally potent inhibitors of MERS-CoV infection and also provide a basis for creating a future MERS-CoV vaccine.

T-cell immunity of SARS-CoV: Implications for vaccine development against MERS-CoV.

PubMed

Liu, William J; Zhao, Min; Liu, Kefang; Xu, Kun; Wong, Gary; Tan, Wenjie; Gao, George F

2017-01-01

Over 12 years have elapsed since severe acute respiratory syndrome (SARS) triggered the first global alert for coronavirus infections. Virus transmission in humans was quickly halted by public health measures and human infections of SARS coronavirus (SARS-CoV) have not been observed since. However, other coronaviruses still pose a continuous threat to human health, as exemplified by the recent emergence of Middle East respiratory syndrome (MERS) in humans. The work on SARS-CoV widens our knowledge on the epidemiology, pathophysiology and immunology of coronaviruses and may shed light on MERS coronavirus (MERS-CoV). It has been confirmed that T-cell immunity plays an important role in recovery from SARS-CoV infection. Herein, we summarize T-cell immunological studies of SARS-CoV and discuss the potential cross-reactivity of the SARS-CoV-specific immunity against MERS-CoV, which may provide useful recommendations for the development of broad-spectrum vaccines against coronavirus infections. Copyright © 2016 Elsevier B.V. All rights reserved.

The effect of multiple external representations (MERs) worksheets toward complex system reasoning achievement

NASA Astrophysics Data System (ADS)

Sumarno; Ibrahim, M.; Supardi, Z. A. I.

2018-03-01

The application of a systems approach to assessing biological systems provides hope for a coherent understanding of cell dynamics patterns and their relationship to plant life. This action required the reasoning about complex systems. In other sides, there were a lot of researchers who provided the proof about the instructional successions. They involved the multiple external representations which improved the biological learning. The researcher conducted an investigation using one shoot case study design which involved 30 students in proving that the MERs worksheets could affect the student's achievement of reasoning about complex system. The data had been collected based on test of reasoning about complex system and student's identification result who worked through MERs. The result showed that only partially students could achieve reasoning about system complex, but their MERs skill could support their reasoning ability of complex system. This study could bring a new hope to develop the MERs worksheet as a tool to facilitate the reasoning about complex system.

Association between Australian Hajj Pilgrims' awareness of MERS-CoV, and their compliance with preventive measures and exposure to camels.

PubMed

Alqahtani, Amani S; Wiley, Kerrie E; Mushta, Sami M; Yamazaki, Kaoruko; BinDhim, Nasser F; Heywood, Anita E; Booy, Robert; Rashid, Harunor

2016-05-01

Through a prospective cohort study the relationship between travellers' awareness of MERS-CoV, and compliance with preventive measures and exposure to camels was evaluated among Australian Hajj pilgrims who attended Hajj in 2015. Only 28% of Australian Hajj pilgrims were aware of MERS-CoV in Saudi Arabia. Those who were aware of MERS-CoV were more likely to receive recommended vaccines [odds ratio (OR) 3.1, 95% confidence interval (CI): 1.5-5.9, P < 0.01], but there was no significant difference in avoiding camels or their raw products during Hajj between those who were aware of MERS-CoV and those who were not (OR 1.2, 95% CI: 0.3-5.2, P = 0.7). Hajj pilgrims' awareness is reflected in some of their practices but not in all. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

Replication and Shedding of MERS-CoV in Upper Respiratory Tract of Inoculated Dromedary Camels

PubMed Central

Adney, Danielle R.; van Doremalen, Neeltje; Brown, Vienna R.; Bushmaker, Trenton; Scott, Dana; de Wit, Emmie; Munster, Vincent J.

2014-01-01

In 2012, a novel coronavirus associated with severe respiratory disease in humans emerged in the Middle East. Epidemiologic investigations identified dromedary camels as the likely source of zoonotic transmission of Middle East respiratory syndrome coronavirus (MERS-CoV). Here we provide experimental support for camels as a reservoir for MERS-CoV. We inoculated 3 adult camels with a human isolate of MERS-CoV and a transient, primarily upper respiratory tract infection developed in each of the 3 animals. Clinical signs of the MERS-CoV infection were benign, but each of the camels shed large quantities of virus from the upper respiratory tract. We detected infectious virus in nasal secretions through 7 days postinoculation, and viral RNA up to 35 days postinoculation. The pattern of shedding and propensity for the upper respiratory tract infection in dromedary camels may help explain the lack of systemic illness among naturally infected camels and the means of efficient camel-to-camel and camel-to-human transmission. PMID:25418529

Differential TAM receptor-ligand-phospholipid interactions delimit differential TAM bioactivities.

PubMed

Lew, Erin D; Oh, Jennifer; Burrola, Patrick G; Lax, Irit; Zagórska, Anna; Través, Paqui G; Schlessinger, Joseph; Lemke, Greg

2014-09-29

The TAM receptor tyrosine kinases Tyro3, Axl, and Mer regulate key features of cellular physiology, yet the differential activities of the TAM ligands Gas6 and Protein S are poorly understood. We have used biochemical and genetic analyses to delineate the rules for TAM receptor-ligand engagement and find that the TAMs segregate into two groups based on ligand specificity, regulation by phosphatidylserine, and function. Tyro3 and Mer are activated by both ligands but only Gas6 activates Axl. Optimal TAM signaling requires coincident TAM ligand engagement of both its receptor and the phospholipid phosphatidylserine (PtdSer): Gas6 lacking its PtdSer-binding 'Gla domain' is significantly weakened as a Tyro3/Mer agonist and is inert as an Axl agonist, even though it binds to Axl with wild-type affinity. In two settings of TAM-dependent homeostatic phagocytosis, Mer plays a predominant role while Axl is dispensable, and activation of Mer by Protein S is sufficient to drive phagocytosis.

KSC-03pd0536

NASA Image and Video Library

2003-02-24

KENNEDY SPACE CENTER, FLA. -- The cruise stage, aeroshell and lander for the Mars Exploration Rover-1 mission and the MER-2 rover arrive at KSC. The same flight hardware for the MER-2 rover arrived Jan. 27; however, the MER-2 rover is scheduled to arrive at KSC in March. While at KSC, each of the two rovers, the aeroshells and the landers will undergo a full mission simulation. All of these flight elements will then be integrated together. After spin balance testing, each spacecraft will be mated to a solid propellant upper stage booster that will propel the spacecraft out of Earth orbit. Approximately 10 days before launch they will be transported to the launch pad for mating with their respective Boeing Delta II rockets. The rovers will serve as robotic geologists to seek answers about the evolution of Mars, particularly for a history of water. The rovers will be identical to each other, but will land at different regions of Mars. Launch of the MER-1 is scheduled for May 30. MER-2 will follow June 25.

Feasibility of Using Convalescent Plasma Immunotherapy for MERS-CoV Infection, Saudi Arabia.

PubMed

Arabi, Yaseen M; Hajeer, Ali H; Luke, Thomas; Raviprakash, Kanakatte; Balkhy, Hanan; Johani, Sameera; Al-Dawood, Abdulaziz; Al-Qahtani, Saad; Al-Omari, Awad; Al-Hameed, Fahad; Hayden, Frederick G; Fowler, Robert; Bouchama, Abderrezak; Shindo, Nahoko; Al-Khairy, Khalid; Carson, Gail; Taha, Yusri; Sadat, Musharaf; Alahmadi, Mashail

2016-09-01

We explored the feasibility of collecting convalescent plasma for passive immunotherapy of Middle East respiratory syndrome coronavirus (MERS-CoV) infection by using ELISA to screen serum samples from 443 potential plasma donors: 196 patients with suspected or laboratory-confirmed MERS-CoV infection, 230 healthcare workers, and 17 household contacts exposed to MERS-CoV. ELISA-reactive samples were further tested by indirect fluorescent antibody and microneutralization assays. Of the 443 tested samples, 12 (2.7%) had a reactive ELISA result, and 9 of the 12 had reactive indirect fluorescent antibody and microneutralization assay titers. Undertaking clinical trials of convalescent plasma for passive immunotherapy of MERS-CoV infection may be feasible, but such trials would be challenging because of the small pool of potential donors with sufficiently high antibody titers. Alternative strategies to identify convalescent plasma donors with adequate antibody titers should be explored, including the sampling of serum from patients with more severe disease and sampling at earlier points during illness.

WATER ON MARS: EVIDENCE FROM MER MISSION RESULTS

NASA Technical Reports Server (NTRS)

Landis, Geoffrey A.

2006-01-01

The Mars Exploration Rover (MER) mission landed two rovers on Mars, equipped with a highly-capable suite of science instruments. The Spirit rover landed on the inside Gusev Crater on January 5, 2004, and the Opportunity rover three weeks later on Meridiani Planum. This paper summarizes some of the findings from the MER rovers related to the NASA science strategy of investigating past and present water on Mars.

Development of FIAT-Based Parametric Thermal Protection System Mass Estimating Relationships for NASA's Multi-Mission Earth Entry Concept

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Zarchi, Kerry; Maddock, Robert W.; Samareh, Jamshid A.

2013-01-01

Part of NASAs In-Space Propulsion Technology (ISPT) program is the development of the tradespace to support the design of a family of multi-mission Earth Entry Vehicles (MMEEV) to meet a wide range of mission requirements. An integrated tool called the Multi Mission System Analysis for Planetary Entry Descent and Landing or M-SAPE tool is being developed as part of Entry Vehicle Technology project under In-Space Technology program. The analysis and design of an Earth Entry Vehicle (EEV) is multidisciplinary in nature, requiring the application many disciplines. Part of M-SAPE's application required the development of parametric mass estimating relationships (MERs) to determine the vehicle's required Thermal Protection System (TPS) for safe Earth entry. For this analysis, the heat shield was assumed to be made of a constant thickness TPS. This resulting MERs will then e used to determine the pre-flight mass of the TPS. Two Mers have been developed for the vehicle forebaody. One MER was developed for PICA and the other consisting of Carbon Phenolic atop an Advanced Carbon-Carbon composition. For the the backshell, MERs have been developed for SIRCA, Acusil II, and LI-900. How these MERs were developed, the resulting equations, model limitations, and model accuracy are discussed in this poster.

Cell Surface Display of MerR on Saccharomyces cerevisiae for Biosorption of Mercury.

PubMed

Wei, Qinguo; Yan, Jiakuo; Chen, Yao; Zhang, Lei; Wu, Xiaoyang; Shang, Shuai; Ma, Shisheng; Xia, Tian; Xue, Shuyu; Zhang, Honghai

2018-01-01

The metalloregulatory protein MerR which plays important roles in mer operon system exhibits high affinity and selectivity toward mercury (II) (Hg 2+ ). In order to improve the adsorption ability of Saccharomyces cerevisiae for Hg 2+ , MerR was displayed on the surface of S. cerevisiae for the first time with an α-agglutinin-based display system in this study. The merR gene was synthesized after being optimized and added restriction endonuclease sites EcoR I and Mlu I. The display of MerR was indirectly confirmed by the enhanced adsorption ability of S. cerevisiae for Hg 2+ and colony PCR. The hydride generation atomic absorption spectrometry was applied to measure the Hg 2+ content in water. The engineered yeast strain not only showed higher tolerance to Hg, but also their adsorption ability was much higher than that of origin and control strains. The engineered yeast could adsorb Hg 2+ under a wide range of pH levels, and it could also adsorb Hg 2+ effectively with Cd 2+ and Cu 2+ coexistence. Furthermore, the engineered yeast strain could adsorb ultra-trace Hg 2+ effectively. The results above showed that the surface-engineered yeast strain could adsorb Hg 2+ under complex environmental conditions and could be used for the biosorption and bioremediation of environmental Hg contaminants.

Exploring Gusev Crater with Spirit: Review of science objectives and testable hypotheses

USGS Publications Warehouse

Cabrol, N.A.; Grin, E.A.; Carr, M.H.; Sutter, B.; Moore, Johnnie N.; Farmer, J.D.; Greeley, R.; Kuzmin, R.O.; DesMarais, D.J.; Kramer, M.G.; Newsom, H.; Barber, C.; Thorsos, I.; Tanaka, K.L.; Barlow, N.G.; Fike, D.A.; Urquhart, M.L.; Grigsby, B.; Grant, F.D.; de Goursac, O.

2003-01-01

Gusev Crater was selected as the landing site for the Mars Exploration Rover (MER) Spirit mission. Located at the outlet of Ma'adim Vallis and 250 km south of the volcano Apollinaris Patera, Gusev is an outstanding site to achieve the goals of the MER mission. The crater could have collected sediments from a variety of sources during its 3.9 Ga history, including fluvial, lacustrine, volcanic, glacial, impact, regional and local aeolian, and global air falls. It is a unique site to investigate the past history of water on Mars, climate and geological changes, and the potential habitability of the planet, which are central science objectives of the MER mission. Because of its complex history and potential diversity, Gusev will allow the testing of a large spectrum of hypotheses with the complete suite of MER instruments. Evidence consistent with long-lived lake episodes exist in the landing ellipse area. They might offer a unique opportunity to study, for the first time, Martian aqueous sediments and minerals formed in situ in their geological context. We review the geological history and diversity of the landing site, the science hypotheses that can be tested during the MER mission, and the relevance of Gusev to the MER mission objectives and payload. Copyright 2003 by the American Geophysical Union.

Reduction of soluble dipeptidyl peptidase 4 levels in plasma of patients infected with Middle East respiratory syndrome coronavirus.

PubMed

Inn, Kyung-Soo; Kim, Yuri; Aigerim, Abdimadiyeva; Park, Uni; Hwang, Eung-Soo; Choi, Myung-Sik; Kim, Yeon-Sook; Cho, Nam-Hyuk

2018-05-01

Dipeptidyl peptidase 4 (DPP4) is a receptor for MERS-CoV. The soluble form of DPP4 (sDPP4) circulates systematically and can competitively inhibit MERS-CoV entry into host cells. Here, we measured the concentration of sDPP4 in the plasma and sputa of 14 MERS-CoV-infected patients of various degrees of disease severity. The concentration of sDPP4 in the plasma of MERS patients (474.76 ± 108.06 ng/ml) was significantly lower than those of healthy controls (703.42 ± 169.96 ng/ml), but there were no significant differences among the patient groups. Interestingly, plasma levels of IL-10 and EGF were negatively and positively correlated with sDPP4 concentrations, respectively. The sDPP4 levels in sputa were less than 300 ng/ml. Viral infection was inhibited by 50% in the presence of more than 8000 ng/ml of sDPP4. Therefore, sDPP4 levels in the plasma of MERS patients are significantly reduced below the threshold needed to exert an antiviral effect against MERS-CoV infection. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

KMC 2: fast and resource-frugal k-mer counting.

PubMed

Deorowicz, Sebastian; Kokot, Marek; Grabowski, Szymon; Debudaj-Grabysz, Agnieszka

2015-05-15

Building the histogram of occurrences of every k-symbol long substring of nucleotide data is a standard step in many bioinformatics applications, known under the name of k-mer counting. Its applications include developing de Bruijn graph genome assemblers, fast multiple sequence alignment and repeat detection. The tremendous amounts of NGS data require fast algorithms for k-mer counting, preferably using moderate amounts of memory. We present a novel method for k-mer counting, on large datasets about twice faster than the strongest competitors (Jellyfish 2, KMC 1), using about 12 GB (or less) of RAM. Our disk-based method bears some resemblance to MSPKmerCounter, yet replacing the original minimizers with signatures (a carefully selected subset of all minimizers) and using (k, x)-mers allows to significantly reduce the I/O and a highly parallel overall architecture allows to achieve unprecedented processing speeds. For example, KMC 2 counts the 28-mers of a human reads collection with 44-fold coverage (106 GB of compressed size) in about 20 min, on a 6-core Intel i7 PC with an solid-state disk. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Chemical synthesis of a very long oligoribonucleotide with 2-cyanoethoxymethyl (CEM) as the 2′-O-protecting group: structural identification and biological activity of a synthetic 110mer precursor-microRNA candidate

PubMed Central

Shiba, Yoshinobu; Masuda, Hirofumi; Watanabe, Naoki; Ego, Takeshi; Takagaki, Kazuchika; Ishiyama, Kouichi; Ohgi, Tadaaki; Yano, Junichi

2007-01-01

A long RNA oligomer, a 110mer with the sequence of a precursor-microRNA candidate, has been chemically synthesized in a single synthesizer run by means of standard automated phosphoramidite chemistry. The synthetic method involved the use of 2-cyanoethoxymethyl (CEM), a 2′-hydroxyl protecting group recently developed in our laboratory. We improved the methodology, introducing better coupling and capping conditions. The overall isolated yield of highly pure 110mer was 5.5%. Such a yield on a 1-μmol scale corresponds to 1 mg of product and emphasizes the practicality of the CEM method for synthesizing oligomers of more than 100 nt in sufficient quantity for biological research. We confirmed the identity of the 110mer by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, as well as HPLC, electrophoretic methods, and RNase-digestion experiments. The 110mer also showed sense-selective specific gene-silencing activity. As far as we know, this is the longest chemically synthesized RNA oligomer reported to date. Furthermore, the identity of the 110mer was confirmed by both physicochemical and biological methods. PMID:17459888

Cross-sectional surveillance of Middle East respiratory syndrome coronavirus (MERS-CoV) in dromedary camels and other mammals in Egypt, August 2015 to January 2016

PubMed Central

Ali, Mohamed; El-Shesheny, Rabeh; Kandeil, Ahmed; Shehata, Mahmoud; Elsokary, Basma; Gomaa, Mokhtar; Hassan, Naglaa; El Sayed, Ahmed; El-Taweel, Ahmed; Sobhy, Heba; Oludayo, Fasina Folorunso; Dauphin, Gwenaelle; El Masry, Ihab; Wolde, Abebe Wossene; Daszak, Peter; Miller, Maureen; VonDobschuetz, Sophie; Gardner, Emma; Morzaria, Subhash; Lubroth, Juan; Makonnen, Yilma Jobre

2017-01-01

A cross-sectional study was conducted in Egypt to determine the prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) in imported and resident camels and bats, as well as to assess possible transmission of the virus to domestic ruminants and equines. A total of 1,031 sera, 1,078 nasal swabs, 13 rectal swabs, and 38 milk samples were collected from 1,078 camels in different types of sites. In addition, 145 domestic animals and 109 bats were sampled. Overall, of 1,031 serologically-tested camels, 871 (84.5%) had MERS-CoV neutralising antibodies. Seroprevalence was significantly higher in imported (614/692; 88.7%) than resident camels (257/339; 5.8%) (p < 0.05). Camels from Sudan (543/594; 91.4%) had a higher seroprevalence than those from East Africa (71/98; 72.4%) (p < 0.05). Sampling site and age were also associated with MERS-CoV seroprevalence (p < 0.05). All tested samples from domestic animals and bats were negative for MERS-CoV antibodies except one sheep sample which showed a 1:640 titre. Of 1,078 camels, 41 (3.8%) were positive for MERS-CoV genetic material. Sequences obtained were not found to cluster with clade A or B MERS-CoV sequences and were genetically diverse. The presence of neutralising antibodies in one sheep apparently in contact with seropositive camels calls for further studies on domestic animals in contact with camels. PMID:28333616

Active antitumor immunity elicited by vaccine based on recombinant form of epidermal growth factor receptor.

PubMed

Hu, Bing; Wei, Yuquan; Tian, Ling; Zhao, Xia; Lu, You; Wu, Yang; Yao, Bing; Liu, Jiyan; Niu, Ting; Wen, Yanjun; He, Qiuming; Su, Jingmei; Huang, Meijuan; Lou, Yanyan; Luo, Yan; Kan, Bing

2005-01-01

Active immunotherapy targeting epidermal growth factor receptor (EGFR) should be another attractive approach to the treatment of EGFR-positive tumors. To test this concept, the authors evaluated the potential immune responses and antitumor activities elicited by dendritic cells pulsed with recombinant ectodomain of mouse EGFR (DC-edMER). Spleen cells isolated from DC-edMER-vaccinated mice showed a high quantity of EGFR-specific antibody-producing cells. EGFR-reactive antibody in sera isolated from vaccinated mice was identified and shown to be effective against tumors in vitro and in vivo by adoptive transfer. DC-edMER vaccine also elicited cytotoxic T-lymphocyte responses that could mediate antitumor effects in vitro and adoptive transfer in vivo. In addition, EGFR-specific cytokines responses were elicited by DC-edMER vaccine. Immunization with DC-edMER resulted in tumor regression and prolonged survival in mice challenged with Lewis lung carcinomas and mammary cancer models. Depletion of CD4+ T lymphocytes could completely abrogate the antitumor activity and EGFR-specific antibody responses, whereas the depletion of CD8+ T lymphocytes showed partial abrogation of the antitumor activity but antibody was still detected. Furthermore, tumor-induced angiogenesis was suppressed in DC-edMER-vaccinated mice or mice treated with antibody adoptive transfer. Taken together, these findings suggest the antitumor immunity could be induced by DC-edMER, which may involve both humoral and cellular immunity, and may provide insight into the treatment of EGFR-positive tumors through the induction of active immunity against EGFR.

Novel chimeric virus-like particles vaccine displaying MERS-CoV receptor-binding domain induce specific humoral and cellular immune response in mice.

PubMed

Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu

2017-04-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation. Copyright © 2017 Elsevier B.V. All rights reserved.

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

Protection of rat liver against hepatic ischemia-reperfusion injury by a novel selenocysteine-containing 7-mer peptide

PubMed Central

Jiang, Qianqian; Pan, Yu; Cheng, Yupeng; Li, Huiling; Li, Hui

2016-01-01

Hepatic ischemia-reperfusion (I-R) injury causes acute organ damage or dysfunction, and remains a problem for liver transplantation. In the I-R phase, the generation of reactive oxygen species aggravates the injury. In the current study, a novel selenocysteine-containing 7-mer peptide (H-Arg-Sec-Gly-Arg-Asn-Ala-Gln-OH) was constructed to imitate the active site of an antioxidant enzyme, glutathione peroxidase (GPX). The 7-mer peptide which has a lower molecular weight, and improved water-solubility, higher stability and improved cell membrane permeability compared with other GPX mimics. Its GPX activity reached 13 U/µmol, which was 13 times that of ebselen (a representative GPX mimic). The effect of this GPX mimic on I-R injury of the liver was assessed in rats. The 7-mer peptide significantly inhibited the increase in serum hepatic amino-transferases, tissue malondialdehyde, nitric oxide contents, myeloperoxidase activity and decrease of GPX activity compared with I-R tissue. Following treatment with the 7-mer peptide, the expression of B-cell CLL/lymphoma-2 (Bcl-2) was significantly upregulated at the mRNA and protein level compared with the I-R group, as determined by reverse transcription-polymerase chain reaction and immunohistochemistry, respectively. By contrast, Bcl-2 associated X protein (Bax) was downregulated by the 7-mer peptide compared the I-R group. Histological and ultrastructural changes of the rat liver tissue were also compared among the experimental groups. The results of the current study suggest that the 7-mer peptide protected the liver against hepatic I-R injury via suppression of oxygen-derived free radicals and regulation of Bcl-2 and Bax expression, which are involved in the apoptosis of liver cells. The findings of the present study will further the investigation of the 7-mer peptide as an effective therapeutic agent in hepatic I-R injury. PMID:27431272

Treatment outcomes for patients with Middle Eastern Respiratory Syndrome Coronavirus (MERS CoV) infection at a coronavirus referral center in the Kingdom of Saudi Arabia.

PubMed

Al Ghamdi, Mohammed; Alghamdi, Khalid M; Ghandoora, Yasmeen; Alzahrani, Ameera; Salah, Fatmah; Alsulami, Abdulmoatani; Bawayan, Mayada F; Vaidya, Dhananjay; Perl, Trish M; Sood, Geeta

2016-04-21

Middle Eastern Respiratory Syndrome coronavirus (MERS-CoV) is a poorly understood disease with no known treatments. We describe the clinical features and treatment outcomes of patients with laboratory confirmed MERS-CoV at a regional referral center in the Kingdom of Saudi Arabia. In 2014, a retrospective chart review was performed on patients with a laboratory confirmed diagnosis of MERS-CoV to determine clinical and treatment characteristics associated with death. Confounding was evaluated and a multivariate logistic regression was performed to assess the independent effect of treatments administered. Fifty-one patients had an overall mortality of 37 %. Most patients were male (78 %) with a mean age of 54 years. Almost a quarter of the patients were healthcare workers (23.5 %) and 41 % had a known exposure to another person with MERS-CoV. Survival was associated with male gender, working as a healthcare worker, history of hypertension, vomiting on admission, elevated respiratory rate, abnormal lung exam, elevated alanine transaminase (ALT), clearance of MERS-CoV on repeat PCR polymerase chain reaction (PCR) testing, and mycophenolate mofetil treatment. Survival was reduced in the presence of coronary artery disease, hypotension, hypoxemia, CXR (chest X-ray) abnormalities, leukocytosis, creatinine >1 · 5 mg/dL, thrombocytopenia, anemia, and renal failure. In a multivariate analysis of treatments administered, severity of illness was the greatest predictor of reduced survival. Care for patients with MERS-CoV remains a challenge. In this retrospective cohort, interferon beta and mycophenolate mofetil treatment were predictors of increased survival in the univariate analysis. Severity of illness was the greatest predictor of reduced survival in the multivariate analysis. Larger randomized trials are needed to better evaluate the efficacy of these treatment regimens for MERS-CoV.

Stochastic precision analysis of 2D cardiac strain estimation in vivo

NASA Astrophysics Data System (ADS)

Bunting, E. A.; Provost, J.; Konofagou, E. E.

2014-11-01

Ultrasonic strain imaging has been applied to echocardiography and carries great potential to be used as a tool in the clinical setting. Two-dimensional (2D) strain estimation may be useful when studying the heart due to the complex, 3D deformation of the cardiac tissue. Increasing the framerate used for motion estimation, i.e. motion estimation rate (MER), has been shown to improve the precision of the strain estimation, although maintaining the spatial resolution necessary to view the entire heart structure in a single heartbeat remains challenging at high MERs. Two previously developed methods, the temporally unequispaced acquisition sequence (TUAS) and the diverging beam sequence (DBS), have been used in the past to successfully estimate in vivo axial strain at high MERs without compromising spatial resolution. In this study, a stochastic assessment of 2D strain estimation precision is performed in vivo for both sequences at varying MERs (65, 272, 544, 815 Hz for TUAS; 250, 500, 1000, 2000 Hz for DBS). 2D incremental strains were estimated during left ventricular contraction in five healthy volunteers using a normalized cross-correlation function and a least-squares strain estimator. Both sequences were shown capable of estimating 2D incremental strains in vivo. The conditional expected value of the elastographic signal-to-noise ratio (E(SNRe|ɛ)) was used to compare strain estimation precision of both sequences at multiple MERs over a wide range of clinical strain values. The results here indicate that axial strain estimation precision is much more dependent on MER than lateral strain estimation, while lateral estimation is more affected by strain magnitude. MER should be increased at least above 544 Hz to avoid suboptimal axial strain estimation. Radial and circumferential strain estimations were influenced by the axial and lateral strain in different ways. Furthermore, the TUAS and DBS were found to be of comparable precision at similar MERs.

Chromatin accessibility prediction via convolutional long short-term memory networks with k-mer embedding.

PubMed

Min, Xu; Zeng, Wanwen; Chen, Ning; Chen, Ting; Jiang, Rui

2017-07-15

Experimental techniques for measuring chromatin accessibility are expensive and time consuming, appealing for the development of computational approaches to predict open chromatin regions from DNA sequences. Along this direction, existing methods fall into two classes: one based on handcrafted k -mer features and the other based on convolutional neural networks. Although both categories have shown good performance in specific applications thus far, there still lacks a comprehensive framework to integrate useful k -mer co-occurrence information with recent advances in deep learning. We fill this gap by addressing the problem of chromatin accessibility prediction with a convolutional Long Short-Term Memory (LSTM) network with k -mer embedding. We first split DNA sequences into k -mers and pre-train k -mer embedding vectors based on the co-occurrence matrix of k -mers by using an unsupervised representation learning approach. We then construct a supervised deep learning architecture comprised of an embedding layer, three convolutional layers and a Bidirectional LSTM (BLSTM) layer for feature learning and classification. We demonstrate that our method gains high-quality fixed-length features from variable-length sequences and consistently outperforms baseline methods. We show that k -mer embedding can effectively enhance model performance by exploring different embedding strategies. We also prove the efficacy of both the convolution and the BLSTM layers by comparing two variations of the network architecture. We confirm the robustness of our model to hyper-parameters by performing sensitivity analysis. We hope our method can eventually reinforce our understanding of employing deep learning in genomic studies and shed light on research regarding mechanisms of chromatin accessibility. The source code can be downloaded from https://github.com/minxueric/ismb2017_lstm . tingchen@tsinghua.edu.cn or ruijiang@tsinghua.edu.cn. Supplementary materials are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Chromatin accessibility prediction via convolutional long short-term memory networks with k-mer embedding

PubMed Central

Min, Xu; Zeng, Wanwen; Chen, Ning; Chen, Ting; Jiang, Rui

2017-01-01

Abstract Motivation: Experimental techniques for measuring chromatin accessibility are expensive and time consuming, appealing for the development of computational approaches to predict open chromatin regions from DNA sequences. Along this direction, existing methods fall into two classes: one based on handcrafted k-mer features and the other based on convolutional neural networks. Although both categories have shown good performance in specific applications thus far, there still lacks a comprehensive framework to integrate useful k-mer co-occurrence information with recent advances in deep learning. Results: We fill this gap by addressing the problem of chromatin accessibility prediction with a convolutional Long Short-Term Memory (LSTM) network with k-mer embedding. We first split DNA sequences into k-mers and pre-train k-mer embedding vectors based on the co-occurrence matrix of k-mers by using an unsupervised representation learning approach. We then construct a supervised deep learning architecture comprised of an embedding layer, three convolutional layers and a Bidirectional LSTM (BLSTM) layer for feature learning and classification. We demonstrate that our method gains high-quality fixed-length features from variable-length sequences and consistently outperforms baseline methods. We show that k-mer embedding can effectively enhance model performance by exploring different embedding strategies. We also prove the efficacy of both the convolution and the BLSTM layers by comparing two variations of the network architecture. We confirm the robustness of our model to hyper-parameters by performing sensitivity analysis. We hope our method can eventually reinforce our understanding of employing deep learning in genomic studies and shed light on research regarding mechanisms of chromatin accessibility. Availability and implementation: The source code can be downloaded from https://github.com/minxueric/ismb2017_lstm. Contact: tingchen@tsinghua.edu.cn or ruijiang@tsinghua.edu.cn Supplementary information: Supplementary materials are available at Bioinformatics online. PMID:28881969

Catalytic Function and Substrate Specificity of the Papain-Like Protease Domain of nsp3 from the Middle East Respiratory Syndrome Coronavirus

PubMed Central

Báez-Santos, Yahira M.; Mielech, Anna M.; Deng, Xufang; Baker, Susan

2014-01-01

ABSTRACT The papain-like protease (PLpro) domain from the deadly Middle East respiratory syndrome coronavirus (MERS-CoV) was overexpressed and purified. MERS-CoV PLpro constructs with and without the putative ubiquitin-like (UBL) domain at the N terminus were found to possess protease, deubiquitinating, deISGylating, and interferon antagonism activities in transfected HEK293T cells. The quaternary structure and substrate preferences of MERS-CoV PLpro were determined and compared to those of severe acute respiratory syndrome coronavirus (SARS-CoV) PLpro, revealing prominent differences between these closely related enzymes. Steady-state kinetic analyses of purified MERS-CoV and SARS-CoV PLpros uncovered significant differences in their rates of hydrolysis of 5-aminomethyl coumarin (AMC) from C-terminally labeled peptide, ubiquitin, and ISG15 substrates, as well as in their rates of isopeptide bond cleavage of K48- and K63-linked polyubiquitin chains. MERS-CoV PLpro was found to have 8-fold and 3,500-fold higher catalytic efficiencies for hydrolysis of ISG15-AMC than for hydrolysis of the Ub-AMC and Z-RLRGG-AMC substrates, respectively. A similar trend was observed for SARS-CoV PLpro, although it was much more efficient than MERS-CoV PLpro toward ISG15-AMC and peptide-AMC substrates. MERS-CoV PLpro was found to process K48- and K63-linked polyubiquitin chains at similar rates and with similar debranching patterns, producing monoubiquitin species. However, SARS-CoV PLpro much preferred K48-linked polyubiquitin chains to K63-linked chains, and it rapidly produced di-ubiquitin molecules from K48-linked chains. Finally, potent inhibitors of SARS-CoV PLpro were found to have no effect on MERS-CoV PLpro. A homology model of the MERS-CoV PLpro structure was generated and compared to the X-ray structure of SARS-CoV PLpro to provide plausible explanations for differences in substrate and inhibitor recognition. IMPORTANCE Unlocking the secrets of how coronavirus (CoV) papain-like proteases (PLpros) perform their multifunctional roles during viral replication entails a complete mechanistic understanding of their substrate recognition and enzymatic activities. We show that the PLpro domains from the MERS and SARS coronaviruses can recognize and process the same substrates, but with different catalytic efficiencies. The differences in substrate recognition between these closely related PLpros suggest that neither enzyme can be used as a generalized model to explain the kinetic behavior of all CoV PLpros. As a consequence, decoding the mechanisms of PLpro-mediated antagonism of the host innate immune response and the development of anti-CoV PLpro enzyme inhibitors will be a challenging undertaking. The results from this study provide valuable information for understanding how MERS-CoV PLpro-mediated antagonism of the host innate immune response is orchestrated, as well as insight into the design of inhibitors against MERS-CoV PLpro. PMID:25142582

Developpement des betons semi autoplacants a rheologie adaptee pour des infrastructures

NASA Astrophysics Data System (ADS)

Sotomayor Cruz, Cristian Daniel

Au cours des dernières décennies, les infrastructures canadiennes et québécoises comportent plusieurs structures en béton armé présentant des problèmes de durabilité dus aux conditions climatiques sévères, à la mauvaise conception des structures, à la qualité des matériaux, aux types des bétons choisis, aux systèmes de construction ou à l'existence d'événements incontrôlables. En ce qui concerne le choix du béton pour la construction des infrastructures, une vaste gamme de béton divisée en deux principaux types peut être utilisée: le béton conventionnel vibré (BCV) et le béton autoplaçant (BAP). Dans le cas d'un BCV, la consolidation inadéquate par vibration a été un problème récurrent, occasionnant des dommages structuraux. Ceci a conduit à une réduction de la durabilité et à une augmentation du coût d'entretien et de réparation des infrastructures. Rien que l'utilisation d'un BAP a des avantages tels que l'élimination de la vibration, la réduction des coûts de main d'oeuvre et l'amélioration de la qualité des structures, néanmoins, le coût initial d'un BAP par rapport à un BCV ne permet pas encore de généraliser son utilisation dans l'industrie de la construction. Ce mémoire présente la conception d'une nouvelle gamme de béton semi-autoplaçant pour la construction des infrastructures (BSAP-I) exigeant une vibration minimale. Il s'agit de trouver un équilibre optimal entre la rhéologie et le coût initial du nouveau béton pour conférer une bonne performance structurale et économique aux structures. Le programme expérimental établi a premièrement permis d'évaluer la faisabilité d'utilisation des BSAP-I pour la mise en place des piliers d'une infrastructure de pont à Sherbrooke. En plus, l'utilisation d'un plan d'expériences a permis l'évaluation de trois paramètres de formulation sur les propriétés des mélanges de BSAP-I à l'état frais et durci. Finalement, l'évaluation de la performance des BSAP-I optimisés à travers une caractérisation complète des propriétés mécaniques et de la durabilité a été réalisée. A la suite de cette étude, les résultats obtenus nous permettent de conclure que : (1) L'utilisation d'un BSAP-I avec un gros granulat de 5 - 14 mm, des rapports E/L = 0,37 et S/G = 0,52 et une teneur en air de 6 à 9% a été possible en conférant un équilibre optimal fluidité / stabilité à l'état frais, ainsi qu'un niveau de thixotropie adéquate au chantier permettant d'optimiser la conception du coffrage des piliers de pont et de conférer des qualités de surfaces très acceptables de ces infrastructures. (2) La méthode adaptée pour l'essai L-Box contenant 2 barres et une vibration de 5 secondes a permis de bien caractériser la capacité de remplissage d'un BSAP-I. (3) L'utilisation d'un plan factoriel 23 a permis d'obtenir des modèles statistiques fiables, capables de prédire les propriétés rhéologiques à l'état frais et les résistances en compression des BSAP-I avec des dosages en liant entre 370 et 420 kg/m3, des rapports E/L entre 0,34 et 0,40 et S/G entre 0,47 et 0,53. (4) Des mesures de vitesse d'écoulement T40 d'un BSAP-I sont très semblables à celles d'un BAP. En plus, des valeurs T40 montrent une bonne corrélation linéaire avec celles de T400 mesurés dans la boîte L-Box. (5) À la frontière du BAP et du BCV, une bande rhéologique possédant un τ0 entre 30 et 320 Pa et un η entre 10 et 140 Pa.s a été trouvée pour la conception optimale des BSAP-I. (6) Les BSAP-I optimisés ont également conféré une très bonne performance à l'état frais, en permettant maintenir un bon équilibre entre la rhéologie et la stabilité dans le temps, lorsqu'on utilise une énergie de vibration minimale pour amorcer son écoulement. (7) À l'état durci Les BSAP-I ont conféré une bonne performance présentant des résistances mécaniques élevées et des niveaux négligeables de pénétration aux ions chlores, de perte de masse par écaillage et des attaques par le gel/dégel. (8) L'utilisation des ciments combinés possédant de la fumée de silice, du laitier et de la cendre volante ont permis améliorer le comportement rhéologique et minimiser le retrait par séchage des BSAP-I dans le temps. Mots-clés : Béton autoplaçant (BAP), capacité de remplissage, pression hydrostatique, rhéologie, seuil de cisaillement, thixotropie, maniabilité.

MIMOS II on MER One Year of Mossbauer Spectroscopy on the Surface of Mars: From Jarosite at Meridiani Planum to Goethite at Gusev Crater

NASA Technical Reports Server (NTRS)

Klingelhoefer, G.; Rodionov, D. S.; Morris, R. V.; Schroeder, C.; deSouza, P. A.; Ming, D. W.; Yen, A. S.; Bernhardt, B.; Renz, F.; Fleischer, I.

2005-01-01

The miniaturized Mossbauer (MB) spectrometer MIMOS II [1] is part of the Athena payload of NASA s twin Mars Exploration Rovers "Spirit" (MER-A) and "Opportunity" (MER-B). It determines the Fe-bearing mineralogy of Martian soils and rocks at the Rovers respective landing sites, Gusev crater and Meridiani Planum. Both spectrometers performed successfully during first year of operation. Total integration time is about 49 days for MERA (79 samples) and 34 days for MER-B (85 samples). For curiosity it might be interesting to mention that the total odometry of the oscillating part of the MB drive exceeds 35 km for both rovers.

MERS-CoV at the Animal–Human Interface: Inputs on Exposure Pathways from an Expert-Opinion Elicitation

PubMed Central

Funk, Anna L.; Goutard, Flavie Luce; Miguel, Eve; Bourgarel, Mathieu; Chevalier, Veronique; Faye, Bernard; Peiris, J. S. Malik; Van Kerkhove, Maria D.; Roger, Francois Louis

2016-01-01

Nearly 4 years after the first report of the emergence of Middle-East respiratory syndrome Coronavirus (MERS-CoV) and nearly 1800 human cases later, the ecology of MERS-CoV, its epidemiology, and more than risk factors of MERS-CoV transmission between camels are poorly understood. Knowledge about the pathways and mechanisms of transmission from animals to humans is limited; as of yet, transmission risks have not been quantified. Moreover the divergent sanitary situations and exposures to animals among populations in the Arabian Peninsula, where human primary cases appear to dominate, vs. other regions in the Middle East and Africa, with no reported human clinical cases and where the virus has been detected only in dromedaries, represents huge scientific and health challenges. Here, we have used expert-opinion elicitation in order to obtain ideas on relative importance of MERS-CoV risk factors and estimates of transmission risks from various types of contact between humans and dromedaries. Fourteen experts with diverse and extensive experience in MERS-CoV relevant fields were enrolled and completed an online questionnaire that examined pathways based on several scenarios, e.g., camels–camels, camels–human, bats/other species to camels/humans, and the role of diverse biological substances (milk, urine, etc.) and potential fomites. Experts believed that dromedary camels play the largest role in MERS-CoV infection of other dromedaries; however, they also indicated a significant influence of the season (i.e. calving or weaning periods) on transmission risk. All experts thought that MERS-CoV-infected dromedaries and asymptomatic humans play the most important role in infection of humans, with bats and other species presenting a possible, but yet undefined, risk. Direct and indirect contact of humans with dromedary camels were identified as the most risky types of contact, when compared to consumption of various camel products, with estimated “most likely” incidence risks of at least 22 and 13% for direct and indirect contact, respectively. The results of our study are consistent with available, yet very limited, published data regarding the potential pathways of transmission of MERS-CoV at the animal–human interface. These results identify key knowledge gaps and highlight the need for more comprehensive, yet focused research to be conducted to better understand transmission between dromedaries and humans. PMID:27761437

The Middle East Respiratory Syndrome Coronavirus - A Continuing Risk to Global Health Security.

PubMed

Azhar, Esam I; Lanini, Simone; Ippolito, Giuseppe; Zumla, Alimuddin

2017-01-01

Two new zoonotic coronaviruses causing disease in humans (Zumla et al. 2015a; Hui and Zumla 2015; Peiris et al. 2003; Yu et al. 2014) have been the focus of international attention for the past 14 years due to their epidemic potential; (1) The Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) (Peiris et al. 2003) first discovered in China in 2001 caused a major global epidemic of the Severe Acute Respiratory Syndrome (SARS). (2) The Middle East respiratory syndrome coronavirus (MERS-CoV) is a new corona virus isolated for the first time in a patients who died of severe lower respiratory tract infection in Jeddah (Saudi Arabia) in June 2012 (Zaki et al. 2012). The disease has been named Middle East Respiratory Syndrome (MERS) and it has remained on the radar of global public health authorities because of recurrent nosocomial and community outbreaks, and its association with severe disease and high mortality rates (Assiri et al. 2013a; Al-Abdallat et al. 2014; Memish et al. 2013a; Oboho et al. 2015; The WHO MERS-CoV Research Group 2013; Cotten et al. 2013a; Assiri et al. 2013b; Memish et al. 2013b; Azhar et al. 2014; Kim et al. 2015; Wang et al. 2015; Hui et al. 2015a). Cases of MERS have been reported from all continents and have been linked with travel to the Middle East (Hui et al. 2015a; WHO 2015c). The World Health Organization (WHO) have held nine meetings of the Emergency Committee (EC) convened by the Director-General under the International Health Regulations (IHR 2005) regarding MERS-CoV (WHO 2015c). There is wishful anticipation in the political and scientific communities that MERS-CoV like SARS-CoV will disappear with time. However it's been nearly 4 years since the first discovery of MERS-CoV, and MERS cases continue to be reported throughout the year from the Middle East (WHO 2015c). There is a large MERS-CoV camel reservoir, and there is no specific treatment or vaccine (Zumla et al. 2015a). With 10 million people visiting Saudi Arabia every year for Umrah and/or Hajj, the potential risk of global spread is ever present (Memish et al. 2014a; McCloskey et al. 2014; Al-Tawfiq et al. 2014a).

Systeme microfluidique d'analyse sanguine en temps reel pour l'imagerie moleculaire chez le petit animal

NASA Astrophysics Data System (ADS)

Convert, Laurence

De nouveaux radiotraceurs sont continuellement développés pour améliorer l'efficacité diagnostique en imagerie moléculaire, principalement en tomographie d'émission par positrons (TEP) et en tomographie d'émission monophotonique (TEM) dans les domaines de l'oncologie, de la cardiologie et de la neurologie. Avant de pouvoir être utilisés chez les humains, ces radiotraceurs doivent être caractérisés chez les petits animaux, principalement les rats et les souris. Pour cela, de nombreux échantillons sanguins doivent être prélevés et analysés (mesure de radioactivité, séparation de plasma, séparation d'espèces chimiques), ce qui représente un défi majeur chez les rongeurs à cause de leur très faible volume sanguin (˜1,4 ml pour une souris). Des solutions fournissant une analyse partielle sont présentées dans la littérature, mais aucune ne permet d'effectuer toutes les opérations dans un même système. Les présents travaux de recherche s'insèrent dans le contexte global d'un projet visant à développer un système microfluidique d'analyse sanguine complète en temps réel pour la caractérisation des nouveaux radiotraceurs TEP et TEM. Un cahier des charges a tout d'abord été établi et a permis de fixer des critères quantitatifs et qualitatifs à respecter pour chacune des fonctions de la puce. La fonction de détection microfluidique a ensuite été développée. Un état de l'art des travaux ayant déjà combiné la microfluidique et la détection de radioactivité a permis de souligner qu'aucune solution existante ne répondait aux critères du projet. Parmi les différentes technologies disponibles, des microcanaux en résine KMPR fabriqués sur des détecteurs semiconducteurs de type p-i-n ont été identifiés comme une solution technologique pour le projet. Des détecteurs p-i-n ont ensuite été fabriqués en utilisant un procédé standard. Les performances encourageantes obtenues ont mené à initier un projet de maîtrise pour leur optimisation. En parallèle, les travaux ont été poursuivis avec des détecteurs du commerce sous forme de gaufres non découpées. Un premier dispositif intégrant des canaux en KMPR sur ces gaufres a permis de valider le concept démontrant le grand potentiel de ces choix technologiques et incitant à poursuivre les développements dans cette voie, notamment en envisageant des expériences animales. L'utilisation prolongée des canaux avec du sang non dilué est cependant particulièrement exigeante pour les matériaux artificiels. Une passivation à l'albumine a permis d'augmenter considérablement la compatibilité sanguine de la résine KMPR. Le concept initial, incluant la passivation des canaux, a ensuite été optimisé et intégré dans un système de mesure complet avec toute l'électronique et l'informatique de contrôle. Le système final a été validé chez le petit animal avec un radiotraceur connu. Ces travaux ont donné lieu à la première démonstration d'un détecteur microfluidique de haute efficacité pour la TEP et la TEM. Cette première brique d'un projet plus global est déjà un outil innovant en soi qui permettra d'augmenter l'efficacité du développement d'outils diagnostiques plus spécifiques principalement pour l'oncologie, la cardiologie et la neurologie. Mots clefs : imagerie moléculaire, tomographie d'émission par positrons (TEP), tomographie d'émission monophotonique (TEM), microfluidique, détecteur de radioactivité, KMPR, diodes p-i-n, hémocompatibilité.

Reaction mechanism of CO oxidation on Cu2O(111): A density functional study

NASA Astrophysics Data System (ADS)

Sun, Bao-Zhen; Chen, Wen-Kai; Xu, Yi-Jun

2010-10-01

The possible reaction mechanisms for CO oxidation on the perfect Cu2O(111) surface have been investigated by performing periodic density functional theoretical calculations. We find that Cu2O(111) is able to facilitate the CO oxidation with different mechanisms. Four possible mechanisms are explored (denoted as MER1, MER2, MLH1, and MLH2, respectively): MER1 is CO(gas)+O2(ads)-->CO2(gas) MER2 is CO(gas)+O2(ads)-->CO3(ads)-->O(ads)+CO2(gas) MLH1 refers to CO(ads)+O2(ads)-->O(ads)+CO2(ads) and MLH2 refers to CO(ads)+O2(ads)-->OOCO(ads)-->O(ads)+CO2(ads). Our transition state calculations clearly reveal that MER1 and MLH2 are both viable; but MER1 mechanism preferentially operates, in which only a moderate energy barrier (60.22 kJ/mol) needs to be overcome. When CO oxidation takes place along MER2 path, it is facile for CO3 formation, but is difficult for its decomposition, thereby CO3 species can stably exist on Cu2O(111). Of course, the reaction of CO with lattice O of Cu2O(111) is also considered. However, the calculated barrier is 600.00 kJ/mol, which is too large to make the path feasible. So, we believe that on Cu2O(111), CO reacts with adsorbed O, rather than lattice O, to form CO2. This is different from the usual Mars-van Krevene mechanism. The present results enrich our understanding of the catalytic oxidation of CO by copper-based and metal-oxide catalysts.

Value, Market Preferences and Trade of Beche-De-Mer from Pacific Island Sea Cucumbers

PubMed Central

Purcell, Steven W.

2014-01-01

Market preferences of natural resources contribute to shape their exploitation and production. Beche-de-mer, the product after gutting, cooking, salting and drying sea cucumbers, is exported worldwide to Asian dried seafood markets. A better understanding of the trade, value and market preferences of Pacific island beche-de-mer could identify critical postharvest processing techniques and management strategies for fisheries and aquaculture. Data were collected on export prices and trade of beche-de-mer from Kiribati, Fiji, Tonga and New Caledonia, and the selling prices, respective sizes and organoleptic properties of the products in stores in China. Export prices varied considerably within and among the four countries and low-value species were the most exported by volume. Most of the beche-de-mer from the four Pacific islands is exported to Hong Kong, where quality products are sold and others are distributed to mainland China. Prices of the beche-de-mer in Chinese stores varied up to ten-fold and were mostly influenced by species, body size and, to a lesser extent, physical damage to the products. Market prices across species (averaging US$15–385 kg−1) appear to have mostly increased six- to twelve-fold over the past decade. The data allude that fisheries for Holothuria scabra, H. lessoni, H. fuscogilva, H. whitmaei and Thelenota ananas should be most carefully managed because they were the highest-value species and under greatest demand. The relationships between size of beche-de-mer and sale price were species specific and highly varied. This study also highlights the need for better regulations and/or enforcement of minimum size limits in sea cucumber fisheries, which can help to maximise economic benefits of wild stocks. PMID:24736374

Value, market preferences and trade of Beche-de-mer from Pacific Island sea cucumbers.

PubMed

Purcell, Steven W

2014-01-01

Market preferences of natural resources contribute to shape their exploitation and production. Beche-de-mer, the product after gutting, cooking, salting and drying sea cucumbers, is exported worldwide to Asian dried seafood markets. A better understanding of the trade, value and market preferences of Pacific island beche-de-mer could identify critical postharvest processing techniques and management strategies for fisheries and aquaculture. Data were collected on export prices and trade of beche-de-mer from Kiribati, Fiji, Tonga and New Caledonia, and the selling prices, respective sizes and organoleptic properties of the products in stores in China. Export prices varied considerably within and among the four countries and low-value species were the most exported by volume. Most of the beche-de-mer from the four Pacific islands is exported to Hong Kong, where quality products are sold and others are distributed to mainland China. Prices of the beche-de-mer in Chinese stores varied up to ten-fold and were mostly influenced by species, body size and, to a lesser extent, physical damage to the products. Market prices across species (averaging US$15-385 kg-1) appear to have mostly increased six- to twelve-fold over the past decade. The data allude that fisheries for Holothuria scabra, H. lessoni, H. fuscogilva, H. whitmaei and Thelenota ananas should be most carefully managed because they were the highest-value species and under greatest demand. The relationships between size of beche-de-mer and sale price were species specific and highly varied. This study also highlights the need for better regulations and/or enforcement of minimum size limits in sea cucumber fisheries, which can help to maximise economic benefits of wild stocks.

Factors Influencing Emergency Nurses' Burnout During an Outbreak of Middle East Respiratory Syndrome Coronavirus in Korea.

PubMed

Kim, Ji Soo; Choi, Jeong Sil

2016-12-01

Emergency department (ED) nurses suffer from persistent stress after experiencing the traumatic event of exposure to Middle East respiratory syndrome coronavirus (MERS-CoV), which can subsequently lead to burnout. This study aimed to assess ED nurses' burnout level during an outbreak of MERS-CoV and to identify influencing factors in order to provide basic information for lowering and preventing the level of burnout. Study participants were ED nurses working in eight hospitals designated for treating MERS-CoV-infected patients in Korea. We performed multiple regression analysis to explore the factors influencing burnout. The ED nurses' burnout was affected by job stress (β=0.59, p<.001), poor hospital resources for the treatment of MERS-CoV (β = -0.19, p<.001) and poor support from family and friends (β = -0.14, p<.05). These three variables explained 47.3% of the variance in burnout. ED nurses taking care of MERS-CoV-infected patients should be aware that burnout is higher for nurses in their divisions than nurses in other hospital departments and that job stress is the biggest influential factor of burnout. To be ready for the outbreak of emerging contagious diseases such as MERS-CoV, efforts and preparations should be made to reduce burnout. Job stress should be managed and resolved. Working conditions for mitigating job stress and systematic stress management programs should be provided, and hospital resources for the treatment of MERS-CoV need to be reinforced. Moreover, promoting support from family and friends is required. Copyright © 2016. Published by Elsevier B.V.

Comparative study of microelectrode recording-based STN location and MRI-based STN location in low to ultra-high field (7.0 T) T2-weighted MRI images

NASA Astrophysics Data System (ADS)

Verhagen, Rens; Schuurman, P. Richard; van den Munckhof, Pepijn; Fiorella Contarino, M.; de Bie, Rob M. A.; Bour, Lo J.

2016-12-01

Objective. The correspondence between the anatomical STN and the STN observed in T2-weighted MRI images used for deep brain stimulation (DBS) targeting remains unclear. Using a new method, we compared the STN borders seen on MRI images with those estimated by intraoperative microelectrode recordings (MER). Approach. We developed a method to automatically generate a detailed estimation of STN shape and the location of its borders, based on multiple-channel MER measurements. In 33 STNs of 19 Parkinson patients, we quantitatively compared the dorsal and lateral borders of this MER-based STN model with the STN borders visualized by 1.5 T (n = 14), 3.0 T (n = 10) and 7.0 T (n = 9) T2-weighted MRI. Main results. The dorsal border was identified more dorsally on coronal T2 MRI than by the MER-based STN model, with a significant difference in the 3.0 T (range 0.97-1.19 mm) and 7.0 T (range 1.23-1.25 mm) groups. The lateral border was significantly more medial on 1.5 T (mean: 1.97 mm) and 3.0 T (mean: 2.49 mm) MRI than in the MER-based STN; a difference that was not found in the 7.0 T group. Significance. The STN extends further in the dorsal direction on coronal T2 MRI images than is measured by MER. Increasing MRI field strength to 3.0 T or 7.0 T yields similar discrepancies between MER and MRI at the dorsal STN border. In contrast, increasing MRI field strength to 7.0 T may be useful for identification of the lateral STN border and thereby improve DBS targeting.

Healthcare Workers Emotions, Perceived Stressors and Coping Strategies During a MERS-CoV Outbreak.

PubMed

Khalid, Imran; Khalid, Tabindeh J; Qabajah, Mohammed R; Barnard, Aletta G; Qushmaq, Ismael A

2016-03-01

Healthcare workers (HCWs) are at high risk of contracting Middle East respiratory syndrome coronavirus (MERS-CoV) during an epidemic. We explored the emotions, perceived stressors, and coping strategies of healthcare workers who worked during a MERS-CoV outbreak in our hospital. A cross-sectional descriptive survey design. A tertiary care hospital. HCWs (150) who worked in high risk areas during the April-May 2014 MERS-CoV outbreak that occurred in Jeddah, Saudi Arabia. We developed and administered a "MERS-CoV staff questionnaire" to study participants. The questionnaire consisted of 5 sections with 72 questions. The sections evaluated hospital staffs emotions, perceived stressors, factors that reduced their stress, coping strategies, and motivators to work during future outbreaks. Responses were scored on a scale from 0-3. The varying levels of stress or effectiveness of measures were reported as mean and standard deviation, as appropriate. Completed questionnaires were returned by 117 (78%) of the participants. The results had many unique elements. HCWs ethical obligation to their profession pushed them to continue with their jobs. The main sentiments centered upon fear of personal safety and well-being of colleagues and family. Positive attitudes in the workplace, clinical improvement of infected colleagues, and stoppage of disease transmission among HCWs after adopting strict protective measures alleviated their fear and drove them through the epidemic. They appreciated recognition of their efforts by hospital management and expected similar acknowledgment, infection control guidance, and equipment would entice them to work during future epidemics. The MERS-CoV outbreak was a distressing time for our staff. Hospitals can enhance HCWs experiences during any future MERS-CoV outbreak by focusing on the above mentioned aspects. © 2016 Marshfield Clinic.

Enhanced inflammation in New Zealand white rabbits when MERS-CoV reinfection occurs in the absence of neutralizing antibody

PubMed Central

Houser, Katherine V.; Gretebeck, Lisa; Vogel, Leatrice; Sutton, Troy; Orandle, Marlene; Moore, Ian N.

2017-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a zoonotic betacoronavirus that was first detected in humans in 2012 as a cause of severe acute respiratory disease. As of July 28, 2017, there have been 2,040 confirmed cases with 712 reported deaths. While many infections have been fatal, there have also been a large number of mild or asymptomatic cases discovered through monitoring and contact tracing. New Zealand white rabbits are a possible model for asymptomatic infection with MERS-CoV. In order to discover more about non-lethal infections and to learn whether a single infection with MERS-CoV would protect against reinfection, we inoculated rabbits with MERS-CoV and monitored the antibody and inflammatory response. Following intranasal infection, rabbits developed a transient dose-dependent pulmonary infection with moderately high levels of viral RNA, viral antigen, and perivascular inflammation in multiple lung lobes that was not associated with clinical signs. The rabbits developed antibodies against viral proteins that lacked neutralizing activity and the animals were not protected from reinfection. In fact, reinfection resulted in enhanced pulmonary inflammation, without an associated increase in viral RNA titers. Interestingly, passive transfer of serum from previously infected rabbits to naïve rabbits was associated with enhanced inflammation upon infection. We further found this inflammation was accompanied by increased recruitment of complement proteins compared to primary infection. However, reinfection elicited neutralizing antibodies that protected rabbits from subsequent viral challenge. Our data from the rabbit model suggests that people exposed to MERS-CoV who fail to develop a neutralizing antibody response, or persons whose neutralizing antibody titers have waned, may be at risk for severe lung disease on re-exposure to MERS-CoV. PMID:28817732

Antiviral Potential of ERK/MAPK and PI3K/AKT/mTOR Signaling Modulation for Middle East Respiratory Syndrome Coronavirus Infection as Identified by Temporal Kinome Analysis

PubMed Central

Ork, Britini; Hart, Brit J.; Holbrook, Michael R.; Frieman, Matthew B.; Traynor, Dawn; Johnson, Reed F.; Dyall, Julie; Olinger, Gene G.; Hensley, Lisa E.

2014-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a lineage C betacoronavirus, and infections with this virus can result in acute respiratory syndrome with renal failure. Globally, MERS-CoV has been responsible for 877 laboratory-confirmed infections, including 317 deaths, since September 2012. As there is a paucity of information regarding the molecular pathogenesis associated with this virus or the identities of novel antiviral drug targets, we performed temporal kinome analysis on human hepatocytes infected with the Erasmus isolate of MERS-CoV with peptide kinome arrays. bioinformatics analysis of our kinome data, including pathway overrepresentation analysis (ORA) and functional network analysis, suggested that extracellular signal-regulated kinase (ERK)/mitogen-activated protein kinase (MAPK) and phosphoinositol 3-kinase (PI3K)/serine-threonine kinase (AKT)/mammalian target of rapamycin (mTOR) signaling responses were specifically modulated in response to MERS-CoV infection in vitro throughout the course of infection. The overrepresentation of specific intermediates within these pathways determined by pathway and functional network analysis of our kinome data correlated with similar patterns of phosphorylation determined through Western blot array analysis. In addition, analysis of the effects of specific kinase inhibitors on MERS-CoV infection in tissue culture models confirmed these cellular response observations. Further, we have demonstrated that a subset of licensed kinase inhibitors targeting the ERK/MAPK and PI3K/AKT/mTOR pathways significantly inhibited MERS-CoV replication in vitro whether they were added before or after viral infection. Taken together, our data suggest that ERK/MAPK and PI3K/AKT/mTOR signaling responses play important roles in MERS-CoV infection and may represent novel drug targets for therapeutic intervention strategies. PMID:25487801

MERS-CoV Accessory ORFs Play Key Role for Infection and Pathogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Menachery, Vineet D.; Mitchell, Hugh D.; Cockrell, Adam S.

ABSTRACT While dispensable for viral replication, coronavirus (CoV) accessory open reading frame (ORF) proteins often play critical roles during infection and pathogenesis. Utilizing a previously generated mutant, we demonstrate that the absence of all four Middle East respiratory syndrome CoV (MERS-CoV) accessory ORFs (deletion of ORF3, -4a, -4b, and -5 [dORF3-5]) has major implications for viral replication and pathogenesis. Importantly, attenuation of the dORF3-5 mutant is primarily driven by dysregulated host responses, including disrupted cell processes, augmented interferon (IFN) pathway activation, and robust inflammation.In vitroreplication attenuation also extends toin vivomodels, allowing use of dORF3-5 as a live attenuated vaccine platform.more » Finally, examination of ORF5 implicates a partial role in modulation of NF-κB-mediated inflammation. Together, the results demonstrate the importance of MERS-CoV accessory ORFs for pathogenesis and highlight them as potential targets for surveillance and therapeutic treatments moving forward. IMPORTANCEThe initial emergence and periodic outbreaks of MERS-CoV highlight a continuing threat posed by zoonotic pathogens to global public health. In these studies, mutant virus generation demonstrates the necessity of accessory ORFs in regard to MERS-CoV infection and pathogenesis. With this in mind, accessory ORF functions can be targeted for both therapeutic and vaccine treatments in response to MERS-CoV and related group 2C coronaviruses. In addition, disruption of accessory ORFs in parallel may offer a rapid response platform to attenuation of future emergent strains based on both SARS- and MERS-CoV accessory ORF mutants.« less

Money Laundering in China: Why PACOM Should Place High Priority on this Issue

DTIC Science & Technology

2012-10-06

Financial Action Task Force ( FATF ), a multi-national organization responsible for anti-money laundering (AML) regulation and enforcement standards...29, 2007, 7. www.fatf- gafi.org/media/ fatf /documents/reports/mer/MER%20China%20full.pdf Accessed on 12Sep12. 14 George W. Russell, “Dirty Money...Evaluation, 8 th Follow-up Report, Financial Action Task Force, February 17, 2012. www.fatf- gafi.org/media/ fatf /documents/reports/mer/Follow%20Up

Clinically mild encephalitis/encephalopathy with a reversible splenial lesion associated with febrile urinary tract infection.

PubMed

Okamoto, Takayuki; Sato, Yasuyuki; Yamazaki, Takeshi; Hayashi, Asako

2014-04-01

Common pathogens of clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) are viruses, such as influenza virus. However, bacteria are rare pathogens for MERS. We report the first patient with MERS associated with febrile urinary tract infection. A 16-year-old lupus patient was admitted to our hospital. She had fever, headache, vomiting, and right back pain. Urinary analysis showed leukocyturia, and urinary culture identified Klebsiella pneumoniae. Cerebrospinal fluid examination and brain single-photon emission computed tomography showed no abnormalities. Therefore, she was diagnosed with febrile urinary tract infection. For further examinations, 99mTc-dimercaptosuccinic acid renal scintigraphy showed right cortical defects, and a voiding cystourethrogram demonstrated right vesicoureteral reflux (grade II). Therefore, she was diagnosed with right pyelonephritis. Although treatment with antibiotics administered intravenously improved the fever, laboratory findings, and right back pain, she had prolonged headaches, nausea, and vomiting. T2-weighted, diffusion-weighted, and fluid attenuated inversion recovery images in brain magnetic resonance imaging showed high intensity lesions in the splenium of the corpus callosum, which completely disappeared 1 week later. These results were compatible with MERS. To the best of our knowledge, our patient is the first patient who showed clinical features of MERS associated with febrile urinary tract infection. In patients with pyelonephritis and an atypical clinical course, such as prolonged headache, nausea, vomiting, and neurological disorders, the possibility of MERS should be considered.

MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape

DOE PAGES

Menachery, Vineet D.; Schafer, Alexandra; Burnum-Johnson, Kristin E.; ...

2018-01-16

Convergent evolution dictates that diverse groups of viruses will target both similar and distinct host pathways in order to manipulate the immune response and improve infection. In this study, we sought to leverage this uneven viral antagonism to identify critical host factors that govern disease outcome. Utilizing a systems based approach, we examined differential regulation of IFNγ dependent genes following infection with highly pathogenic viruses including influenza (H5N1-VN1203, H1N1-CA04) and coronaviruses (SARS-CoV, MERS-CoV). Categorizing by function, we observed down regulation of genes associated with antigen presentation following both H5N1-VN1203 and MERS-CoV infection. Further examination revealed global down regulation of antigenmore » presentation genes and was confirmed by proteomics for both H5N1-VN1203 and MERS-CoV infection. Importantly, epigenetic analysis suggested that DNA methylation rather than histone modification plays a crucial role in MERS-CoV mediated antagonism of antigen presentation genes; in contrast, H5N1-VN1203 likely utilizes a combination of epigenetic mechanisms to target antigen presentation. Altogether, the results indicate a common approach utilized by H5N1-VN1203 and MERS-CoV to modulate antigen presentation and the host adaptive immune response.« less

MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Menachery, Vineet D.; Schäfer, Alexandra; Burnum-Johnson, Kristin E.

Convergent evolution dictates that diverse groups of viruses will target both similar and distinct host pathways in order to manipulate the immune response and improve infection. In this study, we sought to leverage this uneven viral antagonism to identify critical host factors that govern disease outcome. Utilizing a systems based approach, we examined differential regulation of IFNγ dependent genes following infection with highly pathogenic viruses including influenza (H5N1-VN1203, H1N1-CA04) and coronaviruses (SARS-CoV, MERS-CoV). Categorizing by function, we observed down regulation of genes associated with antigen presentation following both H5N1-VN1203 and MERS-CoV infection. Further examination revealed global down regulation of antigenmore » presentation genes and was confirmed by proteomics for both H5N1-VN1203 and MERS-CoV infection. Importantly, epigenetic analysis suggested that DNA methylation rather than histone modification plays a crucial role in MERS-CoV mediated antagonism of antigen presentation genes; in contrast, H5N1-VN1203 likely utilizes a combination of epigenetic mechanisms to target antigen presentation. Together, the results indicate a common approach utilized by H5N1-VN1203 and MERS-CoV to modulate antigen presentation and the host adaptive immune response.« less

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

G-triplex structure and formation propensity

PubMed Central

Cerofolini, Linda; Amato, Jussara; Giachetti, Andrea; Limongelli, Vittorio; Novellino, Ettore; Parrinello, Michele; Fragai, Marco; Randazzo, Antonio; Luchinat, Claudio

2014-01-01

The occurrence of a G-triplex folding intermediate of thrombin binding aptamer (TBA) has been recently predicted by metadynamics calculations, and experimentally supported by Nuclear Magnetic Resonance (NMR), Circular Dichroism (CD) and Differential Scanning Calorimetry (DSC) data collected on a 3′ end TBA-truncated 11-mer oligonucleotide (11-mer-3′-t-TBA). Here we present the solution structure of 11-mer-3′-t-TBA in the presence of potassium ions. This structure is the first experimental example of a G-triplex folding, where a network of Hoogsteen-like hydrogen bonds stabilizes six guanines to form two G:G:G triad planes. The G-triplex folding of 11-mer-3′-t-TBA is stabilized by the potassium ion and destabilized by increasing the temperature. The superimposition of the experimental structure with that predicted by metadynamics shows a great similarity, with only significant differences involving two loops. These new structural data show that 11-mer-3′-t-TBA assumes a G-triplex DNA conformation as its stable form, reinforcing the idea that G-triplex folding intermediates may occur in vivo in human guanine-rich sequences. NMR and CD screening of eight different constructs obtained by removing from one to four bases at either the 3′ and the 5′ ends show that only the 11-mer-3′-t-TBA yields a relatively stable G-triplex. PMID:25378342

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers prepare to mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-23

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers prepare to mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-23

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

Saracatinib Inhibits Middle East Respiratory Syndrome-Coronavirus Replication In Vitro.

PubMed

Shin, Jin Soo; Jung, Eunhye; Kim, Meehyein; Baric, Ralph S; Go, Yun Young

2018-05-24

The Middle East respiratory syndrome-coronavirus (MERS-CoV), first identified in Saudi Arabia, is an emerging zoonotic pathogen that causes severe acute respiratory illness in humans with a high fatality rate. Since its emergence, MERS-CoV continues to spread to countries outside of the Arabian Peninsula and gives rise to sporadic human infections following the entry of infected individuals to other countries, which can precipitate outbreaks similar to the one that occurred in South Korea in 2015. Current therapeutics against MERS-CoV infection have primarily been adapted from previous drugs used for the treatment of severe acute respiratory syndrome. In search of new potential drug candidates, we screened a library composed of 2334 clinically approved drugs and pharmacologically active compounds. The drug saracatinib, a potent inhibitor of Src-family of tyrosine kinases (SFK), was identified as an inhibitor of MERS-CoV replication in vitro. Our results suggest that saracatinib potently inhibits MERS-CoV at the early stages of the viral life cycle in Huh-7 cells, possibly through the suppression of SFK signaling pathways. Furthermore, saracatinib exhibited a synergistic effect with gemcitabine, an anticancer drug with antiviral activity against several RNA viruses. These data indicate that saracatinib alone or in combination with gemcitabine can provide a new therapeutic option for the treatment of MERS-CoV infection.

Concerted action of the MutLβ heterodimer and Mer3 helicase regulates the global extent of meiotic gene conversion

PubMed Central

Duroc, Yann; Kumar, Rajeev; Ranjha, Lepakshi; Adam, Céline; Guérois, Raphaël; Md Muntaz, Khan; Marsolier-Kergoat, Marie-Claude; Dingli, Florent; Laureau, Raphaëlle; Loew, Damarys; Llorente, Bertrand; Charbonnier, Jean-Baptiste; Cejka, Petr; Borde, Valérie

2017-01-01

Gene conversions resulting from meiotic recombination are critical in shaping genome diversification and evolution. How the extent of gene conversions is regulated is unknown. Here we show that the budding yeast mismatch repair related MutLβ complex, Mlh1-Mlh2, specifically interacts with the conserved meiotic Mer3 helicase, which recruits it to recombination hotspots, independently of mismatch recognition. This recruitment is essential to limit gene conversion tract lengths genome-wide, without affecting crossover formation. Contrary to expectations, Mer3 helicase activity, proposed to extend the displacement loop (D-loop) recombination intermediate, does not influence the length of gene conversion events, revealing non-catalytical roles of Mer3. In addition, both purified Mer3 and MutLβ preferentially recognize D-loops, providing a mechanism for limiting gene conversion in vivo. These findings show that MutLβ is an integral part of a new regulatory step of meiotic recombination, which has implications to prevent rapid allele fixation and hotspot erosion in populations. DOI: http://dx.doi.org/10.7554/eLife.21900.001 PMID:28051769

Estimating Potential Incidence of MERS-CoV Associated with Hajj Pilgrims to Saudi Arabia, 2014

PubMed Central

Lessler, Justin; Rodriguez-Barraquer, Isabel; Cummings, Derek A.T.; Garske, Tini; Van Kerkhove, Maria; Mills, Harriet; Truelove, Shaun; Hakeem, Rafat; Albarrak, Ali; Ferguson, Neil M.; Aguas, Ricardo; Algarni, Homud; AlHarbi, Khalid; Cauchemez, Simon; Clapham, Hannah; Collins, Caitlin; Cori, Anne; Donnelly, Christl; Fraser, Christophe; Jombart, Thibaut; Moore, Sean M.; Nouvellet, Pierre; Riley, Steven; Salje, Henrik; Turkistani, Abdulhafiz

2014-01-01

Between March and June 2014 the Kingdom of Saudi Arabia (KSA) had a large outbreak of MERS-CoV, renewing fears of a major outbreak during the Hajj this October. Using KSA Ministry of Health data, the MERS-CoV Scenario and Modeling Working Group forecast incidence under three scenarios. In the expected incidence scenario, we estimate 6.2 (95% Prediction Interval [PI]: 1–17) pilgrims will develop MERS-CoV symptoms during the Hajj, and 4.0 (95% PI: 0–12) foreign pilgrims will be infected but return home before developing symptoms. In the most pessimistic scenario, 47.6 (95% PI: 32–66) cases will develop symptoms during the Hajj, and 29.0 (95% PI: 17–43) will be infected but return home asymptomatic. Large numbers of MERS-CoV cases are unlikely to occur during the 2014 Hajj even under pessimistic assumptions, but careful monitoring is still needed to detect possible mass infection events and minimize introductions into other countries.   PMID:25685624

AFM study of morphology and mechanical properties of a chimeric spider silk and bone sialoprotein protein for bone regeneration

PubMed Central

Gomes, Sílvia; Numata, Keiji; Leonor, Isabel B.; Mano, João F.; Reis, Rui L.; Kaplan, David L.

2011-01-01

Atomic force microscopy (AFM) was used to assess a new chimeric protein consisting of a fusion protein of the consensus repeat for Nephila clavipes spider dragline protein and bone sialoprotein (6mer+BSP). The elastic modulus of this protein in film form was assessed through force curves, and film surface roughness was also determined. The results showed a significant difference between the elastic modulus of the chimeric silk protein, 6mer+BSP, and control films consisting of only the silk component (6mer). The behaviour of the 6mer+BSP and 6mer proteins in aqueous solution in the presence of calcium (Ca) ions was also assessed to determine interactions between the inorganic and organic components related to bone interactions, anchoring and biomaterial network formation. The results demonstrated the formation of protein networks in the presence of Ca2+ ions, characteristics that may be important in the context of controlling materials assembly and properties related to bone-formation with this new chimeric silk-BSP protein. PMID:21370930

AFM study of morphology and mechanical properties of a chimeric spider silk and bone sialoprotein protein for bone regeneration.

PubMed

Gomes, Sílvia; Numata, Keiji; Leonor, Isabel B; Mano, João F; Reis, Rui L; Kaplan, David L

2011-05-09

Atomic force microscopy (AFM) was used to assess a new chimeric protein consisting of a fusion protein of the consensus repeat for Nephila clavipes spider dragline protein and bone sialoprotein (6mer+BSP). The elastic modulus of this protein in film form was assessed through force curves, and film surface roughness was also determined. The results showed a significant difference among the elastic modulus of the chimeric silk protein, 6mer+BSP, and control films consisting of only the silk component (6mer). The behavior of the 6mer+BSP and 6mer proteins in aqueous solution in the presence of calcium (Ca) ions was also assessed to determine interactions between the inorganic and organic components related to bone interactions, anchoring, and biomaterial network formation. The results demonstrated the formation of protein networks in the presence of Ca(2+) ions, characteristics that may be important in the context of controlling materials assembly and properties related to bone formation with this new chimeric silk-BSP protein.

GAS6/Mer axis regulates the homing and survival of the E2A/PBX1 positive B-cell precursor acute lymphoblastic leukemia in the bone marrow niche

PubMed Central

Shiozawa, Yusuke; Pedersen, Elisabeth A.; Taichman, Russell S.

2009-01-01

Despite improvements in current combinational chemotherapy regimens, the prognosis of the (1;19)(q23;p13) translocation (E2A/PBX1) positive B-cell precursor acute lymphoblastic leukemia (ALL) is poor in pediatric leukemia patients. In this study, we examined the roles of GAS6/Mer axis in the interactions between E2A/PBX1 positive B-cell precursor ALL cells and the osteoblastic niche in the bone marrow. The data show that primary human osteoblasts secrete GAS6 in response to the Mer-over-expressed E2A/PBX1 positive ALL cells through MAPK signaling pathway and that leukemia cells migrate toward GAS6 using pathways activated by Mer. Importantly, GAS6 supports the survival and prevents apoptosis from chemotherapy of E2A/PBX1 positive ALL cells by inducing dormancy. Together, these data suggest that GAS6/Mer axis regulates the homing and survival of the E2A/PBX1 positive B-cell precursor ALL in the bone marrow niche. PMID:19922767

MER Telemetry Processor

NASA Technical Reports Server (NTRS)

Lee, Hyun H.

2012-01-01

MERTELEMPROC processes telemetered data in data product format and generates Experiment Data Records (EDRs) for many instruments (HAZCAM, NAVCAM, PANCAM, microscopic imager, Moessbauer spectrometer, APXS, RAT, and EDLCAM) on the Mars Exploration Rover (MER). If the data is compressed, then MERTELEMPROC decompresses the data with an appropriate decompression algorithm. There are two compression algorithms (ICER and LOCO) used in MER. This program fulfills a MER specific need to generate Level 1 products within a 60-second time requirement. EDRs generated by this program are used by merinverter, marscahv, marsrad, and marsjplstereo to generate higher-level products for the mission operations. MERTELEPROC was the first GDS program to process the data product. Metadata of the data product is in XML format. The software allows user-configurable input parameters, per-product processing (not streambased processing), and fail-over is allowed if the leading image header is corrupted. It is used within the MER automated pipeline. MERTELEMPROC is part of the OPGS (Operational Product Generation Subsystem) automated pipeline, which analyzes images returned by in situ spacecraft and creates level 1 products to assist in operations, science, and outreach.

Differential TAM receptor–ligand–phospholipid interactions delimit differential TAM bioactivities

PubMed Central

Lew, Erin D; Oh, Jennifer; Burrola, Patrick G; Lax, Irit; Zagórska, Anna; Través, Paqui G; Schlessinger, Joseph; Lemke, Greg

2014-01-01

The TAM receptor tyrosine kinases Tyro3, Axl, and Mer regulate key features of cellular physiology, yet the differential activities of the TAM ligands Gas6 and Protein S are poorly understood. We have used biochemical and genetic analyses to delineate the rules for TAM receptor–ligand engagement and find that the TAMs segregate into two groups based on ligand specificity, regulation by phosphatidylserine, and function. Tyro3 and Mer are activated by both ligands but only Gas6 activates Axl. Optimal TAM signaling requires coincident TAM ligand engagement of both its receptor and the phospholipid phosphatidylserine (PtdSer): Gas6 lacking its PtdSer-binding ‘Gla domain’ is significantly weakened as a Tyro3/Mer agonist and is inert as an Axl agonist, even though it binds to Axl with wild-type affinity. In two settings of TAM-dependent homeostatic phagocytosis, Mer plays a predominant role while Axl is dispensable, and activation of Mer by Protein S is sufficient to drive phagocytosis. DOI: http://dx.doi.org/10.7554/eLife.03385.001 PMID:25265470

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

The Characteristics of Middle Eastern Respiratory Syndrome Coronavirus Transmission Dynamics in South Korea.

PubMed

Kim, Yunhwan; Lee, Sunmi; Chu, Chaeshin; Choe, Seoyun; Hong, Saeme; Shin, Youngseo

2016-02-01

The outbreak of Middle Eastern respiratory syndrome coronavirus (MERS-CoV) was one of the major events in South Korea in 2015. In particular, this study pays attention to formulating a mathematical model for MERS transmission dynamics and estimating transmission rates. Incidence data of MERS-CoV from the government authority was analyzed for the first aim and a mathematical model was built and analyzed for the second aim of the study. A mathematical model for MERS-CoV transmission dynamics is used to estimate the transmission rates in two periods due to the implementation of intensive interventions. Using the estimates of the transmission rates, the basic reproduction number was estimated in two periods. Due to the superspreader, the basic reproduction number was very large in the first period; however, the basic reproduction number of the second period has reduced significantly after intensive interventions. It turned out to be the intensive isolation and quarantine interventions that were the most critical factors that prevented the spread of the MERS outbreak. The results are expected to be useful to devise more efficient intervention strategies in the future.

KSC-03pd1832

NASA Image and Video Library

2003-06-06

KENNEDY SPACE CENTER, FLA. - A science briefing on the Mars Exploration Rover (MER) missions is held for the media at Kennedy Space Center. From left, the participants are Donald Savage, NASA Public Information Officer; Dr. Ed Weiler, Associate Administrator for Space Science, NASA Headquarters; Dr. Jim Garvin, Mars lead scientist, NASA Headquarters; Dr. Cathy Weitz, MER program scientist, NASA Headquarters; Dr. Joy Crisp, MER project scientist, Jet Propulsion Laboratory; and Dr. Steve Squyres, Mer principal investigator, Cornell Univeristy, Ithaca, N.Y. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans are not yet able to go. MER-A is scheduled to launch on June 8 at 2:06 p.m. EDT, with two launch opportunities each day during a launch period that closes on June 24.

KSC-03pd0537

NASA Image and Video Library

2003-02-24

KENNEDY SPACE CENTER, FLA. -- The cruise stage, aeroshell and lander for the Mars Exploration Rover-1 mission and the MER-2 rover arrive at KSC's Multi-Payload Processing Facility. The same flight hardware for the MER-2 rover arrived Jan. 27; however, the MER-2 rover is scheduled to arrive at KSC in March. While at KSC, each of the two rovers, the aeroshells and the landers will undergo a full mission simulation. All of these flight elements will then be integrated together. After spin balance testing, each spacecraft will be mated to a solid propellant upper stage booster that will propel the spacecraft out of Earth orbit. Approximately 10 days before launch they will be transported to the launch pad for mating with their respective Boeing Delta II rockets. The rovers will serve as robotic geologists to seek answers about the evolution of Mars, particularly for a history of water. The rovers will be identical to each other, but will land at different regions of Mars. Launch of the MER-1 is scheduled for May 30. MER-2 will follow June 25.

Estimation of wind stress using dual-frequency TOPEX data

NASA Astrophysics Data System (ADS)

Elfouhaily, Tanos; Vandemark, Douglas; Gourrion, Jéro‸me; Chapron, Bertrand

1998-10-01

The TOPEX/POSEIDON satellite carries the first dual-frequency radar altimeter. Monofrequency (Ku-band) algorithms are presently used to retrieve surface wind speed from the altimeter's radar cross-section measurement (σ0Ku). These algorithms work reasonably well, but it is also known that altimeter wind estimates can be contaminated by residual effects, such as sea state, embedded in the σ0Ku measurement. Investigating the potential benefit of using two frequencies for wind retrieval, it is shown that a simple evaluation of TOPEX data yields previously unavailable information, particularly for high and low wind speeds. As the wind speed increases, the dual-frequency data provides a measurement more directly linked to the short-scale surface roughness, which in turn is associated with the local surface wind stress. Using a global TOPEX σ0° data set and TOPEX's significant wave height (Hs) estimate as a surrogate for the sea state's degree of development, it is also shown that differences between the two TOPEX σ0 measurements strongly evidence nonlocal sea state signature. A composite scattering theory is used to show how the dual-frequency data can provide an improved friction velocity model, especially for winds above 7 m/s. A wind speed conversion is included using a sea state dependent drag coefficient fed with TOPEX Hs data. Two colocated TOPEX-buoy data sets (from the National Data Buoy Center (NDBC) and the Structure des Echanges Mer-Atmosphre, Proprietes des Heterogeneites Oceaniques: Recherche Expérimentale (SEMAPHORE) campaign) are employed to test the new wind speed algorithm. A measurable improvement in wind speed estimation is obtained when compared to the monofrequency Witter and Chelton [1991] model.

Evaluation of Latent Heat Flux Fields from Satellites and Models during SEMAPHORE.

NASA Astrophysics Data System (ADS)

Bourras, Denis; Liu, W. Timothy; Eymard, Laurence; Tang, Wenqing

2003-02-01

Latent heat fluxes were derived from satellite observations in the region of Structure des Echanges Mer-Atmosphère, Propriétés des Hétérogénéités Océaniques: Recherche Expérimentale (SEMAPHORE), which was conducted near the Azores islands in the North Atlantic Ocean in autumn of 1993. The satellite fluxes were compared with output fields of two atmospheric circulation models and in situ measurements. The rms error of the instantaneous satellite fluxes is between 35 and 40 W m-2 and the bias is 60-85 W m-2. The large bias is mainly attributed to a bias in satellite-derived atmospheric humidity and is related to the particular shape of the vertical humidity profiles during SEMAPHORE. The bias in humidity implies that the range of estimated fluxes is smaller than the range of ship fluxes, by 34%-38%. The rms errors for fluxes from models are 30-35 W m-2, and the biases are smaller than the biases in satellite fluxes (14-18 W m-2). Two case studies suggest that the satellites detect horizontal gradients of wind speed and specific humidity if the magnitude of the gradients exceeds a detection threshold, which is 1.27 g kg-1 (100 km)-1 for specific humidity and between 0.35 and 0.82 m s-1 (30 km)-1 for wind speed. In contrast, the accuracy of the spatial gradients of bulk variables from models always varies as a function of the location and number of assimilated observations. A comparison between monthly fluxes from satellites and models reveals that satellite-derived flux anomaly fields are consistent with reanalyzed fields, whereas operational model products lack part of the mesoscale structures present in the satellite fields.

Hydrological and dynamical characterization of Meddies in the Azores region: A paradigm for baroclinic vortex dynamics

NASA Astrophysics Data System (ADS)

Tychensky, A.; Carton, X.

1998-10-01

The Structure des Echanges Mer-Atmosphere, Proprietes des Heterogeneites Oceaniques: Recherche Expérimentale (SEMAPHORE) oceanographic experiment surveyed a 500 × 500 km2 domain south of the Azores from June to November 1993 and collected hydrological data, float trajectories, and current meter recordings. This data exhibited three intrathermocline eddies of Mediterranean water (Meddies), two of them being repeatedly sampled. Their hydrological and dynamical properties are quantified here by an isopycnic analysis. For the three Meddies, intense temperature and salinity anomalies (up to 4°C and 1.1 practical salinity units (psu)) are observed extending vertically over up to 1000 m and centered around 1000 m. Horizontally, these anomalies spread out to radii of 50-60 km, while the maximum azimuthal velocities (30 cm s-1, as computed by geostrophy) lie only at 35-40 km from the central axis. These Meddies followed curved trajectories, with drift velocities up to 7.5 cm s-1, under the influence of the neighboring mesoscale features (cyclonic vortices or Azores Current meanders). The three-dimensional structure of potential vorticity in and around these features evidences their complex interactions. Northwest of the domain, a Meddy was coupled to a subsurface anticyclone, forming an "aligned" vortex. It later interacted with the Azores Current, creating a large-amplitude northward meander by vertical alignment of vorticity. In the southeastern part of the domain, another Meddy was vertically aligned with an anticyclonic meander of the Azores Current and horizontally coupled with a cyclone of large vertical extent. These two features, as well as a small warm and salty fragment in their vicinity, seem to result from the southward crossing of the Meddy under the Azores Current. These observations illustrate previous theoretical studies of baroclinic vortex dynamics.

Identifying Monoclonal Antibodies that Potently Inhibit MERS-CoV | Center for Cancer Research

Cancer.gov

The Middle East respiratory syndrome coronavirus (MERS-CoV), first isolated in September 2012, infects cells lining the human airway, causing severe flu-like symptoms that, in some cases, lead to death. As of July 2, 2014, 824 confirmed cases of MERS-CoV infection, including at least 286 related deaths, have been reported to the World Health Organization. While there are currently no effective therapies against the virus, monoclonal antibodies (MAbs) may be a promising candidate. Having previously developed MAbs against other viruses, including the related severe acute respiratory syndrome coronavirus or SARS-CoV, Dimiter Dimitrov, Ph.D., of CCR’s Laboratory of Experimental Immunology (LEI), and his colleagues decided to pan a library of antigen binding fragments (Fab) for activity against MERS-CoV.

The Effects of the Mars Exploration Rovers (MER) Work Schedule Regime on Locomotor Activity Circadian Rhythms, Sleep and Fatigue

NASA Technical Reports Server (NTRS)

DeRoshia, Charles W.; Colletti, Laura C.; Mallis, Melissa M.

2008-01-01

This study assessed human adaptation to a Mars sol by evaluating sleep metrics obtained by actigraphy and subjective responses in 22 participants, and circadian rhythmicity in locomotor activity in 9 participants assigned to Mars Exploration Rover (MER) operational work schedules (24.65 hour days) at the Jet Propulsion Laboratory in 2004. During MER operations, increased work shift durations and reduced sleep durations and time in bed were associated with the appearance of pronounced 12-hr (circasemidian) rhythms with reduced activity levels. Sleep duration, workload, and circadian rhythm stability have important implications for adaptability and maintenance of operational performance not only of MER operations personnel but also in space crews exposed to a Mars sol of 24.65 hours during future Mars missions.

KSC-03PD-1587

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASAs twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans cant yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Molecular analysis of mercury-resistant Bacillus isolates from sediment of Minamata Bay, Japan.

PubMed Central

Nakamura, K; Silver, S

1994-01-01

Bacillus isolates from Minamata Bay sediment were selected for the ability to volatilize mercury from a range of organomercurials (including methylmercury). Chromosomal DNA from 74 of 78 such strains hybridized with the mer mercury resistance operon DNA from marine Bacillus sp. strain RC607 (Y. Wang, M. Moore, H. S. Levinson, S. Silver, C. Walsh, and I. Mahler, J. Bacteriol. 171:83-92, 1989). The most frequent classes with regard to restriction nuclease site maps of the mer operon for the new isolates were identical to or closely related to the mer determinant of strain RC607. PCR amplification analysis with primers designed from the strain RC607 mer operon gave products of precisely the predicted size with the 74 Minamata Bay isolates. Images PMID:7811095

Middle East respiratory syndrome in South Korea during 2015: Risk-related perceptions and quarantine attitudes.

PubMed

Kim, E Y; Liao, Q; Yu, E S; Kim, J H; Yoon, S W; Lam, W W T; Fielding, R

2016-11-01

A telephone survey involving 200 household members in and around Seoul, South Korea, was completed during the maturity stage of the outbreak of Middle East respiratory syndrome (MERS) in Korea during June 2015. The study found that respondents perceived low risk from contracting MERS, had low trust in government in controlling MERS, and generally held unfavorable attitudes toward quarantine. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

The Role of an Aggrecan 32mer Fragment in Post-Traumatic Osteoarthritis

DTIC Science & Technology

2017-10-01

Award Number: W81XWH-16-1-0706 TITLE: The Role of an Aggrecan 32mer Fragment in Post -Traumatic Osteoarthritis PRINCIPAL INVESTIGATOR: Professor...TITLE AND SUBTITLE The Role of an Aggrecan 32mer Fragment in Post - Traumatic Osteoarthritis 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-16-1-0706 5c...reduction in knee hyperalgesia, but not mechanical allodynia, in mice at 8 weeks post -surgery. This trend was not statistically significant, however, we are

Development of FIAT-based Thermal Protection System Mass Estimating Relationships for NASA's Multi-Mission Earth Entry Concep

NASA Technical Reports Server (NTRS)

Sepka, Steven Andrew; Zarchi, Kerry Agnes; Maddock, Robert W.; Samareh, Jamshid A.

2011-01-01

Mass Estimating Relationships (MERs) have been developed for use in the Program to Optimize Simulated Trajectories II (POST2) as part of NASA's multi-mission Earth Entry Vehicle (MMEEV) concept. MERs have been developed for the thermal protection systems of PICA and of Carbon Phenolic atop Advanced Carbon-Carbon on the forebody and for SIRCA and Acusil II on the backshell. How these MERs were developed, the resulting equations, model limitations, and model accuracy are discussed herein.

MERS, SARS and other coronaviruses as causes of pneumonia.

PubMed

Yin, Yudong; Wunderink, Richard G

2018-02-01

Human coronaviruses (HCoVs) have been considered to be relatively harmless respiratory pathogens in the past. However, after the outbreak of the severe acute respiratory syndrome (SARS) and emergence of the Middle East respiratory syndrome (MERS), HCoVs have received worldwide attention as important pathogens in respiratory tract infection. This review focuses on the epidemiology, pathogenesis and clinical characteristics among SARS-coronaviruses (CoV), MERS-CoV and other HCoV infections. © 2017 Asian Pacific Society of Respirology.

Development Of FIAT-Based Thermal Protection System Mass Estimating Relationships For NASA's Multi-Mission Earth Entry Concept

NASA Technical Reports Server (NTRS)

Sepka, Steven; Trumble, Kerry A.; Maddock, Robert W.; Samareh, Jamshid

2012-01-01

Mass Estimating Relationships (MERs) have been developed for use in the Program to Optimize Simulated Trajectories II (POST2) as part of NASA's multi-mission Earth Entry Vehicle (MMEEV) concept. MERs have been developed for the thermal protection systems of PICA and of Carbon Phenolic atop Advanced Carbon-Carbon on the forebody and for SIRCA and Acusil II on the backshell. How these MERs were developed, the resulting equations, model limitations, and model accuracy are discussed herein.

Building predictive models for MERS-CoV infections using data mining techniques.

PubMed

Al-Turaiki, Isra; Alshahrani, Mona; Almutairi, Tahani

Recently, the outbreak of MERS-CoV infections caused worldwide attention to Saudi Arabia. The novel virus belongs to the coronaviruses family, which is responsible for causing mild to moderate colds. The control and command center of Saudi Ministry of Health issues a daily report on MERS-CoV infection cases. The infection with MERS-CoV can lead to fatal complications, however little information is known about this novel virus. In this paper, we apply two data mining techniques in order to better understand the stability and the possibility of recovery from MERS-CoV infections. The Naive Bayes classifier and J48 decision tree algorithm were used to build our models. The dataset used consists of 1082 records of cases reported between 2013 and 2015. In order to build our prediction models, we split the dataset into two groups. The first group combined recovery and death records. A new attribute was created to indicate the record type, such that the dataset can be used to predict the recovery from MERS-CoV. The second group contained the new case records to be used to predict the stability of the infection based on the current status attribute. The resulting recovery models indicate that healthcare workers are more likely to survive. This could be due to the vaccinations that healthcare workers are required to get on regular basis. As for the stability models using J48, two attributes were found to be important for predicting stability: symptomatic and age. Old patients are at high risk of developing MERS-CoV complications. Finally, the performance of all the models was evaluated using three measures: accuracy, precision, and recall. In general, the accuracy of the models is between 53.6% and 71.58%. We believe that the performance of the prediction models can be enhanced with the use of more patient data. As future work, we plan to directly contact hospitals in Riyadh in order to collect more information related to patients with MERS-CoV infections. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

MERS in the U.S.

MedlinePlus

... traveler departed Riyadh, Saudi Arabia and traveled by plane to London, England, then to Chicago, Illinois. The ... MERS. On May 1, the patient traveled by plane from Jeddah, Saudi Arabia to London, England; to ...

Human Neutralizing Monoclonal Antibody Inhibition of Middle East Respiratory Syndrome Coronavirus Replication in the Common Marmoset.

PubMed

Chen, Zhe; Bao, Linlin; Chen, Cong; Zou, Tingting; Xue, Ying; Li, Fengdi; Lv, Qi; Gu, Songzhi; Gao, Xiaopan; Cui, Sheng; Wang, Jianmin; Qin, Chuan; Jin, Qi

2017-06-15

Middle East respiratory syndrome coronavirus (MERS-CoV) infection in humans is highly lethal, with a fatality rate of 35%. New prophylactic and therapeutic strategies to combat human infections are urgently needed. We isolated a fully human neutralizing antibody, MCA1, from a human survivor. The antibody recognizes the receptor-binding domain of MERS-CoV S glycoprotein and interferes with the interaction between viral S and the human cellular receptor human dipeptidyl peptidase 4 (DPP4). To our knowledge, this study is the first to report a human neutralizing monoclonal antibody that completely inhibits MERS-CoV replication in common marmosets. Monotherapy with MCA1 represents a potential alternative treatment for human infections with MERS-CoV worthy of evaluation in clinical settings. © Crown copyright 2017.

Community Case Clusters of Middle East Respiratory Syndrome Coronavirus in Hafr Al-Batin, Kingdom of Saudi Arabia: A Descriptive Genomic study

PubMed Central

Memish, Ziad A.; Cotten, Matthew; Watson, Simon J.; Kellam, Paul; Zumla, Alimuddin; Alhakeem, Rafat F.; Assiri, Abdullah; Rabeeah, Abdullah A. Al; Al-Tawfiq, Jaffar A.

2014-01-01

Summary The Middle East respiratory syndrome coronavirus (MERS-CoV) was first described in September 2012 and to date 86 deaths from a total of 206 cases of MERS-CoV infection have been reported to the WHO. Camels have been implicated as the reservoir of MERS-CoV, but the exact source and mode of transmission for most patients remain unknown. During a 3 month period, June to August 2013, there were 12 positive MERS-CoV cases reported from the Hafr Al-Batin region district in the north east region of the Kingdom of Saudi Arabia. In addition to the different regional camel festivals in neighboring countries, Hafr Al-Batin has the biggest camel market in the entire Kingdom and hosts an annual camel festival. Thus, we conducted a detailed epidemiological, clinical and genomic study to ascertain common exposure and transmission patterns of all cases of MERS-CoV reported from Hafr Al-Batin. Analysis of previously reported genetic data indicated that at least two of the infected contacts could not have been directly infected from the index patient and alternate source should be considered. While camels appear as the likely source, other sources have not been ruled out. More detailed case control studies with detailed case histories, epidemiological information and genomic analysis are being conducted to delineate the missing pieces in the transmission dynamics of MERS-CoV outbreak. PMID:24699184

The backshell for the Mars Exploration Rover 1 (MER-1) is moved toward the rover (foreground, left). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

The backshell for the Mars Exploration Rover 1 (MER-1) is moved toward the rover (foreground, left). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

The TAM-family receptor Mer mediates production of HGF through the RhoA-dependent pathway in response to apoptotic cells.

PubMed

Park, Hyun-Jung; Baen, Ji-Yeon; Lee, Ye-Ji; Choi, Youn-Hee; Kang, Jihee Lee

2012-08-01

The TAM receptor protein tyrosine kinases Tyro3, Axl, and Mer play important roles in macrophage function. We investigated the roles of the TAM receptors in mediating the induction of hepatocyte growth factor (HGF) during the interaction of macrophages with apoptotic cells. Mer-specific neutralizing antibody, small interfering RNA (siRNA), and a recombinant Mer protein (Mer/Fc) inhibited HGF mRNA and protein expression, as well as activation of RhoA, Akt, and specific mitogen-activated protein (MAP) kinases in response to apoptotic cells. Inhibition of Axl or Tyro3 with specific antibodies, siRNA, or Fc-fusion proteins did not prevent apoptotic cell-induced HGF mRNA and protein expression and did not inhibit activation of the postreceptor signaling molecules RhoA and certain MAP kinases, including extracellular signal-regulated protein kinase and c-Jun NH(2)-terminal kinase. However, Axl- and Tyro3-specific blockers did inhibit the activation of Akt and p38 MAP kinase in response to apoptotic cells. In addition, none of the TAM receptors mediated the effects of apoptotic cells on transforming growth factor-β or epidermal growth factor mRNA expression. However, they were involved in the induction of vascular endothelial growth factor mRNA expression. Our data provide evidence that when macrophages interact with apoptotic cells, only Mer of the TAM-family receptors is responsible for mediating transcriptional HGF production through a RhoA-dependent pathway.

Serologic follow-up of Middle East Respiratory Syndrome Coronavirus Cases and Contacts - Abu Dhabi, United Arab Emirates.

PubMed

Al Hosani, Farida Ismail; Kim, Lindsay; Khudhair, Ahmed; Pham, Huong; Al Mulla, Mariam; Al Bandar, Zyad; Pradeep, Krishna; Elkheir, Kheir Abou; Weber, Stefan; Khoury, Mary; Donnelly, George; Younis, Naima; El Saleh, Feda; Abdalla, Muna; Imambaccus, Hala; Haynes, Lia M; Thornburg, Natalie J; Harcourt, Jennifer L; Miao, Congrong; Tamin, Azaibi; Hall, Aron J; Russell, Elizabeth S; Harris, Aaron M; Kiebler, Craig; Mir, Roger A; Pringle, Kimberly; Alami, Negar N; Abedi, Glen R; Gerber, Susan I

2018-06-13

Although there is evidence of person-to-person transmission of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in household and healthcare settings, more data are needed to describe and better understand the risk factors and transmission routes in both settings, as well as the extent that disease severity affects transmission. A sero-epidemiological investigation was conducted among Middle East Respiratory Syndrome Coronavirus (MERS-CoV) case-patients and their household contacts to investigate transmission risk in Abu Dhabi, United Arab Emirates. Cases diagnosed between January 1, 2013-May 9, 2014 and their household contacts were approached for enrollment. Demographic, clinical, and exposure history data were collected. Sera were screened by MERS-CoV nucleocapsid protein (N) ELISA and indirect immunofluorescence, with results confirmed by microneutralization assay. Ninety-one percent (n=31/34) of case-patients were asymptomatic or mildly symptomatic and did not require oxygen during hospitalization. MERS-CoV antibodies were detected in 13 of 24 (54%) cases with available sera, including 3 asymptomatic, 9 mildly symptomatic, and 1 severely symptomatic case-patient. No serologic evidence of MERS-CoV transmission was found among 105 household contacts with available sera. Transmission of MERS-CoV was not documented in this investigation of mostly asymptomatic and mildly symptomatic cases and their household contacts. These results have implications for clinical management of cases and formulation of isolation policies to reduce the risk of transmission.

EDs on heightened alert for MERS-CoV as first cases reach the US.

PubMed

2014-07-01

The first cases of Middle East Respiratory Syndrome coronavirus (MERS-CoV) have turned up in the United States. First, in late April, a patient tested positive for the virus at a hospital in Munster, IN, and then shortly thereafter, a second patient tested positive at a hospital in Orlando, FL. While both patients have since recovered from the virus and been released, the cases have raised awareness of the infectious threat of MERS-CoV, and they have put EDs and other frontline providers on heightened alert for patients with severe respiratory symptoms and other risk factors. While MERS-CoV is not yet as contagious as seasonal influenza or the severe acute respiratory syndrome (SARS) that started in China and then swept around the globe in 2003, it is more deadly. The World Health Organization reports that roughly one-quarter of 514 people who have tested positive for the virus have died. Experts note that health care workers make up a large percentage of the documented cases of MERS-CoV, and they point out that most human-to-human transmissions of the virus occur in the hospital setting. Public health officials urge emergency personnel to pay strict attention to infection control practices, and to query patients who present with fever and respiratory distress about recent travel to the Arabian Peninsula and/or close contact with a person who has a confirmed or probable case of MERS-CoV.

Importance of Neutralizing Monoclonal Antibodies Targeting Multiple Antigenic Sites on the Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein To Avoid Neutralization Escape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingshu; Shi, Wei; Chappell, James D.

ABSTRACT Middle East respiratory syndrome coronavirus (MERS-CoV) causes a highly lethal pulmonary infection with ~35% mortality. The potential for a future pandemic originating from animal reservoirs or health care-associated events is a major public health concern. There are no vaccines or therapeutic agents currently available for MERS-CoV. Using a probe-based single B cell cloning strategy, we have identified and characterized multiple neutralizing monoclonal antibodies (MAbs) specifically binding to the receptor-binding domain (RBD) or S1 (non-RBD) regions from a convalescent MERS-CoV-infected patient and from immunized rhesus macaques. RBD-specific MAbs tended to have greater neutralizing potency than non-RBD S1-specific MAbs. Six RBD-specificmore » and five S1-specific MAbs could be sorted into four RBD and three non-RBD distinct binding patterns, based on competition assays, mapping neutralization escape variants, and structural analysis. We determined cocrystal structures for two MAbs targeting the RBD from different angles and show they can bind the RBD only in the “out” position. We then showed that selected RBD-specific, non-RBD S1-specific, and S2-specific MAbs given prophylactically prevented MERS-CoV replication in lungs and protected mice from lethal challenge. Importantly, combining RBD- and non-RBD MAbs delayed the emergence of escape mutations in a cell-based virus escape assay. These studies identify MAbs targeting different antigenic sites on S that will be useful for defining mechanisms of MERS-CoV neutralization and for developing more effective interventions to prevent or treat MERS-CoV infections. IMPORTANCEMERS-CoV causes a highly lethal respiratory infection for which no vaccines or antiviral therapeutic options are currently available. Based on continuing exposure from established reservoirs in dromedary camels and bats, transmission of MERS-CoV into humans and future outbreaks are expected. Using structurally defined probes for the MERS-CoV spike glycoprotein (S), the target for neutralizing antibodies, single B cells were sorted from a convalescent human and immunized nonhuman primates (NHPs). MAbs produced from paired immunoglobulin gene sequences were mapped to multiple epitopes within and outside the receptor-binding domain (RBD) and protected against lethal MERS infection in a murine model following passive immunization. Importantly, combining MAbs targeting distinct epitopes prevented viral neutralization escape from RBD-directed MAbs. These data suggest that antibody responses to multiple domains on CoV spike protein may improve immunity and will guide future vaccine and therapeutic development efforts.« less

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

A camel-derived MERS-CoV with a variant spike protein cleavage site and distinct fusion activation properties

PubMed Central

Millet, Jean Kaoru; Goldstein, Monty E; Labitt, Rachael N; Hsu, Hung-Lun; Daniel, Susan; Whittaker, Gary R

2016-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) continues to circulate in both humans and camels, and the origin and evolution of the virus remain unclear. Here we characterize the spike protein of a camel-derived MERS-CoV (NRCE-HKU205) identified in 2013, early in the MERS outbreak. NRCE-HKU205 spike protein has a variant cleavage motif with regard to the S2′ fusion activation site—notably, a novel substitution of isoleucine for the otherwise invariant serine at the critical P1′ cleavage site position. The substitutions resulted in a loss of furin-mediated cleavage, as shown by fluorogenic peptide cleavage and western blot assays. Cell–cell fusion and pseudotyped virus infectivity assays demonstrated that the S2′ substitutions decreased spike-mediated fusion and viral entry. However, cathepsin and trypsin-like protease activation were retained, albeit with much reduced efficiency compared with the prototypical EMC/2012 human strain. We show that NRCE-HKU205 has more limited fusion activation properties possibly resulting in more restricted viral tropism and may represent an intermediate in the complex pattern of MERS-CoV ecology and evolution. PMID:27999426

Non-genomic oestrogen receptor signal in B lymphocytes: An approach towards therapeutic interventions for infection, autoimmunity and cancer.

PubMed

Seto, Karsen; Hoang, Minh; Santos, Thaddeus; Bandyopadhyay, Mausumi; Kindy, Mark S; Dasgupta, Subhajit

2016-07-01

The non-genomic membrane bound oestrogen receptor (mER) regulates intracellular signals through receptor-ligand interactions. The mER, along with G-protein coupled oestrogen receptor GPR 30 (GPER), induces diverse cell signalling pathways in murine lymphocytes. The mER isoform ER-alpha46 has recently been demonstrated in human B and T lymphocytes as an analogue receptor for chemokine CCL18, the signalling events of which are not clearly understood. Ligand-induced mER and GPER signalling events are shared with BCR, CD19 mediated intracellular signalling through phospholipase C, PIP2/IP3/PI3 mediated activation of Akt, MAP kinase, and mTOR. Oestrogen has the ability to induce CD40-mediated activation of B cells. The complete signalling pathways of mER, GPR30 and their interaction with other signals are targeted areas for novel drug development in B cells during infection, autoimmunity and cancer. Therefore, an in depth investigation is critical for determining shared signal outputs during B cell activation. Here, we focus on the mode of action of membrane bound ER in B cells as therapeutic checkpoints. Copyright © 2016 Elsevier Ltd. All rights reserved.

Potential MER Landing Site in Melas Chasma

NASA Technical Reports Server (NTRS)

Weitz, C. M.; Parker, Timothy J.; Anderson, F. Scott

2001-01-01

We have selected one area in Valles Marineris as a potential landing site for the Mars Exploration Rover (MER) mission. After 30 years of analyses, the formation of the Valles Marineris system of troughs and its associated deposits still remains an enigma. Understanding all aspects of the Valles Marineris would significantly contribute to deciphering the internal and external history of Mars. A landing site within Melas Chasma could provide insight into both the formation of Valles Marineris and the composition and origin of the interior layered deposits (ILDs). The ILDs have been proposed as: (1) sedimentary deposits formed in lakes mass wasted material from the walls; (3) remnants of the wall rock; (4) carbonate deposits; (5) aeolian deposits; and (6) volcanic. More recently, Malin and Edgett suggest that the fine-scale, rhythmic layering seen in the interior deposits, as well as other layered deposits in craters, supports a sedimentary origin. Because an understanding of the formation of Valles Marineris and its interior deposits is so important to deciphering the history of Mars, we have proposed a landing site for the MER mission on an exposure of interior deposits in western Melas Chasma. Either MER-A and MER-B could land at this same location.

Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen

PubMed Central

Pallesen, Jesper; Wang, Nianshuang; Corbett, Kizzmekia S.; Wrapp, Daniel; Kirchdoerfer, Robert N.; Turner, Hannah L.; Cottrell, Christopher A.; Becker, Michelle M.; Wang, Lingshu; Shi, Wei; Kong, Wing-Pui; Andres, Erica L.; Kettenbach, Arminja N.; Denison, Mark R.; Chappell, James D.; Graham, Barney S.; Ward, Andrew B.

2017-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a lineage C betacoronavirus that since its emergence in 2012 has caused outbreaks in human populations with case-fatality rates of ∼36%. As in other coronaviruses, the spike (S) glycoprotein of MERS-CoV mediates receptor recognition and membrane fusion and is the primary target of the humoral immune response during infection. Here we use structure-based design to develop a generalizable strategy for retaining coronavirus S proteins in the antigenically optimal prefusion conformation and demonstrate that our engineered immunogen is able to elicit high neutralizing antibody titers against MERS-CoV. We also determined high-resolution structures of the trimeric MERS-CoV S ectodomain in complex with G4, a stem-directed neutralizing antibody. The structures reveal that G4 recognizes a glycosylated loop that is variable among coronaviruses and they define four conformational states of the trimer wherein each receptor-binding domain is either tightly packed at the membrane-distal apex or rotated into a receptor-accessible conformation. Our studies suggest a potential mechanism for fusion initiation through sequential receptor-binding events and provide a foundation for the structure-based design of coronavirus vaccines. PMID:28807998

Real-Time Sequence-Validated Loop-Mediated Isothermal Amplification Assays for Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

PubMed Central

Bhadra, Sanchita; Jiang, Yu Sherry; Kumar, Mia R.; Johnson, Reed F.; Hensley, Lisa E.; Ellington, Andrew D.

2015-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV), an emerging human coronavirus, causes severe acute respiratory illness with a 35% mortality rate. In light of the recent surge in reported infections we have developed asymmetric five-primer reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays for detection of MERS-CoV. Isothermal amplification assays will facilitate the development of portable point-of-care diagnostics that are crucial for management of emerging infections. The RT-LAMP assays are designed to amplify MERS-CoV genomic loci located within the open reading frame (ORF)1a and ORF1b genes and upstream of the E gene. Additionally we applied one-step strand displacement probes (OSD) for real-time sequence-specific verification of LAMP amplicons. Asymmetric amplification effected by incorporating a single loop primer in each assay accelerated the time-to-result of the OSD-RT-LAMP assays. The resulting assays could detect 0.02 to 0.2 plaque forming units (PFU) (5 to 50 PFU/ml) of MERS-CoV in infected cell culture supernatants within 30 to 50 min and did not cross-react with common human respiratory pathogens. PMID:25856093

Adaptive evolution influences the infectious dose of MERS-CoV necessary to achieve severe respiratory disease.

PubMed

Douglas, Madeline G; Kocher, Jacob F; Scobey, Trevor; Baric, Ralph S; Cockrell, Adam S

2018-04-01

We recently established a mouse model (288-330 +/+ ) that developed acute respiratory disease resembling human pathology following infection with a high dose (5 × 10 6 PFU) of mouse-adapted MERS-CoV (icMERSma1). Although this high dose conferred fatal respiratory disease in mice, achieving similar pathology at lower viral doses may more closely reflect naturally acquired infections. Through continued adaptive evolution of icMERSma1 we generated a novel mouse-adapted MERS-CoV (maM35c4) capable of achieving severe respiratory disease at doses between 10 3 and 10 5 PFU. Novel mutations were identified in the maM35c4 genome that may be responsible for eliciting etiologies of acute respiratory distress syndrome at 10-1000 fold lower viral doses. Importantly, comparative genetics of the two mouse-adapted MERS strains allowed us to identify specific mutations that remained fixed through an additional 20 cycles of adaptive evolution. Our data indicate that the extent of MERS-CoV adaptation determines the minimal infectious dose required to achieve severe respiratory disease. Copyright © 2017 Elsevier Inc. All rights reserved.

Synthetic oligosaccharides can replace animal-sourced low-molecular weight heparins.

PubMed

Xu, Yongmei; Chandarajoti, Kasemsiri; Zhang, Xing; Pagadala, Vijayakanth; Dou, Wenfang; Hoppensteadt, Debra Moorman; Sparkenbaugh, Erica M; Cooley, Brian; Daily, Sharon; Key, Nigel S; Severynse-Stevens, Diana; Fareed, Jawed; Linhardt, Robert J; Pawlinski, Rafal; Liu, Jian

2017-09-06

Low-molecular weight heparin (LMWH) is used clinically to treat clotting disorders. As an animal-sourced product, LMWH is a highly heterogeneous mixture, and its anticoagulant activity is not fully reversible by protamine. Furthermore, the reliability of the LMWH supply chain is a concern for regulatory agencies. We demonstrate the synthesis of heparin dodecasaccharides (12-mers) at the gram scale. In vitro experiments demonstrate that the anticoagulant activity of the 12-mers could be reversed using protamine. One of these, labeled as 12-mer-1, reduced the size of blood clots in the mouse model of deep vein thrombosis and attenuated circulating procoagulant markers in the mouse model of sickle cell disease. An ex vivo experiment demonstrates that the anticoagulant activity of 12-mer-1 could be reversed by protamine. 12-mer-1 was also examined in a nonhuman primate model to determine its pharmacodynamic parameters. A 7-day toxicity study in a rat model showed no toxic effects. The data suggest that a synthetic homogeneous oligosaccharide can replace animal-sourced LMWHs. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Microbial Certification of the MER spacecraft

NASA Technical Reports Server (NTRS)

Schubert, W. W.; Arakelian, T.; Barengoltz, J. B.; Chough, N. G.; Chung, S. Y.; Law, J.; Kirschner, L.; Koukol, R. C.; Newlin, L. E.; Morales, F.

2003-01-01

Spacecraft such as the Mars Exploration Rovers (MER) must meet acceptable microbial population levels prior to launch. Sensitive parts and materials prevent any single sterilization method from being used as a final step on the assembled spacecraft.

Mesure Objective De L'attenuation et De L'effet D'occlusion Des Protecteurs Auditifs a Partir Des Potentiels Evoques Stationnaires et Multiples =

NASA Astrophysics Data System (ADS)

Valentin, Olivier

Selon l'Organisation mondiale de la sante, le nombre de travailleurs exposes quotidiennement a des niveaux de bruit prejudiciables a leur audition est passe de 120 millions en 1995 a 250 millions en 2004. Meme si la reduction du bruit a la source devrait etre toujours privilegiee, la solution largement utilisee pour lutter contre le bruit au travail reste la protection auditive individuelle. Malheureusement, le port des protecteurs auditifs n'est pas toujours respecte par les travailleurs car il est difficile de fournir un protecteur auditif dont le niveau d'attenuation effective est approprie a l'environnement de travail d'un individu. D'autre part, l'occlusion du canal auditif induit une modification de la perception de la parole, ce qui cree un inconfort incitant les travailleurs a retirer leurs protecteurs. Ces deux problemes existent parce que les methodes actuelles de mesure de l'effet d'occlusion et de l'attenuation sont limitees. Les mesures objectives basees sur des mesures microphoniques intra-auriculaires ne tiennent pas compte de la transmission directe du son a la cochlee par conduction osseuse. Les mesures subjectives au seuil de l'audition sont biaisees a cause de l'effet de masquage aux basses frequences induit par le bruit physiologique. L'objectif principal de ce travail de these de doctorat est d'ameliorer la mesure de l'attenuation et de l'effet d'occlusion des protecteurs auditifs intra-auriculaires. L'approche generale consiste a : (i) verifier s'il est possible de mesurer l'attenuation des protecteurs auditifs grâce au recueil des potentiels evoques stationnaires et multiples (PEASM) avec et sans protecteur auditif (protocole 1), (ii) adapter cette methodologie pour mesurer l'effet d'occlusion induit par le port de protecteur auditifs intra-auriculaires (protocole 2), et (iii) valider chaque protocole par l'intermediaire de mesures realisees sur sujets humains. Les resultats du protocole 1 demontrent que les PEASM peuvent etre utilises pour mesurer objectivement l'attenuation des protecteurs auditifs : les resultats obtenus a 500 Hz et 1 kHz demontrent que l'attenuation mesuree a partir des PEASM est relativement equivalente a l'attenuation calculee par la methode REAT, ce qui est en accord avec ce qui etait attendu puisque l'effet de masquage induit par le bruit physiologique aux basses frequences est relativement negligeable a ces frequences. Les resultats du protocole 2 demontrent que les PEASM peuvent etre egalement utilises pour mesurer objectivement l'effet d'occlusion induit par le port de protecteurs auditifs : l'effet d'occlusion mesure a partir des PEASM a 500 Hz est plus eleve que celui calcule par l'intermediaire de la methode subjective au seuil de l'audition, ce qui est en accord avec ce qui etait attendu puisqu'en dessous d'1 kHz, l'effet de masquage induit par le bruit physiologique aux basses frequences est source de biais pour les resultats obtenus par la methode subjective car il y a surestimation des seuils de l'audition en basse frequence lors du port de protecteurs auditifs. Toutefois, les resultats obtenus a 250 Hz sont en contradiction avec les resultats attendus. D'un point de vue scientifique, ce travail de these a permis de realiser deux nouvelles methodes innovantes pour mesurer objectivement l'attenuation et l'effet d'occlusion des protecteurs auditifs intra-auriculaires par electroencephalographie. D'un point de vue sante et securite au travail, les avancees presentees dans cette these pourraient aider a concevoir des protecteurs auditifs plus performants. En effet, si ces deux nouvelles methodes objectives etaient normalisees pour caracteriser les protecteurs auditifs intra-auriculaires, elles pourraient permettre : (i) de mieux apprehender l'efficacite reelle de la protection auditive et (ii) de fournir une mesure de l'inconfort induit par l'occlusion du canal auditif lors du port de protecteurs. Fournir un protecteur auditif dont l'efficacite reelle est adaptee a l'environnement de travail et dont le confort est optimise permettrait, sur le long terme, d'ameliorer les conditions des travailleurs en minimisant le risque lie a la degradation de leur appareil auditif. Les perspectives de travail proposees a la fin de cette these consistent principalement a : (i) exploiter ces deux methodes avec une gamme frequentielle plus etendue, (ii) explorer la variabilite intra-individuelle de chacune des methodes, (iii) comparer les resultats des deux methodes avec ceux obtenus par l'intermediaire de la methode "Microphone in Real Ear" (MIRE) et (iv) verifier la compatibilite de chacune des methodes avec tous les types de protecteurs auditifs. De plus, pour la methode de mesure de l'effet d'occlusion utilisant les PEASM, une etude complementaire est necessaire pour lever la contradiction observee a 250 Hz.

The MER Mossbauer Spectrometers: 40 Months of Operation on the Martian Surface

NASA Technical Reports Server (NTRS)

Fleischer, Iris; Rodionov, D.; Schroeder, C.; Morris, R.; Yen, A.; Ming, D.; McCoy, T.; Mittlefehldt, D.; Gellert, R.; Cohen, B.;

The Department of Defense Global, Laboratory-Based Influenza Surveillance Program: Technical Report on Program Methods for the 2012-2013 Influenza Season

DTIC Science & Technology

2013-10-01

revealed the emergence of two novel respiratory pathogens: Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and influenza A( H7N9 ). MERS-CoV was...first identified in patients who lived in or had recent travel to the Saudi Arabian Peninsula, while influenza A( H7N9 ) was first identified in several...individuals in Eastern China. To date, MERS-CoV has shown limited human-to-human transmission, while influenza A( H7N9 ) has not shown sustained

KSC-03pd1231

NASA Image and Video Library

2003-04-24

KENNEDY SPACE CENTER, FLA. - Tom Shain, the MER ATLO logistics manager, holds a computer chip with about 35,000 laser-engraved signatures of visitors to the Mars Exploration Rovers at the Jet Propulsion Laboratory. He and Jim Lloyd, also with the program, will place the chip on the second rover to be launched to Mars (MER-1/MER-B); the first rover already has one. The signatures include those of senators, artists, and John Glenn. The identical Mars rovers are scheduled to launch June 5 and June 25 from Cape Canaveral Air Force Station.

KMC 3: counting and manipulating k-mer statistics.

PubMed

Kokot, Marek; Dlugosz, Maciej; Deorowicz, Sebastian

2017-09-01

Counting all k -mers in a given dataset is a standard procedure in many bioinformatics applications. We introduce KMC3, a significant improvement of the former KMC2 algorithm together with KMC tools for manipulating k -mer databases. Usefulness of the tools is shown on a few real problems. Program is freely available at http://sun.aei.polsl.pl/REFRESH/kmc . sebastian.deorowicz@polsl.pl. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Analysis of phospholipid fatty acids (PLFA) to characterize microbial communities in aquifers

NASA Astrophysics Data System (ADS)

Green, Christopher T.; Scow, Kate M.

This paper reviews published applications of lipid-based biochemical techniques for characterizing microbial communities in aquifers and other deep subsurface habitats. These techniques, such as phospholipid fatty acid (PLFA) analysis, can provide information on a variety of microbial characteristics, such as biomass, physiology, taxonomic and functional identity, and overall community composition. In addition, multivariate statistical analysis of lipid data can relate spatial or temporal changes in microbial communities to environmental factors. The use of lipid-based techniques in the study of groundwater microbiology is advantageous because they do not require culturing and can provide quantitative data on entire communities. However, combined effects of physiological and phylogenetic changes on the lipid composition of a community can confound interpretation of the data, and many questions remain about the validity of various lipid techniques. Despite these caveats, lipid-based research has begun to show trends in community composition in contaminated and pristine aquifers that contribute to our understanding of groundwater microbial ecology and have potential for use in optimization of bioremediation of groundwater pollutants. Résumé Ce papier passe en revue les applications des techniques biochimiques basées sur les lipides pour caractériser les communautés microbiennes présentes dans les aquifères et dans les autres habitats souterrains profonds. Ces techniques, telles que l'analyse des acides gras phospholipidiques (PLFA), peuvent fournir des informations sur un ensemble de caractères microbiens, tels que la biomasse, la physiologie, l'identité taxonomique et fonctionnelle, et surtout la composition de la communauté. En outre, l'analyse statistique multivariée des données sur les lipides peut établir les liens entre des changements spatiaux ou temporels dans la communauté microbienne et des facteurs environnementaux. L'utilisation des techniques basées sur les lipides dans l'étude de la microbiologie des eaux souterraines est intéressante parce qu'elle ne nécessite pas de mise en culture et qu'elle peut fournir des données quantitatives sur les communautés dans leur ensemble. Toutefois, les effets combinés de changements physiologiques et phylogénétiques sur la composition d'une communauté peuvent brouiller l'interprétation des données de nombreuses questions se posent sur la validité des différentes techniques lipidiques. Malgré ces oppositions, la recherche basée sur les lipides a commencéà montrer des tendances dans la composition des communautés dans les aquifères pollués et dans ceux non perturbés ces résultats contribuent ainsi à notre compréhension de l'écologie microbienne des eaux souterraines et montrent qu'il existe un potentiel pour leur utilisation en vue d'une optimisation de la dépollution biologique des eaux souterraines. Resumen Se revisan distintas técnicas bioquímicas que se basan en el análisis de lípidos para caracterizar las comunidades microbianas en hábitats subsuperficiales, incluyendo acuíferos. Estas técnicas, entre las que se incluye el análisis de ácidos grasos fosfolípidos (PLFA), pueden proporcionar información sobre toda una serie de características de las comunidades microbianas, como su biomasa, fisiología, identidad taxonómica y funcional y composición. Además, el análisis estadístico multivariado de los datos de lípidos permite relacionar los cambios espaciales o temporales en las comunidades microbianas con factores ambientales. Las técnicas basadas en lípidos son muy útiles para el estudio microbiológico de las aguas subterráneas, puesto que no requieren cultivos y además proporcionan datos cuantitativos de comunidades completas. Sin embargo, la acción combinada de los cambios fisiológicos y filogenéticos en la composición de lípidos en una comunidad pueden confundir la interpretación de los datos, por lo existen muchas cuestiones abiertas respecto a la validez de algunas de estas técnicas. A pesar de estas dificultades, estas técnicas han permitido detectar diferentes tendencias en la composición de las comunidades en acuíferos con y sin contaminación, lo que contribuye a nuestro entendimiento de la ecología microbiana de los acuíferos. Este último aspecto tiene un uso potencial en la optimización de los métodos de biorremediación de acuíferos.

Demonstration of Mer-Cure Technology for Enhanced Mercury Control

DOE Office of Scientific and Technical Information (OSTI.GOV)

John Marion; Dave O'Neill; Kevin Taugher

2008-06-01

Alstom Power Inc. has completed a DOE/NETL-sponsored program (under DOE Cooperative Agreement No. De-FC26-07NT42776) to demonstrate Mer-Cure{trademark}, one of Alstom's mercury control technologies for coal-fired boilers. The Mer-Cure{trademark}system utilizes a small amount of Mer-Clean{trademark} sorbent that is injected into the flue gas stream for oxidation and adsorption of gaseous mercury. Mer-Clean{trademark} sorbents are carbon-based and prepared with chemical additives that promote oxidation and capture of mercury. The Mer-Cure{trademark} system is unique in that the sorbent is injected into an environment where the mercury capture kinetics is accelerated. The full-scale demonstration program originally included test campaigns at two host sites: LCRA's 480-MW{sub e} Fayette Unit No.3 and Reliant Energy's 190-MW{sub e} Shawville Unit No.3. The only demonstration tests actually done were the short-term tests at LCRA due to budget constraints. This report gives a summary of the demonstration testing at Fayette Unit No.3. The goals for this Mercury Round 3 program, established by DOE/NETL under the original solicitation, were to reduce the uncontrolled mercury emissions by 90% at a cost significantly less than 50% of the previous target ofmore » $$60,000/lb mercury removed. The results indicated that Mer-Cure{trademark} technology could achieve mercury removal of 90% based on uncontrolled stack emissions. The estimated costs for 90% mercury control, at a sorbent cost of $$0.75 to $2.00/lb respectively, were $13,400 to $18,700/lb Hg removed. In summary, the results from demonstration testing show that the goals established by DOE/NETL were met during this test program. The goal of 90% mercury reduction was achieved. Estimated mercury removal costs were 69-78% lower than the benchmark of $60,000/lb mercury removed, significantly less than 50% of the baseline removal cost.« less

Production of Titanium Metal by an Electrochemical Molten Salt Process

NASA Astrophysics Data System (ADS)

Fatollahi-Fard, Farzin

Titanium production is a long and complicated process. What we often consider to be the standard method of primary titanium production (the Kroll process), involves many complex steps both before and after to make a useful product from titanium ore. Thus new methods of titanium production, especially electrochemical processes, which can utilize less-processed feedstocks have the potential to be both cheaper and less energy intensive than current titanium production processes. This project is investigating the use of lower-grade titanium ores with the electrochemical MER process for making titanium via a molten salt process. The experimental work carried out has investigated making the MER process feedstock (titanium oxycarbide) with natural titanium ores--such as rutile and ilmenite--and new ways of using the MER electrochemical reactor to "upgrade" titanium ores or the titanium oxycarbide feedstock. It is feasible to use the existing MER electrochemical reactor to both purify the titanium oxycarbide feedstock and produce titanium metal.

Simrank: Rapid and sensitive general-purpose k-mer search tool

PubMed Central

2011-01-01

Background Terabyte-scale collections of string-encoded data are expected from consortia efforts such as the Human Microbiome Project http://nihroadmap.nih.gov/hmp. Intra- and inter-project data similarity searches are enabled by rapid k-mer matching strategies. Software applications for sequence database partitioning, guide tree estimation, molecular classification and alignment acceleration have benefited from embedded k-mer searches as sub-routines. However, a rapid, general-purpose, open-source, flexible, stand-alone k-mer tool has not been available. Results Here we present a stand-alone utility, Simrank, which allows users to rapidly identify database strings the most similar to query strings. Performance testing of Simrank and related tools against DNA, RNA, protein and human-languages found Simrank 10X to 928X faster depending on the dataset. Conclusions Simrank provides molecular ecologists with a high-throughput, open source choice for comparing large sequence sets to find similarity. PMID:21524302

Mars Exploration Rover -2

NASA Image and Video Library

2003-03-06

Components of the two Mars Exploration Rovers (MER) reside in the Payload Hazardous Servicing Facility. At right MER-2. At left is a lander. In the background is one of the aeroshells. MER-1 and MER-2, their aeroshells and landers will undergo a full mission simulation before being integrated. After spin balance testing, each spacecraft will be mated to a solid propellant upper stage booster that will propel the spacecraft out of Earth orbit. Approximately 10 days before launch they will be transported to the launch pad for mating with their respective Boeing Delta II rockets. The rovers will serve as robotic geologists to seek answers about the evolution of Mars, particularly for a history of water. The rovers are identical to each other, but will land at different regions of Mars. Launch of the first rover is scheduled for May 30 from Cape Canaveral Air Force Station. The second will follow June 25.

Nosocomial infection control in healthcare settings: Protection against emerging infectious diseases.

PubMed

Fu, Chuanxi; Wang, Shengyong

2016-04-12

The Middle East respiratory syndrome (MERS) outbreak in Korea in 2015 may be attributable to poor nosocomial infection control procedures implemented. Strict infection control measures were taken in the hospital where an imported case with MERS was treated in southern China and 53 health care workers were confirmed to be MERS-CoV negative. Infection control in healthcare settings, in which patients with emerging infectious diseases such as MERS, Ebola virus disease, and the severe acute respiratory syndrome (SARS) are diagnosed and treated, are often imperfect. When it comes to emerging or unknown infectious diseases, before the imported case was finally identified or community transmission was reported, cases have often occurred in clusters in healthcare settings. Nosocomial infection control measures should be further strengthened among the workers and inpatients in designated healthcare settings that accommodate suspected cases suffering from emerging or unknown infectious diseases.

KSC-03PD-1593

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. While one solid rocket booster (SRB) is suspended in the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, another is raised from its transporter for a similar lift. They are two of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASAs twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans cant yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KGCAK: a K-mer based database for genome-wide phylogeny and complexity evaluation.

PubMed

Wang, Dapeng; Xu, Jiayue; Yu, Jun

2015-09-16

The K-mer approach, treating genomic sequences as simple characters and counting the relative abundance of each string upon a fixed K, has been extensively applied to phylogeny inference for genome assembly, annotation, and comparison. To meet increasing demands for comparing large genome sequences and to promote the use of the K-mer approach, we develop a versatile database, KGCAK ( http://kgcak.big.ac.cn/KGCAK/ ), containing ~8,000 genomes that include genome sequences of diverse life forms (viruses, prokaryotes, protists, animals, and plants) and cellular organelles of eukaryotic lineages. It builds phylogeny based on genomic elements in an alignment-free fashion and provides in-depth data processing enabling users to compare the complexity of genome sequences based on K-mer distribution. We hope that KGCAK becomes a powerful tool for exploring relationship within and among groups of species in a tree of life based on genomic data.

Multimode marine engine room simulation system based on field bus technology

NASA Astrophysics Data System (ADS)

Zheng, Huayao; Deng, Linlin; Guo, Yi

2003-09-01

Developing multi mode MER (Marine Engine Room) Labs is the main work in Marine Simulation Center, which is the key lab of Communication Ministry of China. It includes FPP (Fixed Pitch Propeller) and CPP (Controllable Pitch Propeller) mode MER simulation systems, integrated electrical propulsion mode MER simulation system, physical mode MER lab, etc. FPP mode simulation system, which was oriented to large container ship, had been completed since 1999, and got second level of Shanghai Municipal Science and Technical Progress award. This paper mainly introduces the recent development and achievements of Marine Simulation Center. Based on the Lon Works field bus, the structure characteristics and control strategies of completely distributed intelligent control network are discussed. The experiment mode of multi-nodes field bus detection and control system is described. Besides, intelligent fault diagnosis technology about some mechatronics integration control systems explored is also involved.

Unraveling the drivers of MERS-CoV transmission

PubMed Central

Cauchemez, Simon; Nouvellet, Pierre; Cori, Anne; Jombart, Thibaut; Clapham, Hannah; Moore, Sean; Mills, Harriet Linden; Salje, Henrik; Collins, Caitlin; Rodriquez-Barraquer, Isabel; Riley, Steven; Truelove, Shaun; Algarni, Homoud; Alhakeem, Rafat; AlHarbi, Khalid; Turkistani, Abdulhafiz; Aguas, Ricardo J.; Cummings, Derek A. T.; Van Kerkhove, Maria D.; Donnelly, Christl A.; Lessler, Justin; Fraser, Christophe; Al-Barrak, Ali; Ferguson, Neil M.

2016-01-01

With more than 1,700 laboratory-confirmed infections, Middle East respiratory syndrome coronavirus (MERS-CoV) remains a significant threat for public health. However, the lack of detailed data on modes of transmission from the animal reservoir and between humans means that the drivers of MERS-CoV epidemics remain poorly characterized. Here, we develop a statistical framework to provide a comprehensive analysis of the transmission patterns underlying the 681 MERS-CoV cases detected in the Kingdom of Saudi Arabia (KSA) between January 2013 and July 2014. We assess how infections from the animal reservoir, the different levels of mixing, and heterogeneities in transmission have contributed to the buildup of MERS-CoV epidemics in KSA. We estimate that 12% [95% credible interval (CI): 9%, 15%] of cases were infected from the reservoir, the rest via human-to-human transmission in clusters (60%; CI: 57%, 63%), within (23%; CI: 20%, 27%), or between (5%; CI: 2%, 8%) regions. The reproduction number at the start of a cluster was 0.45 (CI: 0.33, 0.58) on average, but with large SD (0.53; CI: 0.35, 0.78). It was >1 in 12% (CI: 6%, 18%) of clusters but fell by approximately one-half (47% CI: 34%, 63%) its original value after 10 cases on average. The ongoing exposure of humans to MERS-CoV from the reservoir is of major concern, given the continued risk of substantial outbreaks in health care systems. The approach we present allows the study of infectious disease transmission when data linking cases to each other remain limited and uncertain. PMID:27457935

Phenomenological Partial Specific Volumes for G-Quadruplex DNAs

PubMed Central

Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.

2009-01-01

Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377

Membrane estrogen receptors - is it an alternative way of estrogen action?

PubMed

Soltysik, K; Czekaj, P

2013-04-01

The functions of estrogens are relatively well known, however the molecular mechanism of their action is not clear. The classical pathway of estrogen action is dependent on ERα and ERβ which act as transcription factors. The effects of this pathway occur within hours or days. In addition, so-called, non-classical mechanism of steroid action dependent on membrane estrogen receptors (mER) was described. In this mechanism the effects of estrogen action are observed in a much shorter time. Here we review the structure and cellular localization of mER, molecular basis of non-classical mER action, physiological role of mER as well as implications of mER action for cancer biology. Finally, some concerns about the new estrogen receptor - GPER and candidates for estrogen receptors - ER-X and ERx, are briefly discussed. It seems that mER is a complex containing signal proteins (signalosome), as IGF receptor, EGF receptor, Ras protein, adaptor protein Shc, non-receptor kinase c-Src and PI-3K, what rationalizes production of second messengers. Some features of membrane receptors are almost identical if compared to nuclear receptors. Probably, membrane and nuclear estrogen receptors are not separate units, but rather the components of a complex mechanism in which they both cooperate with each other. We conclude that the image of the estrogen receptor as a simple transcription factor is a far-reaching simplification. A better understanding of the mechanisms of estrogen action will help us to design more effective drugs affecting signal pathways depending on both membrane and nuclear receptors.

KENNEDY SPACE CENTER, FLA. - Workers watch as an overhead crane begins to lift the backshell with the Mars Exploration Rover 1 (MER-1) inside. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers watch as an overhead crane begins to lift the backshell with the Mars Exploration Rover 1 (MER-1) inside. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - A closeup of the cruise stage to be mated to the Mars Exploration Rover 2 (MER-2) entry vehicle. The cruise stage includes fuel tanks, thruster clusters and avionics for steering and propulsion. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch June 5 as MER-A aboard a Delta rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-06

KENNEDY SPACE CENTER, FLA. - A closeup of the cruise stage to be mated to the Mars Exploration Rover 2 (MER-2) entry vehicle. The cruise stage includes fuel tanks, thruster clusters and avionics for steering and propulsion. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch June 5 as MER-A aboard a Delta rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Assembly of the backshell and heat shield surrounding the Mars Exploration Rover 1 (MER-1) is complete. The resulting aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Assembly of the backshell and heat shield surrounding the Mars Exploration Rover 1 (MER-1) is complete. The resulting aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

A Computerized Microelectrode Recording to Magnetic Resonance Imaging Mapping System for Subthalamic Nucleus Deep Brain Stimulation Surgery.

PubMed

Dodani, Sunjay S; Lu, Charles W; Aldridge, J Wayne; Chou, Kelvin L; Patil, Parag G

2018-06-01

Accurate electrode placement is critical to the success of deep brain stimulation (DBS) surgery. Suboptimal targeting may arise from poor initial target localization, frame-based targeting error, or intraoperative brain shift. These uncertainties can make DBS surgery challenging. To develop a computerized system to guide subthalamic nucleus (STN) DBS electrode localization and to estimate the trajectory of intraoperative microelectrode recording (MER) on magnetic resonance (MR) images algorithmically during DBS surgery. Our method is based upon the relationship between the high-frequency band (HFB; 500-2000 Hz) signal from MER and voxel intensity on MR images. The HFB profile along an MER trajectory recorded during surgery is compared to voxel intensity profiles along many potential trajectories in the region of the surgically planned trajectory. From these comparisons of HFB recordings and potential trajectories, an estimate of the MER trajectory is calculated. This calculated trajectory is then compared to actual trajectory, as estimated by postoperative high-resolution computed tomography. We compared 20 planned, calculated, and actual trajectories in 13 patients who underwent STN DBS surgery. Targeting errors for our calculated trajectories (2.33 mm ± 0.2 mm) were significantly less than errors for surgically planned trajectories (2.83 mm ± 0.2 mm; P = .01), improving targeting prediction in 70% of individual cases (14/20). Moreover, in 4 of 4 initial MER trajectories that missed the STN, our method correctly indicated the required direction of targeting adjustment for the DBS lead to intersect the STN. A computer-based algorithm simultaneously utilizing MER and MR information potentially eases electrode localization during STN DBS surgery.

Community case clusters of Middle East respiratory syndrome coronavirus in Hafr Al-Batin, Kingdom of Saudi Arabia: a descriptive genomic study.

PubMed

Memish, Ziad A; Cotten, Matthew; Watson, Simon J; Kellam, Paul; Zumla, Alimuddin; Alhakeem, Rafat F; Assiri, Abdullah; Rabeeah, Abdullah A Al; Al-Tawfiq, Jaffar A

2014-06-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) was first described in September 2012 and to date 86 deaths from a total of 206 cases of MERS-CoV infection have been reported to the WHO. Camels have been implicated as the reservoir of MERS-CoV, but the exact source and mode of transmission for most patients remain unknown. During a 3 month period, June to August 2013, there were 12 positive MERS-CoV cases reported from the Hafr Al-Batin region district in the north east region of the Kingdom of Saudi Arabia. In addition to the different regional camel festivals in neighboring countries, Hafr Al-Batin has the biggest camel market in the entire Kingdom and hosts an annual camel festival. Thus, we conducted a detailed epidemiological, clinical and genomic study to ascertain common exposure and transmission patterns of all cases of MERS-CoV reported from Hafr Al-Batin. Analysis of previously reported genetic data indicated that at least two of the infected contacts could not have been directly infected from the index patient and alternate source should be considered. While camels appear as the likely source, other sources have not been ruled out. More detailed case control studies with detailed case histories, epidemiological information and genomic analysis are being conducted to delineate the missing pieces in the transmission dynamics of MERS-CoV outbreak. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Evaluation of Serologic and Antigenic Relationships Between Middle Eastern Respiratory Syndrome Coronavirus and Other Coronaviruses to Develop Vaccine Platforms for the Rapid Response to Emerging Coronaviruses

PubMed Central

Agnihothram, Sudhakar; Gopal, Robin; Yount, Boyd L.; Donaldson, Eric F.; Menachery, Vineet D.; Graham, Rachel L.; Scobey, Trevor D.; Gralinski, Lisa E.; Denison, Mark R.; Zambon, Maria; Baric, Ralph S.

2014-01-01

Background. Middle East respiratory syndrome coronavirus (MERS-CoV) emerged in 2012, causing severe acute respiratory disease and pneumonia, with 44% mortality among 136 cases to date. Design of vaccines to limit the virus spread or diagnostic tests to track newly emerging strains requires knowledge of antigenic and serologic relationships between MERS-CoV and other CoVs. Methods. Using synthetic genomics and Venezuelan equine encephalitis virus replicons (VRPs) expressing spike and nucleocapsid proteins from MERS-CoV and other human and bat CoVs, we characterize the antigenic responses (using Western blot and enzyme-linked immunosorbent assay) and serologic responses (using neutralization assays) against 2 MERS-CoV isolates in comparison with those of other human and bat CoVs. Results. Serologic and neutralization responses against the spike glycoprotein were primarily strain specific, with a very low level of cross-reactivity within or across subgroups. CoV N proteins within but not across subgroups share cross-reactive epitopes with MERS-CoV isolates. Our findings were validated using a convalescent-phase serum specimen from a patient infected with MERS-CoV (NA 01) and human antiserum against SARS-CoV, human CoV NL63, and human CoV OC43. Conclusions. Vaccine design for emerging CoVs should involve chimeric spike protein containing neutralizing epitopes from multiple virus strains across subgroups to reduce immune pathology, and a diagnostic platform should include a panel of nucleocapsid and spike proteins from phylogenetically distinct CoVs. PMID:24253287

KENNEDY SPACE CENTER, FLA. - Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Rapid generation of a mouse model for Middle East respiratory syndrome

PubMed Central

Zhao, Jincun; Li, Kun; Wohlford-Lenane, Christine; Agnihothram, Sudhakar S.; Fett, Craig; Zhao, Jingxian; Gale, Michael J.; Baric, Ralph S.; Enjuanes, Luis; Gallagher, Tom; McCray, Paul B.; Perlman, Stanley

2014-01-01

In this era of continued emergence of zoonotic virus infections, the rapid development of rodent models represents a critical barrier to public health preparedness, including the testing of antivirus therapy and vaccines. The Middle East respiratory syndrome coronavirus (MERS-CoV) was recently identified as the causative agent of a severe pneumonia. Given the ability of coronavirus to rapidly adapt to new hosts, a major public health concern is that MERS-CoV will further adapt to replication in humans, triggering a pandemic. No small-animal model for this infection is currently available, but studies suggest that virus entry factors can confer virus susceptibility. Here, we show that mice were sensitized to MERS-CoV infection by prior transduction with adenoviral vectors expressing the human host-cell receptor dipeptidyl peptidase 4. Mice developed a pneumonia characterized by extensive inflammatory-cell infiltration with virus clearance occurring 6–8 d after infection. Clinical disease and histopathological changes were more severe in the absence of type-I IFN signaling whereas the T-cell response was required for virus clearance. Using these mice, we demonstrated the efficacy of a therapeutic intervention (poly I:C) and a potential vaccine [Venezuelan equine encephalitis replicon particles expressing MERS-CoV spike protein]. We also found little protective cross-reactivity between MERS-CoV and the severe acute respiratory syndrome-CoV. Our results demonstrate that this system will be useful for MERS-CoV studies and for the rapid development of relevant animal models for emerging respiratory viral infections. PMID:24599590

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Une alternative au cobalt pour la synthese de nanotubes de carbone monoparoi par plasma inductif thermique

NASA Astrophysics Data System (ADS)

Carrier, Jean-Francois

Les nanotubes de carbone de type monoparoi (C-SWNT) sont une classe recente de nanomateriaux qui ont fait leur apparition en 1991. L'interet qu'on leur accorde provient des nombreuses proprietes d'avant-plan qu'ils possedent. Leur resistance mecanique serait des plus rigide, tout comme ils peuvent conduire l'electricite et la chaleur d'une maniere inegalee. Non moins, les C-SWNT promettent de devenir une nouvelle classe de plateforme moleculaire, en servant de site d'attache pour des groupements reactifs. Les promesses de ce type particulier de nanomateriau sont nombreuses, la question aujourd'hui est de comment les realiser. La technologie de synthese par plasma inductif thermique se situe avantageusement pour la qualite de ses produits, sa productivite et les faibles couts d'operation. Par contre, des recherches recentes ont permis de mettre en lumiere des risques d'expositions reliees a l'utilisation du cobalt, comme catalyseur de synthese; son elimination ou bien son remplacement est devenu une preoccupation importante. Quatre recettes alternatives ont ete mises a l'essai afin de trouver une alternative plus securitaire a la recette de base; un melange catalytique ternaire, compose de nickel, de cobalt et d'oxyde d'yttrium. La premiere consiste essentiellement a remplacer la proportion massique de cobalt par du nickel, qui etait deja present dans la recette de base. Les trois options suivantes contiennent de nouveaux catalyseurs, en remplacement au Co, qui sont apparus dans plusieurs recherches scientifiques au courant des dernieres annees: le dioxyde de zircone (ZrO2), dioxyde de manganese (MnO2) et le molybdene (Mo). La methode utilisee consiste a vaporiser la matiere premiere, sous forme solide, dans un reacteur plasma a haute frequence (3 MHz) a paroi refroidi. Apres le passage dans le plasma, le systeme traverse une section dite de "croissance", isolee thermiquement a l'aide de graphite, afin de maintenir une certaine plage de temperature favorable a la synthese de C-SWNT. Le produit final est par la suite recolte sur des filtres metalliques poreux, une fois le systeme mis a l'arret. Dans un premier temps, une analyse thermodynamique, calculee avec le logiciel Fact-Sage, a permis de mettre en lumiere l'etat des differentes produits et reactifs, tout au long de leur passage dans le systeme. Elle a permis de reveler la similitude de composition de la phase liquide du melange catalytique ternaire de base, avec celui du melange binaire, avec nickel et oxyde d'yttrium. Par la suite, une analyse du bilan d'energie, a l'aide d'un systeme d'acquisition de donnees, a permis de determiner que les conditions operatoires des cinq echantillons mis a l'essai etaient similaires. Au total, le produit final a ete caracterise a l'aide de six methodes de caracterisations differentes : l'analyse thermogravimetrique, la diffraction de rayons X, la microscopie electronique a balayage a haute resolution (HRSEM), la microscopie electronique a transmission (MET), la spectroscopie RAMAN, ainsi que la mesure de la surface specifique (BET). Les resultats de ces analyses ont permis de constater, de facon coherente, que le melange a base de molybdene etait celui qui produisait la moins bonne qualite de produit. Ensuite, en ordre croissant, s'en suivait du melange a base de MnO2 et de ZrO2. Le melange de reference, a base de cobalt, est au deuxieme rang en matiere de qualite. La palme revient au melange binaire, dont la proportion est double en nickel. Les resultats de ce travail de recherche permettent d'affirmer qu'il existe une alternative performante au cobalt pour effectuer la synthese de nanotubes de carbone monoparoi, par plasma inductif thermique. Cette alternative est l'utilisation d'un melange catalytique binaire a base de nickel et d'oxyde d'yttrium. Il est suggere que les performances plus faibles des recettes alternatives, moins performantes, pourraient etre expliquees par le profil thermique fixe du reacteur. Ceci pourrait favoriser certains melanges, au detriment des autres, qui possedent des proprietes thermodynamiques differentes. Le montage, l'equipement, ainsi que les parametres d'operations, pourraient etre modifies en fonction de ces catalyseurs afin d'optimiser la synthese. Mots cles : nanotubes de carbone mono paroi, plasma inductif thermique, cobalt, nickel, dioxyde de zirconium, dioxyde de manganese, molybdene, trioxyde d'yttrium et noir de carbone

Strength and Deformability of Light-toned Layered Deposits Observed by MER Opportunity: Eagle to Erebus Craters

NASA Astrophysics Data System (ADS)

Okubo, C. H.; Schultz, R. A.; Nahm, A. L.

2007-07-01

The strength and deformability of light-toned layered deposits are estimated based on measurements of porosity from Microscopic Imager data acquired by MER Opportunity during its traverse from Eagle Crater to Erebus Crater.

First Confirmed Case of Middle East Respiratory Syndrome Coronavirus Infection in the Kingdom of Bahrain: In a Saudi Gentleman after Cardiac Bypass Surgery

PubMed Central

Al-Qahtani, Manaf; Al-Tawfiq, Jaffar A.; Bukamal, Nazar

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is well known to cause severe respiratory infection and was first reported in the Kingdom of Saudi Arabia in 2012. We report here the first confirmed MERS-CoV infection in the Kingdom of Bahrain in a Saudi gentleman who was admitted electively for coronary bypass surgery, postoperatively developed an acute respiratory illness, and tested positive for MERS-CoV. 40 close contacts, all healthcare workers, were traced and followed with no documented secondary cases. PMID:28948054

Planetary Defense. Department of Defense Cost for the Detection, Exploration, and Rendezvous Mission of Near-Earth Objects

DTIC Science & Technology

1997-01-01

or even impact the Earth. In the past 15 years, research on NEOs has dra­ mati cally increased as astrono mers and ge­ olo gists real ize the Earth...fig. 7). In 1989, astrono mers discov ered an aster­ oid labeled 1989FC after its closest approach to Earth. This illus trates a disturb ing fact...Cur rently only astrono mers on shoestring, aca demic budgets are trying to locate and track NEOs, making esti mates of NEO popu­ la tions very impre

Depth-time interpolation of feature trends extracted from mobile microelectrode data with kernel functions.

PubMed

Wong, Stephen; Hargreaves, Eric L; Baltuch, Gordon H; Jaggi, Jurg L; Danish, Shabbar F

2012-01-01

Microelectrode recording (MER) is necessary for precision localization of target structures such as the subthalamic nucleus during deep brain stimulation (DBS) surgery. Attempts to automate this process have produced quantitative temporal trends (feature activity vs. time) extracted from mobile MER data. Our goal was to evaluate computational methods of generating spatial profiles (feature activity vs. depth) from temporal trends that would decouple automated MER localization from the clinical procedure and enhance functional localization in DBS surgery. We evaluated two methods of interpolation (standard vs. kernel) that generated spatial profiles from temporal trends. We compared interpolated spatial profiles to true spatial profiles that were calculated with depth windows, using correlation coefficient analysis. Excellent approximation of true spatial profiles is achieved by interpolation. Kernel-interpolated spatial profiles produced superior correlation coefficient values at optimal kernel widths (r = 0.932-0.940) compared to standard interpolation (r = 0.891). The choice of kernel function and kernel width resulted in trade-offs in smoothing and resolution. Interpolation of feature activity to create spatial profiles from temporal trends is accurate and can standardize and facilitate MER functional localization of subcortical structures. The methods are computationally efficient, enhancing localization without imposing additional constraints on the MER clinical procedure during DBS surgery. Copyright © 2012 S. Karger AG, Basel.

Large-scale machine learning of media outlets for understanding public reactions to nation-wide viral infection outbreaks.

PubMed

Choi, Sungwoon; Lee, Jangho; Kang, Min-Gyu; Min, Hyeyoung; Chang, Yoon-Seok; Yoon, Sungroh

2017-10-01

From May to July 2015, there was a nation-wide outbreak of Middle East respiratory syndrome (MERS) in Korea. MERS is caused by MERS-CoV, an enveloped, positive-sense, single-stranded RNA virus belonging to the family Coronaviridae. Despite expert opinions that the danger of MERS might be exaggerated, there was an overreaction by the public according to the Korean mass media, which led to a noticeable reduction in social and economic activities during the outbreak. To explain this phenomenon, we presumed that machine learning-based analysis of media outlets would be helpful and collected a number of Korean mass media articles and short-text comments produced during the 10-week outbreak. To process and analyze the collected data (over 86 million words in total) effectively, we created a methodology composed of machine-learning and information-theoretic approaches. Our proposal included techniques for extracting emotions from emoticons and Internet slang, which allowed us to significantly (approximately 73%) increase the number of emotion-bearing texts needed for robust sentiment analysis of social media. As a result, we discovered a plausible explanation for the public overreaction to MERS in terms of the interplay between the disease, mass media, and public emotions. Copyright © 2017 Elsevier Inc. All rights reserved.

Lectin Affinity Plasmapheresis for Middle East Respiratory Syndrome-Coronavirus and Marburg Virus Glycoprotein Elimination.

PubMed

Koch, Benjamin; Schult-Dietrich, Patricia; Büttner, Stefan; Dilmaghani, Bijan; Lohmann, Dario; Baer, Patrick C; Dietrich, Ursula; Geiger, Helmut

2018-04-26

Middle East respiratory syndrome coronavirus (MERS-CoV) and Marburg virus (MARV) are among the World Health Organization's top 8 emerging pathogens. Both zoonoses share nonspecific early symptoms, a high lethality rate, and a reduced number of specific treatment options. Therefore, we evaluated extracorporeal virus and glycoprotein (GP) elimination by lectin affinity plasmapheresis (LAP). For both MERS-CoV (pseudovirus) as well as MARV (GPs), 4 LAP devices (Mini Hemopurifiers, Aethlon Medical, San Diego, CA, USA) and 4 negative controls were tested. Samples were collected every 30 min and analyzed for reduction in virus infectivity by a flow cytometry-based infectivity assay (MERS-CoV) and in soluble GP content (MARV) by an immunoassay. The experiments show a time-dependent clearance of MERS-CoV of up to 80% within 3 h (pseudovirus). Up to 70% of MARV-soluble GPs were eliminated at the same time. Substantial saturation of the binding resins was detected within the first treatment hour. MERS-CoV (pseudovirus) and MARV soluble GPs are eliminated by LAP in vitro. Considering the high lethality and missing established treatment options, LAP should be evaluated in vivo. Especially early initiation, continuous therapy, and timed cartridge exchanges could be of importance. The Author(s). Published by S. Karger AG, Basel.

Multi-Agent Modeling and Simulation Approach for Design and Analysis of MER Mission Operations

NASA Technical Reports Server (NTRS)

Seah, Chin; Sierhuis, Maarten; Clancey, William J.

2005-01-01

A space mission operations system is a complex network of human organizations, information and deep-space network systems and spacecraft hardware. As in other organizations, one of the problems in mission operations is managing the relationship of the mission information systems related to how people actually work (practices). Brahms, a multi-agent modeling and simulation tool, was used to model and simulate NASA's Mars Exploration Rover (MER) mission work practice. The objective was to investigate the value of work practice modeling for mission operations design. From spring 2002 until winter 2003, a Brahms modeler participated in mission systems design sessions and operations testing for the MER mission held at Jet Propulsion Laboratory (JPL). He observed how designers interacted with the Brahms tool. This paper discussed mission system designers' reactions to the simulation output during model validation and the presentation of generated work procedures. This project spurred JPL's interest in the Brahms model, but it was never included as part of the formal mission design process. We discuss why this occurred. Subsequently, we used the MER model to develop a future mission operations concept. Team members were reluctant to use the MER model, even though it appeared to be highly relevant to their effort. We describe some of the tool issues we encountered.

Searching for animal models and potential target species for emerging pathogens: Experience gained from Middle East respiratory syndrome (MERS) coronavirus.

PubMed

Vergara-Alert, Júlia; Vidal, Enric; Bensaid, Albert; Segalés, Joaquim

2017-06-01

Emerging and re-emerging pathogens represent a substantial threat to public health, as demonstrated with numerous outbreaks over the past years, including the 2013-2016 outbreak of Ebola virus in western Africa. Coronaviruses are also a threat for humans, as evidenced in 2002/2003 with infection by the severe acute respiratory syndrome coronavirus (SARS-CoV), which caused more than 8000 human infections with 10% fatality rate in 37 countries. Ten years later, a novel human coronavirus (Middle East respiratory syndrome coronavirus, MERS-CoV), associated with severe pneumonia, arose in the Kingdom of Saudi Arabia. Until December 2016, MERS has accounted for more than 1800 cases and 35% fatality rate. Finding an animal model of disease is key to develop vaccines or antivirals against such emerging pathogens and to understand its pathogenesis. Knowledge of the potential role of domestic livestock and other animal species in the transmission of pathogens is of importance to understand the epidemiology of the disease. Little is known about MERS-CoV animal host range. In this paper, experimental data on potential hosts for MERS-CoV is reviewed. Advantages and limitations of different animal models are evaluated in relation to viral pathogenesis and transmission studies. Finally, the relevance of potential new target species is discussed.

Pervasive sequence patents cover the entire human genome.

PubMed

Rosenfeld, Jeffrey A; Mason, Christopher E

2013-01-01

The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.

An exactly solvable model of polymerization

NASA Astrophysics Data System (ADS)

Lushnikov, A. A.

2017-08-01

This paper considers the evolution of a polydisperse polymerizing system comprising g1,g2 … - mers carrying ϕ1,ϕ2 … functional groups reacting with one another and binding the g-mers together. In addition, the g-mers are assumed to be added at random by one at a time with a known rate depending on their mass g and functionality ϕ . Assuming that the rate of binding of two g-mers is proportional to the product of the numbers of nonreacted functional groups the kinetic equation for the distribution of clusters (g-mers) over their mass and functionalities is formulated and then solved by applying the generating function method. In contrast to existing approaches this kinetic equation operates with the efficiencies proportional to the product of the numbers of active functional groups in the clusters rather than to the product of their masses. The evolution process is shown to reveal a phase transition: the emergence of a giant linked cluster (the gel) whose mass is comparable to the total mass of the whole polymerizing system. The time dependence of the moments of the distribution of linked components over their masses and functionalities is investigated. The polymerization process terminates by forming a residual spectrum of sol particles in addition to the gel.

Monocyte and plasma expression of TAM ligand and receptor in renal failure: Links to unregulated immunity and chronic inflammation.

PubMed

Lee, Iris J; Hilliard, Brendan A; Ulas, Mehriban; Yu, Daohai; Vangala, Chandan; Rao, Swati; Lee, Jean; Gadegbeku, Crystal A; Cohen, Philip L

2015-06-01

Chronic inflammation is increased in patients with chronic kidney disease (CKD) and contributes to cardiovascular morbidity and mortality. Specific immune mechanisms and pathways that drive and maintain chronic inflammation in CKD are not well described. The TAM ligands (Gas6 and protein S) and receptors (Axl and Mer) have been recently recognized as playing a prominent role in immune regulation. The receptors exist in both soluble and cell-bound forms; the soluble receptors (sAxl and sMer) are believed to compete with the bound receptors and thus inhibit their function. In this study, we determined the expression of cell-bound and soluble TAM proteins in patients with CKD. CKD patients had significantly lower expression of Mer in monocytes, yet increased expression of soluble TAM receptors sAxl and sMer in plasma compared to controls. The metalloproteinase ADAM 17, responsible for cleavage of Mer to its soluble form, was increased in patient monocytes. Elevated levels of soluble TAM receptors were more evident in patients with progressive renal failure. These observations suggest that functional deficiency of TAM receptor-mediated regulation of inflammation may contribute to chronic inflammation in patients with CKD. Copyright © 2015 Elsevier Inc. All rights reserved.

Length of encapsidated cargo impacts stability and structure of in vitro assembled alphavirus core-like particles

NASA Astrophysics Data System (ADS)

Rayaprolu, Vamseedhar; Moore, Alan; Che-Yen Wang, Joseph; Goh, Boon Chong; Perilla, Juan R.; Zlotnick, Adam; Mukhopadhyay, Suchetana

2017-12-01

In vitro assembly of alphavirus nucleocapsid cores, called core-like particles (CLPs), requires a polyanionic cargo. There are no sequence or structure requirements to encapsidate single-stranded nucleic acid cargo. In this work, we wanted to determine how the length of the cargo impacts the stability and structure of the assembled CLPs. We hypothesized that cargo neutralizes the basic region of the alphavirus capsid protein and if the cargo is long enough, it will also act to scaffold the CP monomers together. Experimentally we found that CLPs encapsidating short 27mer oligonucleotides were less stable than CLPs encapsidating 48mer or 90mer oligonucleotides under different chemical and thermal conditions. Furthermore, cryo-EM studies showed there were structural differences between CLPs assembled with 27mer and 48mer cargo. To mimic the role of the cargo in CLP assembly we made a mutant (4D) where we substituted a cluster of four Lys residues in the CP with four Asp residues. We found that these few amino acid substitutions were enough to initiate CLP assembly in the absence of cargo. The cargo-free 4D CLPs show higher resistance to ionic strength and increased temperature compared to wild-type cargo containing CLPs suggesting their CLP assembly mechanism might also be different.

Modelling of enterobacterial loads to the Baie des Veys (Normandy, France).

PubMed

Lafforgue, Michel; Gerard, Laure; Vieillard, Celine; Breton, Marguerite

2018-06-01

The Baie des Veys (Normandy, France) has abundant stocks of shellfish (oyster and cockle farms). Water quality in the bay is affected by pollutant inputs from a 3500 km 2 watershed and notably occasional episodes of contamination by faecal coliforms. In order to characterise enterobacterial loads and develop a plan of action to improve the quality of seawater and shellfish in the bay, a two-stage modelling procedure was adopted. This focused on Escherichia coli and included a catchment model describing the E. coli releases, and the transport and die-off of this bacteria up to the coast. The output from this model then served as input for a marine model used to determine the concentration of E. coli in seawater. A total 60 scenarios were tested, including different wind, tidal, rainfall and temperature conditions and accidental pollution events, for both current situations and future scenarios. The modelling results highlighted the impact of rainfall on E. coli loadings to the sea, as well as the effects of sluice gates and tidal cycles, which dictated the use of an hourly timescale for the modelling process. The coupled models also made it possible to identify the origin of these enterobacteria as found in shellfish harvesting areas, both in terms of the contributing watercourses and the sources of contamination of those watercourses. The tool can accordingly be used to optimise remedial action. Copyright © 2018 Elsevier GmbH. All rights reserved.

Planning Mars Memory: Learning from the MER Mission

NASA Technical Reports Server (NTRS)

Charlotte, Linde

2004-01-01

This viewgraph presentation discusses ways in which the lessons learned from a mission can be systematically remembered, retained, and applied by individuals and by an organization as a whole. The presentation cites lessons learned from the Mars Exploration Rover (MER) Mission as examples.

The clinical and virological features of the first imported case causing MERS-CoV outbreak in South Korea, 2015.

PubMed

Lee, Ji Yeon; Kim, You-Jin; Chung, Eun Hee; Kim, Dae-Won; Jeong, Ina; Kim, Yeonjae; Yun, Mi-Ran; Kim, Sung Soon; Kim, Gayeon; Joh, Joon-Sung

2017-07-14

In 2015, the largest outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) infection outside the Middle East occurred in South Korea. We summarized the epidemiological, clinical, and laboratory findings of the first Korean case of MERS-CoV and analyzed whole-genome sequences of MERS-CoV derived from the patient. A 68-year-old man developed fever and myalgia 7 days after returning to Korea, following a 10-day trip to the Middle East. Before diagnosis, he visited 4 hospitals, potentially resulting in secondary transmission to 28 patients. On admission to the National Medical Center (day 9, post-onset of clinical illness), he presented with drowsiness, hypoxia, and multiple patchy infiltrations on the chest radiograph. He was intubated (day 12) because of progressive acute respiratory distress syndrome (ARDS) and INF-α2a and ribavirin treatment was commenced. The treatment course was prolonged by superimposed ventilator associated pneumonia. MERS-CoV PCR results converted to negative from day 47 and the patient was discharged (day 137), following rehabilitation therapy. The complete genome sequence obtained from a sputum sample (taken on day 11) showed the highest sequence similarity (99.59%) with the virus from an outbreak in Riyadh, Saudi Arabia, in February 2015. The first case of MERS-CoV infection had high transmissibility and was associated with a severe clinical course. The patient made a successful recovery after early treatment with antiviral agents and adequate supportive care. This first case in South Korea became a super-spreader because of improper infection control measures, rather than variations of the virus.

Ash-plume dynamics and eruption source parameters by infrasound and thermal imagery: The 2010 Eyjafjallajökull eruption

NASA Astrophysics Data System (ADS)

Ripepe, M.; Bonadonna, C.; Folch, A.; Delle Donne, D.; Lacanna, G.; Marchetti, E.; Höskuldsson, A.

2013-03-01

During operational ash-cloud forecasting, prediction of ash concentration and total erupted mass directly depends on the determination of mass eruption rate (MER), which is typically inferred from plume height. Uncertainties for plume heights are large, especially for bent-over plumes in which the ascent dynamics are strongly affected by the surrounding wind field. Here we show how uncertainties can be reduced if MER is derived directly from geophysical observations of source dynamics. The combination of infrasound measurements and thermal camera imagery allows for the infrasonic type of source to be constrained (a dipole in this case) and for the plume exit velocity to be calculated (54-142 m/s) based on the acoustic signal recorded during the 2010 Eyjafjallajökull eruption from 4 to 21 May. Exit velocities are converted into MER using additional information on vent diameter (50±10 m) and mixture density (5.4±1.1 kg/m3), resulting in an average ∼9×105 kg/s MER during the considered period of the eruption. We validate our acoustic-derived MER by using independent measurements of plume heights (Icelandic Meteorological Office radar observations). Acoustically derived MER are converted into plume heights using field-based relationships and a 1D radially averaged buoyant plume theory model using a reconstructed total grain size distribution. We conclude that the use of infrasonic monitoring may lead to important understanding of the plume dynamics and allows for real-time determination of eruption source parameters. This could improve substantially the forecasting of volcano-related hazards, with important implications for civil aviation safety.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Wenfei; Wang, Ying; Wang, Nianshuang

Middle East respiratory syndrome coronavirus (MERS-CoV) infects host cells through binding the receptor binding domain (RBD) on its spike glycoprotein to human receptor dipeptidyl peptidase 4 (hDPP4). Here, we report identification of critical residues on hDPP4 for RBD binding and virus entry through analysis of a panel of hDPP4 mutants. Based on the RBD–hDPP4 crystal structure we reported, the mutated residues were located at the interface between RBD and hDPP4, which potentially changed the polarity, hydrophobic or hydrophilic properties of hDPP4, thereby interfering or disrupting their interaction with RBD. Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay,more » we showed that several residues in hDPP4–RBD binding interface were important on hDPP4–RBD binding and viral entry. These results provide atomic insights into the features of interactions between hDPP4 and MERS-CoV RBD, and also provide potential explanation for cellular and species tropism of MERS-CoV infection. - Highlights: • It has been demonstrated that MERS-CoV infects host cells through binding its envelope spike (S) glycoprotein to the host cellular receptor dipeptidyl peptidase 4 (DPP4). • To identify the critical residues on hDPP4 for RBD binding and virus entry, we constructed a panel of hDPP4 mutants based on structure-guided mutagenesis. • Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay, we showed that several residues on hDPP4 had significant impacts on virus/receptor interactions and viral entry. • Our study has provided new insights into the features of interactions between hDPP4 and MERS-CoV RBD, and provides potential explanation for cellular and species tropism of MERS-CoV infection.« less

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers check the attachment between the backshell (above) and heat shield (below) surrounding the Mars Exploration Rover 1 (MER-1). The aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers check the attachment between the backshell (above) and heat shield (below) surrounding the Mars Exploration Rover 1 (MER-1). The aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Social Big Data Analysis of Information Spread and Perceived Infection Risk During the 2015 Middle East Respiratory Syndrome Outbreak in South Korea.

PubMed

Song, Juyoung; Song, Tae Min; Seo, Dong-Chul; Jin, Dal-Lae; Kim, Jung Sun

2017-01-01

We investigated online diffusion of information, spread of fear, and perceived risk of infection to Middle East Respiratory Syndrome (MERS) as cases of MERS spread rapidly and dozens of fatalities occurred in South Korea in May-June of 2015. This study retrieved 8,671,695 MERS-related online documents from May 20 to June 18, 2015, from 171 Korean online channels and analyzed such documents by using multilevel models and data mining with Apriori algorithm association analysis. We used R software (version 3.2.1) for the association analysis data mining and visualization. Buzz with negative emotions (i.e., anxiety or fear) was more prevalent in online discussion boards, Twitter, and online cafes than news sites and blogs. News buzz (b = 0.21, p < 0.001), but not rumor buzz (b = 0.06, p = 0.308), was associated with positive MERS emotions (i.e., being calm or composed). The mention of eating immunity-boosting food in the news led to a 94 percent chance of a positive MERS emotion and that such a chance of showing a positive emotion was 4.75 times higher than that without such a mention (support of 0.001, confidence of 0.94, and lift of 4.75). Even with the same precautionary messages that were disseminated, they yielded the opposite emotional reactions to people depending on the channel through which the messages were communicated. In the face of a novel and highly contagious disease such as MERS, the government must deploy a response system that includes provision and dissemination of reliable information and inhibits online diffusion of false information.

Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607

NASA Astrophysics Data System (ADS)

Schiering, N.; Kabsch, W.; Moore, M. J.; Distefano, M. D.; Walsh, C. T.; Pai, E. F.

1991-07-01

SEVERAL hundred million tons of toxic mercurials are dispersed in the biosphere1. Microbes can detoxify organo-mercurials and mercury salts through sequential action of two enzymes, organomercury lyase2 and mercuric ion reductase (MerA) 3-5. The latter, a homodimer with homology to the FAD-dependent disulphide oxidoreductases6, catalyses the reaction NADPH + Hg(II) --> NADP+ + H+Hg(0), one of the very rare enzymic reactions with metal substrates. Human glutathione reductase7,8 serves as a reference molecule for FAD-dependent disulphide reductases and between its primary structure9 and that of MerA from Tn501 (Pseudomonas), Tn21 (Shigella), pI258 (Staphylococcus) and Bacillus, 25-30% of the residues have been conserved10,11. All MerAs have a C-terminal extension about 15 residues long but have very varied N termini. Although the enzyme from Streptomyces lividans has no addition, from Pseudomonas aeruginosa Tn5Ol and Bacillus sp. strain RC607 it has one and two copies respectively of a domain of 80-85 residues, highly homologous to MerP, the periplasmic component of proteins encoded by the mer operon11. These domains can be proteolytically cleaved off without changing the catalytic efficiency3. We report here the crystal structure of MerA from the Gram-positive bacterium Bacillus sp. strain RC607. Analysis of its complexes with nicotinamide dinucleotide substrates and the inhibitor Cd(II) reveals how limited structural changes enable an enzyme to accept as substrate what used to be a dangerous inhibitor. Knowledge of the mode of mercury ligation is a prerequisite for understanding this unique detoxification mechanism.

Identification of information types and sources by the public for promoting awareness of Middle East respiratory syndrome coronavirus in Saudi Arabia.

PubMed

Hoda, Jradi

2016-02-01

Middle East Respiratory Syndrome (MERS) is a viral respiratory disease of serious consequences caused by MERS Coronavirus (MERS-CoV). Saudi communities still lack awareness of available protective measures to prevent the transmission of the virus. It is necessary to explore the current information-seeking strategies and preferences for communication tools among the Saudi population to promote dissemination of accurate information. Guided by McGuire's Input-Output Persuasion Model and focusing on input variables (receiver characteristics, sources, message, channel and destination), we explored the current information-seeking strategies and preferences for different communication tools among residents of Riyadh (n = 658). Preferred and sought-after information sources on MERS. Most participants in the sample were female (61.7%), and the majority (98.2%) had internet access at home. The internet was the most commonly used source of information (39.5%) and the most endorsed channel for a MERS awareness campaign. Physicians were the preferred source of information (45.6%), followed by other health care providers (31.3%). In univariate multinomial logistic regression models, males and individuals aged ≤27 years were more likely to seek information from the internet than from physicians. Residents of southern and western Riyadh preferred physicians as a credible source of information over the Ministry of Health. The results of this survey provide valuable information on how to reach this population and for understanding how to launch an effective MERS risk communication campaign in a Saudi population. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Antibiotic and synergistic effect of Leu-Lys rich peptide against antibiotic resistant microorganisms isolated from patients with cholelithiasis.

PubMed

Jeong, Nari; Kim, Jin-Young; Park, Seong-Cheol; Lee, Jong-Kook; Gopal, Ramamourthy; Yoo, Suyeon; Son, Byoung Kwan; Hahm, Joon Soo; Park, Yoonkyung; Hahm, Kyung-Soo

2010-09-03

Pseudomonas aeruginosa has eventually developed resistance against flomoxef sodium, isepamicin and cefpiramide. Therefore, in this study, the antibacterial activity and synergistic effects of the amphipathic-derived P5-18mer antimicrobial peptide were tested against pathogens associated with cholelithiasis that have developed resistance against commonly used antibiotics. The results were then compared with the activities of the amphipathic-derived peptide, P5-18mer, melittin and common antibiotics. Growth inhibition of planktonic bacteria was tested using the National Committee for Clinical Laboratory Standards (NCCLS). The bactericidal activity of the antimicrobial peptides was measured using time-kill curves. Synergistic effects were evaluated by testing the effects of P5-18mer alone and in combination with flomoxef sodium, isepamicin or cefpiramide at 0.5xMIC. P5-18mer peptide displayed strong activity against pathogens and flomoxef sodium, isepamicin and cefpiramide-resistant bacteria cell lines obtained from a patient with gallstones; however, it did not exert cytotoxicity against the human keratinocyte HaCat cell line. In addition, the results of time-kill curves indicated that P5-18mer peptide exerted bactericidal activity against four strains of P. aeruginosa. Finally, the use of P5-18mer and antibiotics exerted synergistic effects against cell lines that were resistant to commonly used antibiotics. These results indicate that this class of peptides has a rapid microbicidal effect on flomoxef sodium, isepamicin and cefpiramide-resistant strains of P. aeruginosa. Therefore, these peptides may be used as a lead drug for the treatment of acquired pathogens from patients with cholelithiasis who are affected with antibiotic-resistant bacteria. Copyright 2010 Elsevier Inc. All rights reserved.

Fluorescence-based characterization of genetically encoded peptides that fold in live cells: progress toward a generic hairpin scaffold

NASA Astrophysics Data System (ADS)

Cheng, Zihao; Campbell, Robert E.

2007-02-01

Binding proteins suitable for expression and high affinity molecular recognition in the cytoplasm or nucleus of live cells have numerous applications in the biological sciences. In an effort to add a new minimal motif to the growing repertoire of validated non-immunoglobulin binding proteins, we have undertaken the development of a generic protein scaffold based on a single β-hairpin that can fold efficiently in the cytoplasm. We have developed a method, based on the measurement of fluorescence resonance energy transfer (FRET) between a genetically fused cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), that allows the structural stability of recombinant β-hairpin peptides to be rapidly assessed both in vitro and in vivo. We have previously reported the validation of this method when applied to a 16mer tryptophan zipper β-hairpin. We now describe the use of this method to evaluate the potential of a designed 20mer β-hairpin peptide with a 3rd Trp/Trp cross-strand pair to function as a generic protein scaffold. Quantitative analysis of the FRET efficiency, resistance to proteolysis (assayed by loss of FRET), and circular dichroism spectra revealed that the 20mer peptide is significantly more tolerant of destabilizing mutations than the 16mer peptide. Furthermore, we experimentally demonstrate that the in vitro determined β-hairpin stabilities are well correlated with in vivo β-hairpin stabilities as determined by FRET measurements of colonies of live bacteria expressing the recombinant peptides flanked by CFP and YFP. Finally, we report on our progress to develop highly folded 24mer and 28mer β-hairpin peptides through the use of fluorescence-based library screening.

Best Practices in Shift Handover Communication: Mars Exploration Rover Surface Operations

NASA Astrophysics Data System (ADS)

Parke, Bonny; Mishkin, Andrew

2005-12-01

During its prime mission, Mars Exploration Rover (MER) had many shift handovers in its surface operations. Because of the increased rates of accidents and errors historically associated with shift handovers, MER Mission management paid close attention to shift handovers and, when possible, developed them in accordance with best handover practices.We review the most important of these best practices, and include a generic "Checklist for Effective Handovers" to aid in the development of handovers.We present charts that depict structured information transfer across shifts. These charts show personnel schedules, meetings attended, handovers, and hand-offs on both the MER and on the earlier Mars Pathfinder Mission (MPF). It is apparent from these charts that although the MER Mission had a much larger number of surface operations personnel than MPF (approximately 300 vs. 178), and had three shifts instead of two, that it used many of the successful MPF communication strategies. Charts such as these can be helpful to those designing complicated and unique mission surface operations.

Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B.

PubMed

Dash, Hirak R; Basu, Subham; Das, Surajit

2017-04-01

Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

Catalysis in prebiotic chemistry RNA synthesis

NASA Astrophysics Data System (ADS)

Ferris, J.; Joshi, P.; Wang, K.; Huang, W.; Miyakawa, S.

It is proposed that catalysis by minerals and metal ions had a central role in the steps that led to the origins of life. In particular, the formation of biopolymers in the presence of water requires catalysis to compete with hydrolytic processes. Catalysis is required to limit the number of isomers generated so that the longer polymers necessary for the origins of life formed. Montmorillonite clay catalyzes the formation of 6 14 mers of RNA from activated monomers of A, G, U and C in- aqueous solution. Daily addition of activated monomers to a 10 mer primer results in the formation of 40-50 mers of adenylic acid and 30 mers of uridylic acid. The sequence selectivity and regioselectivity in phosphodiester bond formation results from the montmorillonite catalysis. Reaction of D, L-activated monomers of A and U leads to the preferential formation of homochiral dimers (eg. D, D and L, L-- pApA). These data and any more recent developments will be discussed.

When Information from Public Health Officials is Untrustworthy: The Use of Online News, Interpersonal Networks, and Social Media during the MERS Outbreak in South Korea.

PubMed

Jang, Kyungeun; Baek, Young Min

2018-03-20

Public health officials (PHOs) are responsible for providing trustworthy information during a public health crisis; however, there is little research on how the public behaves when their expectations for such information are violated. Drawing on media dependency theory and source credibility research as our primary theoretical framework, we tested how credibility of information from PHOs is associated with people's reliance on a particular communication channel in the context of the 2015 Middle East Respiratory Syndrome (MERS) outbreak in South Korea. Using nationally representative data (N = 1036) collected during the MERS outbreak, we found that less credible information from PHOs led to more frequent use of online news, interpersonal networks, and social media for acquiring MERS-related information. However, credibility of information from PHOs was not associated with the use of television news or print newspapers. The theoretical and practical implications of our results on communication channels usage are discussed.

Recombination Proteins Mediate Meiotic Spatial Chromosome Organization and Pairing

PubMed Central

Storlazzi, Aurora; Gargano, Silvana; Ruprich-Robert, Gwenael; Falque, Matthieu; David, Michelle; Kleckner, Nancy; Zickler, Denise

2010-01-01

SUMMARY Meiotic chromosome pairing involves not only recognition of homology but also juxtaposition of entire chromosomes in a topologically regular way. Analysis of filamentous fungus Sordaria macrospora reveals that recombination proteins Mer3, Msh4 and Mlh1 play direct roles in all of these aspects, in advance of their known roles in recombination. Absence of Mer3 helicase results in interwoven chromosomes, thereby revealing the existence of features that specifically ensure “entanglement avoidance”. Entanglements that remain at zygotene, i.e. “interlockings”, require Mlh1 for resolution, likely to eliminate constraining recombinational connections. Patterns of Mer3 and Msh4 foci along aligned chromosomes show that the double-strand breaks mediating homologous alignment have spatially separated ends, one localized to each partner axis, and that pairing involves interference among developing interhomolog interactions. We propose that Mer3, Msh4 and Mlh1 execute all of these roles during pairing by modulating the state of nascent double-strand break/partner DNA contacts within axis-associated recombination complexes. PMID:20371348

Overview of preparedness and response for Middle East respiratory syndrome coronavirus (MERS-CoV) in Oman.

PubMed

Al-Abaidani, I S; Al-Maani, A S; Al-Kindi, H S; Al-Jardani, A K; Abdel-Hady, D M; Zayed, B E; Al-Harthy, K S; Al-Shaqsi, K H; Al-Abri, S S

2014-12-01

Several countries in the Middle East and around 22 countries worldwide have reported cases of human infection with the Middle East respiratory syndrome coronavirus (MERS-CoV). The exceptionally high fatality rate resulting from MERS-CoV infection in conjunction with the paucity of knowledge about this emerging virus has led to major public and international concern. Within the framework of the national acute respiratory illness surveillance, the Ministry of Health in the Sultanate of Oman has announced two confirmed cases of MERS-CoV to date. The aim of this report is to describe the epidemiological aspects of these two cases and to highlight the importance of public health preparedness and response. The absence of secondary cases among contacts of the reported cases can be seen as evidence of the effectiveness of infection prevention and control precautions as an important pillar of the national preparedness and response plan applied in the health care institutions in Oman. Copyright © 2014. Published by Elsevier Ltd.

Isotopic micro generators 1 volt; Les microgenerateurs radioisotopiques 1 volt (in French)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bomal, R.; Devin, B.; Delaquaize, P.

1969-07-01

Various configurations for electrical isotopic generators in the milliwatt range are investigated; these generators are not of the classical thermoelectric type. The four following energy conversion method are examined : thermionic, thermo-photovoltaic, radio-voltaic, wired thermoelectric. The calculus has been conducted having in view not the best energy conversion efficiency, but the need to attain directly 1 volt output voltage. High temperature {sup 238}Pu sources (T above 1000 ) are isolated by multi layer thermal insulation material of the Moly/Alumina type. Optimised application is given for number 1 and 2 here above. Thermionic is interesting by its compactness and Wired-thermoelectric ismore » cheap, simple and rugged. Both method do not allow to extend output voltage range far above 1 volt. TPV and RV, can be designed for multi volt application. Radio-voltaic is 1 per cent efficient but irradiation defects in the semiconductor induced by high energy radiations can strongly limit the lifetime of the generator. Isotope sources technology is the determining factor for these micro generators. (author) [French] Cette etude examine les types de generateurs electriques realisables a partir de sources isotopiques en dehors du procede thermoelectrique classique. Les quatre procedes suivants sont examines: thermoionique, thermophoto-voltaique, radiovoltaique, thermoelectrique a fils. Les calculs sont conduits sans souci exagere du rendement de conversion pour aboutir a une puissance electrique delivree de 0,2 a 1 mW sous une tension au moins egale a 1 volt. Le probleme des sources thermiques de {sup 238}Pu a haute temperature (T > 1000 C) est resolu avec une isolation a structure multi-couche moly-alumine. L'optimalisation est calculee en vue d'une utilisation dans les procedes 1 et 2. Le procede 1 est interessant par sa compacite et le procede 4 par sa simplicite, sa robustesse et son prix de revient; mais avec ces deux generateurs on ne peut obtenir plus d'un volt en charge. Les procedes 2 et 3 peuvent delivrer des tensions de plusieurs volts. Le radiovoltaique donne des rendements de 1 pour cent, mais la creation de defauts dans le reseau cristallin du semiconducteur avec les particules de grande energie peut limiter son utilisation. Les performances de ces differents modes de conversion sont conditionnees avant tout par les technologies des sources isotopiques. (auteur)« less

Analyse des interactions energetiques entre un arena et son systeme de refrigeration

NASA Astrophysics Data System (ADS)

Seghouani, Lotfi

La presente these s'inscrit dans le cadre d'un projet strategique sur les arenas finance par le CRSNG (Conseil de Recherche en Sciences Naturelles et en Genie du Canada) qui a pour but principal le developpement d'un outil numerique capable d'estimer et d'optimiser la consommation d'energie dans les arenas et curlings. Notre travail s'inscrit comme une suite a un travail deja realise par DAOUD et coll. (2006, 2007) qui a developpe un modele 3D (AIM) en regime transitoire de l'arena Camilien Houde a Montreal et qui calcule les flux de chaleur a travers l'enveloppe du batiment ainsi que les distributions de temperatures et d'humidite durant une annee meteorologique typique. En particulier, il calcule les flux de chaleur a travers la couche de glace dus a la convection, la radiation et la condensation. Dans un premier temps nous avons developpe un modele de la structure sous la glace (BIM) qui tient compte de sa geometrie 3D, des differentes couches, de l'effet transitoire, des gains de chaleur du sol en dessous et autour de l'arena etudie ainsi que de la temperature d'entree de la saumure dans la dalle de beton. Par la suite le BIM a ete couple le AIM. Dans la deuxieme etape, nous avons developpe un modele du systeme de refrigeration (REFSYS) en regime quasi-permanent pour l'arena etudie sur la base d'une combinaison de relations thermodynamiques, de correlations de transfert de chaleur et de relations elaborees a partir de donnees disponibles dans le catalogue du manufacturier. Enfin le couplage final entre l'AIM +BIM et le REFSYS a ete effectue sous l'interface du logiciel TRNSYS. Plusieurs etudes parametriques on ete entreprises pour evaluer les effets du climat, de la temperature de la saumure, de l'epaisseur de la glace, etc. sur la consommation energetique de l'arena. Aussi, quelques strategies pour diminuer cette consommation ont ete etudiees. Le considerable potentiel de recuperation de chaleur au niveau des condenseurs qui peut reduire l'energie requise par le systeme de ventilation de l'arena a ete mis en evidence. Mots cles. Arena, Systeme de refrigeration, Consommation d'energie, Efficacite energetique, Conduction au sol, Performance annuelle.

The Main Ethiopian Rift: a Narrow Rift in a Hot Craton?

NASA Astrophysics Data System (ADS)

Gashawbeza, E.; Keranen, K.; Klemperer, S.; Lawrence, J.

2008-12-01

The Main Ethiopian Rift (MER) is a classic example of a narrow rift, but a synthesis of our results from the EAGLE (Ethiopia-Afar Geoscientific Lithospheric Experiment Phase I broadband experiment) and from the EBSE experiment (Ethiopia Broadband Seismic Experiment) suggests the MER formed in thin, hot, weak continental lithosphere, in strong contrast with predictions of the Buck model of modes of continental lithospheric extension. Our joint inversion of receiver functions and Rayleigh-wave group velocities yields shear-wave velocities of the lowermost crust and uppermost mantle across the MER and the Ethiopian Plateau that are significantly lower than the equivalent velocities in the Eastern and Western branches of the East African Rift System. The very low shear-wave velocities, high electrical conductivity in the lower-crust, and high shear-wave splitting delay times beneath a very broad region of the MER and the Ethiopian Plateau indicate that the lower-crust is hot and likely contains partial melt. Our S-receiver function data demonstrate shallowing of the lithosphere-asthenosphere boundary from 90 km beneath the northwestern Ethiopian Plateau to 60 km beneath the MER. Although we lack good spatial resolution on the lithosphere-asthenosphere boundary, the region of thinned lithosphere may be intermediate in width between the narrow surface rift (< 100 km) and the broader zone of strain in the lower crust (~ 300 km). The MER developed as a narrow rift at the surface, localized along the Neoproterozoic suture that joined East and West Gondwana. However, a far broader of lower crust and uppermost mantle remains thermally weakened since the Oligocene formation of the flood basalts by the Afar plume head. If the lithosphere- asthenosphere boundary is indeed a strain marker then lithospheric mantle deformation is localized beneath the surface rift. The development of both the Eastern/Western branches of the East African Rift System to the south and of the MER in the north as narrow rifts, despite vastly different lithospheric strength profiles, indicates that inherited structure, rather than rheological stratification, is the primary control on the mode of extension in these continental rifts.

Probing the mer- to fac-isomerization of tris-cyclometallated homo- and heteroleptic (C,N)3 iridium(III) complexes.

PubMed

McDonald, Aidan R; Lutz, Martin; von Chrzanowski, Lars S; van Klink, Gerard P M; Spek, Anthony L; van Koten, Gerard

2008-08-04

We have developed techniques which allow for covalent tethering, via a "hetero" cyclometallating ligand, of heteroleptic tris-cyclometallated iridium(III) complexes to polymeric supports (for application in light-emitting diode technologies). This involved the selective synthesis and thorough characterization of heteroleptic [Ir(C,N) 2(C',N')] tris-cyclometallated iridium(III) complexes. Furthermore, the synthesis and characterization of heteroleptic [Ir(C,N) 2OR] complexes is presented. Under standard thermal conditions for the synthesis of the facial ( fac) isomer of tris-cyclometallated complexes, it was not possible to synthesize pure heteroleptic complexes of the form [Ir(C,N) 2(C',N')]. Instead, a mixture of homo- and heteroleptic complexes was acquired. It was found that a stepwise procedure involving the synthesis of a pure meridonial ( mer) isomer followed by photochemical isomerization of this mer to the fac isomer was necessary to synthesize pure fac-[Ir(C,N) 2(C',N')] complexes. Under thermal isomerization conditions, the conversion of mer-[Ir(C,N) 2(C',N')] to fac-[Ir(C,N) 2(C',N')] was also not a clean reaction, with again a mixture of homo- and heteroleptic complexes acquired. An investigation into the thermal mer to fac isomerization of both homo- and heteroleptic tris-cyclometallated complexes is presented. It was found that the process is an alcohol-catalyzed reaction with the formation of an iridium alkoxide [Ir(C,N) 2OR] intermediate in the isomerization process. This catalyzed reaction can be carried out between 50 and 100 degrees C, the first such example of low-temperature mer-fac thermal isomerization. We have synthesized analogous complexes and have shown that they do indeed react so as to give fac-tris-cyclometallated products. A detailed explanation of the intermediates (and all of their stereoisomers, in particular when systems of the generic formula [M(a,b) 2(a',b')] are synthesized) formed in the mer to fac isomerization process is presented, including how the formed intermediates react further, and the stereoisomeric products they yield.

Mars Exploration Rover (MER) aeroshell

NASA Image and Video Library

2003-01-31

In the Payload Hazardous Servicing Facility, workers prepare the Mars Exploration Rover (MER) aeroshell for transfer to a rotation stand. Set to launch in 2003, the MER Mission will consist of two identical rovers designed to cover roughly 110 yards (100 meters) each Martian day. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. The rovers will be identical to each other, but will land at different regions of Mars. The first rover has a launch window opening May 30, and the second rover a window opening June 25, 2003.

The Ballerina Experiment on the Rømer Mission

NASA Astrophysics Data System (ADS)

Brandt, Soren

The Rømer mission has recently been approved as the next mission within the Danish Small Satellite Program. The scientific payload will consist of two separate experiments, the MONS and the Ballerina payloads. The primary objective of Ballerina is to provide accurate, real-time positions relayed to ground for ~ 70 Gamma Ray Bursts (GRBs) per year, and to study the temporal and spectral evolution of the early GRB X-ray afterglow. As an additional goal, Ballerina will detect and study bright X-ray transients, in particular X-ray novae and micro-quasar systems. R{\\o}mer is currently scheduled for launch in late 2003.

Activity of Antimicrobial Combinations against KPC-2-Producing Klebsiella pneumoniae in a Rat Model and Time-Kill Assay

PubMed Central

Aranha Junior, Ayrton Alves; Arend, Lavinia Nery; Ribeiro, Vanessa; Zavascki, Alexandre Prehn; Tuon, Felipe Francisco

2015-01-01

This study evaluated the efficacy of tigecycline (TIG), polymyxin B (PMB), and meropenem (MER) in 80 rats challenged with Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae infection. A time-kill assay was performed with the same strain. Triple therapy and PMB+TIG were synergistic, promoted 100% survival, and produced negative peritoneal cultures, while MER+TIG showed lower survival and higher culture positivity than other regimens (P = 0.018) and was antagonistic. In vivo and in vitro studies showed that combined regimens, except MER+TIG, were more effective than monotherapies for this KPC-producing strain. PMID:25896686

21 CFR 177.1040 - Acrylonitrile/styrene copoly-mer.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Acrylonitrile/styrene copoly-mer. 177.1040 Section 177.1040 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Internal Standard Method”; “Infrared Spectrophotometric Determination of Polymer Extracted from Barex 210...

Detection and full genome characterization of two beta CoV viruses related to Middle East respiratory syndrome from bats in Italy.

PubMed

Moreno, Ana; Lelli, Davide; de Sabato, Luca; Zaccaria, Guendalina; Boni, Arianna; Sozzi, Enrica; Prosperi, Alice; Lavazza, Antonio; Cella, Eleonora; Castrucci, Maria Rita; Ciccozzi, Massimo; Vaccari, Gabriele

2017-12-19

Middle East respiratory syndrome coronavirus (MERS-CoV), which belongs to beta group of coronavirus, can infect multiple host species and causes severe diseases in humans. Multiple surveillance and phylogenetic studies suggest a bat origin. In this study, we describe the detection and full genome characterization of two CoVs closely related to MERS-CoV from two Italian bats, Pipistrellus kuhlii and Hypsugo savii. Pool of viscera were tested by a pan-coronavirus RT-PCR. Virus isolation was attempted by inoculation in different cell lines. Full genome sequencing was performed using the Ion Torrent platform and phylogenetic trees were performed using IQtree software. Similarity plots of CoV clade c genomes were generated by using SSE v1.2. The three dimensional macromolecular structure (3DMMS) of the receptor binding domain (RBD) in the S protein was predicted by sequence-homology method using the protein data bank (PDB). Both samples resulted positive to the pan-coronavirus RT-PCR (IT-batCoVs) and their genome organization showed identical pattern of MERS CoV. Phylogenetic analysis showed a monophyletic group placed in the Beta2c clade formed by MERS-CoV sequences originating from humans and camels and bat-related sequences from Africa, Italy and China. The comparison of the secondary and 3DMMS of the RBD of IT-batCoVs with MERS, HKU4 and HKU5 bat sequences showed two aa deletions located in a region corresponding to the external subdomain of MERS-RBD in IT-batCoV and HKU5 RBDs. This study reported two beta CoVs closely related to MERS that were obtained from two bats belonging to two commonly recorded species in Italy (P. kuhlii and H. savii). The analysis of the RBD showed similar structure in IT-batCoVs and HKU5 respect to HKU4 sequences. Since the RBD domain of HKU4 but not HKU5 can bind to the human DPP4 receptor for MERS-CoV, it is possible to suggest also for IT-batCoVs the absence of DPP4-binding potential. More surveillance studies are needed to better investigate the potential intermediate hosts that may play a role in the interspecies transmission of known and currently unknown coronaviruses with particular attention to the S protein and the receptor specificity and binding affinity.

A systematic investigation of aluminium ion speciation at high temperature. Part 1. Solution studies.

PubMed

Shafran, Kirill L; Perry, Carole C

2005-06-21

Speciation diagrams of aluminium ions in aqueous solution (0.2 M) at high temperature (90 degrees C) have been obtained from 48 h time-resolved multi-batch titration experiments monitored by 27Al NMR spectroscopy, potentiometry and dynamic light scattering. The quantitative speciation patterns and kinetic data obtained offer a dynamic picture of the distribution of soluble and insoluble Al species as a function of hydrolysis ratio h(h=[OH-]/[Al3+]) over a very broad range of conditions (-1.0 < or =h < or = 4.0). Monomeric, small oligomeric, tridecameric (the 'Al13-mer') and the recently characterised 30-meric aluminium species (the 'Al30-mer') as well as aluminium hydroxide have been identified and quantified. The Al13-mer species dominates over a relatively broad range of hydrolysis ratios (1.5 < or =h< or = 2.7) during the first 6 h of experiment, but are gradually replaced by Al30-mers at longer reaction times. Kinetic profiles indicate that the formation of the Al30-mer is limited by the disappearance of the Al13 species at mildly acidic conditions. The estimated rate constants of both hydrolytic processes show good internal correlation at h> or = 1.5. The effect of local perturbations leading to the formation of aluminium hydroxide below the electroneutrality point (h= 3.0) has been estimated quantitatively.

Molecular events during the early stages of aggregation of GNNQQNY: An all atom MD simulation study of randomly dispersed peptides.

PubMed

Srivastava, Alka; Balaji, Petety V

2015-12-01

This study probes the early events during lag phase of aggregation of GNNQQNY using all atom MD simulations in explicit solvent. Simulations were performed by varying system size, temperature and starting configuration. Peptides dispersed randomly in the simulation box come together early on in the simulation and form aggregates. These aggregates are dynamic implying the absence of stabilizing interactions. This facilitates the exploration of alternate arrangements. The constituent peptides sample a variety of conformations, frequently re-orient and re-arrange with respect to each other and dissociate from/re-associate with the aggregate. The size and lifetime of aggregates vary depending upon the number of inter-peptide backbone H-bonds. Most of the aggregates formed are amorphous but crystalline aggregates of smaller size (mainly 2-mers) do appear and sustain for varying durations of time. The peptides in crystalline 2-mers are mostly anti-parallel. The largest crystalline aggregate that appears is a 4-mer in a single sheet and a 4-, 5-, or 6-mer in double layered arrangement. Crystalline aggregates grow either by the sequential addition of peptides, or by the head-on or lateral collision-adhesion of 2-mers. The formation of various smaller aggregates suggests the polymorphic nature of oligomers and heterogeneity in the lag phase. Copyright © 2015 Elsevier Inc. All rights reserved.

The role of gut microbiota in fetal methylmercury exposure: Insights from a pilot study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothenberg, Sarah E.; Keiser, Sharon; Ajami, Nadim J.

The mechanisms by which gut microbiota contribute to methylmercury metabolism remain unclear. Among a cohort of pregnant mothers, the main objectives of our pilot study were to determine 1) associations between gut microbiota and mercury concentrations in biomarkers (stool, hair and cord blood) and 2) the contributions of gut microbial mercury methylation/demethylation to stool methylmercury. Moreover, for pregnant women (36-39 weeks gestation, n=17) donated hair and stool specimens, and cord blood was collected for a subset (n=7). The diversity of gut microbiota was determined using 16S rRNA gene profiling (n=17). For 6 stool samples with highest/lowest methylmercury concentrations, metagenomic wholemore » genome shotgun sequencing was employed to search for one mercury methylation gene (hgcA), and two mer operon genes involved in methylmercury detoxification (merA and merB). There were seventeen bacterial genera that were significantly correlated (increasing or decreasing) with stool methylmercury, stool inorganic mercury, or hair total mercury; however, aside from one genus, there was no overlap between biomarkers. No definitive matches for hgcA or merB, while merA were detected at low concentrations in all six samples. Proportional differences in stool methylmercury were not likely attributed to gut microbiota through methylation/demethylation. Gut microbiota potentially altered methylmercury metabolism using indirect pathways.« less