Science.gov

Sample records for mercaptoethanol

  1. Replacing β-mercaptoethanol in RNA extractions.

    PubMed

    Mommaerts, Kathleen; Sanchez, Ignacio; Betsou, Fay; Mathieson, William

    2015-06-15

    RNA extractions are potentially compromised in terms of both yield and quality by ribonucleases (RNases). The pungent and toxic reducing agent β-mercaptoethanol (β-ME), therefore, is commonly added to the biospecimen's lysis buffer to aid in RNase deactivation. Using different tissue types (liver tissue, kidney tissue, and cell pellets), extraction kits (RNeasy Mini Kit, Illustra RNA Spin Mini Kit, and PureLink Mini Kit), RNA quality assays (RNA integrity numbers [RINs] and quantitative real-time polymerase chain reaction [qRT-PCR]), yield assessments, and in vitro functional RNase assays (RNaseAlert Kit), we demonstrate that β-ME should be replaced by the less toxic dithiothreitol (DTT) alternative.

  2. Thermoluminescence of mercaptoethanol-capped ZnS:Mn nanoparticles.

    PubMed

    Sharma, Ravi; Bisen, D P

    2015-03-01

    The thermoluminescence (TL) of nanoparticles has become a matter of keen interest in recent times but is rarely reported. This article reports the synthesis of ZnS:Mn nanocrystals using a chemical route, with mercaptoethanol (ME) as the capping agent. The particle sizes for the nanocrystals were measured by X-ray diffraction (XRD) and also by studying transmission electron microscopy (TEM) patterns. The particle sizes of the synthesized samples were found to be between 1 and 3 nm. For samples with different concentrations of the capping agent, it was found that the TL intensity of the ZnS:Mn nanoparticles increased as the particle size decreased. A shift in the peak position of the TL glow curve was also seen with decreasing particle size. The TL intensity was found to be maximal for samples with 1.2% of Mn. A change in the peak position was not found for samples with different concentrations of Mn. The half-width glow peak curve method was used to determine the trap-depth. The frequency factor of the synthesized samples was also calculated. The stability of the charge carriers in the traps increases with decreasing nanoparticle size. The higher stability may be attributed to the higher surface/volume ratio and also to the increase in the trap-depth with decreasing particle size.

  3. Stabilizing the urinary activity of fructose-1,6-bisphosphatase with EDTA and mercaptoethanol.

    PubMed

    Kepka, Alina; Szajda, Sławomir Dariusz; Waszkiewicz, Napoleon; Zalewska, Anna; Płudowski, Paweł; Zwierz-Gugała, Dorota; Zalewska-Szajda, Beata; Borzym-Kluczyk, Małgorzata; Kryśkiewicz, Edyta; Zwierz, Krzysztof

    2009-09-01

    The study aim was to establish conditions for stabilization the activity of fructose-1,6-bisphosphatase (FBP-1) in stored urine. The FBP-1 was determined by the method Kepka et. al in a collected fraction of purified urine. EDTA and mercaptoethanol stabilized FBP-1 activity in stored urine. At optimal conditions urine may be stored up to 7 days at a temperature of 4 degrees C.

  4. Stress lowers the detection threshold for foul-smelling 2-mercaptoethanol.

    PubMed

    Pacharra, Marlene; Schäper, Michael; Kleinbeck, Stefan; Blaszkewicz, Meinolf; Wolf, Oliver T; van Thriel, Christoph

    2016-01-01

    Previous studies have reported enhanced vigilance for threat-related information in response to acute stress. While it is known that acute stress modulates sensory systems in humans, its impact on olfaction and the olfactory detection of potential threats is less clear. Two psychophysical experiments examined, if acute stress lowers the detection threshold for foul-smelling 2-mercaptoethanol. Participants in Experiment 1 (N = 30) and Experiment 2 (N = 32) were randomly allocated to a control group or a stress group. Participants in the stress group underwent a purely psychosocial stressor (public mental arithmetic) in Experiment 1 and a stressor that combined a physically demanding task with social-evaluative threat in Experiment 2 (socially evaluated cold-pressor test). In both experiments, olfactory detection thresholds were repeatedly assessed by means of dynamic dilution olfactometry. Each threshold measurement consisted of three trials conducted using an ascending method of limits. Participants in the stress groups showed the expected changes in heart rate, salivary cortisol, and mood measures in response to stress. About 20 min after the stressor, participants in the stress groups could detect 2-mercaptoethanol at a lower concentration than participants in the corresponding control groups. Our results show that acute stress lowers the detection threshold for a malodor.

  5. Mechanism of augmentation of the antibody response in vitro by 2-mercaptoethanol in murine lymphocytes. II. A major role of the mixed disulfide between 2-mercaptoethanol and cysteine.

    PubMed

    Ohmori, H; Yamamoto, I

    1983-07-01

    Five thiol compounds including 2-mercaptoethanol (2-ME) were examined for their augmenting effects on in vitro antibody response to sheep erythrocytes. Three compounds were effective with the following order of activity; 2-ME greater than dithiothreitol greater than cysteamine. Glutathione and thioglycollate failed to enhance the response. The same order or effectiveness was seen in the stimulation of [35S]cystine uptake by murine lymphocytes by these thiols. Murine lymphocytes took up cysteine five to six times more rapidly than cystine. It is, however, unlikely that 2-ME stimulation of cystine uptake is solely due to the reduction of cystine into cysteine, because 2-ME was still stimulatory after free thiol groups had disappeared in the medium containing 2-ME and [35S]cystine. The mixed disulfide of cysteine with 2-ME (Cys-2-ME) was found to be an only product after free thiols had been oxidized. [35S]Cys-2-ME was taken up by the lymphocytes with a comparable rate to cysteine via a transport system common to that of leucine and phenylalanine. Cysteine was, however, transported via a different route. It was observed that Cys-2-ME was readily metabolized to cysteine and glutathione after the uptake. Cys-2-ME added to cystine-free RPMI 1640 medium could support the antibody response as efficiently as cystine plus 2-ME. These observations strongly suggest that 2-Me stimulates cystine uptake and, therefore, enhances the antibody response through the formation of the mixed disulfide with cysteine.

  6. Mechanism of augmentation of the antibody response in vitro by 2-mercaptoethanol in murine lymphocytes. II. A major role of the mixed disulfide between 2-mercaptoethanol and cysteine

    SciTech Connect

    Ohmori, H.; Yamamoto, I.

    1983-07-01

    Five thiol compounds including 2-mercaptoethanol (2-ME) were examined for their augmenting effects on in vitro antibody response to sheep erythrocytes. Three compounds were effective with the following order of activity; 2-ME greater than dithiothreitol greater than cysteamine. Glutathione and thioglycollate failed to enhance the response. The same order or effectiveness was seen in the stimulation of (/sup 35/S)cystine uptake by murine lymphocytes by these thiols. Murine lymphocytes took up cysteine five to six times more rapidly than cystine. It is, however, unlikely that 2-ME stimulation of cystine uptake is solely due to the reduction of cystine into cysteine, because 2-ME was still stimulatory after free thiol groups had disappeared in the medium containing 2-ME and (/sup 35/S)cystine. The mixed disulfide of cysteine with 2-ME (Cys-2-ME) was found to be an only product after free thiols had been oxidized. (/sup 35/S)Cys-2-ME was taken up by the lymphocytes with a comparable rate to cysteine via a transport system common to that of leucine and phenylalanine. Cysteine was, however, transported via a different route. It was observed that Cys-2-ME was readily metabolized to cysteine and glutathione after the uptake. Cys-2-ME added to cystine-free RPMI 1640 medium could support the antibody response as efficiently as cystine plus 2-ME. These observations strongly suggest that 2-Me stimulates cystine uptake and, therefore, enhances the antibody response through the formation of the mixed disulfide with cysteine.

  7. Aminopeptidase activity in rat brain synaptosomes - 2-mercaptoethanol stimulation and Arg-vasopressin degradation

    SciTech Connect

    Simmons, W.H.; Orawski, A.T.

    1986-03-05

    Rat brain synaptic plasma membranes contain an amastatin-inhibited aminopeptidase activity which degrades Arg-vaso-pressin (AVP). The pH optimum for AVP cleavage was found to be 6.8, similar to that reported for oxytocin. The ability of other peptides and arylamides such as oxytocin, Tyr-Phe-Met-Arg-Phe-NH/sub 2/ and Arg-Arg-..beta..NA to inhibit cleavage of (/sup 3/H-Tyr/sup 2/)-AVP suggests that the enzyme may not be specific for AVP. The AVP-cleaving activity has been solubilized and partially characterized. Synaptosomes were lysed with hypotonic buffer, washed, and extracted with 1% Nonidet P-40 detergent. The solubilized protein was chromatographed by gel filtration HPLC on Superose 6. A single peak of activity was found with a M.W. = 117,000 which could hydrolyze 1mM Ala-..beta..NA, Arg-..beta..NA, Arg-Arg-..beta..NA, Phe-Met and Phe-Arg as well as slowly cleave AVP with the ultimate release of /sup 3/H-Tyr. 2-Mercaptoethanol (3.9mM) (ME) stimulated activity 3.6 to 6.6-fold for arylamide and dipeptide substrates, but 35-fold for labelled AVP, possibly owing to reduction of the AVP disulfide bond. All activities in the presence of ME were completely inhibited by 0.2mM amastatin.

  8. Effect of Antioxidants (β-mercaptoethanol and Cysteamine) on Assisted Reproductive Technology In vitro

    PubMed Central

    Nikseresht, Mohsen; Toori, Mehdi Akbartabar; Rahimi, Hamid Reza; Fallahzadeh, Ali Reza; Kahshani, Iraj Ragerdi; Hashemi, Seyedeh Fatemeh; Bahrami, Solmaz

    2017-01-01

    Introduction Oocyte Culture of Germinal Vesicle (GV) and its growth improves Assisted Reproductive Technology (ART) invitro and infertility. Inappropriate culture medium environment, low quality of oocytes, increase in Oxidative Stress (OS) events, Reactive Oxygen Species (ROS) and free radicals production are the main factors that result in unsuccessful Invitro Maturation (IVM) and decrease in reproduction. Aim The present study was conducted with the aim to evaluate the effect of β-mercaptoethanol (BME) and Cysteamine (CYS) on IVM improvement, embryo fertilization and development of blastocyst of mouse immature oocyte. Materials and Methods Oocytes were obtained from 4-6 weeks old Naval Medical Research Institute (NMRI) female mice, 48 hours after stimulation with Intraperitoneal (IP) injection of 10 IU Pregnant Mare Serum Gonadotropin (PMSG). GV oocyte with and without cumulus cells were isolated from ovaries and cultured in Tissue Culture Medium (TCM) 199 with availability of 100 μM of antioxidants (BME and CYS). After 24 hours, mature oocyte in metaphase II (MII) were fertilized with sperm in In vitro Fertilization (IVF) medium (T6) and evaluated for fetal development into blastocyst. Results BME and CYS could significantly (p<0.05) increase the rate of IVM and oocyte evolution, and embryo formation in medium culture. Furthermore, it is demonstrated that existence of Cumulus Oocyte Complexes (COC) significantly showed better IVM, fertilization and evolution trend as compared to oocytes without cumulus cover or Denuded Oocytes (DO), especially in TCM199 plus BME and CYS. So that the change in GV stage oocytes to MII (maturation rate), fertilization rates or 2PN formation, and two cell embryos formation or blastocyst development rate in the treatment group with addition of BME & CYS and COC was statistically significant as compared to the DO group (p-value < 0.0001). Conclusion Both cellular and environmental factors could be important and involved in ART

  9. Alteration of radiation-sensitive processes associated with cancer and longevity by dietary 2-mercaptoethanol.

    PubMed

    Click, Robert E

    2014-01-01

    Previous results demonstrated dietary 2-mercaptoethanol (2-ME) delayed appearance of cancer in certain murine strains. In addition, it had a benefit not found with other organosulfurs, in that it completely prevented spontaneous development of cancer in BXSB-Yaa + over an entire lifespan. These benefits raise the question: What, if any, alteration of radiation-induced tumorigenesis would 2-ME impart that may differ from that of other sulfur antioxidants? This is relevant based on the extensive use of radiation in diagnoses and therapy and 2-ME's superior in vitro and in situ immune enhancement properties. This was addressed by exposing long-lived, B10.A (4R) mice to sublethal, 5.5 Gy ionizing gamma-rays and then tumor development monitored over a lifetime. Two-tailed P-values were determined using the Fischer's Exact Test. The only tumors detected were mammary and only in animals that were both exposed to radiation and not treated with 2-ME. The 43% incidence differed significantly from the absence of tumors in non-irradiated mice that were or were not exposed to 2-ME and in those irradiated and treated daily with 2-ME, irrespective of whether treatment was started prior to or post irradiation. However, quite unexpectedly, radiation shortened longevity 29% from undefined causes, including cancer, in animals pretreated with 2-ME; longevity was not altered in those not pretreated or if treatment was started post-irradiation. The findings have relevance for cancer prevention and the controversy relative to ''long term survival/safety'' of currently used antioxidants as free radical scavengers in humans undergoing radiotherapy.

  10. A review: alteration of in vitro reproduction processes by thiols —Emphasis on 2-mercaptoethanol

    PubMed Central

    CLICK, Robert E.

    2014-01-01

    Descriptions of organosulfurs altering biologically relevant cellular functions began some 40 years ago when murine in vitro cell mediated and humoral immune responses were shown to be dramatically enhanced by any of four xenobiotic, sulfhydryl compounds—2-mercaptoethanol (2ME), dithiothreitol (DTT), glutathione, and L-cysteine; the most effective were 2ME and DTT. These findings triggered a plethora of reports defining 2ME benefits for a multitude of immunological processes. This in turn led to investigations on 2ME alterations of (a) immune functions in other species, (b) activities of other cell-types, and (c) in vivo diseases. In addition, these early findings preceded the identification of previously undefined anticarcinogenic chemicals in specific foods as organosulfurs. Taken all together, there is little doubt that organosulfur compounds have enormous benefits for cellular functions and for a multitude of diseases. Issues of importance still to be resolved are (a) clarification of mechanisms that underlie alteration of in vitro and in vivo processes and perhaps more importantly, (b) which if any in vitro alterations are relevant for (i) alteration of in vivo diseases and (ii) identification of other diseases that might therapeutically benefit from organosulfurs. As one means to address these questions, reviews of different processes impacted by thiols could be informative. Therefore, the present review on alterations of in vitro fertilization processes by thiols (mainly 2ME, since cysteamine alterations have been reviewed) was undertaken. Alterations found to occur in medium supplemented with 2ME were enhancement, no effect, or inhibition. Parameters associated with which are discussed as they relate to postulated thiol mechanisms. PMID:25087867

  11. Alteration of radiation-sensitive processes associated with cancer and longevity by dietary 2-mercaptoethanol

    PubMed Central

    Click, Robert E.

    2014-01-01

    Background Previous results demonstrated dietary 2-mercaptoethanol (2-ME) delayed appearance of cancer in certain murine strains. In addition, it had a benefit not found with other organosulfurs, in that it completely prevented spontaneous development of cancer in BXSB-Yaa+ over an entire lifespan. Aims These benefits raise the question: What, if any, alteration of radiation-induced tumorigenesis would 2-ME impart that may differ from that of other sulfur antioxidants? This is relevant based on the extensive use of radiation in diagnoses and therapy and 2-ME's superior in vitro and in situ immune enhancement properties. Materials and Methods This was addressed by exposing long-lived, B10.A(4R) mice to sublethal, 5.5 Gy ionizing gamma-rays and then tumor development monitored over a lifetime. Statistical Analysis Two-tailed P-values were determined using the Fischer's Exact Test. Results The only tumors detected were mammary and only in animals that were both exposed to radiation and not treated with 2-ME. The 43% incidence differed significantly from the absence of tumors in non-irradiated mice that were or were not exposed to 2-ME and in those irradiated and treated daily with 2-ME, irrespective of whether treatment was started prior to or post irradiation. However, quite unexpectedly, radiation shortened longevity 29% from undefined causes, including cancer, in animals pretreated with 2-ME; longevity was not altered in those not pretreated or if treatment was started post-irradiation. Conclusions The findings have relevance for cancer prevention and the controversy relative to “long term survival/safety” of currently used antioxidants as free radical scavengers in humans undergoing radiotherapy. PMID:24762499

  12. Optimization and efficient purification of recombinant Omp28 protein of Brucella melitensis using Triton X-100 and β-mercaptoethanol.

    PubMed

    Kumar, Ashu; Tiwari, Sapana; Thavaselvam, Duraipandian; Sathyaseelan, Kannusamy; Prakash, Archana; Barua, Anita; Arora, Sonia; Kameswara Rao, M

    2012-06-01

    The high level expression of recombinant proteins in Escherichia coli often leads to the formation of inclusion bodies that contain most of the expressed protein held together by non-covalent forces. The inclusion bodies are usually solubilized using strong denaturing agents like urea and guanidium hydrochloride. In this study recombinant Omp28 (rOmp28) protein of Brucella melitensis was expressed in two different vector systems and further efficient purification of the protein was done by modification in buffers to improve the yield and purity. Different concentrations of Triton X-100 and β-mercaptoethanol were optimized for the solubilization of inclusion bodies. The lysis buffer with 8M urea alone was not sufficient to solubilize the inclusion bodies. It was found that the use of 1% Triton X-100 and 20mM β-mercaptoethanol in lysis and wash buffers used at different purification steps under denaturing conditions increased the yield of purified rOmp28 protein. The final yield of purified protein obtained with modified purification protocol under denaturing conditions was 151 and 90mg/l of the culture or 11.8 and 9.37mg/g of wet weight of cells in pQE30UA and pET28a(+) vector respectively. Thus modified purification protocol yielded more than threefold increase of protein in pQE30UA as compared with purification by conventional methods.

  13. Laser induced autofluorescence in the monitoring of β-mercaptoethanol mediated photo induced proton coupled electron transfer in proteins.

    PubMed

    Manjunath, S; Satish Rao, B S; Satyamoorthy, K; Mahato, K K

    2015-01-01

    Photo induced proton coupled electron transfer (PCET) is an important process that many organisms use for progression of catalytic reactions leading to energy conversion. In the present study, the influence of SDS and BME on the redox properties of tyrosine and tryptophan for five different globular proteins, BSA, HSA, RNase-A, trypsin and lysozyme were studied using laser induced autofluorescence. The proteins were subjected to denaturation under SDS, SDS plus heat and SDS plus β-mercaptoethanol (BME) plus heat and the corresponding fluorescence were recorded. The influence of BME on the autofluorescence properties of the proteins were evaluated upon tris-2-corboxy-ethyl phosphine (TCEP) denaturation. The BSA and HSA when exposed to SDS alone, exhibited hydrophobic collapse around their tryptophan moieties. However, these proteins when treated with SDS plus BME plus heat, an unusual red shift in the emission was observed, may be due to proton transfer from hydroxyl group of the excited tyrosine residues to the local microenvironments. The observation was further confirmed with similar proton transfer in absence of tryptophan in RNase-A showing involvement of tyrosine in the process. A drastic quenching of fluorescence in all of the proteins under study were also observed, may be due to photo-induced electron transfer (PET) from BME to the intrinsic fluorophores resulting in radical ions formation, evaluated upon DCFDA measurements. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Accumulation of FlAsH/Lumio Green in active mitochondria can be reversed by beta-mercaptoethanol for specific staining of tetracysteine-tagged proteins.

    PubMed

    Langhorst, Matthias F; Genisyuerek, Selda; Stuermer, Claudia A O

    2006-06-01

    Recent advances in the field of small molecule labels for live cell imaging promise to overcome some of the limitations set by the size of fluorescent proteins. We tested the tetracysteine-biarsenical labeling system in live cell fluorescence microscopy of reggie-1/flotillin-2 in HeLa and N2a cells. In both cell types, the biarsenical staining reagent FlAsH/Lumio Green accumulated in active mitochondria and led to mitochondrial swelling. This is indicative of toxic side effects caused by arsenic, which should be considered when this labeling system is to be used in live cell imaging. Mitochondrial accumulation of FlAsH/Lumio Green was reversed by addition of low concentrations of thiol-containing reagents during labeling and a subsequent high stringency thiol wash. Both ethanedithiol and beta-mercaptoethanol proved to be effective. We therefore established a staining protocol using beta-mercaptoethanol as thiol binding site competitor resulting in a specific staining of tetracysteine-tagged reggie-1/flotillin-2 of adequate signal to noise ratio, so that the more toxic and inconvenient ethanedithiol could be avoided. Furthermore, we show that staining efficiency was greatly enhanced by introducing a second tetracysteine sequence in tandem.

  15. Serological profile of buffalo (Bubalus bubalis) female calves vaccinated with standard Brucella abortus strain 19 vaccine using rose bengal, 2-mercaptoethanol and complement fixation tests.

    PubMed

    Nardi, G Júnior; Ribeiro, M G; Jorge, A M; Megid, J; Silva, L M P

    2012-03-01

    The serological profiles of 21 female buffaloes vaccinated between 3 and 8 months of age using Brucella abortus strain 19 (S19) were evaluated by rose bengal (RBT), 2-mercaptoethanol (2ME) and complement fixation (CFT) tests. The serum strains were collected in day zero, 15, 30, 45, 60th days and subsequently to each 30 months, until 720th day after vaccination. No animal showed reaction in day zero. In 15th day above 95% of animals revealed reaction in all tests. All the animals presented absence of reactions in CFT, RBT and 2ME tests at 270, 300 and 360 days after vaccination, respectively. Our finding highlighted early response in CFT compared than other conventional agglutination tests. None of animals presented oscillation of titers or reactions in any test after 360 day of study, which enables the use of these tests after this period without interference of antibodies from S19 vaccine origin between 3 and 8 months in buffalo heifers.

  16. Electrocatalytic oxidation of 2-mercaptoethanol using modified glassy carbon electrode by MWCNT in combination with unsymmetrical manganese (II) Schiff base complexes

    SciTech Connect

    Mohebbi, Sajjad Eslami, Saadat

    2015-06-15

    Highlights: • High electocatalytic efficiency and stability of modified hybrid electrode GC/MWCNTs/MnSaloph. • Direct reflection of catalytic activity of manganese complexes on electrocatalytic oxidation of 2-ME. • Decreasing overpotential and increasing catalytic peak current toward oxidation of 2-ME. • Deposition of range of novel substituted N{sub 2}O{sub 2} Saloph complexes of manganese(II) on GCE/MWCNT. • Enhancement of electrocatalytic oxidation activity upon electron donating substitutions on the Saloph. - Abstract: The performance of modified hybrid glassy carbon electrode with composite of carbon nanotubes and manganese complexes for the electrocatalytic oxidation of 2-mercaptoethanol is developed. GC electrode was modified using MWCNT and new N{sub 2}O{sub 2} unsymmetrical tetradentate Schiff base complexes of manganese namely Manganese Saloph complexes 1-5, with general formula Mn[(5-x-4-y-Sal)(5-x′-4-y′-Sal) Ph], where x, x′ = H, Br, NO{sub 2} and y, y′ = H, MeO. Direct immobilization of CNT on the surface of GCE is performed by abrasive immobilization, and then modified by manganese(II) complexes via direct deposition method. These novel modified electrodes clearly demonstrate the necessity of modifying bare carbon electrodes to endow them with the desired behavior and were identified by HRTEM. Also complexes were characterized by elemental analyses, MS, UV–vis and IR spectroscopy. Modified hybrid GC/MWCNT/MnSaloph electrode exhibits strong and stable electrocatalytic activity towards the electrooxidation of 2-mercaptoethanol molecules in comparison with bare glassy carbon electrode with advantages of very low over potential and high catalytic current. Such ability promotes the thiol’s electron transfer reaction. Also, electron withdrawing substituent on the Saloph was enhanced electrocatalytic oxidation activity.

  17. Optimization of o-phtaldialdehyde/2-mercaptoethanol postcolumn reaction for the hydrophilic interaction liquid chromatography determination of memantine utilizing a silica hydride stationary phase.

    PubMed

    Douša, Michal; Pivoňková, Veronika; Sýkora, David

    2016-08-01

    A rapid procedure for the determination of memantine based on hydrophilic interaction chromatography with fluorescence detection was developed. Fluorescence detection after postcolumn derivatization with o-phtaldialdehyde/2-mercaptoethanol was performed at excitation and emission wavelengths of 345 and 450 nm, respectively. The postcolumn reaction conditions such as reaction temperature, derivatization reagent flow rate, and reagents concentration were studied due to steric hindrance of amino group of memantine. The derivatization reaction was applied for the hydrophilic interaction liquid chromatography method which was based on Cogent Silica-C stationary phase with a mobile phase consisting of a mixture of 10 mmol/L citric acid and 10 mmol/L o-phosphoric acid (pH 6.0) with acetonitrile using an isocratic composition of 2:8 v/v. The benefit of the reported approach consists in a simple sample pretreatment and a quick and sensitive hydrophilic interaction chromatography method. The developed method was validated in terms of linearity, accuracy, precision, and selectivity according to the International Conference on Harmonisation guidelines. The developed method was successfully applied for the analysis of commercial memantine tablets. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Augmentation by 2-mercaptoethanol of in vitro anti-TNP antibody production induced by butyrate plus IL-2 in murine splenic B cells.

    PubMed

    Gohda, Eiichi; Okamura, Takayuki; Aoyama, Eriko; Yamamoto, Itaru

    2003-11-01

    We previously reported that anti-trinitrophenyl (TNP) antibody production in murine splenic B cells stimulated with TNP-lipopolysaccharide in vitro was promoted by sodium butyrate (NaBu) in an IL-2-dependent manner. In the present study, we found that the effect of NaBu plus IL-2 was markedly augmented by 2-mercaptoethanol (2-ME), which showed a slight or null effect on the response of untreated, IL-2-treated or NaBu-treated B cells, as assessed by both anti-TNP plaque-forming cell assay and anti-TNP IgM ELISA. Other thiol compounds such as dithiothreitol, cysteamine and reduced glutathione (GSH) also had this activity. 2-ME enhanced the anti-TNP antibody production induced by other short-chain fatty acids with three to five carbon atoms plus IL-2. The proliferation of B cells was significantly inhibited by NaBu or NaBu plus IL-2, and the proliferation was completely restored by the simultaneous addition of 2-ME. These results demonstrate that 2-ME markedly enhanced anti-TNP antibody production in murine B cells induced by NaBu plus IL-2 and suggest that the effect of 2-ME is at least partly due to its blocking activity of the growth-inhibitory action of NaBu.

  19. Enhancing effect of N-acetyl-l-cysteine or 2-mercaptoethanol on the in vitro permeation of 5-fluorouracil or tolnaftate through the human nail plate.

    PubMed

    Kobayashi, Y; Miyamoto, M; Sugibayashi, K; Morimoto, Y

    1998-11-01

    The enhancing effects of various vehicles on the in vitro permeation of a hydrophilic model drug, 5-fluorouracil (5-FU), or a lipophilic model drug, tolnaftate (TN), through human nail plates were investigated using a modified side-by-side diffusion cell. Tip pieces from the 5th finger-nail, clipped from healthy volunteers, were used in this permeation study. The swelling and softening properties of the nail pieces were also measured in each vehicle. The weights and stresses of the nail pieces were dramatically changed after immersion in aqueous solvents containing N-acetyl-L-cysteine (AC) or 2-mercaptoethanol (ME). However, no significant change in the physicochemical properties of the nail pieces was found in the lipophilic vehicles. Thus, the water content in the nail plates absorbed from vehicles may relate to their physicochemical properties. Although keratin-softening agents and new skin permeation enhancers did not significantly promote 5-FU permeation compared with water alone, the flux from solvent systems containing AC or ME was substantially higher. In addition, TN permeation from solvents containing AC or ME could be measured, whereas that from other solvents was undetectable. When the AC concentration was increased, the 5-FU permeation and the nail weight increased and the stress of each nail piece decreased. It is concluded from these experimental results that AC and ME may be useful as enhancers for increasing drug permeation through the human nail plate.

  20. Mercaptoethanol capped CdSe quantum dots and CdSe/ZnS core/shell: synthesis, characterization and cytotoxicity evaluation.

    PubMed

    Painuly, Diksha; Bhatt, Anugya; Krishnan, V Kalliyana

    2013-02-01

    CdSe Quantum dots (Q-dots) and CdSe/ZnS core/shell have been synthesized by wet chemical route using mercaptoethanol (ME) as cappant. The synthesized Q-dots and core/shell were characterized using X-ray diffraction (XRD), Transmission electron microscopy (TEM), Energy dispersive X-ray analysis (EDS), Dynamic Light Scattering (DLS), Optical absorption and luminescence spectroscopy. The core/shell formation was confirmed by both XRD and TEM analysis. The luminescence was shown to be considerably enhanced in the core/shell sample. Effect of dialysis process on the optical properties of the Q-dots and core/shell has also been discussed. Cytotoxicity studies have been carried out for Q-dots and core/shell. CdSe/ZnS core/shell was found to be non-cytotoxic as compared to CdSe Q-dots up to a certain concentration range. Polyethylene glycol (PEG) coating enhances the non-cytotoxic nature of CdSe/ZnS core/shell when compared with bare core/shell.

  1. Determination of Gonyautoxin-4 in Echinoderms and Gastropod Matrices by Conversion to Neosaxitoxin Using 2-Mercaptoethanol and Post-Column Oxidation Liquid Chromatography with Fluorescence Detection

    PubMed Central

    Silva, Marisa; Rey, Verónica; Botana, Ana; Vasconcelos, Vitor; Botana, Luis

    2015-01-01

    Paralytic Shellfish Toxin blooms are common worldwide, which makes their monitoring crucial in the prevention of poisoning incidents. These toxins can be monitored by a variety of techniques, including mouse bioassay, receptor binding assay, and liquid chromatography with either mass spectrometric or pre- or post-column fluorescence detection. The post-column oxidation liquid chromatography with fluorescence detection method, used routinely in our laboratory, has been shown to be a reliable method for monitoring paralytic shellfish toxins in mussel, scallop, oyster and clam species. However, due to its high sensitivity to naturally fluorescent matrix interferences, when working with unconventional matrices, there may be problems in identifying toxins because of naturally fluorescent interferences that co-elute with the toxin peaks. This can lead to erroneous identification. In this study, in order to overcome this challenge in echinoderm and gastropod matrices, we optimized the conversion of Gonyautoxins 1 and 4 to Neosaxitoxin with 2-mercaptoethanol. We present a new and less time-consuming method with a good recovery (82.2%, RSD 1.1%, n = 3), requiring only a single reaction step. PMID:26729166

  2. Determination of Gonyautoxin-4 in Echinoderms and Gastropod Matrices by Conversion to Neosaxitoxin Using 2-Mercaptoethanol and Post-Column Oxidation Liquid Chromatography with Fluorescence Detection.

    PubMed

    Silva, Marisa; Rey, Verónica; Botana, Ana; Vasconcelos, Vitor; Botana, Luis

    2015-12-30

    Paralytic Shellfish Toxin blooms are common worldwide, which makes their monitoring crucial in the prevention of poisoning incidents. These toxins can be monitored by a variety of techniques, including mouse bioassay, receptor binding assay, and liquid chromatography with either mass spectrometric or pre- or post-column fluorescence detection. The post-column oxidation liquid chromatography with fluorescence detection method, used routinely in our laboratory, has been shown to be a reliable method for monitoring paralytic shellfish toxins in mussel, scallop, oyster and clam species. However, due to its high sensitivity to naturally fluorescent matrix interferences, when working with unconventional matrices, there may be problems in identifying toxins because of naturally fluorescent interferences that co-elute with the toxin peaks. This can lead to erroneous identification. In this study, in order to overcome this challenge in echinoderm and gastropod matrices, we optimized the conversion of Gonyautoxins 1 and 4 to Neosaxitoxin with 2-mercaptoethanol. We present a new and less time-consuming method with a good recovery (82.2%, RSD 1.1%, n = 3), requiring only a single reaction step.

  3. Application of rapid-scanning, stopped-flow spectroscopy to the characterization of intermediates formed in the reactions of L- and D-tryptophan and beta-mercaptoethanol with Escherichia coli tryptophan synthase.

    PubMed

    Drewe, W F; Koerber, S C; Dunn, M F

    1989-04-01

    The reactions of the alpha 2 beta 2 complex of Escherichia coli tryptophan synthase with D- and L-Trp and the presteady-state reaction of L-Ser and beta-mercaptoethanol under different premixing conditions have been investigated by rapid-scanning stopped-flow (RSSF) UV-visible spectroscopy. The reaction of alpha 2 beta 2 with L-Ser and beta-mercaptoethanol occurs in 3 detectable relaxations with rates similar to the 3 relaxations seen in the partial reaction with L-Ser and in the reaction with L-Ser and indole. The presteady-state phase of the reaction of beta-mercaptoethanol with the alpha-aminoacrylate intermediate is characterized by 2 relaxations. The RSSF spectra for this reaction show that the spectral changes that take place in these 2 phases are essentially identical. The L-Trp reaction is biphasic, and the spectral changes occurring in each phase of the reaction also are identical. The 2 new spectral bands formed (lambda max congruent to 420 nm and congruent to 476 nm) are assigned as the L-Trp external aldimine (Schiff's base) and L-Trp quinonoid intermediates, respectively. The reaction of D-Trp also is biphasic. Analysis of first and second derivatives of the RSSF spectral changes give evidence for the formation of spectral bands with lambda max of approximately 423 nm, approximately 450 nm, and approximately 478 nm. The positions and shapes of these bands suggest a D-Trp external aldimine structure (423 nm) and a quinonoidal species (450 and 478 nm). However, product studies do not support this latter assignment. The behavior of the D- and L-Trp reactions and the reaction of beta-mercaptoethanol with the alpha-aminoacrylate strongly indicate the pre-existence of 2 slowly equilibrating forms of the internal aldimine and of the alpha-aminoacrylate.

  4. Longevity of SLE-prone mice increased by dietary 2-mercaptoethanol via a mechanism imprinted within the first 28 days of life.

    PubMed

    Click, Robert E

    2010-01-01

    In the preceding report, moderately lived-mice fed dietary 2-mercaptoethanol (2-Me) had their life extended, whereas long-lived mice were found to have the quality of life improved, but not extended, and did not develop high fat-diet obesity. In the present report, alteration of longevity of mice prone to develop spontaneous, systemic lupus erythematosus (SLE) by dietary 2-Me was determined. NZB, NZW, (NZW x NZB) F₁-hybrid, BXSB/MpJ, BXSB-Yaa+/J, MRL/MpJ and MRL/MpJ-Faslpr mice received drinking water, without or with 2-Me at concentrations of 10⁻³ or 10⁻² M. Therapeutic benefit was assessed by changes in longevity. The median survival of MRL/MpJ males was increased from 443 to 615 days and those of (NZW x NZB) F₁ and NZB males and females were increased approximately 2-fold. The most unexpected finding was that longevity of F₁ males was significantly extended irrespective of whether dietary exposure to 2-Me was initiated at 28 days of age, at 50 days of age, or initiated during gestation (and then terminated at weaning--28 days of age). Survival of F₁-hybrids in which treatment was initiated in utero or at 28 days of age was not significantly different, whereas if initiation was delayed until 50 days of age, survival was >200 days shorter. Survival of male MRL/MpJ-Fas lpr and BXSB/MpJ (Yaa-), two strains with genetically controlled accelerated SLE, was not altered by 2-Me when started at 50 days. Various alternatives are discussed regarding potential long-lasting mechanisms imprinted early in life. Even though present day treatments of rodent SLE are generally aimed at controlling specific immunological events, with or without survival benefits, or are procedures presently unsuitable for therapeutic use in humans, the findings presented herein seem worthy of clinical evaluation.

  5. Longevity of SLE-prone mice increased by dietary 2-mercaptoethanol via a mechanism imprinted within the first 28 days of life

    PubMed Central

    2010-01-01

    In the preceding report, moderately lived mice fed dietary 2-mercaptoethanol (2-Me) had their life extended, whereas long-lived mice were found to have the quality of life improved, but not extended, and did not develop high fat-diet obesity. In the present report, alteration of longevity of mice prone to develop spontaneous, systemic lupus erythematosus (SLE) by dietary 2-Me was determined. NZB, NZW, (NZW × NZB) F1-hybrid, BXSB/MpJ, BXSB-Yaa+/J, MRL/MpJ and MRL/MpJ-Faslpr mice received drinking water, without or with 2-Me at concentrations of 10−3 or 10−2 M. Therapeutic benefit was assessed by changes in longevity. The median survival of MRL/MpJ males was increased from 443 to 615 days and those of (NZW × NZB) F1 and NZB males and females were increased approximately two-fold. The most unexpected finding was that longevity of F1 males was significantly extended irrespective of whether dietary exposure to 2-Me was initiated at 28 days of age, at 50 days of age or initiated during gestation (and then terminated at weaning, 28 days of age). Survival of F1-hybrids in which treatment was initiated in utero or at 28 days of age was not significantly different, whereas if initiation was delayed until 50 days of age, survival was >200 days shorter. Survival of male MRL/MpJ-Faslpr and BXSB/MpJ (Yaa−), two strains with genetically controlled accelerated SLE, was not altered by 2-Me when started at 50 days. Various alternatives are discussed regarding potential long-lasting mechanisms imprinted early in life. Even though present day treatments of rodent SLE are generally aimed at controlling specific immunological events, with or without survival benefits or are procedures presently unsuitable for therapeutic use in humans, the findings presented herein seem worthy of clinical evaluation. PMID:21178504

  6. Evaluation of nitrogen nuclear hyperfine and quadrupole coupling parameters for the proximal imidazole in myoglobin-azide, -cyanide, and -mercaptoethanol complexes by electron spin echo envelope modulation spectroscopy.

    PubMed

    Magliozzo, R S; Peisach, J

    1993-08-24

    Electron spin echo envelope modulation (ESEEM) spectroscopy and computer simulation of spectra has been used to evaluate the nitrogen nuclear hyperfine and quadrupole coupling parameters for the proximal imidazole nitrogen directly coordinated to iron in three low-spin heme complexes, myoglobin-azide, -cyanide, and -mercaptoethanol (MbN3, MbCN, and MbRS). The variability in the weak electron-nuclear coupling parameters reveals the electronic flexibility within the heme group that depends on properties of the exogenous ligands. For example, the isotropic component of the nitrogen nuclear hyperfine coupling ranges from 4.4 MHz for MbN3 to 2.2 MHz for both MbCN and MbRS. The weaker coupling in MbCN and MbRS is taken as evidence for delocalization of unpaired electron spin from iron into the exogenous anionic ligands. The value of e2Qq, the nuclear quadrupole coupling constant for the axial imidazole nitrogen in MbCN and MbRS, was 2.5 MHz but was significantly larger, 3.2 MHz, in MbN3. This large value is considered evidence for a weakened sigma bond between the proximal imidazole and ferric iron in this form, and for a feature contributing to the origin of the high spin-low spin equilibrium exhibited by MbN3 [Beetlestone, J., & George, P. (1964) Biochemistry 5, 707-714]. The ESEEM results have allowed a correlation to be made between the orientation of the g tensor axes, the orientation of the p-pi orbital of the proximal imidazole nitrogen, and sigma- and pi-bonding features of the axial ligands. Furthermore, the proximal imidazole is suggested to act as a pi-acceptor in low-spin heme complexes in order to support strong sigma electron donation from the lone pair orbital to iron. An evaluation of the nitrogen nuclear hyperfine coupling parameters for the porphyrin pyrrole sites in MbRS reveals a large inequivalence in isotropic components consistent with an orientation of rhombic axes (and g tensor axes) that eclipses the Fe-Npyrrole vector directions.

  7. Tailoring the optical properties of poly(diallyl dimethyl ammonium chloride) polyelectrolyte by incorporation of 2-mercaptoethanol capped CdSe nanoparticles

    NASA Astrophysics Data System (ADS)

    Tyagi, Chetna; Sharma, Ambika

    2016-10-01

    The present work deals with the preparation and characterization of 2-mercaptoethanol capped cadmium selenide (CdSe) nanoparticles, dispersed in poly(diallyl dimethyl ammonium chloride) (PDADMAC) polyelectrolyte aqueous solution. X-ray diffraction spectra, scanning electron microscopy and energy-dispersive x-ray have been used to determine the structure, particle size (d), surface morphology and composition of various constituents. The absorption spectra of pure PDADMAC and the CdSe/PDADMAC polymer nanocomposite (PNC) are analyzed to determine the values of the absorption coefficient (α) and energy band gap (E g) which are found to be 4 eV and 3.26 eV respectively. A red shift in the spectrum of the PNC, as compared to the pure polymer, has been observed. With the addition of CdSe nanoparticles in the PDADMAC polyelectrolyte, a remarkable change in the optical parameters of the pure polymer has been observed. The refractive index (n) obtained by using Swanepoel’s method decreases in the case of the PNC as compared to the pure polymer. The value of the static refractive index (n 0) is found to be 4.29 for the pure polymer and 1.52 for the PNC. The extinction coefficient, dielectric constants, optical conductivity and relaxation time have been evaluated. The Wemple-DiDomenico model has been used to evaluate the dispersion parameters such as the average energy gap (E 0) and dispersion energy (E d). The values of the nonlinear refractive index (n 2) of the pure polymer and PNC have been determined using the theoretical approaches suggested by Boling and Tichy and Ticha. n 2 increases in the case of PNC, which relates to the decreased energy band gap. Photoluminescence (PL) spectra have been studied to explore the energy band structure and interaction between CdSe nanoparticles and PDADMAC. The PL peaks obtained at 437 nm and 461 nm correspond to the pure polymer whereas the peak at 577 nm is attributed to CdSe.

  8. Rapid and sensitive step gradient assays of glutamate, glycine, taurine and gamma-aminobutyric acid by high-performance liquid chromatography-fluorescence detection with o-phthalaldehyde-mercaptoethanol derivatization with an emphasis on microdialysis samples.

    PubMed

    Piepponen, T P; Skujins, A

    2001-06-15

    We developed a rapid step-gradient HPLC method for determination of glutamate, glycine and taurine, and a separate method for determination of gamma-aminobutyric acid (GABA) in striatal microdialysates. The amino acids were pre-column derivatized with o-phthalaldehyde-2-mercaptoethanol by using an automated refrigerated autoinjector. Separation of the amino acids was established with a non-porous ODS-II HPLC column, late-eluting substances were washed out with a one-step low-pressure gradient. Concentrations of the amino acids were determined with a fixed-wavelength fluorescence detector. The detection limit for GABA was 80 fmol in a 15 microl sample, detection limits for glutamate, glycine and taurine were not determined because their concentrations in striatal perfusates were far above their detection limits. Total analysis time was less than 12 min, including the wash-out step. The methods described are relatively simple, sensitive, inexpensive, and fast enough to keep up with the microdialysis sampling.

  9. Effect of interleukin-2 on cell proliferation, sister-chromatid exchange induction, and nuclear stress protein phosphorylation in PHA-stimulated Fischer 344 rat spleen lymphocytes: Modulation by 2-mercaptoethanol

    SciTech Connect

    Morris, S.M.; Aidoo, A.; Domon, O.E.; McGarrity, L.J.; Kodell, R.L.; Schol, H.M.; Hinson, W.G.; Pipkin, J.L.; Casciano, D.A. )

    1990-01-01

    The effect of interleukin-2 (IL-2) on cell proliferation, sister-chromatid exchange (SCE) frequency, and the phosphorylation of nuclear stress proteins was evaluated in phytohemagglutinin (PHA)-stimulated spleen lymphocytes isolated from Fischer 344 rats. In addition, the ability of 2-mercaptoethanol (2-ME) to modulate the induction of these biological responses was characterized. Cell proliferation, as measured by the mitotic index, increased significantly. The average generation time (AGT) did not respond to IL-2 in a concentration-dependent manner and decreased significantly. The number of SCE increased significantly from control frequencies, to frequencies of 18.5 to 21.5 SCE per cell as the concentration of IL-2 in the culture medium increased to 50 half-maximal units per ml. A reduction in SCE frequency was observed when cells were cultured with 20 {mu}M 2-ME and IL-2 compared to IL-2 alone. Three nuclear proteins, with relative molecular masses of approximately 13,000-18,000, 20,000, and 80,000, were phosphorylated in IL-2-exposed G{sub 1}-phase nuclei. Elicitation of these nuclear proteins in IL-2-exposed cells was not affected by exposure to 2-ME.

  10. Comparison of different cryopreservation techniques: higher survival and implantation rate of frozen-thawed mouse pronuclear embryos in the presence of beta-mercaptoethanol in post-thaw culture.

    PubMed

    Bagis, H; Akkoc, T; Taskin, C; Arat, S

    2010-12-01

    The objective of this study was to investigate the effects of beta-mercaptoethanol (β-ME) on post-thaw embryo developmental competence and implantation rate of mouse pronuclear (PN) embryos that were cryopreserved after slow freezing, solid surface vitrification (SSV) or open-pulled straw (OPS) vitrification methods. Mouse PN embryos were cryopreserved by using slow freezing, SSV and OPS methods. After cryopreservation, freeze-thawed PN embryos were cultured up to blastocyst stage in a defined medium supplemented without or with 50 μM β-ME. The blastocyst formation rate of embryos that were cryopreserved by slow freezing method (40.0%) or vitrified by OPS method (18.3%) were lower than those vitrified by SSV method (55.6%) and fresh embryos (61.9%) in the absence of 50 β-ME in the culture media (p < 0.05). The blastocyst formation rate of embryos that were cryopreserved by slow freezing method (53.1%) or by OPS method (41.9%) were lower than those vitrified by SSV method (79.5%) and that of fresh (85.7%) in the presence of β-ME in the culture media (p < 0.05). The embryos transfer results revealed that the implantation rate of blastocyst derived from mouse PN embryos vitrified by SSV method (31.9% vs 51.2%) was similar to that of the control (39.0% vs 52.5%), but higher than those cryopreserved by slow freezing (28.2% vs 52.0%) and by OPS method (0.0% vs 51.2%) (p < 0.05). In conclusion, supplementation of β-ME in an in vitro culture medium was shown to increase survival of embryo development and implantation rate of frozen-thawed mouse PN embryos after different cryopreservation protocols.

  11. The use of new surface-modified poly(2-hydroxyethyl methacrylate) hydrogels in tissue engineering: treatment of the surface with fibronectin subunits versus Ac-CGGASIKVAVS-OH, cysteine, and 2-mercaptoethanol modification.

    PubMed

    Kubinová, Šárka; Horák, Daniel; Vaněček, Václav; Plichta, Zdeněk; Proks, Vladimír; Syková, Eva

    2014-07-01

    Superporous poly(2-hydroxyethyl methacrylate) is successfully used as a scaffold material for tissue engineering; however, it lacks functional groups that support cell adhesion. The objective of this study was to investigate the cell-adhesive properties of biomimetic ligands, such as laminin-derived Ac-CGGASIKVAVS-OH (SIKVAV) peptide and fibronectin subunits (Fn), as well as small molecules exemplified by 2-mercaptoethanol (ME) and cysteine (Cys), immobilized on a copolymer of 2-hydroxyethyl methacrylate (HEMA) with 2-aminoethyl methacrylate (AEMA) by a maleimide-thiol coupling reaction. The maleimide group was introduced to the P(HEMA-AEMA) hydrogels by the reaction of their amino groups with N-γ-maleimidobutyryl-oxysuccinimide ester (GMBS). Mesenchymal stem cells (MSCs) were used to investigate the cell adhesive properties of the modified hydrogels. A significantly larger area of cell growth as well as a higher cell density were found on Fn- and SIKVAV-modified hydrogels when compared to the ME- and Cys-modified supports or neat P(HEMA-AEMA). Moreover, Fn-modification strongly stimulated cell proliferation. The ability of MSCs to differentiate into adipocytes and osteoblasts was maintained on both Fn- and SIKVAV-modifications, but it was reduced on ME-modified hydrogels and neat P(HEMA-AEMA). The results show that the immobilization of SIKVAV and Fn-subunits onto superporous P(HEMA-AEMA) hydrogels via a GMBS coupling reaction improves cell adhesive properties. The high proliferative activity observed on Fn-modified hydrogels suggests that the immobilized Fn-subunits maintain their bioactivity and thus represent a promising tool for application in tissue engineering. © 2013 Wiley Periodicals, Inc.

  12. Toxic material advisory report - 2-mercaptoethanol

    SciTech Connect

    Bernholc, N. M.; White, O. Jr.; Baloyi, R. S.; Silverstein, B. D.

    1983-03-01

    A review of the animal toxicity data for 2-ME is presented. The results revealed that chronic inhalation exposures at a concentration of 6 mg/m/sup 3/ produced decreased oxygen consumption, lymphopenia, and neutrophilia. Comparison of acute toxicity data for 2-ME with data of structurally similar compounds suggests that 2-ME may be 2.3 times more toxic than butanethiol (TLV = 0.5 ppM), 6.5 times more toxic than ethanethiol, and 6 times more toxic than propanethiol (TLV = 0.5 ppM) via oral administration but may be comparable to propanethiol and less toxic than butanethiol and ethanethiol by the inhalation route of exposure. The TLVs for ethanethiol, methanethiol, and butanethiol were based on discomfort to human volunteers rather than toxicity. Since 2-ME has many effects similar to those of the thiols discussed and its odor threshold falls in the range of other thiols, by analogy the exposure limit for 2-ME should be comparable to the TLVs for butanethiol and ethanethiol. An interim exposure limit (IEL) of 0.5 ppM for a time-weighted average concentration during an 8-hour work shift is recommended. As with other thiols, a nuisance problem due to 2-ME odors and complaints of odor may serve as a primary reason for controlling workplace concentrations.

  13. Effect of the addition of beta-mercaptoethanol to a thawing solution supplemented with caffeine on the function of frozen-thawed boar sperm and on the fertility of sows after artificial insemination.

    PubMed

    Yamaguchi, S; Funahashi, H

    2012-03-15

    We have reported that artificial insemination (AI) with frozen-thawed boar semen supplemented with caffeine increased the number of uterine sperm by inhibiting the migration of polymorphonuclear leukocytes (PMNs) into the uterine lumen, thereby improving the fertility of gilts and sows. The objective of the present study was to examine the effects of the addition of the antioxidant beta-mercaptoethanol (bME) and caffeine to the thawing solution on the function of frozen-thawed sperm, on the phagocytic activity of PMNs for sperm, and on the fertility of sows after AI. When frozen-thawed sperm were cultured in the presence of 25 or 50 μm bME, sperm capacitation and spontaneous acrosome reactions were inhibited (P < 0.01). There was no effect of bME on phagocytic activity of PMNs for sperm in vitro. When hormonally treated (400 IU of equine chorionic gonadotropin + 200 IU of human chorionic gonadotropin) weaned sows experienced a single intrauterine insemination with frozen-thawed sperm (25 × 10(8) sperm per 50 ml dose) 40 h after subsequent hCG administration, pregnancy and farrowing rates were unaffected by the addition of 50 μm bME (pregnancy rate, 20 vs 21% in controls; farrowing rate, 20 vs 21%; n = 15 and 14, respectively). However, litter size tended to be higher than in the presence of 50 μm bME compared to its absence (10.0 ± 1.0 vs 5.7 ± 1.5, respectively; P < 0.07). Thus, the addition of bME to the thawing solution containing caffeine could be of benefit for improving the function of frozen-thawed sperm without influencing the phagocytic activity of PMNs for sperm. Although there were no statistically significant effects of bME on pregnancy or farrowing rates, the litter size tended to be higher in the sows subjected to a fixed-time single AI treatment with synchronized ovulation.

  14. Synthesis and biodistribution of radioarsenic labeled dimethylarsinothiols: derivatives of penicillamine and mercaptoethanol.

    PubMed

    Emran, A; Hosain, F; Spencer, R P; Kolstad, K S

    1984-01-01

    Arsenic analogs of sulfhydryl containing biomolecules can be derived from dimethylchloroarsine as a precursor. Arsenic-76 labeled dimethylarsinothiols (dimethylarsinopenicillamine and dimethylarsinomercaptoethanol) were synthesized, purified by chromatography, and their biodistributions obtained in mice. The present study demonstrates the possibility of developing a group of radioarsenicals from SH-containing biomolecules.

  15. Alteration of GI symptoms in a cow with Johne disease by the dietary organosulfur, 2-mercaptoethanol

    PubMed Central

    Click, Robert E.

    2012-01-01

    Sub-phenotypes of inflammatory bowel disease (IBD)—Crohn disease, ulcerative colitis and some cases of irritable bowel syndrome—are generally considered a consequence of gastrointestinal inflammation of unknown etiology. Conventional therapy and more recently biologic agents, all with varying degrees of drawbacks, have resulted in improved control of these diseases. However, as the incidence and prevalence continue to rise, needs for prevention, permanent remission and cures remain unmet, plus there still remain needs for improved control of symptoms, such as pain and diarrhea. The case report herein describes a serendipitous, novel means for curtailing these symptoms associated with a bovine gastrointestinal disease that may have applicability for patients with diseases characterized by abdominal-visceral pain and diarrhea. PMID:23076275

  16. Alteration of GI symptoms in a cow with Johne disease by the dietary organosulfur, 2-mercaptoethanol.

    PubMed

    Click, Robert E

    2012-10-01

    Sub-phenotypes of inflammatory bowel disease (IBD)-Crohn disease, ulcerative colitis and some cases of irritable bowel syndrome-are generally considered a consequence of gastrointestinal inflammation of unknown etiology. Conventional therapy and more recently biologic agents, all with varying degrees of drawbacks, have resulted in improved control of these diseases. However, as the incidence and prevalence continue to rise, needs for prevention, permanent remission and cures remain unmet, plus there still remain needs for improved control of symptoms, such as pain and diarrhea. The case report herein describes a serendipitous, novel means for curtailing these symptoms associated with a bovine gastrointestinal disease that may have applicability for patients with diseases characterized by abdominal-visceral pain and diarrhea.

  17. An alternative method for inactivating heteroagglutinins in human sera applicable to rubella haemagglutination inhibition testing at low dilutions.

    PubMed Central

    Mortimer, P P

    1976-01-01

    Serum agglutinins of chick and pigeon cells are predominantly immunoglobulin M and can be inactivated by 2 mercaptoethanol. 2 Mercaptoethanol is more effective than strong suspensions of red cells in removing the agglutinins of indicator cells from sera being prepared for HAI tests. In rubella HAI tests from a dilution of 1 to 10 dilute 2 mercaptoethanol offer a convenient method of removing agglutinins, and, at higher concentration, allow dilutions of sera from 1 in 2-5 to be tested without significant interference by heteroagglutinins. HAI titres are comparable when red cell absorbed and 2 mercaptoethanol treated sera are tested in parallel. Images PMID:946972

  18. Improving the in vitro Protein Digestibility of Sorghum with Reducing Agents

    NASA Astrophysics Data System (ADS)

    Hamaker, B. R.; Kirleis, A. W.; Butler, L. G.; Axtell, J. D.; Mertz, E. T.

    1987-02-01

    We have shown in previous reports that cooked sorghum protein is less digestible than other cooked cereal proteins. The pepsin-indigestible proteins in sorghum were found to be mainly prolamin proteins. Cooking sorghum in the presence of 2-mercaptoethanol increased protein digestibility (in vitro with pepsin or trypsin/chymotrypsin) to a level comparable with other cereals. At a concentration of 100 mM, other reducing agents (dithiothreitol, sodium bisulfite, and L-cysteine) were equally effective in improving sorghum digestibility. When maize was cooked in the presence of 2-mercaptoethanol, protein digestibility increased 5% compared to 25% for sorghum. Cooking barley, rice, and wheat with 2-mercaptoethanol had no significant effect on protein digestibility. The addition of reducing agents appears to prevent the formation of protein polymers linked by disulfide bonds.

  19. Some physico-chemical properties of the rigid form of the Sendai virus nucleocapsid.

    PubMed

    Repanovici, R; Hristova, M; Popa, L M

    1989-01-01

    The effect of some dissociation agents (SDS, beta-mercaptoethanol, urea, EDTA) on the rigid form of the Sendai virus nucleocapsid was studied. Polyacrylamide gel electrophoresis in the presence of lytic mixture (1% SDS, 2% beta-mercaptoethanol, 5 M urea, for 2 min at 100 degrees C) revealed two types of polypeptide subunits (mol. wts. 46,000 and 14,000), as well as the dissociation in the presence of 0.1% SDS only. The EDTA treatment leads to a disorganization of the protein part (10(-2) M) or of the nucleocapsid structure (5 x 10(-2) M).

  20. Fluorophors and chromophors from rat lens crystallins in UV with hydroxykynurenine

    SciTech Connect

    Bando, M.; Yu, N.T.; Kuck, J.F.

    1984-05-01

    Isolated alpha-, beta-, and gamma-crystallins from young rat lenses were incubated in solution for 16 hr with 3-hydroxykynurenine under ultraviolet (366 nm) light. Controls included: incubation without light, without kynurenine, and with 2-mercaptoethanol. These procedures generated several chromophors (with absorption maxima or shoulders at 340, 370, and 470 nm) and fluorophors (with excitation/emission at 407/515, 458/550, 515/555, 647/664, and 647/740 nm). The formation of these pigments was inhibited by 2-mercaptoethanol. The findings are discussed in relation to the chromophors and fluorophors found in aged and brunescent human lenses.

  1. Heat Stable Enzymes from Thermophiles

    DTIC Science & Technology

    1998-02-01

    Capillary electrophoresis 67 APPLICATIONS 67 Heavy metal removal from waste water 67 Time 68 Phosphate level 68 Alkaline phosphatase level 68 Heavy...glycerol 0.001 % Bromphenol blue 20 microliters of 1 % stain 5% P-mercaptoethanol 1.0 ml of 100% P-mercaptoethanol water 1.75 ml Store in 1 ml...aliquots at -20 TC 30% Acrylamide (29.2% acrylamide, 0.8% bisacrylamide) Dissolve 29.2 gms acrylamide in about 50 ml water Add 0.8 gms bisacrylamide and

  2. Anaerobic toxicity and biodegradability of hydrolysis products of chemical warfare agents.

    PubMed

    Sklyar, V I; Mosolova, T P; Kucherenko, I A; Degtyarova, N N; Varfolomeyev, S D; Kalyuzhnyi, S V

    1999-08-01

    The toxicity and biodegradability of the main hydrolysis products of chemical warfare agents were investigated under methanogenic conditions. Among the tested substances, only MPhA does not have any toxic effect with regard to the aceticlastic methanogenic activity. The toxicity of other compounds varied between moderate (TDG, mercaptoethanol) to strong (ethanolamine, diisobutyl ester of MPhA). Biodegradability tests showed that all the products of chemical detoxification of mustard gas (ethanolamine, ethylene glycol, TDG, mercaptoethanol) can be biomineralized under methanogenic conditions. On the contrary, phosphorus-containing compounds from the chemical detoxification of nerve warfare agents (Sarin, Soman, Vx-gases) are quite persistent under these conditions.

  3. Investigating the microstructure of keratin extracted from wool: peptide sequence (MALDI-TOF/TOF) and protein conformation (FTIR)

    USDA-ARS?s Scientific Manuscript database

    Keratin was extracted from wool by reduction with 2-mercaptoethanol. It was isolated as intact keratin and characterized by its similar molecular weight, protein composition, and secondary structure to native keratin. Gel electrophoresis patterns and MALDI-TOF/TOF peptide sequences provided the ide...

  4. Synthesis of Capped AIIBVI Nanoparticles for Fluorescent Biomarkers

    NASA Astrophysics Data System (ADS)

    Rudko, Galyna; Fediv, Volodymyr; Davydenko, Igor; Gule, Evgen; Olar, Olena; Kovalchuk, Andrii

    2016-02-01

    The conditions for growing CdS nanoparticles suitable for the visualization of biological tissues were theoretically studied and experimentally checked. The optimal ranges for pH values and precursors' concentrations were determined. The applicability of the mercaptoethanol-capped nanoparticles for in vitro luminescence visualization of several cellular forms in histological specimens of human placenta has been proven.

  5. Pilot Scale Production and Testing of a Recombinant Staphylococcal Enterotoxin (SEB) Triple Mutant

    DTIC Science & Technology

    2017-09-01

    with gel, which was used by the instrument to form a barrier between samples during the run. The sample was reduced with 2-mercaptoethanol (Bio-Rad...ECBC Rock Island RDCB-DES ATTN: Lee, K. RDCB-DEM ATTN: Grodecki, J. ECBC Technical Library RDCB-DRB-BL ATTN: Foppiano, S. Stein, J. Defense Technical Information Center ATTN: DTIC OA

  6. Purification and in vitro complementation of mutant histidinol dehydrogenases. [Salmonella typhimurium

    SciTech Connect

    Lee, S.Y.; Grubmeyer, C.T.

    1987-09-01

    The biochemistry of interallelic complementation within the Salmonella typhimurium hisD gene was investigated by in vitro protein complementation of mutant histidinol dehydrogenases (EC 1.1.1.23). Double-mutant strains were constructed containing the his01242 (constitutive overproducer) attenuator mutations and selected hisDa or hisDb mutations. Extracts from such hisDa986 and hisDb1799 mutant cells failed to show histidinol dehydrogenase activity but complemented to produce active enzyme. Inactive mutant histidinol dehydrogenases were purified from each of the two mutants by ion-exchange chromatography. Complementation by the purified mutant proteins required the presence of 2-mercaptoethanol and MnCl/sub 2/, and protein-protein titrations indicated that heterodimers were strongly preferred in mixtures of the complementary mutant enzymes. Both purified mutant proteins failed to catalyze NAD-NADH exchange reactions reflective of the first catalytic step of the two-step reaction. The inactive enzymes bound /sup 54/Mn/sup 2 +/ weakly or not at all in the presence of 2-mercaptoethanol, in contrast to wild-type enzyme which bound /sup 54/Mn/sup 2 +/ to 0.6 sites per monomer under the same conditions. The mutant proteins, like wild-type histidinol dehydrogenase, behaved as dimers on analytical gel filtration chromatography, but dissociated to form monomers in the presence of 2-mercaptoethanol. This effect of 20-mercaptoethanol was prevented by low levels of MnCl/sub 2/.

  7. Crystallization And Preliminary Crystallographic Analysis of Recombinant Human Galectin-1

    SciTech Connect

    Scott, S.A.; Scott, K.; Blanchard, H.

    2009-06-04

    Human galectin-1 has been cloned, expressed in E. coli, purified and crystallized in the presence of both lactose (ligand) and {beta}-mercaptoethanol under six different conditions. The X-ray diffraction data obtained have enabled the assignment of unit-cell parameters for two novel crystal forms of human galectin-1.

  8. Low temperature regulated growth of PbS quantum dots by wet chemical method

    SciTech Connect

    Kumar, Hitanshu Barman, P. B.; Singh, Ragini Raj; Bind, Umesh Chandra

    2015-08-28

    Narrow size distribution with regulated synthesis of lead sulfide (PbS) quantum dots (QDs) was achieved through wet chemical method. Different concentrations of 2-mercaptoethanol (capping agent) were used for tailoring the QDs size. Transmission electron microscopy and X-ray diffraction studies revealed that the QDs have mean diameters between 6 to 15 nm. The optical absorption spectra were compared to the predictions of a theoretical model for the electronic structure. The theory agrees well with experiment for QDs larger than 7 nm, but for smaller dots there is some deviation from the theoretical predictions. Consequently, the produced particles are having monodispersity, good water solubility, stability and may be good arguments to be biologically compatible due to the use of 2-mercaptoethanol.

  9. Prevalence of Brucella spp in humans1

    PubMed Central

    Soares, Catharina de Paula Oliveira Cavalcanti; Teles, José Andreey Almeida; dos Santos, Aldenir Feitosa; Silva, Stemberg Oliveira Firmino; Cruz, Maria Vilma Rocha Andrade; da Silva-Júnior, Francisco Feliciano

    2015-01-01

    Objective: to determine the seroprevalence of Brucella spp in humans. Method: this is an observational study, developed with 455 individuals between 18 and 64 years old, who use the Estratégia de Saúde da Família (Brazil's family health strategy). The serum samples of volunteers underwent buffered acid antigen tests, such as screening, agar gel immunodiffusion and slow seroagglutination test in tubes and 2-Mercaptoethanol. Results: among the samples, 1.98% has responded to buffered-acid antigen, 2.85% to agar gel immunodiffusion test and 1.54% to the slow seroagglutination tests on tubes/2-Mercaptoethanol. The prevalence of Brucella spp was 4.4%, represented by the last two tests. Conclusion: the results of this research suggest that the studied population is exposed to Brucella spp infection. PMID:26487143

  10. Early Antibody Response in Mice to Either Infection or Immunization with Salmonella typhimurium

    PubMed Central

    Kenny, Kathryn; Herzberg, Mendel

    1967-01-01

    After immunization with either live or heat-killed Salmonella typhimurium, mice responded with an extremely rapid production of bactericidal antibody which was correlated with the appearance of immunity to a heavy challenge dose (100 ld50) of the virulent bacteria. Inactivation of sera with mercaptoethanol along with Sephadex fractionation indicated that the observed bactericidal activity was associated with a macroglobulin which was completely mercaptoethanol-sensitive. The unexpected finding, that a heat-killed vaccine gave excellent protection from a challenge dose which killed all unimmunized control mice, seriously challenges the theory attributing immunity against typhoid infection entirely to a cellular host factor produced only in response to a live vaccine. PMID:5337833

  11. Membrane-bound dd-carboxypeptidases from Bacillus megaterium KM. General properties, substrate specificity and sensitivity to penicillins, cephalosporins and peptide inhibitors of the activity at pH5

    PubMed Central

    Diaz-Mauriño, Teresa; Nieto, Manuel; Perkins, Harold R.

    1974-01-01

    1. The membrane from Bacillus megaterium KM contained a dd-carboxypeptidase with optimum activity under the following conditions: pH5.2, bivalent cation, 3mm; ionic strength, 40mm; temperature, 35°C. It was inactivated by treatment with p-chloromercuribenzoate but was fairly insensitive to 2-mercaptoethanol. 2. The enzyme was inhibited by penicillins and cephalosporins. The inhibition of this enzyme was partially reversed on dialysis but 0.2m-2-mercaptoethanol could neither prevent nor reverse the inhibition. 3. The enzyme was extremely sensitive to changes in the configuration and size of the side chain of the C-terminal dipeptide of the substrate. An aliphatic side chain of a well-defined length and polarity was required in the residue that precedes the C-terminal dipeptide. 4. The enzyme was inhibited by a wide range of analogues of the peptidic portion of the natural substrate. PMID:4218954

  12. DENATURATION AND RENATURATION OF MALIC DEHYDROGENASE IN A CELL-FREE EXTRACT FROM A MARINE PSYCHROPHILE.

    PubMed

    BURTON, S D; MORITA, R Y

    1963-11-01

    Burton, Sheril D. (Oregon State University, Corvallis), and Richard Y. Morita. Denaturation and renaturation of malic dehydrogenase in a cell-free extract from a marine psychrophile. J. Bacteriol. 86:1019-1024. 1963.-Malic dehydrogenase from a marine psychrophilic vibrio (PS 207) was found to be heat-sensitive at 30 C, the maximal growth temperature for the organism. Initial denaturation was reversible, with maximal renaturation occurring when the denatured enzyme was slowly cooled in the presence of mercaptoethanol, reduced nicotinamide adenine dinucleotide, and malate. No renaturation occurred when these compounds were added after slow cooling, or when the renaturation mixture was rapidly cooled. Mercaptoethylamine, cysteine, glutathione, or mercaptoacetic acid could not replace mercaptoethanol. The kinetics of denaturation and renaturation suggest the presence of several malic isozymes each with different heat labilities, or that these processes are occurring in several distinct steps.

  13. Effect of antioxidants on the proliferative response of canine lymphocytes in serum from dogs with vitamin E deficiency.

    PubMed

    Langweiler, M; Sheffy, B E; Schultz, R D

    1983-01-01

    The in vitro effect of vitamin E and 3 other antioxidants--ethoxyquin, 2-mercaptoethanol, and ascorbic acid--on proliferation of canine lymphocytes was examined. Lymphocytes from 2 groups of dogs given a vitamin E-deficient diet or whelped from a bitch fed such a diet were cultured with pooled samples of serum from dogs fed a vitamin E-deficient diet or whelped from a bitch fed such a diet, or normal canine serum, and stimulated with phytohemagglutinin. Added vitamin E enhanced the responsiveness in serum from the dogs with vitamin E deficiency, but not in normal canine serum. A similar effect was noted with added ethoxyquin and 2-mercaptoethanol. Ascorbic acid had no effect on proliferation in either serum pool. These results indicated that depressed lymphocyte responsiveness seen with serum from vitamin E-deficient dogs may, at least in part, be due to a loss of antioxidant activity in this serum.

  14. Prevalence of Brucella spp in humans.

    PubMed

    Soares, Catharina de Paula Oliveira Cavalcanti; Teles, José Andreey Almeida; dos Santos, Aldenir Feitosa; Silva, Stemberg Oliveira Firmino; Cruz, Maria Vilma Rocha Andrade; da Silva-Júnior, Francisco Feliciano

    2015-01-01

    to determine the seroprevalence of Brucella spp in humans. this is an observational study, developed with 455 individuals between 18 and 64 years old, who use the Estratégia de Saúde da Família (Brazil's family health strategy). The serum samples of volunteers underwent buffered acid antigen tests, such as screening, agar gel immunodiffusion and slow seroagglutination test in tubes and 2-Mercaptoethanol. among the samples, 1.98% has responded to buffered-acid antigen, 2.85% to agar gel immunodiffusion test and 1.54% to the slow seroagglutination tests on tubes/2-Mercaptoethanol. The prevalence of Brucella spp was 4.4%, represented by the last two tests. the results of this research suggest that the studied population is exposed to Brucella spp infection.

  15. JPRS Report, Science & Technology USSR: Life Sciences.

    DTIC Science & Technology

    1988-07-01

    following treatment with 2-mercaptoethanol. Cyprein has been shown to a glycoprotein with 18 percent carbohydrate and a MW of 36,000 D which is...react only with CEA and not with biomolecules that share similar carbohydrate moieties. Furthermore, while lectins react with CEA with forward...demonstration that pyridoxylated hemo- globin polymers (PHP) constitute efficient blood substi- tutes led to the assessment of various carbohydrates as

  16. Chronotropic Biosensing Via Stem-Cell Derived Myocyte Aggregates

    DTIC Science & Technology

    2007-11-02

    Rockville, MD) as previously described [4– 6]. Briefly, embryonic stem cells were cultivated on a feeder- layer of primary mouse embryonic fibroblasts...in DMEM cul- ture medium supplemented with non-essential amino acids, L-glutamine, -mercaptoethanol, 20% fetal calf serum, and 100 IU leukemia...bacteriological petri dishes filled with phosphate-buffered saline (PBS) and cultivated for two days (at C and 5% CO ). The resulting aggregates were

  17. /sup 75/Selenium-labeled sheep plasma: the time course of changes in 75selenium distribution

    SciTech Connect

    Davidson, W.B.; McMurray, C.H.

    1988-09-01

    Sheep fed rations containing 0.1 ppm selenium were labeled by intravenous injection of radioactive sodium selenite or selenocystine. Gel filtration of serially collected plasma samples indicated that, with time, there was a transition from mercaptan sensitive to high mol wt mercaptan and protein solubilizer resistant selenoproteins. Radiolabeled plasma samples collected from selenite and selenocystine labeled sheep were dialyzed against buffer containing 2-mercaptoethanol or protein solubilizer. No difference in the stability between selenite- and selenocystine-labeled plasma could be detected.

  18. Purification and Properties of Clostridium perfringens Spore Lytic Enzymes.

    DTIC Science & Technology

    1983-01-01

    occurred with, for example, urea/mercaptoethanol (UME) treatment of Bacillus megaterium (Vary, 1973). alkaline dithioerythritol/sodium dodecyl sulphate...cetylmuremides of Bacillus subtilis YT 25. Agr. Biol. Chem. 38 2357-65. Accepted 15 June 1979 91 Germination of C perfringns spores Journal qf General Microbiology...spore-lytic enzymes of Bacillus cereus have been isolated and extensively studied by Strange & Dark (1957). Gould et al. (1966), Warth (1972) and Brown et

  19. Immunological responsiveness of the pigeon (Columba livia) following neonatal bursectomy.

    PubMed

    Thaxton, J P; Grissom, R E

    1984-01-01

    Pigeon squabs in two separate experiments were surgically bursectomized ( BSX ), surgically sham bursectomized ( SBSX ), or maintained as non-surgical controls (CON). Surgical procedures were performed within 2 hr of hatching. Primary and secondary hemagglutinin (HA) responses, as well as mercaptoethanol sensitive (ME-S) and resistant (ME-R) levels, to sheep red blood cells (SRBC) were quantitated. BSX did not reduce HA responses, nor ME-S and ME-R levels.

  20. Separation of amino acids and antibiotics by narrow-bore and normal-bore high-performance liquid chromatography with pre-column derivatization.

    PubMed

    Fiedler, H P; Plaga, A

    1987-01-16

    The selectivity, efficiency and lifetime of normal- and narrow-bore columns for high-performance liquid chromatography were investigated for the separation and quantification of amino acids and the amino acid-like antibiotics phosphinothricin and phosphinothricylalanylalanine in biological samples. These compounds were determined by an automated pre-column derivatization with o-phthalaldehyde-2-mercaptoethanol reagent and UV detection at 338 nm.

  1. Inactivation of ribosomes by an inhibitor of protein synthesis from Salmonella enteritidis.

    PubMed

    Brigotti, M; Nanetti, A; Montanaro, L; Sperti, S

    1993-01-01

    Sonic extracts of Salmonella enteritidis contain a factor which inhibits protein synthesis in cell-free systems by irreversibly inactivating ribosomes. The extent of the inactivation of ribosomes depends on the system used to assay protein synthesis, natural mRNA translation being more strongly inhibited than poly(U) translation. The inhibitory power of the Salmonella factor is destroyed by trypsin and by 5% mercaptoethanol. Placental RNase inhibitor is unable to protect ribosomes from inactivation.

  2. Time Course of Immune Activity in Response to Two Acute Stressors

    DTIC Science & Technology

    1994-04-14

    fetal calf serum (Gibco, 11 Grand Island, Ny), 1% glutamine (200 mM, Gibco), I % penicillin-streptomycin (Gibco), 1% Beta-mercaptoethanol (2 x Io-’M... fetal calf serum. CeJls were counted using Trypan Blue exclusion criteria, and concentration was adjusted to 2 x 10’ cells/m!. Con A (Sigma Medical...1981). Stress and cancer. Psychological Bulletin, ~, 369-406. Solomon, R. & Corbit, J. (1974). An opponent-process theory of motivation: 1. temporal

  3. Infrared microcalorimetric spectroscopy using uncooled thermal detectors

    SciTech Connect

    Datskos, P.G. |; Rajic, S.; Datskou, I.; Egert, C.M.

    1997-10-01

    The authors have investigated a novel infrared microcalorimetric spectroscopy technique that can be used to detect the presence of trace amounts of target molecules. The chemical detection is accomplished by obtaining the infrared photothermal spectra of molecules absorbed on the surface of an uncooled thermal detector. Traditional gravimetric based chemical detectors (surface acoustic waves, quartz crystal microbalances) require highly selective coatings to achieve chemical specificity. In contrast, infrared microcalorimetric based detection requires only moderately specific coatings since the specificity is a consequence of the photothermal spectrum. They have obtained infrared photothermal spectra for trace concentrations of chemical analytes including diisopropyl methylphosphonate (DIMP), 2-mercaptoethanol and trinitrotoluene (TNT) over the wavelength region2.5 to 14.5 {micro}m. They found that in the wavelength region 2.5 to 14.5 {micro}m DIMP exhibits two strong photothermal peaks. The photothermal spectra of 2-mercaptoethanol and TNT exhibit a number of peaks in the wavelength region 2.5 to 14.5 {micro}m and the photothermal peaks for 2-mercaptoethanol are in excellent agreement with infrared absorption peaks present in its IR spectrum. The photothermal response of chemical detectors based on microcalorimetric spectroscopy has been found to vary reproducibly and sensitively as a consequence of adsorption of small number of molecules on a detector surface followed by photon irradiation and can be used for improved chemical characterization.

  4. Omeprazole, a specific inhibitor of gastric (H/sup +/-K/sup +/)-ATPase, is a H/sup +/-activated oxidizing agent of sulfhydryl groups

    SciTech Connect

    Im, W.B.; Sih, J.C.; Blakeman, D.P.; McGrath, J.P.

    1985-04-25

    Omeprazole (5-methoxy-2-(((4-methoxy-3,5- dimethylpyridinyl)methyl)sulfinyl)-1H-benzimidazole) appeared to inhibit gastric (H/sup +/-K/sup +/)-ATPase by oxidizing its essential sulfhydryl groups, since the gastric ATPase inactivated by the drug in vivo or in vitro recovered its K+-dependent ATP hydrolyzing activity upon incubation with mercaptoethanol. Biological reducing agents like cysteine or glutathione, however, were unable to reverse the inhibitory effect of omeprazole. Moreover, acidic environments enhanced the potency of omeprazole. The chemical reactivity of omeprazole with mercaptans is also consistent with the biological action of omeprazole. The N-sulfenylated compound reacted at neutral pH with another stoichiometric amount of ethyl mercaptan to produce omeprazole sulfide quantitatively. The gastric polypeptides of 100 kilodaltons representing (H/sup +/-K/sup +/)-ATPase in the rat gastric mucosa or isolated hog gastric membranes were covalently labeled with (/sup 14/C)omeprazole. The radioactive label bound to the ATPase, however, could not be displaced by mercaptoethanol under the identical conditions where the ATPase activity was fully restored. These observations suggest that the essential sulfhydryl groups which reacted with omeprazole did not form a stable covalent bond with the drug, but rather that they further reacted with adjacent sulfhydryl groups to form disulfides which could be reduced by mercaptoethanol.

  5. Infrared microcalorimetric spectroscopy using uncooled thermal detectors

    NASA Astrophysics Data System (ADS)

    Datskos, Panos G.; Rajic, Slobodan; Datskou, Irene; Egert, Charles M.

    1997-10-01

    We have investigated a novel IR microcalorimetric spectroscopy technique that can be used to detect the presence of trace amounts of target molecules. The chemical detection is accomplished by obtaining the IR photothermal spectra of molecules absorbed on the surface of an uncooled thermal detector. Traditional gravimetric based chemical detectors require highly selective coatings to achieve chemical specificity. In contrast, IR microcalorimetric based detection requires only moderately specific coatings since the specificity is a consequence of the photothermal spectrum. We have obtained IR photothermal spectra for trace concentrations of chemical analytes including diisopropyl methylphosphonate (DIMP), 2-mercaptoethanol and trinitrotoluene (TNT) over the wavelength region 2.5 to 14.5 micrometers . We found that in the wavelength region 2.5 to 14.5 micrometers DIMP exhibits two strong photothermal peaks. The photothermal spectra of 2-mercaptoethanol and TNT exhibit a number of peaks in the wavelength region 2.5 to 14.5 micrometers and the photothermal peaks for 2-mercaptoethanol are in excellent agreement with IR absorption peaks present in its IR spectrum. The photothermal response of chemical detectors based on microcalorimetric spectroscopy has been found to vary reproducibly and sensitively as a consequence of adsorption of small number of molecules on a detector surface followed by photon irradiation and can be used for improved chemical characterization.

  6. A comparison of surface proteins in embryonal carcinoma cells and their differentiated derivatives.

    PubMed

    Keil-Dlouha, V; Paulin, D; Bagilet, L K; Keil, B

    1980-03-27

    Surface proteins from five cell lines (three embryonal carcinoma cell lines (F9, PCC4 and PCC3), teratocarcinoma-derived endodermal cells (PYS) and fibroblasts (line 3/A/1-D-3 differentiated from PCC3) were compared by two-dimensional polyacrylamide gel electrophoresis after selective iodination with 125I in the presence of lactoperoxidase. The labeled proteins were solubilized either in Nonidet P40/urea/ampholyte/mercaptoethanol solution or in Nonidet P40 only. In total, about thirty major 125I-labeled surface proteins were identified by their isoelectric point and molecular weight. 14 proteins are present in all five cell types, although their quantity or accessibility for labeling differs between differentiated and undifferentiated cells. Three proteins (200, 160 and 150 kilodaltons) are present in undifferentiated cells only. Two of them (160 and 150 kilodaltons) were solubilized by Nonidet P40/urea/ampholyte/mercaptoethanol, but not by Nonidet P40. One protein (50 kilodaltons) was found in nullipotent F9 cells only. About 14--15 proteins (including fibronectin) were released by Nonidet P40/urea/ampholyte/mercaptoethanol but not by Nonidet P40. They are presumably bound to submembrane or cytoskeleton structures by non-covalent bonds.

  7. Centrosome detection in sea urchin eggs with a monoclonal antibody against Drosophila intermediate filament proteins: characterization of stages of the division cycle of centrosomes.

    PubMed

    Schatten, H; Walter, M; Mazia, D; Biessmann, H; Paweletz, N; Coffe, G; Schatten, G

    1987-12-01

    A mouse monoclonal antibody generated against Drosophila intermediate filament proteins (designated Ah6/5/9 and referred to herein as Ah6) is found to cross-react specifically with centrosomes in sea urchin eggs and with a 68-kDa antigen in eggs and isolated mitotic apparatus. When preparations stained with Ah6 are counterstained with a human autoimmune serum whose anti-centrosome activity has been established, the immunofluorescence images superimpose exactly. A more severe test of the specificity of the antibody demands that it display all of the stages of the centrosome cycle in the cell cycle: the flattening and spreading of the compact centrosomes followed by their division and the establishment of two compact poles. The test was made by an experimental design that uses a period of exposure of the eggs to 2-mercaptoethanol. This treatment allows observation of the stages of the centrosome cycle--separation, division, and bipolarization--while the chromosomes are arrested in metaphase. Mitosis is arrested in the presence of 0.1 M 2-mercaptoethanol. Chromosomes remain in a metaphase configuration while the centrosomes divide, producing four poles perpendicular to the original spindle axis. Microtubules are still present in the mitotic apparatus, as indicated by immunofluorescence and transmission electron microscopy. When 2-mercaptoethanol is removed, the chromosomes reorient to the poles of a tetrapolar (sometimes tripolar) mitotic apparatus. During the following cycle, the blastomeres form a monopolar mitotic apparatus. The observations of the centrosome cycle with the Ah6 antibody display very clearly all the stages that have been seen or deduced from work with other probes. The 68-kDa antigen that reacts with the Ah6 monoclonal antibody to Drosophila intermediate filament proteins must be a constant component of sea urchin centrosomes because it is present at all stages of the centrosome cycle.

  8. Centrosome detection in sea urchin eggs with a monoclonal antibody against Drosophila intermediate filament proteins: characterization of stages of the division cycle of centrosomes.

    PubMed Central

    Schatten, H; Walter, M; Mazia, D; Biessmann, H; Paweletz, N; Coffe, G; Schatten, G

    1987-01-01

    A mouse monoclonal antibody generated against Drosophila intermediate filament proteins (designated Ah6/5/9 and referred to herein as Ah6) is found to cross-react specifically with centrosomes in sea urchin eggs and with a 68-kDa antigen in eggs and isolated mitotic apparatus. When preparations stained with Ah6 are counterstained with a human autoimmune serum whose anti-centrosome activity has been established, the immunofluorescence images superimpose exactly. A more severe test of the specificity of the antibody demands that it display all of the stages of the centrosome cycle in the cell cycle: the flattening and spreading of the compact centrosomes followed by their division and the establishment of two compact poles. The test was made by an experimental design that uses a period of exposure of the eggs to 2-mercaptoethanol. This treatment allows observation of the stages of the centrosome cycle--separation, division, and bipolarization--while the chromosomes are arrested in metaphase. Mitosis is arrested in the presence of 0.1 M 2-mercaptoethanol. Chromosomes remain in a metaphase configuration while the centrosomes divide, producing four poles perpendicular to the original spindle axis. Microtubules are still present in the mitotic apparatus, as indicated by immunofluorescence and transmission electron microscopy. When 2-mercaptoethanol is removed, the chromosomes reorient to the poles of a tetrapolar (sometimes tripolar) mitotic apparatus. During the following cycle, the blastomeres form a monopolar mitotic apparatus. The observations of the centrosome cycle with the Ah6 antibody display very clearly all the stages that have been seen or deduced from work with other probes. The 68-kDa antigen that reacts with the Ah6 monoclonal antibody to Drosophila intermediate filament proteins must be a constant component of sea urchin centrosomes because it is present at all stages of the centrosome cycle. Images PMID:3120191

  9. Hepatitis B e antigen polypeptides isolated from sera of individuals infected with hepatitis B virus: comparison with HBeAg polypeptide derived from Dane particles.

    PubMed

    Takahashi, K; Imai, M; Gotanda, T; Sano, T; Oinuma, A; Mishiro, S; Miyakawa, Y; Mayumi, M

    1980-09-01

    Hepatitis B e antigen (HBeAg) occurs in the serum of individuals infected with hepatitis B virus both free and in association with IgG. Utilizing a succession of steps involving salt precipitation, affinity chromatography, ion-exchange chromatography and isoelectrofocusing, we isolated free and IgG-bound forms of HBeAg from the sera of infected individuals with an overall gain in specific activity of 3000-fold and 540-fold, respectively. Polypeptide profiles of purified HBeAg preparations were studied by SDS-polyacrylamide gel electrophoresis in the presence of 2-mercaptoethanol. Both free and IgG-bound preparations revealed polypeptides with mol. wt. of 15500 (P15.5) and 16 500 (P16.5), and HBeAg activity was detected corresponding to their positions. The HBeAg polypeptides (P15.5/16.5) derived from sera were physicochemically different from the two polypeptides with HBeAg activity (P19 and P45) liberated from Dane particle cores by the conventional method involving incubation with Nonidet P40 and 2-mercaptoethanol. However, when core particles were prepared in the presence of a proteolytic enzyme, in addition to Nonidet P40 and 2-mercaptoethanol, they gave rise to HBeAg polypeptides with mol. wt. of 31000 (P31) and 15 500. Furthermore, P31 split into P15.5 when heated at 100 degrees C for 2 min. On the basis of these results, P15.5 may be assumed to be the essential polypeptide bearing HBeAg activity in the serum and also in Dane particles.

  10. Reaginic antibodies in dogs infected with Echinococcus granulosus

    PubMed Central

    Williams, J. F.; Esandi, Miguela V. Pérez

    1971-01-01

    Serum samples from twenty dogs infected with Echinococcus granulosus were tested for the presence of homocytotropic skin-sensitizing antibodies. Five of the twenty sera were positive in this test, while none of the sera from twenty normal dogs was positive. The antibody was thermolabile and susceptible to 2-mercaptoethanol reduction. Reaginic antibodies to cestode antigens have not been described previously in dogs, though they are frequently associated with helminth infection in other animals and may play a role in acquired resistance. ImagesFIG. 1FIG. 2 PMID:4994864

  11. A modified acidic approach for DNA extraction from plant species containing high levels of secondary metabolites.

    PubMed

    Cavallari, M M; Siqueira, M V B M; Val, T M; Pavanelli, J C; Monteiro, M; Grando, C; Pinheiro, J B; Zucchi, M I; Gimenes, M A

    2014-08-25

    Purified genomic DNA can be difficult to obtain from some plant species because of the presence of impurities such as polysaccharides, which are often co-extracted with DNA. In this study, we developed a fast, simple, and low-cost protocol for extracting DNA from plants containing high levels of secondary metabolites. This protocol does not require the use of volatile toxic reagents such as mercaptoethanol, chloroform, or phenol and allows the extraction of high-quality DNA from wild and cultivated tropical species.

  12. Inactivation of tyrosine 3-monooxygenase by acetone precipitation and its restoration by incubation with a sulfhydryl agent and iron.

    PubMed

    Okuno, S; Fujisawa, H

    1981-04-14

    The acetone precipitation of a partially purified tyrosine 3-monooxygenase (L-tyrosine, tetrahydropteridine: oxygen oxidoreductase (3-hydroxylating), EC 1.14.16.2) resulted in the complete loss of enzymatic activity. The enzymatic activity was restored by incubation with iron and dithiothreitol. The restoration of the activity was a pH-, temperature- and time-dependent reaction. Since cobalt, nickel, copper, zinc, manganese, cadmium, magnesium calcium and barium ions were all ineffective in restoring activity, iron ion appeared to be specifically required in the restoration of the enzyme activity. Dithiothreitol could be partially replaced in the restoration step by glutathione, 2-mercaptoethanol or cysteine.

  13. Molecular Toxicology of Chromatin

    DTIC Science & Technology

    1992-01-01

    FINAL 01 Jan 89 TO 31 Dec 91 4. ITL ANO SUS Y, L RE %UMAS MOLECULAR TOXICOLOGY OF CHROMATIN AFOSR-89-0231 PE - 61102F AUT PR - 2312 TA - A5 Dr Ernest Kun...Waterbury, CT), 2-mercaptoethanol, NAD+, NADPH, nucleo- tides, sodium tungstate , hydrogen peroxide, Tris and MES buffers from Sigma (St. Louis, MO...ml) with sodium tungstate (5.93 g, in 20 ml H20) for 1.5 h followed by extraction of the green product into ethyl acetate, washing with 0.1 N HCl, and

  14. Isolation of Estrogen Regulated Genes from MCF-7 Human Mammary Cancer Cells

    DTIC Science & Technology

    1990-07-13

    Isopropanol Klenow (1 \\J/\\il, DNA polymerase, large fragment, BRL) Lysozyme (stored at -20°C) P-Mercaptoethanol (Et~SH; Sigma) Nick-Translation Kit (BRL...M1 EtOH, and dried under vacuum. The RNA peUets are stored at -70’̂ C in 50 M1 O.OOIM EDTA. B. Large Scale RNA Purification (Chirgwin etal, 1979...of cheese cloth into a second centtifuge bottie. An equal volume of isopropanol is added, samples are placed in the freezer (-70°C for 30 minutes

  15. The M2 protein of influenza A virus is acylated.

    PubMed

    Veit, M; Klenk, H D; Kendal, A; Rott, R

    1991-06-01

    The M2 protein of influenza A virus, a 97 amino acid integral membrane protein expressed on the surface of infected cells, is covalently modified with long chain fatty acids. The fatty acid bond is sensitive to treatment with neutral hydroxylamine and mercaptoethanol, which indicates a labile thioester type linkage. Thin-layer chromatographic fatty acid analysis of [3H]myristic and [3H]palmitic acid-labelled M2 protein shows that palmitic acid is the predominant fatty acid linked to this polypeptide. Palmitoylation of M2 occurs post-translationally and causes an upward shift in the SDS-PAGE mobility of the protein.

  16. Ribonucleic Acid Polymerase Activity in Sendai Virions and Nucleocapsid

    PubMed Central

    Robinson, William S.

    1971-01-01

    After dissociation of purified Sendai virus with the neutral detergent Nonidet P-40 and 2-mercaptoethanol, it catalyzed the incorporation of ribonucleoside triphosphates into an acid-insoluble product. The enzyme activity was associated with viral nucleocapsid as well as whole virions. The reaction product was ribonucleic acid (RNA) which annealed specifically with virion RNA. Sedimentation of the 3H-RNA reaction product revealed two components, a 45S component with properties of double-stranded RNA and 4 to 6S component which appeared to be mostly single-stranded RNA. PMID:4328418

  17. Rapid separation of lysozyme from chicken egg white by reductants and thermal treatment.

    PubMed

    Chang, H M; Yang, C C; Chang, Y C

    2000-02-01

    Reductants (0.1-2.0% ascorbic acid, cysteine, or cystine and 0.04-1. 0% beta-mercaptoethanol) were added to 5-fold diluted, salted duck egg whites (commercially and laboratory prepared) and fresh egg whites (chicken and duck), and subsequently the mixtures were heated at 70 degrees C for 1-10 min. The maximal recovery and purification fold of lysozyme obtained from fresh chicken egg whites added with 1. 0% ascorbic acid were 78% and 2.4, respectively. Storage tests showed that the obtained lyophilized lysozyme powder after dialysis was stable when refrigerated at 4 degrees C for 3 months.

  18. Hemisphaericin-D, a dialysable and polymerizable protease found in Bromelia hemisphaerica.

    PubMed

    Agundis, C; Reyes, M; Córdoba, F

    1977-07-15

    Proteolytic activity was detected outside dialysis bag filled with Bromelia hemisphaerica fruit juice. The dialysable protease was concentrated and purified from small molecular weight contaminants on Sephadex G-10 columns. Acrylamide gel electrophoresis of the dialysable protease, in the presence of SDS and 2-mercaptoethanol, demonstrated a single protein band of about 8000 daltons mol. wt. The same single band with identical mobility was shown with Hemisphaericin, the enzyme retained inside the dialysis bag. The small protease, named Hemisphaericin-D was antigenic in rabbits and the antibodies cross-reacted fully with Hemisphaericin. Hemisphaericin-D appears not to be a degradation product of Hemisphaericin.

  19. Isolation and partial characterization of Bromelia hemisphaerica protease by affinity chromatography.

    PubMed

    Ochoa, N; Agundis, C; Córdoba, F

    1987-01-01

    Hemisphaericin, the protease from Bromelia hemisphaerica fruit juice was isolated by affinity chromatography in one step, using a mercurial sepharose derivative. The enzyme behaves as a single component in immunodifussion, immunoelectrophoresis and polyacrylamide electrophoresis in the presence of SDS and 2-mercaptoethanol. Association and dissociation of active components were evidenced in electrophoresis at pH 3.6 and at pH 8.6. Immunoelectrophoresis analyses also disclosed a certain degree of internal immunological heterogeneity. The results are explained by the presence of an enzyme subunit, of about 8000 daltons, endowed with polymeric properties induced by the pH and oxidative environment.

  20. Chromatographic separation of the polyoma virus proteins and renaturation of the isolated VP1 major capsid protein.

    PubMed Central

    Brady, J N; Consigli, R A

    1978-01-01

    Treatment of purified polyoma virions with 6 M guanidine-hydrochloride and 0.01 M beta-mercaptoethanol resulted in the immediate loss of both hemagglutinating and plaque-forming ability. Gel filtration through Sepharose CL-6B beads allowed separation of the dimer, VP1, VP2, VP3, and histone proteins VP4-7 in highly purified form. Renaturation of the purified VP1 protein resulted in the formation of subunits that were morphologically, biophysically, and immunologically similar to native virion capsomeres. Images PMID:211269

  1. THE INDUCTION OF A RHEUMATOID FACTOR-LIKE SUBSTANCE IN RABBITS

    PubMed Central

    Abruzzo, John L.; Christians, Charles L.

    1961-01-01

    Hyperimmunization of two groups of rabbits with killed Escherichia coli and Bacillus subtilis has resulted in the formation of a serum factor (RFLS) which resembled the human rheumatoid factor. It was a heat-stable protein that migrated electrophoretically in the gamma-beta globulin range and sedimented rapidly with ultracentrifugation. The serologic properties of the RFLS were destroyed by mercaptoethanol. It reacted primarily with rabbit gamma globulin in an aggregated state (immune complexes or physically aggregated gamma globulin) and demonstrated cross-reactivity with human gamma globulin. PMID:13859099

  2. [Characteristics of selected virulence factors of Enterobacter cloacae strains isolated from clinical specimens].

    PubMed

    Nieradko, Józef; Kurlenda, Juliana

    2004-01-01

    We demonstrated that Enterobacter cloacae possesses a selective haemolytic activity on sheep erythrocytes. All the screened strains showed a haemolytic activity on sheep erythrocytes when cultures were preincubated with beta-mercaptoethanol. The investigation circulation of the genes encoding extended spectrum beta-lactamases (ESBL) shows that beta-lactamase producers can be ascribed to specific patterns of plasmids. We also demonstrated that genetic material from E. coli can be transferred and established in selected Enterobacter cloacae strains. In a survival tests we demonstrated that similarly to Salmonella or Vibrio clinical isolates Enterobacter cloacae doesn't demonstrate acid tolerance.

  3. Biochemical Characterization of Complexes with p21, a CDK Inhibitor

    DTIC Science & Technology

    1998-08-01

    additional experiments to further characterize p28 and p40 , two potentially novel proteins that co-fractionated with p21 on glycerol gradients, sizing...well as with amino- and carboxy-terminal fragments of p21. Neither p28 nor p40 was captured in preliminary binding experiments, suggesting that these...an additional step of 1.0 HMGNB (25 mM Z 75 HEPES [pH 7.6], 1 M NaCI, 10% glycerol, 0.1% Nonidet P-40 [NP-40], 5 mM U P-mercaptoethanol, and 0.2 mM

  4. Investigating the Role of Cyclin D1 in the Promotion of Genomic Instability and Breast Cancer

    DTIC Science & Technology

    2011-09-01

    amino acids , 55µM β-mercaptoethanol, and 10µg/mL gentamicin. For growth 3 curves, 1x105 cells were plated on 35mm dishes in duplicate and counted every...ubiquitin, E1, E2, MG132, 7 ubiquitin aldehyde, okadaic acid , energy regeneration buffer (20x: 10mM ATP, 20mM Hepes pH 8 7.4, 10mM MgOAc, 300mM creatine...with hypotonic KCl solution 16 and fixed with methanol-acetic acid . Metaphase spreads were dropped onto glass slides and 17 permitted to dry, followed

  5. Electrophoretic Characteristics of Outer Membrane Proteins of Neisseria meningitidis,

    DTIC Science & Technology

    1987-07-01

    prepared from a monomer stock of 3007o (w/v) acrylamide (Sigma Chemical Company, St. Louis, Missouri) and 0.8% (w/v) N,N- methylene -bis-acrylamide...buffer containing 0.05 M Tris-HCl (pH 6.8), 10% SDS, 10% glycerol, a pinch of bromophenol blue , and 17o 2-mercaptoethanol, such that all aliquots...Brilliant Blue /Silver Stain: Upon completion of electrophoresis, gels were stained for I h in a solution of Coomassie brilliant blue R250 (Sigma

  6. [Isolation and purification of virus damaging sunflower].

    PubMed

    Zakusilo, A O; Didenko, L F; Kniazieva, N A; Boĭko, A L

    1994-01-01

    A procedure has been developed for purifying intact virus's isolate particles evoking yellow spot mosaic disease in sunflower. Purification of pathogen in 0.1 M sodium phosphate buffer, pH 8.0 containing 0.05 M Na3SO3 and 0.2% 2-mercaptoethanol is used. After first clarification extract was exposed to two cycles of high-speed centrifugation and fractionated in linear 10-40% (wt vol-1) sucrose density gradient. Virus was recovered from appropriate fractions after dialysis against 0.01 M Na2SO3.

  7. Purification and properties of a kininogenin from the venom of Vipera ammodytes ammodytes.

    PubMed Central

    Bailey, G S; Shipolini, R A

    1976-01-01

    A kininogenin (EC 3.4.21.8) was purified from the venom of Vipera ammodytes ammodytes (European sand viper) by a combination of gel filtration and ion-exchange chromatography. The enzyme is approximately six times more active than bovine trypsin in its ability to release vasoactive peptides from a plasma precursor. The kininogenin is a glycoprotein containing 18-20% by weight of carbohydrate. It showed a mol. wt. of 40500 on gel filtration. Gel electrophoresis of the reduced sample in the presence of sodium dodecyl sulphate and 2-mercaptoethanol revealed the presence of two major components of mol.wt. 34300 and 31300. The heterogeneity, which was also observed on disc electrophoresis, was removed by incubation with neuraminidase. After incubation with neuraminidase the kininogenin retained full enzymic activity and possessed an isoelectric point of pH7.2. The carbohydrate content has been decreased to 10% by weight, and the single component seen on electrophoresis in the presence of sodium dodecyl sulphate and 2-mercaptoethanol corresponded to a mol.wt. of 29500. PMID:1275896

  8. Effects of bismuth contamination on the growth and activity of soil microorganisms using thiols as model compounds.

    PubMed

    Murata, Tomoyoshi

    2006-01-01

    The present study was undertaken to obtain information about the effects of Bi contamination on soil microbial growth and activity using a series of Bi complexes with thiol compounds, including mercaptoethanol, thioglycerol, mercaptoethylamine, thioglycolic acid, thiomallic acid, reduced glutathione, 2-mercaptopropionic acid, and L-cysteine. We found that Bi complexes with mercaptoethanol, thioglycerol, and mercaptoethylamine, all of which showed lipophilicity, markedly inhibited bacterial growth in 1/10 TSB liquid media in both Eutric Cambisol (brown forest soil) and Eutric Fluvisol (brown lowland soil), with relative CFU of less than 2% at 50 micro M Bi and 6% at 25 micro M Bi. However, none of the Bi-thiols, including Highly lipophilic complexes, at 200 micro M Bi in rosebengal agar medium inhibited fungal growth, possibly because fungi have a metabolic system that protects against Bi uptake or detoxifies Bi compounds. When soil was contaminated experimentally with Bi-thiol, these complexes suppressed soil dehydrogenase activity, particularly in brown forest soil, which contains large amounts of easily decomposable organic matter. These results indicate that the effects of Bi on soil microbes may depend on mutual reactions with organic matter in the environment.

  9. Effect of particle size on activation energy and peak temperature of the thermoluminescence glow curve of undoped ZnS nanoparticles.

    PubMed

    Chandra, B P; Chandrakar, Raju Kumar; Chandra, V K; Baghel, R N

    2016-03-01

    This paper reports the effect of particle size on the thermoluminescence (TL) of undoped ZnS nanoparticles. ZnS nanoparticles were prepared using a chemical precipitation method in which mercaptoethanol was used as the capping agent. The nanoparticles were characterized by X-ray diffraction, field emission gun-scanning electron microscopy and high-resolution transmission electron microscopy. When the concentrations of mercaptoethanol used are 0, 0.005, 0.01, 0.015, 0.025, 0.040 and 0.060 M, the sizes of the nanoparticles are 2.86, 2.81, 2.69, 2.40, 2.10, 1.90 and 1.80 nm, respectively. Initially, the TL intensity of UV-irradiated ZnS nanoparticles increases with temperature, attains a peak value Im for a particular temperature Tm, and then decreases with further increases in temperature. The values of both Im and Tm increase with decreasing nanoparticle size. Whereas the activation energy decreases slightly with decreasing nanoparticle size, the frequency factor decreases significantly as the nanoparticle size is reduced. The order of kinetics for the TL glow curve of ZnS nanoparticles is 2. Expressions are derived for the dependence of activation energy (Ea) and Tm on nanoparticle size, and good agreement is found between the experimental and theoretical results.

  10. Radiotolerance of phosphatases of a Serratia sp.: potential for the use of this organism in the biomineralization of wastes containing radionuclides.

    PubMed

    Paterson-Beedle, M; Jeong, B C; Lee, C H; Jee, K Y; Kim, W H; Renshaw, J C; Macaskie, L E

    2012-08-01

    Aqueous wastes from nuclear fuel reprocessing present special problems of radiotoxicity of the active species. Cells of Serratia sp. were found previously to accumulate high levels of hydrogen uranyl phosphate (HUP) via the activity of a phosphatase enzyme. Uranium is of relatively low radiotoxicity whereas radionuclide fission products such as (90)Sr and (137)Cs are highly radiotoxic. These radionuclides can be co-crystallized, held within the bio-HUP "host" lattice on the bacterial cells and thereby removed from contaminated solution, depending on continued phosphatase activity. Radiostability tests using a commercial (60)Co γ-source showed that while cell viability and activity of purified phosphatase were lost within a few hours on irradiation, whole-cell phosphatase retained 80% of the initial activity, even after loss of cell culturability, which was increased to 100% by the incorporation of mercaptoethanol as an example radioprotectant, beyond an accumulated dose of >1.3 MGy. Using this co-crystallization approach (without mercaptoethanol) (137)Cs(+) and (85)Sr(2+) were removed from a simulated waste selectively against a 33-fold excess of Na(+).

  11. Growth hormone aggregates in the rat adenohypophysis

    NASA Technical Reports Server (NTRS)

    Farrington, M.; Hymer, W. C.

    1990-01-01

    Although it has been known for some time that GH aggregates are contained within the rat anterior pituitary gland, the role that they might play in pituitary function is unknown. The present study examines this issue using the technique of Western blotting, which permitted visualization of 11 GH variants with apparent mol wt ranging from 14-88K. Electroelution of the higher mol wt variants from gels followed by their chemical reduction with beta-mercaptoethanol increased GH immunoassayability by about 5-fold. With the blot procedure we found 1) that GH aggregates greater than 44K were associated with a 40,000 x g sedimentable fraction; 2) that GH aggregates were not present in glands from thyroidectomized rats, but were in glands from the thyroidectomized rats injected with T4; 3) that GH aggregates were uniquely associated with a heavily granulated somatotroph subpopulation isolated by density gradient centrifugation; and 4) that high mol wt GH forms were released from the dense somatotrophs in culture, since treatment of the culture medium with beta-mercaptoethanol increased GH immunoassayability by about 5-fold. Taken together, the results show that high mol wt GH aggregates are contained in secretory granules of certain somatotrophs and are also released in aggregate form from these cells in vitro.

  12. RNA Extraction from Animal and Human's Cancerous Tissues: Does Tissue Matter?

    PubMed

    Samadani, Ali Akbar; Nikbakhsh, Novin; Fattahi, Sadegh; Pourbagher, Roghayeh; Aghajanpour Mir, Seyyed Mohsen; Mousavi Kani, Narges; Abedian, Zeinab; Akhavan-Niaki, Haleh

    2015-01-01

    The reliability of gene expression profiling, based technologies and methods to find transcriptional differences representative of the original samples is influenced by the quality of the extracted RNA. Hence, RNA extraction is the first step to investigate the gene expression and its function. Consequently, the quality of extracted RNA is really significant. Correspondingly, this research was accomplished to optimize the RNA extraction methods and compare the amounts of tissue or quality of tissue. Relatively, the cancerous tissue of human stomach in fresh and frozen conditions and also the mouse fresh tissue were studied. Some factors like the amount of samples, efficacy differences of diverse extraction buffers (TriPure, Trizol) and also the efficacy of b-mercaptoethanol were compared and investigated. The results indicated that the less amount (1-2 mg) compared to other amounts (2-5 mg, 5-15 mg) yielded the best quality and the RNA bands (5S, 18S, 28S) were observed perfectly. Relatively, comparing and measuring some kinds of buffers (Trizol, TriPure) indicated no difference in RNA extraction quality. The last investigated factor was the effect of b- mercaptoethanol which was used along with TriPure to remove the RNAse. Conclusively, no effective impression was observed.

  13. Degradation of mono-oleoylglycerol, trioleoylglycerol and phosphatidylcholine in emulsions and lipoproteins by rat hepatic acylglycerol lipase.

    PubMed Central

    Belcher, J D; Sisson, P J; Waite, M

    1985-01-01

    The purpose of this study was to characterize the lipolytic activities released by heparin from rat livers. Heparin perfusates of rat livers degraded monooleoylglycerol, trioleoylglycerol and phosphatidylcholine in emulsions as well as in chylomicrons, chylomicron remnants, low-density lipoprotein/high-density lipoprotein-1 (LDL/HDL-1) and high-density lipoprotein-2 (HDL-2). The preferred substrate was mono-oleoylglycerol. Heparin perfusates were separated by chromatography on either heparin-Sepharose or N-desulphated, N-acetylated heparin-Sepharose into at least two related lipases which differed in their ability to hydrolyse HDL-2 phosphatidylcholine, but not in their ability to degrade mono-oleoylglycerol, trioleoylglycerol and phosphatidylcholine in emulsions. The sodium dodecyl sulphate (SDS)/polyacrylamide-gel-electrophoretic patterns of heparin perfusates purified on either normal or N-desulphated N-acetylated heparin-Sepharose were the same, despite differences in their ability to degrade HDL-2 phosphatidylcholine. There was a single band of Mr 56000 without 2-mercaptoethanol in the SDS disruption buffer and three major bands, of Mr 62000, 59000 and 56000, with 2-mercaptoethanol present. When mono-oleoylglycerol lipase was purified 161-fold, there was a concomitant enrichment of the Mr-56000 protein. Images Fig. 2. Fig. 3. PMID:4038271

  14. Effects of proteolysis and reduction on phosphatase and ROS-generating activity of human tartrate-resistant acid phosphatase.

    PubMed

    Fagerlund, Katja M; Ylipahkala, Hannele; Tiitinen, Sari L; Janckila, Anthony J; Hamilton, Susan; Mäentausta, Olli; Väänänen, H Kalervo; Halleen, Jussi M

    2006-05-15

    Osteoclasts and macrophages express high amounts of tartrate-resistant acid phosphatase (TRACP), an enzyme with unknown biological function. TRACP contains a disulfide bond, a protease-sensitive loop peptide, and a redox-active iron that can catalyze formation of reactive oxygen species (ROS). We studied the effects of proteolytic cleavage by trypsin, reduction of the disulfide bond by beta-mercaptoethanol, and reduction of the redox-active iron by ascorbate on the phosphatase and ROS-generating activity of baculovirus-generated recombinant human TRACP. Ascorbate alone and trypsin in combination with beta-mercaptoethanol increased k(cat)/K(m) of the phosphatase activity seven- to ninefold. The pH-optimum was changed from 5.4-5.6 to 6.2-6.4 by ascorbate and trypsin cleavage. Trypsin cleavage increased k(cat)/K(m) of the ROS-generating activity 2.5-fold without affecting the pH-optimum (7.0). These results suggest that the protease-sensitive loop peptide, redox-active iron, and disulfide bond are important regulatory sites in TRACP, and that the phosphatase and ROS-generating activity are performed with different reaction mechanisms.

  15. Immune and mitogenic responses by BALB/c, C3H/HeJ, and nude mice to Brucella abortus bacterin and lipopolysaccharide.

    PubMed

    Spellman, J M; Reed, N D

    1979-05-01

    The immunogenic and mitogenic properties of Brucella abortus 1119-3 bacterin (BA) and biologically active B. abortus lipopolysaccharide (BA-LPS) were studied using normal and athymic (nude) BALB/c and C3H/HeJ mice. Although BA stimulated 2-mercaptoethanol-sensitive (2-ME-S) primary and secondary antibody responses in all mice, nude mice, in contrast to normal BALB/c and C3H/HeJ mice, did not make substantial 2-mercaptoethanol-resistant (2-ME-R) antibody responses. Similarly, all mice injected with BA-LPS made 2-ME-S primary responses, and the secondary response of thymus-bearing mice contained a substantial 2-ME-R component. Collectively, these observations suggest that although both BA and BA-LPS can stimulate thymus-independent 2-ME-S antibody synthesis, thymus-derived cells are required for optimal immune responses containing a 2-ME-R component. The antibody responses of normal BALB/c and C3H/HeJ mice to BA and BA-LPS were qualitatively and quantitatively similar. Both BA and BA-LPS were mitogenic for spleen cells from normal and nude BALB/c and C3H/HeJ mice but not for thymus cells from normal BALB/c or C3H/HeJ mice, suggesting that both preparations are B-cell mitogens.

  16. Purification and properties of the enzymes from Drosophila melanogaster that catalyze the conversion of dihydroneopterin triphosphate to the pyrimidodiazepine precursor of the drosopterins.

    PubMed

    Wiederrecht, G J; Brown, G M

    1984-11-25

    The enzyme system responsible for the conversion of 2-amino-4-oxo-6-(D-erythro-1',2',3'-trihydroxypropyl)-7,8-dihyd roptridine triphosphate (dihydroneopterin triphosphate or H2-NTP) to 2-amino-4-oxo-6-acetyl-7,8-dihydro-3H,9H-pyrimido[4,5-b]-[1,4]diazepine (pyrimidodiazepine or PDA), a precursor to the red eye pigments, he drosopterins, has been purified from the heads of Drosophila melanogaster. The PDA-synthesizing system consists of two components, a heat-stable enzyme and a heat-labile enzyme. The heat-stable enzyme can be replaced by sepiapterin synthase A, a previously purified enzyme required for the Mg2+-dependent conversion of H2-NTP to an unstable compound that appears to be 6-pyruvoyltetrahydropterin (pyruvoyl-H4-pterin). The heat-labile enzyme, purified to near-homogeneity and termed PDA synthase (Mr = 48,000), catalyzes the conversion of pyruvoyl-H4-pterin to PDA in a reaction requiring the presence of reduced glutathione. Because PDA is two electrons more reduced than pyruvoyl-H4-pterin, the reducing power required for this transformation is probably supplied by glutathione. The PDA-synthesizing system requires the presence of another thiol-containing compound such as 2-mercaptoethanol when incubation conditions 2-mercaptoethanol is no longer required. Evidence is presented to indicate that the Drosophila eye color mutant, sepia, is missing PDA synthase.

  17. Cadmium-binding proteins of three marine molluscs and characterization of two cadmium-binding glycoproteins from the hepatopancreas of a whelk, Buccinum tenuissimum

    SciTech Connect

    Dohi, Y.; Kosaka, K.; Ohba, K.; Yoneyama, Y.

    1986-03-01

    The cadmium-binding proteins were shown to exist in the hepatopancreas of three molluscs, a whelk, Buccinum tenuissimum, a turbo, Batillus cornutus, and a squid, Todarodes pacificus. Cadmium was efficiently accumulated in nature to a mean concentration of 119, 33, and 50 ..mu..g/g wet tissue in the hepatopancreas of three species of molluscs. Separation of the soluble fraction by Sephadex G-75 in the presence of 2-mercaptoethanol revealed that cadmium was mainly bound to the protein fraction FII of molecular weight 10,000. Two cytoplasmic cadmium-binding glycoproteins from the hepatopancreas of Buccinum tenuissimum were purified to homogeneity by Sephadex G-75 gel filtration and double DEAE-Sephadex A-25 chromatographies in the presence of 2-mercaptoethanol. These two cadmium-binding glycoproteins, termed FII/sub A/ and FII/sub B/, had molecular weights of 8000 and 13,000 and consisted of 52 and 94 amino acid residues, respectively. The sugar contents of FII/sub A/ and FII/sub B/ were about 20.5% and 8.7% by weight, respectively, consisting of galactose, mannose, fucose, and amino sugar. Both showed strong metal-binding ability, especially for cadmium, copper, and mercury.

  18. Epitope Structure of the Carbohydrate Recognition Domain of Asialoglycoprotein Receptor to a Monoclonal Antibody Revealed by High-Resolution Proteolytic Excision Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Stefanescu, Raluca; Born, Rita; Moise, Adrian; Ernst, Beat; Przybylski, Michael

    2011-01-01

    Recent studies suggest that the H1 subunit of the carbohydrate recognition domain (H1CRD) of the asialoglycoprotein receptor is used as an entry site into hepatocytes by hepatitis A and B viruses and Marburg virus. Thus, molecules binding specifically to the CRD might exert inhibition towards these diseases by blocking the virus entry site. We report here the identification of the epitope structure of H1CRD to a monoclonal antibody by proteolytic epitope excision of the immune complex and high-resolution MALDI-FTICR mass spectrometry. As a prerequisite of the epitope determination, the primary structure of the H1CRD antigen was characterised by ESI-FTICR-MS of the intact protein and by LC-MS/MS of tryptic digest mixtures. Molecular mass determination and proteolytic fragments provided the identification of two intramolecular disulfide bridges (seven Cys residues), and a Cys-mercaptoethanol adduct formed by treatment with β-mercaptoethanol during protein extraction. The H1CRD antigen binds to the monoclonal antibody in both native and Cys-alkylated form. For identification of the epitope, the antibody was immobilized on N-hydroxysuccinimide (NHS)-activated Sepharose. Epitope excision and epitope extraction with trypsin and FTICR-MS of affinity-bound peptides provided the identification of two specific epitope peptides (5-16) and (17-23) that showed high affinity to the antibody. Affinity studies of the synthetic epitope peptides revealed independent binding of each peptide to the antibody.

  19. Evidence for an Elongation/Reduction/C1-Elimination Pathway in the Biosynthesis of n-Heptane in Xylem of Jeffrey Pine.

    PubMed Central

    Savage, T. J.; Hristova, M. K.; Croteau, R.

    1996-01-01

    The biosynthetic pathway to n-heptane was investigated by examining the effect of the [beta]-keto acyl-acyl carrier protein synthase inhibitor (2R,3S)-2,3-epoxy-4-oxo-7E,10E-dodecadienamide (cerulenin), a thiol reagent ([beta]-mercaptoethanol), and an aldehydetrapping reagent (hydroxylamine) on the biosynthesis of n-[14C]heptane and putative intermediates in xylem sections of Jeffrey pine (Pinus jeffreyi Grev.& Balf.) incubated with [14C]acetate. Cerulenin inhibited C18 fatty acid biosynthesis but had relatively little effect on radiolabel incorporation into C8 fatty acyl groups and n-heptane. [beta]-Mercaptoethanol inhibited n-heptane biosynthesis, with a corresponding accumulation of radiolabel into both octanal and 1-octanol, whereas hydroxylamine inhibited both n-heptane and 1-octanol biosynthesis, with radiolabel accumulation in octyl oximes. [14C]Octanal was converted to both n-heptane and 1-octanol when incubated with xylem sections, whereas [14C]1-octanol was converted to octanal and n-heptane in a hydroxylamine-sensitive reaction. These results suggest a pathway for the biosynthesis of n-heptane whereby acetate is polymerized via a typical fatty acid synthase reaction sequence to yield a C8 thioester, which subsequently undergoes a two-electron reduction to generate a free thiol and octanal, the latter of which alternately undergoes an additional, reversible reduction to form 1-octanol or loss of C1 to generate n-heptane. PMID:12226360

  20. Cadmium-binding proteins of three marine molluscs and characterization of two cadmium-binding glycoproteins from the hepatopancreas of a whelk, Buccinum tenuissimum.

    PubMed Central

    Dohi, Y; Kosaka, K; Ohba, K; Yoneyama, Y

    1986-01-01

    The cadmium-binding proteins were shown to exist in the hepatopancreas of three molluscs, a whelk, Buccinum tenuissimum, a turbo, Batillus cornutus, and a squid, Todarodes pacificus. Cadmium was efficiently accumulated in nature to a mean concentration of 119, 33, and 50 micrograms/g wet tissue in the hepatopancreas of three species of molluscs, and 30%, 11%, and 43% of the element in each tissue of whelk, turbo, and squid was extracted to the soluble fraction, respectively. Separation of the soluble fraction by Sephadex G-75 in the presence of 2-mercaptoethanol revealed that cadmium was mainly bound to the protein fraction FII of molecular weight 10,000. Two cytoplasmic cadmium-binding glycoproteins from the hepatopancreas of Buccinum tenuissimum were purified to homogeneity by Sephadex G-75 gel filtration and double DEAE-Sephadex A-25 chromatographies in the presence of 2-mercaptoethanol. These two cadmium-binding glycoproteins, termed FIIA and FIIB, had molecular weights of 8000 and 13,000 and consisted of 52 and 94 amino acid residues, respectively. Three and two cysteine residues in FIIA and FIIB, respectively, were found and two more half-cystine were also detected in FIIB. The sugar contents of FIIA and FIIB were about 20.5% and 8.7% by weight, respectively, consisting of galactose, mannose, fucose, and amino sugar. Both showed strong metal-binding ability, especially for cadmium, copper, and mercury. Images FIGURE 4. PMID:3709465

  1. Softening of cattle hoof soles and swelling of heel horn by environmental agents.

    PubMed

    Gregory, N; Craggs, L; Hobson, N; Krogh, C

    2006-08-01

    Bovine soles and shavings from the heel were used in laboratory tests that examined the softening and swelling effects of rainwater, cow slurry (faeces plus urine), urine, silage effluent, and washings from recently laid concrete. Formalin, glutaraldehyde and butyraldehyde were compared for their ability to prevent softening induced by water, urine or urea plus 2-mercaptoethanol. Exposure to rainwater, slurry or urine for 72 h softened the soles on average by 16, 13 and 14 Shore Durometer Units. Silage effluent had less softening effect on soles (7 Shore Durometer Units), and pre-treating heel shavings with silage effluent reversed the swelling effect of water. Washings and scrapings taken from 3- and 7-d-old concrete surfaces prepared from Portland cement, caused swelling in heel shavings by a factor of 1.5 and 1.3. Formaldehyde, glutaraldehyde and butyraldehyde pre-treatment reduced the sole softening effect of urea plus 2-mercaptoethanol in cow soles. Formaldehyde and glutaraldehyde pre-treatment reduced the sole softening effect of urine, and formaldehyde was effective at reducing concrete washings-induced swelling. The findings are relevant to solar bruising and ulceration in cattle.

  2. Swelling of cattle heel horn by urine.

    PubMed

    Gregory, N G

    2004-03-01

    To understand the likely mechanisms responsible for heel horn softening when cattle stand in their own effluent. To examine the effectiveness of some footbath chemicals in preventing heel horn softening. Shavings from the heels of cattle were used in a laboratory test to examine the swelling effects of cow urine, urea, sulphide and ammonia. Formalin, glutaraldehyde, glyoxal, zinc sulphate, copper sulphate, alum, tannic acid and a compound containing nitrocellulose plus nylon, were compared for their ability to prevent swelling in heel shavings induced by urea plus 2-mercaptoethanol. Cow urine caused heel horn to swell. Urea caused swelling at concentrations normally found in cow urine. Sulphide caused swelling at concentrations normally found in cow slurry. Low concentrations of ammonia solution also resulted in swelling. Formalin and glutaraldehyde prevented swelling induced by high concentrations of urea plus 2-mercaptoethanol. Copper sulphate had a moderate anti-swelling effect. Zinc sulphate, alum, tannic acid, and nitrocellulose plus nylon were relatively ineffective in preventing swelling. Cow urine can cause degradation of heel horn in cattle feet. The chemical agents that cause this could be urea, sulphide anions and ammonia. Degradation by urine can be prevented by pretreating heel horn with formalin. Glutaraldehyde may be an effective noncarcinogenic alternative to formalin.

  3. Growth hormone aggregates in the rat adenohypophysis

    NASA Technical Reports Server (NTRS)

    Farrington, M.; Hymer, W. C.

    1990-01-01

    Although it has been known for some time that GH aggregates are contained within the rat anterior pituitary gland, the role that they might play in pituitary function is unknown. The present study examines this issue using the technique of Western blotting, which permitted visualization of 11 GH variants with apparent mol wt ranging from 14-88K. Electroelution of the higher mol wt variants from gels followed by their chemical reduction with beta-mercaptoethanol increased GH immunoassayability by about 5-fold. With the blot procedure we found 1) that GH aggregates greater than 44K were associated with a 40,000 x g sedimentable fraction; 2) that GH aggregates were not present in glands from thyroidectomized rats, but were in glands from the thyroidectomized rats injected with T4; 3) that GH aggregates were uniquely associated with a heavily granulated somatotroph subpopulation isolated by density gradient centrifugation; and 4) that high mol wt GH forms were released from the dense somatotrophs in culture, since treatment of the culture medium with beta-mercaptoethanol increased GH immunoassayability by about 5-fold. Taken together, the results show that high mol wt GH aggregates are contained in secretory granules of certain somatotrophs and are also released in aggregate form from these cells in vitro.

  4. Self-assembly of keratin peptides: Its implication on the performance of electrospun PVA nanofibers

    PubMed Central

    Kadirvelu, Kavitha; Fathima, Nishter Nishad

    2016-01-01

    Drawing inspiration from the field of designer self-assembling materials, this work is aimed to focus on the self-assembling nature of extracted peptides. Hair keratin, a proteinacious reject in tanning industry has been chosen since they have been extracted and used for wide range of applications. Keratin source was subjected to five hydrolysis treatments (viz., sulphitolysis, β-mercaptoethanol, ionic liquid, thioglycolic acid and alkali) and assayed for functional groups. This was followed by the prediction of secondary structure using circular dichroism, determining the microstructural level to which the extracted peptide has self-assembled. Sulphitolysis and thioglycolic acid based hydrolysates exist in monomeric conformation, whereas β-mercaptoethanol based hydrolysate exhibited dimeric conformation. The subsequent part of the study is to incorporate these peptides into the nanofibers to study the structural implication of keratin peptides on its characteristics. Accordingly, the peptides were electrospun with PVA and subjected to morphological, mechanical, thermal and biological characterizations. Monomeric nanofiber mat has high tensile strength of around 5.5 MPa and offered lower mass transport resistance, whereas dimeric mat has high Tm of around 290 °C and was more biocompatible. These results help in understanding the extraction-structure-function aspect of the hydrolysates stressing the role of extraction methods on the choice of application. PMID:27812004

  5. Selective killing of human T cell lymphotropic virus type I-transformed cell lines by a damavaricin Fc derivative.

    PubMed

    Ito, S; Yamamoto, N; Nomoto, K; Sasaki, K; Onodera, K

    1989-05-01

    n-Pentyl ether of damavaricin Fc (n-pentyl DvFc) preferentially killed human T-cell lymphotropic virus type I (HTLV-I)-transformed cell lines. The mechanism of action of the drug was investigated using MT-4 cells. Cytotoxic action was diminished by the removal of n-pentyl DvFc from the culture or by the addition of sulfhydryl compounds such as 2-mercaptoethanol and dithiothreitol. The killing activity of n-pentyl DvFc was also diminished by membrane-acting agents including quinidine and diphenylhydantoin. Influx and subsequent efflux of Ca2+ were observed when either HTLV-I infected (MT-4 cells) or uninfected cells were treated with n-pentyl DvFc. An efflux of K+ was observed in HTLV-I infected MT-4 cells immediately after the exposure of the cells to n-pentyl DvFc. The K+ efflux, however, was not observed in the uninfected T cells. n-Pentyl DvFc seems to act primarily on the cell surface of MT-4 cells, leading to the perturbation of membrane function. The restoration of cell growth, however, is critically dependent on the presence of dithiothreitol and 2-mercaptoethanol, implying a role for a free sulfhydryl group in the killing activity.

  6. Immunoglobulin profiles in acute Brucellosis experimentally induced by Brucella canis in BALB/c mice.

    PubMed

    Lee, Sung-Il; Islam, Md Ariful; Khatun, Mst Minara; Choi, Gyu-Young; Jung, Jae-Myeong; Baek, Byeong-Kirl; Kakoma, Ibulaimu

    2010-11-01

    This study evaluated profiles of immunoglobulin (Ig; IgA, IgG, IgG1, and IgG2a) response in experimental brucellosis induced with Brucella canis in BALB/c mice during an 8-week infection period. Six- to 8-week-old BALB/c mice (n = 36) were experimentally infected with 1 × 10(9) CFU of B. canis via the intraperitoneal route. Serial serum samples were collected from the mice at 0, 3, 7, 14, 21, 28, 35, 42, 49, and 56 days after inoculation. The sera were tested by the rapid slide agglutination test (RSAT) and 2-mercaptoethanol-RSAT and indirect enzyme-linked immunosorbent assay. Sera tested positive for B. canis by the RSAT and 2-mercaptoethanol-RSAT beginning from 7 days after inoculation until the end of the experiment. The IgA response was detected at 14 days after infection and reached peak levels at 21 days after infection. The IgG antibody responses were detected at 7 days after infection and reached the peak value at 35 days after infection. Data of our study demonstrated IgG2a-dominant responses over IgG1 during the course of infection (p > 0.05).

  7. Oxidative Activation of Bacillus cereus Spores

    PubMed Central

    Cochran, Stuart A.; Ordal, Z. John

    1973-01-01

    A study was made of the activation of Bacillus cereus strain T spores by using the oxidizing agent sodium perborate. The degree of activation was measured with constant germination conditions by using L-alanine, inosine, adenosine, and L-alanine plus adenosine as germination stimulants. The germinal response following the various treatments was compared with the responses obtained with heat activation. It was concluded that the optimal time for activation with 30 mM sodium perborate at room temperature was about 4 hr. If the exposure time was greatly extended, the spores would germinate spontaneously. When the perborate treatment followed heat activation, the germinal response to L-alanine was stimulated, to inosine retarded and without apparent effect for adenosine or L-alanine plus adenosine. Results of experiments designed to demonstrate deactivation by slow oxidation showed that spores activated with sodium perborate were not deactivated by slow oxidation, whereas those activated by heat were. A deactivation study using mercaptoethanol as the deactivation agent showed that both methods of activation could be deactivated after a 24-hr exposure, but this deactivation was reversible by extending the exposure to mercaptoethanol. The results of heat-sensitivity studies revealed that about 70% of the sodium perborate-activated spores were heat sensitive after 60 min in a germination menstruum of L-alanine plus adenosine, whereas similarly treated heat-activated and nonactivated spores were about 99.99% heat sensitive, respectively. PMID:4632848

  8. Purification and Partial Characterization of Maize (Zea mays L.) β-Glucosidase

    PubMed Central

    Esen, Asim

    1992-01-01

    Maize (Zea mays L.) β-glucosidase (β-d-glucoside glucohydrolase, EC 3.2.1.21) was extracted from the coleoptiles of 5- to 6-day-old maize seedlings with 50 millimolar sodium acetate, pH 5.0. The pH of the extract was adjusted to 4.6, and most of the contaminating proteins were cryoprecipitated at 0°C for 24 hours. The pH 4.6 supernatant from cryoprecipitation was further fractionated by chromatography on an Accell CM column using a 4.8 to 6.8 pH gradient of 50 millimolar sodium acetate, which yielded the enzyme in two homogeneous, chromatographically different fractions. Purified enzyme was characterized with respect to subunit molecular weight, isoelectric point, amino acid composition, NH2-terminal amino acid sequence, pH and temperature optima, thermostability, and activity and stability in the presence of selected reducing agents, metal ions, and alkylating agents. The purified enzyme has an estimated subunit molecular mass of 60 kilodaltons, isoelectric point at pH 5.2, and pH and temperature optima at 5.8 and 50°C, respectively. The amino acid composition data indicate that the enzyme is rich in Glx and Asx, the sum of which approaches 25%. The sequence of the first 20 amino acids in the N-terminal region was H2N-Ser-Ala-Arg-Val-Gly-Ser-Gln-Asn-Gly-Val-Gln-Met-Leu-Ser-Pro-(Ser?) -Glu-Ile-Pro-Gln, and it shows no significant similarity to other proteins with known sequence. The enzyme is extremely stable at 0 to 4°C up to 1 year but loses activity completely at and above 55°C in 10 minutes. Likewise, the enzyme is stable in the presence of or after treatment with 500 millimolar 2-mercaptoethanol, and it is totally inactivated at 2000 millimolar 2-mercaptoethanol. Such metal ions as Hg2+ and Ag+ reversibly inhibit the enzyme at micromolar concentrations, and inhibition could be completely overcome by adding 2-mercaptoethanol at molar excess of the inhibitory metal ion. The alkylating agents iodoacetic acid and iodoacetamide irreversibly inactivate the

  9. Involvement of disulphide bonds in the renal sodium/phosphate co-transporter NaPi-2.

    PubMed Central

    Xiao, Y; Boyer, C J; Vincent, E; Dugré, A; Vachon, V; Potier, M; Béliveau, R

    1997-01-01

    The rat renal brush border membrane sodium/phosphate co-transporter NaPi-2 was analysed in Western blots with polyclonal antibodies raised against its N-terminal and C-terminal segments. Under reducing conditions, proteins of 45-49 and 70-90 kDa (p45 and p70) were detected with N-terminal antibodies, and proteins of 40 and 70-90 kDa (p40 and p70) were detected with C-terminal antibodies. p40 and p45 apparently result from a post-translational cleavage of NaPi-2 but remain linked through one or more disulphide bonds. Glycosidase digestion showed that both polypeptides are glycosylated; the cleavage site could thus be located between Asn-298 and Asn-328, which have been shown to constitute the only two N-glycosylated residues in NaPi-2. In the absence of reducing agents, both N-terminal and C-terminal antibodies detected p70 and a protein of 180 kDa (p180), suggesting the presence of p70 dimers. Much higher concentrations of beta-mercaptoethanol were required to produce a given effect in intact membrane vesicles than in solubilized proteins, indicating that the affected disulphide bonds are not exposed at the surface of the co-transporter. Phosphate transport activity decreased with increasing concentrations of reducing agents [beta-mercaptoethanol, dithiothreitol and tris-(2-carboxyethyl)phosphine] and was linearly correlated with the amount of p180 detected. The target sizes estimated from the radiation-induced loss of intensity of p40, p70 and p180 were all approx. 190 kDa, suggesting that NaPi-2 exists as an oligomeric protein in which the subunits are sufficiently close to one another to allow substantial energy transfer between the monomers. When protein samples were pretreated with beta-mercaptoethanol [2.5% and 5% (v/v) to optimize the detection of p40 and p70] before irradiation, target sizes estimated from the radiation-induced loss of intensity of p40 and p70 were 74 and 92 kDa respectively, showing the presence of disulphide bridges in the molecular

  10. Development of primary cell cultures using hemocytes and phagocytic tissue cells of Locusta migratoria: an application for locust immunity studies.

    PubMed

    Duressa, Tewodros Firdissa; Huybrechts, Roger

    2016-01-01

    Insect cell cultures played central roles in unraveling many insect physiological and immunological processes. Regardless, despite imminent needs, insect cell lines were developed primarily from Dipteran and Lepidopteran orders, leaving many important insects such as Orthopteran locusts under-represented. Besides the lack of cell lines, the slow progress in development of in vitro techniques is attributed to poor communications between different laboratories regarding optimized primary cell cultures. Therefore, we report here about methods developed for primary cell culture of Locusta migratoria hemocyte and phagocytic tissue cells by which we could maintain viable hemocytes in vitro for over 5 d and phagocytic tissue cells for over 12 d. 2-Mercaptoethanol and phenyl-thiourea supplements in Grace's medium together with addition of fetal bovine serum 30 min after cell seeding resulted in a successful setup of the primary cell cultures and a week-long survival of the hemocytes and phagocytic tissue cells in vitro.

  11. Methods to uncover an antibody epitope in the KPI domain of Alzheimer's amyloid precursor protein for immunohistochemistry in human brain.

    PubMed

    Campbell, E; Pearson, R C; Parkinson, D

    1999-11-15

    A novel polyclonal antibody (Ab993), specific for a KPI domain epitope of APP, was characterised for use in immunoprecipitation, Western blotting and immunohistochemistry. Conditioned medium from NTera2/D1 cells was used for immunoprecipitation and Western blots. Paraffin-embedded human brain sections were used for immunohistochemistry. The antibody recognised KPI-containing APP on Western blots after standard solubilisation but immunoprecipitation of soluble APP required reduction with 2-mercaptoethanol followed by alkylation of reduced sulphydryl bonds with sodium iodoacetate. Immunohistochemical staining of human brain sections was significantly enhanced by this pre-treatment. Microwaving of sections also increased immunolabelling, by a mechanism that was additive to reduction and alkylation. Incubation in 80% formic acid did not confer any enhancement of immunoreactivity. Ab993, applied with the methods reported here, is expected to be valuable in investigations of the pathogenesis of Alzheimer's disease to determine the source of the beta-amyloid peptide.

  12. Quantification of structurally related aliphatic amino alcohols in l-valinol by hydrophilic interaction liquid chromatography separation combined with postcolumn derivatization and fluorescence detection.

    PubMed

    Douša, Michal; Stach, Jan; Gibala, Petr; Lemr, Karel

    2016-03-01

    The amino alcohols in l-valinol were effectively separated and quantified using hydrophilic interaction chromatography with fluorescence detection. The influence of the mobile phase (salt type, buffer concentration, and pH) on retention was studied. A column TSKgel amide and mobile phase consisting of 10 mM acetate buffer pH 4.0 and acetonitrile (20:80, v/v) provided well-separated symmetric peaks of analytes. Fluorescence detection was performed using postcolumn derivatization with o-phtaldialdehyde/2-mercaptoethanol at an excitation and emission wavelength of 345 and 450 nm, respectively. Simple sample pretreatment and very high sensitivity represent the main advantages of the developed method. After validation, the method was successfully applied to the analysis of commercial samples of l-valinol.

  13. The effect of limited proteolysis by trypsin and chymotrypsin on bovine colostral IgG1.

    PubMed Central

    Brock, J H; Arzabe, F R; Ortega, F; Piñeiro, A

    1977-01-01

    Limited proteolysis of bovine colostral IgG1 by trypsin caused loss of specific antibody activity but column chromatography showed that relatively little cleavage into fragements had occurred. Polyacrlamide-agarose SDS electrophoresis of the 2-mercaptoethanol-treated digest revealed, however, that extensive cleavage of light chains had occurred even though most of the material before reduction had a mol. wt close to that of undigested IgG1. Although a Fab-type fragment was detected in the digest by immunoelectrophoresis it appeared to be only a minor component. Chymotrypsin had little effect upon either the structure or antibody activity of IgG1. These findings may explain the effect of trypsin and chymotrypsin on the bactericidal activity of colostral antibodies. Images Figure 2 Figure 3 PMID:321343

  14. Studies on lectins. XXXVII. Isolation and characterization of the lectin from Jimson-weed seeds (Datura stramonium L.).

    PubMed

    Horejsí, V; Kocourek, J

    1978-01-25

    The lectin of Jimson-weed seeds (Datura stramonium L.) was isolated by affinity chromatography on a polysaccharide mixture from mycelium of Aspergillus niger. The lectin yields two bands on disc electrophoresis, it has sedimentation coefficient s20,w = 3.8 S and its apparent molecular weight estimated by thin layer gel chromatography is 120,000. The lectin reduced with mercaptoethanol yields on polyacrylamide gel electrophoresis in the presence of dodecyl sulfate three zones corresponding to subunits of molecular weight 72,000, 45,000 and 25,000. The lectin contains large amounts of cystine, glycine, 6.3% of hydroxyproline residues, 4.5% glucosamine and 28% of neutral sugar, predominantly arabinose. The lectin is nonspecific in human erythrocyte ABO system, it is not inhibited by simple sugars but is inhibited by a partial hydrolysate of chitin-containing mixture of polysaccharides from Aspergillus niger.

  15. Optimized and validated flow-injection spectrophotometric analysis of topiramate, piracetam and levetiracetam in pharmaceutical formulations.

    PubMed

    Hadad, Ghada M; Abdel-Salam, Randa A; Emara, Samy

    2011-12-01

    Application of a sensitive and rapid flow injection analysis (FIA) method for determination of topiramate, piracetam, and levetiracetam in pharmaceutical formulations has been investigated. The method is based on the reaction with ortho-phtalaldehyde and 2-mercaptoethanol in a basic buffer and measurement of absorbance at 295 nm under flow conditions. Variables affecting the determination such as sample injection volume, pH, ionic strength, reagent concentrations, flow rate of reagent and other FIA parameters were optimized to produce the most sensitive and reproducible results using a quarter-fraction factorial design, for five factors at two levels. Also, the method has been optimized and fully validated in terms of linearity and range, limit of detection and quantitation, precision, selectivity and accuracy. The method was successfully applied to the analysis of pharmaceutical preparations.

  16. Detection of Brucella sp. infection through serological, microbiological, and molecular methods applied to buffaloes in Maranhão State, Brazil.

    PubMed

    Dos Santos, Larissa Sarmento; Sá, Joicy Cortez; Dos Santos Ribeiro, Diego Luiz; Chaves, Nancyleni Pinto; da Silva Mol, Juliana Pinto; Santos, Renato Lima; da Paixão, Tatiane Alves; de Carvalho Neta, Alcina Vieira

    2017-04-01

    The aim of the current study is to diagnose Brucella spp. infection using methods such as serology, bacterial isolation, and molecular analysis in buffaloes bred in Maranhão State. In order to do so, 390 samples of buffalo serum were subjected to serological tests, to Rose Bengal Plate Test (RBPT) and to 2-mercaptoethanol (2-ME) combined with slow agglutination test (SAT). Vaginal swabs were collected from seropositive animals and subjected to bacterial isolation and to generic PCR. According to the serological test, 16 animals had a positive reaction to the confirmatory test (2-ME/SAT). As for bacterial isolation, three samples resulted in the isolation of Brucella spp.-characteristic colonies, which were confirmed through PCR. These results confirmed Brucella spp. infection in the buffalo herd from Maranhão State.

  17. Stenotrophomonas sp. RZS 7, a novel PHB degrader isolated from plastic contaminated soil in Shahada, Maharashtra, Western India.

    PubMed

    Wani, S J; Shaikh, S S; Tabassum, B; Thakur, R; Gulati, A; Sayyed, R Z

    2016-12-01

    This paper reports an isolation and identification of novel poly-β-hydroxybutyrate (PHB) degrading bacterium Stenotrophomonas sp. RZS 7 and studies on its extracellular PHB degrading depolymerase enzyme. The bacterium isolated from soil samples of plastic contaminated sites of municipal area in Shahada, Maharashtra, Western India. It was identified as Stenotrophomonas sp. RZS 7 based on polyphasic approach. The bacterium grew well in minimal salt medium (MSM) and produced a zone (4.2 mm) of PHB hydrolysis on MSM containing PHB as the only source of nutrient. An optimum yield of enzyme was obtained on the fifth day of incubation at 37 °C and at pH 6.0. Further increase in enzyme production was recorded with Ca(2+) ions, while other metal ions like Fe(2+) (1 mM) and chemical viz. mercaptoethanol severally affected the production of enzyme.

  18. Sensitive spectrophotometric method for the determination of superoxide dismutase activity in tissue extracts

    SciTech Connect

    Paoletti, F.; Aldinucci, D.; Mocali, A.; Caparrini, A.

    1986-05-01

    Superoxide dismutase (EC 1.15.1.1) has been assayed by a spectrophotometric method based on the inhibition of a superoxide-driven NADH oxidation. The assay consists of a purely chemical reaction sequence which involves EDTA. Mn(II), mercaptoethanol, and molecular oxygen, requiring neither auxiliary enzymes nor sophisticated equipment. The method is very flexible and rapid and is applicable with high sensitivity to the determination of both pure and crude superoxide dismutase preparations. The decrease of the rate of NADH oxidation is a function of enzyme concentration, and saturation levels are attainable. Fifty percent inhibition, corresponding to one unit of the enzyme, is produced by approximately 15 ng of pure superoxide dismutase. Experiments on rat liver cytosol have shown the specificity of the method for superoxide dismutase. Moreover, common cellular components do not interfere with the measurement, except for hemoglobin when present at relatively high concentrations. The assay is performed at physiological pH and is unaffected by catalase.

  19. Simultaneous Determination of Viscosity and Density of Protein Solutions by Magnetic Suspension

    PubMed Central

    Kupke, D. W.; Hodgins, M. G.; Beams, J. W.

    1972-01-01

    The first results are reported with a magnetic suspension instrument for determination of the viscosity and density concurrently on small volumes (0.2 ml) of protein solution. Reasonable agreement was obtained with literature values for the intrinsic viscosities and specific volumes (partial or isopotential) of serum albumin and ribonuclease in native solvents, and in 6 M guanidinium chloride with or without 2-mercaptoethanol. Turnip Yellow Mosaic virus and myosin were also studied, the results with the virus being related to hydration and structure data and those with myosin to the dissociative character of the protein. The possibility of using this approach to follow the time course of viscosity and density changes during reactions is shown. PMID:4506095

  20. A rapid TRIzol-based two-step method for DNA-free RNA extraction from Arabidopsis siliques and dry seeds.

    PubMed

    Meng, Ling; Feldman, Lewis

    2010-02-01

    Extraction of high-quality RNA from Arabidopsis seeds has been a challenge. Here we report a two-step TRIzol-based procedure for RNA extraction from Arabidopsis siliques and dry seeds. This procedure employs a modified, high pH (pH 9.5) extraction buffer. High pH plus the addition of either DTT or beta-mercaptoethanol in the extraction buffer effectively inhibits RNase activity during the extraction, and removes most polysaccharides, polyphenols and other insoluble material. TRIzol reagent was subsequently used to purify the RNA. Using this procedure we isolated high-quality DNA-free RNA samples without DNase I treatment from Arabidopsis seeds or siliques in less than 3 h.

  1. Ring Substituent Effects on the Thiol Addition and Hydrolysis Reactions of N-Arylmaleimides.

    PubMed

    Chen, Yingche; Tsao, Kelvin; De Francesco, Élise; Keillor, Jeffrey W

    2015-12-18

    Maleimide groups are used extensively in bioconjugation reactions, but limited kinetic information is available regarding their thiol addition and hydrolysis reactions. We prepared a series of fluorogenic coumarin maleimide derivatives that differ by the substituent on their maleimide C═C bond. Fluorescence-based kinetic studies of the reaction with β-mercaptoethanol (BME) yielded the second-order rate constants (k2), while pH-rate studies from pH 7 to 9 gave base-catalyzed hydrolysis rate constants (kOH). Linear free-energy relationships were studied through the correlation of log k2 and log kOH to both electronic (σ(+)) and steric (Es(norm)) parameters of the C═C substituent. These correlations revealed the thiol addition reaction is primarily sensitive to the electronic effects, while steric effects dominate the hydrolysis reaction. These mechanistic studies provide the basis for the design of novel bioconjugation reactants or fluorogenic labeling agents.

  2. Identification of baicalein as a ferroptosis inhibitor by natural product library screening.

    PubMed

    Xie, Yangchun; Song, Xinxin; Sun, Xiaofang; Huang, Jin; Zhong, Meizuo; Lotze, Michael T; Zeh, Herbert J; Kang, Rui; Tang, Daolin

    2016-05-13

    Ferroptosis, a novel form of regulated cell death, is characterized by oxidative injury from iron accumulation and lipid peroxidation. In a natural product library screening for ferroptosis inhibitor, we found that baicalein is a potent inhibitor of erastin-induced ferroptosis in pancreatic cancer cells. Baicalein (also termed 5,6,7-trihydroxyflavone) is a flavonoid originally obtained from the roots of Scutellaria baicalensis and Scutellaria lateriflora. We showed that baicalein exhibits remarkable anti-ferroptosis activity compared with well-known ferroptosis inhibitors such as ferrostatin-1, liproxstatin-1, deferoxamine mesylate, and β-mercaptoethanol. At the biochemistry level, baicalein limits erastin-induced ferrous iron production, glutathione depletion, and lipid peroxidation. At the protein level, baicalein suppresses erastin-mediated degradation of glutathione peroxidase 4, a phospholipid hydroperoxidase that protects cells against membrane lipid peroxidation. Thus, baicalein enhances cellular anti-ferroptosis capacity and could be a potential therapeutic agent for ferroptosis-associated tissue injury.

  3. Two-dimensional heterospectral correlation analysis of the redox-induced conformational transition in cytochrome c using surface-enhanced Raman and infrared absorption spectroscopies on a two-layer gold surface.

    PubMed

    Zou, Changji; Larisika, Melanie; Nagy, Gabor; Srajer, Johannes; Oostenbrink, Chris; Chen, Xiaodong; Knoll, Wolfgang; Liedberg, Bo; Nowak, Christoph

    2013-08-22

    The heme protein cytochrome c adsorbed to a two-layer gold surface modified with a self-assembled monolayer of 2-mercaptoethanol was analyzed using a two-dimensional (2D) heterospectral correlation analysis that combined surface-enhanced infrared absorption spectroscopy (SEIRAS) and surface-enhanced Raman spectroscopy (SERS). Stepwise increasing electric potentials were applied to alter the redox state of the protein and to induce conformational changes within the protein backbone. We demonstrate herein that 2D heterospectral correlation analysis is a particularly suitable and useful technique for the study of heme-containing proteins as the two spectroscopies address different portions of the protein. Thus, by correlating SERS and SEIRAS data in a 2D plot, we can obtain a deeper understanding of the conformational changes occurring at the redox center and in the supporting protein backbone during the electron transfer process. The correlation analyses are complemented by molecular dynamics calculations to explore the intramolecular interactions.

  4. Mastery of cultural conditions and physico-chemical properties improves the production and the catalytic efficiency of bglG.

    PubMed

    Saibi, Walid; Gargouri, Ali

    2013-07-01

    Stachybotrys microspora is a filamentous fungus secreting multiple β-glucosidases. Two of them were characterized. The third one, named bglG, was also characterized and used for various investigations. The current work undertakes the plausible role played by some cultural conditions and physico-chemical properties to improve bglG time course synthesis and also its catalytic efficiency. Indeed, bglG time course synthesis is slightly affected by light, but it is clearly affected by aeration and presence of baffle. On the same case, optimization of substrate and enzyme concentration contributes to the improvement of the catalytic efficiency of bglG. This biocatalyst tolerates a high ionic strength during its activity assay; β-mercaptoethanol increases the enzymatic rate. BglG has the capacity to hydrolyse efficiently oleuropéin, with a recovery of 88%.

  5. Changes in protein characteristics during soybean storage under adverse conditions as related to tofu making.

    PubMed

    Kong, Fanbin; Chang, Sam K C

    2013-01-16

    Soybeans stored under adverse conditions decrease in protein recovery (content) in the soymilk and tofu yield. This study investigated how protein structural changes contributed to the decrease in tofu yield. Soymilks were produced from original soybeans (Proto and IA2032 cultivars) and adversely stored soybeans, respectively, and soymilk protein contents were adjusted to the same level before making into tofu. Tofu yield was compared with that made from soybeans without protein content adjustment. For understanding protein structural changes, soy proteins were extracted from Proto soybean by using different solvents, including distilled water, sodium dodecyl sulfate (SDS), and 2-mercaptoethanol. The proteins in the extracts were analyzed by using SDS-PAGE and gel filtration. Results showed that tofu yield was more significantly affected by protein structural characteristics than the protein content in soymilk. Different levels of aggregations among 7S and 11S proteins during adverse storage were responsible for decreasing protein recovery in the soymilk.

  6. Interaction of thiols with n-type cadmium sulfide and n-type cadmium selenide in aqueous solutions: adsorption of thiolate anion and efficient photoelectrochemical oxidation to disulfides

    SciTech Connect

    Natan, M.J.; Thackeray, J.W.; Wrighton, M.S.

    1986-08-14

    Organic thiols, RSH = cysteamine, 2-mercaptoethanol, penicillamine, or cysteine, effectively suppress photoanodic decomposition of n-CdS and n-CdSe in aqueous solution and undergo efficient controlled potential photoelectrochemical oxidation to the corresponding disulfides, RSSR. Photovoltage greater than 700 mV is observed for certain thiols upon excitation of the semiconductor anode with light of energy greater than the band gap. As electrodes for preparative electrosynthesis, both illuminated n-CdS and n-CdSe offer significant electrical energy savings compared to conventional electrochemical oxidation in the dark at a Pt electrode. The oxidation of RSH to RSSR at n-CdS and n-CdSe has been studied under various conditions.

  7. Isolation and characterization of a resistant core peptide of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF); confirmation of the GM-CSF amino acid sequence by mass spectrometry.

    PubMed Central

    Tsarbopoulos, A.; Pramanik, B. N.; Labdon, J. E.; Reichert, P.; Gitlin, G.; Patel, S.; Sardana, V.; Nagabhushan, T. L.; Trotta, P. P.

    1993-01-01

    A trypsin-resistant core peptide of recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) was isolated and analyzed by high-energy Cs+ liquid secondary-ion (LSI) mass spectrometric analysis. This analysis provided successful detection of the high-mass disulfide-linked core peptide as well as information confirming the existence of disulfide pairing. Similarly, LSI mass spectrometric analysis of the peptide fragments isolated chromatographically from a Staphylococcus aureus V8 protease digest of rhGM-CSF provided rapid confirmation of the cDNA-derived sequence and determination of the existing disulfide bonds between cysteine residues 54-96 and 88-121. Electrospray ionization mass spectrometry was employed to measure the molecular weight of the intact protein and to determine the number of the disulfide bonds in the protein molecule by comparative analysis of the protein before and after reduction with beta-mercaptoethanol. PMID:8268804

  8. Novel hybrid materials based on the vanadium oxide nanobelts

    NASA Astrophysics Data System (ADS)

    Zabrodina, G. S.; Makarov, S. G.; Kremlev, K. V.; Yunin, P. A.; Gusev, S. A.; Kaverin, B. S.; Kaverina, L. B.; Ketkov, S. Yu.

    2016-04-01

    Novel hybrid materials based on zinc phthalocyanine and nanostructured vanadium oxides have attracted extensive attention for the development of academic research and innovative industrial applications such as flexible electronics, optical sensors and heterogeneous catalysts. Vanadium oxides nanobelts were synthesized via a hydrothermal treatment V2O5·nH2O gel with surfactants (TBAB, CTAB) used as structure-directing agents, where CTAB - cetyltrimethylammonium bromide, TBAB - tetrabutylammonium bromide. Hybrid materials were prepared decoration of (CTA)0.33V2O5 flexible nanobelts with cationic zinc phthalocyanine by the ion-exchange route. Investigations of the thermal stability, morphologies and structures of the (CTA)0.33V2O5, (TBA)0.16V2O5 nanobelts and zinc phthalocyanine exchange product were carried out. The hybrid materials based on the nanostructured vanadium oxide and zinc phthalocyanine were tested as photocatalysts for oxidation of citronellol and 2-mercaptoethanol by dioxygen.

  9. Antioxidant activity of thiocholesterol on copper-induced oxidation of low-density lipoprotein.

    PubMed

    Tanaka, M; Nakagawa, M

    1995-04-01

    The effect of thiocholesterol (SH-Chol) on the copper-induced in vitro oxidation of low-density lipoprotein (LDL; 1.019 < d < 1.063) was investigated. Among the antioxidants tested, including cysteine, glutathione, 2-mercaptoethanol, dithiothreitol, probucol, thiopalmitic acid, and SH-Chol, SH-Chol was the most effective antioxidant in copper-induced LDL oxidation. Also, SH-Chol completely inhibited the formation of oxysterols, i.e., 7-hydroxycholesterol and 7-ketocholesterol, in LDL particles and reduced 1,1-diphenyl-2-picrylhydrazyl used as stable free-radical model. Moreover, SH-Chol suppressed the degradation of endogenous alpha-tocopherol in LDL particles. These findings indicate that SH-Chol acts as antioxidant in the oxidative damage of LDL in vitro and as a free-radical scavenger in lipid peroxidation.

  10. Synthesis and structure design of new bio-based elastomers via Thiol-ene-Click Reactions.

    PubMed

    Khan, Shafiullah; Wang, Zhao; Wang, Runguo; Zhang, Liqun

    2016-10-01

    The additions of 2-mercaptoethanol to (S)-(-)-limonene via click reaction is described as an adaptable and efficient way to obtain alcohol functionalized renewable monomer for the synthesis of new cross-linkable bio-based elastomers. Thiol first reacted with the limonene endocyclic double bond and then reacted with the exocyclics double bond to form the difunctional monomer. The structure of the monomer was determined by using FTIR, (1)H NMR and mass spectrometry. Thermal Gravimetric Analysis (TGA) and Differential Scanning Calorimetrys (DSC) characterization exposed that this monomer could be used to synthesize elastomers with excellent and adaptable thermal properties. The molecular weight of the synthesized elastomer could reach 186kDaa via melting polycondensation route and the structure-properties relationship was deliberated. Finally, these elastomers were mixed with dicumyl peroxide (DCP) to form cross-linked elastomers with certain mechanical property, and the gel contents of the elastomers were confirmed by using Soxhlet extraction method.

  11. Granulosain I, a cysteine protease isolated from ripe fruits of Solanum granuloso-leprosum (Solanaceae).

    PubMed

    Vallés, Diego; Bruno, Mariela; López, Laura M I; Caffini, Néstor O; Cantera, Ana María B

    2008-08-01

    A new cysteine peptidase (Granulosain I) was isolated from ripe fruits of Solanum granuloso-leprosum Dunal (Solanaceae) by means of precipitation with organic solvent and cation exchange chromatography. The enzyme showed a single band by SDS-PAGE, its molecular mass was 24,746 Da (MALDI-TOF/MS) and its isoelectric point was higher than 9.3. It showed maximum activity (more than 90%) in the pH range 7-8.6. Granulosain I was completely inhibited by E-64 and activated by the addition of cysteine or 2-mercaptoethanol, confirming its cysteinic nature. The kinetic studies carried out with PFLNA as substrate, showed an affinity (Km 0.6 mM) slightly lower than those of other known plant cysteine proteases (papain and bromelain). The N-terminal sequence of granulosain I (DRLPASVDWRGKGVLVLVKNQGQC) exhibited a close homology with other cysteine proteases belonging to the C1A family.

  12. Guinea-pig reaginic antibody

    PubMed Central

    Margni, R. A.; Hajos, Silvia E.

    1973-01-01

    The physicochemical and biological properties of purified guinea-pig reaginic antibody were studied. It is a labile protein different to γ1. Its antibody activity is completely destroyed by heating at 56° for 6 hours and by treatment with mercaptoethanol. The capacity to give PCA is decreased by repeated freezing and thawing. It is a bivalent antibody, haemagglutinating, does not fix complement and is capable of sensitizing guinea-pig skin for PCA reaction after a latent period of a week but not after 3 hours. Reaginic antibody appears on day 7–8 after the first inoculation and the higher levels (PCA reaction) are obtained at the eleventh to thirteenth days. After the fifteenth to seventeenth days the PCA is negative. The reaginic antibody does not pass the placenta. Higher levels of reaginic antibody were obtained when the guinea-pigs were inoculated with the antigen in saline with simultaneous inoculation, intraperitoneally, of killed Bordetella pertussis, phase I. PMID:4354828

  13. Rapid hydrophilic interaction chromatography determination of lysine in pharmaceutical preparations with fluorescence detection after postcolumn derivatization with o-phtaldialdehyde.

    PubMed

    Douša, Michal; Břicháč, Jiří; Gibala, Petr; Lehnert, Petr

    2011-04-05

    A rapid procedure for the determination of lysine based on hydrophilic interaction chromatography (HILIC) separation of arginine and lysine with fluorescence detection has been developed. The separation conditions and parameters of lysine postcolumn derivatization with o-phtaldialdehyde (OPA)/2-mercaptoethanol were studied. The various HILIC columns were employed using isocratic elution. Fluorescence detection was performed at excitation and emission wavelength of 345 nm and 450 nm, respectively. An advantage of the reported method is a simple sample pre-treatment and a quick and very sensitive HPLC method. The developed method was successfully applied for analysis of commercial samples of Ibalgin Fast tablets (Zentiva, Czech Republic). Copyright © 2010 Elsevier B.V. All rights reserved.

  14. The effect of aromatic amines and phenols in the thiyl-induced reactions of polyunsaturated fatty acids

    NASA Astrophysics Data System (ADS)

    Tartaro Bujak, Ivana; Chatgilialoglu, Chryssostomos; Ferreri, Carla; Valgimigli, Luca; Amorati, Riccardo; Mihaljević, Branka

    2016-07-01

    Thiols are well known for their role in cellular redox homeostasis, while aromatic amines and phenols are the best known classes of chain-breaking antioxidants. On the other hand, thiyl radicals are known to catalyse the double bond isomerization in PUFA. We investigated the role and interplay of 2-mercaptoethanol and diphenylamine in the parallel processes of peroxidation and cis-trans isomerization of linoleic acid (LA) during gamma radiolysis, both in solution and micelles. Both compounds, used alone were able to protect LA from oxidation; however pro-oxidant activity and enhanced isomerization was observed when they were used together, depending on the experimental settings. Instead, α-tocopherol protected LA from both oxidation and isomerization in the presence of thiols under any tested settings. The mechanistic scenario is discussed highlighting the role of diphenylaminyl radicals in promoting thiyl-radical-induced cis-trans isomerization in the presence of oxygen.

  15. Design of a Photoreactive Analogue of the Escherichia coli Heat-Stable Enterotoxin STIb: Use in Identifying Its Receptor on Rat Brush Border Membranes

    NASA Astrophysics Data System (ADS)

    Gariepy, Jean; Schoolnik, Gary K.

    1986-01-01

    The Escherichia coli heat-stable enterotoxin, STIb was prepared by solid-phase peptide synthesis and purified to homogeneity by high-pressure liquid chromatography. This analogue was iodinated and shown to bind specifically to rat intestinal membranes. The radiolabeled peptide was derivatized at the amino terminus with the photoreactive heterobifunctional crosslinking agent N-hydroxysuccinimidyl p-benzoylbenzoate. This photoreactive probe also exhibited binding specificity. It was mixed with rat intestinal brush border membranes and photolyzed in the presence or absence of excess unlabeled STIb. Polyacrylamide gel electrophoresis performed in the presence of sodium dodecyl sulfate and 2-mercaptoethanol indicated that the peptide probe was cross-linked specifically to two molecular species of 57 and 75 kDa. One or both of these molecules appear to constitute the enterotoxin receptor or to be in close proximity to it.

  16. Copper(II)-substituted horse liver alcohol dehydrogenase: structure of the minor species.

    PubMed

    Formicka, G; Zeppezauer, M; Fey, F; Hüttermann, J

    1992-08-31

    Oxygen treatment of horse liver alcohol dehydrogenase EE isozyme substituted with Cu(II) at the catalytic site leads to bleaching with concomitant reduction to Cu(I) of approximately 90% of total Cu(II). The Cu(II) of the remaining 'minor species' cannot be reduced nor does it interact with exogenous ligands, e.g. 2-mercaptoethanol, imidazole, pyrazole, or azide ions. The EPR spectrum is axial with a super-hyperfine splitting of 15.6 G indicating binding of one nitrogen atom to Cu(II). These data as well as the energies and intensities of the absorption and CD spectra suggest the Cu(II) ion of the minor species to be located in the catalytic site of HLADH in a position and geometry different from that of the major species.

  17. Seroprevalence of antibodies to Toxoplasma gondii in lynx (Lynx canadensis) and bobcats (Lynx rufus) from Québec, Canada.

    PubMed

    Labelle, P; Dubey, J P; Mikaelian, I; Blanchette, N; Lafond, R; St-Onge, S; Martineau, D

    2001-10-01

    The seroprevalence of antibodies to Toxoplasma gondii was investigated in trapped lynx (Lynx canadensis) and bobcats (Lynx rufus) from Québec, Canada. Forty-seven of 106 (44%) lynx and 4 of 10 (40%) bobcats had positive titers for T. gondii (> or = 25) by means of the modified agglutination test incorporating mercaptoethanol and formalin-fixed tachyzoites. Seroprevalence was significantly higher (P < 0.0001) in adult lynx than in juvenile lynx. The presence of antibodies to T. gondii in lynx and bobcats suggests that this organism is widespread in the wild and that exposure to wild felids and game animals from Québec may represent a potential source of infection for humans.

  18. Distribution and characterization of hemolytic activity by an oral anaerobe from the Streptococcus milleri group.

    PubMed

    Yamaguchi, T; Koreeda, H

    2004-04-01

    Some oral anaerobes from the Streptococcus milleri strain group were found to secrete human specific hemolytic toxin, which was detected when bacteria were cultured in Todd-Hewitt broth and Brain Heart Infusion broth. The toxin elicited by the Streptococcus intermedius strain was partially fractionated by ammonium sulfate precipitation. Preincubation with glutathione or cysteine showed significant inhibiting effects; however, no effects were seen with dithiothreitol or beta-mercaptoethanol, and cholesterol was a weak inhibitor. Five kinds of protease inhibitor had no effect on the hemolytic activity, and rabbit preimmune and immune sera against the bacterial cells showed weak inhibition at a similar level. Digestion with trypsin, chymotrypsin, proteinase-K, subtilisin and pronase-P brought about a rise in activity, followed by a decrease during long-term incubation. Other enzymes tested showed no effects. Further, the presence of the intermedilysin gene in the portion with hemolytic activity was not identified by polymerase chain reaction.

  19. Modulation of the estrogen receptor structure, evidence of a heterogeneity

    SciTech Connect

    Toulas, C.; Guilbaud, N.; Delassus, F.; Bayard, F.; Faye, J.C. )

    1990-01-01

    In order to analyse the molecular weight polymorphism of the estrogen receptor (ER) in MCF-7 cells, we have developed a procedure which allowed in situ linkage of ER by (3H) tamoxifen aziridine and provided labelled proteins in conditions which minimized protease activities. After labelling, cell lysis was performed in SDS buffer containing various concentrations of mercaptoethanol. Proteins extracted with phenolic solution and precipitated by cold acetone were analysed by SDS PAGE. It appears that beside the form of 67 kDa already described, binding entities of tamoxifen aziridine were also present at a molecular mass of 110 kDa and 45 kDa. On the other hand, investigations on the effect of 12-0-Tetradecanoyl Phorbol 13-Acetate (TPA) showed that TPA induces a decrease of the 67 kDa entity.

  20. Guinea-pig reaginic antibody

    PubMed Central

    Margni, R. A.; Hajos, Silvia E.

    1973-01-01

    The methods for isolation and purification of a guinea-pig serum protein with homocytotropic antibody activity and characteristics of IgE are described. By precipitation in the equivalence zone or immunoadsorption and chromatography on DEAE-cellulose, we isolated an homocytotropic antibody, that was not able to give a precipitin line when it was reacted directly with the antigen. It was capable of sensitizing guinea-pig skin for PCA after a latent period of 24–48 hours but not after 3 hours; it was sensitive to treatment with mercaptoethanol. It had antigenic determinants present in the other guinea-pig immunoglobulins and particular antigenic determinants. All these properties make us believe that this protein belongs to an immunoglobulin different from γ1 and similar to the reaginic antibody (IgE) described in other species. ImagesFIG. 3FIG. 4FIG. 5 PMID:4126261

  1. Establishment and characterization of an astroglial cell line derived from the brain of half-smooth tongue sole (Cynoglossus semilaevis)

    PubMed Central

    WANG, Tian-Zi; SUN, Ai; WANG, Na; CUI, Zhong-Kai; CHEN, Song-Lin; SHA, Zhen-Xia

    2015-01-01

    An astroglial cell line was established from the brain of half smooth tongue sole (Cynoglossus semilaevis) and was designated as CSAC. CSAC shows the morphological homogeneity of epithelial cells. The cell identity was tested by the presence of glial fibrillary acidic protein (GFAP), which was revealed by RT-PCR and immunofluorescence. The cell line was optimally maintained at 24 °C in minimum essential medium supplemented with HEPES, antibiotics, 20% fetal bovine serum, 2-Mercaptoethanol (2-Me) and basic fibroblast growth factor. Chromosome analysis revealed that the CSAC cells maintained a normal diploid chromosome number (2n=42). The fluorescent signals were observed in CSAC after the cells were transfected with green fluorescent protein (GFP) reporter plasmids. The CSAC cell line may serve as a valuable tool for studies on the potential functions of fish astroglial cells. PMID:26452695

  2. The assimilation of carbon by Chloropseudomonas ethylicum

    PubMed Central

    Callely, A. G.; Rigopoulos, N.; Fuller, R. C.

    1968-01-01

    1. The enzymes in ultrasonically prepared extracts of Chloropseudomonas ethylicum were studied to elucidate how this organism assimilates acetate and carbon dioxide and why it cannot grow with either of these two compounds alone. 2. Such extracts can (i) convert acetate and oxaloacetate into α-oxoglutarate, (ii) convert oxaloacetate into succinyl-CoA, (iii) convert phosphopyruvate into 3-phosphoglyceraldehyde and (iv) interconvert phosphopyruvate and pyruvate via oxaloacetate. 3. Pyruvate kinase, α-oxoglutarate dehydrogenase, ribulose diphosphate carboxylase, isocitrate lyase and malate synthase were not detected. 4. It is difficult to detect aconitate hydratase, fumarate hydratase and citrate synthase in extracts of the organism ultrasonically treated in tris buffer; to demonstrate these enzymes extracts should be prepared in phosphate buffer containing 2-mercaptoethanol. 5. Provided that this organism can synthesize pyruvate from acetate and carbon dioxide, the enzymes detected are sufficient to account for the nutritional requirements of this organism. PMID:5639917

  3. Pyrocystis lunula bioluminescence: physicochemical characterization of the luciferin precursor.

    PubMed

    Fresneau, C; Arrio, B

    1988-08-15

    The luminescence of the dinoflagellate Pyrocystis lunula is controlled by the reduction state of the luciferin precursor. This molecule (P630) is a chromopeptide more stable than luciferin in methanolic solutions at low temperature. Cations may oxidize P630 or cleave the bond between the peptidic chain and the extended tetrapyrrole. Reduction of P630 is performed enzymatically by a NAD(P)H-dependent oxidoreductase or chemically by 2-mercaptoethanol or dithiothreitol. The state of reduction is monitored by the absorption and fluorescence emission which reveal a conformational change of the chromopeptide depending on the pH. These data will be useful for forthcoming studies on intracellular reducing power regulation and luminescence rhythms of these cells.

  4. The effect of disulphides on mitochondrial oxidations

    PubMed Central

    Skrede, S.; Bremer, J.; Eldjarn, L.

    1965-01-01

    1. Nicotinamide nucleotide-linked mitochondrial oxidations were inhibited by the disulphides NNN′N′-tetraethylcystamine, cystamine and cystine diethyl ester, whereas l-homocystine, oxidized mercaptoethanol, oxidized glutathione, NN′-diacetylcystamine and tetrathionate were only slightly inhibitory. Mitochondrial oxidations were not blocked by the thiol cysteamine. 2. NAD-independent oxidations were not inhibited by cystamine. The oxidation of choline was initially stimulated. 3. The inactivation of isocitrate, malate and β-hydroxybutyrate oxidation of intact mitochondria could be partially reversed by external NAD. For the reactivation of α-oxoglutarate oxidation a thiol was also required. 4. A leakage of nicotinamide nucleotides from the mitochondria is suggested as the main cause of the inhibition. In addition, a strong inhibition of α-oxoglutarate dehydrogenase by cystamine was observed. A mixed disulphide formation with CoA and possibly also lipoic acid and lipoyl dehydrogenase is suggested to explain this inhibition. PMID:14342523

  5. Human C5a anaphylatoxin: gene cloning and expression in Escherichia coli.

    PubMed

    Bautsch, W; Emde, M; Kretzschmar, T; Köhl, J; Suckau, D; Bitter-Suermann, D

    1992-06-01

    A gene coding for the human anaphylatoxin C5a was cloned and expressed in Escherichia coli. A combination of reverse transcription of mRNA of the U937 cell line with subsequent preparative polymerase chain reaction was employed to obtain the gene. The sequence was cloned into the plasmid vector pKK 233-2 behind an ATG initiation codon under the control of a trc promotor. After purification by ion exchange chromatography and reversed phase FPLC a mixture of predominantly non-glycosylated recombinant human C5a with a beta-mercaptoethanol adduct at cysteine 27 and the N-methionyl derivative was obtained which was homogeneous on silver-stained gels, immunoreactive with C5a-specific monoclonal antibodies and functionally active in releasing myeloperoxidase from human granulocytes and ATP from guinea pig platelets. The final yield was about 0.4-0.8 mg purified recombinant C5a per liter bacterial culture.

  6. Escherichia coli agglutinins in cow serum, colostrum and the nursing calf.

    PubMed

    Jacks, T M; Glantz, P J

    1970-07-01

    Immunochemical properties of Escherichia coli O antibodies present in bovine serum and colostrum were investigated. Dam and calf serum samples plus colostral whey samples were fractionated by gel filtration, and the 7S and 19S fractions isolated. Antibody activity against the O antigens of four recognized E. coli bovine pathogens was determined by the indirect hemagglutination test on the whole serum and colostral whey samples and the 7S and 19S fractions thereof. Mercaptoethanol reduction was used to chemically study the immunochemistry of the E. coli O antibodies. The E. coli O antibodies in dam serum were entirely 19S macroglobulins and appeared to be IgM immunoglobulins. The antibodies in colostrum and calf serum were both 7S and 19S globulins. Reasons for believing these 7S antibodies may be IgG, and the 19S antibodies IgA, immunoglobulins are presented.

  7. Dihydropyrazine-induced inactivation of glyceraldehyde-3-phosphate dehydrogenase.

    PubMed

    Takechi, Shinji; Nakahara, Kazuhide; Yamaguchi, Tadatoshi

    2010-01-01

    Dihydropyrazine (DHP), which is produced during the Maillard reaction, generates radicals that not only cause breakage of chromosomal DNA leading to mutagenic lesions but also induce oxidative damage to cellular proteins. In the present study, we show that three DHP derivatives, which generated superoxide anions, caused inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). SH-compounds, such as cysteine, dithiothreitol (DTT), 2-mercaptoethanol, 2-mercaptoethylamine, and N-acetyl-cysteine, suppressed the inhibition of GAPDH by DHP in vitro, although the effect of DHP on GAPDH was not reversed by DTT. In addition, DHP-exposed Escherichia coli showed almost unaffected growth on plates containing a rich medium, but poor growth on plates containing M9 synthetic medium with glucose as the sole carbon source. Furthermore, DHP-exposed E. coli exhibited reduced GAPDH activity. These findings indicate that DHP disturbs the glycolytic pathway by inhibiting GAPDH activity.

  8. Proteins of Yaba Monkey Tumor Virus I. Structural Proteins

    PubMed Central

    Fenger, T; Rouhandeh, H

    1976-01-01

    Yaba virus proteins were characterized by polyacrylamide gel electrophoresis. Electrophoresis of Yaba virion (proteins) dissociated by sodium dodecyl sulfate and 2-mercaptoethanol in continuous and discontinuous buffer systems yielded 37 polypeptide species by staining and by counting bands of radioactively labeled polypeptides. The molecular weights of the viral polypeptide species were found to range from 10,000 to 220,000 by comparing the relative distance of migration of viral proteins with proteins of known molecular weights. Two polypeptides were removed from purified virions by nonionic detergent nonidet P -40 treatment, and the amount of one polypeptide was reduced. Purified cores yielded 21 polypeptide species, none of which was labeled with radioactive glucosamine. Images PMID:178906

  9. Biotransformation of nitro-polycyclic aromatic compounds by vegetable and fruit cell extracts*

    PubMed Central

    Xie, Bo; Yang, Jun; Yang, Qing

    2012-01-01

    Extracts from various vegetables and fruits were investigated for their abilities to reduce nitro-polycyclic aromatic hydrocarbons (NPAHs). The extracts from grape and onion exhibited an interesting selectivity, yielding corresponding hydroxylamines or amines as major products under mild conditions of 30 °C and pH 7.0. Grape extracts reduced the 4-nitro-1,8-naphthalic anhydride with the highest conversion rate (>99%) and the highest ratio of hydroxylamine to amine (95:5). In contrast, the onion extracts reduced 4-nitro-1,8-naphthalic anhydride with a conversion rate of 94% and a ratio of hydroxylamine to amine of 8:92. The thiol-reducing agent, β-mercaptoethanol, and metal cations, Ca2+ and Mg2+, greatly increased the reductive efficiency. This work provides an alternative strategy for biotransformation of nitro-polycyclic compounds. PMID:22467365

  10. 4-Coumaroyl coenzyme A 3-hydroxylase activity from cell cultures of Lithospermum erythrorhizon and its relationship to polyphenol oxidase.

    PubMed

    Wang, Z X; Li, S M; Löscher, R; Heide, L

    1997-11-15

    A 4-coumaroyl-CoA 3-hydroxylase activity was purified 4600-fold from cell cultures of Lithospermum erythrorhizon. The enzyme showed a molecular mass of 42,400 +/- 1700 Da in gel chromatography and required ascorbate, NADH, or NADPH as cofactors. 4-Coumaroyl-CoA, 4-coumarate, p-cresol, and several other phenolic substances, but not tyrosine, were accepted as substrates for the hydroxylation. Besides hydroxylase activity, the enzyme showed diphenol oxidase activity. Both activities were inhibited by diethyldithiocarbamate or beta-mercaptoethanol, although at different concentrations. The enzyme showed striking similarity to a 4-coumaroyl-glucose 3-hydroxylase from sweet potato (Ipomoe batatas) roots, which has reportedly been purified to homogeneity and identified as a specific enzyme of chlorogenic acid biosynthesis. Close examination and comparison to a commercially available polyphenol oxidase, however, suggest that the enzyme activities purified from both Lithospermum and sweet potato are polyphenol oxidases rather than specific enzymes of secondary metabolism.

  11. Optimization of RNA isolation from Brittle Leaf Disease affected date palm leaves and construction of a subtractive cDNA library.

    PubMed

    Saïdi, Mohammed Najib; Gargouri-Bouzid, Radhia; Rayanni, Mariem; Drira, Noureddine

    2009-01-01

    A simple and efficient method was described here for the isolation of high-quality RNA from date palm leaves affected with Brittle Leaf Disease (BLD) and containing high amount of phenolic compounds. The procedure was based on the use of a non-ionic detergent Nonidet-P40 (NP-40), Polyvinylpyrrolidone (PVP), and beta-mercaptoethanol in the extraction buffer in order to isolate cytoplasmic RNA and to prevent the oxidation of phenolic compounds. This method allowed the isolation of intact RNA, suitable for cDNA synthesis and library construction. Differential screening of the subtractive cDNA library from affected leaf RNA led to the identification of some BLD-induced genes.

  12. Purification and partial characterization of nonspecific lipase from rat pancreas.

    PubMed

    Albron, P W; Corbett, B J; Latimer, A D

    1976-03-26

    Nonspecific lipase (also referred to as micelle lipase and secondary ester hydrolase) has been purified to electrophoretic homogeneity starting from acetone powder of rat pancreas. The purified enzyme is found to have a molecular weight (gel filtration) of 64 000 +/- 2000, and an equivalent weight (titration with E-600) of 65 000. Nonspecific lipase is seen to be very sensitive to inhibition by organophosphates but resistant to quinine. Evidence for the presence of sulfhydryl and imidazole groups essential for activity is presented, and some observations on substrate specificity are made. The purified enzyme appears to lack phosphate groups and lipids, and is unstable under conditions of low ionic strength and/or exposure to 2-mercaptoethanol.

  13. The effects of copper and other ions on the ribonucleic acid polymerase activity of isolated rat liver nuclei

    PubMed Central

    Novello, F.; Stirpe, F.

    1969-01-01

    1. The effects of various ions on the Mg2+- and Mn2+/ammonium sulphate-activated RNA polymerase activities of isolated liver nuclei were studied. 2. The Mg2+-activated RNA polymerase reaction was inhibited by more than 60% by Cd2+, SeO32−, Be2+, Cu2+, Co2+, Ca2+ and La3+, all at 1mm concentrations. 3. The Mn2+/ammonium sulphate-activated RNA polymerase reaction was strongly inhibited by Hg2+, Cd2+, Cu2+ and Ag+. The effect of Hg2+, Cd2+ and Ag+ was relieved by cysteine or mercaptoethanol. 4. Inhibition by Cu2+ was not affected by addition of DNA, and was relieved only partially by EDTA or histidine. 5. No changes of RNA polymerase activities were observed in nuclei isolated from the liver of rats treated with copper albuminate. PMID:4975630

  14. Agglutinins to Coxiella burnetii and Brucella spp, with particular reference to Brucella canis, in wild animals of southern Texas.

    PubMed

    Randhawa, A S; Kelly, V P; Baker, E F

    1977-11-01

    The prevalence of agglutinins to Coxiella burnetii and Brucella spp, particularly Brucella canis, was determined in 269 wild animals (14 species) in southern Texas. Serologic evidence of coxiellosis and brucellosis, including B canis infection, was shown for coyotes, raccoons, opossums, badgers, jackrabbits, and feral hogs. Using the microagglutination test, the seroprevalence of C burnetii, phases I and II (titer greater than or equal to 4) was 4.1 and 27.9%, respectively. For brucella agglutinins, prevalence rates were 7.1, 8.9, and 6.7%, as determined by the brucellosis card test, the rapid slide agglutination test, and the salt 2-mercaptoethanol tube agglutination (titer greater than or equal to 50) test, respectively.

  15. Metals in squid, Loligo forbesi, adults, eggs and hatchlings. No evidence for a role for Cu- or Zn-metallothionein.

    PubMed

    Craig, Stephen; Overnell, Julian

    2003-03-01

    An adult squid Loligo forbesi had the following metals in its liver/digestive gland: Mn, Fe, Ni, Zn, Cu, As, Cd, Ba and Pb in the range of 1-110 ppm wet wt. Adult mantle muscle, adult eyes, eggs and hatchlings contained a lesser number of these metals at concentrations above 1 ppm. Chromatographic analysis of non-heat-treated cytosols (in the presence of 5 mM 2-mercaptoethanol) gave no evidence for the presence of copper- or zinc-containing fractions with the molecular weights of mollusc metallothioneins in any of the above tissues. Copper and Zn were bound to either the particulate fraction or to very low molecular weight species.

  16. Effects of T mitogens on in vivo antibody production to a T-dependent antigen in lines of mice genetically selected for high or low in vitro responsiveness to PHA.

    PubMed

    Stiffel, C; Decreusefond, C; Liacopoulos-Briot, M

    1984-01-01

    The influence of genes which regulate the in vitro T-cell proliferative response to T mitogen upon in vivo antibody production to a T-dependent antigen was studied in two lines of mice genetically selected for a high or a low in vitro lymphocyte response to phytohaemagglutinin (PHA). Kinetics of agglutinin production to increasing doses of sheep erythrocytes was similar in the two lines, except for the titres of mercaptoethanol-resistant antibodies, which were slightly lower in the low-responder line. Treatment with mitogen prior to immunization modified the antibody response in the two lines differently. This finding would indicate that the genes which regulate in vitro stimulation of T cells by PHA also control in vivo activation of T-cell subsets involved in immunoresponsiveness.

  17. Recurrent Epistaxis and Bleeding as the Initial Manifestation of Brucellosis.

    PubMed

    Kamali Aghdam, Mojtaba; Davari, Kambiz; Eftekhari, Kambiz

    2016-03-01

    Severe thrombocytopenia with bleeding is rarely reported in children with brucellosis, and recurrent epistaxis is extremely rare. Brucellosis with hemorrhage should be differentiated from viral hemorrhagic fever, malignancy, and other blood disorders. Bone marrow aspiration (BMA) is mandatory to differentiate from other blood diseases. An 8-year-old boy was admitted with recurrent epistaxis, petechiae and purpura on face and extremities and bleeding from the gums. During the hospitalization, he was febrile and complained of muscle pain. Leukopenias associated with thrombocytopenia were observed. BMA showed to be normal. Among the multiple tests requested, only serum agglutination test (SAT) and 2-MercaptoEthanol test (2-ME) were positive. He was treated with Intravenous immunoglobulin (IVIG) associated with co-trimoxazole and rifampin. Finally, fever subsided, and he was discharged with good condition and normal platelet count. Brucellosis should be a differential diagnosis in patients with fever and bleeding disorders and a history of consumption of unpasteurized dairy, in endemic areas.

  18. Chalcane-stilbene conjugates and oligomeric flavonoids from Chinese Dragon's Blood produced from Dracaena cochinchinensis.

    PubMed

    Hao, Qian; Saito, Yoshinori; Matsuo, Yosuke; Li, Hai-Zhou; Tanaka, Takashi

    2015-11-01

    A detailed chemical investigation of Chinese Dragon's Blood, which is a traditional medicine produced form the red resin of Dracaena cochinchinensis, yielded two chalcane-stilbene conjugates, named cochinchinenenes G and H, together with 25 known compounds. The structures of these compounds were determined by spectroscopic examination. HPLC analysis of the resin indicated that the major constituents were a complex mixture of oligomeric polyphenols, which were detected as a broad hump on the base line of a HPLC chromatogram. (13)C NMR analysis indicated that the oligomers were mainly composed of oxygenated chalcane units. This suggestion was supported by the results of a thiol degradation experiment with mercaptoethanol, which yielded a thioether of 4-[(4-hydroxyphenyl)propyl]-3-methoxyphenol. Furthermore, methylation followed by electrospray ionization mass spectroscopic analysis of the resulting fractions established the presence of at least one heptamer of chalcane units. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Comparison of a PCR assay in whole blood and serum specimens for canine brucellosis diagnosis.

    PubMed

    Keid, L B; Soares, R M; Vasconcellos, S A; Salgado, V R; Megid, J; Richtzenhain, L J

    2010-07-17

    The performance of a serum PCR assay was compared with that of a blood PCR assay for the diagnosis of canine brucellosis caused by Brucella canis in 72 dogs. The dogs were classified into three groups (infected, non-infected and suspected brucellosis) according to the results of blood culture and serological tests. The sensitivities of blood PCR and serum PCR were, respectively, 97.14 per cent and 25.71 per cent. The specificities of both were 100 per cent. In the group of dogs with suspected brucellosis, three were positive by blood PCR and none was positive by serum PCR. Serum PCR showed little value for the direct diagnosis of canine brucellosis as the assay had low diagnostic sensitivity and fewer positive dogs were detected by this test than by blood culture, blood PCR, rapid slide agglutination test (RSAT) and RSAT with 2-mercaptoethanol.

  20. A new collagen from the extracellular matrix of Sepia officinalis cartilage.

    PubMed

    Rigo, Cristina; Bairati, Aurelio

    2002-11-01

    Guanidinium chloride treatment of Sepia officinalis cartilage solubilized a component that contained hydroxyproline. Electron-microscopy observation of rotary-shadowed preparations of this component revealed it to consist of rod-like units themselves consisting of filaments. Dialysis of an acetic acid solution against ATP afforded polymeric aggregates consisting of a succession of two or three thick sections showing transverse electron-opaque banding, separated by thinner sections without banding. Electrophoresis produced a main band of about 140 kDa sensitive to bacterial collagenase. After reduction with mercaptoethanol, electrophoresis afforded a 40-kDa band. Pepsin digestion resulted in additional electrophoretic bands. These data suggest the presence of a collagen in Sepia cartilage with characteristics unlike those of any known collagen.

  1. Glutamate synthesis via photoreduction of NADP+ by photostable chlorophyllide coupled with polyethylene-glycol.

    PubMed

    Asada, H; Itoh, T; Kodera, Y; Matsushima, A; Hiroto, M; Nishimura, H; Inada, Y

    2001-01-01

    Chlorophyllide a was coupled with alpha-(3-aminopropyl)-omega-methoxypoly(oxyethylene) (PEG-NH2) to form a PEG-chlorophyllide conjugate through an acid-amide bond. The conjugate catalyzed the reduction of methylviologen in the presence of 2-mercaptoethanol. It also catalyzed the photoreduction of NADP+ or NAD+ in the presence of ascorbate as an electron donor and ferredoxin-NADP+ reductase as the coupling enzyme. Utilizing the reducing power of NADPH generated by PEG-chlorophyllide conjugate under illumination, glutamate was synthesized from 2-oxoglutarate and NH4+ in the presence of glutamate dehydrogenase. PEG-chlorophyllide conjugate was quite stable toward light illumination compared with chlorophyll a. The increase in the molecular weight of PEG in the PEG-chlorophyllide conjugates was accompanied by the enhancement of photostability of the conjugate and also by the increased solubility in the aqueous solution.

  2. Lipid modification processes induced by thiyl radicals

    NASA Astrophysics Data System (ADS)

    Mihaljević, Branka; Bujak, Ivana Tartaro

    2016-07-01

    Polyunsaturated fatty acid (PUFA) oxidation by thiyl radicals (RS•) is believed to be responsible for some of the biological radiation damage. At the same time, RS• can cause isomerization of PUFA double bonds with the formation of trans isomers. The aim of this study was to better understand the competition between lipid peroxidation and geometrical isomerization processes in biomimetic model system of linoleic acid in the presence of 2-mercaptoethanol using irradiation as a method for free radicals generation. In air-equilibrated conditions the propagation of lipid peroxidation was dominant up to the dose of 400 Gy, after which at higher doses up to 10 kGy the termination occurred with the predominance of geometrical isomerization. This study revealed that undesirable and permanent lipid modifications are possible at higher irradiation doses which should be considered in the planning of irradiation treatment of foods and feeds with high content of lipids and sulfur compounds.

  3. Effect of additives on the purification of urease

    NASA Astrophysics Data System (ADS)

    Yu, X.; Wang, J.; Ulrich, J.

    2015-12-01

    The effect of additives on the purification of proteins was investigated. The target protein studied here is the enzyme urease. Studies on the purification of urease from jack bean meal were carried out. 32% (v/v) acetone was utilized to extract urease from the jack bean meal. Further purification by crystallization with the addition of 2-mercaptoethanol and EDTA disodium salt dehydrate was carried out. It was found out that the presence of additives can affect the selectivity of the crystallization. Increases in both purity and yield of the urease after crystallization were observed in the presence of additives, which were proven using both SDS-PAGE and activity. Urease crystals with a yield of 69.9% and a purity of 85.1% were obtained in one crystallization step in the presence of additives. Furthermore, the effect of additives on the thermodynamics and kinetics of urease crystallization was studied.

  4. Addition of Co(2+) to culture medium decides the functional expression of a recombinant nitrile hydratase in Escherichia coli.

    PubMed

    Pei, Xiaolin; Wang, Qiuyan; Li, Chenglu; Yin, Xiaopu; Chen, Rong; Xie, Tian

    2013-09-01

    A nitrile hydratase (NHase) gene from Aurantimonas manganoxydans, cloned and expressed in Escherichia coli, gave an enzyme that efficiently hydrated 3-cyanopyridine to nicotinamide with high thermal stability. We have now found that adding Co(2+) at 0.1 mM to LB medium was essential for production of an active enzyme. However, ≥0.3 mM Co(2+) inhibited the growth of host cells in LB medium and decreased the production of the recombinant NHase. Furthermore, β-mercaptoethanol promoted regeneration of the Co(2+)-defective apoenzyme in vitro possibly by breaking a key disulfide bond thereby promoting the incorporation of Co(2+) into the apoenzyme.

  5. Extraction of high quality of RNA and construction of a suppression subtractive hybridization (SSH) library from chestnut rose (Rosa roxburghii Tratt).

    PubMed

    Xu, Qiang; Wen, Xiaopeng; Tao, Nengguo; Hu, Zhiyong; Yue, Hailin; Deng, Xiuxin

    2006-04-01

    Chestnut rose (Rosa roxburghii Tratt) is a rare fruit crop of promising economical importance in fruit and ornamental exploitation in China. Isolation of high quality RNA from chestnut rose is difficult due to its high levels of polyphenols, polysaccharides and other compounds, but a modified CTAB extraction procedure without phenol gave satisfactory results. High concentrations of PVP (2%, w/v), CTAB (2%, w/v) and beta-mercaptoethanol (4%, v/v) were used in the extraction buffer to improve RNA quality. The average yield was about 200 microg RNA g(-1) fresh leaves. The isolated RNA was of sufficient quality for construction of suppression subtraction hybridization (SSH) library, which allowed the isolation of several pathogen-induced defense genes.

  6. Complement-inactivating Proteinase(s) from Clostridium histolyticum1

    PubMed Central

    Goldlust, Marvin B.; Luzzati, Alma; Levine, Lawrence

    1968-01-01

    A proteinase fraction inhibiting the hemolytic activity of guinea pig complement was obtained from supernatant fluids of Clostridium histolyticum cultures and purified 150- to 350-fold by ammonium sulfate precipitation, Sephadex G-75 gel filtration, and diethylaminoethyl cellulose chromatography. An assay was developed based on the inactivation of hemolytic complement. Partially purified anticomplementary preparations were active against casein and were capable of “solubilizing” Escherichia coli endotoxin. Two components were found by differential heat inactivation, with complement and casein as substrates, but only one of these components was active against endotoxin. The more heat-stable activity, showing 50% inactivation at about 47 C, was characterized as to pH and ionic strength optima and sensitivity to reagents such as cysteine, β-mercaptoethanol, ethylenediaminetetraacetate, and heavy metals. PMID:5724966

  7. Characterization of a Human Serum Inhibitor of Clostridium histolyticum Proteinase(s)1

    PubMed Central

    Luzzati, Alma; Goldlust, Marvin B.; Levine, Lawrence

    1968-01-01

    Normal animal sera inhibit at least one Clostridium histolyticum proteinase. An assay procedure based on immune hemolysis was developed for the estimation of this inhibition. This inhibitory activity occurs in various levels in the sera of different animal species. The highest titers have been obtained with rat sera. The inhibitory activity from human serum was isolated and purified 16- to 27-fold by Sephadex G-200 gel filtration and diethylaminoethyl cellulose or hydroxylapatite chromatography. The properties of the human serum inhibitor of the clostridial proteinase were compared with a trypsin inhibiting factor found in the partially purified preparations. Identical behavior of the two inhibitory factors was observed when measured by heat inactivation, β-mercaptoethanol sensitivity, pH stability, and sucrose gradient centrifugation. The inhibitory factor has an approximate sedimentation coefficient (S20,w) of 17. Goat anti–α-2-macroglobulin specifically precipitated the clostridial proteinase inhibitor from a partially purified preparation. PMID:5303620

  8. Synthesis and Characterization of Polyurethane Acrylates for UV Curable Coating Agents

    NASA Astrophysics Data System (ADS)

    Park, Mi Na; Kang, Young Soo; Oh, Sun Wha; Ahn, Byung Hyun; Moon, Myung Jun

    The single hydroxyl-terminated urethane acrylate oligomers were synthesized from 2-mercaptoethanol (2-MEOH), alkyl (methyl, butyl, and 2-ethylhexyl) acrylate, and 2,2-azobisisobutyronitrile (AIBN, initiator), with dibutyltin dilaurate (DBTDL) as a catalyst. 2-MEOH was used as a functional chain transfer agent. Poly(alkyl urethane) acrylate oligomers were obtained by the reaction of single hydroxyl-terminated polyalkyl acrylates and 2-isocyanatoethyl acrylate. They were characterized by NMR, FT-IR spectroscopy, rheometer, and DSC. Because poly(alkyl urethane) acrylate oligomers have lower Tg and viscosity than hydroxyl-terminated polyalkyl acrylate oligomers (HTPAO) non-containing urethane groups, they can be used for ultraviolet (UV) curable coatings, inks, and adhesives.

  9. Characterization of human carbonic anhydrase III from skeletal muscle.

    PubMed

    Carter, N; Jeffery, S; Shiels, A; Edwards, Y; Tipler, T; Hopkinson, D A

    1979-10-01

    A third form of human carbonic anhydrase (CA III), found at high concentrations in skeletal muscle, has been purified and characterized. This isozyme shows relatively poor hydratase and esterase activities compared to the red cell isozymes, CA I and CA II, but is similar to these isozymes in subunit structure (monomer) and molecular size (28,000). CA III is liable to posttranslational modification by thiol group interaction. Monomeric secondary isozymes, sensitive to beta-mercaptoethanol, are found in both crude and purified material and can be generated in vitro by the addition of thiol reagents. Active dimeric isozymes, generated apparently by the formation of intermolecular disulfide bridges, also occur but account for only a small proportion of the total protein and appear only when the concentration of CA III is particularly high.

  10. Leptospira and Brucella antibodies in collared anteaters (Tamandua tetradactyla) in Brazilian zoos.

    PubMed

    Sales, Indiara dos Santos; Folly, Márcio Manhães; Garcia, Luize Néli Nunes; Ramos, Tatiane Mendes Varela; da Silva, Mariana Cristina; Pereira, Martha Maria

    2012-12-01

    The presence of Leptospira spp. and Brucella spp. antibodies was investigated in serum samples from 28 collared anteaters (Tamandua tetradactyla) kept in seven Brazilian zoos. Sera were tested against 19 Leptospira serovars using microscopic agglutination. Samples reacted to the following serovars: two (7.14%) to Patoc, three (10.71%) to Tarrasovi, three (10.71%) to both Patoc and Tarrasovi, two (7.14%) to Wolffi, and one (3.57%) to Australis. Two (7.14%) samples reacted to the buffered Brucella antigen test, but no confirmatory reaction occurred using the 2-mercaptoethanol slow slide agglutination test. No sample was reactive in the agar gel immunodiffusion test for rugose species of Brucella. The presence of anti-leptospira agglutinins in captive T. tetradactyla serum indicates that this species may be susceptible to infection by these bacteria.

  11. Infrared microcalorimetric spectroscopy using quantum cascade lasers.

    PubMed

    Morales-Rodríguez, M E; Senesac, L R; Rajic, S; Lavrik, N V; Smith, D B; Datskos, P G

    2013-02-15

    We have investigated an IR microcalorimetric spectroscopy technique that can be used to detect the presence of trace amounts of target molecules. The chemical detection is accomplished by obtaining the IR photothermal spectra of molecules adsorbed on the surface of uncooled thermal micromechanical detectors. Although we use a chemical layer to absorb target molecules, IR microcalorimetric spectroscopy requires no chemical specific coatings. The chemical specificity of the presented method is a consequence of the wavelength-specific absorption of IR photons from tunable quantum cascade lasers due to vibrational spectral bands of the analyte. We have obtained IR photothermal spectra for trace concentrations of 1,3,5-Trinitroperhydro-1,3,5-triazine and a monolayer of 2-Sulfanylethan-1-ol (2-mercaptoethanol) over the wavelength region from 6 to 10 μm. We found that both chemicals exhibit a number of photothermal absorption features that are in good agreement with their respective IR spectra.

  12. A non-phenol-chloroform extraction of double-stranded RNA from plant and fungal tissues.

    PubMed

    Balijja, Alitukiriza; Kvarnheden, Anders; Turchetti, Tullio

    2008-09-01

    Double-stranded RNA (dsRNA) molecules of viruses are found in nature at a very high frequency. Their detection in plants and fungi has been carried out with difficulty due to the complicated dsRNA extraction techniques used commonly which includes phenol-chloroform extractions. In this study, an extraction method for isolation of dsRNA is described that is free of phenol and chloroform. A lysis buffer, containing beta-mercaptoethanol and polyvinylpolypyrrolidone (PVPP-40), was added to homogenised tissues and the subsequent supernatant was filtered through a cellulose CF-11 mini-column. DsRNA molecules were separated based on the differing affinity of nucleic acids for the cellulose CF-11 resin in 20% ethanol buffer. This easy, rapid and cheap technique has been successfully tested on fungi and plants containing different dsRNA virus molecules, indicating the possibility of a wide use of the method.

  13. Curcumin-incorporated albumin nanoparticles and its tumor image

    NASA Astrophysics Data System (ADS)

    Gong, Guangming; Pan, Qinqin; Wang, Kaikai; Wu, Rongchun; Sun, Yong; Lu, Ying

    2015-01-01

    Albumin is an ideal carrier for hydrophobic drugs. This paper reports a facile route to develop human serum albumin (HSA)-curcumin (CCM) nanoparticles, in which β-mercaptoethanol (β-ME) acted as an inducer and CCM acted as a bridge. Fluorescence quenching and conformational changes in HSA-CCM nanoparticles occurred during assembly. Disulfide bonds and hydrophobic interactions may play a key role in assembly. HSA-CCM nanoparticles were about 130 nm in size, and the solubility of CCM increased by more than 500 times. The HSA-CCM nanoparticles could accumulate at the cytoplasm of tumor cells and target the tumor tissues. Therefore, HSA nanoparticles fabricated by β-ME denaturation are promising nanocarriers for hydrophobic substances from chemotherapy drugs to imaging probes.

  14. Reduction potential of the sup sm bullet CO sub 2 sup minus radical anion in aqueous solutions

    SciTech Connect

    Surdhar, P.S.; Mezyk, S.P.; Armstrong, D.A. )

    1989-04-20

    The reduction potential for the {sup {sm bullet}}CO{sub 2}{sup {minus}} radical anion has been determined by equilibration of formate with sulfhydryl radicals of {beta}-mercaptoethanol, penicillamine, and lipoamide in aqueous solutions at pH 3-6. The reaction {sup {sm bullet}}CO{sub 2}{sup {minus}} + e{sup {minus}} + H{sup +} = HCO{sub 2}{sup {minus}} yields the value E{degree}{sub 9} = 1.49 V with an uncertainty of {plus minus}0.06 V. On the basis of this value and the known free energies of CO{sub 2}(aq) and HCO{sub 2}{sup {minus}}(aq), E{degree}{sub 19} for CO{sub 2} + e{sup {minus}} = {sup {sm bullet}}CO{sub 2}{sup {minus}} was found to be -1.85 V.

  15. Chemical forms of selenium present in rat and ram spermatozoa.

    PubMed

    Alabi, N S; Beilstein, M A; Whanger, P D

    2000-08-01

    In vivo and in vitro studies were conducted to investigate the chemical forms by ion-exchange chromatography of selenium (Se) present in rat and ovine spermatozoa. After injection with 75Se-selenite, the form of 75Se in rat sperm was selenocysteine, but selenocysteine and selenomethionine (SeMet) were present in ovine sperm. Presumably, synthesis of SeMet by rumen microbes are responsible for its presence in ovine sperm. In vitro incubation of ram sperm with selenocysteine or SeMet produced no changes, but incubation with selenite produced a compound that eluted one fraction before SeMet from the ion-exchange column. After treatment of this fraction with mercaptoethanol, it eluted in a later fraction upon rechromatography, suggesting it to be selenodicysteine. This compound is apparently formed because of high levels of cysteine in semen. Cysteine, reduced glutathione, and oxidized glutathione were also found in semen. The significance of the results is discussed.

  16. [Some properties of proteolytic enzymes from Tribolium confusum].

    PubMed

    Balaian, V M; Levitskiĭ, A P

    1982-01-01

    The digestive tract of Tribolium confusum Duv. larvae was studied for proteolytic enzymes properties. The pH optima are determined for the enzymes effect on various substrates. Proteases were partially purified by gel chromatography on Sephadex G = 100 and investigated for thyol compound influence on their activity. The activity of the enzymes is shown to increase considerably with addition of cystein, glutathione, 2-mercaptoethanol. dithiotreitol and EDTA. Dithiotreitol produces the strongest restoring effect and in concentration of 10(-6) M it activates the enzyme almost twice. Storage for 48 h at 4 degrees C induced a 2.5-fold decrease in the proteolytic enzyme activity; SH-groups in the catalytic action of enzymic solutions is shown. The maximum proteolytic activity is found in extracts from 14-day insects.

  17. Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

    PubMed Central

    Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

    1993-01-01

    We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

  18. Mullerian inhibiting substance fractionation by dye affinity chromatography.

    PubMed

    Budzik, G P; Powell, S M; Kamagata, S; Donahoe, P K

    1983-08-01

    Mullerian inhibiting substance (MIS), a large glycoprotein secreted by the fetal and neonatal testis, is responsible for regression of the Mullerian ducts in the male embryo. This fetal growth regulator has been purified more than 2000-fold from crude testicular incubation medium following fractionation on a triazinyl dye affinity support. A high yield of 60% recovered activity was achieved in the absence of exogenous carrier protein by stabilizing MIS with 2-mercaptoethanol, EDTA, and Nonidet-P40 and eliminating losses in the handling and concentration of MIS fractions. Although affinity elution with nucleotides has proved successful in other systems, MIS could not be eluted with ATP, GTP, or AMP, with or without divalent metal ions. Nucleotide elution, however, does remove contaminating proteins prior to MIS recovery with high ionic strength. The 2000-fold-purified MIS fraction, although not homogeneous, shows a reduction-sensitive band after SDS-gel electrophoresis that has been proposed to be the MIS dimer.

  19. Isolation of surface tubules of fowlpox virus.

    PubMed

    Carter, J K; Cheville, N F

    1981-01-01

    Surface tubules of fowlpox virus were isolated using chemical and physical methods. Suspensions of lipid cytoplasmic inclusion bodies were obtained by treating infected chorioallantoic membranes with 1% trypsin. Inclusions were treated with ultrasonic sound, detergents, and enzymes and were examined by electron microscopy. Although lipase treatment altered the morphology of lipid inclusions, no viral surface tubules were recovered. Treatment with the detergent Nonidet-P40 followed by 2-mercaptoethanol disrupted virions without allowing surface tubules to be recovered. Disruption of lipid inclusions by ultrasonic sound or manual grinding of chorioallantoic membranes produced free virions but only small numbers of tubules. These results indicate that surface tubules can be recovered, but that the lipid nature of cytoplasmic inclusions interferes with procedures commonly used in tubule purification.

  20. Anion complexes of Cu(II) and Co(II) bovine carbonic anhydrase as models for the copper site of blue copper proteins.

    PubMed

    Morpurgo, L; Finazzi Agrò, A; Rotilio, G; Mondovì, B

    1976-05-01

    1. The presence of two intense transitions in the optical absorption spectrum of the sulfide and 2-mercaptoethanol complexes of Cu(II) and Co(II)-substituted bovine carbonic anhydrase suggest that charge-transfer interactions between sulfur and an acceptor group of the protein play an important role in the stabilization of these complexes. 2. The spectra of Co(II) bovine carbonic anhydrase sulfides are very similar to the spectrum of Co(II) stellacyanin whilst the spectra of the corresponding Cu(II) enzymes are considerably different. A possible explanation is that Cu(II) is pentacoordinate in native stellacyanin unlike Cu(II) bovine carbonic anhydrase sulfides and Co(II) enzymes. Tetrahedral Co(II) stellacyanin is proposed as a model of the reduced copper site.

  1. Amphiphile dependency of the monomeric and dimeric forms of acetylcholinesterase from human erythrocyte membrane.

    PubMed

    Ott, P; Brodbeck, U

    1984-08-08

    Human erythrocyte membrane-bound acetylcholinesterase was converted to a monomeric species by treatment of ghosts with 2-mercaptoethanol and iodoacetic acid. After solubilization with Triton X-100, the reduced and alkylated enzyme was partially purified by affinity chromatography and separated from residual dimeric enzyme by sucrose density gradient centrifugation in a zonal rotor. Monomeric and dimeric acetylcholinesterase showed full enzymatic activity in presence of Triton X-100 whereas in the absence of detergent, activity was decreased to approx. 20% and 15%, respectively. Preformed egg phosphatidylcholine vesicles fully sustained activity of the monomeric species whereas the dimer was only 80% active. The results suggest that a dimeric structure is not required for manifestation of amphiphile dependency of membrane-bound acetylcholinesterase from human erythrocytes. Furthermore, monomeric enzyme appears to be more easily inserted into phospholipid bilayers than the dimeric species.

  2. Isoelectric focusing of basic proteins: the problem of oxidation of cysteines.

    PubMed

    Altland, K; Becher, P; Rossmann, U; Bjellqvist, B

    1988-09-01

    Isoelectric focusing of human globin chains in polyacrylamide gels dried in the ambient atmosphere and rehydrated in the presence of 8 mol/L urea produces artefactual doublets of zones as a result of oxidation by the gel. This oxidation can be avoided in separations of short duration by adding a reducing agent (e.g. 2-mercaptoethanol or dithiothreitol to the rehydration solution (Altland, K. and Rossmann, U., Electrophoresis 1985, 6, 314-325). We now demonstrate that the observed zone doublets can be explained by assuming neutralization of the contribution of dissociated sulfhydryl group of cysteine to pI by partial and reversible formation of globin dimers held together by disulfide bridges. Long time separations, requiring e.g. more than 4 h at greater than or equal to 500 V/cm, in pH gradients exceeding pH 7.5, are accompanied by artefactual oxidation from both the atmosphere and the gel matrix. Oxidation from the atmosphere as well as the effect of carbon dioxide can be eliminated by overlayering the gel with paraffin oil. Oxidation from the gel matrix can only partially be inhibited by rehydration of gels in the presence of 2-mercaptoethanol or dithiothreitol. Nearly complete protection against oxidation by the gel matrix was achieved by adding a permanent supply of 2-ME to the gel or by adding DTT to the cathodic wick towards the end of the experiment. Alkylation with iodoacetamide or iodoacetic acid resulted in stable globin patterns, which, however, displayed additional artefactual zones. Our experimental data indicate that the polyacrylamide gels function as an electron acceptor for dissociated sulfhydryl groups in proteins, even after pretreatment with strong reducing agents for proteins.

  3. Self-assembly of a surfactin nanolayer at solid-liquid and air-liquid interfaces.

    PubMed

    Onaizi, Sagheer A; Nasser, M S; Al-Lagtah, Nasir M A

    2016-05-01

    Surfactin, a sustainable and environmentally friendly surface active agent, is used as a model to study the adsorption of biosurfactants at hydrophobic and hydrophilic solid-liquid interfaces as well as the air-liquid interface. Surfactin adsorption was monitored as a function of time and concentration using surface plasmon resonance (SPR) technique in the case of the solid-liquid interfaces or the drop shape analysis (DSA) technique in the case of the air-liquid interface. The results obtained in this study showed that surfactin adsorption at the "hard" hydrophobic (functionalized with octadecanethiol) solid-liquid and the "soft" air-liquid interface were 1.12 ± 0.01 mg m(-2) (area per molecule of 157 ± 2 Å(2)) and 1.11 ± 0.05 mg m(-2) (area per molecule of 159 ± 7 Å(2)), respectively, demonstrating the negligible effect of the interface "hardness" on surfactin adsorption. The adsorption of surfactin at the hydrophilic (functionalized with β-mercaptoethanol) solid-liquid interface was about threefold lower than its adsorption at the hydrophobic-liquid interfaces, revealing the importance of hydrophobic interaction in surfactin adsorption process. The affinity constant of surfactin for the investigated interfaces follows the following order: air > octadecanethiol > β-mercaptoethanol. Biosurfactants, such as surfactin, are expected to replace the conventional fossil-based surfactants in several applications, and therefore the current study is a contribution towards the fundamental understanding of biosurfactant behavior, on a molecular level, at hydrophobic and hydrophilic solid-liquid interfaces in addition to the air-liquid interface. Such understanding might aid further optimization of the utilization of surfactin in a number of industrial applications such as enhanced oil recovery, bioremediation, and detergency.

  4. Induction of E-cadherin+ human amniotic fluid cell differentiation into oocyte-like cells via culture in medium supplemented with follicular fluid.

    PubMed

    Liu, Te; Huang, Yongyi; Bu, Yanzhen; Zhao, Yanhui; Zou, Gang; Liu, Zhixue

    2014-07-01

    Pluripotent human amniotic fluid cells (HuAFCs) can differentiate into various types of somatic cell in vitro. However, their differentiation into oocyte-like cells has never been described to the best of our knowledge. In the present study, differentiation of E-cadherin+ and E-cadherin- HuAFC sub-populations into oocyte-like cells was induced via culture in medium containing bovine follicular fluid and β-mercaptoethanol. The E-cadherin+ HuAFCs expressed DAZL highly. Post-induction, cells with an oocyte-like phenotype were found among the E-cadherin+ HuAFCs, expressing markers specific to germ cells and oocytes (VASA, ZP3 and GDF9) and meiosis (DMC1 and SCP3). When specific small interfering RNA (siRNA) was used to suppress E-cadherin in the E-cadherin+ HuAFCs, the levels of DAZL expression were reduced. Post-induction, the morphology of the siRNA‑E‑cadherin HuAFCs was poorer and the expression levels of germ cell-specific markers were lower compared with those of the siRNA-mock HuAFCs. Therefore, E-cadherin+ HuAFCs could be more easily induced to differentiate into oocyte-like cells by bovine follicular fluid and β-mercaptoethanol. In addition, the E-cadherin+ HuAFCs exhibited potential characteristics of DAZL protein expression, and thus it was conjectured that bovine follicular fluid acts on DAZL protein and promotes E-cadherin+ HuAFC differentiation into oocyte-like cells.

  5. Isolation and properties of the luciferase stored in the ovary of the scyphozoan medusa Periphylla periphylla.

    PubMed

    Shimomura, O; Flood, P R; Inouye, S; Bryan, B; Shimomura, A

    2001-12-01

    Bioluminescence of the medusa Periphylla is based on the oxidation of coelenterazine catalyzed by luciferase. Periphylla has two types of luciferase: the soluble form luciferase L, which causes the exumbrellar bioluminescence display of the medusa, and the insoluble aggregated form, which is stored as particulate material in the ovary, in an amount over 100 times that of luciferase L. The eggs are especially rich in the insoluble luciferase, which drastically decreases upon fertilization. The insoluble form could be solubilized by 2-mercaptoethanol, yielding a mixture of luciferase oligomers with molecular masses in multiples of approximately 20 kDa. Those having the molecular masses of 20 kDa, 40 kDa, and 80 kDa were isolated and designated, respectively, as luciferase A, luciferase B, and luciferase C. The luminescence activities of Periphylla luciferases A, B, and C were 1.2 approximately 4.1 x 10(16) photon/mg. s, significantly higher than any coelenterazine luciferase known, and the quantum yields of coelenterazine catalyzed by these luciferases (about 0.30 at 24 degrees C) are comparable to that catalyzed by Oplophorus luciferase (0.34 at 22 degrees C), which has been considered the most efficient coelenterazine luciferase until now. Luciferase L (32 kDa) could also be split by 2-mercaptoethanol into luciferase A and an accessory protein (approx. 12 kDa), as yet uncharacterized. Luciferases A, B, and C are highly resistant to inactivation: their luminescence activities are only slightly diminished at pH 1 and pH 11 and are enhanced in the presence of 1 approximately 2 M guanidine hydrochloride; but they are less stable to heating than luciferase L, which is practically unaffected by boiling.

  6. Promoting effect of small molecules in cardiomyogenic and neurogenic differentiation of rat bone marrow-derived mesenchymal stem cells

    PubMed Central

    Khanabdali, Ramin; Saadat, Anbarieh; Fazilah, Maizatul; Bazli, Khairul Fidaa’ Khairul; Qazi, Rida-e-Maria; Khalid, Ramla Sana; Hasan Adli, Durriyyah Sharifah; Moghadamtousi, Soheil Zorofchian; Naeem, Nadia; Khan, Irfan; Salim, Asmat; Shamsuddin, ShamsulAzlin Ahmad; Mohan, Gokula

    2016-01-01

    Small molecules, growth factors, and cytokines have been used to induce differentiation of stem cells into different lineages. Similarly, demethylating agents can trigger differentiation in adult stem cells. Here, we investigated the in vitro differentiation of rat bone marrow mesenchymal stem cells (MSCs) into cardiomyocytes by a demethylating agent, zebularine, as well as neuronal-like cells by β-mercaptoethanol in a growth factor or cytokines-free media. Isolated bone marrow-derived MSCs cultured in Dulbecco’s Modified Eagle’s Medium exhibited a fibroblast-like morphology. These cells expressed positive markers for CD29, CD44, and CD117 and were negative for CD34 and CD45. After treatment with 1 μM zebularine for 24 hours, the MSCs formed myotube-like structures after 10 days in culture. Expression of cardiac-specific genes showed that treated MSCs expressed significantly higher levels of cardiac troponin-T, Nkx2.5, and GATA-4 compared with untreated cells. Immunocytochemical analysis showed that differentiated cells also expressed cardiac proteins, GATA-4, Nkx 2.5, and cardiac troponin-T. For neuronal differentiation, MSCs were treated with 1 and 10 mM β-mercaptoethanol overnight for 3 hours in complete and serum-free Dulbecco’s Modified Eagle’s Medium, respectively. Following overnight treatment, neuron-like cells with axonal and dendritic-like projections originating from the cell body toward the neighboring cells were observed in the culture. The mRNA expression of neuronal-specific markers, Map2, Nefl, Tau, and Nestin, was significantly higher, indicating that the treated cells differentiated into neuronal-like cells. Immunostaining showed that differentiated cells were positive for the neuronal markers Flk, Nef, Nestin, and β-tubulin. PMID:26766903

  7. Promoting effect of small molecules in cardiomyogenic and neurogenic differentiation of rat bone marrow-derived mesenchymal stem cells.

    PubMed

    Khanabdali, Ramin; Saadat, Anbarieh; Fazilah, Maizatul; Bazli, Khairul Fidaa' Khairul; Qazi, Rida-e-Maria; Khalid, Ramla Sana; Hasan Adli, Durriyyah Sharifah; Moghadamtousi, Soheil Zorofchian; Naeem, Nadia; Khan, Irfan; Salim, Asmat; Shamsuddin, ShamsulAzlin Ahmad; Mohan, Gokula

    2016-01-01

    Small molecules, growth factors, and cytokines have been used to induce differentiation of stem cells into different lineages. Similarly, demethylating agents can trigger differentiation in adult stem cells. Here, we investigated the in vitro differentiation of rat bone marrow mesenchymal stem cells (MSCs) into cardiomyocytes by a demethylating agent, zebularine, as well as neuronal-like cells by β-mercaptoethanol in a growth factor or cytokines-free media. Isolated bone marrow-derived MSCs cultured in Dulbecco's Modified Eagle's Medium exhibited a fibroblast-like morphology. These cells expressed positive markers for CD29, CD44, and CD117 and were negative for CD34 and CD45. After treatment with 1 μM zebularine for 24 hours, the MSCs formed myotube-like structures after 10 days in culture. Expression of cardiac-specific genes showed that treated MSCs expressed significantly higher levels of cardiac troponin-T, Nkx2.5, and GATA-4 compared with untreated cells. Immunocytochemical analysis showed that differentiated cells also expressed cardiac proteins, GATA-4, Nkx 2.5, and cardiac troponin-T. For neuronal differentiation, MSCs were treated with 1 and 10 mM β-mercaptoethanol overnight for 3 hours in complete and serum-free Dulbecco's Modified Eagle's Medium, respectively. Following overnight treatment, neuron-like cells with axonal and dendritic-like projections originating from the cell body toward the neighboring cells were observed in the culture. The mRNA expression of neuronal-specific markers, Map2, Nefl, Tau, and Nestin, was significantly higher, indicating that the treated cells differentiated into neuronal-like cells. Immunostaining showed that differentiated cells were positive for the neuronal markers Flk, Nef, Nestin, and β-tubulin.

  8. Cost-effective one-step PCR amplification of cystic fibrosis delta F508 fragment in a single cell for preimplantation genetic diagnosis.

    PubMed

    Tsai, Y H

    1999-11-01

    The combination of in vitro fertilization (IVF) with PCR technologies enables diagnosis of single gene defects for preimplantation genetic diagnosis. This has been accomplished by two-step nested PCR, or PEP-PCR followed by nested PCR processes. To improve the detection of single cell genetic defects, the lysate of a single lymphocyte, with or without cystic fibrosis DeltaF508 mutation (CFDeltaF508), was incubated in a higher ionic strength solution containing mercaptoethanol prior to the addition of primers to the denatured cellular DNA. A single cell in 5 microl lysis buffer was incubated at 65 degrees C for 15 min, cooled, and neutralized with an equal volume of neutralizing buffer. A 5 microl aliquot of a solution X containing 50 mM MgCl(2), 1 M NaCl, and 10 mM mercaptoethanol was added to the neutralized cell lysate, followed by incubation at 93 degrees C for 15 min. The step was crucial to the successful amplification of CFDeltaF508 DNA fragment. The incubation of cell lysate in solution with the high level of sulphydryl reducing agent and a high ionic strength of about 0.45, at 93 degrees C for 15 min, might denature many chromatin-binding proteins and also ensure the complete dissociation of dsDNA. After the addition of PCR mix, the resulting reaction mixture still contained a sufficient level of sulphydryl reducing agent and 0.135 total ionic strength. This might reduce significantly the interference of various protein factors with DNA, and favour the primer-template annealing. The efficient initial annealing of the primers to target DNA sequences would facilitate PCR amplification efficacy. In conclusion, in more than 80 single cells tested (apart from one) the CFDeltaF508 defect was successfully demonstrated with the present protocol (>99 per cent), without using fluorescent primers and expensive automatic instrumentation.

  9. Inhibitory protein controls the reversion of protoplasts and L forms of Bacillus subtilis to the walled state.

    PubMed Central

    DeCastro-Costa, M R; Landman, O E

    1977-01-01

    When the cell wall of Bacillus subtilis is removed by lysozyme and the resultant protoplasts are plated on hypertonic soft agar medium, each protoplast forms an L colony. L bodies from such L colonies again plate as L-colony-forming units (CFU). However, if protoplasts or L bodies are "conditioned" by 1 h of incubation in 0.4% casein hydrolysate medium and then incubated in 25% gelatin medium for 1 h, 60 to 100% of the formerly naked cells give rist to bacillary colonies. The present experiments largely explain the mechanism responsible for the "heritable" persistence of the wall-less state in B. subtilis. It is shown that protoplasts produce a reversion inhibitory factor (RIF) which blocks reversion when the cell concentration exceeds 5 x 105 CFU/ml. This inhibitor is nondialyzable and sensitive to trypsin, heat, and detergent. Efficient reversion at 2 x 107 CFU/ml is obtained if the protoplasts are treated with trypsin after conditioning and chloramphenicol is incorporated into the gelatin reversion medium. In the presence of 500 mug of trypsin per ml, the requirement for gelatin is sharply reduced, and reversion occurs rapidly in liquid medium containing only 10% gelatin. Trypsin also stimulates reversion in L colonies growing on soft agar. Latent RIF is activated by beta-mercaptoethanol. This reagent blocks reversion of protoplast suspensions at densities of 5 x 105 CFU/ml. Comparison of the autolytic behavior of B. subtilis and of the RIF revealed that several or the properties of the two activities coincide: both are inhibited by high concentrations of gelatin, both are activated by beta-mercaptoethanol, and both have high affinity for cell wall. Going on the assumption that RIF is autolysin, models for protoplast reversion is suggested by the finding that mutants with altered teichoic acid show altered reversion behavior. PMID:402356

  10. Conjugation of glutathione and other thiols with bioreductively activated mitomycin C. Effect of thiols on the reductive activation rate.

    PubMed

    Sharma, M; Tomasz, M

    1994-01-01

    Mitomycin C (MC), a clinically used natural antitumor agent, was shown to form three monoconjugates (11a-13a) and two bisconjugates (14a, 15a) with GSH upon reductive activation by rat liver microsomes, purified NADPH-cytochrome c reductase, or NADH-cytochrome c reductase or chemical reduction using H2/PtO2. Rat liver cytosol/NADH activated MC only at acidic pH (5.8), resulting in the formation of a single GSH-MC monoconjugate, 13a. The reductase responsible for cytosolic activation of MC to form this conjugate was DT-diaphorase. GSH itself did not reduce MC, and unreduced MC did not form conjugates with GSH. A moderate catalytic effect by glutathione S-transferase was demonstrated on the cytosol-activated reaction. Mercaptoethanol and N-acetylcysteine gave analogous sets of five MC-thiol conjugates under cytochrome c reductase or H2/PtO2 activation conditions. The structures of all 15 MC-thiol conjugates (five each with GSH, mercaptoethanol, and N-acetylcysteine, respectively) were determined, using 1H-NMR, UV, and mass spectroscopies, combined with analytical chemical and radiolabeling methods. The mechanism of formation of the conjugates features SN2 displacement of the carbamate of the reduced MC by GS-. The MC-GSH conjugates were noncytotoxic to the tumor cells tested. The conjugation of GSH with activated MC is likely to represent detoxication in mammalian cells. As another effect, GSH accelerates the rate of reduction of MC by "slow" reducing agents such as cytochrome c reductases and H2/PtO2. A mechanism is proposed to explain this effect, which involves further reduction of the initially formed MC semiquinone free radical by GSH.

  11. The first trimeric Galanthus nivalis agglutinin-related lectin of Orchidaceae was found in Dendrobium pendulum: purification, characterization, and effects of stress factors.

    PubMed

    Siripipatthana, Patthraporn; Phaonakrop, Narumon; Roytrakul, Sittiruk; Senawong, Gulsiri; Mudalige-Jayawickrama, Rasika G; Sattayasai, Nison

    2015-07-01

    Trimeric Galanthus nivalis agglutinin-related lectin of Orchidaceae with two conformational forms was first studied in Dendrobium pendulum . It was highly expressed by stress factors. Using mannan-agarose column chromatography, a mannose-binding protein was purified from Dendrobium pendulum Roxb. pseudobulb. After heating in the presence of sodium dodecyl sulfate (SDS) with or without 2-mercaptoethanol, the protein showed one band with molecular mass of 14.0 kDa on SDS-polyacrylamide gel electrophoresis (PAGE). Without heating, three bands were found at positions of 14.0, 39.4, and 41.5 kDa, but a higher amount of 39.4 and 41.5 kDa protein bands were seen in the presence of 2-mercaptoethanol. Liquid chromatography-tandem mass spectrometry and database search indicated that the 14.0 kDa protein band contained three peptide fragments identical to parts of a lectin precursor from Dendrobiu m findleyanum Parish & Rchb.f. Native-PAGE and Ferguson plot showed that the purified protein had two native forms with molecular masses of 44.2 and 45.3 kDa, indicating three 14.0 kDa polypeptide subunits. The purified protein exhibited the agglutination activity with trypsinized chicken erythrocytes. It was then recognized as a Galanthus nivalis agglutinin-related lectin and named D. pendulum agglutinin (DPA). Using reverse transcription-polymerase chain reaction and DNA sequencing, the deduced amino acid sequence of DPA precursor showed the highest homology (96.4%) with a lectin precursor of D. findleyanum and contained three mannose-binding sites. Greater amounts of DPA were found when the pseudobulbs were treated with stress factors including ultraviolet light, abscisic acid, hydrogen peroxide, and acetylene gas.

  12. Nature of protein-protein interactions during the gelation of canola protein isolate networks.

    PubMed

    Kim, Jae He; Varankovich, Natallia V; Stone, Andrea K; Nickerson, Michael T

    2016-11-01

    The nature of interactions involved during the gelation of a canola protein isolate was investigated using rheology and fractal imaging at neutral pH as a function of protein concentration (5.0-9.0% w/w). The onset of denaturation and the denaturation temperature by differential scanning calorimetry for canola protein isolate (CPI; 98.2% protein) was 78.6°C and 87.1°C, respectively. Rheological testing determined the gelation temperature (Tgel) to be ~87-90°C for all concentrations. The log % strain at break increased from 1.70 to 1.80 as CPI concentration increased from 5.0 to 7.0% (w/w). Rheological testing of CPI in the presence of destabilizing agents, NaCl (0.1 and 0.5M), urea (0.1, 0.5, 1 and 5M) and 2-β-mercaptoethanol (0.1 and 2%), was performed. Samples with NaCl and urea (0.1-1M) had similar temperature profiles and Tgel values to CPI alone whereas no gel was formed with the addition of 5M urea and 2-β-mercaptoethanol reduced the strength of the gel network. Fractal dimension and lacunarity was analyzed using CLSM imaging. The fractal dimension value for all CPI concentrations was ~1.5. The lacunarity of the gel decreased from 0.62 to 0.41 as the concentration of CPI increased from 5 to 7% (w/w). Mechanistic understanding of CPI aggregation and network formation will enable the food industry to better tailor food structure when CPI is present as ingredient. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Reduced levels of intracellular reactive oxygen species and apoptotic status are not correlated with increases in cryotolerance of bovine embryos produced in vitro in the presence of antioxidants.

    PubMed

    Rocha-Frigoni, Nathália A S; Leão, Beatriz C S; Nogueira, Ériklis; Accorsi, Mônica F; Mingoti, Gisele Z

    2014-01-01

    The effects of intracellular (cysteine and β-mercaptoethanol) and extracellular (catalase) antioxidant supplementation at different times during in vitro production (IVM and/or in vitro culture (IVC)) on bovine embryo development, intracellular reactive oxygen species (ROS) levels, apoptosis and re-expansion rates after a vitrification-thawing process were examined. Blastocyst frequencies were not affected by either antioxidant supplementation (40.5%-56.4%) or the timing of supplementation (41.7%-55.4%) compared with control (48.7%; P>0.05). Similarly, antioxidants and the moment of supplementation did not affect (P>0.05) the total number of blastomeres (86.2-90.5 and 84.4-90.5, respectively) compared with control (85.7). However, the percentage of apoptotic cells was reduced (P<0.05) in groups supplemented during IVM (1.7%), IVC (2.0%) or both (1.8%) compared with control (4.3%). Intracellular ROS levels measured in Day 7 blastocysts were reduced (P<0.05) in all groups (0.60-0.78), with the exception of the group supplemented with β-mercaptoethanol during IVC (0.88), which did not differ (P>0.05) from that in the control group (1.00). Re-expansion rates were not affected (P>0.05) by the treatments (50.0%-93.0%). In conclusion, antioxidant supplementation during IVM and/or IVC reduces intracellular ROS and the rate of apoptosis; however, supplementation does not increase embryonic development and survival after vitrification.

  14. A 23-kDa protein as a substrate for protein kinase C in bovine neutrophils. Purification and partial characterization

    SciTech Connect

    Stasia, M.J.; Dianoux, A.C.; Vignais, P.V. )

    1989-12-12

    In {sup 32}P{sub i}-loaded bovine neutrophils stimulated with phorbol myristate acetate (PMA), radioactivity was preferentially incorporated into a protein of low molecular mass, suggesting a PKC-dependent phosphorylation. This protein, termed 23-kDa protein, was predominantly localized in the cytosol. The apparent molecular mass of the purified protein range between 20 and 23 kDa. In the absence of mercaptoethanol, a dimer accumulated. Homogeneity of the 23-kDa protein was verified by 2D-PAGE analysis. Gel isoelectric focusing (IEF) of the purified 23-kDa protein followed by Coomassie blue staining allowed the visualization of our discrete protein bands with isoelectric points ranging between pH 6.3 and 6.7. Phosphorylation of the 23-kDa protein by ({gamma}-{sup 32}P)ATP in the presence of bovine neutrophil PKC supplemented with Ca{sup 2+}, phosphatidylserine, and diacylglycerol or with PMA occurred on serine and required the presence of mercaptoethanol. IEF of the {sup 32}P-labeled 23-kDa protein followed by autoradiography revealed for discrete bands with distinct isoelectric points similar to those of the bands stained by Coomassie blue after IEF on nonlabeled 23-kDa protein. The bands of the 23-kDa protein resolved by IEF and transfered to nitrocellulose showed ability to bind ({sup 35}S)GTP-{gamma}-S. The immunoreactivity of antibodies raised in rabbits against the bovine neutrophil 23-kDa protein was demonstrated on immunoblots after SDS-PAGE. The 23-kDa protein differed also from several other proteins of similar molecular mass that have been identified in neutrophils, namely, calmodulin, the small subunit of the low-potential cytochrome b, and a low molecular weight protein which is ADP-ribosylated by the botulinum toxin.

  15. Regulation of multilineage gene expression and apoptosis during in vitro expansion of human bone marrow stromal cells with different cell culture media.

    PubMed

    Zhu, Huiyong; Miosge, Nicolai; Schulz, Jutta; Schliephake, Henning

    2010-01-01

    The aim of the present study was to analyze the effect of 3 different expansion media on the expression of marker genes of mesenchymal differentiation (bone, cartilage, fat) as well as apoptosis and senescence during repeated passaging in human bone marrow stromal cells (hBMSCs) in order to identify potential expansion strategies for the use of these cells into tissue-engineered growth of bone. Medium 1 (EGF, PDGF, low Glc, 2% FCS) was associated with the highest proliferation rate compared to medium 2 (β-mercaptoethanol, high Glc DMEM, 15% FCS) and medium 3 (low Glc DMEM, 10% FCS). Real time RT-PCR indicated the lowest levels of expression of osteonectin, core binding factor-α 1, lipoprotein lipase and cartilage oligo matrix protein in medium-1 cultures as compared to media 2 and 3. Early passages expressed higher levels of peroxisome proliferator-activator receptor-γ2 in medium 1 than in media 2 and 3, whereas no difference of Sox-9 expression was noticed among the 3 media. Expression of apoptosis- and senescence-related genes (Bax, BCL-2 and P16INK4a) exhibited the lowest level of Bax/BCL-2 ratio and P16INK4a gene expression of hBMSC in medium 1. In conclusion, the replacement of FCS by recombinant EGF and PDGF promoted rapid proliferation of hBMSCs without inducing differentiation of hBMSCs. It also inhibited expression of apoptosis-related genes and limited replicative senescence during repeated passaging. Media with the lowest possible FCS content and replacement by EGF and PDGF thus should be used for 2D culturing during expansion of hBMSCs, whereas β-mercaptoethanol and high concentrations of FCS can help to commence osteogenic differentiation. Copyright © 2010 S. Karger AG, Basel.

  16. Evidence for the presence of collagenous domains in Candida albicans cell surface proteins.

    PubMed Central

    Sepúlveda, P; Murgui, A; López-Ribot, J L; Casanova, M; Timoneda, J; Martínez, J P

    1995-01-01

    Rabbit polyclonal antibodies (PAbs) directed towards the amino-terminal cysteine-rich 7S domain (PAb anti-7S), the major internal collagenous domain (PAb anti-type IV), and the C-terminal noncollagenous region (PAb anti-NC1) of the type IV collagen molecule were probed by indirect immunofluorescence against Candida albicans blastoconidia and germinated blastoconidia. Most nongerminating cells and mother blastoconidia from which germ tubes originated showed strong fluorescence when PAb anti-7S was used, whereas with PAb anti-type IV, fluorescence was found almost exclusively on the surface of filamentous forms. A patched fluorescent pattern rather than a homogenous confluent fluorescence was observed in all cases. No fluorescent cells were observed with PAb anti-NC1. By Western immunoblotting, PAb anti-type IV cross-reacted primarily with a polypeptide of 37 kDa present in wall extracts obtained from intact cells of both growth forms by treatment with beta-mercaptoethanol, whereas PAb anti-7S recognized a major 58-kDa antigen also present in both extracts, along with some other high-molecular-mass (> 106-kDa) polydisperse species present only in the material released from blastoconidia with beta-mercaptoethanol. No reactive bands were observed when PAb anti-NC1 was used as a probe in Western immunoblotting experiments. The sensitivities or resistances to collagenase digestion of the different polypeptides that cross-reacted with PAbs anti-type IV and anti-7S suggest the existence of cell wall components in C. albicans that contain epitopes that mimic the collagenous domains of the type IV collagen molecule. PMID:7768595

  17. Visualization of the turkey erythrocyte beta-adrenergic receptor.

    PubMed

    Durieu-Trautmann, O; Delavier-Klutchko, C; Vauquelin, G; Strosberg, A D

    1980-01-01

    We have recently described the affinity chromatography purification of the turkey erythrocyte beta-adrenergic receptor. The minute amounts obtained initially precluded extensive biochemical characterization. To improve the yield of the receptor, the erythrocyte membranes have been prepared by a new method. This procedure resulted in a 10-fold higher receptor density in comparison with the membrane preparation used previously. The new membranes also contained a catecholamine-sensitive guanine triphosphatase and an adenylate cyclase sensitive to Gpp(NH)p and l-epinephrine. Solubilization by a double digitonin extraction resulted in a preparation containing 4-6 pmoles of 3H-dihydroalprenolol binding sites per mg of membrane protein. A single step of affinity chromatography on alprenolol-sepharose of the soluble digitonin extract resulted in an additional 1,000-fold purification of the receptor. The overall purification factor was 20,000 relative to the binding activity of the crude membrane preparations. Electrophoresis is SDS-polyacrylamide of iodinated purified beta-receptors revealed, after autoradiography, the presence of four major components. Three of these, corresponding to molecular weights of 170,000, 33,000, and 30,000, respectively, were not affected by reduction with beta-mercaptoethanol and were not observed when the digitonin extracts were loaded on the affinity gel in the presence of an excess of l-propranolol. A fourth 52,000-dalton component (60,000 daltons after reduction with beta-mercaptoethanol) remained apparent even when affinity purification was prevented by addition of l-propranolol. Our results suggest that the beta-adrenergic receptor is composed of at least three subunits that interact by noncovalent bonds.

  18. Biochemical and EPR-spectroscopic investigation into heterologously expressed vinyl chloride reductive dehalogenase (VcrA) from Dehalococcoides mccartyi strain VS.

    PubMed

    Parthasarathy, Anutthaman; Stich, Troy A; Lohner, Svenja T; Lesnefsky, Ann; Britt, R David; Spormann, Alfred M

    2015-03-18

    Reductive dehalogenases play a critical role in the microbial detoxification of aquifers contaminated with chloroethenes and chlorethanes by catalyzing the reductive elimination of a halogen. We report here the first heterologous production of vinyl chloride reductase VcrA from Dehalococcoides mccartyi strain VS. Heterologously expressed VcrA was reconstituted to its active form by addition of hydroxocobalamin/adenosylcobalamin, Fe(3+), and sulfide in the presence of mercaptoethanol. The kinetic properties of reconstituted VcrA catalyzing vinyl chloride reduction with Ti(III)-citrate as reductant and methyl viologen as mediator were similar to those obtained previously for VcrA as isolated from D. mccartyi strain VS. VcrA was also found to catalyze a novel reaction, the environmentally important dihaloelimination of 1,2-dichloroethane to ethene. Electron paramagnetic resonance (EPR) spectroscopic studies with reconstituted VcrA in the presence of mercaptoethanol revealed the presence of Cob(II)alamin. Addition of Ti(III)-citrate resulted in the appearance of a new signal characteristic of a reduced [4Fe-4S] cluster and the disappearance of the Cob(II)alamin signal. UV-vis absorption spectroscopy of Ti(III)citrate-treated samples revealed the formation of two new absorption maxima characteristic of Cob(I)alamin. No evidence for the presence of a [3Fe-4S] cluster was found. We postulate that during the reaction cycle of VcrA, a reduced [4Fe-4S] cluster reduces Co(II) to Co(I) of the enzyme-bound cobalamin. Vinyl chloride reduction to ethene would be initiated when Cob(I)alamin transfers an electron to the substrate, generating a vinyl radical as a potential reaction intermediate.

  19. Large-Scale Refolding and Enzyme Reaction of Human Preproinsulin for Production of Human Insulin.

    PubMed

    Kim, Chang-Kyu; Lee, Seung-Bae; Son, Young-Jin

    2015-10-01

    Human insulin is composed of 21 amino acids of an A-chain and 30 amino acids of a B-chain. This is the protein hormone that has the role of blood sugar control. When the recombinant human proinsulin is expressed in Escherichia coli, a serious problem is the formation of an inclusion body. Therefore, the inclusion body must be denatured and refolded under chaotropic agents and suitable reductants. In this study, H27R-proinsulin was refolded from the denatured form with β-mercaptoethanol and urea. The refolding reaction was completed after 15 h at 15°C, whereas the reaction at 25°C was faster than that at 15°C. The refolding yield at 15°C was 17% higher than that at 25°C. The refolding reaction could be carried out at a high protein concentration (2 g/l) using direct refolding without sulfonation. The most economical and optimal refolding condition for human preproinsulin was 1.5 g/l protein, 10 mM glycine buffer containing 0.6 M urea, pH 10.6, and 0.3 mM β-mercaptoethanol at 15°C for 16 h. The maximum refolding yield was 74.8% at 15°C with 1.5 g/l protein. Moreover, the refolded preproinsulin could be converted into normal mature insulin with two enzymes. The average amount of human insulin was 138.2 g from 200 L of fermentation broth after enzyme reaction with H27R-proinsulin. The direct refolding process for H27R-proinsulin was successfully set up without sulfonation. The step yields for refolding and enzyme reaction were comparatively high. Therefore, our refolding process for production of recombinant insulin may be beneficial to the large-scale production of other biologically active proteins.

  20. An investigation into the inter-relationships of sulphur xeno-biotransformation pathways in Parkinson's and motor neurone diseases.

    PubMed

    Steventon, Glyn B; Waring, Rosemary H; Williams, Adrian C

    2003-01-01

    The role of defective 'sulphur xenobiotic' biotransformations in the aetiology of Parkinson's and motor neurone diseases has been in the literature for over a decade. Problems in the S-oxidation of aliphatic thioethers, sulphation of phenolic compounds and the S-methylation of aliphatic sulphydryl groups have all been reported. These reports have also been consistent in observing that only a 'significant minority' of patients express these problems in sulphur biotransformation pathways. However, no investigation has yet reported on the incidence of these three defective pathways in control invididuals and in patients with Parkinson's and motor neurone disease. This investigation has found that: 1. Forty percent of patients with Parkinson's and motor neurone disease have a defect in the S-oxidation of S-carboxymethyl-L-cysteine compared to 4% of controls. 2. 35-40% of patients with Parkinson's and motor neurone disease have a defect in the sulphation of paracetamol compared to 4% of controls. 3. 60% of patients with motor neurone disease have a high capacity for the S-methylation of 2-mercaptoethanol compared to 4% of controls. 4. 38% of patients with Parkinson's disease have a low capacity for the S-methylation of 2-mercaptoethanol compared to 4% of controls. 5. There is no correlation between the S-oxidation phenotype, low paracetamol sulphation phenotype and low or high S-methylation phenotype in controls or patients with Parkinson's or motor neurone disease. 6. The number of controls that expressed one of the aberrant phenotypes was 4% compared to 38% of the patients with Parkinson's disease and 47% of the patients with motor neurone disease. 7. The number of controls that expressed two of the aberrant phenotypes was 0% compared to 18% of the patients with Parkinson's disease and 19% of those with motor neurone disease. 8. No controls or patients with Parkinson's disease or motor neurone disease expressed all three of the aberrant phenotypes. The results

  1. The crystal structure of a ternary complex of betaine aldehyde dehydrogenase from Pseudomonas aeruginosa Provides new insight into the reaction mechanism and shows a novel binding mode of the 2'-phosphate of NADP+ and a novel cation binding site.

    PubMed

    González-Segura, Lilian; Rudiño-Piñera, Enrique; Muñoz-Clares, Rosario A; Horjales, Eduardo

    2009-01-16

    In the human pathogen Pseudomonas aeruginosa, the NAD(P)(+)-dependent betaine aldehyde dehydrogenase (PaBADH) may play the dual role of assimilating carbon and nitrogen from choline or choline precursors--abundant at infection sites--and producing glycine betaine and NADPH, potentially protective against the high-osmolarity and oxidative stresses prevalent in the infected tissues. Disruption of the PaBADH gene negatively affects the growth of bacteria, suggesting that this enzyme could be a target for antibiotic design. PaBADH is one of the few ALDHs that efficiently use NADP(+) and one of the even fewer that require K(+) ions for stability. Crystals of PaBADH were obtained under aerobic conditions in the presence of 2-mercaptoethanol, glycerol, NADP(+) and K(+) ions. The three-dimensional structure was determined at 2.1-A resolution. The catalytic cysteine (C286, corresponding to C302 of ALDH2) is oxidized to sulfenic acid or forms a mixed disulfide with 2-mercaptoethanol. The glutamyl residue involved in the deacylation step (E252, corresponding to E268 of ALDH2) is in two conformations, suggesting a proton relay system formed by two well-conserved residues (E464 and K162, corresponding to E476 and K178, respectively, of ALDH2) that connects E252 with the bulk water. In some active sites, a bound glycerol molecule mimics the thiohemiacetal intermediate; its hydroxyl oxygen is hydrogen bonded to the nitrogen of the amide groups of the side chain of the conserved N153 (N169 of ALDH2) and those of the main chain of C286, which form the "oxyanion hole." The nicotinamide moiety of the nucleotide is not observed in the crystal, and the adenine moiety binds in the usual way. A salt bridge between E179 (E195 of ALDH2) and R40 (E53 of ALDH2) moves the carboxylate group of the former away from the 2'-phosphate of the NADP(+), thus avoiding steric clashes and/or electrostatic repulsion between the two groups. Finally, the crystal shows two K(+) binding sites per subunit

  2. Dissolution and immunochemical analysis of the sheath of the archaeobacterium Methanospirillum hungatei GP1.

    PubMed Central

    Southam, G; Beveridge, T J

    1991-01-01

    The sheath of Methanospirillum hungatei GP1 was degraded by three dissolution techniques, which produced a range of soluble products. By using 0.05 M L-arginine buffer (pH 12.6) at 90 degrees C for 10 min, 74% (dry weight) of the sheath was dissolved; however, the solubilized polypeptides were extensively degraded. Treatment with 2% beta-mercaptoethanol and 2% sodium dodecyl sulfate at 90 degrees C in 0.05 M 2(N-cyclohexylamino)ethanesulfonic acid (CHES) buffer (pH 9.0) solubilized 42% (dry weight) of the sheath as a group of polypeptides of 30 to 40 kDa. At 100 degrees C for 2 h, 5% beta-mercaptoethanol, 2% sodium dodecyl sulfate (SDS), and 20 mM EDTA released 74% of the sheath's mass as a group of polypeptides of 10 to 40 kDa. All solubilized products were examined by SDS-polyacrylamide gel electrophoresis, and a range of high- and low-molecular-weight polypeptides was identified. None were glycoproteins. Hoops, which comprise the sheath's structure, were seen by electron microscopy after all of the attempted dissolutions. Monoclonal antibodies were produced against the 10- to 40-kDa range of solubilized products and against the approximately 40-kDa polypeptides, and polyclonal antiserum was produced against an 18-kDa polypeptide. These immunological markers were used in Western immunoblotting and protein A-colloidal gold-antibody probing by electron microscopy to identify the structural location of the various polypeptides. Native sheath, which possesses 2.8-nm particles on its outer surface (M. Stewart, T.J. Beveridge, and G.D. Sprott, J. Mol. Biol. 183:509-515, 1985; P.J. Shaw, G.J. Hills, J.A. Henwood, J.E. Harris, and D.B. Archer, J. Bacteriol. 161:750-757, 1985), presented a gentle wave-form surface in platinum-shadowed specimens. In contrast, the inner face of the sheath was highlighted by ridges lying perpendicular to the longitudinal axis of the sheath and likely corresponded to hoop boundaries. Both the polyclonal and monoclonal antibodies were specific

  3. Protein bodies of castor bean endosperm: isolation, fractionation, and the characterization of protein components.

    PubMed

    Tully, R E; Beevers, H

    1976-12-01

    Protein bodies in the endosperm of castor bean seeds (Ricinus communis L.) contain phytin globoids and protein crystalloids embedded in an amorphous proteinaceous matrix. The protein bodies are apparently surrounded by a single membrane. The protein bodies were isolated by grinding and centrifuging in glycerol. Such isolated protein bodies were almost identical (after cytological fixation) to those observed in situ, except that the globoids were lost. However, membrane-like structures appear to have surrounded the globoids. Histochemical analysis of the isolated protein bodies showed that carbohydrates (glycoproteins) are localized only in the matrix region.Addition of water to protein bodies in glycerol caused dissolution of the matrix, and release of the globoids and crystalloids. When the crystalloids were centrifuged on sucrose density gradients, they were recovered at an equilibrium density of 1.29 to 1.30 g/ml. The crystalloids were only slightly soluble in most aqueous buffers but were very soluble in sodium dodecyl sulfate, urea, or NaOH solutions.Polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate and chromatography on ion exchange celluloses show that the protein bodies are composed of one major and several minor anodic proteins. The major protein, along with a few of the minor proteins, is localized in the crystalloids.The major protein (molecular weight 65,000) was converted by mercaptoethanol into subunits with molecular weights of 32,000 and 15,800. It is proposed that the protein is made up of two of the smaller subunits and one of the larger, linked by disulfide bridges. None of the crystalloid proteins appear to be glycosylated.The water-soluble matrix fraction is composed mainly of two proteins, with molecular weights of 12,500 and 10,300 on the gels. Neither is a glycoprotein, and neither can be reduced with mercaptoethanol to give subunits. The soluble fraction also contains other lesser components among which are

  4. Irreversible inhibition of delta 5-3-oxosteroid isomerase by 2-substituted progesterones.

    PubMed Central

    Penning, T M

    1985-01-01

    2 alpha-Cyanoprogesterone (I) and 2-hydroxymethyleneprogesterone (II) were synthesized and screened as irreversible active-site-directed inhibitors of the delta 5-3-oxosteroid isomerase (EC 5.3.3.1) from Pseudomonas testosteroni. Both compounds were found to inhibit the purified bacterial enzyme in a time-dependent manner. In either case the inactivated enzyme could be dialysed without return of activity, indicating that a stable covalent bond had formed between the inhibitor and the enzyme. Inactivation mediated by compounds (I) and (II) followed pseudo-first-order kinetics, and at higher inhibitor concentrations saturation was observed. The competitive inhibitor 17 beta-oestradiol offered protection against the inactivation mediated by both compounds, and initial-rate studies indicated that compounds (I) and (II) can also act as competitive inhibitors yielding Ki values identical with those generated during inactivation experiments. 2 alpha-Cyanoprogesterone (I) and 2-hydroxymethyleneprogesterone (II) thus appear to be active-site-directed. To compare the reactivity of these 2-substituted progesterones with other irreversible inhibitors of the isomerase, 3 beta-spiro-oxiranyl-5 alpha-pregnan-20 beta-ol (III) was synthesized as the C21 analogue of 3 beta-spiro-oxiranyl-5 alpha-androstan-17 beta-ol, which is a potent inactivator of the isomerase [Pollack, Kayser & Bevins (1979) Biochem. Biophys. Res. Commun. 91, 783-790]. Comparison of the bimolecular rate constants for inactivation (k+3/Ki) mediated by compounds (I)-(III) indicated the following order of reactivity: (III) greater than (II) greater than (I). 2-Mercaptoethanol offers complete protection against the inactivation of the isomerase mediated by 2 alpha-cyanoprogesterone (I). Under the conditions of inactivation compound (I) appears to be completely stable, and no evidence could be obtained for enolate ion formation in the presence or absence of enzyme. It is suggested that cyanoprogesterone inactivates

  5. Development of 99mTc-neomannosyl human serum albumin (99mTc-MSA) as a novel receptor binding agent for sentinel lymph node imaging.

    PubMed

    Jeong, Jae Min; Hong, Mee Kyung; Kim, Young Joo; Lee, Jaetae; Kang, Joo Hyun; Lee, Dong Soo; Chung, June-Key; Lee, Myung Chul

    2004-12-01

    Various mannose receptor-binding agents, for example 99mTc-diethylenetriaminepentaacetic acid (DTPA)-mannosyl-polymer, have been developed for sentinel lymph node (SLN) imaging. In order to simplify the synthesis and labelling procedure and to improve the biological properties, we developed a novel mannose receptor-binding agent, 99mTc-neomannosyl human serum albumin (99mTc-MSA), for SLN imaging. MSA was synthesized by conjugating mannopyranosylphenylisothiocyanate to human serum albumin (HSA). After reducing MSA with beta-mercaptoethanol and PD-10 column purification, a medronate solution containing stannous fluoride was added, divided into aliquots and freeze-dried. Reduced MSA was labelled with 99mTc-pertechnetate solution. The stability was checked for 24 h at 37 degrees C in human serum. The biodistribution of 99mTc-MSA in mice was investigated by intravenous injection through the tail vein and subcutaneous injection into the foot pad. The biodistributions of 99mTc-HSA and 99mTc-antimony sulphur colloid (99mTc-ASC) were also investigated for comparison. Dynamic whole-body images were obtained for 30 min after subcutaneous injection into the rats' foot pads. The number of mannose molecules conjugated per MSA was 15.9. The number of thiol groups produced was 19.4 per MSA after reduction with beta-mercaptoethanol. Labelling yields were always higher than 97%. 99mTc-MSA was stable for 24 h at 37 degrees C in human serum. The biodistribution in mice after intravenous injection showed high liver uptake (50.7+/-5.5% and 42.7+/-3.7% injected dose per gram at 10 and 60 min, respectively). 99mTc-MSA and 99mTc-ASC showed high accumulation in the lymph nodes after subcutaneous injection, whereas 99mTc-HSA and Tc-tin colloid did not, in both biodistribution and imaging studies. We have successfully developed a novel 99mTc-MSA for lymphoscintigraphy. The results of animal studies show that 99mTc-MSA has promising properties for SLN imaging.

  6. Role of disulfide bonds in maintaining the structural integrity of the sheath of Leptothrix discophora SP-6.

    PubMed Central

    Emerson, D; Ghiorse, W C

    1993-01-01

    Isolated sheaths of Leptothrix discophora SP-6 (ATCC 51168) were tested for susceptibility to degradation by a variety of chemical denaturants and lytic enzymes and found to be resistant to many reagents and enzyme treatments. However, disulfide bond-reducing agents such as dithiothreitol (DTT), beta-mercaptoethanol, sodium cyanide, and sodium sulfite degraded the sheath, especially at elevated pH (pH 9) and temperature (50 degrees C). DTT and beta-mercaptoethanol caused more rapid degradation of the sheath than cyanide or sulfite. Treatment of the sheath with 1 N NaOH resulted in rapid breakdown, while treatment with 1 N HCl resulted in slow but significant hydrolysis. Transmission electron microscopy showed that the 6.5-nm fibrils previously shown to be an integral structural element of the sheath fabric (D. Emerson and W. C. Ghiorse, J. Bacteriol. 175:7808-7818, 1993) were progressively dissociated into random masses during DTT-induced degradation. Quantitation of disulfide bonds with DTT showed that the sheaths contained approximately 2.2 mumol of disulfides per mg of sheath protein. Reaction with 5,5'-dithio-bis-(2-nitrobenzoic acid) showed that sheaths also contained approximately 0.8 mumol of free sulfhydryls per mg of protein. A sulfhydryl-specific fluorescent probe (fluorescein 5-maleimide) showed that the free sulfhydryls in sheathed cell filaments were evenly distributed throughout the sheath. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis autoradiography of [14C]iodoacetamide-labeled sheaths and DTT-dissociated sheath fibril suspensions showed that the majority of 14C-labeled sulfhydryls in the sheaths did not enter the gel. However, low-molecular-mass silver-staining bands (14 to 45 kDa) did appear in the gels after iodoacetic acid or iodoacetamide alkylation of the dissociated fibrils. These bands did not stain with Coomassie blue. Their migration in gels was slightly affected by digestion with pronase. The fibrils contained 20 to 25

  7. Xyloglucan endotransglycosylase, a new wall-loosening enzyme activity from plants.

    PubMed

    Fry, S C; Smith, R C; Renwick, K F; Martin, D J; Hodge, S K; Matthews, K J

    1992-03-15

    1. Cell-free extracts of all plants tested contained a novel enzyme activity (xyloglucan endotransglycosylase, XET) able to transfer a high-Mr portion from a donor xyloglucan to a suitable acceptor such as a xyloglucan-derived nonasaccharide (Glc4Xyl3GalFuc; XG9). 2. A simple assay for the enzyme, using [3H]XG9 and based on the ability of the [3H]polysaccharide product to bind to filter paper, is described. 3. The enzyme was highly specific for xyloglucan as the glycosyl donor, and showed negligible transglycosylation of other polysaccharides, including CM-cellulose. 4. The Km for XG9 was 50 microM; certain other 3H-labelled xyloglucan oligosaccharides also acted as acceptors, and certain non-radioactive xyloglucan oligosaccharides competed with [3H]XG9 as acceptor; the minimum acceptor structure was deduced to be: [formula: see text] 5. The pH optimum was approx. 5.5 and the enzyme was less than half as active at pH 7.0. The enzyme was slightly activated by Ca2+, Mg2+, Mn2+, spermidine, ascorbate and 2-mercaptoethanol, and inhibited by Ag+, Hg2+, Zn2+ and La3+. 6. XET activity was essentially completely extracted by aqueous solutions of low ionic strength; Triton X-100, Ca2+, La3+, and Li+ did not enhance extraction. Negligible activity was left in the unextractable (cell-wall-rich) residue. 7. The enzyme differed from the major cellulases (EC 3.2.1.4) of pea in: (a) susceptibility to inhibition by cello-oligosaccharides, (b) polysaccharide substrate specificity, (c) inducibility by auxin, (d) requirement for salt in the extraction buffer and (e) activation by 2-mercaptoethanol. XET is therefore concluded to be a new enzyme activity (xyloglucan: xyloglucan xyloglucanotransferase; EC 2.4.1.-). 8. XET was detected in extracts of the growing portions of dicotyledons, monocotyledons (graminaceous and liliaceous) and bryophytes. 9. The activity was positively correlated with growth rate in different zones of the pea stem. 10. We propose that XET is responsible for

  8. Mercury speciation in seawater by liquid chromatography-inductively coupled plasma-mass spectrometry following solid phase extraction pre-concentration by using an ionic imprinted polymer based on methyl-mercury-phenobarbital interaction.

    PubMed

    Rodríguez-Reino, María Pilar; Rodríguez-Fernández, Roi; Peña-Vázquez, Elena; Domínguez-González, Raquel; Bermejo-Barrera, Pilar; Moreda-Piñeiro, Antonio

    2015-04-24

    Trace levels of inorganic mercury, methyl-mercury and ethyl-mercury have been assessed in seawater by high performance liquid chromatography (HPLC) hyphenated with inductively coupled plasma-mass spectrometry (ICP-MS) after solid phase extraction (SPE) pre-concentration with a novel synthesized ionic imprinted polymer. The adsorbent material was prepared by trapping a non-vinylated chelating ligand (phenobarbital) via imprinting of a ternary mixed ligand complex of the non-vinylated chelating agent, the template (methyl-mercury), and the vinyl ligand (metacrylic acid, MAA). Ethylene dimetacrylate (EDMA) and 2,2'-azobisisobutyronitrile (AIBN) were used as cross-linker and initiator reagents, respectively; and the precipitation polymerization technique was used in a porogen of acetonitrile/water (4:1). The best retention properties for methyl-mercury, inorganic mercury and ethyl-mercury species from seawater were obtained when loading 200 mL of sample adjusted to pH 8.0 and at a flow rate of 2.0 mL min(-1) on a column-packed with 200mg of the material. Quantitative mercury species recoveries were obtained using 4 mL of an eluting solution consisting of 0.8% (v/v) 2-mercaptoethanol and 20% (v/v) methanol (pH adjusted to 4.5) pumped at a flow rate of 2.0 mL min(-1). Mercury species separation was achieved on a Kinetex C18 column working under isocratic conditions (0.4% (v/v) 2-mercaptoethanol, 10% (v/v) methanol, pH 2.5, flow rate 0.7 mL min(-1)). ICP-MS detection was performed by monitoring the mercury mass to charge ratio of 202. The limits of quantification of the method were 11, 6.7, and 12 ng L(-1), for inorganic mercury, methyl-mercury and ethyl-mercury, respectively (pre-concentration factor of 50); whereas, analytical recoveries ranged from 96 to 106%. The developed method was successfully applied to several seawater samples from unpolluted areas. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The Crystal Structure of a Ternary Complex of Betaine Aldehyde Dehydrogenase from Pseudomonas aeruginosa Provides New Insight Into the Reaction Mechansim and Shows A Novel Binding Mode of the 2'-Phosphate of NADP+ and A Novel Cation Binding Site

    SciTech Connect

    Gonzalez-Segura, L.; Rudino-Pinera, E; Munoz-Clares, R; Horjales, E

    2009-01-01

    In the human pathogen Pseudomonas aeruginosa, the NAD(P)+-dependent betaine aldehyde dehydrogenase (PaBADH) may play the dual role of assimilating carbon and nitrogen from choline or choline precursors-abundant at infection sites-and producing glycine betaine and NADPH, potentially protective against the high-osmolarity and oxidative stresses prevalent in the infected tissues. Disruption of the PaBADH gene negatively affects the growth of bacteria, suggesting that this enzyme could be a target for antibiotic design. PaBADH is one of the few ALDHs that efficiently use NADP+ and one of the even fewer that require K+ ions for stability. Crystals of PaBADH were obtained under aerobic conditions in the presence of 2-mercaptoethanol, glycerol, NADP+ and K+ ions. The three-dimensional structure was determined at 2.1-A resolution. The catalytic cysteine (C286, corresponding to C302 of ALDH2) is oxidized to sulfenic acid or forms a mixed disulfide with 2-mercaptoethanol. The glutamyl residue involved in the deacylation step (E252, corresponding to E268 of ALDH2) is in two conformations, suggesting a proton relay system formed by two well-conserved residues (E464 and K162, corresponding to E476 and K178, respectively, of ALDH2) that connects E252 with the bulk water. In some active sites, a bound glycerol molecule mimics the thiohemiacetal intermediate; its hydroxyl oxygen is hydrogen bonded to the nitrogen of the amide groups of the side chain of the conserved N153 (N169 of ALDH2) and those of the main chain of C286, which form the 'oxyanion hole.' The nicotinamide moiety of the nucleotide is not observed in the crystal, and the adenine moiety binds in the usual way. A salt bridge between E179 (E195 of ALDH2) and R40 (E53 of ALDH2) moves the carboxylate group of the former away from the 2?-phosphate of the NADP+, thus avoiding steric clashes and/or electrostatic repulsion between the two groups. Finally, the crystal shows two K+ binding sites per subunit. One is in an

  10. Restoration of β-galactosidase to Escherichia coli M15. Complementation studies

    PubMed Central

    Marinkovic, Dobrivoje V.; Marinkovic, Jelka N.

    1977-01-01

    Carboxymethylated β-galactosidase from Escherichia coli was dissociated at 100°C to form carboxymethylated fragments A and B. The mol.wts. of carboxymethylated fragments A and B were determined by gel filtration to be 64300 and 22400 respectively. Sodium dodecyl sulphate/polyacrylamide-gel electrophoresis of carboxymethylated fragments A and B that had been pretreated with 2-mercaptoethanol and sodium dodecyl sulphate yielded mol.wts. of 64000 and 22100 respectively. Carboxymethylated fragments A and B had arginine as their C-terminal amino acid. When a crude extract of E. coli M15 was filtered through a column of Sepharose 6B, it was found that carboxymethylated fragment B could restore β-galactosidase activity when added to fractions having mol.wts. estimated to be 123000, 262000 and 506000. These fractions are referred to as `complementable fractions'. Similarly, it was found that carboxymethylated fragment A could restore enzyme activity to tractions having mol.wts. estimated to be 63000, 253000 and 506000. Estimates of the molecular weights of the β-galactosidase activity obtained by restoration with carboxymethylated fragments A and B were made by filtering the active enzyme through another column of Sepharose 6B. The enzyme obtained by complementation with carboxymethylated fragment B, i.e. the complemented enzyme, had mol.wt. 525000, and that obtained with carboxymethylated fragment A had mol.wts. of 525000, 646000 and 2000000. The latter finding suggests that multiple forms of complemented β-galactosidase can exist. PMID:411487

  11. A cross-sectional study of the seroprevalence and flock-level factors associated with ovine and caprine brucellosis in southeastern Iran

    PubMed Central

    Sharifi, H; Tabatabaei, S; Rashidi, H; Kazeminia, S; Sabbagh, F; Khajooei, P; Karamouzian, M; Nekouei, O; Adeli Sardooei, M; Leontides, L

    2014-01-01

    This cross-sectional study was conducted to estimate seroprevalence and to identify flock-level factors associated with seropositivity to brucellosis in small ruminants in Kerman province, southeastern Iran. In October-November 2011, serum samples were randomly collected from 1767 sheep and 1233 goats, older than 18 months, from 300 flocks. The sera were initially screened for the presence of anti-Brucella antibodies using the Rose-Bengal test; those found to be positive were then examined by Wright and 2-mercaptoethanol Brucella agglutination tests. A questionnaire was used to collect data on flock-level factors likely associated with the within flock seroprevalence of brucellosis. The associations were statistically evaluated for significance in multivariable logistic models. Sixty three flocks (21.00%; 95% CI: 16.80-26.60) had at least one seropositive animal. The mean within-flock seroprevalence was 3.10% (95% CI: 2.60-3.90). The presence of newly purchased animals (OR=3.42; 95% CI: 1.35-8.65) was significantly associated with seropositivity. Our findings highlight the role of animal movement among flocks in the epidemiology of brucellosis in this region. Thus, a control program for brucellosis in the region is suggested to impose appropriate restrictions on animal trade and improve knowledge of livestock owners about quarantine principles for newly purchased animals. PMID:27175133

  12. Evaluation of Primary Binding Assays for Presumptive Serodiagnosis of Swine Brucellosis in Argentina

    PubMed Central

    Paulo, P. Silva; Vigliocco, A. M.; Ramondino, R. F.; Marticorena, D.; Bissi, E.; Briones, G.; Gorchs, C.; Gall, D.; Nielsen, K.

    2000-01-01

    An indirect enzyme-linked immunosorbent assay (IELISA), a competitive ELISA (CELISA), and a fluorescence polarization assay (FPA) for the presumptive serological diagnosis of swine brucellosis were evaluated using two populations of swine sera: sera from brucellosis-free Canadian herds and sera from Argentina selected based on positive reactions in the buffered antigen plate agglutination test (BPAT) and the 2-mercaptoethanol (2-ME) test. In addition, sera from adult swine from which Brucella suis was isolated at least once for each farm of origin were evaluated. The IELISA, CELISA, and FPA specificity values were 99.9, 99.5, and 98.3%, respectively, and the IELISA, CELISA, and FPA sensitivity values relative to the BPAT and the 2-ME test were 98.9, 96.6, and 93.8%, respectively. Actual sensitivity was assessed by using 37 sera from individual pigs from which B. suis was cultured, and the values obtained were as follows: BPAT, 86.5%; 2-ME test, 81.1%; IELISA, 86.5%; CELISA, 78.5%; and FPA, 80.0%. PMID:10973463

  13. A mesoporous silica nanosphere-based carrier system with chemically removable CdS nanoparticle caps for stimuli-responsive controlled release of neurotransmitters and drug molecules.

    PubMed

    Lai, Cheng-Yu; Trewyn, Brian G; Jeftinija, Dusan M; Jeftinija, Ksenija; Xu, Shu; Jeftinija, Srdija; Lin, Victor S-Y

    2003-04-16

    An MCM-41 type mesoporous silica nanosphere-based (MSN) controlled-release delivery system has been synthesized and characterized using surface-derivatized cadmium sulfide (CdS) nanocrystals as chemically removable caps to encapsulate several pharmaceutical drug molecules and neurotransmitters inside the organically functionalized MSN mesoporous framework. We studied the stimuli-responsive release profiles of vancomycin- and adenosine triphosphate (ATP)-loaded MSN delivery systems by using disulfide bond-reducing molecules, such as dithiothreitol (DTT) and mercaptoethanol (ME), as release triggers. The biocompatibility and delivery efficiency of the MSN system with neuroglial cells (astrocytes) in vitro were demonstrated. In contrast to many current delivery systems, the molecules of interest were encapsulated inside the porous framework of the MSN not by adsorption or sol-gel types of entrapment but by capping the openings of the mesoporous channels with size-defined CdS nanoparticles to physically block the drugs/neurotransmitters of certain sizes from leaching out. We envision that this new MSN system could play a significant role in developing new generations of site-selective, controlled-release delivery nanodevices.

  14. Short-Term Culture of Ovarian Cortical Strips From Capuchin Monkeys (Sapajus apella): A Morphological, Viability, and Molecular Study of Preantral Follicular Development In Vitro

    PubMed Central

    Brito, A. B.; van den Hurk, R.; Lima, J. S.; Miranda, M. S.; Ohashi, O. M.; Domingues, S. F. S.

    2013-01-01

    The aim of this study was to evaluate whether an in vitro culture (IVC) medium containing either or not β-mercaptoethanol (BME), bone morphogenetic protein 4 (BMP4), or pregnant mare serum gonadotrophin (PMSG) could be able to promote the development of capuchin monkeys’ preantral follicles enclosed in ovarian cortical strips. Follicular viability after IVC was similar to control (89.32%). Primordial follicle recruitment to primary stage was not reached with IVC, but the rate of secondary follicle formation was increased in the medium supplemented with BME, BMP4, and PMSG (44.86%) when compared to IVC control (9.20%). In the medium supplemented with BME, BMP4, and PMSG, contrary to other media, anti-müllerian hormone-messenger RNA (mRNA) expression in ovarian tissue was upregulated (3.4-fold), while that of growth differentiation factor-9 was maintained. The BMP4-mRNA expression, however, appeared downregulated in all cultured tissues. Our findings show a favorable effect of BME, BMP4, and PMSG on the in vitro development of secondary follicles from capuchin monkeys. PMID:23314959

  15. Optimized culture conditions for bacteriocin production by Pediococcus acidilactici LAB 5 and its characterization.

    PubMed

    Mandal, Vivekananda; Sen, Sukanta Kumar; Mandal, Narayan Chandra

    2008-04-01

    A strain of Pediococcus acidilactici LAB 5 was isolated from vacuum-packed fermented meat product, in order to obtain a novel bacteriocin from food-grade organisms. Optimized culture conditions for bacteriocin production in different media (viz., MRS, TGE, TGE + buffer, TGE + Tween 80, and TGE + Tween 80 + buffer) and at different temperatures and pH conditions were reported. TGE + Tween 80 + buffer medium was found to be most effective for bacteriocin production (about 2400 AU/ml) by this strain, when incubated at 37 degrees C for 24 h. Bacteriocin, partially purified by adsorption-desorption method showed molecular mass of 10.3 kDa and produced prominent inhibition zone in activity gel. It showed significant storage stability both at high as well as in low temperatures for up to 6 months and retained its activity in a number of organic solvents, except in 2-mercaptoethanol. The treatment with amylase and lysozyme did not change its activity, but it lost its activity on proteinase K treatment. Antibacterial efficacy of bacteriocin was proved against some food spoilage and human pathogenic bacteria like Enterococcus, Leuconostoc, Listeria, Staphylococcus and Streptococcus.

  16. Adsorption of glycinin and β-conglycinin on silica and cellulose: surface interactions as a function of denaturation, pH, and electrolytes.

    PubMed

    Salas, Carlos; Rojas, Orlando J; Lucia, Lucian A; Hubbe, Martin A; Genzer, Jan

    2012-02-13

    Soybean proteins have found uses in different nonfood applications due to their interesting properties. We report on the kinetics and extent of adsorption on silica and cellulose surfaces of glycinin and β-conglycinin, the main proteins present in soy. Quartz crystal microgravimetry (QCM) experiments indicate that soy protein adsorption is strongly affected by changes in the physicochemical environment. The affinity of glycinin and the mass adsorbed on silica and cellulose increases (by ca. 13 and 89%, respectively) with solution ionic strength (as it increases from 0 to 100 mM NaCl) due to screening of electrostatic interactions. In contrast, β-conglycinin adsorbs on the same substrates to a lower extent and the addition of electrolyte reduces adsorption (by 25 and 57%, respectively). The addition of 10 mM 2-mercaptoethanol, a denaturing agent, reduces the adsorption of both proteins with a significant effect for glycinin. This observation is explained by the cleavage of disulfide bonds which allows unfolding of the molecules and promotes dissociation into subunits that favors more compact adsorbed layer structures. In addition, adsorption of glycinin onto cellulose decreases with lowering the pH from neutral to pH 3 due to dissociation of the macromolecules, resulting in flatter adsorbed layers. The respective adsorption isotherms fit a Langmuir model and QCM shifts in energy dissipation and frequency reveal multiple-step kinetic processes indicative of changes in adlayer structure.

  17. Single-step purification and characterization of an extreme halophilic, ethanol tolerant and acidophilic xylanase from Aureobasidium pullulans NRRL Y-2311-1 with application potential in the food industry.

    PubMed

    Yegin, Sirma

    2017-04-15

    An extracellular xylanase from Aureobasidium pullulans NRRL Y-2311-1 produced on wheat bran was purified by a single-step chromatographic procedure. The enzyme had a molecular weight of 21.6kDa. The optimum pH and temperature for xylanase activity were 4.0 and 30-50°C, respectively. The enzyme was stable in the pH range of 3.0-8.0. The inactivation energy of the enzyme was calculated as 218kJmol(-1). The xylanase was ethanol tolerant and kept complete activity in the presence of 10% ethanol. Likewise, it retained almost complete activity at a concentration range of 0-20% NaCl. In general, the enzyme was resistant to several metal ions and reagents. Mg(2+), Zn(2+), Cu(2+), K(1+), EDTA and β-mercaptoethanol resulted in enhanced xylanase activity. The Km and Vmax values on beechwood xylan were determined to be 19.43mgml(-1) and 848.4Uml(-1), respectively. The enzyme exhibits excellent characteristics and could, therefore, be a promising candidate for application in food and bio-industries. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Immobilized Sclerotinia sclerotiorum invertase to produce invert sugar syrup from industrial beet molasses by-product.

    PubMed

    Mouelhi, Refka; Abidi, Ferid; Galai, Said; Marzouki, M Nejib

    2014-03-01

    The fungus Sclerotinia sclerotiorum produces invertase activity during cultivation on many agroindustrial residues. The molasses induced invertase was purified by DEAE-cellulose chromatography. The molecular mass of the purified enzyme was estimated at 48 kDa. Optimal temperature was determined at 60 °C and thermal stability up to 65 °C. The enzyme was stable between pH 2.0 and 8.0; optimum pH was about 5.5. Apparent K(m) and V(max) for sucrose were estimated to be respectively 5.8 mM and 0.11 μmol/min. The invertase was activated by β-mercaptoethanol. Free enzyme exhibited 80 % of its original activity after two month's storage at 4 °C and 50 % after 1 week at 25 °C. In order to investigate an industrial application, the enzyme was immobilized on alginate and examined for invert sugar production by molasses hydrolysis in a continuous bioreactor. The yield of immobilized invertase was about 78 % and the activity yield was 59 %. Interestingly the immobilized enzyme hydrolyzed beet molasses consuming nearly all sucrose. It retained all of its initial activity after being used for 4 cycles and about 65 % at the sixth cycle. Regarding productivity; 20 g/l of molasses by-product gave the best invert sugar production 46.21 g/day/100 g substrate related to optimal sucrose conversion of 41.6 %.

  19. Ex Situ Formation of Metal Selenide Quantum Dots Using Bacterially Derived Selenide Precursors

    SciTech Connect

    Fellowes, Jonathan W.; Pattrick, Richard; Lloyd, Jon; Charnock, John M.; Coker, Victoria S.; Mosselmans, JFW; Weng, Tsu-Chien; Pearce, Carolyn I.

    2013-04-12

    Luminescent quantum dots were synthesized using bacterially derived selenide (SeII-) as the precursor. Biogenic SeII- was produced by the reduction of Se-IV by Veillonella atypica and compared directly against borohydride-reduced Se-IV for the production of glutathione-stabilized CdSe and beta-mercaptoethanol-stabilized ZnSe nanoparticles by aqueous synthesis. Biological SeII- formed smaller, narrower size distributed QDs under the same conditions. The growth kinetics of biologically sourced CdSe phases were slower. The proteins isolated from filter sterilized biogenic SeII- included a methylmalonyl-CoA decarboxylase previously characterized in the closely related Veillonella parvula. XAS analysis of the glutathione-capped CdSe at the S K-edge suggested that sulfur from the glutathione was structurally incorporated within the CdSe. A novel synchrotron based XAS technique was also developed to follow the nucleation of biological and inorganic selenide phases, and showed that biogenic SeII- is more stable and more resistant to beam-induced oxidative damage than its inorganic counterpart. The bacterial production of quantum dot precursors offers an alternative, 'green' synthesis technique that negates the requirement of expensive, toxic chemicals and suggests a possible link to the exploitation of selenium contaminated waste streams.

  20. Ex situ formation of metal selenide quantum dots using bacterially derived selenide precursors.

    PubMed

    Fellowes, J W; Pattrick, R A D; Lloyd, J R; Charnock, J M; Coker, V S; Mosselmans, J F W; Weng, T-C; Pearce, C I

    2013-04-12

    Luminescent quantum dots were synthesized using bacterially derived selenide (Se(II-)) as the precursor. Biogenic Se(II-) was produced by the reduction of Se(IV) by Veillonella atypica and compared directly against borohydride-reduced Se(IV) for the production of glutathione-stabilized CdSe and β-mercaptoethanol-stabilized ZnSe nanoparticles by aqueous synthesis. Biological Se(II-) formed smaller, narrower size distributed QDs under the same conditions. The growth kinetics of biologically sourced CdSe phases were slower. The proteins isolated from filter sterilized biogenic Se(II-) included a methylmalonyl-CoA decarboxylase previously characterized in the closely related Veillonella parvula. XAS analysis of the glutathione-capped CdSe at the S K-edge suggested that sulfur from the glutathione was structurally incorporated within the CdSe. A novel synchrotron based XAS technique was also developed to follow the nucleation of biological and inorganic selenide phases, and showed that biogenic Se(II-) is more stable and more resistant to beam-induced oxidative damage than its inorganic counterpart. The bacterial production of quantum dot precursors offers an alternative, 'green' synthesis technique that negates the requirement of expensive, toxic chemicals and suggests a possible link to the exploitation of selenium contaminated waste streams.

  1. Preparation of silver nanowires coated with TiO2 using chemical binder and their applications as photoanodes in dye sensitized solar cell

    NASA Astrophysics Data System (ADS)

    Jang, Inseok; Kang, Taeho; Cho, Woohyung; Kang, Yong Soo; Oh, Seong-Geun; Im, Seung Soon

    2015-11-01

    In this study, the core-shell structured Ag@TiO2 wire was prepared for application to dye-sensitized solar cell (DSSC). The Ag nanowire, having an excellent electrical conductivity, was synthesized by using the facile microwave-assisted polyol reduction process. The diameter and length of Ag wires were 40-50 nm and 20-30 μm, respectively, and the face-centered cubic silver crystal structure was obtained. In the presence of 2-mercaptoethanol as a chemical binder, the entire surface of Ag wire was coated with the TiO2 shell, which has thickness of 20 nm, through solvothermal method. The crystalline structure of TiO2 shell was the anatase phase possessing an advantage to achieve the high efficiency in DSSC. The core-shell structured Ag@TiO2 wire exhibited the high thermal stability. The high conversion efficiency (5.56%) in fabricated device with Ag@TiO2 electrode, which is about 10% higher than reference cell, was achieved by enhancement of short-current density (Jsc) value. The core-shell structured Ag@TiO2 wire could effectively reduce the charge recombination through the contribution to electron shortcut for improvement in the electron transfer rate and lifetime.

  2. The Promotion of Erythropoiesis via the Regulation of Reactive Oxygen Species by Lactic Acid.

    PubMed

    Luo, Shun-Tao; Zhang, Dong-Mei; Qin, Qing; Lu, Lian; Luo, Min; Guo, Fu-Chun; Shi, Hua-Shan; Jiang, Li; Shao, Bin; Li, Meng; Yang, Han-Shuo; Wei, Yu-Quan

    2017-02-06

    The simultaneous increases in blood lactic acid and erythrocytes after intense exercise could suggest a link between lactate and the erythropoiesis. However, the effects of lactic acid on erythropoiesis remain to be elucidated. Here, we utilized a mouse model to determine the role of lactic acid in this process in parallel with studies using leukaemic K562 cells. Treatment of K562 cells in vitro with lactic acid increased the mRNA and protein expression of haemoglobin genes and the frequency of GPA(+) cells. Also, increases in haematocrit and CD71(-)/Ter119(+) erythroid cells were observed in lactic acid-treated mice, which showed a physiological increase in blood lactate. Mouse bone marrow CD34(+)/CD117(-) cells showed an increase in erythroid burst-forming units after stimulation with lactic acid in vitro. Furthermore, lactic acid increased the intracellular reactive oxygen species (ROS) content in bone marrow and in K562 cells. Erythroid differentiation induced in Haematopoietic Stem Cells (HSCs) and K562 cells by lactic acid was abolished by reducing ROS levels with SOD or 2-mercaptoethanol, which suggests that ROS is a critical regulator of this process. These findings provide a better understanding of the role of lactic acid in cellular metabolism and physiological functions.

  3. The Promotion of Erythropoiesis via the Regulation of Reactive Oxygen Species by Lactic Acid

    PubMed Central

    Luo, Shun-Tao; Zhang, Dong-Mei; Qin, Qing; Lu, Lian; Luo, Min; Guo, Fu-Chun; Shi, Hua-Shan; Jiang, Li; Shao, Bin; Li, Meng; Yang, Han-Shuo; Wei, Yu-Quan

    2017-01-01

    The simultaneous increases in blood lactic acid and erythrocytes after intense exercise could suggest a link between lactate and the erythropoiesis. However, the effects of lactic acid on erythropoiesis remain to be elucidated. Here, we utilized a mouse model to determine the role of lactic acid in this process in parallel with studies using leukaemic K562 cells. Treatment of K562 cells in vitro with lactic acid increased the mRNA and protein expression of haemoglobin genes and the frequency of GPA+ cells. Also, increases in haematocrit and CD71−/Ter119+ erythroid cells were observed in lactic acid-treated mice, which showed a physiological increase in blood lactate. Mouse bone marrow CD34+/CD117− cells showed an increase in erythroid burst-forming units after stimulation with lactic acid in vitro. Furthermore, lactic acid increased the intracellular reactive oxygen species (ROS) content in bone marrow and in K562 cells. Erythroid differentiation induced in Haematopoietic Stem Cells (HSCs) and K562 cells by lactic acid was abolished by reducing ROS levels with SOD or 2-mercaptoethanol, which suggests that ROS is a critical regulator of this process. These findings provide a better understanding of the role of lactic acid in cellular metabolism and physiological functions. PMID:28165036

  4. Rocket and Two Dimensional Immunoelectrophoresis in Diagnosis of Caprine Brucellosis.

    PubMed

    Mehrabani, Davood; Gholami, Zahra; Kohanteb, Jamshid; Sepehrimanesh, Masood; Hosseini, Seyed Mohammad Hossein

    2015-08-01

    Brucellosis is a major bacterial zoonosis of global importance with the causative organisms of Gram-negative facultative intracellular pathogens. The aims of this study were to standardize two immunoelectrophoretic techniques, rocket and cross immunoelectrophoresis, and compare their results with other conventional serodiagnostic tests. Sera from 15 sheep, without any history of brucellosis vaccination, infected with Brucella melitensis M16 subcutaneously, were employed in a comparison of culture, precipitating, and immunoelectrophoretic tests. A 125 days serologic follow-up was performed after the infection was started. As a reference, these tests also done in the five healthy sheep. The results obtained with the rocket immunoelectrophoresis test correlated very well with those of the cross immunoelectrophoresis, whereas results of other tests such as culture, Rose Bengal, standard tube agglutination and 2-mercaptoethanol seruagglutination tests were inferior. As agglutination test shows cross reaction and a prozone phenomenon, and in blood culture, the bacteria is not always detectable, so they are time consuming rocket and cross immunoelectrophoresis are recommended because their results can be obtained in a shorter time.

  5. Rocket and Two Dimensional Immunoelectrophoresis in Diagnosis of Caprine Brucellosis

    PubMed Central

    MEHRABANI, Davood; GHOLAMI, Zahra; KOHANTEB, Jamshid; SEPEHRIMANESH, Masood; HOSSEINI, Seyed Mohammad Hossein

    2015-01-01

    Background: Brucellosis is a major bacterial zoonosis of global importance with the causative organisms of Gram-negative facultative intracellular pathogens. The aims of this study were to standardize two immunoelectrophoretic techniques, rocket and cross immunoelectrophoresis, and compare their results with other conventional serodiagnostic tests. Methods: Sera from 15 sheep, without any history of brucellosis vaccination, infected with Brucella melitensis M16 subcutaneously, were employed in a comparison of culture, precipitating, and immunoelectrophoretic tests. A 125 days serologic follow-up was performed after the infection was started. As a reference, these tests also done in the five healthy sheep. Results: The results obtained with the rocket immunoelectrophoresis test correlated very well with those of the cross immunoelectrophoresis, whereas results of other tests such as culture, Rose Bengal, standard tube agglutination and 2-mercaptoethanol seruagglutination tests were inferior. Conclusion: As agglutination test shows cross reaction and a prozone phenomenon, and in blood culture, the bacteria is not always detectable, so they are time consuming rocket and cross immunoelectrophoresis are recommended because their results can be obtained in a shorter time. PMID:26587475

  6. [Labeling of antihuman bladder carcinoma monoclonal antibody with a technetium-99m and radioimmunoimaging of human bladder carcinoma xenograft in nude mice].

    PubMed

    Samten, B; Yu, L; Zhang, C

    1996-01-01

    Anti-human bladder carcinoma cell line BIU-87 monoclonal antibody-BDI-1 was labeled with 99mTc by direct mercaptoethanol reducing method. Quality control tests showed that the labeling yield was 69.9%; the radiochemical purity was higher than 90%; the immunoreactive fraction of 99mTc-BDI-1 was 81% and the association constant was 1.22 x 10(-9) M-1. The radioimmunoimaging of human bladder carcinoma xenograft in nude mice and the biodistribution of 99mTc-BDI-1 were studied. After having been scintigraphed at three time intervals (at 4, 16 and 22 hour), the animals were sacrificed for biodistribution of 99mTc-BDI-1. Tumor can be seen clearly at 22 hour after intravenous injection of 99mTc-BDI-1; %ID/g (percentage of the injected dose per gram of tissue) of tumor was 20.70, the average T/NT was 10.52, the minimum T/NT was 2.90 (tumor/kidney) and the maximum T/NT was 20.70 (tumor/small intestine or muscule). The results above indicated that 99mTc-BDI-1 can be used for radioimmunodetection of human bladder carcinoma in vivo and BDI-1 may be suitable as a targeting device in patients.

  7. Thermoresistant xylanases from Trichoderma stromaticum: Application in bread making and manufacturing xylo-oligosaccharides.

    PubMed

    Carvalho, Elck Almeida; Dos Santos Góes, Laís Mendes; Uetanabaro, Ana Paula T; da Silva, Erik Galvão Paranhos; Rodrigues, Luciano Brito; Pirovani, Carlos Priminho; da Costa, Andréa Miura

    2017-04-15

    The enzymes Xyl1 and Xyl2 from T. stromaticum were purified and identified by mass spectrometry (MALDI-TOF/MS). Xyl1 contained three proteins with similarity to xylanase family 10, 62 and anarabinofuranosidase of the Trichoderma genus and Xyl2 contained a protein with similarity to endo-1,4-β-xylanase. High xylanase activity was found at 50°C for Xyl1 and 60°C for Xyl2 and pH 5.0 for both, retaining more than 80% of activities for one hour at 60°C and pH 5-8. Ag(2+) and β-mercaptoethanol increased while SDS and EDTA inhibited the xylanase activity of both Xyl1 and Xyl2 extracts. The Km and Vmax values for purified Xyl2 were 9.6mg/mL and 28.57μmol/min/mg, respectively. In application tests, both Xyl1 and Xyl2 were effective in degrading beechwood xylan to produce xylo-oligosaccharides. In baking, adding Xyl1 increased the softness and volume of wheat bread and whole grain bread, qualities increasingly desired by consumers in this segment.

  8. Poly(adenosine diphosphate ribose) polymerase in Physarum polycephalum.

    PubMed Central

    Brightwell, M D; Leech, C E; O'Farrell, M K; Whish, W J; Shall, S

    1975-01-01

    1. The isolated nuclei of the slime mould Physarum polycephalum contain an enzyme that will incorporated [adenine-3H] NAD+ into an acid-insoluble product, which is shown to be poly(ADP-ribose). 2. This incorporation has an optimum pH of 8.2 and a temperature optimum below 10degreesC. 3. Optimum stimulation is given by 15 mM-Mg2+. 4. 2-Mercaptoethanol or dithiothreitol also stimulates the incorporation, the latter at an optimum concentration of about 1 mM. 5. Under optimum conditions the Km value for the reaction is 0.28 mM at 15degreesC. Nicotinamide inhibits the incorporation with a Ki of 5.7 muM. 6. Exogenous DNA stimulates the incorporation by about 100%. 7. Preincubation of the nuclei with deoxyribonuclease, but not with ribonuclease, almost completely inactivates the incorporation of NAD+. 8. The enzyme is unstable at both 0degrees and 15degreesC in the absence of dithiothreitol. The presence of dithiothreitol at a concentration of 1 mM stabilizes the enzyme at both these temperatures. 9. The activity of this enzyme per nucleus was shown in three separate experiments to fall by about one-half in early S phase and then to rise to its pre-mitotic value after about 3 h, that is in late S phase. 10. The possible physiological function of this enzyme system is discussed. PMID:239697

  9. Inactivation of nocardiophages phi C and phi EC by extracts of bacteriophage-attachable cells.

    PubMed

    Brownell, G H; Crockett, J K

    1971-12-01

    Cultures of several species of Nocardia, including N. erythropolis Mat-Ce and Mat-cE mating strains, were extracted with solvents in an attempt to isolate an inactivating complex for nocardiophages phiC and phiEC. Ethanol was the only solvent found effective in solubilizing an inhibitory substance. Inactivating extracts were obtained from the cells of all species to which the phage were able to attach. After extraction of whole cells or cell wall preparations, the phage could not effectively attach to them. Both phages phiC and phiEC were inactivated by the same complex. However, phage phiEC inactivation was 10-fold greater than phiC inactivation. The velocity of inactivation was about 4.1 x 10(2) plaque-forming units per microgram per minute for phiC and 1.1 x 10(3) plaque-forming units per microgram per minute for phage phiEC. The cell extracts required divalent cations for phage inactivation. The inhibitory capacity of the cell extracts was reduced or lost by the activity of proteolytic enzymes, Tween 80, 2-mercaptoethanol, thymol, and sodium lauryl sulfate. Boiling the extract for 10 min did not alter its activity. The inactivating substance was postulated to be a lipoprotein of considerable complexity, unique in the ease with which it is solubilized from host cells by ethanol.

  10. Effects of various compounds on lipid peroxidation mediated by detergent-solubilized rat liver NADPH-cytochrome C reductase.

    PubMed

    Kamataki, T; Sugita, O; Naminohira, S; Kitagawa, H

    1978-12-01

    A reconstituted lipid peroxidation system containing NADPH-cytochrome c reductase isolated from detergent-solubilized rat liver microsomes was used to determine the effects of several compounds, including drugs, on the lipid peroxidation activity. EDTA and ferrous ion were essential requirements for reconstitution of the activity. The addition of 1,10-phenanthroline to the system containing both EDTA and ferrous ion further enhanced the activity. Pyrocatecol, thymol, p-aminophenol, imipramine, p-chloromercuribenzoate (PCMB) and alpha-tocopherol exhibited strong inhibition, aniline, N-monomethylaniline, aminopyrine, benzphetamine, SKF 525-A and NADP exhibited moderate inhibition, and phenol, benzoic acid, acetanilide and nicotinamide exhibited less or no inhibition at the concentrations lower than 1000 micron M. Metal ions such as Hg+, Hg2+, Co2+, Cu2+, Mn2+ and U6+ inhibited lipid peroxidation strongly. In addition, Cd2+, St2+ and Ca2+ exhibited less potent to moderate inhibition, and Ba2+ and Mg2+ were without effects on the activity. Among sulfhydryl compounds tested, dithiothreitol inhibited lipid peroxidation to a greater extent than did the other three compounds, glutathione, cysteine and mercaptoethanol.

  11. Inhibitory effects of sesquiterpenes from bay leaf on nitric oxide production in lipopolysaccharide-activated macrophages: structure requirement and role of heat shock protein induction.

    PubMed

    Matsuda, H; Kagerura, T; Toguchida, I; Ueda, H; Morikawa, T; Yoshikawa, M

    2000-04-21

    The methanolic extract from the leaves of Laurus nobilis (bay leaf, laurel) was found to inhibit nitric oxide (NO) production in lipopolysaccharide (LPS)-activated mouse peritoneal macrophages. Through bioassay-guided separation, fourteen known sesquiterpenes were isolated from the active fraction and were examined for ability to inhibit the NO production. Seven sesquiterpene lactones (costunolide, dehydrocostus lactone, eremanthine, zaluzanin C, magnolialide, santamarine and spirafolide) potently inhibited LPS-induced NO production (IC50 = 1.2 approximately 3.8 microM). Other sesquiterpene constituents also showed the inhibitory activity (IC50 > or = 21 microM), but their inhibitory activities were less than those of sesquiterpene lactones. Alpha-methylene-gamma-butyrolactone also showed inhibitory activity (IC50 = 9.6 microM), while mokko lactone and watsonol A etc., reductants of the alpha-methylene-gamma-butyrolactone moiety by NaBH4 or DIBAL, and a 2-mercaptoethanol adduct of dehydrocostus lactone showed little activity (IC50 > or = 18 microM). These results indicated that the alpha-methylene-gamma-butyrolactone moiety is important for the activity. Furthermore, costunolide and dehydrocostus lactone inhibited inducible nitric oxide synthase (iNOS) induction in accordance with induction of heat shock protein 72 (HSP 72). These results suggested that, as one of their mechanisms of action, sesquiterpene lactones induce HSP 72 thereby preventing nuclear factor-kappaB activation followed by iNOS induction.

  12. Purification and characterization of complex carbohydrate specific isolectins from wild legume seeds: Acacia constricta is (vinorama) highly homologous to Phaseolus vulgaris lectins.

    PubMed

    Guzmán-Partida, A M; Robles-Burgueño, M R; Ortega-Nieblas, M; Vázquez-Moreno, I

    2004-01-01

    Vinorama isolectins (VL2-VL4) were purified from seeds of Acacia constricta (vinorama) using affinity chromatography on a fetuin-fractogel column followed by cationic-exchange chromatography. Each isolectin fraction presented a characteristic isoelectric point range from 5.5 to 8.4. Under native conditions, VL containing fractions migrated as tetramers of 133 kDa, while in SDS-PAGE, in presence of 2-mercaptoethanol, a single subunit band with M(r) of 34 kDa was observed. VL was found to be a glycoprotein with a 7.5% neutral sugar content. Antibodies to Phaseolus vulgaris lectins PHA and other wild legume lectins as Olneya tesota (palo fierro) PF2 and PF3, and Parkinsonia aculeate (palo verde) PV reacted with VL, but not with anti Glycine max agglutinin SBA or anti Lotus tetragonolobus agglutinin LTA. Furthermore, direct analysis of VL peptides showed sequences homologous to those reported in different lectins of the Phaseolus genus. VL2-VL4 did not have ABO serological or simple sugar specificity, but were inhibited by complex carbohydrates from fetuin and thyroglobulin. Asialofetuin carbohydrates strongly interacted with VL4 and VL3. Vinorama isolectins could be classified as "complex lectins".

  13. Purification of diamine oxidase and its properties in germinated fava bean (Vicia faba L.).

    PubMed

    Yang, Runqiang; Chen, Hui; Han, Yongbin; Gu, Zhenxin

    2012-06-01

    γ-Aminobutyric acid (GABA) is a non-protein amino acid with bioactive functions for human health. Diamine oxidase (DAO, EC 1.4.3.6) is one of the key enzymes for GABA formation. In the present study, this enzyme was purified from 5 day germinated fava bean and its properties were investigated in vitro. The molecular mass of the enzyme estimated by Sephadex G-100 gel filtration was 121 kDa. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) displayed a single band at a molecular mass of 52 kDa. The enzyme had optimal activity at 40 °C and retained its activity after being incubated at 30 °C for 30 min. It showed higher activity at pH 6.5 than at other pH values. The enzyme was significantly inhibited by Mg(2+), Cu(2+), Fe(3+), aminoguanidine, ethylene glycol tetraacetic acid (EGTA), ethylene diamine tetraacetic acid disodium salt (EDTA-Na(2)), L-cysteine and β-mercaptoethanol. The K(m) value of DAO was 0.23 mmol L(-1) for putrescine and 0.96 mmol L(-1) for spermidine. However, the enzyme did not degrade spermine. DAO from germinated fava bean was purified. The optimal reaction temperature and pH of the enzyme were mild. The enzyme had higher affinity to putrescine than to spermidine and spermine. Copyright © 2011 Society of Chemical Industry.

  14. Pure erythropoietic colony and burst formations in serum-free culture and their enhancement by insulin-like growth factor I.

    PubMed

    Akahane, K; Tojo, A; Urabe, A; Takaku, F

    1987-08-01

    Recombinant human insulin-like growth factor I (IGF-I) increased human and murine erythropoietic colony formation in serum-free culture. In order to investigate the effects of purified factors such as IGF-I on hemopoietic progenitor cells, we have established a serum-free culture system which supports the clonal growth of CFU-E- and BFU-E-derived colonies. Exogenously supplied ingredients were bovine serum albumin (BSA), transferrin, lipid suspensions, 2-mercaptoethanol, and recombinant human erythropoietin (epo). Among these, BSA and cholesterol were found to be essential ingredients. The optimum concentration of BSA sufficient to grow BFU-E was 3%. Erythroid colony and burst formation of human and murine marrow cells was enhanced twofold (p less than 0.05) by a physiological concentration of recombinant human IGF-I. Potentiation was observed in a dose-dependent manner between 10(-9) and 10(-7) M. A few murine CFU-E colonies were formed in the absence of epo. These results suggest that IGF-I has a supportive effect on the proliferation and differentiation of erythroid precursor cells stimulated by epo and that its action is synergistic with that of epo.

  15. The molecular heterogeneity of nonspecific cross-reacting antigen synthesized by tumor cells and granulocytes.

    PubMed

    Kuroki, M; Kuroki, M; Moore, G E; Ichiki, S; Matsuoka, Y

    1988-01-01

    The molecular heterogeneity of nonspecific cross-reacting antigen (NCA) was examined. Metabolically-labeled glycoproteins were precipitated from cell lysates of human tumor cell lines and of normal peripheral granulocytes with antibodies specific for NCA, and analyzed by SDS-PAGE. NCA components synthesized by three tumor cell lines, QGP-1 (pancreas), HLC-1 (lung) and CAOV-2 (ovary) showed slightly different migration patterns on SDS-PAGE, but the molecular weights of their unglycosylated peptides synthesized in the presence of tunicamycin were all found to be 35K. On the other hand, two molecular species of NCA were identified in normal granulocytes: an 80K mature form derived from a 69K precursor peptide and a 58K mature form from a 41K precursor peptide. Upon SDS-PAGE, the migration pattern of the unglycosylated NCA peptides from tumor cells was affected by the presence of 2-mercaptoethanol, while that of the peptides of granulocytes was not. All the NCAs identified in this study possessed antigenic determinants common to carcinoembryonic antigen as well as those unique to NCA. These results suggest that the molecular heterogeneity of NCA observed thus far resulted from diverse glycosylation of the three fundamental molecular forms of unglycosylated peptides: one with a molecular weight of 35K produced by tumor cells and two with molecular weights of 69K and 41K produced by granulocytes.

  16. The maize benzoxazinone DIMBOA reacts with glutathione and other thiols to form spirocyclic adducts.

    PubMed

    Dixon, David P; Sellars, Jonathan D; Kenwright, Alan M; Steel, Patrick G

    2012-05-01

    Maize, wheat and other grasses synthesise large quantities of benzoxazinones and their glucosides, which act as antifeedant and allelopathic agents. These activities are probably due to the electrophilic nature of the aglycones, however, the mechanism of their action is unclear. In biological systems, glutathione (GSH) is the major electrophile-reactive compound so the reaction of the major maize benzoxazinone DIMBOA with GSH was studied. GSH reacts with DIMBOA to form eight isomeric mono-conjugates and eight isomeric di-conjugates. Through NMR studies with the model thiol 2-mercaptoethanol, these were structurally elucidated as unusual spirocycles. Similar reactivity was observed with proteins, with cysteinyl thiols being modified by DIMBOA. The thioether bonds formed were stable and not easily reduced to the parent thiol. DIMBOA can therefore readily deplete GSH levels and irreversibly inactivate enzymes with active-site cysteine residues, with clear implications for potentially toxic effects when young grasses are ingested, whether by insect pests or humans. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. [Fusion proteins encoded by orf 129L of ectromelia and orf A30L of smallpox viruses cross-react with neutralizing monoclonal antibodies].

    PubMed

    razumov, I A; Gileva, I P; Vasil'eva, M A; Nepomniashchikh, T S; Mishina, M N; Belanov, E F; Kochneva, G V; Konovalov, E E; Shchelkunov, S N; Loktev, V B

    2005-01-01

    Open reading frame (orf) 129L of ectromelia (EV) and orf A30L of smallpox viruses (SPV) encoding fusion proteins were cloned and expressed in E. coli cells. The recombinant polypeptides (prA30L H pr129L) were purified from cell lysates by Ni-NTA chromatography. Recombinant polypeptides were able to form trimers in buffered saline and they destroyed under treatment with SDS and 2-mercaptoethanol. Reactivity of prA30L, pr129L and orthopoxvirus proteins was analyzed by ELISA and Western blotting with panel of 22 monoclonal antibodies (MAbs) against orthopoxviruses (19 against EV, 2 MAbs against vaccinia virus and 1 Mabs against cowpox virus). This data allowed us to conclude that there are 12 EV-specific epitopes of pr129L and EV fusion proteins, ten orthopox-specific epitopes of EV, VV, CPV fusion proteins, from them 9 orthopox-specific epitopes of prA30L and SPV fusion proteins. Five Mabs, which cross-reacted with orthopox-specific epitopes, were able to neutralize the VV on Vero cells and from them two MAbs has neutralizing activity against smallpox virus. Our findings demonstrate that 129L fusion protein have EV-specific epitopes, that EV 129L and SPV A30L fusion proteins have a several orthopox-specific epitopes to induce a neutralizing antibodies against human pathogenic orthopoxviruses.

  18. Purification and characterization of peroxidase from avocado (Persea americana Mill, cv. Hass).

    PubMed

    Rojas-Reyes, José O; Robles-Olvera, Victor; Carvajal-Zarrabal, Octavio; Castro Matinez, Claudia; Waliszewski, Krzysztof N; Aguilar-Uscanga, María Guadalupe

    2014-07-01

    Avocado (Persea americana Mill, cv. Hass) fruit ranks tenth in terms of the most important products for Mexico. Avocado products are quite unstable due to the presence of oxidative enzymes such as polyphenol oxidase and peroxidase. The present study is to characterize the activity of purified avocado peroxidase from avocado in order to ascertain the biochemical and kinetic properties and their inhibition conditions. Purification was performed by Sephacryl S 200 HR gel filtration chromatography and its estimated molecular weight was 40 kDa. The zymogram showed an isoelectric point of 4.7. Six substrates were tested in order to ascertain the affinity of the enzyme for these substrates. The purified peroxidase was found to have low Km (0.296 mM) and high catalytic efficiency (2688 mM(-1) s(-1)) using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), optimum activity being reached at 51°C, pH 3.8. The addition of dithiothreitol, β-mercaptoethanol, ascorbic acid, sodium azide, L-cysteine and Tween-20 had high inhibitory effects, while metals ions such as Cu(+), Fe(2+) and Mn(2+) had weak inhibitory activity on purified avocado peroxidase. The purified avocado peroxidase exhibits high inhibition (Ki = 0.37 µM) with 1.97 µM n-propyl gallate using ABTS as substrate at 51°C, pH 3.8 for 10 min. © 2013 Society of Chemical Industry.

  19. Solubilization and purification of the glucosyltransferase involved in the biosynthesis of teichuronic acid by fragments of Micrococcus luteus cell membranes

    SciTech Connect

    Hildebrandt, K.M.; Anderson, J.S.

    1987-05-01

    Enzymes involved in the biosynthesis of teichuronic acid have been demonstrated in cytoplasmic membrane fragments recovered from lysozyme treated Micrococcus luteus cells. Solubilization of the glucosyltransferase activity was effected with aqueous solutions of Triton X-100, Nonidet P-40, Tween 20, or Thesit. Thesit proved most amenable for recovery of glucosyltransferase activity as well as spectrophotometric protein determinations. Recovery of the glucosyltranferase activity was aided during purification by inclusion of 15% glycerol, 0.75% Thesit, 20 mM magnesium ion and 2 mM 2-mercaptoethanol in all buffers. Glucosyltransferase activity was monitored by the transfer of (/sup 14/C)glucose from UDP-(/sup 14/C)glucose to an artificial acceptor. Although the natural acceptor is presumed to be an undecaprenyl diphosphate-activated oligosaccharide, alternate acceptors such as isolated cell wall fractions containing teichuronic acid served equally well. Highly purified teichuronic acid devoid of peptidoglycan was the most effective alternate acceptor. The glucosyltransferase was purified by ammonium sulfate precipitation followed by ion exchange chromatography on DEAE-cellulose yielding an overall 200-fold increase in specific activity.

  20. Brucellosis in Occupationally Exposed Groups

    PubMed Central

    Sajjan, Annapurna G.; Mohite, Shivajirao T.; Gajul, Shivali

    2016-01-01

    Introduction In India, high incidence of human brucellosis may be expected, as the conditions conducive for human brucellosis exist. Limited studies have been undertaken on human brucellosis especially in occupationally-exposed groups. Aim To estimate prevalence of anti-brucellar antibodies, evaluate the clinical manifestations, risk factors and Knowledge, Attitude and Practices (KAP) levels about brucellosis among occupationally exposed groups. Materials and Methods Blood samples were collected from 2337 occupationally exposed individuals. The serum samples were screened for the presence of anti-brucellar antibodies by Rose Bengal Plate Test (RBPT), Serum Agglutination Test (SAT) and 2-Mercaptoethanol test (2-ME). Clinical manifestations, risk factors and KAP levels were evaluated by personal interview using a structured questionnaire. Results Seroprevalence of brucellosis by RBPT, SAT and 2-ME test was 9.46%, 4.45% and 3.64 % respectively. Clinical symptoms resembling brucellosis were seen in 91 subjects. The major risk factors were animal exposure in veterinarians and abattoirs, both animal exposure and raw milk ingestion in farmers and shepherds, exposure to raw milk and its ingestion in dairy workers and exposure to Brucella culture in laboratory workers. Except laboratory workers, few veterinarians and dairy workers none had heard about brucellosis. KAP levels regarding brucellosis were too poor in all the groups except laboratory workers. Conclusion Brucellosis most of the times was missed or misdiagnosed. Regular screenings for brucellosis and awareness programmes to increase KAP levels are necessary to control brucellosis in occupationally exposed groups. PMID:27190804

  1. BW A4C and other hydroxamic acids are potent inhibitors of linoleic acid 8R-dioxygenase of the fungus Gaeumannomyces graminis.

    PubMed

    Brodowsky, I D; Hamberg, M; Oliw, E H

    1994-03-11

    Linoleic acid is converted to 8R-hydroperoxylinoleic acid by the soluble 8R-dioxygenase of the fungus Gaeumannomyces graminis. Effects of different lipoxygenase inhibitors on the 8R-dioxygenase were evaluated. Three hydroxamic acid derivatives were investigated. BW A4C (N-(3-phenoxycinnamyl)acetohydroxamic acid) was the most potent with an IC50 of 0.2 microM, followed by zileuton (3-10 microM) and linoleate-hydroxamic acid (0.02 mM). Two other lipoxygenase inhibitors, nordihydroguaiaretic acid and eicosatetraynoic acid, were less potent (IC50 0.09 and 0.15 mM, respectively). The 8R-dioxygenase was also strongly inhibited by commonly used buffer additives, dithiothreitol, beta-mercaptoethanol and phenylmethanesulfonyl fluoride. G. graminis also contains a hydroperoxide isomerase, which converts 8R-hydroperoxylinoleic acid to 7S,8S-dihydroxylinoleic acid. Ammonium sulphate precipitation and gel filtration indicated that the dioxygenase and the hydroperoxide isomerase activities could be separated.

  2. Protein quantification and its tolerance for different interfering reagents using the BCA-method with regard to 2D SDS PAGE.

    PubMed

    Krieg, Rene C; Dong, Yan; Schwamborn, Kristina; Knuechel, Ruth

    2005-10-31

    Measuring the protein content of a sample is a mandatory and frequently practiced procedure in the lab. Although the procedure is quite simple and convenient to perform with commercially available kits, incompatible reagents in the lysate can cause problems in the quality of measurement. Unfortunately these reagents are cornerstones of high efficiency lysing buffers, e.g. high amounts of urea or beta-mercaptoethanol. In this study we addressed the tolerance of the well-known BCA-assay (bicinchoninic acid) to various reagents in different concentrations, with special regard to a subsequent 2D-gelelectrophoresis. As a result, the kit is incompatible with the recipes of regular 2D-buffers. Also, when mixing two different reagents interfering effects will occur in a non-predictable way. Therefore we established a new method to quantify protein content in lysates ready for 2D-gelelectrophoresis: by mixing an aliquot with SDS, an equilibration is performed to that the sample can be run on a regular 1D SDS PAGE. Image analysis following fluorescence staining (SYPRO Ruby) reveals the absolute protein content in comparison to a BSA dilution curve processed accordingly.

  3. A prototype of the direct agglutination test kit (DAT-Canis) for the serological diagnosis of canine visceral leishmaniasis.

    PubMed

    Oliveira, Edward; Saliba, Juliana Wilke; Oliveira, Diana; Dias, Edelberto Santos; Paz, Gustavo Fontes

    2016-05-15

    This report describes the stege I/II development of a new direct agglutination test (DAT) for the diagnosis of canine visceral leishmaniasis (CVL) using freeze-dried antigen produced Coomassie blue-stained Leishmania (Leishmania) infantum promastigotes. In stage I, 16 canine serum samples, collected from eight dogs carrying CVL and eight healthy dogs, were assessed with the DAT using 2-mercaptoethanol (2-ME), N-acetyl-cysteine (NAC), kaolin or NAC plus urea (NAC+U) to improve the assay conditions. Stage II assessed the diagnostic accuracy with 100 serum samples collected from dogs with symptomatic CVL and clinically healthy dogs, comparing the four different sample diluents. The CVL-DAT prototype kit showed equivalent performances when 2-ME, NAC or NAC+U were used: 97.1% sensitivity (CI: 83-99.8%), 97% specificity (CI: 88.5-99.5%) and a 97% diagnostic accuracy (CI: 90.8-99.2). With kaolin, a 94.1% sensitivity (CI: 79-99%), 97% specificity (CI: 88.5-99.5%) and 96% diagnostic accuracy were observed (CI: 89.5-98.7), with no statistically significant differences among the four reagents (p=1.0). The NAC plus urea in sample diluent decreased non-specific agglutination, promoted a better defined sharp-edged blue spot and was thus chosen as a component for the new DAT prototype to diagnose canine VL, designated DAT-Canis.

  4. Inactivation of jack bean urease by scutellarin: elucidation of inhibitory efficacy, kinetics and mechanism.

    PubMed

    Wu, Dian-Wei; Yu, Xiao-Dan; Xie, Jian-Hui; Su, Zu-Qing; Su, Ji-Yan; Tan, Li-Rong; Huang, Xiao-Qi; Chen, Jian-Nan; Su, Zi-Ren

    2013-12-01

    In the present study, the inactivation effect of scutellarin (SL) on jack bean urease was investigated to elucidate the inhibitory potency, kinetics and mechanism of inhibition. It was revealed that SL acted as a concentration- and time-dependent inactivator of urease characteristic of slow-binding inhibition with an IC50 of 1.35±0.15 mM. The rapid formation of the initial SL-urease complex with an inhibition constant of Ki=5.37×10(-2) mM was followed by a slow isomerization into the final complex with the overall inhibition constant of Ki*=3.49×10(-3) mM. High effectiveness of thiol protectors, such as L-cysteine (L-cys), 2-mercaptoethanol (2-ME) and dithiothreitol (DTT) significantly slowed down the rate of inactivation, indicating the strategic role of the active site sulfhydryl group in the blocking process. While the insignificant protection by boric acid and fluoride from the inactivation further confirmed that the active site cysteine should be obligatory for urease inhibition, which was also rationalized by the molecular docking study. The inhibition of SL on urease proved to be reversible since SL-blocked urease could be reactivated by DTT application and multidilution. The results obtained indicated that urease inactivation resulted from the reaction between SL and the sulfhydryl group. © 2013.

  5. Synthesis, characterization and thermoluminescence studies of Mn-doped ZnS nanoparticles.

    PubMed

    Chandrakar, Raju Kumar; Baghel, R N; Chandra, B P

    2016-03-01

    ZnS:Mn nanoparticles were prepared by a chemical precipitation method and characterized by X-ray diffraction (XRD), field emission gun scanning electron microscope (FEGSEM), and high resolution transmission electron microscopy (HRTEM). Capping agent (mercaptoethanol) concentrations used were 0 M, 0.005 M, 0.01 M, 0.015 M, 0.025 M, 0.040 M, and 0.060 M, and resulted in nanoparticles sizes of 2.98 nm, 2.9 nm, 2.8 nm, 2.7 nm, 2.61 nm, 2.2 nm and 2.1 nm, respectively. The thermoluminescence (TL) glow curve was recorded by heating the sample exposed to UV-radiation, at a fixed heating rate 1°C sec(-1). The TL intensity initially increased with temperature, attained a peak value Im for a particular temperature, and then decreased with further increase in temperature. The peak TL intensity increased with decreasing nanoparticle size, whereas the temperature corresponding to the peak TL intensity decreased slightly with reducing nanocrystal size. As a consequence of increase in surface-to-volume ratio and increased carrier recombination rates, the TL intensity increased with decreasing nanoparticle size. It was found that, whereas activation energy slightly decreased with decreasing nanoparticle size, the frequency factor decreased significantly with reduction in nanoparticle size.

  6. Characterization of the ATP-phosphohydrolase activity of bovine spermatozoa flagellar extracts.

    PubMed

    Young, L G; Smithwick, E B

    1975-02-01

    The ATP-phosphohydrolase activity of extracts prepared from bovine spermatozoa flagella (BSFE), was characterized with respect to enzyme, substrate, activator ion and salt concentration, temperature dependence and time stability. BSFE required the presence of a divalent cation for activity: Mg++ or Ca++ could function as activator; Mn++, Zn++ and Cd++ could not. EDTA, but not EGTA, was inhibitory to enzymatic activity. Ca++ inhibited the Mg++ stimulated activity. ATP was dephosphorylated more rapidly than GTP greater than CTP greater than ITP, and ADP was dephosphorylated at 40% of the rate of ATP. The magnesium activated ATPase was stimulated by potassium and inhibited by sodium ions. Activation of BSFE ATP-phosphohydrolase was maximal in the presence of Mg++ and ATP in equimolar concentrations and K+ (0.05-0.3 M) at 30 degrees C. Although the enzymatic activity of the extract was found to decrease rapidly with time, it could be maintained for up to three days by the addition of 2-beta-mercaptoethanol to the bovine spermatozoa flagellar extracts.

  7. Immunogenicity and phylogenetic relationship of tapeworm antigens produced by Hymenolepis nana and Hymenolepis diminuta

    PubMed Central

    Coleman, R. M.; Carty, Janice M.; Graziadei, W. D.

    1968-01-01

    The tapeworms Hymenolepis nana and H. diminuta share three major antigens in the cell sap. Two of these show identical specificity while the third exhibits common as well as uncommon determinants peculiar to the dwarf tapeworm, H. nana. Shared antigens are not, however, immunogenic during infection of mice with the dwarf tapeworm although there is a well defined response to specific antigens. On the other hand infection of rats with H. diminuta elicits a weak response yielding serum antibodies which cross-react with the dwarf tapeworm. Cross-reactive antibodies engendered in rabbits against worm homogenates are insensitive to mercaptoethanol treatment whereas non-cross-reactive antibodies present at 3 weeks post-infection with the dwarf tapeworm are primarily IgM globulins. The rapid formation and subsequent release of these antigens may relate to a persistence of immunogenicity. Antibody levels reach a peak after a 4-week period of infection and the drop in titre observed at 6 weeks is preceded by a reduction in worm load. Resistance to infection following artificial immunization with worm homogenates is consistent with that developed as a result of actual infection with the dwarf tapeworm. Over one-half of mice immunized did not become infected following challenge with ova. Worm loads of mice that did become infected were reduced to approximately 1 per cent that of non-immunized animals. PMID:5673286

  8. Sulfhydryl protection and the oxygen effect on radiation-induced inactivation of r-chromatin in vitro. Influence of an OH scavenger: t-butanol

    SciTech Connect

    Herskind, C.

    1988-07-01

    Transcriptionally active r-chromatin from Tetrahymena has been irradiated in dilute phosphate buffer, pH 7.2, in the presence of the sulfhydryl compound 2-mercaptoethanol (MSH). MSH was more protective against radiation-induced inactivation of transcription under N/sub 2/ than under O/sub 2/. The OH scavenger, t-butanol, on the other hand, gives significantly less protection under N/sub 2/ than under O/sub 2/, apparently due to inactivation by secondary t-butanol radicals under anoxia as shown previously. However, MSH was found to restore most of the protective effect of t-butanol under N/sub 2/. Inactivation was studied as a function of MSH concentration (0.03-10 mM) at different, fixed concentrations of t-butanol (3-300 mM). The observed protection may be explained essentially in terms of (1) OH scavenging, (2) repair of DNA radicals by H-atom transfer from MSH under N/sub 2/ in competition with fixation of damage under O/sub 2/, and (3) protection against inactivation by secondary t-butanol radicals by H-atom transfer to these radicals. The sensitizing effect of oxygen in the presence of MSH is reduced by t-butanol and may even be reversed to produce an apparently protective effect. This finding is discussed in terms of residual inactivation by secondary radicals. The significance of OH scavengers as potential modifiers of oxygen enhancement ratio values is discussed.

  9. Inhibition of human squalene monooxygenase by selenium compounds.

    PubMed

    Gupta, Nisha; Porter, Todd D

    2002-01-01

    Selenosis in animals is characterized by a variety of neurological abnormalities, but the chemical species of selenium and the molecular targets that mediate this neurotoxicity are unknown. We have previously shown that selenite is a potent inhibitor of squalene monooxygenase, the second enzyme in the committed pathway for cholesterol biosynthesis; inhibition of this enzyme by dimethyltellurium leads to a peripheral demyelinating neuropathy similar to that seen in selenosis. To evaluate the role methylation plays in selenium toxicity, we examined the ability of three methylselenium compounds, methylselenol, dimethylselenide, and trimethylselenonium iodide, to inhibit purified recombinant human squalene monooxygenase. IC(50) values for methylselenol (95 microM) and dimethylselenide (680 microM) were greater than that previously obtained for selenite (37 microM), and inhibition by trimethylselenonium iodide was evident only at concentrations above 3 mM. Inhibition by methylselenol as well as by selenite was slow and irreversible, suggestive of covalent binding to the enzyme, and thiol-containing compounds could prevent and reverse this inhibition, indicating that these compounds were reacting with sulfhydryl groups on the protein. Monothiols such as glutathione and beta-mercaptoethanol provided better protection than did dithiols, suggesting that these selenium compounds bind to only one of the two proposed vicinal cysteines on squalene monooxygenase. Unexpectedly, the inhibition by selenite was significantly enhanced by dithiols, indicating that a more toxic species, possibly selenide, was formed in the presence of these dithiol reductants. Copyright 2002 Wiley Periodicals, Inc.

  10. Purification and biochemical characterization of an acidophilic amylase from a newly isolated Bacillus sp. DR90.

    PubMed

    Asoodeh, Ahmad; Alemi, Ashraf; Heydari, Akbar; Akbari, Jafar

    2013-03-01

    An acidophilic and Ca(2+)-independent amylase was purified from a newly isolated Bacillus sp. DR90 by ion-exchange chromatography, and exhibited a molecular weight of 68.9 kDa by SDS-PAGE. The optimum pH and temperature of the enzyme were found to be 4.0 and 45 °C, respectively. The enzyme activity was increased by Ba(2+), Fe(2+) and Mg(2+), and decreased by Hg(2+) and Zn(2+), while it was not affected by Na(+), K(+), phenylmethylsulfonyl fluoride and β-mercaptoethanol. Ca(2+) and EDTA did not have significant effect on the enzyme activity and thermal stability. The values of K m and V max for starch as substrate were 4.5 ± 0.13 mg/ml and 307 ± 12 μM/min/mg, respectively. N,N-dialkylimidazolium-based ionic liquids such as 1-hexyl-3-methylimidazolium bromide [HMIM][Br] have inhibitory effect on the enzyme activity. Thin layer chromatography analyses displayed that maltose and glucose are the main products of the enzyme reaction on starch. Regarding the features of the enzyme, it may be utilized as a novel candidate for industrial applications.

  11. Characterization of a novel non-specific nuclease from thermophilic bacteriophage GBSV1

    PubMed Central

    Song, Qing; Zhang, Xiaobo

    2008-01-01

    Background Thermostable enzymes from thermophiles have attracted extensive studies. In this investigation, a nuclease-encoding gene (designated as GBSV1-NSN) was obtained from a thermophilic bacteriophage GBSV1 for the first time. Results After recombinant expression in Escherichia coli, the purified GBSV1-NSN exhibited non-specific nuclease activity, being able to degrade various nucleic acids, including RNA, single-stranded DNA and double-stranded DNA that was circular or linear. Based on sequence analysis, the nuclease shared no homology with any known nucleases, suggesting that it was a novel nuclease. The characterization of the recombinant GBSV1-NSN showed that its optimal temperature and pH were 60°C and 7.5, respectively. The results indicated that the enzymatic activity was inhibited by enzyme inhibitors or detergents, such as ethylene diamine tetraacetic acid, citrate, dithiothreitol, β-mercaptoethanol, guanidine hydrochloride, urea and SDS. In contrast, the nuclease activity was enhanced by TritonX-100, Tween-20 or chaps to approximately 124.5% – 141.6%. The Km of GBSV1-NSN nuclease was 231, 61 and 92 μM, while its kcat was 1278, 241 and 300 s-1 for the cleavage of dsDNA, ssDNA and RNA, respectively. Conclusion Our study, therefore, presented a novel thermostable non-specific nuclease from thermophilic bacteriophage and its overexpression and purification for scientific research and applications. PMID:18439318

  12. Sulfide oxidations for LC-MS analysis of methionine-containing microcystins in Dolichospermum flos-aquae NIVA-CYA 656.

    PubMed

    Miles, Christopher O; Melanson, Jeremy E; Ballot, Andreas

    2014-11-18

    Microcystins are cyclic heptapeptides produced by a range of cyanobacteria. More than 150 microcystin analogues have been reported from cultures, algal blooms, or other contaminated samples. Relatively few analytical standards are available, making identification and quantitation of these toxins a challenge, even with LC-MS technology. We developed a two-step oxidative procedure that allows LC-MS identification of microcystins containing methionine and methionine sulfoxide, and reveals the oxidation state of the methionyl sulfur atom. The procedure was used in parallel with mercaptoethanol derivatization and LC-MS(2) analysis to demonstrate the presence of [Asp(3)]MC-MR (12) and MC-MR (17) in a culture of Dolichospermum flos-aquae, together with low levels of [Asp(3)]MC-M(O)R (5) and MC-M(O)R (7), as well as 20 other microcystins. Fresh culture contained only traces of sulfoxides 5 and 7, but these increased during storage or sample extraction and preparation. This suggests that microcystins containing methionine sulfoxide are primarily postextraction oxidation artifacts, rather than being produced by biosynthesis in cyanobacteria. A simple, rapid extraction under inert gas followed promptly by LC-MS analysis minimized oxidation artifacts for D. flos-aquae.

  13. Glutathione is required for efficient production of infectious picornavirus virions

    SciTech Connect

    Smith, Allen D. . E-mail: smitha@ba.ars.usda.gov; Dawson, Harry . E-mail: dawsonh@ba.ars.usda.gov

    2006-09-30

    Glutathione is an intracellular reducing agent that helps maintain the redox potential of the cell and is important for immune function. The drug L-buthionine sulfoximine (BSO) selectively inhibits glutathione synthesis. Glutathione has been reported to block replication of HIV, HSV-1, and influenza virus, whereas cells treated with BSO exhibit increased replication of Sendai virus. Pre-treatment of HeLa cell monolayers with BSO inhibited replication of CVB3, CVB4, and HRV14 with viral titers reduced by approximately 6, 5, and 3 log{sub 1}, respectively. The addition of glutathione ethyl ester, but not dithiothreitol or 2-mercaptoethanol, to the culture medium reversed the inhibitory effect of BSO. Viral RNA and protein synthesis were not inhibited by BSO treatment. Fractionation of lysates from CVB3-infected BSO-treated cells on cesium chloride and sucrose gradients revealed that empty capsids but not mature virions were being produced. The levels of the 5S and 14S assembly intermediates, however, were not affected by BSO treatment. These results demonstrate that glutathione is important for production of mature infectious picornavirus virions.

  14. Effects of Reactive Oxygen Species on Differentiation of Bone Marrow Mesenchymal Stem Cells.

    PubMed

    Shi, Yao; Hu, Yiwen; Lv, Chen; Tu, Guanjun

    2016-11-14

    BACKGROUND The low differentiation rates for transplanted stem cells are challenging problems in spinal cord injury (SCI) treatment. Studies have demonstrated that the inhibition of the Notch1 pathway in bone marrow mesenchymal stem cells (BMSCs) contributed to the differentiation of these cells. Research findings that certain antioxidants induce BMSCs to differentiate into neuronal cells suggest that BMSC differentiation is related to the level of reactive oxygen species (ROS) in cells. This study aimed to define the effect of ROS on the differentiation of BMSCs. MATERIAL AND METHODS In this study, after BMSCs were induced with the antioxidant β-mercaptoethanol (β-ME), related proteins were analyzed by Western blotting and immunofluorescence. In order to find the role of ROS in the differentiation, DCFH-DA was used to detect ROS levels in antioxidant-treated BMSCs, H2O2-treated BMSCs, and normal BMSCs, and the expression levels of Notch1 and its downstream transcriptional suppressor Hes1 were analyzed. RESULTS Induced with β-ME, Western blotting and immunofluorescence revealed gradual increases in the expression of Nestin (a neural stem cell-specific protein) and neuron-specific enolase (NSE) but decreases in Notch1 expression. The expression levels of Notch1 and Hes1 were positively correlated with changes in ROS level. CONCLUSIONS These data suggest that the antioxidant-induced differentiation of BMSCs into neurons may be related to ROS-based regulation of the Notch1 signalling pathway.

  15. Impact of a Reducing Agent on the Dynamic Surface Properties of Lysozyme Solutions.

    PubMed

    Tihonov, Michael M; Kim, Viktoria V; Noskov, Boris A

    2016-05-01

    Disulfide bond shuffling in the presence of the reducing agents dithiothreitol (DTT) or β-mercaptoethanol (BME) strongly affects the surface properties of lysozyme solutions. The addition of 0.32 mM DTT substantially alters the kinetic dependencies of the dynamic surface elasticity and surface tension relative to those of pure protein solutions. The significant increase in the dynamic surface elasticity likely relates to the cross-linking between lysozyme molecules and the formation of a dense layer of protein globules stabilized by intermolecular disulfide bonds at the liquid/gas interface. This effect differs from the previously described influence of chaotropic denaturants, such as guanidine hydrochloride (GuHCl) and urea, on the surface properties of lysozyme solutions. If both chaotropic and reducing agents are added to protein solutions simultaneously, their effects become superimposed. In the case of mixed lysozyme/GuHCl/DTT solutions, the dynamic surface elasticity near equilibrium decreases as the GuHCl concentration increases because of the gradual loosening of the cross-linked layer of protein globules but remains much higher than that of lysozyme/GuHCl solutions.

  16. Ethacrynic and alpha-lipoic acids inhibit vaccinia virus late gene expression.

    PubMed

    Spisakova, Martina; Cizek, Zdenek; Melkova, Zora

    2009-02-01

    Smallpox was declared eradicated in 1980. However recently, the need of agents effective against poxvirus infection has emerged again. In this paper, we report an original finding that two redox-modulating agents, the ethacrynic and alpha-lipoic acids (EA, LA), inhibit growth of vaccinia virus (VACV) in vitro. The effect of EA and LA was compared with those of beta-mercaptoethanol, DTT and ascorbic acid, but these agents increased VACV growth in HeLa G cells. The inhibitory effects of EA and LA on the growth of VACV were further confirmed in several cell lines of different embryonic origin, in epithelial cells, fibroblasts, macrophages and T-lymphocytes. Finally, we have analyzed the mechanism of action of the two agents. They both decreased expression of VACV late genes, as demonstrated by western blot analysis and activity of luciferase expressed under control of different VACV promoters. In contrast, they did not inhibit virus entry into the cell, expression of VACV early genes or VACV DNA synthesis. The results suggest new directions in development of drugs effective against poxvirus infection.

  17. Mechanism of action of cysteamine in depleting prolactin immunoreactivity

    SciTech Connect

    Sagar, S.M.; Millard, W.J.; Martin, J.B.; Murchison, S.C.

    1985-08-01

    The thiol reagent cysteamine (CSH) depletes anterior pituitary cells of immunoreactive PRL both in vivo and in vitro. The authors examined the hypothesis that CSH affects either the solubility or immunoreactivity of PRL through a mechanism involving thiol-disulfide exchange. Adult female rats were treated with either CSH (300 mg/kg, sc) or an equimolar dose of ethanolamine as a control. Anterior pituitary glands were extracted in 0.1 M sodium borate buffer, pH 9.0. Treatment of pituitary extracts with beta-mercaptoethanol (BME) destroys the immunoreactivity of PRL. However, extraction in the presence of reduced glutathione or CSH of pituitaries of rats treated with CSH restores immunoreactive PRL to control levels. Extracts were also subjected to polyacrylamide gel electrophoresis (PAGE). On gels of pituitary extracts of CSH-treated rats, the band that comigrates with purified PRL is diminished compared to that in ethanolamine-treated controls. However, extraction of the pituitaries in sodium dodecyl sulfate-containing buffer followed by chemical reduction with BME restores the PRL band. Therefore, CSH acts on PRL through a thiol-related mechanism to yield a product that is poorly soluble in aqueous buffer at pH 9 and is poorly immunoreactive. Dispersed anterior pituitary cells in tissue culture were incubated with L-(TVS)methionine to radiolabel newly synthesized peptides. PAGE followed by autoradiography confirmed the above results obtained in vivo.

  18. Quantification of dye-mediated photodamage during single-molecule DNA imaging.

    PubMed

    Tycon, Michael A; Dial, Catherine F; Faison, Keia; Melvin, Whitney; Fecko, Christopher J

    2012-07-01

    Single-molecule fluorescence imaging of DNA-binding proteins has enabled detailed investigations of their interactions. However, the intercalating dyes used to visually locate DNA molecules have the undesirable effect of photochemically damaging the DNA through radical intermediaries. Unfortunately, this damage occurs as single-strand breaks (SSBs), which are visually undetectable but can heavily influence protein behavior. We investigated the formation of SSBs on DNA molecules by the dye YOYO-1 using complementary single-molecule imaging and gel electrophoresis-based damage assays. The single-molecule assay imaged hydrodynamically elongated lambda DNA, enabling the real-time detection of double-strand breaks (DSBs). The gel assay, which used supercoiled plasmid DNA, was sensitive to both SSBs and DSBs. This enabled the quantification of SSBs that precede DSB formation. Using the parameters determined from the gel damage assay, we applied a model of stochastic DNA damage to the time-resolved DNA breakage data, extracting the rates of single-strand breakage at two dye staining ratios and measuring the damage reduction from the radical scavengers ascorbic acid and β-mercaptoethanol. These results enable the estimation of the number of SSBs that occur during imaging and are scalable over a wide range of laser intensities used in fluorescence microscopy. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. [Thermostable extracellular cyclic nucleotide phosphodiesterase from Physarum polycephalum plasmodium].

    PubMed

    Nezvetskiĭ, A R; Orlova, T G; Beĭlina, S I; Orlov, N Ia

    2006-01-01

    The cyclic nucleotide phosphodiesterase secreted by Physarum polycephalum plasmodium into extracellular medium has been partially purified by DEAE cellulose chromatography, ultrafiltration, and HPLC. The results obtained by gel filtration, HPLC, electrophoresis, and isoelectric focusing suggest that, the native enzyme in solution is a monomer with a molecular mass of about 90 kDa and pI in the range 3.6 - 4.0. The Km values were estimated to be about 0.9 mM and 7.7 mM, respectively, and Vm for both substrates were similar (up to several thousand micromoles of cAMP hydrolyzed/hour per mg of enzyme). The partially purified enzyme was shown to be extremely stable. It did not lose the activity after heat treatment at 100 degrees C during 30 min. The enzyme was active in the presence of 1% SDS, but it was fully inactivated under the same conditions in the presence of beta-mercaptoethanol. The properties of the phosphodiesterase from Physarum polycephalum are discussed.

  20. An antioxidant agent prevents NO sub 2 -induced inhibition of mast cell mediator release: Evidence that the mechanism involves free radicals

    SciTech Connect

    Fujimaki, Hidekazu; Shiraishi, Fujio; Wakamori, Kazuo Jikei Univ. School of Medicine, Tokyo )

    1990-12-01

    Previously we established that in vitro NO{sub 2} exposure induced inhibition of histamine release from rat peritoneal mast cells (PMC) stimulated with secretagogues such as compound 48/80 or substance P. To further explore the effects of NO{sub 2} exposure on mast cells, we investigated whether the addition of an antioxidant agent, 2-mercaptoethanol (2-ME), can prevent NO{sub 2}-induced inhibition of mediator release from PMC. Histamine release from 5 ppm NO{sub 2}-exposed PMC stimulated with 20 {mu}M substance P was also significantly inhibited compared with that from the controls. {beta}-Hexosaminidase release from 5 ppm NO{sub 2}-exposed PMC stimulated with 20 {mu}M substance P was also significantly inhibited. However, the inhibition of both histamine and {beta}-hexosaminidase release from exposed PMC was diminished by the addition of 5 mM 2-ME during NO{sub 2} exposure. Although IgE-mediated histamine release from NO{sub 2} exposed PMC was markedly inhibited, the addition of 5 mM 2-ME during NO{sub 2} exposure induced no inhibition of histamine release. These results suggest a possible relationship between NO{sub 2}-induced inhibition of mast cell mediator release and production of free radicals by the action of NO{sub 2}.

  1. Different effects of reducing agents on ω-conotoxin GVIA inhibition of [3H]-acetylcholine release from rat cortical slices and guinea-pig myenteric plexus

    PubMed Central

    Casali, T A A; Gomez, R S; Moraes-Santos, T; Romano-Silva, M A; Prado, M A M; Gomez, M V

    1996-01-01

    The effect of reducing reagents on ω-conotoxin GVIA (ω-CgTX) inhibition of the release of [3H]-acetylcholine ([3H]-ACh) induced by tityustoxin, K+ 50 mM and electrical stimulation was investigated in rat brain cortical slices.In cortical slices the inhibition of tityustoxin or electrically-stimulated [3H]-ACh release by ω-CgTX was dramatically increased by reducing reagents ascorbate or β-mercaptoethanol. Dehydroascorbic acid did not substitute for ascorbateDepolarization induced by K+ 50 mM caused [3H]-ACh release from cortical slices which was not inhibited by ω-CgTX, even in the presence of ascorbate.In the guinea-pig myenteric plexus, ω-CgTX inhibition of the tityustoxin induced release of [3H]-ACh was independent of ascorbate.It is suggested that N-type-like calcium channels in guinea-pig myenteric plexus may have pharmacological/biochemical diversity from similar channels of rat cerebral cortex. PMID:9117104

  2. Purification and Characterization of a New Thermostable, Haloalkaline, Solvent Stable, and Detergent Compatible Serine Protease from Geobacillus toebii Strain LBT 77

    PubMed Central

    Riahi, Yosra; Belhadj, Omrane

    2016-01-01

    A new thermostable, haloalkaline, solvent stable SDS-induced serine protease was purified and characterized from a thermophilic Geobacillus toebii LBT 77 newly isolated from a Tunisian hot spring. This study reveals the potential of the protease from Geobacillus toebii LBT 77 as an additive to detergent with spectacular proprieties described for the first time. The protease was purified to homogeneity by ammonium sulfate precipitation followed by Sephadex G-75 and DEAE-Cellulose chromatography. It was a monomeric enzyme with molecular weight of 30 kDa. The optimum pH, temperature, and NaCl for maximum protease activity were 13.0, 95°C, and 30%, respectively. Activity was stimulated by Ca2+, Mg2+, DTNB, β-mercaptoethanol, and SDS. The protease was extremely stable even at pH 13.25, 90°C, and 30% NaCl and in the presence of hydrophilic, hydrophobic solvents at high concentrations. The high compatibility with ionic, nonionic, and commercial detergents confirms the utility as an additive to cleaning products. Kinetic and thermodynamic characterization of protease revealed Km = 1 mg mL−1,  Vmax = 217.5 U mL−1, Kcat/Km = 99 mg mL−1 S−1, Ea = 51.5 kJ mol−1, and ΔG⁎ = 56.5 kJ mol−1. PMID:27069928

  3. Cloning and Characterization of Cold-Adapted α-Amylase from Antarctic Arthrobacter agilis.

    PubMed

    Kim, Su-Mi; Park, Hyun; Choi, Jong-Il

    2017-03-01

    In this study, the gene encoding an α-amylase from a psychrophilic Arthrobacter agilis PAMC 27388 strain was cloned into a pET-28a(+) vector and heterologously expressed in Escherichia coli BL21(DE3). The recombinant α-amylase with a molecular mass of about 80 kDa was purified by using Ni(2+)-NTA affinity chromatography. This recombinant α-amylase exhibited optimal activity at pH 3.0 and 30 °C and was highly stable at varying temperatures (30-60 °C) and within the pH range of 4.0-8.0. Furthermore, α-amylase activity was enhanced in the presence of FeCl3 (1 mM) and β-mercaptoethanol (5 mM), while CoCl2 (1 mM), ammonium persulfate (5 mM), SDS (10 %), Triton X-100 (10 %), and urea (1 %) inhibited the enzymatic activity. Importantly, the presence of Ca(2+) ions and phenylmethylsulfonyl fluoride (PMSF) did not affect enzymatic activity. Thin layer chromatography (TLC) analysis showed that recombinant A. agilis α-amylase hydrolyzed starch, maltotetraose, and maltotriose, producing maltose as the major end product. These results make recombinant A. agilis α-amylase an attractive potential candidate for industrial applications in the textile, paper, detergent, and pharmaceutical industries.

  4. Brucella suis in armadillos (Chaetophractus villosus) from La Pampa, Argentina.

    PubMed

    Kin, Marta S; Fort, Marcelo; de Echaide, Susana T; Casanave, Emma B

    2014-06-04

    Brucellosis is a zoonotic disease transmitted from an animal reservoir to humans. Both, wildlife and domestic animals, contribute to the spreading of these zoonosis. The surveillance of the animal health status is strictly regulated for domestic animals, whereas disease monitoring in wildlife does not exist. The aim of the present study was to provide data on the prevalence of anti-Brucella antibodies in Chaetophractus villosus from a region of La Pampa, Argentina to assess public health risks. The C. villosus is endemic to South America, and in Argentina it represents a food resource for human consumption. A total of 150 sera of armadillos bleeding between 2007 and 2010 were tested using buffered plate antigen test (BPAT), serum agglutination test (SAT), 2-mercaptoethanol (2-ME) and complement fixation test (CFT), for the detection of anti-Brucella antibodies. Antibodies to Brucella sp. were found in 16% (24:150) of the armadillos tested using the BPAT test. All 24 positive samples were confirmed by the SAT, 2-ME and CFT tests. Strain isolation was attempted from liver and spleen samples of two animals with positive serology. Isolates were characterized by conventional biotyping and identification of specific DNA using polymerase chain reaction (PCR). A total of 2 isolates were recovered from spleen and liver. Both of them were identified as Brucella suis biovar 1. This preliminary study provides the first report on the seroprevalence of brucellosis and describes the first isolate of B. suis biovar 1 in C. villosus in Argentina.

  5. Maillard reaction products derived from thiol compounds as inhibitors of enzymatic browning of fruits and vegetables: the structure-activity relationship.

    PubMed

    Billaud, C; Maraschin, C; Peyrat-Maillard, M-N; Nicolas, J

    2005-06-01

    Some thiol-derived Maillard reaction products (MRPs) may exert antioxidant activity, depending on the reaction conditions as well as on the sugar and the sulphydryl compound. Recently, we reported that MRPs derived from glucose or fructose with cysteine (CSH) or glutathione (GSH) mixtures greatly inhibited polyphenoloxidases (PPOs), oxidoreductases responsible for discoloration of fresh or minimally processed fruits and vegetables. Glucose and GSH were shown to be the most active in producing inhibitory MRPs. Therefore, we examined the way in which the nature of the reactants affected their synthesis, in order to establish a structure-activity relationship for the inhibitory products. Various aqueous (0.083 M, 0.125 M, or 0.25 M) mixtures of a sugar (hexose, pentose, or diholoside) with either a CSH-related compound (CSH, GSH, N-acetyl-cysteine, cysteamine, cysteic acid, methyl-cysteine, cysteine methyl ester), an amino acid (gamma-glutamic acid, glycine, methionine), or other sulfur compound (thiourea, 1,4-dithiothreitol, 2-mercaptoethanol) were heated at 103 degrees C for 14 h. Soluble MRPs were compared for their ability to inhibit apple PPO activity. In the presence of CSH, the rated sugars (same molar concentration) ranked as to inhibitory effect were pentoses > sucrose > hexoses > or = maltose. In the presence of glucose, the simultaneous presence of an amino group, a carboxyl group, and a free thiol group on the same molecule seemed essential for the production of highly inhibitory compounds.

  6. Use of 8-azidoguanosine 5'-(gamma-/sup 32/P)triphosphate as a probe of the guanosine 5'-triphosphate binding protein subunits in bovine rod outer segments

    SciTech Connect

    Kohnken, R.E.; Mc Connell, D.G.

    1985-07-02

    In an in vitro incubation, 8-azidoguanosine 5'-(gamma-/sup 32/P)triphosphate ( (gamma-/sup 32/P)-8-azido-GTP) labeled bleached rhodopsin independent of ultraviolet light. Characterization of this labeling indicated that rhodopsin was phosphorylated with (gamma-/sup 32/P)-8-azido-GTP as a phosphate donor. At low concentrations, ATP increased this labeling activity 5-fold. In the same incubation, (gamma-/sup 32/P)-8-azido-GTP also labeled G alpha (Mr 40 000). This labeling was ultraviolet light dependent. G beta (Mr 35 000) was also labeled dependent for the most part upon ultraviolet light, but a smaller component of labeling appeared to result from phosphorylation. Differential labeling of G alpha and G beta was found to vary intricately with experimental conditions, especially prebleaching of rhodopsin, tonicity of the medium, and the presence or absence of 2-mercaptoethanol. Affinity labeling of G alpha and G beta by (gamma-/sup 32/P)-8-azido-GTP in competition with ATP or GTP was kinetically complex, consistent with possible multiple binding sites for GTP on both subunits. Independent evidence for two or more binding sites on G alpha has been offered by other laboratories, and recently, at least one binding site on G beta and its analogues among the N proteins of adenylate cyclases has been identified.

  7. Soluble suppressor factors in patients with acquired immune deficiency syndrome and its prodrome. Elaboration in vitro by T lymphocyte-adherent cell interactions.

    PubMed Central

    Laurence, J; Gottlieb, A B; Kunkel, H G

    1983-01-01

    Supernatants from peripheral blood mononuclear cells obtained from certain patients with the acquired immune deficiency syndrome (AIDS) or its prodrome were capable of depressing spontaneous and pokeweed mitogen-driven B lymphocyte differentiation into plasmacytes, and the proliferative responses of T cells to specific antigen. These soluble suppressor factors (SSF) were present in uniquely high concentrations, with significant differences from healthy controls and from patients with various other conditions previously associated with factor-mediated immunosuppression. T cell-independent functions were not modified by SSF. Suppression was not genetically constrained, and did not appear to be mediated by cytotoxicity, prostaglandin, or alpha or gamma interferons. SSF was a product of the interaction of T lymphocytes with adherent cells. T cells or T cell factors from AIDS patients, but not from normal controls, could collaborate with control adherent cells in the formation of SSF. Restoration of DNA synthesis-independent differentiation of B lymphocytes into plasmacytes in SSF-treated cultures was realized by addition of reducing agents, such as 2-mercaptoethanol, on culture initiation. These data suggest inhibitory mechanisms possibly related to that of concanavalin A-induced soluble immune response suppression, and perhaps offer clues to clinically applicable substances which are potentially capable of mitigating such responses. PMID:6605980

  8. The effect of disulfiram on the aldehyde dehydrogenases of sheep liver.

    PubMed Central

    Kitson, T M

    1975-01-01

    1. The effect of disulfiram on the activity of the cytoplasmic and mitochondrial aldehyde dehydrogenases of sheep liver was studied. 2. Disulfiram causes an immediate inhibition of the enzyme reaction. The effect on the cytoplasmic enzyme is much greater than on the mitochondrial enzyme. 3. In both cases, the initial partial inhibition is followed by a gradual irreversible loss of activity. 4. The pH-rate profile of the inactivation of the mitochondrial enzyme by disulfiram and the pH-dependence of the maximum velocity of the enzyme-catalysed reaction are both consistent with the involvement of a thiol group. 5. Excess of 2-mercaptoethanol or GSH abolishes the effect of disulfiram. However, equimolar amounts of either of these reagents and disulfiram cause an effect greater than does disulfiram alone. It was shown that the mixed disulphide, Et2N-CS-SS-CH2-CH2OH, strongly inhibits aldehyde dehydrogenase. 6. The inhibitory effect of diethyldithiocarbamate in vitro is due mainly to contamination by disulfiram. PMID:3167

  9. Encapsulation of highly confined CdSe quantum dots for defect free luminescence and improved stability

    NASA Astrophysics Data System (ADS)

    Kumari, Asha; Singh, Ragini Raj

    2017-05-01

    This is the first report on the generation of trap states and their effective elimination in highly confined CdSe quantum dots in order to obtain enhanced and stable optical properties prepared by aqueous route. Surface plays an important role in optical properties of quantum dots (QDs) and surface modification of quantum dots can improve optical properties. In present work luminescent CdSe QDs were prepared using 2-Mercaptoethanol (2-ME) as stabilizing agent and encapsulated by polymer. Different concentrations of 2-ME were used to tune the emission spectra with respect to their reduced size. Addition of 2-ME to CdSe QDs enhances the trap emission and quenching band edge emission due to (i) increased surface to volume ratio and; (ii) presence of high concentration of sulfide ions as confirmed from EDX analysis as sulfide ions possesses the hole scavenging characteristics. Polymer encapsulation of QDs was carried out to make them stable and to improve their optical properties. Even though there are previous reports addressing the improved optical properties by polymer encapsulation and silica encapsulation but experimentally it has not been reported yet experimentally. In this work we have synthesized and characterized water soluble polymer encapsulated QDs and proved the facts experimentally. Photoluminescence spectroscopy clearly reveals the role of polymer encapsulation in boosting the optical properties of CdSe QDs. FTIR spectra validate the presence of biocompatible functional groups on CdSe4/PEG (Polymer encapsulated QDs).

  10. Glutathionylation of the iron superoxide dismutase from the psychrophilic eubacterium Pseudoalteromonas haloplanktis.

    PubMed

    Castellano, Immacolata; Ruocco, Maria Rosaria; Cecere, Francesca; Di Maro, Antimo; Chambery, Angela; Michniewicz, Andzelika; Parlato, Giuseppe; Masullo, Mariorosario; De Vendittis, Emmanuele

    2008-05-01

    Our previous work showed that the adduct between beta-mercaptoethanol and the single cysteine residue (Cys57) in superoxide dismutase from the psychrophilic eubacterium Pseudoalteromonas haloplanktis (PhSOD) reduces the enzyme inactivation by peroxynitrite. In this work, immunoblotting experiments prove that peroxynitrite inactivation of PhSOD involves formation of nitrotyrosine residue(s). In order to study the role of Cys57 as a redox-sensor residue modifiable by cellular thiols, a recombinant PhSOD and two Cys57 mutants were produced and characterized. Recombinant and mutant enzymes share similar activity and peroxynitrite inactivation, but different reactivity towards three glutathione forms. Indeed, oxidized glutathione and S-nitrosoglutathione, but reduced glutathione, lead to S-glutathionylation of recombinant PhSOD. This new covalent modification for a Fe-SOD does not occur in both Cys57 mutants, thus indicating that its target is Cys57. Moreover, mass spectrometry analysis confirmed that S-glutathionylation of Cys57 takes place also with endogenous PhSOD. Formation of this mixed disulfide in PhSOD protects the enzyme from tyrosine nitration and peroxynitrite inactivation. PhSOD undergoes S-glutathionylation during its overproduction in E. coli cells and in a growing culture of P. haloplanktis. In both cases the extent of glutathionylated PhSOD is enhanced upon cell exposure to oxidative agents. We suggest that S-glutathionylation of PhSOD could represent a further cold-adaptation strategy to improve the antioxidant cellular defence mechanism.

  11. Immunological studies of an atypical (myeloma) immunoglobulin

    PubMed Central

    Johansson, S. G. O.; Bennich, H.

    1967-01-01

    An 8S myeloma component, isolated from serum of a patient with myelomatosis is described, which appears to have no antigenic determinants in common with human, α-, δ-, γ- or μ-polypeptide chains as revealed by immuno-electrophoresis and Ouchterlony gel diffusion analysis. The myeloma protein migrates in the fast γ-region on electrophoresis at pH 8.6 and has an elution volume on Sephadex G-200 similar to that of 6.5S IgA. The isolated myeloma component has an approximate molecular weight of 200,000 and a total carbohydrate content of 10.7 per cent. Reduction with β-mercaptoethanol and acid dissociation yields light polypeptide chains of Type L and a carbohydrate-rich component, in the ratio of 1:4. Antisera specific to determinants on the heavy chains of the myeloma protein showed no reaction with the immunoglobulins A, D, G or M. Instead unique determinants were found on the heavy polypeptide chains. ImagesFIG. 3FIG. 1FIG. 7FIG. 9FIG. 10 PMID:4168094

  12. Application of the chloramphenicol acetyltransferase (CAT) diffusion assay to transgenic plant tissues.

    PubMed

    Peach, C; Velten, J

    1992-02-01

    Chloramphenicol acetyltransferase (CAT) activity was quantified in crude extracts from tobacco callus tissues using a modification of a previously reported diffusion assay. We describe here the alterations necessary in applying this rapid and simple assay procedure to plant materials. Due to the high concentration of nonspecific oxidases present in most plant tissues, some type of protective agent is required to maintain enzyme activity. We have tested beta-mercaptoethanol, cysteine, dithiothreitol, ascorbic acid and polyvinyl pyrrolidone as protective agents within the initial extraction buffer. We also investigated the effect of heat (60 degrees C, 10 min) and 5 mM EDTA on CAT activity. The highest CAT activity was obtained using 5 mM cysteine plus 5 mM EDTA in 40 mM Tris-HCl (pH 7.8) as the initial extraction buffer followed by a heat treatment. Using this buffer, CAT activity was stable on ice for more than two hours. In our hands, total acetyl-coenzyme A concentration within the assay mixture was found to be saturating at 250 microM and the Km determined to be 100 microM. Assays performed using the same crude plant extract indicate that 1) duplicate assays show less than 1.5% variation in activities and 2) CAT activity increases linearly with respect to volume of extract used.

  13. A review of Brucella seroprevalence among humans and animals in Bangladesh with special emphasis on epidemiology, risk factors and control opportunities.

    PubMed

    Islam, Md Ariful; Khatun, Mst Minara; Werre, Stephen R; Sriranganathan, Nammalwar; Boyle, Stephen M

    2013-10-25

    Brucellosis is a neglected bacterial zoonotic disease in many countries affecting both humans and animals. The aim of this paper is to review published reports of the seroprevalence of brucellosis in humans and animals (cattle, buffalo, sheep, goats and dogs) in Bangladesh. The prevalence studies are based primarily on the following serological tests: rose bengal plate agglutination test (RBT), plate agglutination test (PAT), tube agglutination test (TAT), mercaptoethanol agglutination test (MET), standard tube agglutination test (STAT), slow agglutination test (SAT), milk ring test (MRT), indirect enzyme-linked immunosorbant assay (I-ELISA), competitive ELISA (C-ELISA) and fluorescent polarization assay (FPA). Seroprevalences of brucellosis were found to be affected by the sensitivity and specificity of serological tests employed. Brucellosis prevalence varied based on occupations of people (2.5-18.6%) and species of animals (3.7% in cattle, 4.0% in buffalo, 3.6% in goats and 7.3% in sheep). The prevalence of brucellosis in humans was reported in livestock farmers (2.6-21.6%), milkers (18.6%), butchers (2.5%) and veterinarians (5.3-11.1%) who have direct contact with animal and its products or who consume raw milk. According to published reports brucellosis does affect people and livestock of Bangladesh. There is an immediate need for a concerted effort to control and eradicate brucellosis from domesticated animals in Bangladesh.

  14. Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

    PubMed

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  15. Fast protocol for extraction of DNA from Prosopis spp leaves (plant adapted to arid environment) without liquid nitrogen.

    PubMed

    Michel-López, C Y; González-Mendoza, D; Grimaldo-Juarez, O

    2013-09-27

    The extraction of high-quality genomic DNA from Prosopis spp for polymerase chain reaction (PCR) amplification is complicated, owing to the presence of a high percentage of secondary metabolites that bind to or co-precipitate with nucleic acids. In the present study, we report a modified sodium dodecyl sulfate/phenol protocol that eliminates the use of liquid nitrogen in the maceration process, β-mercaptoethanol in the buffer extraction, and the ethanol precipitation step. The A₂₆₀/A₂₈₀ absorbance ratios of the isolated DNA were approximately 2.0 to 1.9, suggesting that the DNA fraction was pure and can be used for further PCR analysis. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. Finally, this proposal represents an alternative fast, cheap, and effective method for the isolation of genomic DNA from fresh leaves of Prosopis spp, even in low-technology laboratories.

  16. Extraction of DNA suitable for PCR applications from mature leaves of Mangifera indica L.

    PubMed

    Azmat, Muhammad Abubakkar; Khan, Iqrar Ahmad; Cheema, Hafiza Masooma Naseer; Rajwana, Ishtiaq Ahmad; Khan, Ahmad Sattar; Khan, Asif Ali

    2012-04-01

    Good quality deoxyribonucleic acid (DNA) is the pre-requisite for its downstream applications. The presence of high concentrations of polysaccharides, polyphenols, proteins, and other secondary metabolites in mango leaves poses problem in getting good quality DNA fit for polymerase chain reaction (PCR) applications. The problem is exacerbated when DNA is extracted from mature mango leaves. A reliable and modified protocol based on the cetyltrimethylammonium bromide (CTAB) method for DNA extraction from mature mango leaves is described here. High concentrations of inert salt were used to remove polysaccharides; Polyvinylpyrrolidone (PVP) and β-mercaptoethanol were employed to manage phenolic compounds. Extended chloroform-isoamyl alcohol treatment followed by RNase treatment yielded 950-1050 µg of good quality DNA, free of protein and RNA. The problems of DNA degradation, contamination, and low yield due to irreversible binding of phenolic compounds and coprecipitation of polysaccharides with DNA were avoided by this method. The DNA isolated by the modified method showed good PCR amplification using simple sequence repeat (SSR) primers. This modified protocol can also be used to extract DNA from other woody plants having similar problems.

  17. Short-term culture of ovarian cortical strips from capuchin monkeys (Sapajus apella): a morphological, viability, and molecular study of preantral follicular development in vitro.

    PubMed

    Brito, A B; Santos, R R; van den Hurk, R; Lima, J S; Miranda, M S; Ohashi, O M; Domingues, S F S

    2013-08-01

    The aim of this study was to evaluate whether an in vitro culture (IVC) medium containing either or not β-mercaptoethanol (BME), bone morphogenetic protein 4 (BMP4), or pregnant mare serum gonadotrophin (PMSG) could be able to promote the development of capuchin monkeys' preantral follicles enclosed in ovarian cortical strips. Follicular viability after IVC was similar to control (89.32%). Primordial follicle recruitment to primary stage was not reached with IVC, but the rate of secondary follicle formation was increased in the medium supplemented with BME, BMP4, and PMSG (44.86%) when compared to IVC control (9.20%). In the medium supplemented with BME, BMP4, and PMSG, contrary to other media, anti-müllerian hormone-messenger RNA (mRNA) expression in ovarian tissue was upregulated (3.4-fold), while that of growth differentiation factor-9 was maintained. The BMP4-mRNA expression, however, appeared downregulated in all cultured tissues. Our findings show a favorable effect of BME, BMP4, and PMSG on the in vitro development of secondary follicles from capuchin monkeys.

  18. A new approach to the thermodynamic study of ABO antibodies.

    PubMed Central

    Rouger, P; Salmon, C

    1979-01-01

    Enthalpy change was determined for natural anti-A (B, O subjects) and anti-B (A1, A2, O subjects). Entropy change, free energy change and association constant were calculated according to the law of mass action and the Wurmser method. The concentrations of allohaemagglutinins were measured by the Wilkie and Becker method using an autoanalyser. 2-Mercaptoethanol was used to estimate the proportions of IgG and IgM and their respective contribution to the thermodynamic properties. The following results and conclusions were obtained. Individual enthalpy and entrophy changes are different for each subject so that only the average values of these thermodynamic parameters represent a characteristic of the phenotype. There is a correlation between enthalpy and entropy changes and the relative proportion of anti-A or anti-B IgG. There is heterogeneity of the values of association constant. Free energy change is about 10 kcal mol-1 for all anti-A and anti-B; this result confirms the low energy binding between antigen and antibody. All these results confirm the role of environment and red-cell phenotype in the synthesis of allohaemagglutinins. PMID:500114

  19. Rapid affinity-purification and physicochemical characterization of pumpkin (Cucurbita maxima) phloem exudate lectin.

    PubMed

    Narahari, Akkaladevi; Swamy, Musti J

    2010-04-21

    The chito-oligosaccharide-specific lectin from pumpkin (Cucurbita maxima) phloem exudate has been purified to homogeneity by affinity chromatography on chitin. After SDS/PAGE in the presence of 2-mercaptoethanol, the pumpkin phloem lectin yielded a single band corresponding to a molecular mass of 23.7 kDa, whereas ESI-MS (electrospray ionization MS) gave the molecular masses of the subunit as 24645 Da. Analysis of the CD spectrum of the protein indicated that the secondary structure of the lectin consists of 9.7% alpha-helix, 35.8% beta-sheet, 22.5% beta-turn and 32.3% unordered structure. Saccharide binding did not significantly affect the secondary and tertiary structures of the protein. The haemagglutinating activity of pumpkin phloem lectin was mostly unaffected in the temperature range 4-70 degrees C, but a sharp decrease was seen between 75 and 85 degrees C. Differential scanning calorimetric and CD spectroscopic studies suggest that the lectin undergoes a co-operative thermal unfolding process centred at approx. 81.5 degrees C, indicating that it is a relatively stable protein.

  20. Tryptophan exposure and accessibility in the chitooligosaccharide-specific phloem exudate lectin from pumpkin (Cucurbita maxima). A fluorescence study.

    PubMed

    Narahari, Akkaladevi; Swamy, Musti J

    2009-10-06

    The exposure and accessibility of the tryptophan residues in the chitooligosaccharide-specific pumpkin (Cucurbita maxima) phloem exudate lectin (PPL) have been investigated by fluorescence spectroscopy. The emission lambda(max) of native PPL, seen at 338nm was red-shifted to 348nm upon denaturation by 6M Gdn.HCl in the presence of 10mM beta-mercaptoethanol, indicating near complete exposure of the tryptophan residues to the aqueous medium, whereas a blue-shift to 335nm was observed in the presence of saturating concentrations of chitotriose, suggesting that ligand binding leads to a decrease in the solvent exposure of the tryptophan residues. The extent of quenching was maximum with the neutral molecule, acrylamide whereas the ionic species, iodide and Cs(+) led to significantly lower quenching, which could be attributed to the presence of charged amino acid residues in close proximity to some of the tryptophan residues. The Stern-Volmer plot for acrylamide was linear for native PPL and upon ligand binding, but became upward curving upon denaturation, indicating that the quenching occurs via a combination of static and dynamic mechanisms. In time-resolved fluorescence experiments, the decay curves could be best fit to biexponential patterns, for native protein, in the presence of ligand and upon denaturation. In each case both lifetimes systematically decreased with increasing acrylamide concentrations, indicating that quenching occurs predominantly via a dynamic process.

  1. Development of flow cytometric protocol for nuclear DNA content estimation and determination of chromosome number in Pongamia pinnata L., a valuable biodiesel plant.

    PubMed

    Ramesh, Aadi Moolam; Basak, Supriyo; Choudhury, Rimjhim Roy; Rangan, Latha

    2014-01-01

    The potentiality of Pongamia pinnata L. as a sustainable source of feedstock for the biodiesel industry is dependent on an extensive knowledge of the genome structure of the plant. Flow cytometry, with propidium iodide (PI) as the DNA stain, was used to estimate the nuclear DNA content of P. pinnata, with respect to Zea mays 'CE-777' as standard. The internal and pseudo-internal standardization was followed on account of the inhibitory effect of secondary compounds on PI intercalation. The antioxidants (PVP-40 and β-mercaptoethanol) were added to the nuclear isolation buffer for the reduction of inhibitory effect of P. pinnata cytosol. Nuclear DNA content estimation was done for P. pinnata leaves from different altitudes (37-117 m height from sea level) of Assam. Flow cytometry analysis indicated that the nuclear DNA content of P. pinnata is 2.66 pg with predicted 1C value of 1,300 Mb using Z. mays as standard. Coefficient of variation in flow cytometric analysis was within the limit of 5 % indicating that the results were reliable. Somatic chromosome numbers were counted from root-tip cells and was found to be 2n = 22 corresponding to the diploid level (x = 11). A decreasing trend in the nuclear DNA content was observed for the species of different altitudes.

  2. Isolation of high quality RNA from pistachio (Pistacia vera L.) and other woody plants high in secondary metabolites.

    PubMed

    Moazzam Jazi, Maryam; Rajaei, Saideh; Seyedi, Seyed Mahdi

    2015-10-01

    The quality and quantity of RNA are critical for successful downstream transcriptome-based studies such as microarrays and RNA sequencing (RNA-Seq). RNA isolation from woody plants, such as Pistacia vera, with very high amounts of polyphenols and polysaccharides is an enormous challenge. Here, we describe a highly efficient protocol that overcomes the limitations posed by poor quality and low yield of isolated RNA from pistachio and various recalcitrant woody plants. The key factors that resulted in a yield of 150 μg of high quality RNA per 200 mg of plant tissue include the elimination of phenol from the extraction buffer, raising the concentration of β-mercaptoethanol, long time incubation at 65 °C, and nucleic acid precipitation with optimized volume of NaCl and isopropyl alcohol. Also, the A260/A280 and A260/A230 of extracted RNA were about 1.9-2.1and 2.2-2.3, respectively, revealing the high purity. Since the isolated RNA passed highly stringent quality control standards for sensitive reactions, including RNA sequencing and real-time PCR, it can be considered as a reliable and cost-effective method for RNA extraction from woody plants.

  3. Multimeric immobilization of alcohol oxidase on electrospun fibers for valid tests of alcoholic saliva.

    PubMed

    Zhao, Long; Liu, Qingjie; Yan, Shili; Chen, Zhoujiang; Chen, Jianmei; Li, Xiaohong

    2013-10-10

    An accurate quantitation of ethanol is of great importance in clinical and forensic analyses. In the current study, alcohol oxidase (AOX) from Pichia pastoris, a multimeric enzyme consisting of eight identical subunits, was immobilized on electrospun polystyrene-co-maleic anhydride (PSMA) fibers for valid tests of alcoholic saliva. Branched polyethyleneimine (PEI) was grafted on PSMA fibers with a density of 0.15 nmol/cm(2) as tethers to allow multipoint covalent binding of enzyme molecules through glutaraldehyde activation, and the secondary and tertiary amino groups of PEI could intensify the interactions with AOX subunits to stabilize the quaternary structure. PSMA-PEI-AOX fibers were less sensitive than free AOX to the incubation temperature and pH, and indicated no detectable subunit release from the immobilized AOX after boiling in the presence of sodium dodecyl sulfate (SDS) and 2-mercaptoethanol. Color strips were established on PSMA-PEI-AOX fibrous mats dyed with indigo Carmine after incubation into ethanol solutions of different concentrations. The color fading ratio remained no significant change after repeat tests for 9 cycles after immersion in 0.2 and 0.8 mg/mL of alcoholic saliva. It was indicated that multipoint immobilization of the multimeric enzyme was essential to improve the enzyme stability by stabilizing both the quaternary structure of the enzyme and the structure of each individual subunit.

  4. Effects of cinnamaldehyde on the glucose transport activity of GLUT1.

    PubMed

    Plaisier, Christina; Cok, Alexandra; Scott, Jordan; Opejin, Adeleye; Bushhouse, Kelsey T; Salie, Mathew J; Louters, Larry L

    2011-02-01

    There is accumulating evidence that cinnamon extracts contain components that enhance insulin action. However, little is know about the effects of cinnamon on non-insulin stimulated glucose uptake. Therefore, the effects of cinnamaldehyde on the glucose transport activity of GLUT1 in L929 fibroblast cells were examined under both basal conditions and conditions where glucose uptake is activated by glucose deprivation. The data reveal that cinnamaldehyde has a dual action on the glucose transport activity of GLUT1. Under basal conditions it stimulates glucose uptake and reaches a 3.5 fold maximum stimulation at 2.0mM. However, cinnamaldehyde also inhibits the activation of glucose uptake by glucose deprivation in a dose dependent manner. Experiments with cinnamaldehyde analogs reveal that these activities are dependent on the α,β-unsaturated aldehyde structural motif in cinnamaldehyde. The inhibitory, but not the stimulatory activity of cinnamaldehyde was maintained after a wash-recovery period. Pretreatment of cinnamaldehyde with thiol-containing compounds, such as β-mercaptoethanol or cysteine, blocked the inhibitory activity of cinnamaldehyde. These results suggest that cinnamaldehyde inhibits the activation of GLUT1 by forming a covalent link to target cysteine residue/s. This dual activity of cinnamaldehyde on the transport activity of GLUT1 suggests that cinnamaldehyde is not a major contributor to the anti-diabetic properties of cinnamon.

  5. Effects of cinnamaldehyde on the glucose transport activity of GLUT1

    PubMed Central

    Plaisier, Christina; Cok, Alexandra; Scott, Jordan; Opejin, Adeleye; Bushhouse, Kelsey T.; Sallie, Mathew; Louters, Larry L.

    2010-01-01

    There is accumulating evidence that cinnamon extracts contain components that enhance insulin action. However, little is know about the effects of cinnamon on non-insulin stimulated glucose uptake. Therefore, the effects of cinnamaldehyde on the glucose transport activity of GLUT1 in L929 fibroblast cells were examined under both basal conditions and conditions where glucose uptake is activated by glucose deprivation. The data reveal that cinnamaldehyde has a dual action on the glucose transport activity of GLUT1. Under basal conditions it stimulates glucose uptake and reaches a 3.5 fold maximum stimulation at 2.0 mM. However, cinnamaldehyde also inhibits the activation of glucose uptake by glucose deprivation in a dose dependent manner. Experiments with cinnamaldehyde analogs reveal that these activities are dependent on the α,β-unsaturated aldehyde structural motif in cinnamaldehyde. The inhibitory, but not the stimulatory activity of cinnamaldehyde was maintained after a wash-recovery period. Pretreatment of cinnamaldehyde with thiol-containing compounds, such as β-mercaptoethanol or cysteine, blocked the inhibitory activity of cinnamaldehyde. These results suggest that cinnamaldehyde inhibits the activation of GLUT1 by forming a covalent link to target cysteine residue/s. This dual activity of cinnamaldehyde on the transport activity of GLUT1 suggests that cinnamaldehye is not a major contributor to the anti-diabetic properties of cinnamon. PMID:20955755

  6. Inactivation of bacteriophage phi X174 by mitomycin C in the presence of sodium hydrosulfite and cupric ions.

    PubMed

    Ueda, K; Morita, J; Yamashita, K; Komano, T

    1980-02-01

    Bacteriophage phi X174 was inactivated by mitomycin C reduced with sodium hydrosulfite in the presence of cupric ions (Cu2+). 99% of the phage particles lost their plaque-forming abilities when incubated with 1.5 . 10(-4) M mitomycin C, 5.7 . 10(-4) M sodium hydrosulfite and 1.0 . 10(-4) M CuCl2 for 120 min at 37 degrees C in 0.05 M Tris--HCl buffer (pH 8.1). Sodium borohydride and thiol-reducing agents such as L-cysteine, 2-mercaptoethanol or dithiothreitol could not serve as a substitute for sodium hydrosulfite and other transition metal ions such as Fe2+, Fe3+, Mn2+, Co2+ and Zn2+ were of no effect. Inactivated phage sedimented at 114S just as intact phage, but phage DNA was degraded. Strand-scission was observed when phi X174 single-stranded DNA was directly reacted with mitomycin C reduced with sodium hydrosulfite in the presence of CuCl2. Phage inactivation was inhibited bycatalase, EDTA and several scavengers such as cysteamine, 2-aminoethylisothiuronium bromide HBr (AET), 4,5-dihydroxy-1,3-benzene-disulfonic acid (Tiron), or 1,4-diazabicyclo[2,2,2]octane (DABCO). These results suggest that free oxygen radicals and mitomycin C semiquinone radical generated during autoxidation of reduced mitomycin C in the presence of cupric ions cause the degradation of phy X174 DNA.

  7. Preparation of thiolated polymeric nanocomposite for sensitive electroanalysis of dopamine.

    PubMed

    Su, Zhaohong; Liu, Ying; Xie, Qingji; Chen, Li; Zhang, Yi; Meng, Yue; Li, Yan; Fu, Yingchun; Ma, Ming; Yao, Shouzhuo

    2012-01-01

    We report on the thiol-ene chemistry guided preparation of novel thiolated polymeric nanocomposite films of abundant anionic carboxylic groups for electrostatic enrichment and sensitive electroanalysis of cationic dopamine (DA) in neutral solution. Briefly, the thiol-ene nucleophilic reaction of a carboxylated thiol with oxidized polypyrrole (PPy), which was electrosynthesized on an Au electrode in the presence of solution-dispersed acidified multiwalled carbon nanotubes (MWCNTs), produced an a PPy-thiol-MWCNTs/Au electrode, and the PPy can be electrochemically overoxidized (OPPy) to form an OPPy-thiol-MWCNTs/Au electrode. The carboxylic groups of the polymeric nanocomposite film originate from the acidified MWCNTs, PPy-tethered carboxylated thiol, and OPPy. The carboxylated thiols examined are mercaptosuccinic acid (MSA) and thioglycolic acid, with β-mercaptoethanol as a control. Electrochemical quartz crystal microbalance, scanning electron microscopy, Fourier transform infrared spectroscopy and ultraviolet-visible spectroscopy were used for film characterization and process monitoring. Under the optimized condition, the differential pulse voltammetry peak current of DA oxidation at OPPy-MSA-MWCNTs/Au electrode is linear with DA concentration from 1.00×10(-9) to 2.87×10(-6) mol L(-1), with a limit of detection of 0.4 nmol L(-1), good anti-interferent ability and stability.

  8. Comparison in effect of different metal ions, pH and reducing agent on the protease activity in human hyper mature and mature cataract.

    PubMed

    Sami, Amtul Jamil; Sami, Amtul Naseer; Kanwal, Noreen

    2007-08-01

    This study was undertaken to isolate and characterize the protease activity of human eye lens sample of mature and hyper mature cataract. Samples were collected just after surgery of the cataract lens and were stored at -20 degrees C. The total protein extract was isolated from 5 samples in each case (mature and hyper mature cataract) and clear supernatant obtained after centrifugation was used as an enzyme source. The optimum pH for the proteases of mature cataract was 7.5 while the proteases of hyper mature cataract were recorded for maximum activity at pH 5.5 and 7.5. The optimum temperature for both enzyme sources was 50 degrees C. Effect of different metal ions such as potassium, lead, silver, zinc and borate was studied. In each case protease activity was increased. Reducing agent e.g. beta mercaptoethanol also caused an increase in activity indicating the involvement of sulfhydryl groups. Protease activity was also located on agar plates.

  9. Electron transfer with self-assembled copper ions at Au-deposited biomimetic films: mechanistic ‘anomalies’ disclosed by temperature- and pressure-assisted fast-scan voltammetry

    NASA Astrophysics Data System (ADS)

    Khoshtariya, Dimitri E.; Dolidze, Tinatin D.; Tretyakova, Tatyana; van Eldik, Rudi

    2015-06-01

    It has been suggested that electron transfer (ET) processes occurring in complex environments capable of glass transitions, specifically in biomolecules, under certain conditions may experience the medium’s nonlinear response and nonergodic kinetic patterns. The interiors of self-assembled organic films (SAMs) deposited on solid conducting platforms (electrodes) are known to undergo glassy dynamics as well, hence they may also exhibit the abovementioned ‘irregularities’. We took advantage of Cu2+ ions as redox-active probes trapped in the Au-deposited  -COOH-terminated SAMs, either L-cysteine, or 3-mercaptopropionic acid diluted by the inert 2-mercaptoethanol, to systematically study the impact of glassy dynamics on ET using the fast-scan voltammetry technique and its temperature and high-pressure extensions. We found that respective kinetic data can be rationalized within the extended Marcus theory, taking into account the frictionally controlled (adiabatic) mechanism for short-range ET, and complications due to the medium’s nonlinear response and broken ergodicity. This combination shows up in essential deviations from the conventional energy gap (overpotential) dependence and in essentially nonlinear temperature (Arrhenius) and high-pressure patterns, respectively. Biomimetic aspects for these systems are also discussed in the context of recently published results for interfacial ET involving self-assembled blue copper protein (azurin) placed in contact with a glassy environment.

  10. Effect of rainbow trout (Oncorhynchus mykiss) plasma protein on the gelation of Alaska pollock (Theragra chalcogramma) Surimi.

    PubMed

    Li, D K; Lin, H; Kim, S M

    2008-05-01

    The effect of rainbow trout plasma protein (RPP) on the gelation of Alaska pollock surimi was determined to evaluate the possibility of its commercialization as a new protein additive. For modori gel, the breaking force, deformation, whiteness, and water holding capacity increased as the addition amount of RPP (0 to 0.75 mg/g) increased, and decreased at higher concentration of RPP (0.75 to 1.50 mg/g) (P < 0.05). Protein solubility of modori gel in the mixture of SDS, urea, and beta-mercaptoethanol decreased as the addition amount of RPP increased up to 0.75 mg/g, and increased at higher concentration of RPP (0.75 to 1.50 mg/g) (P < 0.05). The contents of trichloroacetic acid-soluble peptide decreased as the addition amount of RPP (0 to 1.50 mg/g) increased (P < 0.05). Based on the result of sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), most myosin heavy chain of surimi was not degraded when RPP was added. Thus, RPP was supposed to act as a protease inhibitor in the gelation of Alaska pollock surimi. An RPP of 0.75 mg/g was the optimal concentration to prevent the gel weakening of Alaska pollock surimi. Compounds with molecular weights less than 10 kDa in RPP had no significant effect on the gelation of Alaska pollock surimi based on the result of the dialyzed RPP.

  11. Stimulation of human platelet guanylate cyclase by unsaturated fatty acid peroxides.

    PubMed Central

    Hidaka, H; Asano, T

    1977-01-01

    Guanylate cyclase [GTP pyrophosphate-lyase (cyclizing), EC 4.6.1.2] activity of human platelet homogenates was stimulated by the addition of phospholipase A2 or unsaturated fatty acids such as oleic, vaccenic, linoleic, linolenic, eicosenoic, eicosadienoic, and arachidonic acids. The addition of lipoxidase potentiated the fatty acid-induced stimulation of guanylate cyclase purified by DEAE-cellulose column chromatography. The extent of the stimulation was dependent on the concentration of the oxidized form of these fatty acids (peroxides). Saturated fatty acids such as stearic and arachidic acids had no effect on the guanylate cyclase activity in the presence or absence of lipoxidase, indicating that human plateletguanylate cyclase is stimulated by unsaturated fatty acid peroxides rather than by fatty acids.Hemoglobin prevented the enzyme stimulation produced by low concentrations of fatty acid peroxides, but enhanced stimulation of the enzyme activity with high concentrations of fatty acid peroxides. 2-Mercaptoethanol, dithiothreitol, and N-ethylmaleimide inhibited the guanylate cyclase activities both in the presence and absence of unsaturated fatty acidperoxide. The stimulation of guanylate cyclase activity by unsaturated fatty acid peroxidesis attributed to oxidation of sulfhydryl residues of the enzyme protein. PMID:20630

  12. Xylanase production by Burkholderia sp. DMAX strain under solid state fermentation using distillery spent wash.

    PubMed

    Mohana, Sarayu; Shah, Amita; Divecha, Jyoti; Madamwar, Datta

    2008-11-01

    Xylanase production by a newly isolated strain of Burkholderia sp. was studied under solid state fermentation using anaerobically treated distillery spent wash. Response surface methodology (RSM) involving Box-Behnken design was employed for optimizing xylanase production. The interactions between distillery effluent concentration, initial pH, moisture ratio and inoculum size were investigated and modeled. Under optimized conditions, xylanase production was found to be in the range of 5200-5600 U/g. The partially purified enzyme recovered after ammonium sulphate fractionation showed maximum activity at 50 degrees C and pH 8.6. Kinetic parameters like Km and Vmax for xylan were found to be 12.75 mg/ml and 165 micromol/mg/min. In the presence of metal ions such as Ca2+, Co2+, Mn2+, Ba2+, Mg2+ and protein disulphide reducing agents such as beta-mercaptoethanol and dithiotheritol (DTT) the activity of enzyme increased, where as strong inhibition of enzyme activity was observed in the presence of Cu2+, Ag+, Fe2+ and SDS. The crude enzyme hydrolysed lignocellulosic substrate, wheat bran as well as industrial pulp.

  13. Pure zinc sulfide quantum dot as highly selective luminescent probe for determination of hazardous cyanide ion.

    PubMed

    Shamsipur, Mojtaba; Rajabi, Hamid Reza

    2014-03-01

    A rapid and simple fluorescence method is presented for selective and sensitive determination of hazardous cyanide ion in aqueous solution based on functionalized zinc sulfide (ZnS) quantum dot (QD) as luminescent prob. The ultra-small ZnS QDs were synthesized using a chemical co-precipitation method in the presence of 2-mercaptoethanol (ME) as an efficient capping agent. The prepared pure ZnS QDs was applied as an optical sensor for determination of cyanide ions in aqueous solutions. ZnS nanoparticles have exhibited a strong fluorescent emission at about 424 nm. The fluorescence intensity of QDs is linearly proportional to the cyanide ion concentration in the range 2.44×10(-6) to 2.59×10(-5)M with a detection limit of 1.70×10(-7)M at pH11. The designed fluorescent sensor possesses remarkable selectivity for cyanide ion over other anions such as Cl(-), Br(-), F(-), I(-), IO3(-), ClO4(-), BrO3(-), CO3(2-), NO2(-), NO3(-), SO4(2-), S2O4(2-), C2O4(2-), SCN(-), N3(-), citrate and tartarate with negligible influences on the cyanide detection by fluorescence spectroscopy.

  14. Method optimization for proteomic analysis of soybean leaf: Improvements in identification of new and low-abundance proteins

    PubMed Central

    Mesquita, Rosilene Oliveira; de Almeida Soares, Eduardo; de Barros, Everaldo Gonçalves; Loureiro, Marcelo Ehlers

    2012-01-01

    The most critical step in any proteomic study is protein extraction and sample preparation. Better solubilization increases the separation and resolution of gels, allowing identification of a higher number of proteins and more accurate quantitation of differences in gene expression. Despite the existence of published results for the optimization of proteomic analyses of soybean seeds, no comparable data are available for proteomic studies of soybean leaf tissue. In this work we have tested the effects of modification of a TCA-acetone method on the resolution of 2-DE gels of leaves and roots of soybean. Better focusing was obtained when both mercaptoethanol and dithiothreitol were used in the extraction buffer simultaneously. Increasing the number of washes of TCA precipitated protein with acetone, using a final wash with 80% ethanol and using sonication to ressuspend the pellet increased the number of detected proteins as well the resolution of the 2-DE gels. Using this approach we have constructed a soybean protein map. The major group of identified proteins corresponded to genes of unknown function. The second and third most abundant groups of proteins were composed of photosynthesis and metabolism related genes. The resulting protocol improved protein solubility and gel resolution allowing the identification of 122 soybean leaf proteins, 72 of which were not detected in other published soybean leaf 2-DE gel datasets, including a transcription factor and several signaling proteins. PMID:22802721

  15. Redox regulation of sperm surface thiols modulates adhesion to the fallopian tube epithelium.

    PubMed

    Talevi, Riccardo; Zagami, Maria; Castaldo, Marianna; Gualtieri, Roberto

    2007-04-01

    Sperm that adhere to the fallopian tube epithelium are of superior quality and adhesion extends their fertile life. It has been postulated that periovulatory signals, as yet undefined, promote sperm release. In the in vitro studies described here, we examined the effects of several antioxidants, reportedly present within oviductal fluid, on the modulation of sperm-oviduct adhesion in bovine species. Results showed that 1) the cell-permeant thiols (penicillamine, beta mercaptoethanol, cysteine, and dithiotreitol), as well as the nonpermeant thiol, reduced glutathione, cause adhering spermatozoa to release from the epithelium; 2) thiol action is exerted on spermatozoa; and 3) oxidized glutathione, as well as the non-thiol antioxidants (dimethylthiourea, trolox, superoxide dismutase, and catalase) have no effect. Sperm surface sulfhydryls labeled with iodoacetamide fluorescein showed that spermatozoa devoid of sulfhydryls on the head surface adhered to the fallopian epithelium in vitro, whereas thiol-induced release increased the exposure of sulfhydryls on the sperm head surface. Finally, analysis of capacitation status demonstrated that uncapacitated spermatozoa adhered to the oviduct, and that thiol-induced release of spermatozoa was accompanied by capacitation. In conclusion, thiol-reducing agents in the oviductal fluid may modulate the redox status of sperm surface proteins, leading to the release of spermatozoa selected and stored through adhesion to the fallopian tube epithelium in the bovine species.

  16. Humoral immune responses in foetal sheep.

    PubMed Central

    Fahey, K J; Morris, B

    1978-01-01

    A total of fifty-two foetal sheep between 49 and 126 days gestation were injected with polymeric and monomeric flagellin, dinitrophenylated monomeric flagellin, chicken red blood cells, ovalbumin, ferritin, chicken gamma-globulin and the somatic antigens of Salmonella typhimurium in a variety of combinations. Immune responses were followed in these animals by taking serial blood samples from them through indwelling vascular cannulae and measuring the circulating titres of antibody. Of the antigens tested, ferritin induced immune responses in the youngest foetuses. A short time later in gestation, the majority of foetuses responded to chicken red blood cells, polymeric flagellin, monomeric flagellin and dinitrophenylated monomeric flagellin. Only older foetuses responded regularly to chicken gamma-globulin and ovalbumin. However, antibodies to all these antigens were first detected over the relatively short period of development between 64 and 82 days gestation and this made it difficult to define any precise order in the development of immune responsiveness. Of the antigens tested only the somatic antigens of S. typhimurium failed to induce a primary antibody response during foetal life. The character and magnitude of the antibody responses in foetuses changed throughout in utero development. Both the total amount of antibody produced and the duration of the response increased with foetal age. Foetuses younger than 87 days gestation did not synthesize 2-mercaptoethanol resistant antibodies or IgG1 immunoglobulin to any of the antigens tested, whereas most foetuses older than this regularly did so. PMID:711249

  17. Cloning, Expression and 3D Structure Prediction of Chitinase from Chitinolyticbacter meiyuanensis SYBC-H1

    PubMed Central

    Hao, Zhikui; Wu, Hangui; Yang, Meiling; Chen, Jianjun; Xi, Limin; Zhao, Weijie; Yu, Jialin; Liu, Jiayang; Liao, Xiangru; Huang, Qingguo

    2016-01-01

    Two CHI genes from Chitinolyticbacter meiyuanensis SYBC-H1 encoding chitinases were identified and their protein 3D structures were predicted. According to the amino acid sequence alignment, CHI1 gene encoding 166 aa had a structural domain similar to the GH18 type II chitinase, and CHI2 gene encoding 383 aa had the same catalytic domain as the glycoside hydrolase family 19 chitinase. In this study, CHI2 chitinase were expressed in Escherichia coli BL21 cells, and this protein was purified by ammonium sulfate precipitation, DEAE-cellulose, and Sephadex G-100 chromatography. Optimal activity of CHI2 chitinase occurred at a temperature of 40 °C and a pH of 6.5. The presence of metal ions Fe3+, Fe2+, and Zn2+ inhibited CHI2 chitinase activity, while Na+ and K+ promoted its activity. Furthermore, the presence of EGTA, EDTA, and β-mercaptoethanol significantly increased the stability of CHI2 chitinase. The CHI2 chitinase was active with p-NP-GlcNAc, with the Km and Vm values of 23.0 µmol/L and 9.1 mM/min at a temperature of 37 °C, respectively. Additionally, the CHI2 chitinase was characterized as an N-acetyl glucosaminidase based on the hydrolysate from chitin. Overall, our results demonstrated CHI2 chitinase with remarkable biochemical properties is suitable for bioconversion of chitin waste. PMID:27240345

  18. Fabrication of a nanocarrier system through self-assembly of plasma protein and its tumor targeting

    NASA Astrophysics Data System (ADS)

    Gong, Guangming; Zhi, Feng; Wang, Kaikai; Tang, Xiaolei; Yuan, Ahu; Zhao, Lili; Ding, Dawei; Hu, Yiqiao

    2011-07-01

    Human serum albumin (HSA) nanoparticles hold great promise as a nanocarrier system for targeted drug delivery. The objective of this study was to explore the possibility of preparing size controllable albumin nanoparticles using the disulfide bond breaking reagent β-mercaptoethanol (β-ME). The results showed that the protein concentration and temperature had positive effects on the sizes of the albumin nanoparticles, while pH had a negative effect on the rate of nanoparticle formation. The addition of β-ME induced changes in HSA secondary structure and exposed the hydrophobic core of HSA, leading to the formation of nanoparticles. Human serum albumin nanoparticles could be internalized by MCF-7 cells and mainly accumulated in cytoplasm. After injection in tumor bearing mice, the HSA nanoparticles accumulated in tumor tissues, demonstrating the targeting ability of the nanoparticles. Therefore, human serum albumin can be fabricated into nanoparticles by breaking the disulfide bonds and these nanoparticles exhibit high tumor targeting ability. Human serum albumin nanoparticles could be ideal for the targeted delivery of pharmacologically active substances.

  19. Enzymes involved in vinyl acetate decomposition by Pseudomonas fluorescens PCM 2123 strain.

    PubMed

    Szczyrba, Elżbieta; Greń, Izabela; Bartelmus, Grażyna

    2014-03-01

    Esterases are widely used in food processing industry, but there is little information concerning enzymes involved in decompositions of esters contributing to pollution of environment. Vinyl acetate (an ester of vinyl alcohol and acetic acid) is a representative of volatile organic compounds (VOCs) in decomposition, of which hydrolyses and oxidoreductases are mainly involved. Their activities under periodically changing conditions of environment are essential for the removal of dangerous VOCs. Esterase and alcohol/aldehyde dehydrogenase activities were determined in crude cell extract from Pseudomonas fluorescens PMC 2123 after vinyl acetate induction. All examined enzymes exhibit their highest activity at 30-35 °C and pH 7.0-7.5. Esterase preferably hydrolyzed ester bonds with short fatty chains without plain differences for C2 or C4. Comparison of Km values for alcohol and aldehyde dehydrogenases for acetaldehyde suggested that this metabolite was preferentially oxidized than reduced. Activity of alcohol dehydrogenase reducing acetaldehyde to ethanol suggested that one mechanism of defense against the elevated concentration of toxic acetaldehyde could be its temporary reduction to ethanol. Esterase activity was inhibited by phenylmethanesulfonyl fluoride, while β-mercaptoethanol, dithiothreitol, and ethylenediaminetetraacetic acid had no inhibitor effect. From among metal ions, only Mg(2+) and Fe(2+) stimulated the cleavage of ester bond.

  20. Microstructural Properties of Chemically Synthesized Cubic ZnS Nanocrystals

    NASA Astrophysics Data System (ADS)

    Deka, Kuldeep; Kalita, M. P. C.

    2015-02-01

    In this paper we present microstructural properties of chemically synthesized cubic zinc sulfide (ZnS) nanocrystals, investigated by X-ray diffraction (XRD) line profile analysis applying classical Williamson-Hall (WH) and modified Williamson-Hall (MWH) methods, and transmission electron microscopy (TEM) observations. ZnS nanocrystals are synthesized using 1:1 M ratio of Zn and S precursors with 25, 50, and 75 mM, 2-mercaptoethanol as capping agent. WH analyses show that the average crystallite sizes (lattice strain) are 3.98 nm (2.22 × 10-2), 2.69 nm (1.99 × 10-2), and 2.58 nm (2.65 × 10-2). Dislocation contrast factors of ZnS crystals required for the MWH method are calculated from their elastic stiffness constants for various proportions of screw and edge dislocations. The best fit to MWH equation is found to be for dislocation contrast factors corresponding to 100 % edge dislocations and thereby suggesting edge dislocations are main contributors to strain. MWH analyses show dislocation density of 3.65, 2.69, and 2.47 nm crystallites are 3.19 × 1018 m-2, 2.58 × 1018 m-2, and 4.62 × 1018 m-2 , respectively. The crystallite sizes as estimated from the WH, MWH, and TEM studies are found to be intercorrelated. Presence of edge dislocations, as suggested by the MWH analysis, is confirmed by high resolution TEM (HRTEM) studies.

  1. Sulfhydryl compounds reduce Staphylococcus aureus biofilm formation by inhibiting PIA biosynthesis.

    PubMed

    Wu, Xiaoqian; Wang, Yu; Tao, Liang

    2011-03-01

    Staphylococcus aureus is the most common opportunistic pathogen causing foreign-body-associated infections. It has been widely accepted that biofilms would help the bacteria to cope with variable environments. Here we showed that treatment with sulfhydryl compounds such as dithiothreitol, β-mercaptoethanol or cysteine inhibited biofilm formation significantly in S. aureus. These sulfhydryl compounds at biofilm-inhibitive concentrations caused little inhibition of the growth rate and the initial adhesion ability of the cells. Real-time reverse transcriptase-PCR showed that the transcriptional level of ica, which encodes essential enzymes for polysaccharide intercellular adhesion (PIA) biosynthesis, was decreased after the treatment with thiols. Proteomic analysis revealed that Embden-Meyerhof-Parnas pathway and pentose phosphate pathway were strengthened while N-acetyl-glucosamine-associated polysaccharide metabolism was repressed in the cells treated with thiols. These changes finally resulted in the inhibition of PIA biosynthesis. We hope the discovery of this major physiological phenomenon will help in the prevention and clinical therapy of biofilm-associated problems caused by S. aureus. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  2. Effect of temperature stress on protein methyl esters

    SciTech Connect

    Welch, W.; Kracaw, K.

    1986-05-01

    Protein methyl esters have been implicated in a number of physiological processes. They have measured the effect of temperature stress on the levels of protein methyl esters in the mesophilic fungus Penicillium chrysogenum (PCPS) and the thermophilic fungus P. duponti (PD). PD and PCPS were incubated with (methyl-/sup 3/H)methionine. The mycelia were collected by filtration, frozen in liquid nitrogen and ground to a fine powder. The nitrogen powder was extracted with either phosphate buffer or with SDS, glycerol, phosphate, 2-mercaptoethanol. Insoluble material was removed by centrifugation. The supernatants were assayed for protein methyl esters. The released (/sup 3/H)methanol was extracted into toluene:isoamyl alcohol (3:2) and quantitated by liquid scintillation. The production of volatile methanol was confirmed by use of Conway diffusion cells. Soluble proteins accounted for about one-fourth of the total protein methyl ester extracted by SDS. In PCPS, the SDS extracted proteins have about three times the level of esterification of the soluble proteins whereas in PD there is little difference between soluble and SDS extracted protein. The level of protein esterification in PD is about one-tenth that observed in PCPS. Temperature stress caused large changes in the level of protein esterification. The data suggest protein methyl esters may contribute to the adaptation to environmental stress.

  3. Novel spectrophotometric method for detection and estimation of butanol in acetone-butanol-ethanol fermenter.

    PubMed

    Maiti, Sampa; Sarma, Saurabh Jyoti; Brar, Satinder Kaur; Bihan, Yann Le; Drogui, Patrick; Buelna, Gerardo; Verma, Mausam; Soccol, Carlos Ricardo

    2015-08-15

    A new, simple, rapid and selective spectrophotometric method has been developed for detection and estimation of butanol in fermentation broth. The red colored compound, produced during reduction of diquat-dibromide-monohydrate with 2-mercaptoethanol in aqueous solution at high pH (>13), becomes purple on phase transfer to butanol and gives distinct absorption at λ520nm. Estimation of butanol in the fermentation broth has been performed by salting out extraction (SOE) using saturated K3PO4 solution at high pH (>13) followed by absorbance measurement using diquat reagent. Compatibility and optimization of diquat reagent concentration for detection and estimation of butanol concentration in the fermentation broth range was verified by central composite design. A standard curve was constructed to estimate butanol in acetone-ethanol-butanol (ABE) mixture under optimized conditions. The spectrophotometric results for butanol estimation, was found to have 87.5% concordance with the data from gas chromatographic analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Differential expression of two isolates of beak and feather disease virus capsid protein in Escherichia coli.

    PubMed

    Patterson, Edward I; Swarbrick, Crystall M D; Roman, Noelia; Forwood, Jade K; Raidal, Shane R

    2013-04-01

    Expression of recombinant beak and feather disease virus (BFDV) capsid-associated protein (Cap) has relied on inefficient techniques that typically produce low yields or use specialized expression systems, which greatly increase the cost and expertise required for mass production. An Escherichia coli system was used to express recombinant BFDV Cap derived from two isolates of BFDV, from a Long-billed Corella (Cacatua tenuirostris) and an Orange-bellied parrot (OBP; Neophema chrysogaster). Purification by affinity and size exclusion chromatography was optimized through an iterative process involving screening and modification of buffer constituents and pH. A buffer containing glycerol, β-mercaptoethanol, Triton X-100, and a high concentration of NaCl at pH 8 was used to increase solubility of the protein. The final concentration of the corella-isolated BFDV protein was fifteen- to twenty-fold greater than that produced in previous publications using E. coli expression systems. Immunoassays were used to confirm the specific antigenicity of recombinant Cap, verifying its validity for use in continued experimentation as a potential vaccine, a reagent in diagnostic assays, and as a concentrated sample for biological discoveries.

  5. Preparation of reusable bioreactors using reversible immobilization of enzyme on monolithic porous polymer support with attached gold nanoparticles.

    PubMed

    Lv, Yongqin; Lin, Zhixing; Tan, Tianwei; Svec, Frantisek

    2014-01-01

    Porcine lipase has been reversibly immobilized on a monolithic polymer support containing thiol functionalities prepared within confines of a fused silica capillary and functionalized with gold nanoparticles. Use of gold nanoparticles enabled rejuvenation of the activity of the deactivated reactor simply by stripping the inactive enzyme from the nanoparticles using 2-mercaptoethanol and subsequent immobilization of fresh lipase. This flow through enzymatic reactor was then used to catalyze the hydrolysis of glyceryl tributyrate (tributyrin). The highest activity was found within a temperature range of 37-40°C. The reaction kinetics is characterized by Michaelis-Menten constant, Km  = 10.9 mmol/L, and maximum reaction rate, Vmax  = 5.0 mmol/L min. The maximum reaction rate for the immobilized enzyme is 1,000 times faster compared to lipase in solution. The fast reaction rate enabled to achieve 86.7% conversion of tributyrin in mere 2.5 min and an almost complete conversion in 10 min. The reactor lost only less than 10% of its activity even after continuous pumping through it a solution of substrate equaling 1,760 reactor volumes. Finally, potential application of this enzymatic reactor was demonstrated with the transesterification of triacylglycerides from kitchen oil to fatty acid methyl esters thus demonstrating the ability of the reactor to produce biodiesel. © 2013 Wiley Periodicals, Inc.

  6. Isolation of RNA of high quality and yield from Ginkgo biloba leaves.

    PubMed

    Wang, Tao; Zhang, Nianhui; Du, Lingfang

    2005-05-01

    An improved protocol was developed to isolate total RNA in good yield and integrity from Ginkgo biloba leaves containing high levels of flavonoid glycosides, terpene lactones, carbohydrates and polyphenolic secondary metabolites. Polyvinylpolypyrrolidone at 2% and beta-mercaptoethanol at 4% were added to the standard CTAB extraction buffer and, after chloroform and phenol extraction, the pellet obtained by ethanol/acetate precipitation was washed and a second phenol/chloroform extraction was introduced to remove co-precipitated polysaccharides. Both A(260)/A(230) and A(260)/A(280) absorbancy ratios of isolated RNA were around 2 and the yield was about 0.4 mg g(--1) fresh weight. At least seven distinct rRNA bands were detected by denaturing gel electrophoresis. Sharp hybridization signals were obtained from Northern blots with both nuclear and plastid gene probes. Two gene fragments: nuclear-encoded cab and chloroplast encoded rbcL were successfully amplified by RT-PCR, suggesting the integrity of isolated RNA. The total RNA isolated by this protocol is of sufficient quality for subsequent molecular applications.

  7. Ubiquitination on nonlysine residues by a viral E3 ubiquitin ligase.

    PubMed

    Cadwell, Ken; Coscoy, Laurent

    2005-07-01

    Ubiquitination controls a broad range of cellular functions. The last step of the ubiquitination pathway is regulated by enzyme type 3 (E3) ubiquitin ligases. E3 enzymes are responsible for substrate specificity and catalyze the formation of an isopeptide bond between a lysine residue of the substrate (or the N terminus of the substrate) and ubiquitin. MIR1 and MIR2 are two E3 ubiquitin ligases encoded by Kaposi's sarcoma-associated herpesvirus that mediate the ubiquitination of major histocompatibility complex class I (MHC I) molecules and subsequent internalization. Here, we found that MIR1, but not MIR2, promoted down-regulation of MHC I molecules lacking lysine residues in their intracytoplasmic domain. In the presence of MIR1, these MHC I molecules were ubiquitinated, and their association with ubiquitin was sensitive to beta2-mercaptoethanol, unlike lysine-ubiquitin bonds. This form of ubiquitination required a cysteine residue in the intracytoplasmic tail of MHC I molecules. An MHC I molecule containing a single cysteine residue in an artificial glycine and alanine intracytoplasmic domain was endocytosed and degraded in the presence of MIR1. Thus, ubiquitination can occur on proteins lacking accessible lysines or an accessible N terminus.

  8. Biochemical properties and primary structure of elastase inhibitor AFUEI from Aspergillus fumigatus.

    PubMed

    Okumura, Yoshiyuki; Matsui, Takeshi; Ogawa, Kenji; Uchiya, Kei-ichi; Nikai, Toshiaki

    2008-07-01

    An elastase inhibitor from Aspergillus fumigatus (AFUEI) was isolated, and its biochemical properties and primary structure examined. The inhibitor was purified by column chromatography using DE52 cellulose and Sephadex G-75, and was found to be homogeneous as indicated by a single band following discontinuous PAGE and SDS-PAGE. A molecular mass of 7525.1 Da was observed by matrix-assisted desorption/ionization time-of-flight mass spectroscopy. The elastolytic activity of elastases from A. fumigatus, Aspergillus flavus and human leukocytes was inhibited by AFUEI. However, the elastolytic activity of porcine pancreas elastase, Pseudomonas aeruginosa elastase and elastase from snake venom was not affected by AFUEI. No inhibitory effect of DTT or 2-mercaptoethanol on the elastase inhibitory activity of AFUEI was observed. The amino acid sequence of AFUEI peptides derived from digests utilizing clostripain was determined by Edman sequencing. AFUEI was composed of 68 aa and had a calculated molecular mass of 7526.2 Da. The search for amino acid homology with other proteins demonstrated that aa 1-68 of AFUEI are 100 % identical to aa 20-87 of the hypothetical protein AFUA 3G14940 of A. fumigatus.

  9. Serological survey and risk factors for brucellosis in water buffaloes in the state of Pará, Brazil.

    PubMed

    da Silva, Jenevaldo Barbosa; Rangel, Charles Passos; da Fonseca, Adivaldo Henrique; de Morais, Eziquiel; Vinhote, Wagner Marcelo Souza; da Silva Lima, Danillo Henrique; da Silva e Silva, Natália; Barbosa, José Diomedes

    2014-02-01

    To evaluate the prevalence and possible risk factors for brucellosis caused by Brucella abortus in water buffaloes in the state of Pará, Brazil, 3,917 female buffalo serum samples from pregnant and non-pregnant animals were examined: 2,809 from Marajó Island and 1,108 from the mainland. The buffered acidified plate antigen (BAPA) screening test positively diagnosed 4.8% (188/3,917) of the animals with brucellosis, and the 2-mercaptoethanol (2-ME) confirmatory test affirmed 95.7% (180/188) of the results. The brucellosis prevalence was 4.17 times greater in mainland animals than on Marajó Island, with the highest prevalence in Tailândia (11.30%) and Paragominas (12.38%). Brucellosis seroprevalence was significantly influenced (p < 0.05) by reproductive status, with pregnant females being most vulnerable. These results demonstrate that brucellosis infection is active in the Brazilian region containing the largest buffalo population and that this disease poses a threat to public health and buffalo production in Pará.

  10. Purification and characterization of a serine protease with fibrinolytic activity from Tenodera sinensis (praying mantis).

    PubMed

    Hahn, B S; Cho, S Y; Wu, S J; Chang, I M; Baek, K; Kim, Y C; Kim, Y S

    1999-03-19

    Mantis egg fibrolase (MEF) was purified from the egg cases of Tenodera sinensis using ammonium sulfate fractionation, gel filtration on Bio-Gel P-60 and affinity chromatography on DEAE Affi-Gel blue gel. The protease was assessed homogeneous by SDS-polyacrylamide gel electrophoresis and has a molecular mass of 31500 Da. An isoelectric point of 6.1 was determined by isoelectric focusing. Amino acid sequencing of the N-terminal region established a primary structure composed of Ala-Asp-Val-Val-Gln-Gly-Asp-Ala-Pro-Ser. MEF readily digested the Aalpha- and Bbeta-chains of fibrinogen and more slowly the gamma-chain. The nonspecific action of the enzyme results in extensive hydrolysis of fibrinogen and fibrin releasing a variety of fibrinopeptide. The enzyme is inactivated by Cu2+ and Zn2+ and inhibited by PMSF and chymostatin, yet elastinal, aprotinin, TLCK, TPCK, EDTA, EGTA, cysteine, beta-mercaptoethanol, iodoacetate, E64, benzamidine and soybean trypsin inhibitor do not affect activity. Antiplasmin was not sensitive to MEF but antithrombin III inhibited the enzymatic activity of MEF. Among chromogenic protease substrates, the most sensitive to MEF hydrolysis was benzoyl-Phe-Val-Arg-p-nitroanilide with maximal activity at pH 7.0 and 30 degrees C. MEF preferentially cleaved the oxidized B-chain of insulin between Leu15 and Tyr16. D-Dimer concentrations increased on incubation of cross-linked fibrin with MEF, indicating the enzyme has a strong fibrinolytic activity.

  11. Suicide inactivation of catechol 2,3-dioxygenase from Pseudomonas putida mt-2 by 3-halocatechols

    SciTech Connect

    Bartels, I.; Knackmuss, H.J.; Reineke, W.

    1984-03-01

    The inactivation of catechol 2,3-dioxygenase from Pseudomonas putida mt-2 by 3-chloro- and 3-fluorocatechol and the iron-chelating agent Tiron (catechol-3,5-disulfonate) was studied. Whereas inactivation by Tiron is an oxygen-independent and mostly reversible process, inactivation by the 3-halocatechols was only observed in the presence of oxygen and was largely irreversible. The rate constants for inactivation (K/sub 2/) were 1.62 x 10/sup -3/ sec/sup -1/ for 3-chlorocatechol and 2.38 x 10/sup -3/ sec/sup -1/ for 3-fluorocatechol. The inhibitor constants (K/sub i/) were 23 ..mu..M for 3-chlorocatechol and 17 ..mu..M for 3-fluorocatechol. The kinetic data for 3-fluorocatechol could only be obtained in the presence of 2-mercaptoethanol. Besides inactivated enzyme, some 2-hydroxyhexa-2,4-dienoic acid as the actual suicide product of meta-cleavage. A side product of 3-fluorocatechol cleavage is a yellow compound with the spectral characteristics of a 2-hydroxy-6-oxohexa-2,4-dienoci acid indicating 1,6-cleavage. Rates of inactivation by 3-fluorocatechol were reduced in the presence of superoxide dismutase, catalase, formate, and mannitol, which implies that superoxide anion, hydrogen peroxide, and hydroxyl radical exhibit additional inactivation. 64 references.

  12. Williamson-Hall analysis and optical properties of small sized ZnO nanocrystals

    NASA Astrophysics Data System (ADS)

    Kalita, Amarjyoti; Kalita, Manos P. C.

    2017-08-01

    We apply Williamson-Hall (WH) method of X-ray diffraction (XRD) line profile analysis for lattice strain estimation of small sized ZnO nanocrystals (crystallite size≈4 nm). The ZnO nanocrystals are synthesized by room temperature chemical co-precipitation followed by heating at 40 °C. Zinc acetate, sodium hydroxide and 2-mercaptoethanol (ME) are used for the synthesis of the nanocrystals. {100}, {002}, {101} and {200}, {112}, {201} line profiles in the XRD pattern are significantly merged, therefore determination of the full width at half maximum values and peak positions of the line profiles required for WH analysis has been carried out by executing Rietveld refinement of the XRD pattern. Lattice strain of the 4 nm sized ZnO nanocrystals is found to be 5.8×10-3 which is significantly higher as compared to the literature reported values for larger ones (crystallite size≈17-47 nm). Role of ME as capping agent is confirmed by Fourier transform infrared spectroscopy. The band gap of the nanocrystals is determined from the UV-Visible absorption spectrum and is found to be 3.68 eV. The photoluminescence spectrum exhibits emissions in the visible (408 nm-violet, 467 nm-blue and 538 nm-green) regions showing presence of zinc interstitial and oxygen vacancy in the ZnO nanocrystals.

  13. Effects of redox and sulfhydryl reagents on the bioelectric properties of the giant axon of the squid.

    PubMed

    Huneeus-Cox, F; Fernandez, H L; Smith, B H

    1966-09-01

    The effects of internally and externally applied sulfhydryl reagents on the bioelectric properties of the giant axon of the squid Loligo pealeii and Dosidicus gigas were studied. Cysteine-HCl (400 mM, pH 7.3) was used to remove axoplasm from the perfusion channel. Oxidizing agents (1 to 60 mM) tended to increase the duration of the action potential and had a slow, irreversible blocking effect when perfused internally; the membrane potential was little affected. Reducing agents applied internally caused a decrease in the spike duration without affecting its height or the membrane potential, although at high concentrations there was reversible deterioration of the action potential. Both external and internal perfusion of mercaptide-forming reagents caused deterioration in the action and membrane potentials with conduction block occurring in 5 to 45 min. 2-mercaptoethanol reversed the effects. Thiol alkylating reagents, iodoacetate and iodoacetamide, were without effect. N-ethylmaleimide did, however, block. Tests with chelating agents for nonheme iron in the membrane brought about no change in the electrical parameters. The implications of the present findings with regard to the macromolecular mechanism of excitation are discussed.

  14. Localization of Rh1(D), 2(C), 3(E), 4(c), 5(e) and 25(LW) antigens of human Rh blood groups in fetal erythrocyte membranes.

    PubMed

    Fukushima, H; Segawa, M; Ota, M; Yonemura, I; Hiraide, K; Hasekura, H

    1987-01-01

    The fetal erythrocyte membranes were partially solubilized with Triton X-100 at the low concentration (0.5%). The localizations of Rh1(D), 2(C), 3(E), 4(c), 5(e) and 25(LW) were investigated. Using hemagglutination inhibition assay, Rh1(D) antigen activity was observed in the Triton-treated membrane (Triton shell) containing mainly band 1, 2 (spectrin), band 5 (actin), band 4.1 and a part of band 3, while Rh2(C), 3(E), 4(c), 5(e) and 25(LW) antigens were detected in the supernatant containing band 3, 6, 2.2, 2.3 and 4.2. It is suggested that: Rh1(D) antigen would associate with cytoskeleton matrix of fetal erythrocyte membranes; Rh1(D) and Rh25(LW) antigens might be integral membrane proteins, while Rh2(C), 3(E), 4(c) and 5(e) antigens would be surface membrane proteins which are easily released from membranes by EDTA, mercaptoethanol and alkaline treatments.

  15. Dielectric relaxation of CdSe nanoparticles

    NASA Astrophysics Data System (ADS)

    Das, Sayantani; Dutta, Alo; Ghosh, Binita; Banerjee, Sourish; Sinha, T. P.

    2014-11-01

    Nanoparticles of cadmium selenide (CdSe) have been synthesized by soft chemical route using mercaptoethanol as a capping agent. X-ray diffraction and transmission electron microscope measurements show that the prepared sample belongs to sphalerite structure with the average particle size of 25 nm. The band gap of the material is found to be 2.1 eV. The photoluminescence (PL) emission spectra of the sample are measured at various excitation wavelengths. The PL spectra appear in the visible region, and the emission feature depends on the wavelength of the excitation. Impedance spectroscopy is applied to investigate the dielectric relaxation of the sample in a temperature range from 323 to 473 K and in a frequency range from 42 Hz to 1.1 MHz. The complex impedance plane plot has been analyzed by an equivalent circuit consisting of two serially connected R-CPE units, each containing a resistance (R) and a constant phase element (CPE). The dielectric relaxation of the sample is investigated in the electric modulus formalism. The temperature dependent relaxation times obey the Arrhenius law. The Havriliak-Negami model is used to investigate the dielectric relaxation mechanism in the sample. The frequency dependent conductivity spectra are found to obey the power law.

  16. Screening for stress-resistance mutations in the mouse

    PubMed Central

    Chick, Wallace S.; Ludwig, Michael; Zhao, Xiaoyun; Kitzenberg, David; Williams, Kristina; Johnson, Thomas E.

    2014-01-01

    Longevity is correlated with stress resistance in many animal models. However, previous efforts through the boosting of the antioxidant defense system did not extend life span, suggesting that longevity related stress resistance is mediated by other uncharacterized pathways. We have developed a high-throughput platform for screening and rapid identification of novel genetic mutants in the mouse that are stress resistant. Selection for resistance to stressors occurs in mutagenized mouse embryonic stem (ES) cells, which are carefully treated so as to maintain pluripotency for mouse production. Initial characterization of these mutant ES cells revealed mutations in Pigl, Tiam1, and Rffl, among others. These genes are implicated in glycosylphosphatidylinositol biosynthesis, NADPH oxidase function, and inflammation. These mutants: (1) are resistant to two different oxidative stressors, paraquat and the omission of 2-mercaptoethanol, (2) have reduced levels of endogenous reactive oxygen species (ROS), (3) are capable of generating live mice, and (4) transmit the stress resistance phenotype to the mice. This strategy offers an efficient way to select for new mutants expressing a stress resistance phenotype, to rapidly identify the causative genes, and to develop mice for in vivo studies. PMID:25250048

  17. Human anti-immunoglobulin antibodies with specificity for native and pepsin-digested IgD

    PubMed Central

    Mellbye, O. J.; Høyeraal, H. M.; Michaelsen, T.; Natvig, J. B.

    1975-01-01

    When human sera were tested against red cells coated with IgD by the CrCl3 technique, agglutinating activity was found in a high proportion of sera from patients with systemic lupus erythematosus and rheumatoid arthritis, while sera from normals and patients with non-rheumatoid diseases contained only trace activity. Haemagglutination inhibition experiments indicated that the activity was directed against the Fc part of IgD, and reduction with 2-mercaptoethanol, sucrose density gradient ultracentrifugation, and absorption experiments all indicated that the agglutinating activity was due to IgM antibodies. In some sera a very weak activity was also found against antigens revealed by pepsin digestion of IgD. After density gradient ultracentrifugation of sera at pH 3·0, the 19S fractions showed higher antibody activity against IgD than fractions obtained at pH 7·2, indicating that the sera contained complexes of IgD and anti-IgD. Agglutination inhibition experiments with different IgD myeloma proteins or whole myeloma sera did not give evidence for subclasses or genetic polymorphism of IgD.

  18. Purification and Characterization of Colicin D

    PubMed Central

    Timmis, K.

    1972-01-01

    Colicin D-CA23, obtained by sonic treatment of mitomycin C-induced cells of Escherichia coli K-12 W1485 (colD), was purified by ammonium sulfate precipitation, gel filtration on Sephadex G200, ion-exchange chromatography on diethylaminoethyl cellulose, and isoelectrofocusing. Polyacrylamide-gel electrophoresis, sedimentation velocity analysis, and antigenic analysis indicated that the preparation was homogeneous. Colicin D is composed entirely of amino acids and hence is a simple protein uncomplexed with lipid or lipopolysaccharide. It contains six residues of cysteine per molecule. The molecular weight of colicin D is approximately 92,000, as determined by sodium dodecyl sulfate-polyacrylamide-gel electrophoresis and gel filtration on Sephadex G200. Its sedimentation coefficient is 4.41S. The behavior of colicin D in solutions of sodium dodecyl sulfate and 2-mercaptoethanol indicates that it does not consist of subunits and exists as a single polypeptide chain. Its high molecular weight and presence of six cysteine residues per molecule distinguish colicin D from all colicins previously described. Although colicins D and E3 have similar modes of action, their gross molecular properties are entirely different. Images PMID:4621624

  19. Purification and characterization of a serine protease (CPM-2) with fibrinolytic activity from the dung beetles.

    PubMed

    Ahn, Mi Young; Hahn, Bum-Soo; Ryu, Kang Sun; Hwang, Jae Sam; Kim, Yeong Shik

    2005-07-01

    Catharsius protease-2 (CPM-2) was isolated from the body of dung beetles, Catharsius molossus, using a three step purification process (ammonium sulfate fractionation, gel filtration on Bio-Gel P-60, and affinity chromatography on DEAE Affi-Gel blue). The purified CPM-2, having a molecular weight of 24 kDa, was assessed homogeneously by SDS-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of CPM-2 was composed of X Val Gln Asp Phe Val Glu Glu Ile Leu. CPM-2 was inactivated by Cu2+ and Zn2+ and strongly inhibited by typical serine proteinase inhibitors such as TLCK, soybean trypsin inhibitor, aprotinin, benzamidine, and alpha1-antitrypsin. However, EDTA, EGTA, cysteine, beta-mercaptoethanol, E64, and elastatinal had little effect on enzyme activity. In addition, antiplasmin and antithrombin III were not sensitive to CPM-2. Based on the results of a fibrinolytic activity test, CPM-2 readily cleaved Aalpha- and Bbeta-chains of fibrinogen and fibrin, and gamma-chain of fibrinogen more slowly. The nonspecific action of the enzyme resulted in extensive hydrolysis, releasing a variety of fibrinopeptides of fibrinogen and fibrin. Polyclonal antibodies of CPM-2 were reactive to the native form of antigen. The ELISA was applied to detect quantities, in nanograms, of the antigen in CPM-2 protein.

  20. THE EVOLUTION OF THE IMMUNE RESPONSE. 3. IMMUNOLOGIC RESPONSES IN THE LAMPREY.

    PubMed

    FINSTAD, J; GOOD, R A

    1964-12-01

    1. Studies of the immune response have been carried out in more than 1700 lampreys representing three stages in the life cycle of these animals. 2. Lampreys used in this study were unable to clear certain soluble protein antigens and bacteriophage and were unable to make antibodies to these antigens. Hemocyanin was cleared from the circulation. 3. The immune responses demonstrated in lampreys include the production of specific antibody to killed Brucella cells, the rejection of skin homografts, and the development of a delayed allergic response to old tuberculin. 4. A responsive proliferation of lymphoid cells occurred in the protovertebral arch following antigen-adjuvant stimulation. 5. Electrophoretic and immunoelectrophoretic analysis of lamprey serum revealed gamma globulin. Ultracentrifugal analysis of serum revealed proteins with sedimentation coefficients of 17S, 8S, 7S, and 3S. 6. The antibodies thus far observed in the lamprey are of relatively high molecular weight and destroyed by 2-mercaptoethanol. 7. In the lamprey it would appear that there is reflected the coordinate evolution of a primitive thymus, primitive spleen containing lymphoid foci, a family of lymphocytes in the peripheral blood and capacity for gamma globulin synthesis and expression of adaptive immunity.

  1. THE EVOLUTION OF THE IMMUNE RESPONSE

    PubMed Central

    Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. Studies of the immune response have been carried out in more than 1700 lampreys representing three stages in the life cycle of these animals. 2. Lampreys used in this study were unable to clear certain soluble protein antigens and bacteriophage and were unable to make antibodies to these antigens. Hemocyanin was cleared from the circulation. 3. The immune responses demonstrated in lampreys include the production of specific antibody to killed Brucella cells, the rejection of skin homografts, and the development of a delayed allergic response to old tuberculin. 4. A responsive proliferation of lymphoid cells occurred in the protovertebral arch following antigen-adjuvant stimulation. 5. Electrophoretic and immunoelectrophoretic analysis of lamprey serum revealed gamma globulin. Ultracentrifugal analysis of serum revealed proteins with sedimentation coefficients of 17S, 8S, 7S, and 3S. 6. The antibodies thus far observed in the lamprey are of relatively high molecular weight and destroyed by 2-mercaptoethanol. 7. In the lamprey it would appear that there is reflected the coordinate evolution of a primitive thymus, primitive spleen containing lymphoid foci, a family of lymphocytes in the peripheral blood and capacity for gamma globulin synthesis and expression of adaptive immunity. PMID:14238932

  2. Energy-dependent arsenate efflux: the mechanism of plasmid-mediated resistance.

    PubMed Central

    Silver, S; Keach, D

    1982-01-01

    Plasmid-mediated resistance to arsenate, arsenite, and antimony(III) is coordinately induced by arsenate, arsenite, antimony(III), and bismuth(III). Resistance to arsenate was recently shown [Silver, S., Budd, K., Leahy, K.M., Shaw, W.V., Hammond, D., Novick, R.P., Willsky, G.R., Malamy, M.H. & Rosenberg, H. (1981) J. Bacteriol. 146, 983-996] to be due to decreased accumulation of arsenate by the induced resistant cells. We report here that decreased net uptake results from accelerated efflux of arsenate by induced plasmid-containing cells of Staphylococcus aureus and Escherichia coli. The efflux system in S. aureus was inhibited by nigericin, monensin, and proton-mobilizing uncouplers; efflux was unaffected by valinomycin. The mechanism of arsenate efflux in S. aureus was apparently not by chemiosmotic coupling to the membrane electrical potential or pH gradient. The intracellular efflux system was inhibited by low pH and mercurials (reversible by mercaptoethanol). The efflux rate was relatively independent of external pH or phosphate level and showed a sigmoidal pattern of concentration dependence. PMID:6755462

  3. Effects of sulphydryl reagents on the structure of dehistonized metaphase chromosomes.

    PubMed

    Jeppesen, P; Morten, H

    1985-02-01

    Dehistonized metaphase chromosomes lose their apparent axial organization (the 'scaffold') and sediment more slowly following exposure to beta-mercaptoethanol (BME). We have subsequently treated BME chromosomes with reagents that oxidize protein sulphydryls to disulphides, and found that if calcium is also present during the oxidation an apparently similar axial structure is restored following dehistonization, as seen by microscopic examination. In general, however, we do not find that oxidation restores the higher sedimentation rate of dehistonized control chromosomes. Analysis of residual core protein in dehistonized chromosomes by sodium dodecyl sulphate/polyacrylamide gel electrophoresis fails to detect any differences in polypeptide composition related to the state of oxidation or to the presence or absence of visible axial organization. Combining our results with those of other workers, we conclude that the axial structure evident in dehistonized metaphase chromosomes is maintained, at least partially, by inter-protein cross-linking, although in vivo this may not be via simple disulphide bridges. Additional factors, which we have not yet characterized, but which possibly include heavy metal ions, appear to be involved in the axial organization existing in vivo.

  4. Role of disulfide bridges in the activity and stability of a cold-active alpha-amylase.

    PubMed

    Siddiqui, Khawar Sohail; Poljak, Anne; Guilhaus, Michael; Feller, Georges; D'Amico, Salvino; Gerday, Charles; Cavicchioli, Ricardo

    2005-09-01

    The cold-adapted alpha-amylase from Pseudoalteromonas haloplanktis unfolds reversibly and cooperatively according to a two-state mechanism at 30 degrees C and unfolds reversibly and sequentially with two transitions at temperatures below 12 degrees C. To examine the role of the four disulfide bridges in activity and conformational stability of the enzyme, the eight cysteine residues were reduced with beta-mercaptoethanol or chemically modified using iodoacetamide or iodoacetic acid. Matrix-assisted laser desorption-time of flight mass spectrometry analysis confirmed that all of the cysteines were modified. The iodoacetamide-modified enzyme reversibly folded/unfolded and retained approximately one-third of its activity. Removal of all disulfide bonds resulted in stabilization of the least stable region of the enzyme (including the active site), with a concomitant decrease in activity (increase in activation enthalpy). Disulfide bond removal had a greater impact on enzyme activity than on stability (particularly the active-site region). The functional role of the disulfide bridges appears to be to prevent the active site from developing ionic interactions. Overall, the study demonstrated that none of the four disulfide bonds are important in stabilizing the native structure of enzyme, and instead, they appear to promote a localized destabilization to preserve activity.

  5. Influence of co-culture with denuded oocytes during in vitro maturation on fertilization and developmental competence of cumulus-enclosed porcine oocytes in a defined system.

    PubMed

    Appeltant, Ruth; Somfai, Tamás; Kikuchi, Kazuhiro; Maes, Dominiek; Van Soom, Ann

    2016-04-01

    Co-culture of cumulus-oocyte complexes (COCs) with denuded oocytes (DOs) during in vitro maturation (IVM) was reported to improve the developmental competence of oocytes via oocyte-secreted factors in cattle. The aim of the present study was to investigate if addition of DOs during IVM can improve in vitro fertilization (IVF) and in vitro culture (IVC) results for oocytes in a defined in vitro production system in pigs. The maturation medium was porcine oocyte medium supplemented with gonadotropins, dbcAMP and β-mercaptoethanol. Cumulus-oocyte complexes were matured without DOs or with DOs in different ratios (9 COC, 9 COC+16 DO and 9 COC+36 DO). Consequently; oocytes were subjected to IVF as intact COCs or after denudation to examine if DO addition during IVM would affect cumulus or oocyte properties. After fertilization, penetration and normal fertilization rates of zygotes were not different between all tested groups irrespective of denudation before IVF. When zygotes were cultured for 6 days, no difference could be observed between all treatment groups in cleavage rate, blastocyst rate and cell number per blastocyst. In conclusion, irrespective of the ratio, co-culture with DOs during IVM did not improve fertilization parameters and embryo development of cumulus-enclosed porcine oocytes in a defined system.

  6. A new post-column reactor-laser induced fluorescence detector for capillary electrophoresis

    SciTech Connect

    Liling, Zhang

    1996-01-02

    Capillary zone electrophoresis (CZE), a powerful separation method based on the differential migration of charged species under the influence of an electric field, has been widely used for separations covering from small ions to big biomolecules. Chapter 1 describes the method, then discusses detection of the separated analytes by laser induced fluorescence and by chemical derivatization, and the use of O-phthaldialdehyde (OPA) as a post-column reagent. Chapter 2 describes a post-column reactor which uses two narrow bore capillaries connected coaxially. This reactor differs from other coaxial reactors in terms of capillary dimensions, reagent flow control, ease of construction and most importantly, better limits of detection. The derivatization reagent is electroosmotically driven into the reaction capillary and the reagent flow rate is independently controlled by a high voltage power supply. Amino acids, amines and proteins, derivatized by OPA/2-mercaptoethanol using this post-column reactor coupled with LIF detection, show low attomole mass limits of detection, and for the first time, the authors demonstrate single cell capability with a post-column derivatization scheme. The single cell capability shows that this reactor could find applications in assaying non-fluorescent or electrochemically inactive components in individual biological cells in the future.

  7. Purification and characterization of polyphenol oxidase from nettle (Urtica dioica L.) and inhibitory effects of some chemicals on enzyme activity.

    PubMed

    Güllçin, Ilhami; Küfrevioğlu, O Irfan; Oktay, Münir

    2005-06-01

    Polyphenol oxidase (PPO) of nettle (Urtica dioica L.) was extracted and purified through (NH4)2SO4 precipitation, dialysis, and CM-Sephadex ion-exchange chromatography and was used for its characterization. The PPO showed activity to catechol, 4-methylcatechol, L-3,4-dihydroxyphenylalanine (L-DOPA), L-tyrosine, p-cresol, pyrogallol, catechin and trans-cinnamic acid. For each of these eight substrates, optimum conditions such as pH and temperature were determined and L-tyrosine was found to be one of the most suitable substrates. Optimum pH and temperature were found at pH 4.5 and 30 degrees C respectively and Km and Vmax values were 7.90 x 10(-4) M, and 11290 EU/mL for with L-tyrosine as substrate. The inhibitory effect of several inhibitors, L-cysteine chloride, sodium azide, sodium cyanide, benzoic acid, salicylic acid, L-ascorbic acid, glutathione, thiourea, sodium diethyl dithiocarbamate, beta-mercaptoethanol and sodium metabisulfite were tested. The most effective was found to be sodium diethyl dithiocarbamate which acted as a competitive inhibitor with a Ki value of 1.79 x 10(-9)M. In addition one isoenzyme of PPO was detected by native polacrylamide slab gel electrophoresis.

  8. Evaluation of silica- and sepharose-based immunoaffinity sorbents for sample cleanup in determination of fumonisins B1 and B2 in corn products.

    PubMed

    Lawrence, J F; Menard, C; Yeung, J; Rejeb, S B

    2000-01-01

    Anti-fumonisin B1 polyclonal antibodies were isolated from the serum of rabbits, immobilized onto the surface of glutaraldehyde-activated silica or Sepharose CL-4B particles, and placed into empty small plastic solid-phase extraction cartridges. The immobilized antibodies were evaluated for their ability to retain fumonisin B1 and fumonisin B2. Cartridge capacity and elution conditions were determined, and the results were compared to those obtained with a commercially available cartridge. The cartridges, which were tested for their effectiveness to isolate the fumonisins from extracts of corn flour and nacho chips, detected fumonisins down to levels of about 20 ng/g. However, additional cleanup was required for detection at lower concentrations. With the use of a strong anion-exchange cartridge as a preliminary cleanup before immunoaffinity chromatography, the detection limit reached 2-5 ng/g in the products tested. The silica sorbent material exhibited strong interactions with the fumonisins, requiring acidified ethanol-water mixtures for elution and resulting in an additional degree of selectivity in isolating fumonisins from sample extracts. The silica-based immunoaffinity cartridges were successfully reused more than 10 times; the Sepharose-based cartridges were less robust. Liquid chromatography with fluorescence detection was used after prechromatographic derivatization with o-phthaldialdehyde-mercaptoethanol.

  9. Strong Keratin-like Nanofibers Made of Globular Protein

    NASA Astrophysics Data System (ADS)

    Dror, Yael; Makarov, Vadim; Admon, Arie; Zussman, Eyal

    2008-03-01

    Protein fibers as elementary structural and functional elements in nature inspire the engineering of protein-based products for versatile bio-medical applications. We have recently used the electrospinning process to fabricate strong sub-micron fibers made solely of serum albumin (SA). This raises the challenges of turning a globular non-viscous protein solution into a polymer--like spinnable solution and producing keratin-like fibers enriched in inter S-S bridges. A stable spinning process was achieved by using SA solution in a rich trifluoroethanol-water mixture with β-mercaptoethanol. The breakage of the intra disulfide bridges, as identified by mass spectrometry, together with the denaturing alcohol, enabled a pronounced expansion of the protein. This in turn, affects the rheological properties of the solution. X-ray diffraction pattern of the fibers revealed equatorial orientation, indicating the alignment of structures along the fiber axis. The mechanical properties reached remarkable average values (Young's modulus of 1.6GPa, and max stress of 36MPa) as compared to other fibrous protein nanofibers. These significant results are attributed to both the alignment and inter disulfide bonds (cross linking) that were formed by spontaneous post-spinning oxidation.

  10. Characterization of a Thermostable d-Stereospecific Alanine Amidase from Brevibacillus borstelensis BCS-1

    PubMed Central

    Baek, Dae Heoun; Kwon, Seok-Joon; Hong, Seung-Pyo; Kwak, Mi-Sun; Lee, Mi-Hwa; Song, Jae Jun; Lee, Seung-Goo; Yoon, Ki-Hong; Sung, Moon-Hee

    2003-01-01

    A gene encoding a new thermostable d-stereospecific alanine amidase from the thermophile Brevibacillus borstelensis BCS-1 was cloned and sequenced. The molecular mass of the purified enzyme was estimated to be 199 kDa after gel filtration chromatography and about 30 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, indicating that the enzyme could be composed of a hexamer with identical subunits. The purified enzyme exhibited strong amidase activity towards d-amino acid-containing aromatic, aliphatic, and branched amino acid amides yet exhibited no enzyme activity towards l-amino acid amides, d-amino acid-containing peptides, and NH2-terminally protected amino acid amides. The optimum temperature and pH for the enzyme activity were 85°C and 9.0, respectively. The enzyme remained stable within a broad pH range from 7.0 to 10.0. The enzyme was inhibited by dithiothreitol, 2-mercaptoethanol, and EDTA yet was strongly activated by Co2+ and Mn2+. The kcat/Km for d-alaninamide was measured as 544.4 ± 5.5 mM−1 min−1 at 50°C with 1 mM Co2+. PMID:12571020

  11. Determination of ammonium ion by fluorometry or spectrophotometry after on-line derivatization with o-phthalaldehyde

    NASA Technical Reports Server (NTRS)

    Goyal, S. S.; Rains, D. W.; Huffaker, R. C.

    1988-01-01

    A fast, sensitive, simple, and highly reproducible method for routine assay of ammonium ion (NH4+) was developed by using HPLC equipment. The method is based on the reaction of NH4+ with o-phthalaldehyde (OPA) in the presence of 2-mercaptoethanol. After an on-line derivatization, the resulting NH4(+)-OPA product was quantified by using fluorometric or spectrophotometric detection. For fluorometric detection, the excitation and emission wavelengths were 410 and 470 nm, respectively. The spectrophotometric detection was made by measuring absorbance at 410 nm. Results on the effects of OPA-reagent composition and pH, reaction temperature, sample matrix, and linearity of the assay are presented. Even though it took about 2 min from the time of sample injection to the appearance of sample peak, sample injections could be overlapped at an interval of about 1 min. Thus, the actual time needed for analysis was about 1 min per assay. The method can be used in a fully automated mode by using an autosampler injector.

  12. Carbon Nanodots-Based Fluorescent Turn-On Sensor Array for Biothiols.

    PubMed

    Wu, Yapei; Liu, Xue; Wu, Qiuhua; Yi, Jie; Zhang, Guolin

    2017-07-05

    Biothiols play important roles in biological processes. In this study, a novel sensor array-based method was proposed to detect and differentiate biothiols. The sensor array was constructed using three kinds of Ag(+)-sensitive carbon nanodots (CDs). The CDs were synthesized with amino acids and urea as carbon sources via a simple microwave method. Results revealed that Ag(+) can bind with CDs and depress the fluorescence of CDs, while the subsequently joined biothiols can take Ag(+) away from CDs and recover the fluorescence of CDs. Due to the different binding ability between Ag(+) and various CDs, as well as Ag(+) and various biothiols, the CD-Ag(+) array exhibits a unique pattern of fluorescence variations when interacting with six biothiol samples (cysteamine, dithiothreitol, mercaptosuccinic acid, glutathione, mercaptoacetic acid, and mercaptoethanol). Principal component analysis (PCA) was applied to analyze the pattern and generate a clustering map for a clearer identification of these biothiols. PCA can also be employed to simplify the established three-sensor array into a two-sensor array. Both the three- and two-sensor arrays can identify these biothiols in a wide biothiol concentration range (>10 μM).

  13. A radiolabeled antiglobulin assay to identify human cervical mucus immunoglobulin (Ig) A and IgG antisperm antibodies

    SciTech Connect

    Haas, G.G. Jr.; D'Cruz, O.J. )

    1989-09-01

    Antisperm immunoglobulin (Ig) A and IgG antibodies in human cervical mucus (CM) were identified by a radiolabeled antiglobulin assay. Cervical mucus samples from fertile and infertile women were exposed to a 1:3,200 dilution of 2-mercaptoethanol (2-ME), and 5 micrograms of the solubilized CM protein were assayed for the presence of IgA and IgG antisperm and anti-Candida activity by the radiolabeled antiglobulin assay. Purified human secretory IgA and IgG exposed to 2-ME retained the molecular integrity and functional activity of the untreated antibody molecules. CM aliquots collected after high-performance liquid chromatography (HPLC) fractionation were assessed for antisperm antibody activity; antisperm antibody activity was retained in the appropriate IgA or IgG CM fractions. The incidence of CM antisperm antibodies was minimally affected when the radiolabeled antiglobulin assay was performed with a motile sperm population. Approximately 70% of the CM IgA antisperm antibodies were of the IgA1 subclass; CM IgG was primarily of the IgG4 subclass. When Candida antigen was substituted for sperm in the radiolabeled antiglobulin assay, the CM antisperm antibodies were found to be exclusively sperm-specific. These data indicate that the radiolabeled antiglobulin assay using 2-ME to extract CM antibodies is a specific method for the assay of antisperm antibodies in CM.

  14. Purification and characterization of keratinase from a new Bacillus subtilis strain

    PubMed Central

    Cai, Cheng-gang; Chen, Ji-shuang; Qi, Jiong-jiong; Yin, Yun; Zheng, Xiao-dong

    2008-01-01

    The aim of this study was to purify and characterize a keratinase produced by a new isolated Bacillus subtilis KD-N2 strain. The keratinase produced by the isolate was purified using ammonium sulphate precipitation, Sephadex G-75 and DEAE (diethylaminoethyl)-Sepharose chromatographic techniques. The purified enzyme was shown to have a molecular mass of 30.5 kDa, as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The optimum pH at 50 °C was 8.5 and the optimum temperature at pH 8.5 was 55 °C. The keratinase was partially inactivated by some metal ions, organic solvents and serine protease inhibitor phenylmethanesulfonyl fluoride (PMSF). Sodium dodecyl sulfate (SDS) and ethylene diamine tetraacetic acid (EDTA) had positive effect on the keratinase activity. Reducing agents including dithiothreitol (DTT), mercaptoethanol, L-cysteine, sodium sulphite, as well as chemicals of SDS, ammonium sulfamate and dimethylsulfoxide (DMSO) stimulated the enzyme activity upon a feather meal substrate. Besides feather keratin, the enzyme is active upon the soluble proteins ovalbumin, bovine serum albumin (BSA), casein and insoluble ones as sheep wool and human hair. Calf hair, silk and collagen could not be hydrolyzed by the keratinase. PMID:18763304

  15. Characterization of factor XII Tenri, a rare CRM-negative factor XII deficiency.

    PubMed

    Fujihara, Noriko; Tozuka, Minoru; Yamauchi, Kazuyoshi; Ueno, Ichiro; Urasawa, Nobuyuki; Ishikawa, Shinsuke; Hirota-Kawadobora, Masako; Okumura, Nobuo; Hidaka, Hiroya; Katsuyama, Tsutomu

    2004-01-01

    Factor XII Tenri (Y34C), a rare cross-reacting material (CRM)-negative factor XII deficiency, was identified in a 71-yr-old Japanese woman with angina pectoris. In the patient's plasma, factor XII activity and antigen levels were only 1.6% and 5.0%, respectively, of those seen in a normal subject. Immunoblot analysis showed that the secreted factor XII Tenri existed not only as a monomer (76 kDa), but also in complexes with apparent molecular weights of approximately 115, 140, 190, 215, and 225 kDa. After reduction with 2-mercaptoethanol, the factor XII Tenri contained in the complexes was completely converted to monomeric form on immunoblot patterns. It appeared that some of the secreted factor XII Tenri formed several types of disulfide-linked complexes, including a factor XII-alpha1-microglobulin complex, through a newly generated Cys residue. The monomeric form of factor XII Tenri, like normal factor XII, was degraded into 2 major fragments with molecular weights of approximately 45 kDa and 30 kDa following mixing with activated partial-thromboplastin-time measuring reagent (cephalin and ellagic acid), whereas the factor XII Tenri that formed the complexes was not. This indicates that the factor XII Tenri present in disulfide-linked complexes with other proteins (and itself) is not converted to active forms, suggesting that attached proteins obstruct or delay the activation of factor XII via an inhibition of its binding to a negatively charged surface in vitro.

  16. High-performance pure and Fe3+-ion doped ZnS quantum dots as green nanophotocatalysts for the removal of malachite green under UV-light irradiation.

    PubMed

    Rajabi, Hamid Reza; Khani, Omid; Shamsipur, Mojtaba; Vatanpour, Vahid

    2013-04-15

    The heterogeneous photocatalysis using UV-radiation and quantum dots (QDs) is an interesting method for the treatment of water polluted with the organic substances. In this study, ZnS QDs, as a pure and doped with Fe(3+), were prepared for photodecolorization of malachite green (MG) as a model dye. The synthesis of QDs was carried out using a chemical precipitation method in aqueous solution, in the presence of 2-mercaptoethanol as a capping agent. The XRD patterns indicated that the doped nanoparticles are crystalline, with cubic zinc blend structure. The effects of dopant content, pH, nanophotocatalyst amount, irradiation time, and initial dye concentration on the removal efficiency of MG were studied. Results showed that the QDs presented high MG decolorization efficiency, and doping with Fe(3+) promoted the dye removal. The maximum removal of dyes was obtained at 80 mg/L of photocatalyst as an optimum value for the dosage of photocatalyst in pH of 8.0. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Suppression of hepatitis C virus replication by cyclosporin a is mediated by blockade of cyclophilins.

    PubMed

    Nakagawa, Mina; Sakamoto, Naoya; Tanabe, Yoko; Koyama, Tomoyuki; Itsui, Yasuhiro; Takeda, Yoshie; Chen, Cheng-Hsin; Kakinuma, Sei; Oooka, Shinya; Maekawa, Shinya; Enomoto, Nobuyuki; Watanabe, Mamoru

    2005-09-01

    Cyclosporin A specifically suppresses hepatitis C virus (HCV) replication in vitro at clinically achievable concentrations. In this study, we investigated the mechanisms of action of cyclosporin A against HCV replication. The in vitro effects of cyclosporin A on HCV replication were analyzed using an HCV replicon system that expresses chimeric luciferase reporter protein. The significant effects of cyclosporin A on expression of an HCV replicon and the absence of such effects of FK506, which shares mechanisms of action with cyclosporin A, suggested the involvement of intracellular ligands of cyclosporin A, the cyclophilins. Transient and stable knockdown of the expression of cytoplasmic cyclophilins A, B, and C by short hairpin RNA-expressing vectors suppressed HCV replication significantly. A cyclosporin analogue, cyclosporin D, which lacks immunosuppressive activity but exhibits cyclophilin binding, induced a similar suppression of HCV replication. Furthermore, cyclosporin A treatment of Huh7 cells induced an unfolded protein response exemplified by expression of cellular BiP/GRP78. Treatment of cells with thapsigargin and mercaptoethanol, which induce the unfolded protein responses, suppressed HCV replication, suggesting that the cyclosporin-induced unfolded protein responses might contribute to the suppression of HCV protein processing and replication. The anti-HCV activity of cyclosporin A is mediated through a specific blockade of cyclophilins, and these molecules may constitute novel targets for anti-HCV therapeutics.

  18. Modulation of brain opioid receptors by zinc and histidine

    SciTech Connect

    Hanissian, S.H.

    1988-01-01

    The effect of zinc and several trace elements was studied on the binding of the opioid receptor antagonist ({sup 3}H)-naloxone and the agonists ({sup 3}H)-DAGO, ({sup 3}H)-DSTLE, and ({sup 3}H)-EKC, specific for the mu, delta and kappa receptors, respectively, in several areas of the rat brain. Physiological concentrations of zinc were inhibitory to the binding of naloxone, DAGO, and EKC, whereas delta receptors were insensitive to this inhibition. Copper, cadmium, and mercury also inhibited the binding of all the ligands studied to their receptors. Histidine was most effective in preventing the inhibitory effects of zinc and copper, whereas it was less effective on cadmium, and without any effect on the inhibit was less effective on cadmium, and without any effect on the inhibition caused by mercury. Its metabolites histamine and imidazoleacetic acid, and also citrate were ineffective. Magnesium and manganese were stimulatory to opioid receptor binding, whereas cobalt and nickel had dual effects. Concentrations of zinc less that its IC{sub 50} totally prevented the stimulatory effects of magnesium and manganese on the mu and delta receptors on which zinc alone had no effects. The reducing reagents dithiothreitol and B-mercaptoethanol partially protected against zinc inhibition, and the oxidizing reagent dithiobisnitrobenzoic acid even potentiated the inhibitory effects of zinc on DSTLE and DAGO binding, although to different extents.

  19. Production, characterization and antioxidant potential of protease from Streptomyces sp. MAB18 using poultry wastes.

    PubMed

    Manivasagan, Panchanathan; Venkatesan, Jayachandran; Sivakumar, Kannan; Kim, Se-Kwon

    2013-01-01

    Poultry waste is an abundant renewable source for the recovery of several value-added metabolites with potential industrial applications. This study describes the production of protease on poultry waste, with the subsequent use of the same poultry waste for the extraction of antioxidants. An extracellular protease-producing strain was isolated from Cuddalore coast, India, and identified as Streptomyces sp. MAB18. Its protease was purified 17.13-fold with 21.62% yield with a specific activity of 2398.36 U/mg and the molecular weight was estimated as 43 kDa. The enzyme was optimally active at pH 8-10 and temperature 50-60 ° C and it was most stable up to pH 12 and 6-12% of NaCl concentration. The enzyme activity was reduced when treated with Hg(2+), Pb(2+), and SDS and stimulated by Fe(2+), Mg(2+), Triton X-100, DMSO (dimethyl sulfoxide), sodium sulphite, and β-mercaptoethanol. Furthermore, the antioxidant activities of protease were evaluated using in vitro antioxidant assays, such as DPPH radical-scavenging activity, O2 scavenging activity, NO scavenging activity, Fe(2+) chelating activity, and reducing power. The enzyme showed important antioxidant potential with an IC50 value of 78 ± 0.28 mg/mL. Results of the present study indicate that the poultry waste-derived protease may be useful as supplementary protein and antioxidant in the animal feed formulations.

  20. [Biochemistry of the growth cycle of Triatoma infestans (Vinchuca). VIII. Preliminary study of hemo-lymphatic apolipoproteins in the adult male].

    PubMed

    Fichera, L E; Brenner, R R

    1985-01-01

    The three lipoproteins of high (HDL) and very high density (VHDL-I and VHDL-II) were separated from the hemolymph of adult males of T. infestans. They were delipidated and the corresponding apolipoproteins examined by sodium dodecyl sulphate (SDS) gel electrophoresis in polyacrylamide in the presence of 2-mercaptoethanol. They were also iso-electro focused in a pH gradient of 5 to 8. All three groups of apolipoproteins were separated in several polypeptide chains, but all of them had in common a glycoproteic unit of PM 86 000. The VHDL-II presented the simplest composition with predominance of the 86 000 band. Apo-HDL was the most complicated and showed intense bands of PM as high as 210 000 and as low as 17 000 together with 44 000 and 86 000 and less intense bands. The apo-VHDL-I was separated in polypeptides chains in the range of 86 000 to 17 000. The different apoproteins are apparently formed by the association at least in part of common polypeptides.

  1. Redox-Based Photostabilizing Agents in Fluorescence Imaging: The Hidden Role of Intersystem Crossing in Geminate Radical Ion Pairs.

    PubMed

    Glembockyte, Viktorija; Cosa, Gonzalo

    2017-09-08

    Here we report transient absorption studies on the ground-state recovery dynamics of the single-molecule fluorophore Cy3B in the presence of four different photostabilizing agents, namely β-mercaptoethanol (β-ME), Trolox (TX), n-propyl gallate (n-PG), and ascorbic acid (AA). These are triplet-state quenchers that operate via photoinduced electron transfer (PeT). While quantitative geminate recombination was recorded following PeT for β-ME (∼100%), for Trolox, n-propyl gallate, and ascorbic acid the extent of geminate recombination was >48%, >27%, and >13%, respectively. The results are rationalized in terms of the rates of intersystem crossing (ISC) in the newly formed geminate radical ion pairs (GRIPs). Rapid spin relaxation in the radicals formed accounts for quantitative geminate recombination with β-ME and efficient geminate recombination with TX. Our results illustrate how the interplay of PeT quenching efficiency and geminate recombination dynamics may lead to improved photostabilization strategies, critical for single-molecule fluorescence and super-resolution imaging.

  2. Single domain antibodies are specially suited for quantitative determination of gliadins under denaturing conditions.

    PubMed

    Doña, Vanina; Urrutia, Mariela; Bayardo, Mariela; Alzogaray, Vanina; Goldbaum, Fernando Alberto; Chirdo, Fernando G

    2010-01-27

    Food intended for celiac patients' consumption must be analyzed for the presence of toxic prolamins using high detectability tests. Though 60% ethanol is the most commonly used solvent for prolamins extraction, 2-mercaptoethanol (2-ME) and guanidinium chloride (GuHCl) can be added to increase protein recovery. However, ethanol and denaturing agents interfere with antigen recognition when conventional antibodies are used. In the present work, a new method for gliadins quantification is shown. The method is based on the selection of llama single domain antibody fragments able to operate under denaturing conditions. Six out of 28 VHH-phages obtained retained their binding capacity in 15% ethanol. Selected clones presented a long CDR3 region containing two additional cysteines that could be responsible for the higher stability. One of the clones (named VHH26) was fully operative in the presence of 15% ethanol, 0.5% 2-ME, and 0.5 M GuHCl. Capture ELISA using VHH26 was able to detect gliadins in samples shown as negatives by conventional ELISA. Therefore, this new strategy appears as an excellent platform for quantitative determination of proteins or any other immunogenic compound, in the presence of denaturing agents, when specific recognition units with high stability are required.

  3. In vitro incorporation of label from (. gamma. /sup 32/P) ATP into isocitrate lyase of Escherichia coli

    SciTech Connect

    Robertson, F.; Reeves, H.C.

    1986-05-01

    A partially purified sonic extract of an E. coli mutant, constitutive for the glyoxylate by-pass enzymes, was incubated with (..gamma../sup 32/P) ATP in 50 mM MOPS buffer at pH 7.5 containing 2 mM 2-mercaptoethanol, 10 mM MgCl/sub 2/ and 10% glycerol at room temperature for 1 h. Incubation was continued for another hour following the addition of unlabeled ATP. The assay was terminated by the addition of 10 mM EDTA. The assay mixture was then analyzed, by several electrophoretic techniques and subsequent autoradiography, to determine which of the proteins in the extract had incorporated label. Isoelectric focusing was performed at pH 3-10 and pH 4-4.5. Specific enzyme staining of IEF gels revealed that active isocitrate lyase (ICL) co-migrated with a protein band which also was radioactive. Immuno blots of these IEF gels, using antibody raised in rabbits against ICL, also demonstrated incorporation of label. SDS-PAGE autoradiograms displayed a labeled protein which co-migrated with purified E. coli ICL, which has a subunit M/sub r/ of 48,000. The mixture was also analyzed by 2-D PAGE which further demonstrated that a labeled protein and authentic purified ICl co-migrate.

  4. Reprogramming somatic cells to cells with neuronal characteristics by defined medium both in vitro and in vivo.

    PubMed

    He, Songwei; Guo, Yiping; Zhang, Yixin; Li, Yuan; Feng, Chengqian; Li, Xiang; Lin, Lilong; Guo, Lin; Wang, Haitao; Liu, Chunhua; Zheng, Yi; Luo, Chuanming; Liu, Qiang; Wang, Fuhui; Sun, Hao; Liang, Lining; Li, Lingyu; Su, Huanxing; Chen, Jiekai; Pei, Duanqing; Zheng, Hui

    2015-01-01

    Currently, direct conversion from somatic cells to neurons requires virus-mediated delivery of at least one transcriptional factor or a combination of several small-molecule compounds. Delivery of transcriptional factors may affect genome stability, while small-molecule compounds may require more evaluations when applied in vivo. Thus, a defined medium with only conventional growth factors or additives for cell culture is desirable for inducing neuronal trans-differentiation. Here, we report that a defined medium (5C) consisting of basic fibroblast growth factor (bFGF), N2 supplement, leukemia inhibitory factor, vitamin C (Vc), and β-mercaptoethanol (βMe) induces the direct conversion of somatic cells to cells with neuronal characteristics. Application of 5C medium converted mouse embryonic fibroblasts (MEFs) into TuJ+ neuronal-like cells, which were capable of survival after being transplanted into the mouse brain. The same 5C medium could convert primary rat astrocytes into neuronal-like cells with mature electrophysiology characteristics in vitro and facilitated the recovery of brain injury, possibly by inducing similar conversions, when infused into the mouse brain in vivo. Crucially, 5C medium could also induce neuronal characteristics in several human cell types. In summary, this 5C medium not only provides a means to derive cells with neuronal characteristics without viral transfection in vitro but might also be useful to produce neurons in vivo for neurodegenerative disease treatment.

  5. Inhibitory effect of sesquiterpene lactones from Saussurea lappa on tumor necrosis factor-alpha production in murine macrophage-like cells.

    PubMed

    Cho, J Y; Park, J; Yoo, E S; Baik, K U; Jung, J H; Lee, J; Park, M H

    1998-10-01

    Total methanol extract of Saussurea lappa radix (Compositae) showed potent inhibitory effect on the production of tumor necrosis factor-alpha (TNF-alpha), a proinflammatory cytokine, in murine macrophage-like cell (RAW264.7 cells) in our previous screening studies on 120 Korean medicinal plants. The activity-guided purification of the plant resulted in the isolation of three components. The chemical structures of the components isolated were established by spectroscopic analyses as sesquiterpene lactones [cynaropicrin (1), reynosin (2), and santamarine (3)]. These three compounds inhibited TNF-alpha production in a dose-dependent manner. The molar concentrations of cynaropicrin, reynosin, and santamarine producing 50% inhibition (IC50) of TNF-alpha production were 2.86 micrograms/ml (8.24 microM), 21.7 micrograms/ml (87.4 microM), and 26.2 micrograms/ml (105 microM), respectively. However, treatment with sulphydryl (SH) compounds such as L-cysteine, dithiothreitol, and 2-mercaptoethanol abrogated the inhibitory effect of cynaropicrin on TNF-alpha production. Therefore, we conclude that the principal inhibitory component of Saussurea lappa is cynaropicrin and its inhibitory effect is mediated through conjugation with SH-groups of target proteins.

  6. Production, Purification, and Characterization of a Major Penicillium glabrum Xylanase Using Brewer's Spent Grain as Substrate

    PubMed Central

    Beitel, Susan Michelz; Fortkamp, Diana; Terrasan, César Rafael Fanchini; de Almeida, Alex Fernando

    2013-01-01

    In recent decades, xylanases have been used in many processing industries. This study describes the xylanase production by Penicillium glabrum using brewer's spent grain as substrate. Additionally, this is the first work that reports the purification and characterization of a xylanase using this agroindustrial waste. Optimal production was obtained when P. glabrum was grown in liquid medium in pH 5.5, at 25 °C, under stationary condition for six days. The xylanase from P. glabrum was purified to homogeneity by a rapid and inexpensive procedure, using ammonium sulfate fractionation and molecular exclusion chromatography. SDS-PAGE analysis revealed one band with estimated molecular mass of 18.36 kDa. The optimum activity was observed at 60 °C, in pH 3.0. The enzyme was very stable at 50 °C, and high pH stability was verified from pH 2.5 to 5.0. The ion Mn2+ and the reducing agents β-mercaptoethanol and DTT enhanced xylanase activity, while the ions Hg2+, Zn2+, and Cu2+ as well as the detergent SDS were strong inhibitors of the enzyme. The use of brewer's spent grain as substrate for xylanase production cannot only add value and decrease the amount of this waste but also reduce the xylanase production cost. PMID:23762855

  7. Obesity, longevity, quality of life

    PubMed Central

    2010-01-01

    Previous investigations demonstrated that optimization of murine immunological reactivity in tissue culture required a sulfhydryl compound; the most effective being 2-mercaptoethanol (2-Me). Since these reports, 2-Me was found beneficial for both growth/function of other cell-types in vitro, including those of other species, and when fed orally, it impeded and/or reversed some in situ physiological changes associated with aging. More recently, thiol-containing compounds possessing oxidation-reduction potentials weaker than 2-Me were found to impart beneficial effects for many other, including human, diseases. Based on these effects, the research herein addressed the question: What consequences might dietary 2-Me impart on health and disease of mice other than those associated with aging? The main parameters monitored over the lifetime of individual animals exposed to dietary 10−3 M 2-Me in their drinking water were: quality of life (obesity and development of recumbent, emaciated and/or cachectic health, longevity, and appearance of tumors. Instead of anticipated toxic attributes, the following unique benefits were found: mean survival of a moderately-lived strain (A/J) was increased 40.8%, high-fat-diet obesity was curtailed in C57BL/10 mice, and a goal of aging intervention protocols, namely preventing loss of quality of life during aging (recumbent, emaciated and/or cachectic) was achieved. Various mechanisms are discussed as they pertain to these findings. PMID:21178502

  8. 8-thiocyanatoflavins as active-site probes for flavoproteins.

    PubMed

    Macheroux, P; Massey, V

    1991-01-15

    8-Thiocyanatoflavins at the riboflavin, FMN, and FAD level were prepared via the diazonium salt of the corresponding 8-aminoflavin and some of the physical and chemical properties studied. 8-Thiocyanatoriboflavin has a UV-visible spectrum similar to that of the native flavin with absorbance maxima at 446 nm (epsilon = 14,900 M-1 cm-1) and 360 nm. Reaction with thiols such as dithiothreitol and mercaptoethanol gives rise to an 8-mercapto- and an 8-SR-flavin, whereas reaction with sulfide yields only the 8-mercaptoflavin. The 8-SCN-flavin binds to riboflavin-binding protein as the riboflavin derivative, to apoflavodoxin, apo-Old Yellow Enzyme, and apo-lactate oxidase as the FMN derivative, and to apo-D-amino acid oxidase, apo-p-hydroxybenzoate hydroxylase, apo-glucose oxidase, apo-anthranilate hydroxylase, and apo-general acyl-CoA dehydrogenase as the FAD derivative. In two cases, namely, with anthranilate hydroxylase and D-amino acid oxidase, the 8-SCN-FAD was spontaneously and completely converted to the 8-mercapto-FAD derivative, suggesting the presence of a nucleophile (most likely the thiol of a cysteine residue) in the vicinity of the 8-position. It was also found that flavodoxin stabilizes the neutral radical and Old Yellow Enzyme the anionic radical of 8-SCN-FMN. Further studies with Old Yellow Enzyme, established that fully (two electron) reduced 8-SCN-FMN undergoes photoelimination of cyanide.

  9. Composition of the coenzyme F420-dependent formate dehydrogenase from Methanobacterium formicicum.

    PubMed

    Schauer, N L; Ferry, J G

    1986-02-01

    The coenzyme F420-dependent formate dehydrogenase from Methanobacterium formicicum was purified to electrophoretic homogeneity by anoxic procedures which included the addition of azide, flavin adenine dinucleotide (FAD), glycerol, and 2-mercaptoethanol to all buffer solutions to stabilize activity. The enzyme contains, in approximate molar ratios, 1 FAD molecule and 1 molybdenum, 2 zinc, 21 to 24 iron, and 25 to 29 inorganic sulfur atoms. Denaturation of the enzyme released a molybdopterin cofactor. The enzyme has a molecular weight of 177,000 and consists of one each of two different subunits, giving the composition alpha 1 beta 1. The molecular weight of the alpha-subunit is 85,000, and that of the beta-subunit is 53,000. The UV-visible spectrum is typical of nonheme iron-sulfur flavoprotein. Reduction of the enzyme facilitated dissociation of FAD, and the FAD-depleted enzyme was unable to reduce coenzyme F420. Preincubation of the FAD-depleted enzyme with FAD restored coenzyme F420-dependent activity.

  10. The effect of gamma-ray-induced radicals on activities and membrane structure of Sendai virus in aqueous solutions.

    PubMed

    Megumi, T; Fujita, S; Iwai, Y; Ito, T

    1993-05-01

    The effects of gamma-ray-induced radicals on the activities of viruses and membrane proteins were studied with Sendai virus in aqueous suspensions with or without additives including OH scavengers. The activities measured were hemagglutination and hemolysis located in the viral membrane. The changes in the protein components of viruses were analyzed at the same time by polyacrylamide gel electrophoresis (PAGE). 2-Mercaptoethanol (70 mM) and p-aminobenzoic acid (1 mM), both known as OH scavengers, fully protected the viral activities from gamma-ray-induced inactivation. Deaeration of virus suspensions by bubbling argon through the suspension did not affect the inactivation curve of the activities of the virus. Conspicuous changes in the membrane-associated glycoprotein bands found by PAGE analysis generally coincided with the findings in the activities of the virus. These findings suggest that OH radicals are the major damaging species acting on the glycoproteins in the membrane, and result in the inactivation of viral functions. In spite of strong OH scavenging ability, t-butanol resulted in the enhancement of inactivation and a decrease in the intensity of glycoprotein bands in the PAGE pattern. This finding, which is seemingly contradictory to the above conclusion, is discussed in terms of the action of alcohol radicals generated after OH scavenging. In particular, the possibility is pointed out that the membrane structure is affected by the reaction with the alcohol radicals, causing a crucial alteration of embedded proteins.

  11. The reversibility of the glutathionyl-quercetin adduct spreads oxidized quercetin-induced toxicity

    SciTech Connect

    Boots, Agnes W. . E-mail: a.boots@farmaco.unimaas.nl; Balk, Jiska M.; Bast, Aalt; Haenen, Guido R.M.M.

    2005-12-16

    Quercetin is one of the most prominent dietary antioxidants. During its antioxidant activity, quercetin becomes oxidized into its o-quinone/quinone methide QQ. QQ is toxic since it instantaneously reacts with thiols of, e.g., proteins. In cells, QQ will initially form an adduct with glutathione (GSH), giving GSQ. We have found that GSQ is not stable; it dissociates continuously into GSH and QQ with a half life of 2 min. Surprisingly, GSQ incubated with 2-mercapto-ethanol (MSH), a far less reactive thiol, results in the conversion of GSQ into the MSH-adduct MSQ. A similar conversion of GSQ into relatively stable protein thiol-quercetin adducts is expected. With the dithiol dihydrolipoic acid (L(SH){sub 2}), quercetin is formed out of GSQ. These results indicate that GSQ acts as transport and storage of QQ. In that way, the initially highly focussed toxicity of QQ is dispersed by the formation of GSQ that finally spreads QQ-induced toxicity, probably even over cells.

  12. Topography of Escherichia coli ribosomal proteins. The order of reactivity of thiol groups*

    PubMed Central

    Bakardjieva, Anastasia; Crichton, Robert R.

    1974-01-01

    1. 30S and 50S ribosomal subunits of Escherichia coli were treated with N-[2,3-14C]-ethylmaleimide and iodo[14C]acetamide. 2. The proteins in the native subunits which reacted with the reagents were S1,‡ S2, S12, S13, S18, S21, L2, L5, L6, L10, L11, L15, L17, L20, L26+28 and L27. 3. Several proteins, such as S1, S12, S14, S18, L2, L6, L10, L11 and either L26 or 28, had thiol groups in an oxidized form and reacted to a greater extent after reduction with β-mercaptoethanol or dithiothreitol. 4. The total number of thiol groups in 30S and 50S subunits was determined as 16–17 and 26–27 respectively. The total number of thiol groups in each ribosomal protein was also determined. 5. The reaction of 30S and 50S subunits with iodoacetamide under several different conditions established the order of reactivity of thiol groups. PMID:4618476

  13. Electron transport chain dysfunction by H(2)O (2) is linked to increased reactive oxygen species production and iron mobilization by lipoperoxidation: studies using Saccharomyces cerevisiae mitochondria.

    PubMed

    Cortés-Rojo, Christian; Estrada-Villagómez, Mirella; Calderón-Cortés, Elizabeth; Clemente-Guerrero, Mónica; Mejía-Zepeda, Ricardo; Boldogh, Istvan; Saavedra-Molina, Alfredo

    2011-04-01

    The mitochondrial electron transport chain (ETC) contains thiol groups (-SH) which are reversibly oxidized to modulate ETC function during H(2)O(2) overproduction. Since deleterious effects of H(2)O(2) are not limited to -SH oxidation, due to the formation of other H(2)O(2)-derived species, some processes like lipoperoxidation could enhance the effects of H(2)O(2) over ETC enzymes, disrupt their modulation by -SH oxidation and increase superoxide production. To verify this hypothesis, we tested the effects of H(2)O(2) on ETC activities, superoxide production and iron mobilization in mitochondria from lipoperoxidation-resistant native yeast and lipoperoxidation-sensitized yeast. Only complex III activity from lipoperoxidation-sensitive mitochondria exhibited a higher susceptibility to H(2)O(2) and increased superoxide production. The recovery of ETC activity by the thiol reductanct β-mercaptoethanol (BME) was also altered at complex III, and a role was attributed to lipoperoxidation, the latter being also responsible for iron release. A hypothetical model linking lipoperoxidation, increased complex III damage, superoxide production and iron release is given.

  14. Characterization of biotechnologically relevant extracellular lipase produced by Aspergillus terreus NCFT 4269.10.

    PubMed

    Sethi, Bijay Kumar; Nanda, Prativa Kumari; Sahoo, Santilata

    2016-01-01

    Enzyme production by Aspergillus terreus NCFT 4269.10 was studied under liquid static surface and solid-state fermentation using mustard oil cake as a substrate. The maximum lipase biosynthesis was observed after incubation at 30°C for 96h. Among the domestic oils tested, the maximum lipase biosynthesis was achieved using palm oil. The crude lipase was purified 2.56-fold to electrophoretic homogeneity, with a yield of 8.44%, and the protein had a molecular weight of 46.3kDa as determined by SDS-PAGE. Enzyme characterization confirmed that the purified lipase was most active at pH 6.0, temperature of 50°C, and substrate concentration of 1.5%. The enzyme was thermostable at 60°C for 1h, and the optimum enzyme-substrate reaction time was 30min. Sodium dodecyl sulfate and commercial detergents did not significantly affect lipase activity during 30-min incubation at 30°C. Among the metal ions tested, the maximum lipase activity was attained in the presence of Zn(2+), followed by Mg(2+) and Fe(2+). Lipase activity was not significantly affected in the presence of ethylenediaminetetraacetic acid, sodium lauryl sulfate and Triton X-100. Phenylmethylsulfonyl fluoride (1mM) and the reducing, β-mercaptoethanol significantly inhibited lipase activity. The remarkable stability in the presence of detergents, additives, inhibitors and metal ions makes this lipase unique and a potential candidate for significant biotechnological exploitation.

  15. Isolation and characterization of a metal ion-dependent alkaline protease from a halotolerant Bacillus aquimaris VITP4.

    PubMed

    Shivanand, Pooja; Jayaraman, Gurunathan

    2011-04-01

    A halotolerant bacterium Bacillus acquimaris VITP4 was used for the production of extracellular protease. Fractional precipitation using ammonium chloride was used to obtain the enzyme. The protease exhibited optimum activity at pH 8.0 and 40 degrees C and retained 50% of its optimal proteolytic activity even in the presence of 4 M NaCl, suggesting that it is halotolerant. The molecular mass of protease, as revealed by SDS-PAGE was found to be 34 kDa and the homogeneity of the enzyme was confirmed by gelatin zymography and reverse-phase HPLC. Upon purification, the specific activity of th enzyme increased from 533 U/mg to 1719 U/mg. Protease inhibitors like phenyl methane sulphonyl fluoride and 2-mercaptoethanol did not affect the activity of the enzyme, but EDTA inhibited the activity, indicating the requirement of metal ions for activity. Cu2, Ni2+ and Mn2+ enhanced the enzyme activity, but Zn2+, Hg2+ and Fe2+ decreased the activity, while Mg2+, Ca2+ and K+ had no effect on the enzyme activity. The protease was quite stable in the presence of cationic (CTAB), anionic (SDS) and neutral detergents (Triton X-100 and Tween-20) and exhibited antimicrobial activity against selected bacterial and fungal strains. The stability characteristics and broad spectrum antimicrobial activity indicated the potential use of this protease in industrial applications.

  16. Tobacco etch virus protease retains its activity in various buffers and in the presence of diverse additives.

    PubMed

    Sun, Changsheng; Liang, Jiongqiu; Shi, Rui; Gao, Xuna; Zhang, Ruijuan; Hong, Fulin; Yuan, Qihang; Wang, Shengbin

    2012-03-01

    Tobacco etch virus (TEV) protease is widely used to remove tags from recombinant fusion proteins because of its stringent sequence specificity. It is generally accepted that the high concentrations of salts or other special agents in most protein affinity chromatography buffers can affect enzyme activity, including that of TEV protease. Consequently, tedious desalination or the substitution of standard TEV reaction buffer for elution buffer are often needed to ensure TEV protease activity when removing fusion tags after purifying target proteins using affinity chromatography. To address this issue, we used SOE PCR technology to synthesize a TEV protease gene with a codon pattern adapted to the codon usage bias of Escherichia coli, recovered the purified recombinant TEV protease, and examined its activity in various elution buffers commonly used in affinity chromatography as well as the effects of selected additives on its activity. Our results showed that the rTEV protease maintained high activity in all affinity chromatography elution buffers tested and tolerated high concentrations of additives commonly used in protein purification procedures, such as ethylene glycol, EGTA, Triton X-100, Tween-20, NP-40, CHAPS, urea, SDS, guanidine hydrochloride and β-mercaptoethanol. These results will facilitate the use of rTEV protease in removing tags from fusion proteins.

  17. Isolation and characterization of agglutinins from the hemolymph of an acorn barnacle, Megabalanus volcano.

    PubMed

    Kamiya, H; Muramoto, K; Goto, R

    1987-01-01

    Two agglutinins, MVA-1 and MVA-2, were isolated from the hemolymph of the acorn barnacle, Megabalanus volcano. They agglutinated human erythrocytes irrespective of the ABO blood group and also rabbit and sheep blood cells. Lactose and fetuin strongly inhibited the hemagglutinating activity. D-galactose, D-arabinose and N-acetylneuraminic acid were also moderate inhibitors. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, both MVA-1 and MVA-2 gave a single band corresponding to 38,000 daltons. It split into one major band with a molecular weight of 23,000 in the presence of 2-mercaptoethanol. The two agglutinins showed the same apparent molecular weight of 116,000 by gel filtration. In isoelectric focusing MVA-1 showed one band at pH 4.8, whereas MVA-2 gave a main band at pH 4.4 with few faint ones in the range between pH 4.0 and 4.8. The agglutinins were glycoproteins containing D-mannose and L-fucose as carbohydrate components. No precipitation reaction was observed in Ouchterlony immuno-diffusion tests using rabbit antisera against the agglutinins from the phylogenetically related Megabalanus rosa.

  18. Studies on canine bone marrow long-term culture: effect of stem cell factor.

    PubMed

    Neuner, E; Schumm, M; Schneider, E M; Guenther, W; Kremmer, E; Vogl, C; Büttner, M; Thierfelder, S; Kolb, H J

    1998-02-16

    Long-term culture of canine marrow cells allows in vitro studies of the hematopoietic system of the dog and characterization of early progenitor cells. Colonies of fresh marrow cells grew equally good in both agar or methylcellulose supplemented with fetal calf serum, while colonies of long-term cultures required agar-based medium containing human serum. Optimum colony growth was obtained when stem cell factor (SCF) and granulocyte-macrophage-colony-stimulating factor (GM-CSF) were used as growth stimuli of colony forming units (CFU). Similar results were achieved with several cell culture media. Addition of hydrocortisone to long-term cultures improved clonogenic growth of cultured cells. Addition of 2-mercaptoethanol had no effect. Strong differences were observed in long-term culture with different horse serum lots and the addition of fetal calf serum to long-term culture suppressed CFU growth of cultured cells. Recharging of cultures with fresh marrow cells on day 7 of culture improved CFU growth only in the following week but had little effect on the outcome. Adding SCF to long-term cultures led to differentiation of more primitive cells and destruction of the stromal layer. Investigation of purified and cultured cell populations was possible when preestablished long-term cultures as stromal layers were used. Loss of long-term culture-initiating ability could be demonstrated in this system with lineage negative marrow cells expanded ex vivo with SCF and GM-CSF.

  19. Proteolytic Activity at Alkaline pH in Oat Leaves, Isolation of an Aminopeptidase 1

    PubMed Central

    Casano, Leonardo M.; Desimone, Marcelo; Trippi, Victorio S.

    1989-01-01

    Proteolytic activity in oat leaf extracts was measured with both azocasein and ribulose bisphosphate carboxylase (Rubisco) as substrates over a wide range of pH (3.0-9.2). With either azocasein or Rubisco activity peaks appeared at pH 4.8, 6.6, and 8.4. An aminopeptidase (AP) which hydrolyzes leucine-nitroanilide was partially purified. Purification consisted of a series of six steps which included ammonium sulfate precipitation, gel filtration, and two ionic exchange chromatographies. The enzyme was purified more than 100-fold. The apparent Km for leucine-nitroanilide is 0.08 millimolar at its pH optimum of 8.4. AP may be a cystein protease since it is inhibited by heavy metals and activated by 2-mercaptoethanol. Isolated chloroplasts were also able to hydrolyze leucine-nitroanilide at a pH optimum of 8.4, indicating that AP could be localized inside the photosynthetic organelles. PMID:16667194

  20. Evaluation of culture, tube agglutination, and PCR methods for the diagnosis of brucellosis in humans.

    PubMed

    Elfaki, Mohamed G; Al-Hokail, Abdullah A; Nakeeb, Shaheen M; Al-Rabiah, Fahad A

    2005-11-01

    Brucellosis is prevalent in Saudi Arabia and Brucela melitensis is a leading cause of zoonosis worldwide. Therefore, accurate diagnosis of brucellosis is a key to its treatment and control. Twenty patients presented with symptoms of brucellosis were examined before and after antibiotic treatment for the diagnosis of brucellosis. Sequential blood samples collected monthly from each patient were tested for the diagnosis of brucellosis by serum plate agglutination test (SPA), standard tube agglutination test (STA), culture, and polymerase chain reaction (PCR). While most of the samples were positive by the agglutination tests, only 40% and 70% were positive by culture and PCR, respectively. After the course of antibiotic treatment, the culture rate and PCR results were positive in 10% of the samples. In contrast, anti-brucella antibodies of the treated patients were positive in 20% and 45% by STA and SPA tests, respectively. Furthermore, agglutinating antibodies in the presence of 2-mercaptoethanol were positive in 60% of the enrolled patients and negative in all patients after the antibiotic treatment. The present study revealed that the expression of anti-brucella antibodies does not correlate with the status of the disease condition. Further, completion of antibiotic therapy hampered the appearance of brucella-specific IgM antibodies, but did not eliminate the appearance of residual IgG antibodies in the treated patients. Therefore, for effective therapy, detection of the Brucella organisms by PCR or culture is an important attribute in the evaluation of the treatment regimen against brucellosis.

  1. Proteases from Canavalia ensiformis: Active and Thermostable Enzymes with Potential of Application in Biotechnology

    PubMed Central

    Gonçalves, Rayane Natshe; Gozzini Barbosa, Suellen Duarte

    2016-01-01

    Extracts of leaves, seeds, roots, and stem from a tropical legume, C. ensiformis, were prepared employing buffers and detergent in aqueous solution. Leaf extracts had the highest protein content and the most pronounced peptidase activity with optimal pH in the neutral to alkaline range. All extracts exhibited peaks of activity at various pH values, suggesting the presence of distinctive classes of proteases. N-α-Tosyl-L-arginine methyl ester hydrolysis was maximal at 30°C to 60°C and peptidase activity from all extracts presented very good thermal stability after 24 h incubation at 70°C. C. ensiformis proteases exhibited molecular masses of about 200–57, 40–37, and 20–15 kDa by SDS-PAGE analysis. These enzymes cleaved hemoglobin, bovine serum albumin, casein, and gelatin at different levels. Serine and metalloproteases are the major proteases in C. ensiformis extracts, modulated by divalent cations, stable at 1% of surfactant Triton X-100 and at different concentrations of the reducing agent β-mercaptoethanol. Thus, C. ensiformis expresses a particular set of proteases in distinctive organs with high activity and stability, making this legume an important source of proteases with biotechnological potential. PMID:27630776

  2. Heterogeneity of collagens in rabbit cornea: type VI collagen

    SciTech Connect

    Cintron, C.; Hong, B.S.

    1988-05-01

    Normal adult rabbit corneas were digested with 5% pepsin and their collagens extracted with acetic acid. Collagen extracts were fractionated by differential salt precipitation. The 2.5 M NaCl fraction was then redissolved with tris buffer and precipitated with sodium acetate. The precipitate contained a high-molecular-weight disulfide-bonded aggregate which, upon reduction with mercaptoethanol, was converted into three distinct polypeptides having molecular weights between 45 and 66 Kd. These physical characteristics, together with the susceptibility of these polypeptides to collagenase and their amino acid composition, identified the high molecular weight aggregate as type VI collagen. Corneas from neonate rabbits and adult corneas containing 2-week-old scars were organ cultured in the presence of (/sup 14/C) glycine to incorporate radiolabel into collagen. Tissues were digested with 0.02% pepsin and their collagens extracted with formic acid. The total radioactivity of the extracts and tissue residues was determined before the collagens were separated by SDS-polyacrylamide slab gel electrophoresis. Radioactive collagen polypeptides bands were then stained with Coomassie blue, processed for fluorography, and analyzed by densitometry. The results show that: (1) type VI collagen is synthesized by neonate corneas and healing adult corneas; (2) it is not readily solubilized from either corneal tissue by 0.02% pepsin digestion and formic acid extraction; and (3) the proportion of type VI collagen deposited in scar tissue is markedly lower than that found in neonate corneas.

  3. [Purification and properties of dipeptidyl amino-peptidase I from chicken liver (author's transl)].

    PubMed

    Barceló, F; Vives, N; Bozal, J

    1980-09-01

    Dipeptidyl aminopeptidase I (E.S. 3.4.14.1) from chicken liver was purified by the following steps: homogenization at pH 5, thermic precipitation, acetone fractionation and Sephadex G-100, DEAE-cellulose and organomercurial-Sepharose column fractionations. The purified enzyme appears to be homogeneous by polyacrylamide gel electrophoresis at both pH 4.5 and 8.3 and has an isoelectric point of 5.7 +/- 0.05. The molecular weight of the enzyme reale 167,000 +/- 17,000 on the Sephadex G-150 column chromatography. The optimum pH for hydrolysis of Gly-Phe-p-nitroanilide (GPNA) and Gly-Phe-B-naphthylamide was 5.8. The value of Km for the hydrolysis of GPNA was estimated at 3.3 mM. The enzyme required halide ions for activity and was activated by thiol reagents (dithiothreitol, cysteine and 2-mercaptoethanol). Accordingly, DAP I was inhibited by thiol-blocking reagents (PCMB, IAA, Hg2+). The enzyme oxidation with oxygen current was fostered by chloride anion (50 nM); nevertheless the activity was recovered when cysteine was present in the incubation mixture; the latter, besides, seems to perform as enzyme protector.

  4. Metal ion substrate inhibition of ferrochelatase.

    PubMed

    Hunter, Gregory A; Sampson, Matthew P; Ferreira, Gloria C

    2008-08-29

    Ferrochelatase catalyzes the insertion of ferrous iron into protoporphyrin IX to form heme. Robust kinetic analyses of the reaction mechanism are complicated by the instability of ferrous iron in aqueous solution, particularly at alkaline pH values. At pH 7.00 the half-life for spontaneous oxidation of ferrous ion is approximately 2 min in the absence of metal complexing additives, which is sufficient for direct comparisons of alternative metal ion substrates with iron. These analyses reveal that purified recombinant ferrochelatase from both murine and yeast sources inserts not only ferrous iron but also divalent cobalt, zinc, nickel, and copper into protoporphyrin IX to form the corresponding metalloporphyrins but with considerable mechanistic variability. Ferrous iron is the preferred metal ion substrate in terms of apparent k(cat) and is also the only metal ion substrate not subject to severe substrate inhibition. Substrate inhibition occurs in the order Cu(2+) > Zn(2+) > Co(2+) > Ni(2+) and can be alleviated by the addition of metal complexing agents such as beta-mercaptoethanol or imidazole to the reaction buffer. These data indicate the presence of two catalytically significant metal ion binding sites that may coordinately regulate a selective processivity for the various potential metal ion substrates.

  5. Inhibition of RNA-dependent DNA polymerase of Rous sarcoma virus by thiosemicarbazones and several cations.

    PubMed

    Levinson, W; Faras, A; Woodson, B; Jackson, J; Bishop, J M

    1973-01-01

    The RNA-dependent DNA polymerase of Rous sarcoma virus is inhibited by N-methyl isatin beta-thiosemicarbazone and by thiosemicarbazide, but not by semicarbazide. These inhibitors also inactivate, upon contact with the virion, the transforming ability of Rous sarcoma virus. Sulfhydryl donors, such as 2-mercapto-ethanol, can prevent these effects. The RNA-directed activity of the purified polymerase is inhibited to a greater degree than is the DNA-directed activity. Two cations, Cu(++) and Hg(++), can inhibit RNA-dependent DNA polymerase and inactivate the transforming ability of the virus. Synergism between N-methyl isatin beta-thiosemicarbazone and Cu(++) occurs, since treatment of the virus with a low dose of either N-methyl isatin beta-thiosemicarbazone or Cu(++) has little effect; however, when the two compounds are mixed together, significant inactivation occurs. This observation supports the hypothesis that the antiviral action of thiosemicarbazones is a function of their ability to act as a ligand for metallic ions. Several cations (Ag(+), Co(++), Zn(++), Cd(++), and Ni(++)) significantly inactivate the RNA-dependent DNA polymerase, but have little effect on the transforming ability. In view of this result, the conclusion that the enzyme activity is required for transformation remains open to question.

  6. Biological activity of complexes derived from pyridine-2-carbaldehyde thiosemicarbazone. Structure of.

    PubMed

    García-Tojal, J; García-Orad, A; Díaz, A A; Serra, J L; Urtiaga, M K; Arriortua, M I; Rojo, T

    2001-04-01

    Biological studies on [Fe(L)2](NO3).0.5H2O (1), [Fe(L)2][PF6] (2), [Co(L)2](NCS) (3), [Ni(HL)2]Cl2.3H2O (4) and Cu(L)(NO3) (5), where HL=C7H8N4S, pyridine-2-carbaldehyde thiosemicarbazone, have been carried out. The crystal structure of compound 3 has been solved. It consists of discrete monomeric cationic entities containing cobalt(III) ions in a distorted octahedral environment. The metal ion is bonded to one sulfur and two nitrogen atoms of each thiosemicarbazone molecule. The thiocyanate molecules act as counterions. The copper(II) and iron(III) complexes react with reduced glutathione and 2-mercaptoethanol. The reaction of compound 1 with the above thiols causes the reduction of the metal ion and bis(thiosemicarbazonato)iron(II) species are obtained. The redox activity, and in particular the reaction with cell thiols, seems to be related to the cytotoxicity of these complexes against Friend erithroleukemia cells and melanoma B16F10 cells.

  7. Envoplakin, a novel precursor of the cornified envelope that has homology to desmoplakin

    PubMed Central

    1996-01-01

    The cornified envelope is a layer of transglutaminase cross-linked protein that is deposited under the plasma membrane of keratinocytes in the outermost layers of the epidermis. We present the sequence of one of the cornified envelope precursors, a protein with an apparent molecular mass of 210 kD. The 210-kD protein is translated from a 6.5- kb mRNA that is transcribed from a single copy gene. The mRNA was upregulated during suspension-induced terminal differentiation of cultured human keratinocytes. Like other envelope precursors, the 210- kD protein became insoluble in SDS and beta-mercaptoethanol on activation of transglutaminases in cultured keratinocytes. The protein was expressed in keratinizing and nonkeratinizing stratified squamous epithelia, but not in simple epithelia or nonepithelial cells. Immunofluorescence staining showed that in epidermal keratinocytes, both in vivo and in culture, the protein was upregulated during terminal differentiation and partially colocalized with desmosomal proteins. Immunogold EM confirmed the colocalization of the 210-kD protein and desmoplakin at desmosomes and on keratin filaments throughout the differentiated layers of the epidermis. Sequence analysis showed that the 210-kD protein is homologous to the keratin- binding proteins desmoplakin, bullous pemphigoid antigen 1, and plectin. These data suggest that the 210-kD protein may link the cornified envelope to desmosomes and keratin filaments. We propose that the 210-kD protein be named "envoplakin." PMID:8707850

  8. A unique uracil-DNA binding protein of the uracil DNA glycosylase superfamily

    PubMed Central

    Sang, Pau Biak; Srinath, Thiruneelakantan; Patil, Aravind Goud; Woo, Eui-Jeon; Varshney, Umesh

    2015-01-01

    Uracil DNA glycosylases (UDGs) are an important group of DNA repair enzymes, which pioneer the base excision repair pathway by recognizing and excising uracil from DNA. Based on two short conserved sequences (motifs A and B), UDGs have been classified into six families. Here we report a novel UDG, UdgX, from Mycobacterium smegmatis and other organisms. UdgX specifically recognizes uracil in DNA, forms a tight complex stable to sodium dodecyl sulphate, 2-mercaptoethanol, urea and heat treatment, and shows no detectable uracil excision. UdgX shares highest homology to family 4 UDGs possessing Fe-S cluster. UdgX possesses a conserved sequence, KRRIH, which forms a flexible loop playing an important role in its activity. Mutations of H in the KRRIH sequence to S, G, A or Q lead to gain of uracil excision activity in MsmUdgX, establishing it as a novel member of the UDG superfamily. Our observations suggest that UdgX marks the uracil-DNA for its repair by a RecA dependent process. Finally, we observed that the tight binding activity of UdgX is useful in detecting uracils in the genomes. PMID:26304551

  9. Carbon Tetrachloride at Hepatotoxic Levels Blocks Reversibly Gap Junctions between Rat Hepatocytes

    NASA Astrophysics Data System (ADS)

    Saez, J. C.; Bennett, M. V. L.; Spray, D. C.

    1987-05-01

    Electrical coupling and dye coupling between pairs of rat hepatocytes were reversibly reduced by brief exposure to halogenated methanes (CBrCl3, CCl4, and CHCl3). The potency of different halomethanes in uncoupling hepatocytes was comparable to their hepatotoxicity in vivo, and the rank order was the same as that of their tendency to form free radicals. The effect of carbon tetrachloride (CCl4) on hepatocytes was substantially reduced by prior treatment with SKF 525A, an inhibitor of cytochrome P-450, and by exposure to the reducing reagent β -mercaptoethanol. Halomethane uncoupling occurred with or without extracellular calcium and did not change intracellular concentrations of calcium and hydrogen ions or the phosphorylation state of the main gap-junctional protein. Thus the uncoupling appears to depend on cytochrome P-450 oxidative metabolism in which free radicals are generated and may result from oxidation of the gap-junctional protein or of a regulatory molecule that leads to closure of gap-junctional channels. Decreases in junctional conductance may be a rapid cellular response to injury that protects healthy cells by uncoupling them from unhealthy ones.

  10. Characterisation of protein composition and detection of IgA in cervicovaginal fluid by microchip technology.

    PubMed

    Werling, József; Kocsis, Béla; Dean, Diane; Kustos, Ildikó

    2008-06-15

    In this paper the application of microchip electrophoresis to examine the protein profile of cervicovaginal fluid and the detection of IgA heavy and light chains is presented. This method is a fast growing field of technology and ensures high-speed analysis requiring only microliters of sample. Proteins with wide range of molecular masses could be separated within 1 min. Cervicovaginal specimens of healthy women showed a complex protein pattern-containing several peaks in the 15-70 kDa region. sIgA is considered to be an important protein constituent of all mucosal surfaces. Detection of sIgA in cervicovaginal samples was achievable by microchip technology. Under reduced circumstances (induced by mercaptoethanol, a component of the denaturating solution) the disulfide bonds connecting IgA heavy and light chains are broken up and chains can be detected as separate peaks during electrophoresis. In 82.5% of the cases only the light chain of IgA could be detected in the clinical samples. The intact IgA heavy chain could be demonstrated in only 12.5% of the cases. Based on our data some conclusions were provided about the correlation of these patterns with the age of patients, pH of the cervicovaginal fluid, operations performed before sample collection and usage of oral contraceptives.

  11. Microchip-based integration of cell immobilization, electrophoresis, post-column derivatization, and fluorescence detection for monitoring the release of dopamine from PC 12 cells.

    PubMed

    Li, Michelle W; Martin, R Scott

    2008-10-01

    In this paper, we describe the fabrication and evaluation of a multilayer microchip device that can be used to quantitatively measure the amount of catecholamines released from PC 12 cells immobilized within the same device. This approach allows immobilized cells to be stimulated on-chip and, through rapid actuation of integrated microvalves, the products released from the cells are repeatedly injected into the electrophoresis portion of the microchip, where the analytes are separated based upon mass and charge and detected through post-column derivatization and fluorescence detection. Following optimization of the post-column derivatization detection scheme (using naphthalene-2,3-dicarboxaldehyde and 2-beta-mercaptoethanol), off-chip cell stimulation experiments were performed to demonstrate the ability of this device to detect dopamine from a population of PC 12 cells. The final 3-dimensional device that integrates an immobilized PC 12 cell reactor with the bilayer continuous flow sampling/electrophoresis microchip was used to continuously monitor the on-chip stimulated release of dopamine from PC 12 cells. Similar dopamine release was seen when stimulating on-chip versus off-chip yet the on-chip immobilization studies could be carried out with 500 times fewer cells in a much reduced volume. While this paper is focused on PC 12 cells and neurotransmitter analysis, the final device is a general analytical tool that is amenable to the immobilization of a variety of cell lines and analysis of various released analytes by electrophoretic means.

  12. Differentiation of human bone marrow stem cells into cells with a neural phenotype: diverse effects of two specific treatments

    PubMed Central

    Scintu, Franca; Reali, Camilla; Pillai, Rita; Badiali, Manuela; Sanna, Maria Adele; Argiolu, Francesca; Ristaldi, Maria Serafina; Sogos, Valeria

    2006-01-01

    Background It has recently been demonstrated that the fate of adult cells is not restricted to their tissues of origin. In particular, it has been shown that bone marrow stem cells can give rise to cells of different tissues, including neural cells, hepatocytes and myocytes, expanding their differentiation potential. Results In order to identify factors able to lead differentiation of stem cells towards cells of neural lineage, we isolated stromal cells from human adult bone marrow (BMSC). Cells were treated with: (1) TPA, forskolin, IBMX, FGF-1 or (2) retinoic acid and 2-mercaptoethanol (BME). Treatment (1) induced differentiation into neuron-like cells within 24 hours, while a longer treatment was required when using retinoic acid and BME. Morphological modifications were more dramatic after treatment (1) compared with treatment (2). In BMSC both treatments induced the expression of neural markers such as NF, GFAP, TUJ-1 and neuron-specific enolase. Moreover, the transcription factor Hes1 increased after both treatments. Conclusion Our study may contribute towards the identification of mechanisms involved in the differentiation of stem cells towards cells of neural lineage. PMID:16483379

  13. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  14. Update on childhood brucellosis.

    PubMed

    Roushan, Mohammad R H; Amiri, Mohammad J S

    2013-04-01

    In endemic regions of brucellosis, childhood brucellosis includes up to one-third of all cases of human brucellosis. The main source of infection in children is consumption of unpasteurized dairy products and traditional local foods containing dairy products. The older boys are more involved in animal care. Boys are more commonly infected than girls. Common symptoms and signs include fever, arthralgia, sweating, peripheral arthritis and splenomegaly. Peripheral arthritis especially monoarthritis is more common and the most commonly affected joints are hip and knee. All organs may involve during the course of the disease. Isolation of Brucella spp. from the blood, bone marrow or other tissue fluids is the hallmark of diagnosis. Serologic tests are the main tools of diagnosis of brucellosis in endemic regions. Standard agglutination test (SAT) with titers > 1:160 and the 2-mercaptoethanol (2ME) test ≥ 1:80 are suggestive of active infection. Children older than 8 years should be treated with doxycycline for 45 days or 8 weeks plus gentamicin for 7 or 5 days respectively or doxycycline for 45 days and streptomycin for 14 days. Also doxycycline plus rifampin or cotrimoxazole plus rifampin for 45 days may be alternative regimens. Cotrimoxazole plus rifampin for six weeks is the regimen of choice for the treatment of patients younger than 8 years old. Gentamicin for 5 days plus cotrimoxazole for six weeks may be a suitable alternative regimen. The article presented few of the patents associated with Brucellosis.

  15. Development of Sensitive and Specific Analysis of Vildagliptin in Pharmaceutical Formulation by Gas Chromatography-Mass Spectrometry

    PubMed Central

    Uçaktürk, Ebru

    2015-01-01

    A sensitive and selective gas chromatography-mass spectrometry (GC-MS) method was developed and fully validated for the determination of vildagliptin (VIL) in pharmaceutical formulation. Prior to GC-MS analysis, VIL was efficiently derivatized with MSTFA/NH4I/β-mercaptoethanol at 60°C for 30 min. The obtained O-TMS derivative of VIL was detected by selected ion monitoring mode using the diagnostic ions m/z 223 and 252. Nandrolone was chosen as internal standard. The GC-MS method was fully validated by the following validation parameters: limit of detection (LOD) and quantitation (LOQ), linearity, precision, accuracy, specificity, stability, robustness, and ruggedness. LOD and LOQ were found to be 1.5 and 3.5 ng mL−1, respectively. The GC-MS method is linear in the range of 3.5–300 ng mL−1. The intra- and interday precision values were less than ≤3.62%. The intra- and interday accuracy values were found in the range of −0.26–2.06%. Finally, the GC-MS method was successfully applied to determine VIL in pharmaceutical formulation. PMID:26682085

  16. Characterization of the glycoprotein of infectious hematopoietic necrosis virus using neutralizing monoclonal antibodies

    USGS Publications Warehouse

    Huang, Chienjin; Chien, Maw-Sheng; Landolt, Marsha; Winton, James

    1994-01-01

    To study the antigenic nature of the glycoprotein (G protein) of infectious hematopoietic necrosis virus (IHNV), 31 neutralizing monoclonal antibodies (MAbs) were produced against a reference isolate of the virus. The MAbs were compared using a neutralization assay, an enzyme-linked immunosorbent assay (ELISA), and by immunoblotting of the G protein in the native, reduced, and deglycosylated forms. Hybridoma culture fluids of the various MAbs could be diluted from 1:2 to 1:512 and still completely neutralize 1 X 104 plaque-forming units of IHNV. Similarly, the end point dilutions that produced optical density readings of 0.1 or greater in the ELISA were 1:40 to 1:10240. Western blotting showed that all of the MAbs reacted with the G protein in the unreduced (i.e. native) conformation; however, only 9 nine of the MAbs were able to react with the G protein following reduction by 2-mercaptoethanol. Deglycosylation of the protein did not influence the binding ability of any of the MAbs. These data indicate that all the MAbs recognized amino acid sequences on the protein itself and that the IHNV glycoprotein contains linear as well as conformation-dependent neutralizing epitopes. When rainbow trout Oncorhynchus mykiss fingerlings were passively immunized with MAbs against either a linear or a conformation-dependent epitope, the fish were protected against challenge with wild-type IHNV.

  17. Photo-oxidation of 6-thioguanine by UVA: the formation of addition products with low molecular weight thiol compounds.

    PubMed

    Ren, Xiaolin; Xu, Yao-Zhong; Karran, Peter

    2010-01-01

    The thiopurine, 6-thioguanine (6-TG) is present in the DNA of patients treated with the immunosuppressant and anticancer drugs azathioprine or mercaptopurine. The skin of these patients is selectively sensitive to UVA radiation-which comprises >90% of the UV light in incident sunlight-and they suffer high rates of skin cancer. UVA irradiation of DNA 6-TG produces DNA lesions that may contribute to the development of cancer. Antioxidants can protect 6-TG against UVA but 6-TG oxidation products may undergo further reactions. We characterize some of these reactions and show that addition products are formed between UVA-irradiated 6-TG and N-acetylcysteine and other low molecular weight thiol compounds including β-mercaptoethanol, cysteine and the cysteine-containing tripeptide glutathione (GSH). GSH is also adducted to 6-TG-containing oligodeoxynucleotides in an oxygen- and UVA-dependent nucleophilic displacement reaction that involves an intermediate oxidized 6-TG, guanine sulfonate (G(SO3) ). These photochemical reactions of 6-TG, particularly the formation of a covalent oligodeoxynucleotide-GSH complex, suggest that crosslinking of proteins or low molecular weight thiol compounds to DNA may be a previously unrecognized hazard in sunlight-exposed cells of thiopurine-treated patients.

  18. A novel neutral, halophile Stachybotrys microspora-based endoglucanase active impact on β-glucan.

    PubMed

    Benhmad, Ines; Boudabbous, Manel; Yaîch, Asma; Rebai, Maryem; Gargouri, Ali

    2016-04-01

    The production of cellulases from Stachybotrys microspora strain (A19) has been improved by fed-batch fermentation on Avicel cellulose 10 mg/ml. An endoglucanase EG2 was purified to homogeneity. This cellulase has a molecular mass estimated to 50 kDa when analyzed by a denaturant gel electrophoresis. It exhibited an optimal activity at 50 °C, pH 7.0 and 0.85 M NaCl. Specifically, these results show the thermo-active, alkali-tolerant and halo-tolerant properties of EG2. In addition, this endoglucanase showed its highest activity on barley-β-glucan, compared to the CMC. Moreover, it was less active on Avicel cellulose. Furthermore, the EG2 activity was stimulated in the presence of EDTA, urea and β-mercaptoethanol whereas it was reduced in the presence of SDS. This cellulase was highly stable in the presence of organic solvents such as acetone and n-hexane. TLC showed that the main hydrolysis products from EG2 were cellobiose and glucose. This fungal endoglucanase could be potentially important in the conversion of grass-derived biomass into fermentable sugars.

  19. Delayed Lysis with Salmonella Bacteriophage P22: Induction of Lysis by Addition of Cysteine or Histidine to the Growth Medium

    PubMed Central

    Cohen, Larry W.

    1969-01-01

    A mutant (Lys−) of Salmonella bacteriophage P22 showed a delay in lysis of more than 3 hr in infections in unsupplemented M9 medium. The infected cells were induced to lyse during that interval by addition of histidine or sulfhydryl compounds cysteine, mercaptoethanol, glutathione, or ergothioneine. Urocanic acid, the first intermediate in the catabolic histidine pathway, did not induce lysis, nor did histamine, imidazolelactate, or carnosine. None of the other amino acids common to protein had any inductive effect. Both the d and l forms of histidine were effective in inducing lysis, suggesting that the incorporation of the histidine into protein is not involved. Chloramphenicol inhibited lysis when added at 60 min with or without histidine, but did not inhibit the induction of lysis when added with cysteine. Bacterial cells infected with Lys+ phage were induced to lyse prematurely when cysteine was added at 30 min but not at 20 min of infection. Iodoacetate inhibited lysis of Lys+-infected cells when added at 20 min but not at 30 min. PMID:16789095

  20. Ternary DNA chip based on a novel thymine spacer group chemistry.

    PubMed

    Yang, Yanli; Yildiz, Umit Hakan; Peh, Jaime; Liedberg, Bo

    2015-01-01

    A novel thymine-based surface chemistry suitable for label-free electrochemical DNA detection is described. It involves a simple two-step sequential process: immobilization of 9-mer thymine-terminated probe DNAs followed by backfilling with 9-mer thymine-based spacers (T9). As compared to commonly used organic spacer groups like 2-mercaptoethanol, 3-mercapto-1-propanol and 6-mercapto-1-hexanol, the 9-mer thymine-based spacers offer a 10-fold improvement in discriminating between complementary and non-complementary target hybridization, which is due mainly to facilitated transport of the redox probes through the probe-DNA/T9 layers. Electrochemical measurements, complemented with Surface Plasmon Resonance (SPR) and Quartz Crystal Microbalance (QCM-D) binding analyses, reveal that optimum selectivity between complementary and non-complementary hybridization is obtained for a sensing surface prepared using probe-DNA and backfiller T9 at equimolar concentration (1:1). At this particular ratio, the probe-DNAs are preferentially oriented and easily accessible to yield a sensing surface with favorable hybridization and electron transfer characteristics. Our findings suggest that oligonucleotide-based spacer groups offer an attractive alternative to short organic thiol spacers in the design of future DNA biochips. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Purification and characterization of catalase from chard (Beta vulgaris var. cicla).

    PubMed

    Dinçer, A; Aydemir, T

    2001-01-01

    Catalase is a major primary antioxidant defence component that primarily catalyses the decomposition of H(2) O(2) to H(2) O. Here we report the purification and characterization of catalase from chard (Beta vulgaris var. cicla). Following a procedure that involved chloroform treatment, ammonium sulfate precipitation and three chromatographic steps (CM-cellulose, Sephadex G-25, and Sephadex G-200), catalase was purified about 250-fold to a final specific activity of 56947 U/mg of protein. The molecular weight of the purified catalase and its subunit were determined to be 235 000 and 58 500 daltons, indicating that the chard catalase is a tetramer. The absorption spectra showed a soret peak at 406 nm, and there was slightly reduction by dithionite. The ratio of absorption at 406 and 275 nanometers was 1.5, the value being similar to that obtained for catalase from other plant sources. In the catalytic reaction, the apparent Km value for chard catalase was 50 mM. The purified protein has a broad pH optimum for catalase activity between 6.0 and 8.0. The enzyme had an optimum reaction temperature at 30 degrees C. Heme catalase inhibitors, such as azide and cyanide, inhibited the enzyme activity markedly and the enzyme was also inactivated by ?-mercaptoethanol, dithiothreitol and iodoacetamide.

  2. The possible relevance of autoxidative glycosylation in glucose mediated alterations of proteins: an in vitro study on myofibrillar proteins.

    PubMed

    Lal, S; Chithra, P; Chandrakasan, G

    1996-01-26

    The present work was carried out to examine the role of glycation and transition metal catalysed autoxidation of sugars in glucose-mediated alterations of myofibrillar proteins. Myofibrils were prepared from rat skeletal muscle and incubated with 1) sugar alone 2) sugar and micromolar concentrations of transition metals (Cu2+ or Fe3+) 3) transition metals alone and the control remained without sugar or transition metals. A significant increase in extent of glycation and decrease in ATPase activity of myofibrils incubated under autoxidative conditions were observed over the other three incubations. Reducing agent 2-mercaptoethanol was highly effective in preventing the alterations induced by glucoxidation, compared to EDTA and aminoguanidine, suggesting the involvement of thiol group oxidation in the reduced function of the protein. Free radical scavengers like catalase, benzoic acid and mannitol were also effective in preventing glucose mediated alterations. Although a high concentration of glucose alone has an insignificant effect on myofibrils in vitro, the results from the present work suggest that glucose in combination with transition metals could lead to functional alterations of myofibrils, and this process by generating free radicals may contribute to the overall complications of diabetes and aging.

  3. Partial purification of a binding protein for polychlorinated biphenyls from rat lung cytosol: Physicochemical and immunochemical characterization

    SciTech Connect

    Lund, J.; Nordlund, L.; Gustafsson, J.A. )

    1988-10-04

    A binding protein for certain methyl sulfone metabolites of polychlorinated biphenyls (PCB) was partially purified from lung cytosol of untreated female rats. The protein has an M{sub r} of 13,000 and a pI of 5.3 in the absence of reducing agents. In the presence of dithioerythreitol or {beta}-mercaptoethanol, the protein is split into subunits with a more basic pI. The 13-kDa protein was electroeluted from SDS-polyacrylamide gels, and an antiserum against the protein was raised in rabbit. The immunoglobulin fraction was shown to contain monospecific antibodies against the 13-kDa protein as determined by Western immunoblots. Due to striking similarities in physicochemical characteristics of the 13-kDa protein and a protein purified from rabbit lung and uterus, uteroglobin, the anti 13-kDa protein antibodies were tested for cross-reactivity. As judged by Western immunoblots, the anti 13-kDa protein antibodies did not cross-react with uteroglobin and the two proteins, although similar, do not seem to be identical. The 13-kDa protein is proposed to be responsible for the accumulation of certain methylsulfonyl-PCBs in lung tissue of rats. Monospecific antibodies against the 13-kDa protein should constitute immunochemical probes of great value in attempts to elucidate the physiological role of the protein as well as its possible role in PCB-induced respiratory toxicity.

  4. Extraction of Renilla-type luciferin from the calcium-activated photoproteins aequorin, mnemiopsin, and berovin.

    PubMed Central

    Ward, W W; Cormier, M J

    1975-01-01

    Photoproteins, which emit light in an oxygen-independent intramolecular reaction initiated by calcium ions, have been isolated from several bioluminescent organisms, including the hydrozoan jellyfish Aequorea and the ctenophore Mnemiopsis. The system of a related anthozoan coelenterate, the sea pansy Renilla reniformis, however, is oxygen dependent, requiring two organic components, luciferin and luciferase. Previously published indirect evidence indicates that photoproteins may contain a Renilla-type luciferin. We have now extracted in high yield a Renilla-type luciferin from three photoproteins, aequorin (45% yield), mnemiopsin (98% yield), and berovin (85% yield). Photoprotein luciferin, released from the holoprotein by mercaptoethanol treatment and separated from apo-photoprotein by gel filtration, no longer responds to calcium but now requires luciferase and O2 for light production. Photoprotein luciferin is identical to Renilla luciferin with respect to reaction kinetics and bioluminescence spectral distribution. In view of these results, the generally accepted hypothesis that the photoprotein chromophore is a protein-stabilized hydroperoxide of luciferin must be modified. We believe, instead, that the chromophore is free luciferin and that oxygen is bound as an oxygenated derivative of an amino-acid side chain of the protein. We propose the general term "coelenterate luciferin" to describe the light-producing chromophore from all bioluminescent coelenterates and ctenophores. PMID:241074

  5. Production, purification, and characterization of a major Penicillium glabrum xylanase using Brewer's spent grain as substrate.

    PubMed

    Knob, Adriana; Beitel, Susan Michelz; Fortkamp, Diana; Terrasan, César Rafael Fanchini; de Almeida, Alex Fernando

    2013-01-01

    In recent decades, xylanases have been used in many processing industries. This study describes the xylanase production by Penicillium glabrum using brewer's spent grain as substrate. Additionally, this is the first work that reports the purification and characterization of a xylanase using this agroindustrial waste. Optimal production was obtained when P. glabrum was grown in liquid medium in pH 5.5, at 25 °C, under stationary condition for six days. The xylanase from P. glabrum was purified to homogeneity by a rapid and inexpensive procedure, using ammonium sulfate fractionation and molecular exclusion chromatography. SDS-PAGE analysis revealed one band with estimated molecular mass of 18.36 kDa. The optimum activity was observed at 60 °C, in pH 3.0. The enzyme was very stable at 50 °C, and high pH stability was verified from pH 2.5 to 5.0. The ion Mn(2+) and the reducing agents β -mercaptoethanol and DTT enhanced xylanase activity, while the ions Hg(2+), Zn(2+), and Cu(2+) as well as the detergent SDS were strong inhibitors of the enzyme. The use of brewer's spent grain as substrate for xylanase production cannot only add value and decrease the amount of this waste but also reduce the xylanase production cost.

  6. Wind tunnel behavioural response and field trapping of the blowfly Calliphora vicina.

    PubMed

    Aak, A; Knudsen, G K; Soleng, A

    2010-09-01

    The attraction of the blowfly Calliphora vicina Robineau-Desvoidy, 1830 (Diptera: Calliphoridae) to single synthetic compounds, blends and authentic odours was investigated in a wind tunnel. A total of 1850 C. vicina (1750 females and 100 males) were tested. A comparison of male and female responses showed significant differences in attraction between the sexes. Females were more attracted than males to liver odour. The attraction of females lay in the ranges of 0-22% for single compounds, 26-64% for synthetic blends and 58-88% for authentic odours. Dimethyl trisulphide was the most attractive single compound. Significant improvement in attraction was achieved with blends and a three-component lure, consisting of dimethyl trisulphide, mercaptoethanol and o-cresol, was found to be the best solution for field trapping of C. vicina. Authentic odours from dead fish and mice were significantly more attractive than liver and the three-component blend, and the blend and liver were similarly effective as attractants. Field tests support the results of the wind tunnel study and a high number of C. vicina were caught in funnel traps. Overall, 99.1% of the specimens caught were females.

  7. Plasma immunoreactive calcitonin in lung cancer.

    PubMed

    Roos, B A; Lindall, A W; Baylin, S B; O'Neil, J; Frelinger, A L; Birnbaum, R S; Lambert, P W

    1979-01-01

    We have measured plasma calcitonin in 135 untreated eucalemic men with lung cancer and a control/smoker population. Calcitonin levels were determined by radioimmunoassay and validated by immunoextraction. Plasma immunoreactive calcitonin moieties were purified by immunoadsorbent chromatography, treated with mercaptoethanol and urea, and characterized by gel filtration. Artifacts in human calcitonin radioimmunoassays of cancer-patient plasmas were detected by parallel plasma incubations in a salmon calcitonin radioimmunoassay system which does not detect human calcitonin and by immunoprecipitation of tracer at the end of radioimmunoassay incubations. Heating fresh plasmas to 65 degrees C for 1.5 hours reduced radioimmunoassay artifacts without loss of calcitonin moieties. Such characterization of hypercalcitoninemia in each of the histopathological types of lung cancer has raised some important questions about the interpretation of plasma calcitonin radioimmunoassay measurements in lung cancer. Based on inhibition of tracer-antibody binding, plasma calcitonin seemed to be elevated in 18% (14/80) of basal plasma samples obtained from patients with epidermoid or with anaplastic lung cancer. Unequivocal hypercalcitoninemia (heat stable, causing no inhibition of antibody-tracer binding in the salmon calcitonin radioimmunoassays, and immunoextractable with human calcitonin antibodies) was not found in any of the apparently hypercalcitoninemic plasmas from persons with epidermoid or anaplastic lung cancer. By contrast, unequivocal hypercalcitoninemia was found in 27% (15/55) of plasmas from patients with small cell carcinoma or adenocarcinoma. Most of the immunoreactive calcitonin recovered from small cell and adenocarcinoma lung cancer plasmas with unequivocally elevated calcitonin is much larger than calcitonin monomer.

  8. Copper-metallothioneins in the American lobster, Homarus americanus: potential role as Cu(I) donors to apohemocyanin

    SciTech Connect

    Brouwer, M.; Whaling, P.; Engel, D.W.

    1986-03-01

    The physiological function of copper(I)-metallothionein is not well understood. The respiratory function of hemocyanin, a copper(I)-containing respiratory protein found in the hemolymph of many invertebrates, has been known a long time. However, the mechanism by which Cu(I) is inserted into the oxygen-binding site of apohemocyanin is completely unknown. This investigation tests that hypothesis that copper(I)-metallothionein may act as a Cu(I) donor to apohemocyanin. To this end, copper-binding proteins and hemocyanin were purified from the digestive gland and hemolymph of the American lobster, Homarus americanus. In the presence of ..beta..-mercaptoethanol, the copper-binding proteins can be resolved into three components of DEAE-cellulose. The first two have been characterized as metallothioneins. The cysteine content of the third component is half of that of components I and II. The purified proteins are not capable of transferring Cu(I) to the active sites of completely copper-free apohemocyanin. They are capable, however, of transferring Cu(I) to active sites of hemocyanin containing reduced amounts of Cu(I), suggesting that the conformational state of hemocyanin is the determining factor in the Cu(I) transfer mechanism.

  9. Reactive Intermediates Produced from Metabolism of the Vanilloid Ring of Capsaicinoids by P450 Enzymes

    PubMed Central

    Reilly, Christopher A.; Henion, Fred; Bugni, Tim S.; Ethirajan, Manivannan; Stockmann, Chris; Pramanik, Kartick C.; Srivastava, Sanjay K.; Yost, Garold S.

    2012-01-01

    This study characterized electrophilic and radical products derived from metabolism of capsaicin by cytochrome P450 and peroxidase enzymes. Multiple glutathione and β-mercaptoethanol conjugates (a.k.a., adducts), derived from trapping of quinone methide and quinone intermediates of capsaicin, its analogue nonivamide, and O-demethylated and aromatic hydroxylated metabolites thereof, were produced by human liver microsomes and individual recombinant human P450 enzymes. Conjugates derived from concomitant dehydrogenation of the alkyl terminus of capsaicin, were also characterized. Modifications to the 4-OH substituent of the vanilloid ring of capsaicinoids largely prevented the formation of electrophilic intermediates, consistent with the proposed structures and mechanisms of formation for the various conjugates. 5,5’-Dicapsaicin, presumably arising from bi-molecular coupling of free radical intermediates, was also characterized. Finally, the analysis of hepatic glutathione conjugates and urinary N-acetylcysteine conjugates from mice dosed with capsaicin confirmed the formation of glutathione conjugates of O-demethylated, quinone methide, and 5-OH-capsaicin in vivo. These data demonstrated that capsaicin and structurally similar analogues are converted to reactive intermediates by certain P450 enzymes, which may partially explain conflicting reports related to the cytotoxic, pro-carcinogenic, and chemoprotective effects of capsaicinoids in different cells and/or organ systems. PMID:23088752

  10. Experimental and Theoretical Study of the Mechanoluminescence of ZnS:Mn Nanoparticles

    NASA Astrophysics Data System (ADS)

    Sharma, Ravi; BiSen, D. P.; Chandra, B. P.

    2015-10-01

    We report the synthesis and mechanoluminescence (ML) of manganese-doped zinc sulfide (ZnS) nanoparticles. Clusters of ZnS:Mn nanocrystals were prepared by chemical precipitation, by mixing of solutions of zinc chloride, sodium sulfide, and manganese chloride. Mercaptoethanol (ME) was used as capping agent, to modify the surface of the nanoparticles and prevent their growth. The particle size of the nanocrystals, measured by use of x-ray diffraction and transmission electron microscopy, was in the range 2-5 nm. The ZnS:Mn nanoparticles were deformed impulsively by dropping a load from a fixed height. The ML intensity of ZnS:Mn nanocrystals increased with increasing mechanical stress i.e. with increasing impact velocity. The impact velocity-dependence of maximum ML intensity, I m, and total ML intensity, I T, are discussed. The effect of crystal size on the ML intensity-time curve is also discussed. ML intensity initially increases with increasing concentration of Mn in the samples, reaches an optimum value at a specific concentration of Mn, then decreases with further increasing concentration of Mn in the nanocrystals. The theory of the ML of nanoparticles is also discussed.

  11. Saccharomyces cerevisiae-induced stomatal closure mainly mediated by salicylhydroxamic acid-sensitive peroxidases in Vicia faba.

    PubMed

    Gao, Jing; Wang, Nan; Wang, Gen-Xuan

    2013-04-01

    Saccharomyces cerevisiae induced stomatal closure in a dose-dependent manner on Vicia faba L. (cv. Daqingpi). Using pharmacological inhibitors in this study, we found that stomatal closure was completely inhibited by salicylhydroxamic acid (SHAM) and reduced glutathione (GSH), whereas slightly inhibited by diphenyleneiodonium chloride (DPI), suggesting that H2O2 was mostly produced by cell wall peroxidases. The specific NO scavenger (cPTIO), NO synthase (NOS) inhibitor NG-nitro-l-arginine methyl ester (l-NAME) and sodium azide (NaN3; inhibitor of nitrate reductase) prevented yeast-induced stomatal closure, suggesting that NO in guard cells of V. faba is derived from both NOS-like enzyme and nitrate reductase. Results of HgCl2 and β-mercaptoethanol (ME) treatment (as a functional inhibitor of water channels and its reversing agent, respectively) suggest that water channels are involved in yeast-induced stomatal movements. CoCl2 (the blocker of calcium channel), LaCl3 (Ca(2+) antagonist) and EGTA (Ca(2+) chelator) also impaired yeast-induced stomatal closure. Thus, it is concluded that H2O2, NO, water channels and Ca(2+) are involved in yeast-induced stomatal closure.

  12. Glucose- and mannose-induced stomatal closure is mediated by ROS production, Ca(2+) and water channel in Vicia faba.

    PubMed

    Li, Yan; Xu, ShanShan; Gao, Jing; Pan, Sha; Wang, GenXuan

    2016-03-01

    Sugars act as vital signaling molecules that regulate plant growth, development and stress responses. However, the effects of sugars on stomatal movement have been unclear. In our study, we explored the effects of monosaccharides such as glucose and mannose on stomatal aperture. Here, we demonstrate that glucose and mannose trigger stomatal closure in a dose- and time-dependent manner in epidermal peels of broad bean (Vicia faba). Pharmacological studies revealed that glucose- and mannose-induced stomatal closure was almost completely inhibited by two reactive oxygen species (ROS) scavengers, catalase (CAT) and reduced glutathione (GSH), was significantly abolished by an NADPH oxidase inhibitor, diphenylene iodonium chloride (DPI), whereas they were hardly affected by a peroxidase inhibitor, salicylhydroxamic acid (SHAM). Furthermore, glucose- and mannose-induced stomatal closure was strongly inhibited by a Ca(2+) channel blocker, LaCl3 , a Ca(2+) chelator, ethyleneglycol-bis(beta-aminoethylether)-N,N'-tetraacetic acid (EGTA) and two water channel blockers, HgCl2 and dimethyl sulfoxide (DMSO); whereas the inhibitory effects of the water channel blockers were essentially abolished by the reversing agent β-mercaptoethanol (β-ME). These results suggest that ROS production mainly via NADPH oxidases, Ca(2+) and water channels are involved in glucose- and mannose-induced stomatal closure.

  13. Purification, properties and cDNA cloning of glutamate decarboxylase in germinated faba bean (Vicia faba L.).

    PubMed

    Yang, Runqiang; Yin, Yongqi; Guo, Qianghui; Gu, Zhenxin

    2013-06-01

    Gamma-aminobutyric acid (GABA) is a non-protein amino acid with bioactive functions in humans. In this work, glutamate decarboxylase (EC 4.1.1.15, GAD) which is key in the GABA bioformation was purified from 5-day germinated faba beans and characterized. A single band was observed at 58 kDa using sodium dodecyl sulphate gel electrophoresis. GAD optimal activity was at pH 6.0 at 40°C with a K(m) value for glutamic acid (Glu) of 2.63 mM. The enzyme was inhibited significantly by Cu(2+), Fe(3+), Mg(2+), Ba(2+), aminoxyacetate, EGTA, Na(2)EDTA, l-cysteine and beta-mercaptoethanol; and activated at low Ca(2+) 0.2mM. Using RT-PCR, the GAD cDNA was sequenced which indicated 1787 bp long, containing a 1527 bp open reading frame (ORF) that encoded 509 amino-acid peptides with a calculated molecular weight of 57.74 kDa and a pI of 5.41 (GenBank accession number: JX444699).

  14. Purification and characterization of two bifunctional chitinases/lysozymes extracellularly produced by Pseudomonas aeruginosa K-187 in a shrimp and crab shell powder medium.

    PubMed Central

    Wang, S L; Chang, W T

    1997-01-01

    Two extracellular chitinases (FI and FII) were purified from the culture supernatant of Pseudomonas aeruginosa K-187. The molecular weights of FI and FII were 30,000 and 32,000, respectively, by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 60,000 and 30,000, respectively, by gel filtration. The pIs for FI and FII were 5.2 and 4.8, respectively. The optimum pH, optimum temperature, pH stability, and thermal stability of FI were pH 8, 50 degrees C, pH 6 to 9, and 50 degrees C; those of FII were pH 7, 40 degrees C, pH 5 to 10, and 60 degrees C. The activities of both enzymes were activated by Cu2+; strongly inhibited by Mn2+, Mg2+, and Zn2+; and completely inhibited by glutathione, dithiothreitol, and 2-mercaptoethanol. Both chitinases showed lysozyme activity. The purified enzymes had antibacterial and cell lysis activities with many kinds of bacteria. This is the first report of a bifunctional chitinase/lysozyme from a prokaryote. PMID:9023918

  15. Subcellular distribution of calcium-activated neutral proteinase (CANP) in rat brain

    SciTech Connect

    Chakrabarti, A.; Yoshida, Y.; Singh, I.; Banik, N.; Hogan, E.

    1987-05-01

    In pursuing the association of calcium-activated neutral proteinase (CANP) with purified myelin, its subcellular distribution in myelin and other organelles of rat brain has been determined quantitatively. Subcellular fractions were prepared according to Eichberg et al. CANP was assayed using UC-azocasein as substrate in 50 mM Tris acetate buffer, pH 7.4, 0.1% Triton X-100 and 5 mM US -mercaptoethanol, with and without CaS . TCA-soluble radioactivity was that activity over an EGTA control. Triton X-100 increased CANP activitiy in homogenate and myelin by ten fold. CANP activity was present primarily in the particulate fractions P1 (nuclear), P2 (mitochondrial) and P3 (microsomal). On subfractionation of these fractions, over 50% of the activity was recovered in the myelin-rich fractions (P1A, P2A, P3A). The distribution of activity was P2A > P1 A > P3 A. The cytosolic fraction contained 30% of the homogenate activity. Further purification of myelin of P2A increased the specific activity by more than 2.5-fold over homogenate. The same myelin had the highest proportion and specific activity of CNPase. The purity of each subcellular fraction was tested by monitoring the activity of suitable marker enzymes. Their results indicate that in CNS CANP is present as membrane bound and soluble forms and the bulk of CANP is intimately associated with the myelin membrane.

  16. Impaired fertilizing ability of superoxide dismutase 1-deficient mouse sperm during in vitro fertilization.

    PubMed

    Tsunoda, Satoshi; Kawano, Natsuko; Miyado, Kenji; Kimura, Naoko; Fujii, Junichi

    2012-11-01

    The oxidative modification of gametes by a reactive oxygen species is a major deleterious factor that decreases the successful rate of in vitro fertilization. Superoxide dismutase 1 (SOD1) plays a pivotal role in antioxidation by scavenging the superoxide anion, and its deficiency causes infertility in female mice, but the significance of the enzyme in male mice remains unclear. In the present study, we characterized Sod1(-/-) (Sod1-KO) male reproductive organs and compiled the first report of the impaired fertilizing ability of Sod1-KO sperm in in vitro fertilization. Insemination of wild-type oocytes with Sod1-KO sperm exhibited lower rates of fertility compared with insemination by wild-type sperm. The low fertilizing ability found for Sod1-KO sperm was partially rescued by reductant 2-mercaptoethanol, which suggested the oxidative modification of sperm components. The numbers of motile and progressive sperm decreased during the in vitro fertilization process, and a decline in ATP content and elevation in lipid peroxidation occurred in the Sod1-KO sperm in an incubation time-dependent manner. Tyrosine phosphorylation, which is a hallmark for sperm capacitation, was also impaired in the Sod1-KO sperm. These results collectively suggest that machinery involved in sperm capacitation and motility are vulnerable to oxidative damage during the in vitro fertilization process, which could increase the rate of inefficient fertilization.

  17. Permeability and Channel-Mediated Transport of Boric Acid across Membrane Vesicles Isolated from Squash Roots1

    PubMed Central

    Dordas, Christos; Chrispeels, Maarten J.; Brown, Patrick H.

    2000-01-01

    Boron is an essential micronutrient for plant growth and the boron content of plants differs greatly, but the mechanism(s) of its uptake into cells is not known. Boron is present in the soil solution as boric acid and it is in this form that it enters the roots. We determined the boron permeability coefficient of purified plasma membrane vesicles obtained from squash (Cucurbita pepo) roots and found it to be 3 × 10−7 ±1.4 × 10−8 cm s−1, six times higher than the permeability of microsomal vesicles. Boric acid permeation of the plasma membrane vesicles was partially inhibited (30%–39%) by mercuric chloride and phloretin, a non-specific channel blocker. The inhibition by mercuric chloride was readily reversible by 2-mercaptoethanol. The energy of activation for boron transport into the plasma membrane vesicles was 10.2 kcal mol−1. Together these data indicate that boron enters plant cells in part by passive diffusion through the lipid bilayer of the plasma membrane and in part through proteinaceous channels. Expression of the major intrinsic protein (MIP) PIP1 in Xenopus laevis oocytes resulted in a 30% increase in the boron permeability of the oocytes. Other MIPs tested (PIP3, MLM1, and GlpF) did not have this effect. We postulate that certain MIPs, like those that have recently been shown to transport small neutral solutes, may also be the channels through which boron enters plant cells. PMID:11080310

  18. Cell surface proteins of Candida albicans: Preparation of extracts and improved detection of proteins

    PubMed Central

    Vediyappan, Govindsamy; Bikandi, Joseba; Braley, Richard; Chaffin, W. LaJean

    2016-01-01

    We have reexamined the detection of the components in a β-mercaptoethanol and ammonium carbonate buffer extract of surface proteins of Candida albicans and the effects of postextraction manipulation of the extract on recovery of extract components. Following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), preferential staining of some moieties was observed when bands detected by a commercial silver staining method or a Coomassie Brilliant Blue (CBB) staining method were compared. Additional protein bands that were either not detected or poorly detected by a single method alone were readily observed by a combined silver-CBB staining method. This method also detected alterations in the profile of extracted proteins from organisms grown in the presence of galactose or hemoglobin rather than glucose. Two-dimensional electrophoresis (2-DE) gel analysis by double stain showed better detection of several acidic and basic protein spots. Less than 10% of the extract as determined by a dye-binding assay was lost following either or both lyophilization and dialysis. These manipulations of the extract did not change the protein profile following SDS-PAGE as determined by the combined staining or Western blot analysis of a 70 kDa protein. These observations suggest that soluble cell wall proteins are not unusually sensitive to procedures routinely used in protein purification. In addition, these studies suggest that a modified staining method that combines both silver stain and CBB stain provides improved detection of cell wall proteins compared to either method alone. PMID:10768782

  19. Decolorization of the textile dyes using purified banana pulp polyphenol oxidase.

    PubMed

    Jadhav, Umesh U; Dawkar, Vishal V; Jadhav, Mital U; Govindwar, Sanjay P

    2011-04-01

    Polyphenol oxidase (PPO) purified using DEAE-cellulose and Biogel P-100 column chromatography from banana pulp showed 12.72-fold activity and 2.49% yield. The optimum temperature and pH were found to be 30 degrees C and 7.0, respectively for its activity. Catechol was found to be a suitable substrate for banana pulp PPO that showed V(max), 0.041 mM min(-1) and K(m), 1.6 mM. The enzyme activity was inhibited by sodium metabisulfite, citric acid, cysteine, and beta-mercaptoethanol at 10 mM concentration. The purified enzyme could decolorize (90%) Direct Red 5B (160 microg mL(-1)) dye within 48 h and Direct Blue GLL (400 microg mL(-1)) dye up to 85% within 90 h. The GC-MS analysis indicated the presence of 4-hydroxy-benzenesulfonic acid and Naphthalene-1,2,3,6-tetraol in the degradation products of Direct Red 5B, and 5-(4-Diazenyl-naphthalene-1-ylazo)-8-hydroxy-naphthalene-2-sulfonic acid and 2-(4-Diazenyl-naphthalene-1-ylazo)-benzenesulfonic acid in the degradation products of Direct Blue GLL.

  20. Identification of a Passiflora alata Curtis dimeric peptide showing identity with 2S albumins.

    PubMed

    Ribeiro, Suzana M; Almeida, Renato G; Pereira, Camila A A; Moreira, João S; Pinto, Michelle F S; Oliveira, Antonio C; Vasconcelos, Ilka M; Oliveira, José T A; Santos, Marcelo O; Dias, Simoni C; Franco, Octávio L

    2011-05-01

    Antifungal proteins and peptides, essential compounds for plant defense, have been isolated from several tissues of various plants. These proteins could be used as a natural alternative to control phytopathogenic fungi. In this report a heterodimeric antifungal protein named Pa-AFP1, showing higher identity with the 2S albumin family, was purified by using 70-100% ammonium sulfate saturation and further purification steps such as anionic exchange Q-Sepharose chromatography associated with HPLC reversed-phase C4 chromatography. Analysis by Tricine-SDS-PAGE revealed two peptidic molecular masses of approximately 4500 Da and 7000 Da, in the presence of β-mercaptoethanol, while by removing the reducing agent a single protein with molecular mass of about 11,500 Da was obtained. Moreover, dimer mass was confirmed by MALDI-TOF analyses (11,569.76 Da). The antifungal protein, named Pa-AFP1, efficiently inhibited the growth of filamentous fungi Colletotrichum gloeosporioides, and was added to a short list of 2S albumins with antimicrobial properties. Otherwise, this same peptide showed no activity toward bacteria and yeasts. In summary, this compound could be used in the future to develop biotechnological products for the control of phytopathogenic fungi.

  1. Artifactual formation of disulfide bonds during SDS-PAGE analysis of type I copper proteins

    SciTech Connect

    Kumar, M.A.; Davidson, V.L. )

    1991-03-11

    Amicyanin is a monomeric Type I blue' copper protein, which possesses a single cysteine that serves as one of the ligands to copper. Amicyanin denatured by heating in SDS in the presence of {beta}-mercaptoethanol ({beta}ME) migrated during SDS-PAGE with an M{sub r} = 15,000. When heated in SDS in the absence of {beta}ME it exhibited an M{sub r} = 30,000. If treated with {beta}ME, but not heated it exhibited an M{sub r} = 15,000. Similar data were obtained with the small blue copper protein, azurin. Ascorbate oxidase is a multicopper enzyme which is composed of two identical non-covalently bound subunits, each of which possesses a Type I copper center. When this blue' oxidase was denatured by heating in SDS with {beta}ME, or incubated with {beta}ME without heating, a single band of M{sub r} = 70,000 was observed. When heated in SDS without {beta}ME, a species twice that size was observed. Thus, exposure during denaturation of the free sulfhydryl of the Type I copper binding site can cause formation of disulfide bonds between otherwise unlinked polypeptides.

  2. Hydrogen-enriched water restoration of impaired calcium propagation by arsenic in primary keratinocytes

    NASA Astrophysics Data System (ADS)

    Yu, Wei-Tai; Chiu, Yi-Ching; Lee, Chih-Hung; Yoshioka, Tohru; Yu, Hsin-Su

    2013-11-01

    Endemic contamination of artesian water for drinking by arsenic is known to cause several human cancers, including cancers of the skin, bladder, and lungs. In skin, multiple arsenic-induced Bowen's disease (As-BD) can develop into invasive cancers after decades of arsenic exposure. The characteristic histological features of As-BD include full-layer epidermal dysplasia, apoptosis, and abnormal proliferation. Calcium propagation is an essential cellular event contributing to keratinocyte differentiation, proliferation, and apoptosis, all of which occur in As-BD. This study investigated how arsenic interferes calcium propagation of skin keratinocytes through ROS production and whether hydrogen-enriched water would restore arsenic-impaired calcium propagation. Arsenic was found to induce oxidative stress and inhibit ATP- and thapsigaragin-induced calcium propagation. Pretreatment of arsenic-treated keratinocytes by hydrogen-enriched water or beta-mercaptoethanol with potent anti-oxidative effects partially restored the propagation of calcium by ATP and by thapsigaragin. It was concluded that arsenic may impair calcium propagation, likely through oxidative stress and interactions with thiol groups in membrane proteins.

  3. Isolation and characterization of a specific enterokinase inhibitor from kidney bean (Phaseolus vulgaris).

    PubMed

    Jacob, R T; Bhat, P G; Pattabiraman, T N

    1983-01-01

    A specific enterokinase inhibitor from kidney bean (Phaseolus vulgaris) was purified to homogeneity. It showed a single protein band on sodium dodecyl sulphate/polyacryl-amide-gel electrophoresis in the presence of mercaptoethanol, and the Mr was 31000. Aspartic acid was identified as the N-terminus of the inhibitor. The Mr by gel chromatography on Sephadex G-200 was found to be 60000, indicating the dimeric nature of the inhibitor. The inhibitor was found to be a glycoprotein. The monosaccharide moieties were glucose, mannose, glucuronic acid and glucosamine in the proportions 3.15%, 5.0%, 0.85% and 1.3% respectively. The inhibitor was most active on pig enterokinase, followed by bovine and human enterokinases. Maximal inhibitory activity was elicited by preincubation of the inhibitor with the enzyme for 15 min. Digestion with pepsin resulted in loss of inhibitory activity. The inhibitor was stable to exposure to a wide range of pH values (2-10), and exposure to pH above 10 resulted in loss of inhibitory activity. Modification of arginine residues by cyclohexane 1,2-dione and ninhydrin led to complete loss of enterokinase-inhibitory activity.

  4. Acoustic technology for high-performance disruption and extraction of plant proteins.

    PubMed

    Toorchi, Mahmoud; Nouri, Mohammad-Zaman; Tsumura, Makoto; Komatsu, Setsuko

    2008-07-01

    Acoustic technology shows the capability of protein pellet homogenization from different tissue samples of soybean and rice in a manner comparable to the ordinary mortar/pestle method and far better than the vortex/ultrasonic method with respect to the resolution of the protein pattern through two-dimensional polyacrylamide gel electrophoresis (2D-PAGE). With acoustic technology, noncontact tissue disruption and protein pellet homogenization can be carried out in a computer-controlled manner, which ultimately increases the efficiency of the process for a large number of samples. A lysis buffer termed the T-buffer containing TBP, thiourea, and CHAPS yields an excellent result for the 2D-PAGE separation of soybean plasma membrane proteins followed by the 2D-PAGE separation of crude protein of soybean and rice tissues. For this technology, the T-buffer is preferred because protein quantification is possible by eliminating the interfering compound 2-mercaptoethanol and because of the high reproducibility of 2D-PAGE separation.

  5. Cation-selective channels in the vacuolar membrane of Saccharomyces: Dependence on calcium, redox state, and voltage

    SciTech Connect

    Bertl, A.; Slayman, C.L. )

    1990-10-01

    The vacuolar membrane of the yeast Saccharomyces cerevisiae, which is proposed as a system for functional expression of membrane proteins, was examined by patch-clamp techniques. Its most conspicuous feature, in the absence of energizing substrates, is a cation channel /with a characteristic conductance of {approx}120 pS for symmetric 100 mM KCl solutions and with little selectivity between K{sup {plus}} and Na{sup {plus}} but strong selectivity for cations over anions. Channel gating is voltage-dependent. The time-averaged current-voltage curve shows strong rectification, with negative currents much larger than positive currents. The open probability also depends strongly on cytoplasmic Ca{sup 2{plus}} concentration but, for ordinary recording conditions, is high only at unphysiologically high Ca{sup 2{plus}}. However, reducing agents such as dithiothreitol and 2-mercaptoethanol poise the channels so that they can be activated by micromolar cytoplasmic Ca{sup 2{plus}}. The channels are blocked irreversibly by chloramine T, which is known to oxidize exposed methionine and cysteine residues specifically.

  6. 9S binding protein for androgens and progesterone.

    PubMed

    Wilson, E M; Lea, O A; French, F S

    1977-05-01

    A steroid binding protein fraction with a sedimentation coefficient of approximately 9 S (molecular weight approximately equal to 200,000) has been identified in 105,000 X g supernatants of several androgen-responsive organs. Highest concentrations were found in epididymis and testis, but small amounts were detected in prostate, seminal vesicle, kidney, submandibular gland, and lung. The 9S protein binds [3H]dihydrotestosterone (17beta-hydroxy-5alpha-androstan-3-one) and [3H]progesterone (4-pregnene-3,20-dione) with equilibrium binding constants of approximately 10(5) M-1 and 10(6) M-1, respectively. The concentration of 9S binding sites in epididymis is approximately 10(-11) mol/mg of supernatant protein, which is at least 10(5) times greater than the concentration of androgen receptor. 9S binding protein appears to be a nonsecretory, intracellular protein and has properties different from the andorgen receptor. It is unretarded on DEAE-Sephadex chromatography at pH 8.0, and its sedimentation rate on sucrose gradients is not altered at high ionic strength (0.4 M KCl). Like the androgen receptor, its binding activity, which is maximal between pH 7 and 9.5, is heat labile, decreased by sulfhydryl reagents, and enhanced by 2-mercaptoethanol. It is suggested that because of its high concentration and low affinity, 9S binding protein may function in the intracellular accumulation of compartmentalization of androgens or progesterone.

  7. An Improved Method for Analysis of Polyamines in Plant Tissue by Precolumn Derivatization with o-Phthalaldehyde and Separation by High Performance Liquid Chromatography 1

    PubMed Central

    Corbin, James L.; Marsh, Barry H.; Peters, Gerald A.

    1989-01-01

    An improved high-performance liquid-chromatographic method was developed for estimation of polyamines in crude plant extracts. Polyamines were derivatized with o-phthalaldehyde and mercaptoethanol (OPT). The fluorescent derivatives were eluted from a C18 column with the dimethylcyclohexylamine-phosphate buffer derived by T. Skaaden and T. Greibrokk ([1982] J Chromatogr 247: 111-122) after treatment to remove impurities in the buffer. The method had a sensitivity of 1-2 picomoles and completely resolved nine polyamines (agmatine, spermine, nor-spermidine, spermidine, 3,5-homospermidine, 4,4-homospermidine, 1,3-diaminopropane, putrescine, and cadaverine) in 12 to 14 minutes. An optional ion-exchange step was used to remove less basic amines (including amino acids) and to concentrate the crude extracts. This method was compared with benzoyl chloride derivatization. Use of the benzoyl chloride method vastly under-estimated the amount of polyamine in some plant extracts, a problem not encountered with the OPT procedure. Additionally, the OPT procedure resolved two isomers of homospermidine found in Azolla caroliniana. These two isomers were not resolved with the benzoylation method. Overall, the OPT method described here requires preparation and analysis time similar to other current methods but provides greater sensitivity and selectivity. PMID:16666789

  8. Sensitivity enhancement in the fluorometric determination of aliphatic amines using naphthalene-2,3-dicarboxaldehyde derivatization followed by vortex-assisted liquid-liquid microextraction.

    PubMed

    Wang, Chin-Yi; Tung, Shu-Yin; Lo, Yu-Shiu; Huang, Hsien-Lu; Ko, Chun-Han; Wu, Chien-Hou

    2016-05-15

    A highly sensitive liquid chromatographic method was developed for the fluorometric determination of trace amounts of linear aliphatic primary amines. Prior to extraction, amines were derivatized with naphthalene-2,3-dicarboxaldehyde (NDA) in the presence of cyanide ion (CN) and extracted by vortex-assisted liquid-liquid microextraction (VALLME). The optimum conditions were as follows: derivatization reaction time for 5 min in 2.0 mL aqueous donor samples with 50 μM NDA/CN, and 10mM borate buffer at pH 9; vortex extraction time for 20s in the VALLME step with 50 μL of isooctane as the extractant phase; centrifugation for 1 min at 6000 rpm. Under the optimum conditions, the limits of detection (LOD) were between 0.01 and 0.04 nmol L(-1). The calibration curves showed good linearity in the range of 0.1-20 nmol L(-1). In comparison with previous work using o-phthalaldehyde/2-mercaptoethanol derivatization, the method has much more stable fluorescent derivatives, higher fluorescence intensities, and greater extraction efficiencies. The sensitivity enhancement factors (SEF) were between 2 and 70, which is in good agreement with the theoretical values calculated from partition coefficients in VALLME system.

  9. Vortex-assisted liquid-liquid microextraction coupled with derivatization for the fluorometric determination of aliphatic amines.

    PubMed

    Chang, Wei-Yao; Wang, Chin-Yi; Jan, Jeng-Lyan; Lo, Yu-Shiu; Wu, Chien-Hou

    2012-07-27

    A new one-step derivatization and microextraction technique was developed for the fluorometric determination of C(1)-C(8) linear aliphatic primary amines in complex sample solutions containing high levels of amino acids. In this method, amines were derivatized with o-phthalaldehyde (OPA) and 2-mercaptoethanol (2-ME) in aqueous solution and extracted simultaneously by vortex-assisted liquid-liquid microextraction (VALLME). Parameters affecting the extraction efficiency were investigated in detail. The optimum conditions were as follows: 50 μL of isooctane as the extractant phase; 2.0 mL aqueous donor samples with 12 mM OPA, 24 mM 2-ME, and 0.1 M borate buffer at pH 10; 1 min vortex extraction time; centrifugation for 4 min at 6000 rpm. After centrifugation, the enriched analytes in the floated extractant phase were determined by HPLC-FL in less than 14 min. Under the optimum conditions, the limits of detection were of the order of 0.09-0.31 nM. The calibration curves showed good linearity over the investigated concentration range between 0.4 and 40 nM. The proposed method has been applied to the determination of aliphatic amines in acidophilus milk, beer, and Cu(II)/amino acid solution.

  10. Rapid approach to biobased telechelics through two one-pot thiol-ene click reactions.

    PubMed

    Lluch, Cristina; Ronda, Joan C; Galià, Marina; Lligadas, Gerard; Cádiz, Virginia

    2010-06-14

    The application of environmentally friendly thiol-ene chemistry to the preparation of biobased telechelics is presented in this work. This methodology is based on two one-pot photoinitiated thiol-ene click processes: step-growth polymerization using a 3,6-dioxa-1,8-octanedithiol and end-group postpolymerization modification with three functional thiols: 2-mercaptoethanol, 3-mercaptopropionic acid, and 3-mercaptopropyltrimethoxysilane. We applied this approach to a potentially 100% biomass-derived monomer, allyl ester of 10-undecenoic acid (UDA). To show the generality and scope of this methodology, a series of well-defined telechelics with molecular weight ranging from 1000-3000 g/mol and hydroxyl, carboxyl, or trimethoxysilyl groups at the polymer terminus were prepared. An exhaustive (1)H NMR and MALDI-TOF MS analyses demonstrates the highly end-group fidelity of this methodology being an interesting procedure for the accelerated preparation of telechelics derived from divinyl monomers. UDA-based thelechelic diol prepared using this methodology was reacted with 4,4'-methylenebis(phenylisocyanate) and 1,4-butanediol as the chain extender to obtain multiblock poly(ester urethane).

  11. Purification and properties of arginase from human liver and erythrocytes.

    PubMed Central

    Berüter, J; Colombo, J P; Bachmann, C

    1978-01-01

    Arginase was isolated from human liver and erythrocytes. The purification procedure used acetone precipitation, heat-treatment, (NH4)2SO4 precipitation, DEAE-cellulose chromatography and gel filtration on Sephadex G-200 in the presence of 2-mercaptoethanol. Both enzymes migrated to the anode at pH8.3 on polyacrylamide-gel electrophoresis. After incubation at pH8.0 and 37 degrees C the purified anionic liver arginase migrated to the cathode on polyacrylamide-gel electrophoresis. It is assumed that the multiple forms of the enzyme reported in the literature are partly artifacts of the purification procedure. The liver arginase showed a mol.wt. of 107000 determined by gel filtration and a sedimentation coefficient of 5.9S. Treatment of the liver enzyme with 0.25% sodium dodecyl sulphate at pH10 demonstrated an oligomeric structure of the enzyme with a mol.wt. of the subunit of 35000. The kinetic properties determined for the purified liver arginase showed an optimum pH of 9.3 and an optimal MnCl2 concentration of 2mM. The Km for L-arginine was 10.5 mM and for L-canavanine 50mM, and L-lysine exhibited a competitive type of inhibition with a Ki of 4.4mM. L-Homoarginine was not a substrate for liver arginase. PMID:743206

  12. Application of a direct agglutination test for detection of specific anti-Leishmania antibodies in the canine reservoir.

    PubMed Central

    el Harith, A; Slappendel, R J; Reiter, I; van Knapen, F; de Korte, P; Huigen, E; Kolk, A H

    1989-01-01

    A direct agglutination test (DAT) for detection of visceral leishmaniasis in humans has been developed. In this study, it was evaluated for applicability to detection of infections in dogs, a reservoir species. The reliability of the test was improved by treating the test sera with 0.2 M 2-mercaptoethanol and incubating them at 37 degrees C. Sensitivity was 100% and specificity was 98.9% when the test was used on serum samples from 220 dogs, including 26 with parasitologically confirmed canine leishmaniasis, 12 with suspected but unconfirmed leishmaniasis, and 182 with other conditions. The DAT detected specific antibodies in 10 dogs with canine leishmaniasis diagnosed by case history, clinical signs of leishmaniasis, and seropositivity in an immunofluorescence test using either promastigotes or amastigotes, as well as in 2 dogs suspected of having leishmaniasis. The performance of an antigen prepared from a homologous isolate of Leishmania infantum in the DAT was compared with that of an antigen from a laboratory-adapted strain of L. donovani (sensu lato). The homologous antigen compared favorably with the standard antigen, and the results provided further evidence of the potential of the DAT for detection of Leishmania infection in the canine reservoir host. The results of this study, together with those of our previous studies in human visceral leishmaniasis, demonstrate that the DAT is highly suitable for wide-scale epidemiological and ecological field work. This technique could also facilitate diagnosis of leishmaniasis in dogs in veterinary health services. Images PMID:2685025

  13. Enzymatic conversion of dihydroneopterin triphosphate to the pyrimidodiazepine intermediate involved in the biosynthesis of the drosopterins in Drosophila melanogaster.

    PubMed

    Wiederrecht, G J; Paton, D R; Brown, G M

    1984-02-25

    The compound 2-amino-4-oxo-6-acetyl-7,8-dihydro-3H,9H-pyrimido[4,5-b]-[1,4]diazepine (pyrimidodiazepine or PDA, for short) is a precursor of the red eye pigments called the drosopterins in Drosophila melanogaster. The precursor of PDA is 2-amino-4-oxo-6-(D-erythro-1',2',3'-trihydroxypropyl)-7,8-dihydrop teridine triphosphate (dihydroneopterin triphosphate or H2-NTP). The synthesis of of PDA from H2-NTP requires reduced glutathione, another thiol such as 2-mercaptoethanol, Mg2+, and at least three enzymes: one that is missing in the eye color mutant, sepia; one that is present only in limited quantities in the mutant, clot; and a third one that has been described as sepiapterin synthase A. The last enzyme is present only in relatively small quantities in the mutant, purple. Because PDA is two electrons more reduced than H2-NTP, it would appear that the reducing power needed for this transformation is probably supplied by glutathione. Oxidized glutathione cannot replace reduced glutathione in the system. The yield of PDA produced enzymatically from H2-NTP can be as high as 40% under optimal conditions.

  14. High efficiency transport of quantum dots into plant roots with the aid of silwet L-77.

    PubMed

    Hu, Yong; Li, Jun; Ma, Lu; Peng, Qionglin; Feng, Wei; Zhang, Lu; He, Shibin; Yang, Fei; Huang, Jing; Li, Lijia

    2010-08-01

    Quantum dots (QDs) are a novel type of small, photostable and bright fluorophores that have been successfully applied to mammalian and human live cell imaging. In this study, highly dispersive water-soluble mercaptoacetic acid (MAA)-coated CdSe/ZnS QDs were synthesized, which were suitable for investigation as fluorescent probe labels. The treatment of maize seedling roots with QDs showed that the surfactant silwet L-77 aided the efficient transport of QDs into maize roots. Under a concentration ranging from 0.128 to 1.28 microM, QDs caused very low cytotoxicity on maize seed germination and root growth. The addition of mercuric chloride to the Hoagland solution resulted in a decrease of QD content in root tissues, and this decrease was reversed upon the addition of beta-mercaptoethanol, which suggests that mercury-sensitive processes play a significant role in regulating QD flow in the maize root system. We speculate that the apoplastic pathway can contribute substantially to the total quantity of QDs reaching the stele. Therefore, based on this transport approach, MAA-coated QDs can be utilized for live imaging in plant systems to verify known physiological processes. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  15. Cellular and Humoral Antibody Responses of Normal Pastel and Sapphire Mink to Goat Erythrocytes

    PubMed Central

    Lodmell, D. L.; Bergman, R. K.; Hadlow, W. J.; Munoz, J. J.

    1971-01-01

    This study was undertaken to determine whether normal sapphire and royal pastel mink differ immunologically at the cellular and humoral levels. Two days after primary intraperitoneal (ip) inoculation of goat erythrocytes (GE), essentially no 19 or 7S plaque-forming cells (PFC) per 106 cells were detected in spleen or in abdominal and peripheral lymph nodes of either color phase. On the 4th day, more 19S PFC were detected in pastel than in sapphire tissues; pastel tissues also contained 7S PFC, whereas essentially none was present in sapphires until the 6th day. After an ip booster inoculation, the number of PFC was markedly different between the two color phases. These differences were most apparent in spleen and peripheral lymph nodes. In parallel with differences observed in PFC responses between the color phases, total hemolysin and 2-mercaptoethanol-resistant hemolysin titers of pastels exceeded those of sapphires in all but one interval after the primary, and at every interval after the booster, inoculation. These data indicate that sapphire mink are not immunological cripples, nor are they immunologically hyperactive, but that differences do exist between sapphire and royal pastel mink, especially in the response to booster injections of GE. PMID:16557957

  16. Cellular and humoral antibody responses of normal pastel and sapphire mink to goat erythrocytes.

    PubMed

    Lodmell, D L; Bergman, R K; Hadlow, W J; Munoz, J J

    1971-02-01

    This study was undertaken to determine whether normal sapphire and royal pastel mink differ immunologically at the cellular and humoral levels. Two days after primary intraperitoneal (ip) inoculation of goat erythrocytes (GE), essentially no 19 or 7S plaque-forming cells (PFC) per 10(6) cells were detected in spleen or in abdominal and peripheral lymph nodes of either color phase. On the 4th day, more 19S PFC were detected in pastel than in sapphire tissues; pastel tissues also contained 7S PFC, whereas essentially none was present in sapphires until the 6th day. After an ip booster inoculation, the number of PFC was markedly different between the two color phases. These differences were most apparent in spleen and peripheral lymph nodes. In parallel with differences observed in PFC responses between the color phases, total hemolysin and 2-mercaptoethanol-resistant hemolysin titers of pastels exceeded those of sapphires in all but one interval after the primary, and at every interval after the booster, inoculation. These data indicate that sapphire mink are not immunological cripples, nor are they immunologically hyperactive, but that differences do exist between sapphire and royal pastel mink, especially in the response to booster injections of GE.

  17. Fatal toxoplasmosis in free-ranging endangered 'Alala from Hawaii

    USGS Publications Warehouse

    Work, Thierry M.; Massey, J. Gregory; Rideout, Bruce A.; Gardiner, Chris H.; Ledig, David B.; Kwok, O.C.H.; Dubey, J.P.

    2000-01-01

    The ‘Alala (Corvus hawaiiensis) is the most endangered corvid in the world, and intensive efforts are being made to reintroduce it to its former native range in Hawaii. We diagnosed Toxoplasma gondii infection in five free-ranging ‘Alala. One ‘Alala, recaptured from the wild because it was underweight and depressed, was treated with diclazuril (10 mg/kg) orally for 10 days. Antibodies were measured before and after treatment by the modified agglutination test (MAT) using whole T. gondii tachyzoites fixed in formalin and mercaptoethanol. The MAT titer decreased four-fold from an initial titer of 1:1,600 with remarkable improvement in physical condition. Lesions of toxoplasmosis also were seen in two partially scavenged carcasses and in a third fresh intact carcass. Toxoplasma gondii was confirmed immunohistochemically by using anti-T. gondii specific serum. The organism was also cultured by bioassay in mice from tissues of one of these birds and the brain of a fifth ‘Alala that did not exhibit lesions. The life cycle of the parasite was experimentally completed in cats. This is the first record of toxoplasmosis in ‘Alala, and the parasite appears to pose a significant threat and management challenge to reintroduction programs for ‘Alala in Hawaii.

  18. Purification of tomato yellow leaf curl geminivirus.

    PubMed

    Luisoni, E; Milne, R G; Vecchiati, M

    1995-07-01

    Attempts were made to find a good purification procedure for tomato yellow leaf curl virus (TYLCV), a dangerous and continuously spreading whitefly-transmitted germinivirus, up to now only partially purified. Electron microscopy, serology and spectrophotometry were used to evaluate different procedures. The scheme finally adopted was the following: collect leaves and stems from Nicotiana benthamiana graft-infected 45-60 days previously (5-10 g/plant); homogenize with 0.5 M phosphate buffer pH 6 containing 2.5 mM NaEDTA, 10 mM Na2SO3, 0.1% 2-mercaptoethanol, 1% Triton X-100 and 0.1% Driselase (3-4 ml of buffer for each g of material); incubate overnight on ice with gentle agitation; filter; emulsify with 15% cold chloroform; centrifuge at low speed; ultracentrifuge supernatant; resuspend pellets in 0.5 M phosphate buffer pH 7 containing 2.5 mM NaEDTA; centrifuge at low speed; repeat resuspension of the pellets and low-speed centrifugation; ultracentrifuge the pooled supernatant on a Cs2SO4 gradient (e.g. for 5 h at 41,000 rpm); collect the virus band and dialyse or ultracentrifuge the virus. The virus yield was 5-10 mg per kg of tissue.

  19. Toxicity induced by cumene hydroperoxide in PC12 cells: protective role of thiol donors.

    PubMed

    Vimard, F; Saucet, M; Nicole, O; Feuilloley, M; Duval, D

    2011-01-01

    Oxidative shock and production of reactive oxygen species are known to play a major role in situations leading to neuron degeneration, but the precise mechanisms responsible for cell degeneration remain uncertain. In the present article, we have studied in PC 12 cells the effect of cumene hydroxyperoxide on both cell metabolism and morphology. We observed that relatively low concentrations of the drug (100 μM) led to a significant decrease in the cellular content of ATP and reduced glutathione as well as to a decreased mitochondrial potential. These metabolic alterations were followed by an important increase in intracellular free calcium and membrane disruption and death. In parallel, we observed profound changes in cell morphology with a shortening of cell extensions, the formation of ruffles and blebs at the cell surface, and a progressive detachment of the cells from the surface of the culture flasks. We also showed that addition of thiol donors such as N-acetylcysteine or β-mercaptoethanol, which were able to enhance cell glutathione content, almost completely protected PC 12 cells from the toxic action of cumene hydroperoxide whereas pretreatment by buthionine sulfoximine, a selective inhibitor of GSH synthesis, enhanced its action.

  20. High quality RNA extraction from Maqui berry for its application in next-generation sequencing.

    PubMed

    Sánchez, Carolina; Villacreses, Javier; Blanc, Noelle; Espinoza, Loreto; Martinez, Camila; Pastor, Gabriela; Manque, Patricio; Undurraga, Soledad F; Polanco, Victor

    2016-01-01

    Maqui berry (Aristotelia chilensis) is a native Chilean species that produces berries that are exceptionally rich in anthocyanins and natural antioxidants. These natural compounds provide an array of health benefits for humans, making them very desirable in a fruit. At the same time, these substances also interfere with nucleic acid preparations, making RNA extraction from Maqui berry a major challenge. Our group established a method for RNA extraction of Maqui berry with a high quality RNA (good purity, good integrity and higher yield). This procedure is based on the adapted CTAB method using high concentrations of PVP (4 %) and β-mercaptoethanol (4 %) and spermidine in the extraction buffer. These reagents help to remove contaminants such as polysaccharides, proteins, phenols and also prevent the oxidation of phenolic compounds. The high quality of RNA isolated through this method allowed its uses with success in molecular applications for this endemic Chilean fruit, such as differential expression analysis of RNA-Seq data using next generation sequencing (NGS). Furthermore, we consider that our method could potentially be used for other plant species with extremely high levels of antioxidants and anthocyanins.

  1. Determination of ammonium ion by fluorometry or spectrophotometry after on-line derivatization with o-phthalaldehyde

    NASA Technical Reports Server (NTRS)

    Goyal, S. S.; Rains, D. W.; Huffaker, R. C.

    1988-01-01

    A fast, sensitive, simple, and highly reproducible method for routine assay of ammonium ion (NH4+) was developed by using HPLC equipment. The method is based on the reaction of NH4+ with o-phthalaldehyde (OPA) in the presence of 2-mercaptoethanol. After an on-line derivatization, the resulting NH4(+)-OPA product was quantified by using fluorometric or spectrophotometric detection. For fluorometric detection, the excitation and emission wavelengths were 410 and 470 nm, respectively. The spectrophotometric detection was made by measuring absorbance at 410 nm. Results on the effects of OPA-reagent composition and pH, reaction temperature, sample matrix, and linearity of the assay are presented. Even though it took about 2 min from the time of sample injection to the appearance of sample peak, sample injections could be overlapped at an interval of about 1 min. Thus, the actual time needed for analysis was about 1 min per assay. The method can be used in a fully automated mode by using an autosampler injector.

  2. [Human Bone Marrow Mesenchymal Stem Cells Differentiate into Neuron-Like Cells In Vitro

    PubMed

    Guo, Zi-Kuan; Liu, Xiao-Dan; Hou, Chun-Mei; Li, Xiu-Sen; Mao, Ning

    2001-03-01

    Recent reports have clearly demonstrated that bone marrow cells can be differentiated into neurons, suggesting the existence of cells with the differentiation capacity in the bone marrow cell population. It is well known that hematopoietic stem cells as well as mesenchymal stem cells (MSCs) can be transplanted and therefore, alternative of them might contribute to the process. In the present study it was addressed whether marrow MSCs could be coaxed into neuron-specific antigen bearing cells and if so, whether the differentiated cells possess the cytochemical features seen in neurons. The report here showed that high concentration of 2-mercaptoethanol (2-ME) could induce some of the MSCs into neuron-like cells expressing neurofilament (NF) and neuron specific enolase (NSE). The neuron-like cells were alkaline phosphotase positive while the others MSCs were kept negative. Cells treated with 2-ME were positive for alpha-naphthylacetate esterase and glycogen and negative for acetylchonlinesterase, which were similar with the results seen in untreated cells. Furthermore, Nissel body was not observed in treated cells shown by toluidine blue staining. Therefore, it is likely that the cells described here seem not belong to the neuronal lineage. These findings, however, reveal that human MSCs could alter their committed fates under some circumstances.

  3. Mercury hinders recovery of shoot hydraulic conductivity during grapevine rehydration: evidence from a whole-plant approach.

    PubMed

    Lovisolo, Claudio; Schubert, Andrea

    2006-01-01

    This experiment aimed to test whether recovery of shoot hydraulic conductivity after drought depends on cellular metabolism in addition to xylem hydraulics. We rehydrated droughted grapevines (Vitis vinifera) after treating intact plants through the root with 0.5 mm mercuric chloride (a metabolic inhibitor) at the end of the stress period, before rehydration. The contribution of mercury-inhibited water transport in both shoot and root, and the extent of shoot vessel embolization, were assessed. Drought stress decreased plant water potential and induced embolization of the shoot vessels. The rehydration in Hg-untreated plants re-established both shoot water potential and specific shoot hydraulic conductivity (Kss) at levels comparable with watered controls, and induced recovery of most of the embolisms formed in the shoot during the drought. In contrast, in plants treated with HgCl2, recovery of Kss and root hydraulic conductance were impaired. In rehydrated, Hg-treated plants, the effects of Hg on Kss were reversed when either the shoot or the root was treated with 60 mM beta-mercaptoethanol as a mercuric scavenger. This work suggests that plant cellular metabolism, sensitive to mercuric chloride, affects the recovery of shoot hydraulic conductivity during grapevine rehydration by interfering with embolism removal, and that it involves either the root or the shoot level.

  4. Acidic-phosphoprotein phosphatase activity of rat ventral prostate nuclei: apparent lack of effect of androgens.

    PubMed

    Wilson, M J; Ahmed, K; Fischbach, T J

    1978-08-03

    A protein phosphatase activity has been demonstrated in nuclei of rat ventral prostate utilizing 32P-labelled phosvitin as a model acidic phosphoprotein substrate. This phosphoprotein phosphatase has a pH optimum of 6.7, is unaffected by the sulphydryl protecting agent 2-mercaptoethanol, and requires a divalent cation for maximal activity. Of the various divalent cations tested, Mg2+ is the most effective in reactivating the EDTA-inhibited enzyme. The phosphatase is inhibited by sodium flouride, sodium oxalate, N-ethylmaleimide, ATP and ADP but is relatively insensitive to ammonium molybdate. Increased ionic strength of the reaction medium also causes a reduction in the enzyme activity, e.g., by 48% at 200 mM sodium chloride. The activity of the acidic phosphoprotein phosphatase did not change significantly at 48 h or 96 h post-orchiectomy when expressed per unit of nuclear protein. However, it is reduced by approx. 30% at these times after castration if based on DNA content. The decline in activity per nucleus reflects the decrease in the realtive nuclear protein content observed at 48 h or 96 h post-orchiectomy. This suggests that the decline in the phosphorylation of prostatic nuclear acidic proteins which occurs upon androgen withdrawal is not due to increased nuclear phosphatase activity.

  5. Immune response in the turtle (Chrysemys picta)

    PubMed Central

    Coe, J. E.

    1972-01-01

    The immune response of painted turtles (Chrysemys picta) to four purified protein antigens was evaluated by radioimmunoelectrophoresis. Specific antibody production was consistently detected and antigen binding was related to four immunoglobulin (Ig) precipitin lines (called Ig1, 2, 3, 4) in turtle serum. Antibody activity was detected first in the Ig1 or Ig2 and then later in the course of immunization in Ig3 and Ig4. Ig1 was about 19S in size, was not detectable after reduction and alkylation, and was the only Ig absent from turtle lymph. Ig3 and Ig4 were about 7S in size and Ig2 appeared slightly heavier by sucrose density gradient and Sephadex G-200 analysis. Haemagglutinins produced after primary inoculation were routinely sensitive to mild reduction and alkylation although antigen-binding capacity was still detectable. However, mercaptoethanol-resistant haemagglutinins were found in sera from turtles after booster injections of antigen. The electrophoretically slowest gamma globulin in turtle serum did not develop specific antigen-binding capacity, but did bind Fe59 and presumably represents a transferrin-like protein. ImagesFIG. 1FIG. 2FIG. 4 PMID:4114647

  6. Trypsin inhibitor in mung bean cotyledons: purification, characteristics, subcellular localization, and metabolism.

    PubMed

    Chrispeels, M J; Baumgartner, B

    1978-04-01

    Trypsin inhibitor was purified to homogeneity from seeds of the mung bean (Vigna radiata [L.] Wilczek). The protease inhibitor has the following properties: inhibitory activity toward trypsin, but not toward chymotrypsin; isoelectric point at pH 5.05; molecular weight of 11,000 to 12,000 (sodium dodecyl sulfate gel electrophoresis) or 14,000 (gel filtration); immunological cross-reactivity against extracts of black gram and black-eyed pea, but not against soybean; no inhibitory activity against vicilin peptidohydrolase, the principal endopeptidase in the cotyledons of mung bean seedlings.The trypsin inhibitor content of the cotyledons declines in the course of seedling growth and the presence of an inactivating factor can be demonstrated by incubating crude extracts in the presence of beta-mercaptoethanol. This inactivating factor may be a protease as vicilin peptidohydrolase rapidly inactivates the trypsin inhibitor. Removal of trypsin inhibitory activity from crude extracts by means of a trypsin affinity column does not result in an enhancement of protease activity in the extracts.The intracellular localization of trypsin inhibitor was determined by fractionation of crude extracts on isopycnic sucrose gradients and by cytochemistry with fluorescent antibodies. Both methods indicate that trypsin inhibitor is associated with the cytoplasm and not with the protein bodies where reserve protein hydrolysis occurs. No convincing evidence was obtained which indicates that the catabolism of trypsin inhibitor during germination and seedling growth is causally related to the onset of reserve protein breakdown.

  7. Microtubule assembly and in vitro development of bovine oocytes with increased intracellular glutathione level prior to vitrification and in vitro fertilization.

    PubMed

    Hara, H; Yamane, I; Noto, I; Kagawa, N; Kuwayama, M; Hirabayashi, M; Hochi, S

    2014-11-01

    Although vitrification is a useful technique for preservation of bovine oocytes, the yield of blastocysts derived from the vitrified oocytes is still low. We have recently reported a new type of cryoinjury, multiple aster formation, by which pronuclear migration and development of vitrified-warmed and in vitro-fertilized bovine oocytes are impaired. The aim of the present study was to investigate the effect of glutathione (GSH) content of vitrified bovine oocytes on multiple aster formation and subsequent in vitro development. Treatment of bovine cumulus-oocyte complexes with β-mercaptoethanol (βME) and L-cysteine (Cys) during in vitro maturation resulted in 2.5-fold higher GSH content not only in fresh control but also in vitrified-warmed oocytes. The percentage of normally fertilized zygotes exhibiting sperm aster(s) was >95% in all four groups (with or without βME/Cys × fresh control or vitrified). The frequency of multiple aster formation in vitrified oocytes (three-fold higher than that in fresh control oocytes) was not affected by the increased level of intracellular GSH with βME/Cys. Consequently, the migration and development of pronuclei as well as the yield of blastocysts from vitrified-warmed oocytes (17 versus 41%) were not improved. In addition, there was no effect of increased GSH level on the yield of blastocysts in fresh control groups.

  8. Induction of mice adult bone marrow mesenchymal stem cells into functional motor neuron-like cells.

    PubMed

    Abdullah, Rafal H; Yaseen, Nahi Y; Salih, Shahlaa M; Al-Juboory, Ahmad Adnan; Hassan, Ayman; Al-Shammari, Ahmed Majeed

    2016-11-01

    The differentiation of mesenchymal stem cells (MSC) into acetylcholine secreted motor neuron-like cells, followed by elongation of the cell axon, is a promising treatment for spinal cord injury and motor neuron cell dysfunction in mammals. Differentiation is induced through a pre-induction step using Beta- mercaptoethanol (BME) followed by four days of induction with retinoic acid and sonic hedgehog. This process results in a very efficient differentiation of BM-MSCs into motor neuron-like cells. Immunocytochemistry showed that these treated cells had specific motor neural markers: microtubule associated protein-2 and acetylcholine transferase. The ability of these cells to function as motor neuron cells was assessed by measuring acetylcholine levels in a culture media during differentiation. High-performance liquid chromatography (HPLC) showed that the differentiated cells were functional. Motor neuron axon elongation was then induced by adding different concentrations of a nerve growth factor (NGF) to the differentiation media. Using a collagen matrix to mimic the natural condition of neural cells in a three-dimensional model showed that the MSCs were successfully differentiated into motor neuron-like cells. This process can efficiently differentiate MSCs into functional motor neurons that can be used for autologous nervous system therapy and especially for treating spinal cord injuries. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Tyrosine decarboxylase activity of Lactobacillus brevis IOEB 9809 isolated from wine and L. brevis ATCC 367.

    PubMed

    Moreno-Arribas, V; Lonvaud-Funel, A

    1999-11-01

    Tyramine, a frequent amine in wines, is produced from tyrosine by the tyrosine decarboxylase (TDC) activity of bacteria. The tyramine-producing strain Lactobacillus brevis IOEB 9809 isolated from wine and the reference strain L. brevis ATCC 367 were studied. At the optimum pH, 5.0, K(m) values of IOEB 9809 and ATCC 367 crude extracts for L-tyrosine were 0.58 mM and 0.67 mM, and V(max) was higher for the wine strain (115 U) than the ATCC 367 (66 U). TDC exhibited a preference for L-tyrosine over L-DOPA as substrate. Enzyme activity was pyridoxal-5'-phosphate (PLP)-dependent and it was stabilized by the substrate and coenzyme. In contrast, glycerol and beta-mercaptoethanol strongly inhibited TDC. Tyramine competitively inhibited TDC for both strains. Citric acid, lactic acid and ethanol had an inhibitory effect on cells and crude extracts, but none could inhibit TDC at the usual concentrations in wines.

  10. Investigations on a hyper-proteolytic mutant of Beauveria bassiana: broad substrate specificity and high biotechnological potential of a serine protease.

    PubMed

    Borgi, Ines; Gargouri, Ali

    2014-02-01

    A new strain of Beauveria bassiana was identified on the basis of the 18S rRNA gene sequence homology. This strain, called P2, is a spontaneously arisen mutant that was isolated after successive sub-culturing the wild-type B. bassiana P1 strain. P2 showed hyper-production of extracellular protease(s) as much as ninefold more than P1. An extracellular protease (SBP) having a molecular weight of 32 kDa was purified from the P2 strain. SBP was completely inhibited by the phenyl methyl sulphonyl fluoride, which suggests that it belongs to the serine protease family. Based on the homology analysis of its N-terminal and the gene sequences, the enzyme was identified as subtilisin. The enzyme displays maximum activity at 60 °C and pH 8, and was stable at pH 6-12. The enzyme hydrolyses natural proteins such as keratin and is activated in presence of β-mercaptoethanol and Tween detergents. SBP was compatible with some laundry detergent formulations and showed high efficacy in the removal of blood stains from cotton fabric. Moreover, it was observed to degrade the melanised feathers and to hydrolyse the gelatine from X-ray films. All these results highlight the suitability of SBP protease as a very efficient microbial bio-resource.

  11. Subunit structure of karatasin, the proteinase isolated from Bromelia plumieri (karatas).

    PubMed

    Montes, C; Amador, M; Cuevas, D; Cordoba, F

    1990-01-01

    Close to 15% of the karatasin proteinase activity in the fruit juice of Bromelia plumieri (karatas) is present outside dialysis Visking tubing in 7 days in 0.2 M acetate buffer (pH) 3.5 or 6.5) containing phenyl mercuric acetate. The small proteinase(s), distinct from the 85% activity in juice due to nondialysable karatasin with a reported Mr of 24,868, separates across Spectrapore (13 kDa) membranes but not across Spectrapore with 3.5 kDa average pore diameter. The dialyzed proteinase is named karatasin-D (K-D). Purified non-Dialysable karatasin can be dissociated to what seems to be K-D by incubation in a buffer solution, containing SDS and 2-mercaptoethanol with phenyl mercuric acetate, in dialysis experiments for 8 days at room temperature using Spectrapore 13 kDa tubing. Thus, native karatasin in B. plumieri fruit juice seem to be the result of association of 2 small molecular mass K-D subunits, linked together by disulfide bonds and electrostatic forces, in equilibrium with small amounts of free K-D molecules. The amino acid composition and partial sequence of karatasin up to the 14th position from the amino terminus have discrete analogies with papain and with stem bromelain.

  12. Newly isolated Bacillus sp. G51 from Patagonian wool produces an enzyme combination suitable for felt-resist treatments of organic wool.

    PubMed

    Iglesias, Martín S; Sequeiros, Cynthia; García, Sebastián; Olivera, Nelda L

    2017-06-01

    Bacteria from Patagonian Merino wool were isolated to assess their wool-keratinolytic activity and potential for felt-resist treatments. Strains from Bacillus, Exiguobacterium, Deinococcus, and Micrococcus produced wool-degrading enzymes. Bacillus sp. G51 showed the highest wool-keratinolytic activity. LC-MS/MS analysis revealed that G51 secreted two serine proteases belonging to the peptidase family S8 (MEROPS) and a metalloprotease associated with Bacillolysin, along with other enzymes (γ-glutamyltranspeptidase and dihydrolipoyl dehydrogenases) that could be involved in reduction of keratin disulfide bonds. Optimum pH and temperature of G51 proteolytic activity were 9 and 60 °C, respectively. More than 80% of activity was retained in H2O2, Triton X-100, Tween 20, Lipocol OXO650, Teridol B, and β-mercaptoethanol. Treatment of wool top with G51 enzyme extract caused a decrease in wool felting tendency without significant weight loss (<1.5%). Sparse work has so far been performed to investigate suitable keratinases for the organic wool sector. This eco-friendly treatment based on a new enzyme combination produced by a wild bacterium has potential for meeting the demands of organic wool processing which bans the use of hazardous chemicals and genetic engineering.

  13. Prevalence of agglutinating antibodies to Toxoplasma gondii in small ruminants of the Madrid region, Spain, and identification of factors influencing seropositivity by multivariate analysis.

    PubMed

    Mainar, R C; de la Cruz, C; Asensio, A; Domínguez, L; Vázquez-Boland, J A

    1996-01-01

    A seroepidemiological survey of Toxoplasma gondii infection in sheep and goats was conducted in the Madrid region of Spain. Sera were collected from 60 herds, for which farming management information and other relevant data for their characterization were also obtained through a questionnaire. The seroprevalence was 11.8% (64 out of 541), using the modified (2-mercaptoethanol) direct agglutination technique with a 1:64 cut-off titre. The relationship between seropositivity and the variables in the questionnaire was assessed by multivariate analysis. Four variables were found to be significantly associated with seroprevalence. Two of them, the presence of cats and a previous history of abortion outbreaks in the farm, were factors known to be linked with toxoplasmosis, indicating the validity of the serological data. Seropositivity was also related to a lack of replacements in the preceding year. Proximity to other farms appeared to be a protective factor negatively associated with seropositivity, probably because it was an indicator of proximity to an urban area and the availability of local sanitary facilities.

  14. Partial purification of the mu opioid receptor irreversibly labeled with (/sup 3/H)b-funaltrexamine

    SciTech Connect

    Liu-Chen, L.Y.; Phillips, C.A.; Tam, S.W.

    1986-03-01

    The mu opioid receptor in bovine striatal membranes was specifically and irreversibly labeled by incubation with 5 nM (/sup 3/H)..beta..-funaltrexamine (approx.-FNA) at 37/sup 0/C for 90 min in the presence of 100 mM NaCl. The specific and irreversible binding of (/sup 3/H)..beta..-FNA as defined by that blocked by 1 /sup +/M naloxone was about 60% of total irreversible binding. The specific irreversible binding was saturable, stereospecific, time-, temperature, and tissue-dependent. Mu opioid ligands were much more potent than delta or kappa ligands in inhibiting the specific irreversible labeling. SDS polyacrylamide gel electrophoresis of solubilized membranes in the presence of 2-mercaptoethanol yielded a major radiolabeled broad band of MW 68-97K daltons, characteristic of a glycoprotein band. This band was not observed in membranes labeled in the presence of excess unlabeled naloxone. The glycoprotein nature of the (/sup 3/H)..beta..-FNA-labeled opioid receptor was confirmed by its binding to a wheat germ agglutinin-Sepharose column and its elution with N-acetylglucosamine.

  15. A rapid method for isolation of total DNA from pathogenic filamentous plant fungi.

    PubMed

    González-Mendoza, D; Argumedo-Delira, R; Morales-Trejo, A; Pulido-Herrera, A; Cervantes-Díaz, L; Grimaldo-Juarez, O; Alarcón, A

    2010-02-02

    DNA isolation from some fungal organisms of agronomic importance is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. We have developed a fast DNA isolation protocol for Fusarium oxysporum, which causes fusarium wilt disease in more than 100 plant species, and for Pyrenochaeta terrestris, which causes pink root in onions. This protocol was based on the sodium dodecyl sulfate/phenol method, without beta-mercaptoethanol and without maceration in liquid nitrogen; it uses phenol/chloroform extraction to remove proteins and co-precipitated polysaccharides. The A(260/280) absorbance ratios of isolated DNA were around 1.9, suggesting that the DNA fraction was pure and may be used for further analysis. Additionally, the A(260/230) values were higher than 1.8, suggesting negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction.

  16. Cation-selective channels in the vacuolar membrane of Saccharomyces: dependence on calcium, redox state, and voltage.

    PubMed Central

    Bertl, A; Slayman, C L

    1990-01-01

    The vacuolar membrane of the yeast Saccharomyces cerevisiae, which is proposed as a system for functional expression of membrane proteins, was examined by patch-clamp techniques. Its most conspicuous feature, in the absence of energizing substrates, is a cation channel with a characteristic conductance of approximately 120 pS for symmetric 100 mM KCl solutions and with little selectivity between K+ and Na+ (PNa+/PK+ approximately 1) but strong selectivity for cations over anions (PCl-/PK+ less than 0.1). Channel gating is voltage-dependent; open probability, Po, reaches maximum (approximately 0.7) at a transmembrane voltage of -80 mV (cytoplasmic surface negative) and declines at both more negative and more positive voltages (i.e., to 0 around +80 mV). The time-averaged current-voltage curve shows strong rectification, with negative currents (positive charges flowing from vacuolar side to cytoplasmic side) much larger than positive currents. The open probability also depends strongly on cytoplasmic Ca2+ concentration but, for ordinary recording conditions, is high only at unphysiologically high (greater than or equal to 1 mM) Ca2+. However, reducing agents such as dithiothreitol and 2-mercaptoethanol poise the channels so that they can be activated by micromolar cytoplasmic Ca2+. The channels are blocked irreversibly by chloramine T, which is known to oxidize exposed methionine and cysteine residues specifically. Images PMID:1700419

  17. Hydrogen ion titration of 12 S rape seed protein and partial N-terminal sequence of one of it's subunits.

    PubMed

    Bhushan, R; Mahesh, V K; Mallikharjun, P V

    1989-10-01

    The high molecular weight 12 S protein from rape seed was isolated in a homogeneous form and characterized. Six subunits were isolated by PAGE in the presence of SDS and 0.2 M 2-mercaptoethanol. These subunits (s1 to s6) were found in the protein in the weight ratio of 1.32:1.2:1.15:1.0:1.21:1.11. The molecular weights and first two N-terminal amino acids of the isolated subunits were 64,800 and phenylalanine, alanine (s1), 50,650 and valine, tyrosine (s2), 42,500 and phenylalanine, leucine (s3), 28,800 and threonine, glutamic acid (s4), 19,100 and cystine, isoleucine (s5) and 15,600 and alanine, phenylalanine (s6). The number of side chain carboxyl, imidazole and epsilon-amino groups were calculated from the hydrogen ion titrations, which were in agreement with the amino acid assay. Besides, the N-terminal amino acid sequence upto 43 residues for one subunit (s6) is reported using Edman degradation.

  18. Influence of different types of effectors on the kinetic parameters of suicide inactivation of catalase by hydrogen peroxide.

    PubMed

    Ghadermarzi, M; Moosavi-Movahedi, A A

    1999-04-12

    The effects of cyanide and azide ions (class A), sodium-n-dodecyl sulphate (SDS) and 2-mercaptoethanol (class B), 3-aminotriazole (class C) and NADPH (class D) on the initial activity (ai), inactivation rate constant (ki) and the partition ratio (r) of bovine liver catalase reaction with its suicide substrate, hydrogen peroxide, were studied in 50 mM sodium phosphate buffer, pH 7.0 at 27 degrees C. The above kinetic parameters were determined by processing the progress curve data. In class A, which contains fast and reversible inhibitors of catalase, a proportional decrease in ai and ki was observed by inhibitors, so that the r remained constant. In class B, which contains slow and irreversible inactivators, a decrease in ai and constancy of ki and r were observed when catalase was incubated in the presence of such inactivators for a determined time. In class C, containing effector which can combine with intermediate compound I, ai was relatively unchanged but an increase in ki and a decrease in r were observed. In class D, containing effector which reduces compound I to ferricatalase, ai was not affected significantly but some decrease in ki was detected which was linked with an increase in r. These results demonstrate that different classes of effectors affect the determined kinetic parameters of catalase in various ways. Thus, determination of such parameters by simple kinetic experiments can be carried out for classification of the agents which have an effect on the kinetics of catalase.

  19. Cloning and characterization of catalases from rice, Oryza sativa L.

    PubMed

    Wutipraditkul, Nuchanat; Boonkomrat, Suntareeya; Buaboocha, Teerapong

    2011-01-01

    Catalase is the major H(2)O(2)-scavenging enzyme in all aerobic organisms. From the cDNA sequences of three rice (Oryza sativa L.) genes that encode for predicted catalases (OsCatA, OsCatB, and OsCatC), complete ORFs were subcloned into pET21a and expressed as (His)(6)-tagged proteins in Escherichia coli. The recombinant (His)(6)-polypeptides were enriched to apparent homogeneity and characterized. With H(2)O(2) as substrate, the highest catalase k(cat) value (20±1.71×10(-3) min(-1)) was found in recombinant OsCatB. The optimum temperatures for catalase activity were 30 °C for OsCatA and OsCatC and 25 °C for OsCatB, while the pH optima were 8.0, 7.5, and 7.0 for OsCatA, OsCatB, and OsCatC respectively. All the catalases were inhibited by sodium azide, β-mercaptoethanol, and potassium cyanide, but only weakly by 3-amino-1,2,4-triazole. The various catalases exhibited different catalase activities in the presence of different salts at different concentrations, OsCatC showing higher salt inhibitory effects than the two other OsCats.

  20. A protocol for stripping and reprobing of Western blots originally developed with colorimetric substrate TMB.

    PubMed

    Kar, Parmita; Agnihotri, Saurabh Kumar; Sharma, Archana; Sachan, Rekha; Lal Bhatt, Madan; Sachdev, Monika

    2012-10-01

    Western blotting is a widely used analytical technique for detection of specific protein(s) in a given sample of tissue/cell homogenate or extract. Both chemiluminescence (CL) and colorimetric detections can be used for imaging Western blots. Colorimetric substrates offer background free, sensitive, and clean imaging results directly on the blotted membrane and provides more accurate profile with respect to prestained marker. However, blots stained with colorimetric substrates cannot be reused since no stripping protocols have been reported for such blots, thus limiting their reuse for detection of another protein. In the present study, for the first time, we report a novel method of stripping Western blots developed with the colorimetric substrate TMB for detection of a low-abundant protein and reprobing of these blots after stripping for detection of a more abundant protein through CL procedure. The stripping procedure utilizes a stripping buffer consisting of β-mercaptoethanol, SDS, and Tris-HCl and a washing buffer consisting of PBS added with 0.1% Tween-20 involves a series of steps and facilitates accurate detection of the second protein (i.e., more abundant protein) in the stripped blot through CL. The protocol is reproducible and facilitates saving of precious clinical samples, in addition to saving cost and time as compared to the existing procedures. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Immunochemical Studies on α-Amylase III. Immunochemical Relationships Among Amylases from Various Microorganisms1

    PubMed Central

    Sirisinha, Stitaya; Allen, Peter Z.

    1965-01-01

    Sirishinha, Stitaya (University of Rochester School of Medicine and Dentistry, Rochester, N.Y.), and Peter Z. Allen. Immunochemical studies on α-amylase. III. Immunochemical relationships among amylases from various microorganisms. J. Bacteriol. 90:1120–1128. 1965.—Immunochemical relationships among amylases obtained from a selected group of microorganisms were examined, and a cross-reaction was detected between the α-amylases of Bacillus stearothermophilus and B. subtilis. Immunodiffusion and quantitative precipitin studies, as well as cross-neutralization tests, indicate that B. stearothermophilus α-amylase reacts with a portion of antibody present in antisera to crystalline B. subtilis α-amylase. Amylases from these two species thus have some aspects of structure in common. Limited data obtained by immunodiffusion suggest that groupings which confer cross-reactivity to the B. stearothermophilus enzyme are lost after exposure to mercaptoethanol in the presence of ethylenediamine-tetraacetate, followed by treatment with iodoacetamide. With the antisera employed and within the concentration range examined, no immunochemical cross-reaction was observed among amylases from Aspergillus oryzae, B. subtilis, B. polymyxa, B. macerans, Pseudomonas saccharophila, and Euglena sanguinis. Immunoelectrophoresis of partially purified B. stearothermophilus α-amylase by use of antiserum to the crude enzyme, together with localization of amylase activity in immunoelectrophoretic plates, suggests that B. stearothermophilus α-amylase is antigenic in the rabbit. Images PMID:5847799

  2. Production and biochemical characterization of an alkaline protease from Aspergillus oryzae CH93.

    PubMed

    Salihi, Ahsan; Asoodeh, Ahmad; Aliabadian, Mansour

    2017-01-01

    In this study, Aspergillus oryzae CH93 was isolated from soil sample and examined using molecular analysis. Following culture of A. oryzae CH93 under optimal enzyme production, a 47.5kDa extracellular protease was purified using ammonium sulfate precipitation and Q-Sepharose chromatography. The optimal pH 8 and temperature of 50°C obtained for the isolated protease. Sodium dodecyl sulfate (SDS), cetyltrimethyl ammonium bromide (CTAB), H2O2 decreased activity, while Triton X-100 and phenylmethanesulfonyl fluoride (PMSF) had no inhibitory effect on the enzyme activity; meanwhile, 2-mercaptoethanol and ethylenediaminetetraacetic acid (EDTA) declined the protease activity. Isoamyl alcohol and acetone (30%) enhanced activity whereas 2-propanol, isopropanol and dimethyl sulfoxide (DMSO) (30%) reduced protease activity. The enzyme exhibited a half-life of 100min at its optimum temperature. Among five substrates of bovine serum albumin (BSA), N-acetyl-l-tyrosine ethyl ester monohydrate (ATEE), casein, azocasein and gelatin results showed that casein is the best substrate with Vmax of 0.1411±0.004μg/min and Km of 2.432±0.266μg/ml. In conclusion, the extracted protease from A. oryzae CH93 as a fungal source possessed biochemical features which could be useful in some application usages. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Single-molecule DNA digestion in various alkanethiol-functionalized gold nanopores.

    PubMed

    Lee, Seungah; Kang, Seong Ho

    2013-03-30

    This paper presents the alkanethiol-functionalized environmental effects of individual DNA molecules in nanopores on enzyme digestion at the single-molecule level. A template consisting of gold deposited within a solid-state nanoporous polycarbonate membrane was used to trap individual λ-DNA and enzyme molecules. The gold surfaces were modified with various functional groups (-OH, -COOH, -NH3). The enzyme digestion rates of single DNA molecules increased with decreasing nanopore diameters. Surprisingly, the digestion rates in the l-cysteine chemisorbed nanopores were 2.1-2.6 times faster than in the mercaptoethanol chemisorbed gold nanopores, even though these nanopores had equivalent interspacial areas. In addition, the membrane of chemisorbed cysteamine with ionized functional groups of H3N(+) at pH 8.2 had a greater positive influence on the enzyme digestion rate than the membrane of chemisorbed mercaptoproponic acid with ionized carboxyl groups (COO(-)). These results suggest that the three-dimensional environment effect is strongly correlated with the functional group in confined nanopores and can significantly change the enzyme digestion rates for nanopores with different internal areas. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. PROPERTIES OF THE PROTEIN SUBUNIT OF CENTRAL-PAIR AND OUTER-DOUBLET MICROTUBULES OF SEA URCHIN FLAGELLA

    PubMed Central

    Shelanski, Michael L.; Taylor, Edwin W.

    1968-01-01

    The subunit protein has been isolated from the central-pair and outer-doublet microtubules of sea urchin sperm tails. Both proteins have a sedimentation constant of 6S and a molecular weight of 120,000. Both are converted to a 60,000 molecular weight species by denaturation in 6 M guanidine hydrochloride and reduction with mercaptoethanol. The reduced-alkylated proteins have the same Rf on disc electrophoresis, and the same amino acid composition, which is very similar to that of muscle actin. The central-pair protein has one binding site for colchicine per 120,000 g. Both proteins appear to have a guanine nucleotide binding site, but the ability to bind GTP in solution has been demonstrated only for the central-pair protein. Although 1 mole of guanine nucleotide is bound per 60,000 g to outer-doublet tubules, the protein obtained by dissolving the doublets at pH 10.5 has lost the guanine nucleotide-binding site and also shows little or no colchicine-binding activity. Comparison of the properties of the isolated protein with electron microscopic evidence on structure of microtubules suggests that the chemical subunit (M = 120,000) consists of two of the 40 A morphological subunits. PMID:5664206

  5. Establishment and characterization of a chicken mononuclear cell line.

    PubMed

    Qureshi, M A; Miller, L; Lillehoj, H S; Ficken, M D

    1990-11-01

    A new chicken mononuclear cell line (MQ-NCSU) has been established. The starting material used to initiate this cell line was a transformed spleen from a female Dekalb XL chicken which had been experimentally challenged with the JM/102W strain of the Marek's disease virus. After homogenization, a single cell suspension of splenic cells was cultured using L.M. Hahn medium supplemented with 10 microM 2-mercaptoethanol. Under these culture conditions, a rapidly proliferating cell was observed and then expanded after performing limiting dilution cultures. These cells were moderately adherent and phagocytic for sheep red blood cells and Salmonella typhimurium. When tested against a panel of monoclonal antibodies (mAb) using the flow cytometry, MQ-NCSU cells stained readily with anti-chicken monocyte specific (K-1) mAb but did not stain with mAb detecting T-helper, T-cytotoxic/suppressor, and NK cells. MQ-NCSU cells expressed very high levels of Ia antigens and transferrin receptors. In addition, cell-free supernatant obtained from MQ-NCSU culture contained a factor which exhibited cytolytic activity against tumor cell targets. Based on their cultural, morphological, and functional characteristics and mAb reactivity profile, we conclude that MQ-NCSU cell line represents a malignantly-transformed cell which shares features characteristic of cells of the mononuclear phagocyte lineage.

  6. Seroprevalence of Brucellosis in Human Immunodeficiency Virus Infected Patients in Hamadan, Iran.

    PubMed

    Keramat, Fariba; Majzobi, Mohammad Mehdi; Poorolajal, Jalal; Ghane, Zohreh Zarei; Adabi, Maryam

    2017-08-01

    Brucellosis is a systemic disease with a wide spectrum of clinical manifestations. This study aimed to determine the seroprevalence of brucellosis in human immunodeficiency virus (HIV) infected patients in Hamadan Province in the west of Iran. A total of 157 HIV-infected patients were screened through standard serological tests, including Wright's test, Coombs' Wright test, and 2-mercaptoethanol Brucella agglutination test (2ME test), blood cultures in Castaneda media, and CD4 counting. Data were analyzed using Stata version 11. Wright and Coombs' Wright tests were carried out, and only 5 (3.2%) patients had positive serological results. However, all patients had negative 2ME results, and blood cultures were negative for Brucella spp. Moreover, patients with positive serology and a mean CD4 count of 355.8 ± 203.11 cells/μL had no clinical manifestations of brucellosis, and, and the other patients had a mean CD4 count of 335.55 ± 261.71 cells/μL. Results of this study showed that HIV infection is not a predisposing factor of acquiring brucellosis.

  7. An engineered disulfide bridge in the transmembrane region of phage M13 coat protein stabilizes the alpha-helical dimer.

    PubMed

    Khan, A R; Deber, C M

    1995-01-05

    A single Cys-residue (Cys24) was introduced into the 50-amino acid major coat protein of M13 bacteriophage as part of a two-site substitution (Y24C-V31A) within the effective transmembrane (TM) segment (Tyr21 to Ile39) of the coat protein. Mutant Y24C-V31A was able to complete the phage life cycle and was shown to contain free sulfhydryls in the intact virus, as evidenced by susceptibility of Y24C-V31A phage to alkylation by Cys-specific 14C-iodoacetamide (14C-IAN). In contrast, the protein solubilized in deoxycholate micelles was resistant to 14C-IAN modification and was virtually inert to a transition from a characteristic alpha-helical oligomeric state to an aggregated beta-sheet structure relative to WT and V31A coat proteins, as shown by circular dichroism spectroscopy and SDS-PAGE. Reduction of mainly dimeric Y24C-V31A protein using beta-mercaptoethanol (beta-ME) generated monomeric species and resulted in a loss of helical thermostability. The overall results indicated that solubilization of Y24C-V31A coat protein into micelles resulted in formation of thermostable disulfide-bridged helical dimers. The disulfide bridge is deduced to be positioned along the stripe of residues involved in hydrophobic packing of TM parallel helical dimers.

  8. Determination of mercury compounds in fish by microwave-assisted extraction and liquid chromatography-vapor generation-inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Chiou, Chwei-Sheng; Jiang, Shiuh-Jen; Kumar Danadurai, K. Suresh

    2001-07-01

    A method employing a vapor generation system and LC combined with inductively coupled plasma mass spectrometry (LC-ICP-MS) is presented for the determination of mercury in biological tissues. An open vessel microwave digestion system was used to extract the mercury compounds from the sample matrix. The efficiency of the mobile phase, a mixture of L-cysteine and 2-mercaptoethanol, was evaluated for LC separation of inorganic mercury [Hg(II)], methylmercury (methyl-Hg) and ethylmercury (ethyl-Hg). The sensitivity, detection limits and repeatability of the liquid chromatography (LC) ICP-MS system with a vapor generator were comparable to, or better than, that of an LC-ICP-MS system with conventional pneumatic nebulization, or other sample introduction techniques. The experimental detection limits for various mercury species were in the range of 0.05-0.09 ng ml -1 Hg, based on peak height. The proposed method was successfully applied to the determination of mercury compounds in a swordfish sample purchased from the local market. The accuracy of the method was evaluated by analyzing a marine biological certified reference material (DORM-2, NRCC).

  9. Detection and quantification of protein adduction by electrophilic fatty acids: mitochondrial generation of fatty acid nitroalkene derivatives.

    PubMed

    Schopfer, F J; Batthyany, C; Baker, P R S; Bonacci, G; Cole, M P; Rudolph, V; Groeger, A L; Rudolph, T K; Nadtochiy, S; Brookes, P S; Freeman, B A

    2009-05-01

    Nitroalkene fatty acid derivatives manifest a strong electrophilic nature, are clinically detectable, and induce multiple transcriptionally regulated anti-inflammatory responses. At present, the characterization and quantification of endogenous electrophilic lipids are compromised by their Michael addition with protein and small-molecule nucleophilic targets. Herein, we report a trans-nitroalkylation reaction of nitro-fatty acids with beta-mercaptoethanol (BME) and apply this reaction to the unbiased identification and quantification of reaction with nucleophilic targets. Trans-nitroalkylation yields are maximal at pH 7 to 8 and occur with physiological concentrations of target nucleophiles. This reaction is also amenable to sensitive mass spectrometry-based quantification of electrophilic fatty acid-protein adducts upon electrophoretic resolution of proteins. In-gel trans-nitroalkylation reactions also permit the identification of protein targets without the bias and lack of sensitivity of current proteomic approaches. Using this approach, it was observed that fatty acid nitroalkenes are rapidly metabolized in vivo by a nitroalkene reductase activity and mitochondrial beta-oxidation, yielding a variety of electrophilic and nonelectrophilic products that could be structurally characterized upon BME-based trans-nitroalkylation reaction. This strategy was applied to the detection and quantification of fatty acid nitration in mitochondria in response to oxidative inflammatory conditions induced by myocardial ischemia-reoxygenation.

  10. Purification and characterization of an endopeptidase from Lactococcus lactis subsp. cremoris Wg2.

    PubMed Central

    Tan, P S; Pos, K M; Konings, W N

    1991-01-01

    An endopeptidase has been purified to homogeneity from a crude cell extract of Lactococcus lactis subsp. cremoris Wg2 by a procedure that includes diethyl-aminoethane-Sephacel chromatography, phenyl-Sepharose chromatography, hydroxylapatite chromatography, and fast protein liquid chromatography over an anion-exchange column and a hydrophobic-interaction column. Gel filtration and sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated a molecular mass of the purified enzyme of 70,000 Da. The endopeptidase can degrade several oligopeptides into various tetra-, tri-, and dipeptides. The endopeptidase has no aminopeptidase, carboxypeptidase, dipeptidase, or tripeptidase activity. It is optimally active at pH 6.0 to 6.5 and in the temperature range of 30 to 38 degrees C. The enzyme is inactivated by the chemical agents 1,10-phenanthroline, ethylenedinitrilotetraacetate, beta-mercaptoethanol, and phenylmethylsulfonyl fluoride and is inhibited by Cu2+ and Zn2+. The ethylenedinitrilotetraacetate- or 1,10-phenanthroline-treated enzyme can be reactivated by Co2+. Immunoblotting with specific antibodies raised against the purified endopeptidase indicated that the enzyme is also present in other Lactococcus spp., as well as in Lactobacillus spp. and Streptococcus salivarius subsp. thermophilus. Images PMID:1785932

  11. Specific localization of the annexin II heterotetramer in brain lipid raft fractions and its changes in spatial learning.

    PubMed

    Zhao, Wei-Qin; Waisman, David M; Grimaldi, Maurizio

    2004-08-01

    Annexin-II (AII) is a Ca(2+)-dependent phospholipid-binding protein that is present in both intracellular and extracellular compartments. In the present study AII immunoreactivity was found in a subpopulation of neurons in specific brain regions, including the cerebral cortex and the surface of hippocampal pyramidal neurons from adult rats. AII from synaptic membranes was detected by immunoblotting as multiple species containing the monomer (AII36) and heterotetramer (AIIt). AIIt was resistant to beta-mercaptoethanol and dithiothreitol in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, but was completely reduced to monomers (36 kDa) by two-dimensional electrophoresis. AIIt resided exclusively in the detergent-resistant lipid rafts concentrated in neuronal dendrites, and its recruitment to those structures was enhanced by antibody cross-link. AII abundantly distributed on the outer leaflet of neuronal membranes and between spaces of neurons appeared to be neuronal adhesive. The formation of AIIt required synthesis of sphingolipids and cholesterol, and its stability depended on Ca2+. Increases in neuronal activities such as depolarization and learning were shown to promote formation of AIIt. Our results suggest that, via a dynamic association with dendritic lipid rafts, AII may play a role in synaptic signal transduction and remodeling. This probably involves focal adhesion and interactions with actin that are associated with brain development and memory consolidation.

  12. Identification of albumin-binding proteins in capillary endothelial cells

    PubMed Central

    1988-01-01

    Isolated fat tissue microvessels and lung, whose capillary endothelia express in situ specific binding sites for albumin, were homogenized and subjected to SDS-gel electrophoresis and electroblotting. The nitrocellulose strips were incubated with either albumin-gold (Alb-Au) and directly visualized, or with [125I]albumin (monomeric or polymeric) and autoradiographed. The extracts of both microvascular endothelium and the lung express albumin-binding proteins (ABPs) represented by two pairs of polypeptides with major components of molecular mass 31 and 18 kD. The ABP peptides have pIs 8.05 to 8.75. Rabbit aortic endothelium, used as control, does not express detectable amounts of ABPs. The ABPs subjected to electrophoresis bind specifically and with high affinity (Kd = approximately 60 X 10(-9)M) both monomeric and polymeric albumin: the binding is saturable at approximately 80 nM concentration and 50% inhibition is reached at 5.5 micrograms/ml albumin concentration. Sulfhydryl-reducing agents beta-mercaptoethanol and dithiothreitol do not markedly affect the ABPs electrophoretic mobility and binding properties. As indicated by cell surface iodination of isolated capillary endothelium followed by electroblotting, autoradiography, and incubation with Alb-Au, the bands specifically stained by this ligand are also labeled with radioiodine. PMID:2839518

  13. Human brucellosis at a pig slaughterhouse.

    PubMed

    Escobar, Gabriela I; Jacob, Néstor R; López, Gustavo; Ayala, Sandra M; Whatmore, Adrian M; Lucero, Nidia E

    2013-12-01

    Seventeen workers in a pig slaughterhouse with signs and symptoms compatible with brucellosis were clinically examined at the outpatient service of different health institutions and studied by serological tests during the period 2005-2011. Eleven blood cultures were taken and six Brucella suis strains were isolated, three biovar 1 and three with atypical characteristics. In order to confirm that these cases had no common source, a variable number of tandem repeat (VNTR) analyses were performed on 5 of the 6 strains whose results showed substantial heterogeneity in the genotypes, thereby demonstrating that the immediate origin was not the same. Two hundred adult pigs admitted for slaughter at the plant were sampled by convenience and tested by buffered antigen plate test (BPAT), serum agglutination test (SAT) and 2-mercapto-ethanol test (MET). Seven of 62 males (11%) and 25/138 (18%) females tested positive. The study results contribute information on risk scenarios for packing plant workers and underscore the need to improve plant workers' education on appropriate containment measures and to actively screen animals for swine brucellosis.

  14. Immunochemical characterization of mucins. Polypeptide (M1) and polysaccharide (A and Leb) antigens.

    PubMed Central

    Bara, J; Gautier, R; Le Pendu, J; Oriol, R

    1988-01-01

    Seven monoclonal antibodies (MAbs) reacting with high-molecular-mass components (greater than 20,000 kDa) isolated from an ovarian mucinous cyst of an A Le(a-b+) patient are described. By the use of immunoradiometric methods, these MAbs characterized seven different epitopes associated with components having a density of 1.45 g/ml by CsCl-density-gradient ultracentrifugation, like mucins. Two MAbs reacted with A and Lewis blood-group antigens respectively (polysaccharide epitopes). The five other MAbs characterized five M1 epitopes (called a, b, c, d and e), mainly associated with components of more than 20,000 kDa and 2000 kDa. They were completely destroyed by papain and 2-mercaptoethanol treatment (polypeptide epitopes). Moreover, timed trypsin digestion of native mucin resulted in a progressive loss of M1 activity and degraded these mucins into smaller M1-positive fragments. The a and c epitopes were partially degraded from relatively high-molecular-mass fragments (2000 kDa to 500 kDa) into a 100 kDa fragment. The b and d epitopes were completely degraded into smaller fragments ranging from 100 kDa to 40 kDa. The e epitope was completely destroyed by trypsin. These different pathways of M1 antigen degradation suggest the occurrence of different epitopes located in separate regions of the mucin molecules. Images Fig. 5. Fig. 7. PMID:2460087

  15. [Biochemical characteristics of iodperoxidase activity of human saliva].

    PubMed

    Belevich, V K; Senchuk, V V

    2011-01-01

    Peroxidase-catalyzed oxidation of iodide in human saliva leads to the formation of a brown product with lambda max 287 nm and 353 nm (I3-) identified by the method of UV-spectrophotometry. I3- directly reacts with starch producing the characteristic blue complex. Salivary iodide peroxidase activity was found to be from 1.2 to 2.3 times higher then the activity of salivary peroxidases with natural substrates (SCN- and Cl-). Optimum for the iodide peroxidase activity in human saliva was found to be near pH 5.8. Salivary iodide peroxidase activity progressively lowers with the rise of pH value of the reaction mixture until total loss at the pH>7.4 was observed. Iodide peroxidase activity in human saliva at pH>7.4 is masked due to decomposition of I3- with the increase of pH along with the inhibition of peroxidases and I3- reduction by low molecular weight dialyzable salivary components possibly by Cl- and NCS-. Salivary iodide peroxidase activity was completely inhibited by peroxidase inhibitors (NaN3, 2-mercaptoethanol, thiourea), while addition of the peroxidase alternative substrates (ascorbate, quercetin, thiocyanate) resulted in partial inhibition of iodide peroxidase activity. The results of the study confirm the idea, that high activity of human saliva peroxidase with iodide as a substrate may play a crucial role in the bioavailability and metabolism of biologically active iodide.

  16. Isolation and chemical composition of the sheath of Sphaerotilus natans.

    PubMed

    Takeda, M; Nakano, F; Nagase, T; Iohara, K; Koizumi, J

    1998-06-01

    A sheathed bacterium, Sphaerotilus natans, was cultured with vigorous shaking in a medium containing peptone. Then the biomass was harvested and treated with lysozyme, sodium dodecyl sulfate, and protease. With treatment, 1.6 mg of sheaths was obtained from 15 mg of biomass. For the preparation of sheaths of high purity, cultivation must be in the absence of glucose with sufficient aeration to prevent poly(3-hydroxybutyrate) accumulation. Carbohydrate (54.1%), protein (12.2%), and lipid (1-3%) were detected in the sheaths by colorimetric reactions and solvent extraction. Gas-liquid chromatography showed glucose and galactosamine to be present in the molar ratio of 1:4. The most abundant amino acids in the sheath protein were glycine (49.2 mol%) and cysteine (24.6 mol%). The sheaths were resistant to agents that reduce disulfide bonds (dithiothreitol and 2-mercaptoethanol) and to protease. However, sheathes were degraded completely by hydrazine, and a heteropolysaccharide composed of glucose and galactosamine (1:4) was released. The weight-average molecular weight of the polysaccharide was estimated to be 1.2 x 10(5) by gel filtration chromatography with a low-angle laser-light scattering photometer and a rotation index detector. A ladder of 1.5-kDa peptides separable by sodium dodecyl sulfate gel electrophoresis was obtained by partial hydrolysis of sheaths, suggesting the sheath protein has repeating units of 1.5 kDa.

  17. Interference in diagnostic tests for brucellosis in cattle recently vaccinated against leptospirosis.

    PubMed

    Naves, Joao Helder Frederico de Faria; Rezende, Lais M; Ramos, Gabriel C; Soares, Pollyanna M; Tavares, Tatiane C F; França, Andre M S; Neves, Saira M N; Silva, Natascha A M; Lima-Ribeiro, Anna M C

    2012-03-01

    The aim of the current study was to verify if cattle vaccinated against leptospirosis may react in diagnostic tests for brucellosis. Sixty cows were divided into 5 groups, each comprising 12 animals. Four groups were given different vaccines against leptospirosis, while the control group received only saline. Two doses of vaccine were given, as recommended by the manufacturers. Serum samples were collected on the first day of immunization (day 0) and on postvaccination days 7, 14, 21, 28, 35, 42, 49, 56, 96, and 126. All the serum samples were tested for brucellosis and leptospirosis. Twenty animals were reactive at least once to the Rose Bengal test, but by day 96, no further reactions were elicited by this test. Twenty-six samples were reactive to the Rose Bengal test, but only 7 remained positive in confirmatory tests: 1 to the 2-mercaptoethanol test, 2 to the fluorescence polarization assay, and 6 to indirect enzyme-linked immunosorbent assays. None of the samples was reactive in the complement fixation test. None of the animals in the control group was reactive. A significant difference was found between the control group and the groups vaccinated against leptospirosis, according to Fisher exact test. However, the groups were found to respond independently of the vaccine brand. The results indicate that cattle vaccinated against leptospirosis may show reactivity on screening tests for brucellosis.

  18. Development of high refractive ZnS/PVP/PDMAA hydrogel nanocomposites for artificial cornea implants.

    PubMed

    Zhang, Quanyuan; Su, Kai; Chan-Park, Mary B; Wu, Hong; Wang, Dongan; Xu, Rong

    2014-03-01

    A series of high refractive index (RI) ZnS/PVP/PDMAA hydrogel nanocomposites containing ZnS nanoparticles (NPs) were successfully synthesized via a simple ultraviolet-light-initiated free radical co-polymerization method. The average diameter of the ZnS NPs is ∼ 3 nm and the NPs are well dispersed and stabilized in the PVP/PDMAA hydrogel matrix up to a high content of 60 wt.% in the hydrogel nanocomposites. The equilibrium water content of ZnS/PVP/PDMAA hydrogel nanocomposites varied from 82.0 to 66.8 wt.%, while the content of mercaptoethanol-capped ZnS NPs correspondingly varied from 30 to 60 wt.%. The resulting nanocomposites are clear and transparent and their RIs were measured to be as high as 1.58-1.70 and 1.38-1.46 in the dry and hydrated states, respectively, which can be tuned by varying the ZnS NPs content. In vitro cytotoxicity assays suggested that the introduction of ZnS NPs added little cytotoxicity to the PVP/PDMAA hydrogel and all the hydrogel nanocomposites exhibited minimal cytotoxicity towards common cells. The hydrogel nanocomposites implanted in rabbit eyes can be well tolerated over 3 weeks. Hence, the high RI ZnS/PVP/PDMAA hydrogel nanocomposites with adjustable RIs developed in this work might potentially be a candidate material for artificial corneal implants.

  19. [Comparison of the tests polymerase chain reaction, serology, and blood culture with respect to sensitivity and specificity for detection of Brucella spp in human samples].

    PubMed

    Álvarez-Ojeda, María Genoveva; Saldaña-Fuentes, Carolina; Ballesteros-Elizondo, María Romelia; Martínez-Vázquez, Irma O; López-Merino, Ahidé; Briones Lara, Evangelina; Morales-Loredo, Alberto

    2015-01-01

    The aim of this study was to evaluate the sensitivity and specificity of polymerase chain reaction for detection of Brucella spp in human blood samples compared with the serological tests and blood culture. In 2005, a total of 92 people were sampled from the towns of Anahuac and Sabinas Hidalgo, Nuevo Leon, where an outbreak of human cases had taken place in the same year as this study. The sera collected were analyzed by serological tests according to the NOM 022-SS2-1994. DNA was obtained using CTAB extraction method and it was used to amplify a fragment of 223 bp of the coding sequence for a protein of 31 kDa present in all Brucella species. The polymerase chain reaction test detected 23 positive samples. The sensitivity and specificity compared with RB was 44.68 and 95.56%, respectively. Compared with mouse antibody production, it was 51.61 and 88.52%, and 2-mercaptoethanol was 53.57 and 87.50%. When isolation (positives cultures) was compared with polymerase chain reaction, we obtained 100.0% sensitivity and 80.23% specificity, taking into account people with positive and negative serology. The polymerase chain reaction test can be an alternative tool to bacterial culture in human brucellosis diagnosis.

  20. Purification and properties of a soluble reduced nicotinamide–adenine dinucleotide (phosphate) dehydrogenase from the hepatopancreas of Octopus vulgaris

    PubMed Central

    Di Prisco, G.; Casola, L.; Giuditta, A.

    1967-01-01

    1. The oxidation of NADH and NADPH catalysed by the soluble supernatant from the hepatopancreas of Octopus vulgaris is due to a single enzyme, which has been purified approximately 100-fold. The enzyme reacts rapidly with potassium ferricyanide, and more slowly with 2,6-dichlorophenol-indophenol. No activity is obtained with oxygen, cytochrome c, lipoic acid, vitamin K1, vitamin K3, ubiquinone-30, p-benzoquinone, 2-p-iodophenyl-3-p-nitrophenyl-5-phenyltetrazolium chloride or methylene blue. 2. GSH, cysteine and mercaptoethanol stimulate the enzymic activity up to fivefold. GSSG is without any apparent effect. When stimulated by GSH the enzyme becomes sensitive to dicoumarol, which produces an inhibition competitive with respect to the activator. 3. The purified enzyme contains an acid-removable flavine component, which has been identified as FMN by spectrofluorimetry and chromatography in three solvent systems. After acid ammonium sulphate treatment the enzymic activity is lost, but it can be almost fully restored by incubation with FMN. FAD produces only a partial reactivation. PMID:4171422

  1. Identification of the adipocyte acid phosphatase as a PAO-sensitive tyrosyl phosphatase.

    PubMed Central

    Shekels, L. L.; Smith, A. J.; Van Etten, R. L.; Bernlohr, D. A.

    1992-01-01

    We have partially purified an 18-kDa cytoplasmic protein from 3T3-L1 cells, which dephosphorylates pNPP and the phosphorylated adipocyte lipid binding protein (ALBP), and have identified it by virtue of kinetic and immunological criteria as an acid phosphatase (EC 3.1.3.2). The cytoplasmic acid phosphatase was inactivated by phenylarsine oxide (PAO) (Kinact = 10 microM), and the inactivation could be reversed by the dithiol, 2,3-dimercaptopropanol (Kreact = 23 microM), but not the monothiol, 2-mercaptoethanol. Cloning of the human adipocyte acid phosphatase revealed that two isoforms exist, termed HAAP alpha and HAAP beta (human adipocyte acid phosphatase), which are distinguished by a 34-amino acid isoform-specific domain. Sequence analysis shows HAAP alpha and HAAP beta share 74% and 90% identity with the bovine liver acid phosphatase, respectively, and 99% identity with both isoenzymes of the human red cell acid phosphatase but no sequence similarity to the protein tyrosine phosphatases (EC 3.1.3.48). HAAP beta has been cloned into Escherichia coli, expressed, and purified as a glutathione S-transferase fusion protein. Recombinant HAAP beta was shown to dephosphorylate pNPP and phosphoALBP and to be inactivated by PAO and inhibited by vanadate (Ki = 17 microM). These results describe the adipocyte acid phosphatase as a cytoplasmic enzyme containing conformationally vicinal cysteine residues with properties that suggest it may dephosphorylate tyrosyl phosphorylated cellular proteins. PMID:1304913

  2. Enhancement of Charge Transfer and Quenching of Photoluminescence of Capped CdS Quantum Dots

    PubMed Central

    Mehata, Mohan Singh

    2015-01-01

    Quantum dots (Q-dots) of cadmium sulfide (CdS) with three different capping ligands, 1-butanethiol (BT), 2-mercaptoethanol (ME) and benzyl mercaptan (BM) have been investigated. An external electric field of variable strength of 0.2–1.0 MV cm−1 was applied to the sample of capped CdS Q-dots doped in a poly(methyl methacrylate) (PMMA) films. Field-induced changes in optical absorption of capped CdS Q-dots were observed in terms of purely the second-derivative of the absorption spectrum (the Stark shift), indicating an enhancement in electric dipole moment following transition to the first exciton state. The enhancement depends on the shape and size of the Q-dots prepared using different capping ligands. Field induced-change in photoluminescence (PL) reveals similar changes, an enhancement in charge-transfer (CT) character in exciton state. PL of capped CdS Q-dots is significantly quenched in presence of external electric field. The strong field-induced quenching occurs as a result of the increased charge separation resulting exciton dissociation. Thus, understanding the CT character and field-induced PL quenching of CdS Q-dots is important for photovoltaic, LEDs and biological applications. PMID:26166553

  3. Controlled synthesis, optical properties and cytotoxicity studies of CdSe-poly(lactic acid) multifunctional nanocomposites by ring-opening polymerization.

    PubMed

    Islam, Md Rafiqul; Bach, Long Giang; Vo, Thanh-Sang; Lee, Doh C; Lim, Kwon Taek

    2014-08-01

    A facile synthetic route has been developed for the covalent grafting of biocompatible poly(lactic acid) (PLA) onto CdSe Quantum Dots (QDs) using surface initiated ring opening polymerization (ROP) to afford CdSe-g-PLA nanocomposites. At first, 2-mercaptoethanol (ME) capped CdSe QDs were synthesized through a wet chemical process. The surface initiated ROP of lactide was accomplished with Sn(Oct)2 to give CdSe-g-PLA nanocomposites having surface hydroxyl functionality. FT-IR data suggested that a robust covalent bond was formed between ME capped CdSe QDs and polymer moieties. The grafting density of PLA on CdSe QDs was found to be moderate as measured by TGA analysis. The CdSe QDs were well dispersed in CdSe-g-PLA nanocomposites matrices as captured by TEM. The cubic phase crystal structure of CdSe QDs in the nanocomposites was determined by XRD. The optical properties of the CdSe-g-PLA nanocomposites were investigated by UV-vis and photoluminescence spectroscopy which suggested their potentialities as optical materials in biomedical application. Cell viability studies revealed that the biocompatibility of CdSe QDs was improved upon PLA immobilization.

  4. In vivo formation of codeinone and morphinone from codeine. Isolation and identification from guinea pig bile.

    PubMed

    Ishida, T; Yano, M; Toki, S

    1991-01-01

    Codeinone (CO) and morphinone (MO) were isolated and identified in the bile of guinea pigs given sc injections of codeine. Authentic CO was synthesized and characterized by the NMR and mass spectra of its 2-mercaptoethanol (ME) adduct. This material was then used as the standard to identify the CO-ME adduct in the bile of codeine-treated animals. The MO-ME adduct was also identified in the bile with authentic materials prepared earlier. The results of our investigations indicated that 10.5 and 2.7% dose of CO and MO, respectively, were produced for 6 hr after the codeine was given. The metabolites were separated by preparative HPLC on a reverse phase column packed with C18 gel using a 10 mM sodium phosphate buffer, pH 6.8/CH3CN, 1:1 (v/v) as an eluate. For the further purification of metabolites, we used another reverse phase column with the same mobile phase. A structural elucidation of the ME adduct of metabolites was then performed by fast atom bombardment mass spectroscopy and 400 MHz fourier transform-NMR spectrometric analysis, and identified as (8S)-(2-hydroxyethylthio)dihydrocodeinone and (8S)-(2-hydroxyethylthio)dihydromorphinone, respectively.

  5. A method for expression and purification of soluble, active Hsp47, a collagen-specific molecular chaperone.

    PubMed

    Thomson, C A; Ananthanarayanan, V S

    2001-10-01

    Hsp47 is regarded as a collagen-specific chaperone with several suggested roles in collagen biosynthesis under normal and disease conditions. We describe here a procedure for the expression and purification of Hsp47 in Escherichia coli using the IMPACT expression system (New England Biolabs) where the guest gene is fused to the adduct, intein, with a chitin-binding domain. Use of this system resulted in relatively high levels of soluble Hsp47 compared to other available protocols, especially when the bacterial cells were induced at 14 degrees C instead of 37 degrees C. The cell lysate was passed through a chitin-Sepharose affinity column and Hsp47 was cleaved from intein using beta-mercaptoethanol. Minor degradation products were subsequently removed using a hydroxylapatite column to yield milligram amounts of pure and active protein suitable for structural studies. Gel electrophoretic analysis of the purified protein indicated the presence of a small proportion of trimeric species when non-reducing conditions were used. The ability to form a trimer may be important for its role as a chaperone. The IMPACT system allows for radiolabelling of purified Hsp47 with (35)S for use in binding experiments. Illustrative data on collagen binding by (35)S-Hsp47 are shown.

  6. Extraction of high-quality bacterial RNA from infected leaf tissue for bacterial in planta gene expression analysis by multiplexed fluorescent Northern hybridization.

    PubMed

    Schenk, Alexander; Weingart, Helge; Ullrich, Matthias S

    2008-03-01

    Plant pathogenic bacteria possess a large number of genes that allow them to grow and cause disease on plants. In planta gene expression analysis is important to understand the impact of these genes on bacterial virulence. A new mRNA-based approach using multiplexed Northern hybridization was developed. High-quality bacterial and plant total RNA was successfully isolated from leaf tissue infiltrated with Pseudomonas syringae. The procedure employs a new extraction buffer formulation containing glycine, sodium dodecylsulphate, cetyltrimethylammonium bromide, high-molecular-weight polyethylene glycol and beta-mercaptoethanol. Cell lysis and classical acid-phenol extraction steps followed by LiCl precipitation yielded large amounts of total RNA of high purity and integrity. Multiplexing of DIG and chemically fluorescently labelled RNA probes was developed and expression data were normalized using the 23S rRNA gene as reference. The method was validated by studying in planta expression of the P. syringae genes mucD, cmaA, cfl, corR, corS and corP comprising a selection of highly expressed biosynthetic and low-expressed regulatory genes. The method was assessed regarding its sensitivity and might by useful for studying a variety of plant-microbe interactions.

  7. Effects of Redox and Sulfhydryl Reagents on the Bioelectric Properties of the Giant Axon of the Squid

    PubMed Central

    Huneeus-Cox, F.; Fernandez, H. L.; Smith, B. H.

    1966-01-01

    The effects of internally and externally applied sulfhydryl reagents on the bioelectric properties of the giant axon of the squid Loligo pealeii and Dosidicus gigas were studied. Cysteine-HCl (400 mM, pH 7.3) was used to remove axoplasm from the perfusion channel. Oxidizing agents (1 to 60 mM) tended to increase the duration of the action potential and had a slow, irreversible blocking effect when perfused internally; the membrane potential was little affected. Reducing agents applied internally caused a decrease in the spike duration without affecting its height or the membrane potential, although at high concentrations there was reversible deterioration of the action potential. Both external and internal perfusion of mercaptide-forming reagents caused deterioration in the action and membrane potentials with conduction block occurring in 5 to 45 min. 2-mercaptoethanol reversed the effects. Thiol alkylating reagents, iodoacetate and iodoacetamide, were without effect. N-ethylmaleimide did, however, block. Tests with chelating agents for nonheme iron in the membrane brought about no change in the electrical parameters. The implications of the present findings with regard to the macromolecular mechanism of excitation are discussed. ImagesFigure 1 PMID:5970570

  8. [Preparation of Staphylococcus aureus antigens for evaluation of their immunological reactivity with the human sera by the western blot method].

    PubMed

    Tyski, S; Jarecka, K; Gut, W; Hryniewicz, W

    1991-01-01

    Extracellular antigens as well as cell wall extracts of 4 S. aureus strains isolated from different kinds of infection were analysed by Western-Blott technique. Materials obtained in two systems of bacteria cultivation (with and without aeration) were compared. Four systems of PAGE (native conditions, with 8.0 M urea, with SDS and SDS after previous reduction of the material with 2-mercaptoethanol) were compared in order to get the best differentiation of proteins and antigens. Immunological reactivity of the antigens mixture with two human sera: highly positive (with three S. aureus antigens in ELISA) from patient with staphylococcal sepsis and negative (from blood donor) were analysed. The best results were obtained after reduction of the cell wall extracted material in SDS-PAGE. The different protein patterns depending on the strain and the method of bacteria cultivation were observed. The standardisation of Western-Blott technique was performed, including titration of the sera to get the best differentiation of the antigens. The difference in immunological reactivity of the positive and negative sera with staphylococcal antigens mixture showed rather quantitative than qualitative character.

  9. Prevalence of antibodies to Japanese encephalitis virus among pigs in Bali and East Java, Indonesia, 2008.

    PubMed

    Yamanaka, Atsushi; Mulyatno, Kris Cahyo; Susilowati, Helen; Hendrianto, Eryk; Utsumi, Takako; Amin, Mochamad; Lusida, Maria Inge; Soegijanto, Soegeng; Konishi, Eiji

    2010-01-01

    Japanese encephalitis virus (JEV) is a fatal disease in Asia. Pigs are considered to be the effective amplifying host for JEV in the peridomestic environment. Bali Island and Java Island in Indonesia provide a model to assess the effect of pigs on JEV transmission, since the pig density is nearly 100-fold higher in Bali than Java, while the geographic and climatologic environments are equivalent in these areas. We surveyed antibodies to JEV among 123 pigs in Mengwi (Bali) and 96 pigs in Tulungagung (East Java) in 2008 by the hemagglutination-inhibition (HAI) test. Overall prevalences were 49% in Bali and 6% in Java, with a significant difference between them (P < 0.001). Monthly infection rates estimated from age-dependent antibody prevalences were 11% in Bali and 2% in Java. In addition, 2-mercaptoethanol-sensitive antibodies were found only from Bali samples. Further, the average HAI antibody titer obtained from positive samples was significantly higher in Bali (1:52) than Java (1:10; P < 0.001). These results indicated that JEV transmission in nature is more active in Bali than East Java.

  10. Purification, Characterization, and Effect of Thiol Compounds on Activity of the Erwinia carotovora L-Asparaginase

    PubMed Central

    Warangkar, Suchita C.; Khobragade, Chandrahas N.

    2010-01-01

    L-asparaginase was extracted from Erwinia carotovora and purified by ammonium sulfate fractionation (60–70%), Sephadex G-100, CM cellulose, and DEAE sephadex chromatography. The apparent Mr of enzyme under nondenaturing and denaturing conditions was 150 kDa and 37 ± 0.5 kDa, respectively. L-asparaginase activity was studied in presence of thiols, namely, L-cystine (Cys), L-methionine (Met), N-acetyl cysteine (NAC), and reduced glutathione (GSH). Kinetic parameters in presence of thiols (10–400 μM) showed an increase in Vmax values (2000, 2223, 2380, 2500, and control 1666.7 μmoles mg−1min−1) and a decrease in Km values (0.086, 0.076, 0.062, 0.055 and control 0.098 mM) indicating nonessential mode of activation. KA values displayed propensity to bind thiols. A decrease in Vmax/Km ratio in concentration plots showed inverse relationship between free thiol groups (NAC and GSH) and bound thiol group (Cys and Met). Enzyme activity was enhanced in presence of thiol protecting reagents like dithiothreitol (DTT), 2-mercaptoethanol (2-ME), and GSH, but inhibited by p-chloromercurybenzoate (PCMB) and iodoacetamide (IA). PMID:21048860

  11. Purification and partial characterization of a tripeptidase from Pediococcus pentosaceus K9.2.

    PubMed

    Simitsopoulou, M; Vafopoulou, A; Choli-Papadopoulou, T; Alichanidis, E

    1997-12-01

    A tripeptidase was purified from the cytoplasm of Pediococcus pentosaceus K9.2 by anion-exchange chromatography, gel filtration chromatography, and high-performance liquid chromatography. The molecular mass of the enzyme was estimated by gel filtration at 100,000 Da. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified peptidase showed one protein band of 45,000 Da. Optimal enzyme activity was obtained at pH 7.0 and at 50 degrees C. The peptidase hydrolyzed all tripeptides tested. Cleavage was not observed with dipeptides, oligopeptides, or amino acid-p-nitroanilide derivatives. Strong inhibition of activity was caused by EDTA, 1,10-phenanthroline, dithiothreitol, and beta-mercaptoethanol, whereas phenylmethylsulfonyl fluoride and sulfur-reactive reagents had no effect on peptidase activity. Mg2+, Mn2+, and Ca2+ stimulated the hydrolyzing activity of the enzyme. The 20 N-terminal amino acids of the tripeptidase from P. pentosaceus had 84% identity with those from the corresponding N-terminal region of the tripeptidase from Lactococcus lactis subsp. cremoris Wg2.

  12. Aqueous soluble tetrazolium/formazan MTS as an indicator of NADH- and NADPH-dependent dehydrogenase activity.

    PubMed

    Dunigan, D D; Waters, S B; Owen, T C

    1995-10-01

    Recently a new tetrazolium was described for the use of monitoring cell viability in culture. This tetrazolium, commonly referred to as MTS [3-(4,5-dimethylthiazol-2-yl)- 5-(3-carboxymethonyphenol)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt], has the unusual property that it can be reduced to a water-soluble formazan. beta-Nicotinamide adenine dinucleotide/reduced (NADH) and beta-nicotinamide adenine dinucleotide phosphate/reduced (NADPH) are examples of physiologically important reducing agents. In cell-free studies, MTS was reduce to the soluble formazan in the presence of NADH and NADPH, and reaction were compared to those with dithiothreitol (DTT) or 2-mercaptoethanol (2-ME). The efficiency of these reactions was enhanced 1000-fold by the presence of phenazine methosulfate. Selectivity in the electron transfer from NADPH was slightly greater than NADH, and NADPH or NADH was much greater than the thiols DTT or 2-ME. Generation of either NADH or NADPH in solution by malate dehydrogenase or isocitrate dehydrogenase, respectively, was monitored by the MTS reduction reaction. The rate of formazan formation was comparable to the formation of NADH or NADPH. This system represents a useful tool for evaluating reaction kinetics in solutions of NAD- or NADP-dependent dehydrogenase enzymes, and these reactions can be performed in typical biological buffers containing reducing agents without significant interference to the MTS/formazan system.

  13. Carbon Dioxide Fixation by Extracts of Streptococcus faecalis var. liquefaciens

    PubMed Central

    Hartman, Ronald E.

    1970-01-01

    Extracts of cells of Streptococcus faecalis var. liquefaciens strain 31 incorporated 14CO2 into aspartate. Dialyzed extracts produced radioactive oxalacetate in the absence of exogenously added glutamate and pyridoxal-5′-phosphate and produced radioactive aspartate in the presence of these components. Reduced nicotinamide adenine dinucleotide or reduced nicotinamide adenine dinucleotide phosphate could not be substituted for adenosine triphosphate (ATP); phosphoenolpyruvate even in the presence of nucleoside diphosphates could not replace pyruvate plus ATP; propionate plus coenzyme A (CoA) could not replace pyruvate in supporting CO2 fixation by cell extracts. Fixation by dialyzed cell extracts required pyruvate, ATP, MgSO4, and was stimulated by biotin, KCl, 2-mercaptoethanol, CoA, and acetyl CoA. Inhibition of fixation occurred when avidin, NaCl, oxalacetate, or aspartate was added to dialyzed extracts. On the basis of the products formed and the effects of substrates and cofactors on the fixation reaction, it was concluded that pyruvate carboxylase is responsible for CO2 fixation in this microorganism. PMID:4986758

  14. [Experiment on inducing human dental pulp stem cells into neural-like cells].

    PubMed

    He, Hui-xia; Jin, Yan; Shi, Jun-nan; Luo, Yu-qing; Zhou, Yan-ni; Peng, Zhi; Xu, Yu-he

    2007-08-01

    To explore the multi-differentiated capability of human dental pulp stem cells (hDPSCs) obtained by cell-clone culture approach and to determine the appropriate induced medium. The cloned isolation and expansion of hDPSCs were preinduced for 24 h, and were subsequently replaced with neural-inductive medium containing certain concentration of dimethylsulfoxide (DMSO), butylated hydroxyanisode (BHA), forskolin, P-mercaptoethanol (p-ME) and hydrocortisone for 4 days. Then induced cells were analyzed by morphological observation, immnocytochemical staining for non-specific esterase (NSE) and glial fibrillary acidic protein (GFAP) expression, RT-PCR for GFAP mRNA. Meanwhile, the uninduced hDPSCs were used as negative control. The morphology of induced cells changed at the initial 12 h, and displayed a typical neuron-like cells at 24 h. There was a gradual increase in the number of these neuronal differentiated cells with continuous induction. Furthermore, immnocytochemical staining showed that the induced cell expressed NSE and GFAP, two marked enzymes of neuron cell. The GFAP mRNA was also detected in induced cells by RT-PCR assay. In contrast, the uninduced cells maintained its original appearance and had no expression on them. hDPSCs may possess potential of multiple-differentiation and may differentiate into neuron-like cells on certain inductive condition.

  15. Direct aqueous injection-liquid chromatography with post-column derivatization for determination of N-methylcarbamoyloximes and N-methylcarbamates in finished drinking water: collaborative study.

    PubMed

    Edgell, K W; Biederman, L A; Longbottom, J E

    1991-01-01

    An interlaboratory method validation study was conducted on EPA Method 531.1, Measurement of N-Methylcarbamoyloximes and N-Methylcarbamates in Water by Direct Aqueous Injection HPLC with Post Column Derivatization, to determine the precision and mean recovery for determination of 10 carbamate pesticide compounds in reagent water and in finished drinking waters. The study design was based on Youden's nonreplicate plan for collaborative tests of analytical methods. The waters were spiked with 10 carbamate pesticides at 6 concentration levels, as 3 Youden pairs. Eight laboratories analyzed the samples by direct aqueous injection, with separation by reverse-phase liquid chromatography and post-column hydrolysis of the carbamates and carbamoyloximes to methylamine, followed by reaction of the methylamine with o-phthalaldehyde and 2-mercaptoethanol using fluorescence detection. Results were analyzed using an EPA computer program, which measured precision and recovery for each of the 10 compounds and compared the performance of the method between water types. The method was acceptable for all analytes tested. After removal of a nonrepresentative data set for aldicarb sulfoxide, no matrix effects were observed; the statistics for the pooled drinking waters were not significantly different from the statistics for the reagent waters. The method has been adopted official first action by AOAC.

  16. Ultramicro-analysis by use of light-scanning photoacoustic densitometry for electrophoresed protein in human hair.

    PubMed

    Fukami, T; Uchiyama, K; Yoshimura, Y; Watanabe, T; Nakazawa, H

    1996-06-15

    A technique was developed for the ultramicro-analysis of proteins electrophoresed by Laemmli's method using a light-scanning photoacoustic densitometer. After electrophoresis, the proteins were blotted on a nitrocellulose membrane filter and colored by the avidin-biotin complex method. This filter was then measured using a photoacoustic densitometer. The optimal blotting time was 150 min. The relative standard deviation of four measurements was 3.89% for 200 ng bovine serum albumin (BSA). The limits of detection were 2.3, 0.69, 4.4, and 2.9 ng (S/N = 3) for BSA, ovalbumin, carbonic anhydrase, and alpha-Lactoalbum respectively. Proteins eluted from hair by various harmful agents, such as a surfactant and UV irradiation, were analyzed by the present method. Using 2-mercaptoethanol, the molecular weights of proteins in hair were in the range of 14,000-64,000. Maximal elution of protein was obtained at pH 8. More protein was eluted under alkaline conditions than under acidic conditions. A protein of Mr 68,000 was eluted from hair by oxidative treatment with either UV irradiation or sodium bromate.

  17. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    PubMed Central

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR. PMID:21747730

  18. Crystallization and preliminary crystallographic analysis of recombinant human galectin-1

    SciTech Connect

    Scott, Stacy A.; Scott, Ken; Blanchard, Helen

    2007-11-01

    Human galectin-1 has been cloned, expressed in E. coli, purified and crystallized in the presence of both lactose (ligand) and β-mercaptoethanol under six different conditions. The X-ray diffraction data obtained have enabled the assignment of unit-cell parameters for two novel crystal forms of human galectin-1. Galectin-1 is considered to be a regulator protein as it is ubiquitously expressed throughout the adult body and is responsible for a broad range of cellular regulatory functions. Interest in galectin-1 from a drug-design perspective is founded on evidence of its overexpression by many cancers and its immunomodulatory properties. The development of galectin-1-specific inhibitors is a rational approach to the fight against cancer because although galectin-1 induces a plethora of effects, null mice appear normal. X-ray crystallographic structure determination will aid the structure-based design of galectin-1 inhibitors. Here, the crystallization and preliminary diffraction analysis of human galectin-1 crystals generated under six different conditions is reported. X-ray diffraction data enabled the assignment of unit-cell parameters for crystals grown under two conditions, one belongs to a tetragonal crystal system and the other was determined as monoclinic P2{sub 1}, representing two new crystal forms of human galectin-1.

  19. Effect of size and shell: Enhanced optical and surface properties of CdS, ZnS and CdS/ZnS quantum dots

    NASA Astrophysics Data System (ADS)

    Kumar, Hitanshu; Barman, P. B.; Singh, Ragini Raj

    2015-03-01

    This study reports systematic structural, optical and surface studies on wurtzite CdS, ZnS and CdS/ZnS quantum dots where the effects of size and shell thickness were analysed. Size tunable, stable and luminescent quantum dots (QDs) and their core/shell structures were synthesized by wet chemical growth method at low temperature using 2-mercaptoethanol as a stabilizer. Formation of non-agglomerated wurtzite QDs with reduced particle sizes have been confirmed from x-ray diffraction and transmission electron microscopy studies. Size dependent blue shifts have been observed by absorbance spectroscopy and discussed on the basis of various theoretical models. Significantly enhanced luminescence and monochromaticity have been observed in QDs due to particle size reduction and on core/shell structure formation. Fourier transform infrared spectroscopy indicates that OH, CH2 and C-O functional groups are present on the QDs surfaces and for this reason these QDs can be used in various biological applications.

  20. [Determination of total aminothiols and neuroactive amino acids in plasma by high performance liquid chromatography with fluorescence detection].

    PubMed

    Pozdeev, V K; Pozdeev, N V

    2010-01-01

    This paper describes a simple and sensitive reversed-phase HPLC method for the determination of total homocysteine, total cysteine, total glutathione (GSH+GSSG), and neuroactive amino acids (Asp, Glu, Tau, GABA) using precolumn derivatization with ortho-phtaldialdehyde and fluorimetric detection at 360 and 470 nm for emission and excitation, respectively. Derivatization was performed with ortho-phthaldialdehyde in the presence of 2-mercaptoethanol after alkylation of the free sulfhydryl groups with iodoacetic acid. For determination of total aminothiols, the disulfide bonds were reduced and protein-bound thiols were released by addition of dithiothreitol to the plasma sample. The advantage of this method is the simultaneous determination of both homocysteine/cysteine/glutathione and neuroactive amino acids in the sample. The plasma levels of studied compounds were determined in 14 healthy volunteers (20-45 years old) and 55 patients with chronic hepatitis C (20-49 years old) and the resulting numbers were in a good agreement the studies published earlier. The calibration curves were linear over a concentration range of 5-100 microM in plasma (r2 = 0.985-0.996). The intraday and interday coefficients of variation were 3-6% and 4-7%, respectively. The recovery of the standards added to the plasma samples ranged from 94 to 102%. The limits of detection (LOD) were 0.2-0.5 ng per 10 microl injection volume (signal-to-noise ratio of 3).

  1. Fluorimetric determination of intra- and extracellular free amino acids in the microalgae Tetraselmis gracilis (Prasinophyceae) using monolithic column in reversed phase mode.

    PubMed

    Penteado, José Carlo Pires; Rigobello-Masini, Marilda; Liria, Cleber Wanderlei; Miranda, M Terêsa Machini; Masini, Jorge Cesar

    2009-08-01

    This paper describes the development and application of an RP HPLC method using a C(18) monolithic stationary phase for the separation and quantification of extra- and intracellular amino acids in a batch cultivation of the marine alga Tetraselmis gracilis. Fluorimetric detection was made after separation of the o-phthaldialdehyde 2-mercaptoethanol (OPA-2MCE) derivatives using a binary gradient elution. Separation of 19 amino acids was achieved with resolution >1.5 in about 39 min at a flow rate of 1.5 mL/min. RSD of analyses in seawater medium ranged from 0.36% for Orn (0.50 micromol/L) to 12% for Ile (0.10 micromol/L). The main constituents of the intracellular dissolved free amino acids (DFAAs) in the exponential growth phase were arginine (Arg), asparagine (Asn), alanine (Ala), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), glycine (Gly), glutamine (Gln), and leucine (Leu). The major amino acids excreted to the media were valine (Val), Ala, Ser, and Gly. The monolithic phase facilitates the analysis by shortening the separation time and saving solvents and instrumentation costs (indeed conventional HPLC instrumentation can be used, running at lower pressures than those ones used with packed particle columns).

  2. Comb-type grafted poly(N-isopropylacrylamide) gel modified surfaces for rapid detachment of cell sheet.

    PubMed

    Tang, Zhonglan; Akiyama, Yoshikatsu; Yamato, Masayuki; Okano, Teruo

    2010-10-01

    A comb-type grafted poly(N-isopropylacrylamide) (PIPAAm) gel modified surface was newly developed for providing a rapid cell sheet recovery for tissue engineering. PIPAAm macromonomer was prepared by the etherification reaction of the hydroxyl terminal moieties of PIPAAm with acryloyl chloride, followed by the radical telomerization reaction of N-isopropylacrylamide (IPAAm) monomer using 2-mercaptoethanol as a chain transfer agent. Solution containing IPAAm monomer and PIPAAm macromonomer was spread on the surface of tissue culture polystyrene (TCPS), and then the surface was subjected to electron beam irradiation for grafting the monomer and macromonomer on the surfaces, resulting in comb-type grafted PIPAAm gel modified TCPS (GG-TCPS). Besides the difference of the amount of the modified PIPAAm, no distinct difference was found between the properties of GG-TCPSs and normal-type PIPAAm gel modified TCPS (NG-TCPS) through XPS, AFM and a contact angle measurement. At 37 degrees C, bovine aortic endothelial cells (BAECs) were well adhered and spread on GG-TCPS as well as NG-TCPS regardless of the macromonomer concentration. By lowering temperature to 20 degrees C, BAECs detached themselves more rapidly from GG-TCPS compared with NG-TCPS. Upon lowering temperature, the grafted polymer was speculated to accelerate the hydration of modified PIPAAm gel, resulting in a rapid cell sheet detachment.

  3. The Zeta Potential of Surface-Functionalized Metallic Nanorod Particles in Aqueous Solution

    SciTech Connect

    Dougherty, G M; Rose, K A; Tok, J B; Pannu, S S; Chuang, F S; Sha, M Y; Chakarova, G; Penn, S G

    2007-05-07

    Metallic nanoparticles suspended in aqueous solutions, and functionalized with chemical and biological surface coatings, are important elements in basic and applied nanoscience research. Many applications require an understanding of the electrokinetic or colloidal properties of such particles. In this paper we describe the results of experiments to measure the zeta potential of metallic nanorod particles in aqueous saline solutions, including the effects of pH, ionic strength, metallic composition, and surface functionalization state. Particle substrates tested include gold, silver, and palladium monometallic particles as well as gold/silver bimetallic particles. Surface functionalization conditions included 11-mercaptoundecanoic acid (MUA), mercaptoethanol (ME), and mercaptoethanesulfonic acid (MESA) self-assembled monolayers (SAMs), as well as MUA layers subsequently derivatized with proteins. Zeta potential data for typical charge-stabilized polystyrene particles are also presented for comparison. Experimental data are compared with theory. The results of these studies are useful in predicting and controlling the aggregation, adhesion, and transport of functionalized metallic nanoparticles within microfluidic devices and other systems.

  4. Association of poly(ADP-ribose) polymerase with nuclear subfractions catalyzed with sodium tetrathionate and hydrogene peroxide crosslinks.

    PubMed

    Desnoyers, S; Kirkland, J B; Poirier, G G

    1996-06-21

    Poly(ADP-ribose) polymerase (PARP) is a nuclear enzyme which catalyzes the transfer of ADP-ribose units from NAD+ to a variety of nuclear proteins under the stimulation of DNA strand break. To examine its role in DNA repair, we have been studying the interaction of PARP with other nuclear proteins using disulfide cross-linking, initiated by sodium tetrathionate (NaTT). Chinese Hamster Ovary (CHO) cells were extracted sequentially with Nonidet P40 (detergent), nucleases (DNase+RNase), and high salt (1.6 M NaCl) with and without the addition of a sulfhydryl reducing agent. The residual structures are referred to as the nuclear matrix, and are implicated in the organization of DNA repair and replication. Treatment of the cells with NaTT causes the crosslinking of PARP to the nuclear matrix. Activating PARP by pretreating the cells with H2O2 did not increase the cross-linking of PARP with the nuclear matrix, suggesting a lack of additional interaction of the enzyme with the nuclear matrix during DNA repair. Both NaTT and H2O2 induced crosslinks of PARP that were extractable with high salt. To shorten the procedure, these crosslinks were extracted from cells without nucleases and high salt treatment, using phosphate buffer. Using western blotting, these crosslinks appeared as a smear of high molecular weight species including a possible dimer of PARP at 230 kDa, which return to 116 kDa following reduction with beta-mercaptoethanol.

  5. Localization of the African swine fever virus attachment protein P12 in the virus particle by immunoelectron microscopy.

    PubMed

    Carrascosa, A L; Saastre, I; González, P; Viñuela, E

    1993-03-01

    The African swine fever virus attachment protein p12 was localized in the virion by immunoelectron microscopy. Purified virus particles were incubated, before or after different treatments, with p12-specific monoclonal antibody 24BB7 and labeled with protein A-colloidal gold. Untreated virus particles showed labeling only in lateral protrusions that followed the external virus envelope. Mild treatment of African swine fever virions with the nonionic detergent octyl-glucoside or with ethanol onto the electron microscope grid resulted in a heavier and more homogeneous labeling of the virus particles. In contrast, the release of the external virus proteins by either octyl-glucoside or Nonidet-P40 and beta-mercaptoethanol generated a subviral fraction that was not labeled by 24BB7. Preembedding, labeling, and thin-sectioning experiments confirmed that the antigenic determinant recognized by 24BB7 was localized into the external region of the virus particle but required some disruption to make it more accessible. From these results we conclude that protein p12 is situated in a layer above the virus capsid with, at least, one epitope predominantly not exposed in the virion surface; this epitope may not be related to the virus ligand-cell receptor interaction.

  6. Experimental thyroiditis in the rhesus monkey. I. Cytotoxic, mixed-agglutinating and complement-fixing antibodies

    PubMed Central

    Kite, J. H.; Argue, Helen; Rose, N. R.

    1966-01-01

    Rhesus monkeys inoculated repeatedly with a crude extract of pooled rhesus thyroids plus complete Freund adjuvant produced autoantibodies cytotoxic for monkey and human thyroid cells in vitro. No cytotoxicity was observed with normal rhesus kidney or adrenal cells taken as controls from the same animals. The specific cytotoxic reaction was absorbed by thyroid microsomes, but not by other tissue fractions. Monkey (as well as human) thyroiditis sera failed to fix complement with thyroglobulin although both fixed complement with crude thyroid suspensions. The cytotoxic antibody was heat stable (56°C for 30 min) and required complement for damage to tissue cells. Fractionation by sucrose gradient ultracentrifugation demonstrated that the cytotoxic antibody had a sedimentation rate of about 7S and was stable to sulphydryl agents, whereas the complement-fixing antibody sedimented more rapidly and was largely inactivated by mercaptoethanol treatment. Thus in this case, cytotoxic antibody is not identical with the over-all complement-fixing activity of an antiserum. The presence of organ specific antigen on the surface of cultured rhesus thyroid cells was detected by the mixed agglutination antiglobulin reaction using monkey antisera. The curves of antibody production detected by mixed agglutination and cytotoxicity tend to correspond although the former test was 10–100 times more sensitive. ImagesFig. 2Fig. 3Fig. 4 PMID:4958216

  7. Ethylene Enhances Water Transport in Hypoxic Aspen1

    PubMed Central

    Kamaluddin, Mohammed; Zwiazek, Janusz J.

    2002-01-01

    Water transport was examined in solution culture grown seedlings of aspen (Populus tremuloides) after short-term exposures of roots to exogenous ethylene. Ethylene significantly increased stomatal conductance, root hydraulic conductivity (Lp), and root oxygen uptake in hypoxic seedlings. Aerated roots that were exposed to ethylene also showed enhanced Lp. An ethylene action inhibitor, silver thiosulphate, significantly reversed the enhancement of Lp by ethylene. A short-term exposure of excised roots to ethylene significantly enhanced the root water flow (Qv), measured by pressurizing the roots at 0.3 MPa. The Qv values in ethylene-treated roots declined significantly when 50 μm HgCl2 was added to the root medium and this decline was reversed by the addition of 20 mm 2-mercaptoethanol. The results suggest that the response of Qv to ethylene involves mercury-sensitive water channels and that root-absorbed ethylene enhanced water permeation through roots, resulting in an increase in root water transport and stomatal opening in hypoxic seedlings. PMID:11891251

  8. Antiviral Effects of Pyrrolidine Dithiocarbamate on Human Rhinoviruses

    PubMed Central

    Gaudernak, Elisabeth; Seipelt, Joachim; Triendl, Andrea; Grassauer, Andreas; Kuechler, Ernst

    2002-01-01

    Human rhinoviruses (HRVs) are the predominant cause of the common cold. The frequency of HRV infections in industrial countries and the lack of effective therapeutical treatment underline the importance of research for new antiviral substances. As viral infections are often accompanied by the generation of oxidative stress inside the infected cells, several redox-active substances were tested as potential antivirals. In the course of these studies it was discovered that pyrrolidine dithiocarbamate (PDTC) is an extremely potent compound against HRV and poliovirus infection in cell culture. Besides the ability to dramatically reduce HRV production by interfering with viral protein expression, PDTC promotes cell survival and abolishes cytopathic effects in infected cells. PDTC also protects cells against poliovirus infection. These effects were highly specific, as several other antioxidants (vitamin C, Trolox, 2-mercaptoethanol, and N-acetyl-l-cysteine) are inactive against HRV infection. Synthesis of HRV proteins and cleavage of eucaryotic initiation factor 4G responsible for host cell shutoff of cellular protein synthesis are severely inhibited in the presence of PDTC. PMID:12021333

  9. Fluorescent sensing of homocysteine in urine: using fluorosurfactant-capped gold nanoparticles and o-Phthaldialdehyde.

    PubMed

    Lin, Jia-Hui; Chang, Chung-Wei; Tseng, Wei-Lung

    2010-01-01

    This study reports the development of a simple, sensitive, and selective-detection system for homocysteine (HCys) based on the combination of fluorosurfactant-capped gold nanoparticles (FSN-AuNPs) and o-Phthaldialdehyde (OPA). The proposed assay utilizes FSN-AuNPs as extractors for HCys and cysteine (Cys), which can then be collected by centrifugation. As long as the HCys and Cys are isolated from the initial sample, they can be liberated from the NP surface by 2-mercaptoethanol (2-ME). The derivatization of released HCys with OPA/2-ME has a strong fluorescence maximum at 485 nm, whereas the derivatization of released Cys with the same reagent shows an extremely weak fluorescence maximum at 457 nm. As a result, the selectivity of this system is more than 100-fold for HCys over any aminothiols when excited at 370 nm. The extraction and derivation efficiencies are monitored as functions of the concentration of FSN-AuNPs and OPA, respectively. The proposed system has a detection limit of 180 nM at a signal-to-noise ratio of 3 for HCys. This study validates the applicability of this system by analyzing the amount of HCys in urine samples.

  10. A single step protein assay that is both detergent and reducer compatible: The cydex blue assay.

    PubMed

    Rabilloud, Thierry

    2016-10-01

    Determination of protein concentration is often an absolute prerequisite in preparing samples for biochemical and proteomic analyses. However, current protein assay methods are not compatible with both reducers and detergents, which are however present simultaneously in most denaturing extraction buffers used in proteomics and electrophoresis, and in particular in SDS electrophoresis. It was found that inclusion of cyclodextrins in a Coomassie blue-based assay made it compatible with detergents, as cyclodextrins complex detergents in a 1:1 molecular ratio. As this type of assay is intrinsically resistant to reducers, a single-step assay that is both detergent and reducer compatible was developed. Depending on the type and concentration of detergents present in the sample buffer, either beta-cyclodextrin or alpha-cyclodextrin can be used, the former being able to complex a wider range of detergents and the latter being able to complex higher amounts of detergents due to its greater solubility in water. Cyclodextrins are used at final concentrations of 2-10 mg/mL in the assay mix. This typically allows to measure samples containing as little as 0.1 mg/mL protein, in the presence of up to 2% detergent and reducers such as 5% mercaptoethanol or 50 mM DTT in a single step with a simple spectrophotometric assay.

  11. Purification, cloning, and identification of two thaumatin-like protein isoforms in jelly fig (Ficus awkeotsang) Achenes.

    PubMed

    Chua, Anna C N; Chou, Wing-Ming; Chyan, Chia-Lin; Tzen, Jason T C

    2007-09-05

    Jelly curd used for a popular summer drink in Taiwan is prepared by extracting the pericarpial portion of jelly fig (Ficus awkeotsang Makino) achenes. The two most abundant proteins found in jelly curd have been identified as a pectin methylesterase and a chitinase. A method was developed to purify the next abundant protein by 40% ammonium sulfate precipitation and flowing through Mono Q chromatography. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis analyses, the purified protein migrated as a polypeptide of 20 kDa in the absence of beta-mercaptoethanol but split into a minor polypeptide of 20 kDa and a major polypeptide of 27 kDa in the presence of this reducing agent. Two cDNA fragments encoding precursor polypeptides of two putative thaumatin-like protein isoforms were obtained by polymerase chain reaction cloning and subsequently overexpressed in Escherichia coli to generate recombinant proteins for antibody preparations. Immunological detection and mass spectrometric analyses indicated that the two split polypeptides were thaumatin-like protein isoforms encoded by the two cloned cDNA fragments.

  12. A serological diagnostic survey for Brucella canis infection in Turkish patients with Brucellosis-like symptoms.

    PubMed

    Sayan, Murat; Erdenlig, Sevil; Stack, Judy; Kilic, Selcuk; Guducuoglu, Huseyin; Aksoy, Yavuz; Baklan, Ayhan; Etiler, Nilay

    2011-01-01

    The incidence of Brucella canis infection in humans is unknown in Turkey. In this study, we investigated the prevalence of B. canis infection in human sera obtained from six regions in Turkey and comparatively evaluated the results obtained by agglutination-based techniques using standardized antigens made from B. canis. The patients (n = 1,746) presented with clinical symptoms that were similar to those of brucellosis. All patients who tested negative in the Rose Bengal test for the smooth Brucella strains (abortus, melitensis, and suis) were screened for evidence of B. canis infection using the rapid slide agglutination test (RSAT), the microagglutination test (MAT), and the 2-mercaptoethanol RSAT test (2ME-RSAT). Of the samples tested, 157 (8.9%), 68 (3.8%), and 66 (3.7%) were positive for B. canis, as determined by RSAT, MAT, and 2ME-RSAT, respectively. The diagnostic sensitivity, specificity, positive predictive value, and negative predictive value of RSAT were 100%, 94.6%, 42%, and 100%, respectively, and of MAT were 100%, 99.9%, 97%, and 100%, respectively. We recommend the routine use of MAT and 2ME-RSAT to check the sera of all patients with symptoms of brucellosis who are negative for brucellosis using a smooth Brucella antigen.

  13. Purification and characterization of a heteromultimeric glycoprotein from Artocarpus heterophyllus latex with an inhibitory effect on human blood coagulation.

    PubMed

    Siritapetawee, Jaruwan; Thammasirirak, Sompong

    2011-01-01

    Plant latex has many health benefits and has been used in folk medicine. In this study, the biological effect of Artocarpus heterophyllus (jackfruit) latex on human blood coagulation was investigated. By a combination of heat precipitation and ion-exchange chromatography, a heat stable heteromultimeric glycoprotein (HSGPL1) was purified from jackfruit milky latex. The apparent molecular masses of the monomeric proteins on SDS/PAGE were 33, 31 and 29 kDa. The isoelectric points (pIs) of the monomers were 6.63, 6.63 and 6.93, respectively. Glycosylation and deglycosylation tests confirmed that each subunit of HSGPL1 formed the native multimer by sugar-based interaction. Moreover, the multimer of HSGPL1 also resisted 2-mercaptoethanol action. Peptide mass fingerprint analysis indicated that HSGPL1 was a complex protein related to Hsps/chaperones. HSGPL1 has an effect on intrinsic pathways of the human blood coagulation system by significantly prolonging the activated partial thrombin time (APTT). In contrast, it has no effect on the human extrinsic blood coagulation system using the prothrombin time (PT) test. The prolonged APTT resulted from the serine protease inhibitor property of HSGPL1, since it reduced activity of human blood coagulation factors XI(a) and α-XII(a).

  14. A sensitive immunoblotting technique for the serodiagnosis of Brucella ovis infections.

    PubMed

    Kittelberger, R; Hansen, M; Ross, G P; Hilbink, F

    1994-04-01

    A simplified electrophoretic immunoblotting technique based on antigen extracted from Brucella ovis cells with sodium dodecyl sulfate/mercaptoethanol was compared with the complement fixation test (CFT), the enzyme-linked immunosorbent assay, and the gel diffusion test. Sera from 89 chronically infected, semen culture-positive rams, 378 sera from B. ovis-infected flocks, 300 sera from accredited disease-free flocks, and 29 sera from specific-pathogen-free sheep were used. The immunoblotting technique had sensitivity and specificity comparable to those of the standard tests and was able to identify several CFT-negative or -borderline sera as positive. The major immunoreactive antigens of B. ovis had molecular masses of 63, 29, 19 kD (proteins) and 8-12 kD (rough lipopolysaccharide). Antibodies against these antigens were present in 96% of CFT-positive sera from infected flocks and in 100% of sera from semen culture-positive rams. However, immunoblotting also identified antibodies to components other than the major antigens in 1% of CFT-negative sera from infected flocks and in 7.7% of the sera from flocks with a history of freedom from the disease. These reactions probably represent cross-reactivities with other microorganisms and were distinguishable from truly positive reactions.

  15. Biotin as a probe of the surface of Ascaris suum developmental stages.

    PubMed

    Hill, D E; Fetterer, R H; Urban, J F

    1990-06-01

    Sulfo-NHS-biotin (aqueous soluble) and NHS-biotin (organic soluble) labeled similar SDS-2ME (sodium dodecyl sulfate/beta-mercaptoethanol) soluble cuticular proteins of second stage larvae (L2) and third stage Ascaris suum larvae (L3). Comparable analysis of biotin-labeled fourth stage larvae (L4), young adults, and mature adult Ascaris suum revealed strong labeling of several SDS-2ME soluble cuticular proteins with NHS-biotin, while sulfo-NHS-biotin appeared to strongly label a single SDS-2ME soluble cuticular protein. Both biotin probes labeled only cuticular proteins, since no evidence of internal labeling was observed in any developmental stage examined by either electroblot analysis or by electron microscopy. Our data suggest a greater cuticular permeability to the organic soluble biotin reagent in the later developmental stages (greater than L3) of A. suum than to the aqueous soluble biotin reagent, and may indicate the presence of a hydrophobic barrier in the cuticle of the later stages of the parasite.

  16. Surface treatment properties of CdS quantum dot-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Razzaq, Abdul; Lee, Jun Young; Bhattacharya, Bhaskar; Park, Jung-Ki

    2014-08-01

    The dye-sensitized solar cells (DSSCs) are attractive due to their low cost and promising efficiency. One of the research perspectives in the respective field is to replace the expensive and photodegradable ruthenium metal-based dyes. Present work describes a simple, modified in situ route designed by mimicking the adsorption principle of dyes in DSSCs for surface modification and linking of CdS-Quantum Dots (QDs) to TiO2 electrode. An organic compound 2-mercaptoethanol (ME) was used as a surface modifying and linking agent. By following this route it was expected to get a well assembled layer of CdS QDs for better cell performance but performances were not as expected. The main reason for low photocurrent density is the partial coverage of QDs surface by ME and the spatial distance between QDs and TiO2 electrode. Additional surface treatment of the CdS QDs sensitized TiO2 electrode resulted in an increase in the photocurrent density and photovoltage. This indicates that ME is not an effective capping agent and thus partially covers the QDs surface. The remaining sites, not covered by ME were passivated by sulfur ions in the ionic solution.

  17. Enzymic synthesis of indol-3-ylacetyl-myo-inositol galactoside.

    PubMed

    Corcuera, L J; Michalczuk, L; Bandurski, R S

    1982-11-01

    Extracts of immature kernels of Zea mays catalysed the synthesis of indol-3-ylacetyl-myo-inositol galactoside from indol-3-ylacetyl-myo-inositol and UDP-galactose. Addition of 2-mercaptoethanol was required for stability of the catalytic activity during dialysis. The enzyme could be fractionated with (NH4)2SO4, and 55% of the activity was recovered in the 30-60%-saturation fraction. The product of the reaction contained radioactivity from UDP-[U-14C]galactose and was identified as indol-3-ylacetyl-myo-inositol galactoside by gas chromatography-mass spectrometry. Therefore a UDP-galactose:indol-3-ylacetyl-myo-inositol galactosyltransferase (indol-3-ylacetyl-myo-inositol galactoside synthase) is present in developing kernels of Zea mays. The description of this enzyme, together with the enzymes described in the accompanying paper [Michalczuk & Bandurski (1982) Biochem. J. 207, 273-281] for the synthesis of indol-3-ylacetylglucose and indol-3-ylacetyl-myo-inositol, now provides mechanisms for the biosynthesis of one-half of the low-molecular-weight esters of indol-3-ylacetic acid in Zea mays.

  18. Reducer driven baric denaturation and oligomerisation of whey proteins.

    PubMed

    Grinberg, V Y; Haertlé, T

    2000-05-26

    The influence of high pressure on alpha-lactalbumin (ALA)/beta-lactoglobulin (BLG) mixtures of various compositions was studied at pH 8.5 by gel-permeation chromatography and sodium dodecyl sulphate (SDS) gel electrophoresis without 2-mercaptoethanol. High-molecular protein disulfide oligomers formed after denaturation by the pressure of 10 kbar (1000 MPa) if the weight fraction of BLG (W(BLG)(0)) in the protein mixture exceeded 0.2. The maximum yield of these oligomers of order 80-85% is observed at W(BLG)(0)>/=0.4. Conversions of both proteins in the oligomers are roughly the same. The estimates of the oligomerisation yield obtained by the gel-permeation chromatography and SDS gel electrophoresis agree well. This indicates that the formation of intermolecular disulfide bonds is necessary for the oligomerisation. Thus, the oligomerisation of pressure denatured ALA and BLG is driven by the thiol<-->disulfide exchange rendered possible by the vigorous baric denaturation and the exposure of the free thiol group of BLG, which acts as an initiator of disulfide bridges scrambling.

  19. The trypanocidal effect of sesquiterpene lactones helenalin and mexicanin on cultured epimastigotes.

    PubMed

    Jimenez-Ortiz, Verónica; Brengio, Silvia D; Giordano, Oscar; Tonn, Carlos; Sánchez, Matías; Burgos, Mario H; Sosa, Miguel A

    2005-02-01

    Sesquiterpene lactones constitute a large group of biologically active compounds obtained from plants. The lactones, mexicanin (MXN) and helenalin (HLN), were reported recently as active against the infective form of Trypanosoma cruzi. In this work, we studied the effects of these compounds on the growth and viability of the noninfective epimastigote, to compare the sensitivity of the 2 stages and to characterize their actions. Both compounds were cytotoxic to the parasites, with HLN (inhibitory concentration 50% [IC50] 1.9 +/- 0.08 microM) more potent than MXN (IC50 3.8 +/- 0.19 microM) and the typanocidal drug, benznidazole (IC50 8.6 +/- 2.5 microM). The results showed that epimastigotes are less sensitive than trypomastigotes to the compounds. The trypanocidal effect of these lactones, irreversible after 12-hr exposure, was not reversed by the reducing agents dithiotreitol or beta-mercaptoethanol. Ultrastructurally, we observed cytoplasmic vacuolization and nuclear disorganization. Although concentrations between 0.5 and 1.5 microM of the drugs were not lethal to the parasites, epimastigotes became thinner and their nuclei became more pycnotic after exposure. We conclude that MXN and HLN are deleterious for T. cruzi epimastigotes and that their mechanism of action is different than that of the related lactone, dehydroleucodine.

  20. Antigen-specific immune-suppressor factor in herpes simplex virus type 2 infections of UV B-irradiated mice

    SciTech Connect

    Aurelian, L.; Yasumoto, S.; Smith, C.C.

    1988-07-01

    UV B-irradiation (280 to 320 nm) of mice at the site of cutaneous infection with herpes simplex virus type 2 (HSV-2) induced suppressor T-cell circuits that decreased HSV-2-induced proliferative responses of HSV-2-immune lymph node cells. Adoptive transfer experiments indicated that splenocytes from UV B-irradiated HSV-2-infected animals contain L3T4+ cells that suppress proliferative responses in vivo, consistent with suppressor inducer cells. However, following in vitro culture of the splenocytes with HSV-2 antigen, the proliferation of immune lymph node cells was inhibited by Lyt2+ suppressor T cells, consistent with antigen-induced suppressor effector cells. Antigen-specific and nonspecific suppressor factors were fractionated from supernatants of HSV-2-stimulated spleen cells by molecular-sieve chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the Sephadex fraction that contained the antigen-specific suppressor factor, in the presence or absence of 2-mercaptoethanol, defined a 115-kilodalton protein consisting of two disulfide-bound components with molecular sizes of 70 and 52 kilodaltons. The implications of these results with respect to the regulation of HSV-induced cell-mediated immunity following UV B-irradiation are discussed.