Science.gov

Sample records for mesothermal gold mineralisation

  1. Mobilisation and bioavailability of arsenic around mesothermal gold deposits in a semiarid environment, Otago, New Zealand.

    PubMed

    Craw, D; Pacheco, L

    2002-02-05

    Arsenopyrite (FeAsS) is the principal arsenic (As) mineral in mineralised mesothermal veins (typically 5,000 mg/kg As) in southeastern New Zealand. Groundwater in contact with arsenopyrite-bearing rocks has elevated As concentrations (up to 0.1 mg/l). The arsenopyrite decomposes slowly on oxidation in soils and historic mine workings in a cool semiarid climate. Dissolved As is predominantly As(III) in association with arsenopyrite, but this is rapidly oxidised over days to weeks to As(V) in the vadose zone. Oxidation is facilitated by particulate Fe and/or Mn oxyhydroxides, and by bacteria in surface waters. Evaporative concentration of dissolved As(V) in the vadose zone causes precipitation of scorodite (Fe(III)As(V)O4*2H2O). Adsorption of As(V) to Fe oxyhydroxides in soils and groundwater pathways lowers dissolved As concentrations. Soils over mineralised veins typically have <200 mg/kg As, as most As is removed in solution on geological time scales. Most plants on the mineralised rocks and soils do not take up As, although some inedible species can fix up to 18 mg/kg As. Hence, bioavailability of As(V) is low in this environment, despite the substantial As flux. Similar As mobility is seen in an active gold mine processing plant and tailings. Arsenopyrite dissolves more rapidly on agitation, and mine waters can have dissolved As >200 mg/l, predominantly as As(V). This dissolved As decreases in tailings waters to near 2 mg/l, mainly as As(III) when in contact with arsenopyrite. Weak oxidation of evaporatively dried tailings causes cementation with scorodite and iron oxyhydroxides, and scorodite precipitation exerts some control on dissolved As(V) concentrations. High dissolved As in mine waters is lowered by adsorption to iron oxyhydroxides, and waters discharged from the mine site have negligible dissolved As.

  2. Age constraints of the Wassa and Benso mesothermal gold deposits, Ashanti Belt, Ghana, West Africa

    NASA Astrophysics Data System (ADS)

    Parra-Avila, Luis A.; Bourassa, Yan; Miller, John; Perrouty, Stéphane; Fiorentini, Marco L.; Campbell McCuaig, T.

    2015-12-01

    The Ashanti Belt in Ghana hosts numerous multi-million ounce gold deposits and is one of the most richly gold endowed Paleoproterozoic belts of the West African Craton. This work shows that the Wassa mineralized intrusion is part of the Sefwi Group. This unit at Wassa is strongly magnetic and show a distinctly high response in regional magnetic data sets compared to other units of equivalent age within the belt. The unit is inferred to be a lateral extension of an exposed fragment of what defines the substrate to the Tarkwa Basin sediments. The Wassa deposit, located in the eastern limb of the belt, is hosted within mafic to intermediate volcanic flows that are interbedded with minor horizons of volcaniclastics, clastic sediments. The clastic sediments include wackes and magnetite rich sedimentary layers, presumably derived from banded iron formations. The previously described sequence is intruded by syn-volcanic mafic intrusives and felsic porphyries rocks that are all part of the Birimian stratigraphy. Two new key SHRIMP II U-Pb ages were determined as part of this study: a new age of 2191 ± 6 Ma was determined on magmatic zircon grains of the Wassa porphyry host rock, which now represents the oldest known felsic intrusion hosting gold mineralization in the Ashanti Belt region. The Benso gold deposit system, which is located in the eastern limb of the Ashanti Belt approximately 38 km southwest of Wassa is hosted within a series of volcanic units intruded by mafic to intermediate units. A SHRIMP II U-Pb age of 2157 ± 5 Ma was determined from magmatic zircons obtained from a granodiorite of the G-Zone of the Benso deposit. This granodiorite is the main host rock for gold mineralization and thus the age provides an upper constraint for mineral emplacement. The newly determined ages provide an upper constraint for the gold mineralization within this region of the Ashanti Belt. They also support recent structural studies that have interpreted that the Wassa

  3. Orogenic gold mineralisation hosted by Archaean basement rocks at Sortekap, Kangerlussuaq area, East Greenland

    NASA Astrophysics Data System (ADS)

    Holwell, D. A.; Jenkin, G. R. T.; Butterworth, K. G.; Abraham-James, T.; Boyce, A. J.

    2013-04-01

    A gold-bearing quartz vein system has been identified in Archaean basement rocks at Sortekap in the Kangerlussuaq region of east Greenland, 35 km north-northeast of the Skaergaard Intrusion. This constitutes the first recorded occurrence of Au mineralisation in the metamorphic basement rocks of east Greenland. The mineralisation can be classified as orogenic style, quartz vein-hosted Au mineralisation. Two vein types have been identified based on their alteration styles and the presence of Au mineralisation. Mineralised type 1 veins occur within sheared supracrustal units and are hosted by garnet-bearing amphibolites, with associated felsic and ultramafic intrusions. Gold is present as native Au and Au-rich electrum together with arsenopyrite and minor pyrite and chalcopyrite in thin alteration selvages in the immediate wall rocks. The alteration assemblage of actinolite-clinozoisite-muscovite-titanite-scheelite-arsenopyrite-pyrite is considered to be a greenschist facies assemblage. The timing of mineralisation is therefore interpreted as being later and separate event to the peak amphibolite facies metamorphism of the host rocks. Type 2 quartz veins are barren of mineralisation, lack significant alteration of the wall rocks and are considered to be later stage. Fluid inclusion microthermometry of the quartz reveals three separate fluids, including a high temperature ( T h = 300-350 °C), H2O-CO2-CH4 fluid present only in type 1 veins that in interpreted to be responsible for the main stage of Au deposition and sulphidic wall rock alteration. It is likely that the carbonic fluids were actually trapped at temperatures closer to 400 °C. Two other fluids were identified within both vein types, which comprise low temperature (100-200 °C) brines, with salinities of 13-25 wt% eq. NaCl and at least one generation of low salinity aqueous fluids. The sources and timings of the secondary fluids are currently equivocal but they may be related to the emplacement of

  4. Mineralisation footprints and regional timing of the world-class Siguiri orogenic gold district (Guinea, West Africa)

    NASA Astrophysics Data System (ADS)

    Lebrun, Erwann; Thébaud, Nicolas; Miller, John; Roberts, Malcolm; Evans, Noreen

    2016-10-01

    Siguiri is a world-class orogenic gold district hosted in the weakly metamorphosed Upper Birimian to Lower Tarkwa Group sedimentary rocks of the Siguiri Basin (Guinea). The district is characterised by a protracted deformation history associated with four main deformation events: D1S is a N-S compression; D2S is an E-W compression progressively evolving into an early-D3S transpression and then into a late-D3S NNW-SSE transtension and D4S is a NE-SW compression. Field observations, petrography and geochemistry at three key deposits of the Siguiri district (Bidini, Sintroko PB1 and Kosise) suggest a polyphase hydrothermal history that can be subdivided into four hydrothermal events. The first hydrothermal event was associated with the development of barren bedding-parallel and en-echelon V2S quartz-dominated-(pyrite) veins. The second hydrothermal event is characterised by the development of V3A pyrite-ankerite veins late during D3S. Laser ablation-ICP-MS data show that this vein set contains high gold contents of up to 43.3 ppm, in substitution in pyrite crystal lattice, representing a minor first gold mineralisation event. The third and most prominently developed hydrothermal event is late D3S and represents the second and principal gold mineralisation event. This mineralisation event led to two distinct mineralisation textures. The first texture is best exposed in the Kosise deposit and is characterised by gold-bearing quartz-ankerite-arsenopyrite conjugate V3B veins. Although the bulk of the gold is hosted in native gold grains in V3B veins, LA-ICP-MS analyses show that gold also substitutes in the arsenopyrite crystal lattice (up to 55.5 ppm). The second mineralisation texture is best expressed in the Sanu Tinti deposit and consists of disseminated barren pyrite hosted in a polymict conglomerate. The second and third hydrothermal events are both structurally controlled by a series of early-D3S N-S, NE-SW, WNW-ESE and E-W sub-vertical incipient structures

  5. Geological and geochemical implications of the genesis of the Qolqoleh orogenic gold mineralisation, Kurdistan Province (Iran)

    NASA Astrophysics Data System (ADS)

    Taghipour, Batoul; Ahmadnejad, Farhad

    2015-03-01

    The Qolqoleh gold deposit is located in the northwestern part of the Sanandaj-Sirjan Zone (SSZ), within the NE-SW trending Qolqoleh shear zone. Oligocene granitoids, Cretaceous meta-limestones, schists and metavolcanics are the main lithological units. Chondrite-normalised REE patterns of the ore-hosting metavolcanics indicate REE enrichment relative to hanging wall (chlorite-sericite schist) and footwall (meta-limestone) rocks. The pattern also reflects an enrichment in LREE relative to HREE. It seems that the LREE enrichment is related to the circulation of SO42- and CO2-bearing fluids and regional metamorphism in the Qolqoleh shear zone. Both positive and negative Eu anomalies are observed in shear-zone metavolcanics. These anomalies are related to the degree of plagioclase alteration during gold mineralisation and hydrothermal alteration. In progressing from a metavolcanic protomylonite to an ultramylonite, significant changes occurred in the major/trace element and REE concentration. Utilising an Al-Fe-Ti isocon for the ore-hosting metavolcanics shows that Sc, Y, K, U, P, and M-HREE (except Eu) are relatively unchanged; S, As, Ag, Au, Ca, LOI, Rb and LREE are enriched, and Sr, Ba, Eu, Cr, Co and Ni decrease with an increasing degree of deformation. Based on geochemical features and comparison with other well-known shear zones in the world, the study area is best classified as an Isovolume-Gain (IVG) type shear zone and orogenic type gold mineralisation. Based on the number of phases observed at room temperature and their microthermometric behaviour, three fluid inclusion types have been recognised in quartz-sulphide and quartz-calcite veins: Type I monophase aqueous inclusions, Type II two-phase liquid-vapour (L-V) inclusions which are subdivided into two groups based on the homogenisation temperature (Th): a) L-V inclusions with Th from 205 to 255°C and melting temperature of last ice (Tm) from -3 to -9°C. b) L-V inclusions with higher Th from 335 to 385

  6. Controls on mineralisation in the Sierra Foothills gold province, central California, USA: A GIS-based reconnaissance prospectivity analysis

    USGS Publications Warehouse

    Bierlein, F.P.; Northover, H.J.; Groves, D.I.; Goldfarb, R.J.; Marsh, E.E.

    2008-01-01

    The assessment of spatial relationships between the location, abundance and size of orogenic-gold deposits in the highly endowed Sierra Foothills gold province in California, via the combination of field studies and a GIS-based analysis, illustrates the power of such an approach to the characterisation of important parameters of mineral systems, and the prediction of districts likely to host economic mineralisation. Regional- to deposit-scale reconnaissance mapping suggests that deposition of gold-bearing quartz veins occurred in second- and third-order, east-over-west thrusts during regional east - west compression and right-lateral transpression. At the district-scale, significant zones of mineralisation correspond with such transpressional reactivation zones and dilational jogs that developed during the Late Jurassic - Early Cretaceous along the misaligned segments of first-order faults throughout the Sierra Nevada Foothills Metamorphic Belt. Field-based observations and interpretation of GIS data (including solid geology, structural elements, deposit locations, magnetics, gravity) also highlight the importance of structural permeability contrasts, rheological gradients, and variations in fault orientation for localising mineralisation. Although this approach confirms empirical findings and produces promising results at the province scale, enhanced geological, structural, geophysical and geochronological data density is required to generate regionally consistent, high-quality input layers that improve predictive targeting at the goldfield to deposit-scale.

  7. Age constraints on felsic intrusions, metamorphism and gold mineralisation in the Palaeoproterozoic Rio Itapicuru greenstone belt, NE Bahia State, Brazil

    USGS Publications Warehouse

    Mello, E.F.; Xavier, R.P.; McNaughton, N.J.; Hagemann, S.G.; Fletcher, I.; Snee, L.

    2006-01-01

    U-Pb sensitive high resolution ion microprobe mass spectrometer (SHRIMP) ages of zircon, monazite and xenotime crystals from felsic intrusive rocks from the Rio Itapicuru greenstone belt show two development stages between 2,152 and 2,130 Ma, and between 2,130 and 2,080 Ma. The older intrusions yielded ages of 2,152??6 Ma in monazite crystals and 2,155??9 Ma in zircon crystals derived from the Trilhado granodiorite, and ages of 2,130??7 Ma and 2,128??8 Ma in zircon crystals derived from the Teofila??ndia tonalite. The emplacement age of the syntectonic Ambro??sio dome as indicated by a 2,080??2-Ma xenotime age for a granite dyke probably marks the end of the felsic magmatism. This age shows good agreement with the Ar-Ar plateau age of 2,080??5 Ma obtained in hornblendes from an amphibolite and with a U-Pb SHRIMP age of 2,076??10 Ma in detrital zircon crystals from a quartzite, interpreted as the age of the peak of the metamorphism. The predominance of inherited zircons in the syntectonic Ambro??sio dome suggests that the basement of the supracrustal rocks was composed of Archaean continental crust with components of 2,937??16, 3,111??13 and 3,162??13 Ma. Ar-Ar plateau ages of 2,050??4 Ma and 2,054??2 Ma on hydrothermal muscovite samples from the Fazenda Brasileiro gold deposit are interpreted as minimum ages for gold mineralisation and close to the true age of gold deposition. The Ar-Ar data indicate that the mineralisation must have occurred less than 30 million years after the peak of the metamorphism, or episodically between 2,080 Ma and 2,050 Ma, during uplift and exhumation of the orogen. ?? Springer-Verlag 2006.

  8. The Sarylakh and Sentachan gold-antimony deposits, Sakha-Yakutia: A case of combined mesothermal gold-quartz and epithermal stibnite ores

    NASA Astrophysics Data System (ADS)

    Bortnikov, N. S.; Gamynin, G. N.; Vikent'eva, O. V.; Prokof'ev, V. Yu.; Prokop'ev, A. V.

    2010-10-01

    New mineralogical, thermobarometric, isotopic, and geochemical data provide evidence for long and complex formation history of the Sarylakh and Sentachan Au-Sb deposits conditioned by regional geodynamics and various types of ore mineralization, differing in age and source of ore matter combined in the same ore-localizing structural units. The deposits are situated in the Taryn metallogenic zone of the East Yakutian metallogenic belt in the central Verkhoyansk-Kolyma Fold Region. They are controlled by the regional Adycha-Taryn Fault Zone that separates the Kular-Nera Terrane and the western part of the Verkhoyansk Fold-Thrust Belt. The fault extends along the strike of the northwest-trending linear folds and is deep-rooted and repeatedly reactivated. The orebodies are mineralized crush zones accompanied by sulfidated (up to 100 m wide) quartz-sericite metasomatic rocks and replacing dickite-pyrophyllite alteration near stibnite veinlets. Two stages of low-sulfide gold-quartz and stibnite mineralization are distinguished. The formation conditions of the early milk white quartz in orebodies with stibnite mineralization at the Sarylakh and Sentachan deposits are similar: temperature interval 340-280°C, salt concentration in fluids 6.8-1.6 wt % NaCl equiv, fluid pressure 3430-1050 bar, and sodic bicarbonate fluid composition. The ranges of fluid salinity overlapped at both deposits. In the late regenerated quartz that attends stibnite mineralization, fluid inclusions contain an aqueous solution with salinity of 3.2 wt % NaCl equiv and are homogenized into liquid at 304-189°C. Syngenetic gas inclusions contain nitrogen 0.19 g/cm3 in density. The pressure of 300 bar is estimated at 189°C. The composition of the captured fluid is characterized as K-Ca bicarbonatesulfate. The sulfur isotopic composition has been analyzed in pyrite and arsenopyrite from ore and metasomatic zones, as well as in coarse-, medium-, and fine-grained stibnite varieties subjected to

  9. Zonation of primary haloes of Atud auriferous quartz vein deposit, Central Eastern Desert of Egypt: A potential exploration model targeting for hidden mesothermal gold deposits

    NASA Astrophysics Data System (ADS)

    Harraz, Hassan Z.; Hamdy, Mohamed M.

    2015-01-01

    The Atud gold mine located in the Neoproterozoic diorite and metagabbro of the Central Eastern Desert of Egypt has been initially excavated during Pharaonic times. Between 1953 and 1969, the Egyptian Geological Survey and Mining Authority performed underground prospection in the auriferous quartz vein and metasomatic alteration zones in the main Atud area, estimating a principal gold lode of 19,000 tones (16.28 g/ton), and 1600 tons of damp (1.24 g/ton). Yet the potentiality of the deposit has not been exhausted. However, for exploration of hidden ore, quantitative characterization using trace elements zoning of mineralization haloes with 280 samples from surface and three underground mining levels is applied. This was through multivariate statistical analysis (Factor analysis) of 11 selected trace elements. Axial (vertical) extents of primary haloes above and beneath gently dipping orebody are also visualized to interpret the level of erosion, determine the direction of mineralizing solutions as well as to examine whether the hidden orebody is promising at the Atud mine. Axial zones of primary dispersion aureoles of trace elements are: Ag, As, S and U around the auriferous quartz veins; Cu, and Pb in the surface horizons; and Zn, Ni, Co, and U along the lower margin of mineralization zone. Gold contents in bedrock and quartz vein samples from level-42M are the highest (5.7 and 40.3 ppm, respectively). In the transverse (lateral) direction, the maximum relative accumulation of Au and Zn occurs at the Northern Shaft; Pb, Cu, As, and U at the Main Shaft; and Ag, S, Co, and Ni at the Southern Shaft. The estimated axial zonation sequence of indicator elements using the variability index is Pb → Cu → Ag → Au → As → S → Ni → Co → U → Zn. According to this zonation, an index such as (Pb × Cu)D/(U × Zn)D can be a significant for predicting the Au potentiality at a particular depth. In addition, the Pb/U zonality index is an appropriate indicator for the

  10. Sulfur- and lead-isotope signatures of orogenic gold mineralisation associated with the Hill End Trough, Lachlan Orogen, New South Wales, Australia

    NASA Astrophysics Data System (ADS)

    Downes, P. M.; Seccombe, P. K.; Carr, G. R.

    2008-11-01

    The Hill End Trough (HET) is a deformed middle Silurian to Early Devonian sediment-dominated rift within the northeastern Lachlan Orogen. The HET hosts the Hill End, Hargraves, Napoleon Reefs, Stuart Town and Windeyer low-sulfide orogenic gold deposits. Adjacent to the HET are the Bodangora and Gulgong gold deposits. In this study we present 91 new sulfur- and 18 new lead-isotope analyses and collate a further 25 sulfur- and 32 lead-isotopes analyses from unpublished sources for these deposits. Larger gold deposits in the HET have near 0 δ34S‰ values indicating that sulfur in these systems was sourced from a magmatic reservoir. The dominant lead isotope signature for HET-hosted deposits reflects a crustal source however some mantle-derived lead has been introduced into the HET. Sulfur- and lead-isotopic results suggest that gold was sourced from mantle-derived magmatic units beneath the HET. The study supports earlier studies at Hill End by concluding that the majority of orogenic gold mineralisation in and adjacent to the HET formed during the Early Carboniferous period.

  11. Association of gold with uraninite and pyrobitumen in the metavolcanic rock hosted hydrothermal Au-U mineralisation at Rompas, Peräpohja Schist Belt, northern Finland

    NASA Astrophysics Data System (ADS)

    Molnár, Ferenc; Oduro, Harry; Cook, Nick D. J.; Pohjolainen, Esa; Takács, Ágnes; O'Brien, Hugh; Pakkanen, Lassi; Johanson, Bo; Wirth, Richard

    2016-06-01

    The Peräpohja Schist Belt comprises a supracrustal sequence of quartzites, mafic volcanics and volcaniclastics, carbonate rocks, black shales, mica schists and greywackes which were deposited from ca. 2.44 to ~1.91 Ga, during the rifting of the Archaean basement in the eastern part of the Fennoscandian shield. Metamorphism and multiple folding of the basin fill took place during the Svecofennian orogeny (1.9-1.8 Ga) followed by intrusions of late-orogenic (1.84-1.80 Ga) and post-orogenic granitoids (1.79-1.76 Ga). The Rompas Au-U mineralisation is hosted by deformed calcsilicate veins in mafic volcanic rocks and locally contains very high grade (>10,000 g/t Au) gold pockets with strict spatial association of gold minerals to uraninite and pyrobitumen. Chemical ages from the unaltered domains in the structure of uraninite indicate a 1.95-1.90 Ga age for the deposition of the primary, high temperature (e.g. U/Th < 100 in uraninite) hydrothermal uranium mineralisation. These data are in agreement with the results of previous U-Pb dating of uraninite by SIMS. Textural evidence suggests that metamorphic recrystallisation of the uraninite-bearing quartz-dolomite veins into calcsilicate mineral assemblages during the Svecofennian orogeny (1.9-1.8 Ga) was followed by a hydrocarbon-bearing fluid flow event and radiolytic polymerisation of hydrocarbons around grains of uraninite. Gold precipitated during a subsequent hydrothermal process in the fractures of uraninite, as well as in the cracks and on the botryoidal surfaces of uraninite-pyrobitumen nodules. Remobilisation and redeposition of uranium by these hydrothermal events produced secondary uraninite grains with chemical ages between 1.85 and 1.65 Ga. Native gold is associated with galena, altaite, hunchunite, nickeline and rare cobaltite, Pb-bearing maldonite, pyrite, pyrrhotite, chalcopyrite, molybdenite and titanite. Raman spectra show disordered structure of undeformed pyrobitumen nodules in contrast with the well

  12. Mineralogical and stable isotope studies of gold-arsenic mineralisation in the Sams Creek peralkaline porphyritic granite, South Island, New Zealand

    NASA Astrophysics Data System (ADS)

    Faure, Kevin; Brathwaite, Robert L.

    2006-03-01

    At Sams Creek, a gold-bearing, peralkaline granite porphyry dyke, which has a 7 km strike length and is up to 60 m in thickness, intrudes camptonite lamprophyre dykes and lower greenschist facies metapelites and quartzites of the Late Ordovician Wangapeka formation. The lamprophyre dykes occur as thin (< 3 m) slivers along the contacts of the granite dyke. δ18Omagma values (+5 to +8‰, VSMOW) of the A-type granite suggest derivation from a primitive source, with an insignificant mature crustal contribution. Hydrothermal gold-sulphide mineralisation is confined to the granite and adjacent lamprophyre; metapelite country rocks have only weak hydrothermal alteration. Three stages of hydrothermal alteration have been identified in the granite: Stage I alteration (high fO2) consisting of magnetite-siderite±biotite; Stage II consisting of thin quartz-pyrite veinlets; and Stage III (low fO2) consisting of sulphides, quartz and siderite veins, and pervasive silicification. The lamprophyre is altered to an ankerite-chlorite-sericite assemblage. Stage III sulphide veins are composed of arsenopyrite + pyrite ± galena ± sphalerite ± gold ± chalcopyrite ± pyrrhotite ± rutile ± graphite. Three phases of deformation have affected the area, and the mineralised veins and the granite and lamprophyre dykes have been deformed by two phases of folding, the youngest of which is Early Cretaceous. Locally preserved early-formed fluid inclusions are either carbonic, showing two- or three-phases at room temperature (liquid CO2-CH4 + liquid H2O ± CO2 vapour) or two-phase liquid-rich aqueous inclusions, some of which contain clathrates. Salinities of the aqueous inclusions are in the range of 1.4 to 7.6 wt% NaCl equiv. Final homogenisation temperatures (Th) of the carbonic inclusions indicate minimum trapping temperatures of 320 to 355°C, which are not too different from vein formation temperatures of 340-380°C estimated from quartz-albite stable isotope thermometry. δ18O values

  13. Constraints on the composition of ore fluids and implications for mineralising events at the Cleo gold deposit, Eastern Goldfields Province, Western Australia

    USGS Publications Warehouse

    Brown, S.M.; Johnson, C.A.; Watling, R.J.; Premo, W.R.

    2003-01-01

    The Cleo gold deposit, 55 km south of Laverton in the Eastern Goldfields Province of Western Australia, is characterised by banded iron-formation (BIF)-hosted ore zones in the gently dipping Sunrise Shear Zone and high-grade vein-hosted ore in the Western Lodes. There is evidence that gold mineralisation in the Western Lodes (which occurred at ca 2655 Ma) post-dates the majority of displacement along the Sunrise Shear Zone, but it remains uncertain if the ore in both structures formed simultaneously or separately. Overall, the Pb, Nd, Sr, C. O and S isotopic compositions of ore-related minerals from both the Western Lodes and ore zones in the Sunrise Shear Zone are similar. Early low-salinity aqueous-carbonic fluids and late high-salinity fluids with similar characteristics are trapped in inclusions in quartz veins from both the Sunrise Shear Zone and the Western Lodes. The early CO2, CO2-H2O, and H2O- dominant inclusions are interpreted as being related to ore formation, and to have formed from a single low-salinity aqueous-carbonic fluid as a result of intermittent fluid immiscibility. Homogenisation temperatures indicate that these inclusions were trapped at approximately 280??C and at approximately 4 km depth, in the deeper epizonal range. Differences between the ore zones are detected in the trace-element composition of gold samples, with gold from the Sunrise Shear Zone enriched in Ni, Pb, Sn, Te and Zn, and depleted In As, Bi, Cd, Cu and Sb, relative to gold from the Western Lodes. Although there are differences in gold composition between the Sunrise Shear Zone and Western Lodes, and hence the metal content of ore fluids may have varied slightly between the different ore zones, no other systematic fluid or solute differences are detected between the ore zones. Given the fact that the ore fluids in each zone have very similar bulk properties, the considerable differences in gold grade, sulfide mineral abundance, and ore textures between the two ore zones

  14. Dual origins of lode gold deposits in the Canadian Cordillera

    NASA Astrophysics Data System (ADS)

    Nesbitt, Bruce E.; Murowchick, James B.; Muehlenbachs, Karlis

    1986-06-01

    From Late Jurassic to late Tertiary time, two geologically, geochemically, and genetically distinct gold mineralization processes were active in the Canadian Cordillera. One group of deposits can be characterized as epithermal because of its association with intermediate to felsic volcanics, regional caldera structures, low pH alteration zones, low Au/Ag values, and quartz-chalcedony-barite-fluorite gangue. The second group of deposits is mesothermal in character and has strong similarities to the Mother Lode deposits of California, being associated with transcurrent faults, intermediate pH alteration zones, and quartz ± carbonate, albite, mariposite, pyrite, arsenopyrite, scheelite gangue. Compared to epithermal deposits, mesothermal deposits have higher As, W, and Au/Ag values, higher CO2 content in fluid inclusions, and δ18O values of ore-forming fluids of +3‰ to +10‰ vs. -14‰ to -7‰ for epithermal deposits. Like the gold deposits in Nevada and Colorado, epithermal mineralization in the Canadian Cordillera formed from the shallow circulation of meteoric water in subaerial, intermediate to felsic volcanic complexes. In contrast, mesothermal gold deposits throughout the North American Cordillera are shown to be the product of deep circulation and evolution of meteoric water in structures associated with major, transcurrent fault zones. Similarities between Archean lode gold deposits and mesothermal deposits of the Cordillera suggest that Archean lode deposits may have been produced by processes similar to those involved in the formation of Cordilleran mesothermal deposits.

  15. Hercynian Granite and Related Mineralisation in Beni Snouss, Western Algeria

    NASA Astrophysics Data System (ADS)

    Nacera, Hadj Mohamed; Abdelhak, Boutaleb

    2016-10-01

    The purpose of this research is to describe the mineralisation related to the Hercynian granite located in western Algeria by combining geologic, tectonic, mineralogical and fluid inclusion studies. Quartz veins bearing sulphides occur in close spatial association with granitoids, which, representing hydrothermal activities associated with them. Visible but rare gold occurs in a very small quantity connected with arsenopyrite. Barite veins and stock works are developed in the granites where are observed at Mallal and Bouabdous. The vein varies in thickness from a few centimetres up to 2 meters, and their length varies from 10 up to up 100 m. Most of veins are N50 - N75 and 60 to 90 dip.

  16. Phototrophic phylotypes dominate mesothermal microbial mats associated with hot springs in Yellowstone National Park.

    PubMed

    Ross, Kimberly A; Feazel, Leah M; Robertson, Charles E; Fathepure, Babu Z; Wright, Katherine E; Turk-Macleod, Rebecca M; Chan, Mallory M; Held, Nicole L; Spear, John R; Pace, Norman R

    2012-07-01

    The mesothermal outflow zones (50-65°C) of geothermal springs often support an extensive zone of green and orange laminated microbial mats. In order to identify and compare the microbial inhabitants of morphologically similar green-orange mats from chemically and geographically distinct springs, we generated and analyzed small-subunit ribosomal RNA (rRNA) gene amplicons from six mesothermal mats (four previously unexamined) in Yellowstone National Park. Between three and six bacterial phyla dominated each mat. While many sequences bear the highest identity to previously isolated phototrophic genera belonging to the Cyanobacteria, Chloroflexi, and Chlorobi phyla, there is also frequent representation of uncultured, unclassified members of these groups. Some genus-level representatives of these dominant phyla were found in all mats, while others were unique to a single mat. Other groups detected at high frequencies include candidate divisions (such as the OP candidate clades) with no cultured representatives or complete genomes available. In addition, rRNA genes related to the recently isolated and characterized photosynthetic acidobacterium "Candidatus Chloracidobacterium thermophilum" were detected in most mats. In contrast to microbial mats from well-studied hypersaline environments, the mesothermal mats in this study accrue less biomass and are substantially less diverse, but have a higher proportion of known phototrophic organisms. This study provides sequences appropriate for accurate phylogenetic classification and expands the molecular phylogenetic survey of Yellowstone microbial mats.

  17. Gold

    USGS Publications Warehouse

    Kirkemo, Harold; Newman, William L.; Ashley, Roger P.

    1998-01-01

    Through the ages, men and women have cherished gold, and many have had a compelling desire to amass great quantities of it -- so compelling a desire, in fact, that the frantic need to seek and hoard gold has been aptly named "gold fever." Gold was among the first metals to be mined because it commonly occurs in its native form -- that is, not combined with other elements -- because it is beautiful and imperishable, and because exquisite objects can be made from it.

  18. Rapid dewatering of the crust deduced from ages of mesothermal gold deposits

    USGS Publications Warehouse

    Goldfarb, R.J.; Snee, L.W.; Miller, L.D.; Newberry, R.J.

    1991-01-01

    The large-scale migration of fluids through the continental crust has been well documented, but there is no consensus regarding the timing of fluid migration relative to erogenic episodes, or rates of crustal dewatering1. Here we present 40Ar/39Ar dates for muscovites from quartz veins along a major shear zone in southeast Alaska, which show that the veins were emplaced in the early Eocene, during the late stages of orogenic deformation. Hydrothermal activity took place for only about 1 Myr and along a distance of at least 200 km. The fluids were generated by metamorphic reactions in subducted crust along the North American plate margin, and were apparently trapped in the crust by the low permeabilities accompanying a convergent tectonic regime until 56 Myr ago. The rapid dewatering event coincided with a change in plate motion at 56-55 Myr, which caused a shift from convergent to partly transcurrent tectonics. We suggest that this change in tectonic regime led to increased crustal permeabilities and hence the possibility of large-scale fluid migration.

  19. Gold deposit styles and placer gold characterisation in northern and east-central Madagascar

    USGS Publications Warehouse

    Pitfield, Peter E. J; Styles, Michael T.; Taylor, Cliff D.; Key, Roger M.; Bauer,; Ralison, A

    2009-01-01

    Microchemical characterisation of bedrock and placer gold grains from six gold districts within the Archaean domains and intervening Neoproterozoic Anaboriana-Manampotsy belt of northern and east-central Madagascar show few opaque inclusions (e.g pyrrhotite, Bi tellurides) but wide range of Ag contents (40wt%). Some districts exhibit multiple source populations of grains. The ‘greenstone belt’ terranes have an orogenic gold signature locally with an intrusion-related to epithermal overprint. Proterozoic metasediments with felsic to ultramafic bodies yield dominantly intrusion-related gold. A high proportion of secondary gold (<0.5wt% Ag) is related to recycling of paleoplacers and erosion of post-Gondwana planation surfaces and indicates that some mesothermal gold systems were already partially to wholly removed by erosion by the PermoTriassic.

  20. Fully kinetic simulations of collisionless, mesothermal plasma emission: Macroscopic plume structure and microscopic electron characteristics

    NASA Astrophysics Data System (ADS)

    Hu, Yuan; Wang, Joseph

    2017-03-01

    This paper presents a fully kinetic particle particle-in-cell simulation study on the emission of a collisionless plasma plume consisting of cold beam ions and thermal electrons. Results are presented for both the two-dimensional macroscopic plume structure and the microscopic electron kinetic characteristics. We find that the macroscopic plume structure exhibits several distinctive regions, including an undisturbed core region, an electron cooling expansion region, and an electron isothermal expansion region. The properties of each region are determined by microscopic electron kinetic characteristics. The division between the undisturbed region and the cooling expansion region approximately matches the Mach line generated at the edge of the emission surface, and that between the cooling expansion region and the isothermal expansion region approximately matches the potential well established in the beam. The interactions between electrons and the potential well lead to a new, near-equilibrium state different from the initial distribution for the electrons in the isothermal expansion region. The electron kinetic characteristics in the plume are also very anisotropic. As the electron expansion process is mostly non-equilibrium and anisotropic, the commonly used assumption that the electrons in a collisionless, mesothermal plasma plume may be treated as a single equilibrium fluid in general is not valid.

  1. Fusibacter fontis sp. nov., a sulfur-reducing, anaerobic bacterium isolated from a mesothermic Tunisian spring.

    PubMed

    Fadhlaoui, Khaled; Ben Hania, Wajdi; Postec, Anne; Fauque, Guy; Hamdi, Moktar; Ollivier, Bernard; Fardeau, Marie-Laure

    2015-10-01

    Strain KhalAKB1T, a mesophilic, anaerobic, rod-shaped bacterium, was isolated from water collected from a mesothermic Tunisian spring. Cells were Gram-staining-positive rods, occurring singly or in pairs and motile by one lateral flagellum. Strain KhalAKB1T grew at 15-45 °C (optimum 30 °C), at pH 5.5-8.5 (optimum pH 7.0) and in the presence of 0-35 g NaCl l- 1 (optimum 1 g NaCl l- 1). It fermented yeast extract and a wide range of carbohydrates including cellobiose, d-glucose, d-ribose, sucrose, d-xylose, maltose, d-galactose and starch as electron donors. Acetate, ethanol, CO2 and H2 were end products of glucose metabolism. It reduced elemental sulfur, but not sulfate, thiosulfate or sulfite, into sulfide. The DNA G+C content was 37.6 mol%. The predominant cellular fatty acids were C14 : 0 and C16 : 0. Phylogenetic analysis of the 16S rRNA gene sequence suggested Fusibacter bizertensis as the closest relative of this isolate (identity of 97.2 % to the type strain). Based on phenotypic, phylogenetic and genotypic taxonomic characteristics, strain KhalAKB1T is proposed to be assigned to a novel species within the genus Fusibacter, order Clostridiales, Fusibacter fontis sp. nov. The type strain is KhalAKB1T ( = DSM 28450T = JCM 19912T).

  2. Mercury Methylation and Detoxification by Novel Microorganisms in Mercury Enriched Mesothermal Springs

    NASA Astrophysics Data System (ADS)

    Gionfriddo, C. M.; Krabbenhoft, D. P.; Stott, M.; Wick, R. R.; Schultz, M. B.; Holt, K. E.; Moreau, J. W.

    2015-12-01

    Hot springs and fumaroles release significant quantities of aqueous and gaseous mercury into the environment. Yet few studies have looked at the microbial underpinnings of mercury transformations in geothermal settings. Recent advancements in culture-independent molecular techniques, such as ultra-high-throughput sequencing, allow us to delve deeply into the functional and phylogenetic make-up of these extreme environments. Here we present results from deep metagenomic sequencing of geothermal microbial communities cycling mercury, focussing on the connections between putative metabolisms and mercury methylation, and the evolution of the mer-operon. Presented are data from two adjacent, acidic (pH<3), mesothermal (33-68 °C) hot springs of the Ngawha geothermal field (New Zealand), extremely enriched in total mercury (>1000 ng L-1), and varying methylmercury concentrations (1-10 ng L-1). Microbial communities of both springs are dominated by mercury resistant acidophilic, sulfur- and iron-cycling microbes: Acidithiobacillus, Thiomonas, and Thermoplasma. Mercury methylation genes (hgcAB) were only detected in the cooler spring (∆T~10 °C), with an order of magnitude greater methylmercury (10 ng L-1). The hgcAB genes have no known closest relatives (<90%), but lowest common ancestor analysis matched members of the Firmicutes and Deltaproteobacteria as well as uncultured environmental bacteria. Our findings show that geothermal microbial communities are capable of a net production of methylmercury, alongside active demethylation-reduction by mer-capable microbes, despite selective pressures from low pH and high mercury levels. However, temperature may be the major limiting factor on mercury biomethylation in geothermal settings, as no hgcAB genes were detected in the spring that was nearly identical in all physio-chemical parameters to its neighbour except for temperature (T >40°C), and methylmercury concentration. We conclude that the relative amount of mercury

  3. Mineralisation of two phosphate ceramics in HBSS: role of albumin.

    PubMed

    Marques, P A A P; Serro, A P; Saramago, B J; Fernandes, A C; Magalhães, M C F; Correia, R N

    2003-02-01

    The role of albumin in the mineralisation process of commercial hydroxyapatite (HAp) and synthesised biphasic (HAp-tricalcium phosphate) ceramics in a bufferless simulated inorganic plasma (HBSS) was investigated by conventional in vitro tests and static and dynamic wettability measurements. Albumin was either pre-adsorbed or solubilised in HBSS. It was found that calcium complexation by albumin plays a key role in early mineralisation kinetics, so that mineralisation is favoured when albumin is pre-adsorbed and hindered when it is dissolved in HBSS. In the biphasic ceramic this picture is complicated by the fact that albumin, in solution, seems to promote the dissolution of tricalcium phosphate, and simultaneously compete for calcium with the ceramic. It also appears that albumin has a stabilising effect of octacalcium phosphate present in deposits on commercial HAp. The same effect may be present in the case of the biphasic ceramic, at earlier mineralisation times, when octacalcium phosphate appears as a precursor of HAp. Octacalcium phosphate formation on commercial apatite is accompanied by carbonate substitution in phosphate positions.

  4. Regulation of soil organic C mineralisation at the pore scale.

    PubMed

    Ruamps, Léo S; Nunan, Naoise; Pouteau, Valérie; Leloup, Julie; Raynaud, Xavier; Roy, Virginie; Chenu, Claire

    2013-10-01

    Little is known about the factors that regulate C mineralisation at the soil pore scale or how these factors vary throughout the pore network. This study sought to understand how the decomposition of organic carbon varies within the soil pore network and to determine the relative importance of local environmental properties relative to biological properties as controlling factors. This was achieved by sterilising samples of soil and reinoculating them with axenic bacterial suspensions using the matric potential to target different locations in the pore network. Carbon mineralisation curves were described with two-compartment first-order models to distinguish CO2 derived from the labile organic carbon released during sterilisation from CO2 derived from organic C unaffected by sterilisation. The data indicated that the size of the labile pool of organic C, possibly of microbial origin, varied as a function of location in the pore network but that the organic carbon unaffected by sterilisation did not. The mineralisation rate of the labile C varied with the bacterial type inoculated, but the mineralisation rate of the organic C unaffected by sterilisation was insensitive to bacterial type. Taken together, the results suggest that microbial metabolism is a less significant regulator of soil organic carbon decomposition than are microbial habitat properties.

  5. Orogenic gold deposits: a proposed classification in the context of their crustal distribution and relationship to other gold deposit types

    USGS Publications Warehouse

    Groves, D.I.; Goldfarb, R.J.; Gebre-Mariam, M.; Hagemann, S.G.; Robert, F.

    1998-01-01

    The so-called 'mesothermal' gold deposits are associated with reginally metamorphosed terranes of all ages. Ores were formed during compressional to transpressional deformation processes at convergent plate margins in accretionary and collisional orogens. In both types of orogen, hydrated marine sedimentary and volcanic rocks have been added to continental margins during tens to some 100 million years of collision. Subduction-related thermal events, episodically raising geothermal gradients within the hydrated accretionary sequences, initiate and drive long-distance hydrothermal fluid migration. The resulting gold-bearing quartz veins are emplaced over a unique depth range for hydrothermal ore deposits, with gold deposition from 15-20 km to the near surface environment. On the basis of this broad depth range of formation, the term 'mesothermal' is not applicable to this deposit types as a whole. Instead, the unique temporal and spatial association of this deposit type with orogeny means that the vein systems are best termed orogenic gold deposits. Most ores are post-orogenic with respect to to tectonism of their immediate host rocks, but are simultaneously syn-orogenic with respect to ongoing deep-crustal, subduction-related thermal processes and the prefix orogenic satisfies both these conditions. On the basis of their depth of formation, the orogenic deposits are best subdivided into epizonal (12 km) classes.

  6. Correlative spectroscopy of silicates in mineralised nodules formed from osteoblasts

    NASA Astrophysics Data System (ADS)

    Boonrungsiman, Suwimon; Fearn, Sarah; Gentleman, Eileen; Spillane, Liam; Carzaniga, Raffaella; McComb, David W.; Stevens, Molly M.; Porter, Alexandra E.

    2013-07-01

    Silicon supplementation has been shown to play an important role in skeleton development, however, the potential role that silicon plays in mediating bone formation, and an understanding of where it might localise in the resulting bone tissue remain elusive. An improved understanding of these processes could have important implications for treating pathological mineralisation. A key aspect of defining the role of silicon in bone is to characterise its distribution and coordination environment, however, there is currently almost no information available on either. We have combined a sample-preparation method that simultaneously preserved mineral, ions, and the extracellular matrix (ECM) with secondary ion mass spectroscopy (SIMS) and electron energy-loss spectroscopy (EELS) to examine the distribution and coordination environment of silicon in murine osteoblasts (OBs) in an in vitro model of bone formation. SIMS analysis showed a high level of surface contamination from polydimethysiloxane (PDMS) resulting from sample preparation. When the PDMS was removed, silicon compounds could not be detected within the nodules either by SIMS or by energy dispersive X-ray spectroscopy (EDX) analysis. In comparison, electron energy-loss spectroscopy (EELS) provided a powerful and potentially widely applicable means to define the coordination environment and localisation of silicon in mineralising tissues. We show that trace levels of silicon were only detectable from the mineral deposits located on the collagen and in the peripheral region of mineralised matrix, possibly the newly mineralised regions of the OB nodules. Taken together our results suggest that silicon plays a biological role in bone formation, however, the precise mechanism by which silicon exerts its physicochemical effects remains uncertain. Our analytical results open the door for compelling new sets of EELS experiments that can provide detailed and specific information about the role that silicates play in bone

  7. Orebody Modelling for Exploration: The Western Mineralisation, Broken Hill, NSW

    SciTech Connect

    Lotfolah Hamedani, Mohammad Plimer, Ian Rutherford; Xu Chaoshui

    2012-09-15

    The Western Mineralisation in the Broken Hill deposit was studied to identify the zonation sequence of lithogeochemical haloes along and across the strike of the orebody. Samples used are from 77 drill holes and the samples were assayed for Pb, Zn, Fe, S, Cu, Ag, Cd, Sb, Bi and As. Variogram analyses were calculated for all the elements and kriging was used to construct the 3D block model. Analysis of cross sections along and across the strike of the orebody shows that Bi and Sb form broader halos around sulphide masses and this suggests that they are pathfinder elements for the Pb and Zn elements of this orebody. The threshold concentrations (minimum anomaly) of the 10 elements were determined using the concentration-area analysis. On east-west vertical cross sections, the values of linear productivity, variability gradient and zonality index were calculated for each element. Based on the maximum zonality index of each element, the sequence of geochemical zonation pattern was determined from top to bottom of the orebody. The result shows that S, Pb, Zn and Cd tend to concentrate in the upper part of the mineralisation whereas Ag, Cu, Bi and As have a tendency to concentrate in the lower part of the mineralised rocks. Also, an empirical product ratio index was developed based on the position of the elements in the zonation sequence. The methods and results of this research are applicable to exploration of similar Zn and Pb sulphide ore deposits.

  8. Timing and thermochemical constraints on multi-element mineralisation at the Nori/RA Cu-Mo-U prospect, Great Bear magmatic zone, Northwest Territories, Canada

    NASA Astrophysics Data System (ADS)

    Ootes, Luke; Goff, Steve; Jackson, Valerie A.; Gleeson, Sarah A.; Creaser, Robert A.; Samson, Iain M.; Evensen, Norman; Corriveau, Louise; Mumin, A. Hamid

    2010-08-01

    clathrates or CH4 was not observed or detected. Quartz grains only host secondary fluid inclusions, which fluoresce under ultraviolet light, indicating trapped hydrocarbons. We speculate that these resulted from Phanerozoic fluid circulation through the Proterozoic basement. The collective interpretation of the age, hydrothermal character and associated metals, high temperature and variable salinity suggests that the Nori/RA Cu-Mo-U mineralisation can be linked with the earliest stages of plutonism in the Great Bear magmatic zone. From a regional perspective, the mineralisation may pre-date the extensive multi-element mineralisation now recognised as part of the iron oxide copper-gold (IOCG) spectrum of deposits. As IOCG provinces generally contain a variety of mineralisation styles, we interpret this as the earliest phase of the extensive mineralising system.

  9. Conservative tracer bromide inhibits pesticide mineralisation in soil.

    PubMed

    Bech, Tina B; Rosenbom, Annette E; Sørensen, Sebastian R; Jacobsen, Carsten S

    2017-03-01

    Bromide is a conservative tracer that is often applied with non-conservative solutes such as pesticides to estimate their retardation in the soil. It has been applied in concentrations of up to 250 g Br L(-1), levels at which the growth of single-celled organisms can be inhibited. Bromide applications may therefore affect the biodegradation of non-conservative solutes in soil. The present study investigated the effect of potassium bromide (KBr) on the mineralisation of three pesticides - glyphosate, MCPA and metribuzin - in four agricultural A-horizon soils. KBr was added to soil microcosms at concentrations of 0, 0.5, 2.5 and 5 g Br(-) L(-1) in the soil solution. The study concluded that KBr had a negative effect on pesticide mineralisation. The inhibitory effect varied depending on the KBr concentration, the type of pesticide and the type of soil. Furthermore, 16 S amplicon sequencing revealed that the KBr treatment generally reduced the abundance of bacteroidetes and proteobacteria on both an RNA and DNA level. Therefore, in order to reduce the effect of KBr on the soil bacterial community and consequently also on xenobiotic degradation, it is recommended that KBr be applied in a concentration that does not exceed 0.5 g Br(-) L(-1) in the soil water.

  10. Lithologically controlled invisible gold, Yukon, Canada

    NASA Astrophysics Data System (ADS)

    MacKenzie, Doug; Craw, Dave; Finnigan, Craig

    2015-02-01

    The newly discovered Cretaceous Coffee orogenic gold deposit (>4 Moz resource) consists of an extensive oxidised zone developed on primary sulphidic rock. The primary mineralised rock is characterised by invisible gold in arsenian pyrite that has replaced biotite in selected host rocks. The deposit has a cryptic surface expression and is an example of an extremely subtle exploration target. Hydrothermal emplacement was controlled by extensional fractures, with breccias, but most mineralisation was focused on biotite-bearing granitic gneiss, metasedimentary gneisses, and younger biotite granite. Fine-grained (<0.1 mm) arsenian pyrite replaced biotite along mineral cleavage planes and followed biotite-rich metamorphic and post-metamorphic structural fabrics. Arsenian pyrite also formed overgrowths on earlier coarse-grained (up to 2 mm) barren hydrothermal pyrite. Arsenian pyrite is concentrically zoned on the 1-10-μm scale with respect to As, Sb, and Au contents and typically contains ˜5 wt% As, ˜500 mg/kg Sb, and ˜500 mg/kg Au, in solid solution. Biotite replacement was accompanied by sericitisation, silicification, and ankerite impregnation. Hydrothermal alteration involved dilution and localised depletion of K, Na, and Al in silicified host rocks, but most Ca, Mg, and Fe concentrations remained broadly constant. Magnesium-rich ultramafic host rocks were only weakly mineralised with auriferous arsenian pyrite and have fuchsite and magnesite alteration. Near-surface oxidation has liberated nanoparticulate and microparticulate supergene gold, which remains essentially invisible. Varying degrees of oxidation extend as deep as 250 m below the present subdued topographic surface, well beyond the present vadose zone, and this deep oxidation may have occurred during post-mineralisation uplift and erosion in the Cretaceous. Oxidation has leached some As from the surficial mineralised rocks, decreasing the geochemical signal, which is also obscured by the localised

  11. Radioactive disequilibria in mineralised fracture samples from two uranium occurrences in northern Sweden

    USGS Publications Warehouse

    Smellie, John A.T.; Rosholt, J.N.

    1984-01-01

    Mineralised fractures from two uranium occurrences in northern Sweden were examined mineralogically and isotopically to establish the presence or absence of radioactive equilibrium that may indicate recent rock-water interaction processes based on the natural mobility of uranium (i.e.; during the last 0.5 Ma). The results show evidence of radioactive disequilibrium in six of the nine samples investigated. Disequilibria are attributable to solution to solid 234U recoil gain (weakly mineralised zones adjacent to the main mineralisation) and solid to solution 234U recoil loss (moderate to highly mineralised zones). The absence of significant 238U loss in the samples emphasises the reducing conditions at the sampled depths. ?? 1984.

  12. Effect of puberty on rates of bone growth and mineralisation: with observations in male delayed puberty.

    PubMed Central

    Krabbe, S; Christiansen, C; Rødbro, P; Transbøl, I

    1979-01-01

    The bone mineral content (BMC) and body height were measured in 301 normal children and adolescents aged 7--20 years, and in 8 boys with constitutional delayed puberty aged 14--17 years. Serum testosterone was measured in the last group as well as in a subpopulation of the normal children and adolescents. The growth spurt, which coincided with a steep increase of serum testosterone in boys, indicated a great change in skeletal growth and mineralisation in both sexes. After the growth spurt, linear growth slowed down considerably while bone mineralisation rose steeply. When low levels of serum testosterone were maintained, as in delayed puberty, these combined changes of skeletal growth and mineralisation did not occur. It is suggested that gonadal hormones are the true initiators of the short-lived growth spurt as well as of prolonged acceleration of bone mineralisation. PMID:533299

  13. Enzyme encapsulation in zeolitic imidazolate frameworks: a comparison between controlled co-precipitation and biomimetic mineralisation.

    PubMed

    Liang, Kang; Coghlan, Campbell J; Bell, Stephen G; Doonan, Christian; Falcaro, Paolo

    2016-01-11

    Recent studies have demonstrated that metal-organic frameworks can be employed as protective coatings for enzymes. Two efficient strategies have been reported for the synthesis of such composite materials: biomimetic mineralisation and controlled co-precipitation using polyvinylpyrrolidone. We assessed the relative efficacy of each approach by comparing the thermal stability of encapsulated urease. The resulting data shows that over a range of temperatures biomimetic mineralisation offers superior protection than the co-precipitation method.

  14. Environmental health impacts of dispersed mineralisation in South Africa

    NASA Astrophysics Data System (ADS)

    Davies, T. C.; Mundalamo, H. R.

    2010-11-01

    The crust of South Africa has undergone various episodes and styles of mineralisation, dating as far back as the Archaean. The suite of minerals produced is diverse and includes metals, non-metals and industrial minerals. Since the Pleistocene, substantial quantities of elements, both nutritional and toxic, that were involved in ore forming processes, have been remobilised and redistributed by surficial processes of intense tropical weathering, leaching, eluviation, podsolisation and gleying; and more recently, by mining and related processes, as well as by other urban and industrial activities. As a result of this "dispersion" it is not uncommon to find large tracts of the country containing anomalous trace element contents or deficiencies in essential micro-nutrient elements. Through water and food crops, extremes in trace element variation in soils are transmitted into the food chain, with often undesirable consequences for human and animal health. But the known variations are not as yet adequately documented. Nor is there sufficient knowledge on the implications of these variations for the health of the environment and its ecosystems. Nutrient deficient soils may be the principal causative factor in the devastating endemic osteoarthritic disease that afflicts two-thirds of the women in Maputaland, for instance. The generally low Se status of agricultural soils could represent an important co-factor in the relatively high diffusion rates of HIV-AIDS in the country. The impact of geology on animal health also remains an area of critical concern to both farmers and managers of the hugely important wildlife game reserves. This paper discusses a few known relationships between trace element excess/deficiency stemming originally from mineralisation processes, and the local and regional distribution of diseases in man and animals in South Africa. It is submitted that the challenge for future research in medical geology would lie in an organised effort aimed at

  15. Mapping of prospectivity and estimation of number of undiscovered prospects for lode gold, southwestern Ashanti Belt, Ghana

    NASA Astrophysics Data System (ADS)

    Carranza, Emmanuel John M.; Owusu, Emmanuel A.; Hale, Martin

    2009-07-01

    In the southwestern part of the Ashanti Belt, the results of fractal and Fry analyses of the spatial pattern of 51 known mines/prospects of (mostly lode) gold deposits and the results of analysis of their spatial associations with faults and fault intersections suggest different predominant structural controls on lode gold mineralisation at local and district scales. Intersections of NNE- and NW-trending faults were likely predominantly involved in local-scale structural controls on lode gold mineralisation, whilst NNE-trending faults were likely predominantly involved in district-scale structural controls on lode gold mineralisation. The results of the spatial analyses facilitate the conceptualisation and selection of spatial evidence layers for lode gold prospectivity mapping in the study area. The applications of the derived map of lode gold prospectivity and a map of radial density of spatially coherent lode gold mines/prospects results in a one-level prediction of 37 undiscovered lode gold prospects. The applications of quantified radial density fractal dimensions of the spatial pattern of spatially coherent lode gold mines/prospects result in an estimate of 40 undiscovered lode gold prospects. The study concludes finally that analysis of the spatial pattern of discovered mineral deposits is the key to a strong link between mineral prospectivity mapping and assessment of undiscovered mineral deposits.

  16. Organic carbon production, mineralisation and preservation on the Peruvian margin

    NASA Astrophysics Data System (ADS)

    Dale, A. W.; Sommer, S.; Lomnitz, U.; Montes, I.; Treude, T.; Liebetrau, V.; Gier, J.; Hensen, C.; Dengler, M.; Stolpovsky, K.; Bryant, L. D.; Wallmann, K.

    2015-03-01

    Carbon cycling in Peruvian margin sediments (11 and 12° S) was examined at 16 stations, from 74 m water depth on the middle shelf down to 1024 m, using a combination of in situ flux measurements, sedimentary geochemistry and modelling. Bottom water oxygen was below detection limit down to ca. 400 m and increased to 53 μM at the deepest station. Sediment accumulation rates decreased sharply seaward of the middle shelf and subsequently increased at the deep stations. The organic carbon burial efficiency (CBE) was unusually low on the middle shelf (<20%) when compared to an existing global database, for reasons which may be linked to episodic ventilation of the bottom waters by oceanographic anomalies. Deposition of reworked, degraded material originating from sites higher up on the slope is proposed to explain unusually high sedimentation rates and CBE (>60%) at the deep oxygenated sites. In line with other studies, CBE was elevated under oxygen-deficient waters in the mid-water oxygen minimum zone. Organic carbon rain rates calculated from the benthic fluxes alluded to efficient mineralisation of organic matter in the water column compared to other oxygen-deficient environments. The observations at the Peruvian margin suggest that a lack of oxygen does not greatly affect the degradation of organic matter in the water column but promotes the preservation of organic matter in sediments.

  17. Late Archean mineralised cyanobacterial mats and their modern analogs

    NASA Astrophysics Data System (ADS)

    Kazmierczak, J.; Altermann, W.; Kremer, B.; Kempe, S.; Eriksson, P. G.

    2008-09-01

    Abstract Reported are findings of Neoarchean benthic colonial coccoid cyanobacteria preserved as abundant remnants of mineralized capsules and sheaths visible in SEM images as characteristic patterns after etching highly polished carbonate rock platelets. The samples described herein were collected from the Nauga Formation at Prieska (Kaapvaal craton, South Africa). The stratigraphic position of the sampling horizon (Fig. 1) is bracketed by single zircon ages from intercalated tuffs, of 2588±6 Ma and 2549±7Ma [1]. The cyanobacteria-bearing samples are located within sedimentary sequence which begins with Peritidal Member displaying increasingly transgressive character, passing upward into the Chert Member and followed by the Proto-BIF Member and by the Naute Shale Member of the Nauga Formation successively. All three latter members were deposited below the fair weather wave base. As in our previous report [2], the samples are taken from lenses of massive micritic flat pebble conglomerate occurring in otherwise finely laminated siliceous shales intercalating with thin bedded platy limestone. This part of the Nauga Formation is about 30 m thick. The calcareous, cyanobacteria-bearing flat pebble conglomerate and thin intercalations of fine-grained detrital limestones embedded in the clayey sapropel-rich deposits are interpreted as carbonate sediments winnowed during stormy weather from the nearby located peritidal carbonate platform. The mass occurrence and exceptional preservation of mineralised cyanobacterial remains in the micritic carbonate (Mg-calcite) of the redeposited flat pebbles can be explained by their sudden burial in deeper, probably anoxic clay- and sapropel-rich sediments. When examined with standard petrographic optical microscopic technique, the micritic carbonates show rather obscure structure (Fig. 2a), whereas under the SEM, polished and slightly etched platelets of the same samples reveal surprisingly well preserved patterns (Fig. 2b

  18. Histological and electron microprobe studies of mineralisation in aluminium-related osteomalacia.

    PubMed Central

    Boyce, B. F.; Byars, J.; McWilliams, S.; Mocan, M. Z.; Elder, H. Y.; Boyle, I. T.; Junor, B. J.

    1992-01-01

    AIMS: To determine a possible mechanism to explain the presence of aluminium lines within fully calcified bone in aluminium-related osteomalacia. METHODS: Fifty five bone cases shown by bone biopsy to be aluminium-related osteomalacia were studied. In 38 specimens aluminium lines were identified within calcified bone by means of the Aluminon stain and a characteristic form of patchy mineralisation was seen within thickened osteoid seams. Five representative examples were analysed quantitatively by histomorphometry and electronprobe X-ray microanalysis and compared with five cases of vitamin D deficiency-related osteomalacia which also had patchy mineralisation. RESULTS: The patchy calcification occupied 40 +/- 8% (mean +/- SEM) of the osteoid and consisted of small focal deposits (less than 40 microns diameter), often (52%) around osteoid osteocytes (probably an underestimate of the association), and larger areas that extended to the aluminium lines at the underlying mineralisation front. Small and large mineralisation nuclei were seen ultrastructurally in the patchy calcification. Quantitative electronprobe X-ray microanalysis showed that calcium concentrations and calcium:phosphorus ratios in the mineralisation nuclei and in the superficial layer of the fully calcified bone of the aluminium-related osteomalacia cases were significantly less than values measured at similar sites in the vitamin D deficiency-related osteomalacia cases. Furthermore, aluminium could not be detected by means of this technique at the mineralisation front or along cement lines in these specimens. CONCLUSIONS: Calcification can occur in thickened osteoid seams in osteomalacia. It can begin around osteoid osteocytes as small deposits that enlarge within the osteoid and extend to the underlying mineralisation front or cement line where aluminium lines may become trapped. Complete calcification of osteoid could account for the presence of aluminium lines within fully calcified bone. The

  19. Mineralisation and primary biodegradation of aromatic organophosphorus flame retardants in activated sludge.

    PubMed

    Jurgens, Sharona S; Helmus, Rick; Waaijers, Susanne L; Uittenbogaard, Dirk; Dunnebier, Dorien; Vleugel, Melissa; Kraak, Michiel H S; de Voogt, Pim; Parsons, John R

    2014-09-01

    Halogen-free flame retardants (HFFRs), such as the aromatic organophosphorus flame retardants (OPFRs) triphenyl phosphate (TPHP), resorcinol bis(diphenylphosphate) (PBDPP) and bisphenol A bis(diphenylphosphate) (BPA-BDPP) have been proposed as potential replacements for brominated flame retardants in polymers and textiles. Although these OPFRs are already marketed, their environmental fate and effects are poorly characterised. The aim of this study was therefore to determine the mineralisation and primary biodegradation of these OPFRs by activated sludge. Mineralisation was monitored by measuring CO2 production by means of GC analysis, whereas primary biodegradation was monitored by LC-MS/MS analysis of the OPFRs and their potential metabolites. TPHP was biodegraded and mineralised most rapidly and achieved the requirement for ready biodegradability (60% of theoretical maximum mineralisation). Primary biodegradation was also rapid for PBDPP, but 60% mineralisation was not achieved within the time of the test, suggesting that transformation products of PBDPP may accumulate. Primary degradation of BPA-BDPP was very slow and very low CO2 production was also observed. Based on these results, TPHP and to a lesser extent PBDPP appear to be suitable replacements for the more environmentally persistent brominated flame retardants.

  20. Age constraints on Tarkwaian palaeoplacer and lode-gold formation in the Tarkwa-Damang district, SW Ghana

    USGS Publications Warehouse

    Pigois, J.-P.; Groves, D.I.; Fletcher, I.R.; McNaughton, N.J.; Snee, L.W.

    2003-01-01

    Two major epigenetic gold-forming events are recorded in the world-class gold province of southwest Ghana. A pre-Tarkwaian event was the source of the world-class Tarkwa palaeoplacers whereas post-Birimian and Tarkwaian deformation, which was related to the Eburnean orogeny, gave rise to the world-class (e.g. Prestea) to giant (e.g. Obuasi) orogenic gold deposits which have made the region famous for more than 2,500 years. A maximum age of 2133 ?? 4 Ma for Tarkwaian sedimentation is provided by 71 of 111 concordant SHRIMP II U Pb dates from detrital zircons in Tarkwaian clastic rocks from Damang and Bippo Bin, northeast of Tarkwa. The overall data distribution broadly overlaps the relatively poorly constrained ages of Birimian volcanism and associated Dixcove-type granitoid emplacement, indicating syntectonic development of the Tarkwaian sedimentary basin. These zircon ages argue against derivation of the palaeoplacer gold from an orogenic gold source related to the compressional phase of an orogeny significantly older than the Eburnean orogeny. Instead, they suggest that the gold source was either orogenic gold lodes related to an earlier compressional phase of a diachronous Eburnean orogeny or ca. 2200-2100 Ma intrusion-related gold lode. The CO2-rich fluid inclusions in associated vein-quartz pebbles are permissive of either source. At the Damang deposit, an epigenetic, orogenic lode-gold system clearly overprinted, and sulphidised low-grade palaeoplacer hematite magnetite gold occurrences in the Banket Series conglomerate within the Tarkwaian sedimentary sequence. Gold mineralisation is demonstrably post-peak metamorphism, as gold-related alteration assemblages overprint metamorphic assemblages in host rocks. In alteration zones surrounding the dominant, subhorizontal auriferous quartz veins, there are rare occurrences of hydrothermal xenotime which give a SHRIMP U Pb age of 2063 ?? 9 Ma for gold mineralisation. The similar structural timing of epigenetic gold

  1. The geochemical environment of the Wilcherry Hill base metal mineralisation, South Australia

    NASA Astrophysics Data System (ADS)

    Beeson, R.

    1990-07-01

    High grade lead-zinc-silver mineralisation occurs in metamorphosed carbonate and calc-silicate sequences at Wilcherry Hill, South Australia. Whole rock lithogeochemistry indicates that the host sequence of the mineralisation can be defined and contrasted from others at both prospect and exploration licence scales. Geochemical haloes are identified on the basis of Pb, Zn and Mn variations. A saline and possibly evaporitic environment of deposition distal from basin margins is proposed for the host sequence on the basis of alkali element compositions, iron formation facies, carbonate compositions, and comparisons with geochemically similar, less metamorphosed sequences with base metal mineralisation in the Middle Proterozoic of northern Australia. The combination of geochemical haloes and definition of the depositional environment provide additional criteria for the exploration geologist, even in metamorphosed and deformed terrains.

  2. Hydrothermal flake graphite mineralisation in Paleoproterozoic rocks of south-east Greenland

    NASA Astrophysics Data System (ADS)

    Rosing-Schow, Nanna; Bagas, Leon; Kolb, Jochen; Balić-Žunić, Tonči; Korte, Christoph; Fiorentini, Marco L.

    2016-11-01

    Flake graphite mineralisation is hosted in the Kuummiut Terrane of the Paleoproterozoic Nagssugtoqidian Orogen, south-east Greenland. Eclogite-facies peak-metamorphic assemblages record temperatures of 640-830 °C and pressures of 22-25 kbar, and are retrogressed in the high-pressure amphibolite-facies during ca. 1870-1820 Ma. Graphite occurs as lenses along cleavage planes in breccia and as garnet-quartz-graphite veins in various metamorphic host rocks in the Tasiilaq area at Auppaluttoq, Kangikajik, and Nuuk-Ilinnera. Graphite contents reach >30 vol% in 0.2-4 × 20 m wide semi-massive mineralisation (Auppaluttoq, Kangikajik). Supergene alteration formed 1- to 2-m-thick and up to a 2.5 × 2.5 km wide loose limonitic gravel containing graphite flakes in places. The flake size ranges from 1 to 6 mm in diameter with an average of 3 mm. Liberation efficiency is at minimum 60%. Hydrothermal fluids at 600 °C, transporting carbon as CO2 and CH4, formed the mineralisation commonly hosted by shear zones, which acted as pathways for the mineralising fluids. The hydrothermal alteration assemblage is quartz-biotite-grunerite-edenite-pargasite-K-feldspar-titanite. The δ13C values of graphite, varying from -30 to -18‰ PDB, indicate that the carbon was derived from organic matter most likely from metasedimentary sources. Devolatilisation of marble may have contributed a minor amount of carbon by fluid mixing. Precipitation of graphite involved retrograde hydration reactions, depleting the fluid in H2O and causing graphite saturation. Although the high-grade mineralisation is small, it represents an excellent example of hydrothermal mineralisation in an eclogite-facies terrane during retrograde exhumation.

  3. Potential anthropogenic mobilisation of mercury and arsenic from soils on mineralised rocks, Northland, New Zealand.

    PubMed

    Craw, D

    2005-02-01

    Eroded roots of hot spring systems in Northland, New Zealand consist of mineralised rocks containing sulfide minerals. Marcasite and cinnabar are the dominant sulfides with subordinate pyrite. Deep weathering and leached soil formation has occurred in a warm temperate to subtropical climate with up to 3 m/year rainfall. Decomposition of the iron sulfides in natural and anthropogenic rock exposures yields acid rock drainage with pH typically between 2 and 4, and locally down to pH 1. Soils and weathered rocks developed on basement greywacke have negligible acid neutralisation capacity. Natural rainforest soils have pH between 4 and 5 on unmineralised greywacke, and pH is as low as 3.5 in soils on mineralised rocks. Roads with aggregate made from mineralised rocks have pH near 3, and quarries from which the rock was extracted can have pH down to 1. Mineralised rocks are enriched in arsenic and mercury, both of which are environmentally available as solid solution impurities in iron sulfides and phosphate minerals. Base metals (Cu, Pb, Zn) are present at low levels in soils, at or below typical basement rock background. Decomposition of the iron sulfides releases the solid solution arsenic and mercury into the acid rock drainage solutions. Phosphate minerals release their impurities only under strongly acid conditions (pH<1). Arsenic and mercury are adsorbed on to iron oxyhydroxides in soils, concentrated in the C horizon, with up to 4000 ppm arsenic and 100 ppm mercury. Waters emanating from acid rock drainage areas have arsenic and mercury below drinking water limits. Leaching experiments and theoretical predictions indicate that both arsenic and mercury are least mobile in acid soils, at pH of c. 3-4. This optimum pH range for fixation of arsenic and mercury on iron oxyhydroxides in soils is similar to natural pH at the field site of this study. However, neutralisation of acid soils developed on mineralised rocks is likely to decrease adsorption and enhance

  4. The importance of plant-soil interactions for N mineralisation in different soil types

    NASA Astrophysics Data System (ADS)

    Murphy, Conor; Paterson, Eric; Baggs, Elizabeth; Morley, Nicholas; Wall, David; Schulte, Rogier

    2013-04-01

    The last hundred years has seen major advancements in our knowledge of nitrogen mineralisation in soil, but key drivers and controls remain poorly understood. Due to an increase in the global population there is a higher demand on food production. To accommodate this demand agriculture has increased its use of N based fertilizers, but these pose risks for water quality and GHG emissions as N can be lost through nitrate leaching, ammonia volatilization, and denitrification processes (Velthof, et al., 2009). Therefore, understanding the underlying processes that determine the soils ability to supply N to the plant is vital for effective optimisation of N-fertilisation with crop demand. Carbon rich compounds exuded from plant roots to the rhizosphere, which are utilized by the microbial biomass and support activities including nutrient transformations, may be a key unaccounted for driver of N mineralisation. The main aim of this study was to study the impact of root exudates on turnover of C and N in soil, as mediated by the microbial community. Two soil types, known to contrast in N-mineralisation capacity, were used to determine relationships between C inputs, organic matter mineralisation (priming effects) and N fluxes. 15N and 13C stable isotope approaches were used to quantify the importance of rhizosphere processes on C and N mineralisation. Gross nitrogen mineralisation was measured using 15N pool dilution. Total soil CO2 efflux was measured and 13C isotope partitioning was applied to quantify SOM turnover and microbial biomass respiration. Also, 13C was traced through the microbial biomass (chloroform fumigation) to separate pool-substitution effects (apparent priming) from altered microbial utilisation of soil organic matter (real priming effects). Addition of labile carbon resulted in an increase in N-mineralisation from soil organic matter in both soils. Concurrent with this there was an increase in microbial biomass size, indicating that labile C elicited

  5. Isolation and characterisation of an isoproturon-mineralising Methylopila sp. TES from French agricultural soil.

    PubMed

    El Sebai, Talaat; Lagacherie, Bernard; Soulas, Guy; Martin-Laurent, Fabrice

    2004-10-01

    Using enrichment culture three isoproturon (IPU) mineralising bacterial isolates were isolated from a French agricultural soil mineralising up to 50% of the initially added 14C-ring labelled IPU within only eight days. These isolates showed similar metabolic (BIOLOG GN) and amplified rDNA restriction (ARDRA) profiles. Partial 16S rDNA sequencing revealed that they were identical and identified as Methylopila sp TES. This strain harbours a large plasmid (220 kb) putatively bearing essential IPU-degrading genes as demonstrated by a curing experiment. Methylopila sp. TES transformed IPU and its known metabolites to CO2 and biomass but did not degrade chlorotoluron, monolinuron, diuron and linuron.

  6. Characteristics of gold deposits in northern Sonora, Mexico: a preliminary report

    USGS Publications Warehouse

    Silberman, M.L.; Giles, D.A.; Graubard, C.

    1988-01-01

    The complex geology of northern Sonora has a variety of environments suitable for gold mineralisation, and many of the gold prospects occur within or adjacent to the southwestern boundary of the megashear in Precambrian, Mesozoic and Tertiary rocks. The characteristics types of gold deposits have been delineated by reconnaissance field investigations of the authors. There are four main environments of lode gold deposits present in Sonora: epithermal veins and breccias; discontinuous quartz veins; structurally controlled Au; and carbonate sedimentary-hosted disseminated Au. -after Authors

  7. The Yatela gold deposit: 2 billion years in the making

    NASA Astrophysics Data System (ADS)

    Hein, K. A. A.; Matsheka, I. R.; Bruguier, O.; Masurel, Q.; Bosch, D.; Caby, R.; Monié, P.

    2015-12-01

    Gold mineralisation in the Yatela Main gold mine is hosted in a saprolitic residuum situated above Birimian supracrustal rocks, and at depth. The supracrustal rocks comprise metamorphosed calcitic and dolomitic marbles that were intruded by diorite (2106 ± 10 Ma, 207Pb/206Pb), and sandstone-siltstone-shale sequences (youngest detrital zircon population dated at 2139 ± 6 Ma). In-situ gold-sulphide mineralisation is associated with hydrothermal activity synchronous to emplacement of the diorite and forms a sub-economic resource; however, the overlying saprolitic residuum hosts economic gold mineralisation in friable lateritized palaeosols and aeolian sands (loess). Samples of saprolitic residuum were studied to investigate the morphology and composition of gold grains as a proxy for distance from source (and possible exploration vector) because the deposit hosts both angular and detrital gold suggesting both proximal and distal sources. U-Pb geochronology of detrital zircons also indicated a proximal and distal source, with the age spectra giving Archaean (2.83-3.28 Ga), and Palaeoproterozoic (1.95-2.20 Ga) to Neoproterozoic (1.1-1.8 Ga) zircons in the Yatela depocentre. The 1.1-1.8 Ga age spectrum restricts the maximum age for the first deposition of the sedimentary units in the Neoproterozoic, or during early deposition in the Taoudeni Basin. Models for formation of the residuum include distal and proximal sources for detritus into the depocentre, however, it is more likely that material was sourced locally and included recycled material. The creation of a deep laterite weathering profile and supergene enrichment of the residuum probably took place during the mid-Cretaceous-early Tertiary.

  8. Fungal Ferromanganese Mineralisation in Cretaceous Dinosaur Bones from the Gobi Desert, Mongolia.

    PubMed

    Owocki, Krzysztof; Kremer, Barbara; Wrzosek, Beata; Królikowska, Agata; Kaźmierczak, Józef

    2016-01-01

    Well-preserved mycelia of fungal- or saprolegnia-like biota mineralised by ferromanganese oxides were found for the first time in long bones of Late Cretaceous dinosaurs from the Gobi Desert (Nemegt Valley, Mongolia). The mycelia formed a biofilm on the wall of the bone marrow cavity and penetrated the osteon channels of the nearby bone tissue. Optical microscopy, Raman, SEM/EDS, SEM/BSE, electron microprobe and cathodoluminescence analyses revealed that the mineralisation of the mycelia proceeded in two stages. The first stage was early post-mortem mineralisation of the hyphae by Fe/Mn-oxide coatings and microconcretions. Probably this proceeded in a mildly acidic to circumneutral environment, predominantly due to heterotrophic bacteria degrading the mycelial necromass and liberating Fe and Mn sorbed by the mycelia during its lifetime. The second stage of mineralisation, which proceeded much later following the final burial of the bones in an alkaline environment, resulted from the massive precipitation of calcite and occasionally barite on the iron/manganese-oxide-coated mycelia. The mineral phases produced by fungal biofilms colonising the interiors of decaying dinosaur bones not only enhance the preservation (fossilisation) of fungal remains but can also be used as indicators of the geochemistry of the dinosaur burial sites.

  9. The effect of soil: water ratios on the mineralisation of phenanthrene: LNAPL mixtures in soil.

    PubMed

    Doick, Kieron J; Semple, Kirk T

    2003-03-14

    Contamination of soil by polycyclic aromatic hydrocarbons is frequently associated with non-aqueous-phase liquids. Measurement of the catabolic potential of a soil or determination of the biodegradable fraction of a contaminant can be done using a slurried soil respirometric system. This work assessed the impact of increasing the concentration of transformer oil and soil:water ratio on the microbial catabolism of [(14)C]phenanthrene to (14)CO(2) by a phenanthrene-degrading inoculum. Slurrying (1:1, 1:2, 1:3 and 1:5 soil:water ratios) consistently resulted in statistically higher rates and extents of mineralisation than the non-slurried system (2:1 soil:water ratio; P<0.01). The maximum extents of mineralisation observed occurred in the 1:2-1:5 soil:water ratio microcosms irrespective of transformer oil concentration. Transformer oil concentrations investigated displayed no statistically significant effect on total mineralisation (P>0.05). Soil slurries 1:2 or greater, but less than 1:5 (soil:water), are recommended for bioassay determinations of total contaminant bioavailability due to greater overall mineralisation and improved reproducibility.

  10. Fungal Ferromanganese Mineralisation in Cretaceous Dinosaur Bones from the Gobi Desert, Mongolia

    PubMed Central

    Wrzosek, Beata; Królikowska, Agata

    2016-01-01

    Well-preserved mycelia of fungal- or saprolegnia-like biota mineralised by ferromanganese oxides were found for the first time in long bones of Late Cretaceous dinosaurs from the Gobi Desert (Nemegt Valley, Mongolia). The mycelia formed a biofilm on the wall of the bone marrow cavity and penetrated the osteon channels of the nearby bone tissue. Optical microscopy, Raman, SEM/EDS, SEM/BSE, electron microprobe and cathodoluminescence analyses revealed that the mineralisation of the mycelia proceeded in two stages. The first stage was early post-mortem mineralisation of the hyphae by Fe/Mn-oxide coatings and microconcretions. Probably this proceeded in a mildly acidic to circumneutral environment, predominantly due to heterotrophic bacteria degrading the mycelial necromass and liberating Fe and Mn sorbed by the mycelia during its lifetime. The second stage of mineralisation, which proceeded much later following the final burial of the bones in an alkaline environment, resulted from the massive precipitation of calcite and occasionally barite on the iron/manganese-oxide-coated mycelia. The mineral phases produced by fungal biofilms colonising the interiors of decaying dinosaur bones not only enhance the preservation (fossilisation) of fungal remains but can also be used as indicators of the geochemistry of the dinosaur burial sites. PMID:26863014

  11. Extracellular ATP released by osteoblasts is a key local inhibitor of bone mineralisation.

    PubMed

    Orriss, Isabel R; Key, Michelle L; Hajjawi, Mark O R; Arnett, Timothy R

    2013-01-01

    Previous studies have shown that exogenous ATP (>1 µM) prevents bone formation in vitro by blocking mineralisation of the collagenous matrix. This effect is thought to be mediated via both P2 receptor-dependent pathways and a receptor-independent mechanism (hydrolysis of ATP to produce the mineralisation inhibitor pyrophosphate, PP(i)). Osteoblasts are also known to release ATP constitutively. To determine whether this endogenous ATP might exert significant biological effects, bone-forming primary rat osteoblasts were cultured with 0.5-2.5 U/ml apyrase (which sequentially hydrolyses ATP to ADP to AMP + 2 P(i)). Addition of 0.5 U/ml apyrase to osteoblast culture medium degraded extracellular ATP to <1% of control levels within 2 minutes; continuous exposure to apyrase maintained this inhibition for up to 14 days. Apyrase treatment for the first 72 hours of culture caused small decreases (≤25%) in osteoblast number, suggesting a role for endogenous ATP in stimulating cell proliferation. Continuous apyrase treatment for 14 days (≥0.5 U/ml) increased mineralisation of bone nodules by up to 3-fold. Increases in bone mineralisation were also seen when osteoblasts were cultured with the ATP release inhibitors, NEM and brefeldin A, as well as with P2X1 and P2X7 receptor antagonists. Apyrase decreased alkaline phosphatase (TNAP) activity by up to 60%, whilst increasing the activity of the PP(i)-generating ecto-nucleotide pyrophosphatase/phosphodiesterases (NPPs) up to 2.7-fold. Both collagen production and adipocyte formation were unaffected. These data suggest that nucleotides released by osteoblasts in bone could act locally, via multiple mechanisms, to limit mineralisation.

  12. How do cold-sensitive species endure ice ages? Phylogeographic and paleodistribution models of postglacial range expansion of the mesothermic drought-tolerant conifer Austrocedrus chilensis.

    PubMed

    Souto, Cintia P; Kitzberger, Thomas; Arbetman, Marina P; Premoli, Andrea C

    2015-11-01

    In view of global climate change, it is important to understand the responses of tree species to climate changes in the past. Combinations of phylogeographic analysis of genetic evidence, coupled with species distribution models (SDMs), are improving our understanding on this subject. We combined SDMs and microsatellite data from populations of the entire range of Austrocedrus chilensis, a dominant mesotherm (cold-sensitive) conifer of dryland forests of the southern Andes, to test the hypothesis of long-distance postglacial migration from northern and warmer refugia at the Last Glacial Maximum (LGM). The SDM indicated suitable conditions for Austrocedrus in northern Chile (western) at the LGM and largely unsuitable conditions in Argentina (eastern). Population genetic diversity and effective population sizes within populations decreased southward along the Andes, consistent with the hypothesis of long-distance dispersal from a northern refugium. Results support the hypothesis of one (or a few) warmer (low latitude) refugia in Chile for Austrocedrus. On balance, the evidence suggests that in contrast to cold-tolerant tree taxa with the capacity to fast-track postglacial warming thanks to local refugia, cold-sensitive species might have undergone long-distance range expansion, lagging behind progressive climate change throughout the Holocene.

  13. Linking transcriptional responses to organismal tolerance reveals mechanisms of thermal sensitivity in a mesothermal endangered fish.

    PubMed

    Komoroske, Lisa M; Connon, Richard E; Jeffries, Ken M; Fangue, Nann A

    2015-10-01

    Forecasting species' responses to climate change requires understanding the underlying mechanisms governing environmental stress tolerance, including acclimation capacity and acute stress responses. Current knowledge of these physiological processes in aquatic ectotherms is largely drawn from eurythermal or extreme stenothermal species. Yet many species of conservation concern exhibit tolerance windows and acclimation capacities in between these extremes. We linked transcriptome profiles to organismal tolerance in a mesothermal endangered fish, the delta smelt (Hypomesus transpacificus), to quantify the cellular processes, sublethal thresholds and effects of thermal acclimation on acute stress responses. Delta smelt initiated rapid molecular changes in line with expectations of theoretical thermal limitation models, but also exhibited diminished capacity to modify the expression of some genes and cellular mechanisms key to coping with acute thermal stress found in eurytherms. Sublethal critical thresholds occurred 4-6 °C below their upper tolerance limits, and thermal acclimation shifted the onset of acute thermal stress and tolerance as predicted. However, we found evidence that delta smelt's limited thermal plasticity may be partially due to an inability of individuals to effectively make physiological adjustments to truly achieve new homoeostasis under heightened temperatures, resulting in chronic thermal stress. These findings provide insight into the physiological basis of the diverse patterns of thermal tolerances observed in nature. Moreover, understanding how underlying molecular mechanisms shape thermal acclimation capacity, acute stress responses and ultimately differential phenotypes contributes to a predictive framework to deduce species' responses in situ to changes in selective pressures due to climate change.

  14. Gold Rush!

    ERIC Educational Resources Information Center

    Brahier, Daniel J.

    1997-01-01

    Describes a mathematical investigation of gold--how it is weighed, stored, used, and valued. For grades 3-4, children estimate the value of treasure chests filled with gold coins and explore the size and weight of gold bars. Children in grades 5-6 explore how gold is mined and used, and how the value of gold changes over time. (PVD)

  15. Mineralisation of (14)C-labelled polystyrene plastics by Penicillium variabile after ozonation pre-treatment.

    PubMed

    Tian, Lili; Kolvenbach, Boris; Corvini, Nora; Wang, Songfeng; Tavanaie, Nasrin; Wang, Lianhong; Ma, Yini; Scheu, Stefan; Corvini, Philippe François-Xavier; Ji, Rong

    2016-07-19

    Large amounts of polystyrene (PS), one of the most widely used plastics in the world, end up in the environment through industrial discharge and littering, becoming one of the major components of plastic debris. Such plastics, especially the small-sized microplastics and nanoplastics, have received increasing concerns in terms of their potential environmental risks. Feasible approaches for the degradation of PS in waste materials and in the environment are highly desirable. Physicochemical pretreatments of PS may be applied to enhance biological degradation. In the present study, we synthesized (14)C-labelled PS polymers, either uniformly labelled on the ring ([U-ring-(14)C]-PS) or labelled at the β-carbon position of the alkyl chain ([β-(14)C]-PS), and investigated the mineralisation of the (14)C-PS polymers by the fungus Penicillium variabile CCF3219 as well as the effect of ozonation as a physico-chemical pre-treatment on the mineralisation by the fungi. Biodegradation of the (14)C-PS polymers was studied in liquid medium (pH 7.5, without additional carbon substrate) with P. variabile for 16 weeks. During the incubation time, (14)CO2 was captured to calculate the mineralisation of (14)C-PS and the remaining polymers were analysed by means of scanning electron microscopy (SEM), Fourier transform infrared (FT-IR) spectrometry and gel-permeation chromatography (GPC). The results showed that the fungi mineralised both labelled polymers, and that the [U-ring-(14)C]-PS with a lower molecular weight led to a higher mineralisation rate. Ozonation pre-treatment strongly enhanced mineralisation of [β-(14)C]-PS. SEM analysis showed that the surface of the ozonated [β-(14)C]-PS became uneven and rough after the incubation, indicating an attack on the polymer by P. variabile. FT-IR analysis showed that ozonation generated carbonyl groups on the [β-(14)C]-PS and the amount of the carbonyl groups decreased after incubation of the [β-(14)C]-PS with P. variabile. GPC

  16. Organic phosphorus mineralisation in a temperate grassland soil under elevated atmospheric carbon dioxide concentrations

    NASA Astrophysics Data System (ADS)

    Jarosch, Klaus A.; Andresen, Louise; Gorenflo, André D.; Müller, Christoph; Frossard, Emmanuel; Bünemann, Else K.

    2016-04-01

    Background: Phosphorus (P) is an essential nutrient for all biota and significant proportions of P in soil are present in organic form. Increased atmospheric concentrations of carbon dioxide ([CO2]) have been shown to influence plant P uptake traits, resulting in plant-mediated changes in soil P pools. However, little is known on the effect of elevated [CO2] on organic P mineralisation rates in soil. Study design & hypotheses: A 33P isotopic dilution experiment was performed with soils of the 17-year-old Giessen free air carbon dioxide enrichment (GiFACE) - trial. At the GiFACE, three plots are treated with 20 % elevated [CO2] while three control plots receive ambient air. We hypothesised that i) the observed positive effect of elevated [CO2] on plant growth translates into differences in soil organic P mineralisation rates between treated and untreated plots, resulting in ii) differences in soil organic P pools. Methods: Fresh soil (0-8 cm) was sampled from each plot, labelled with a carrier free 33P solution and incubated for 36 days at 19° C in the dark. On six time points, inorganic P and 33P in soil filtrates, soil microorganisms (by liquid fumigation) and resin extractable P were quantified. The baseline of 33P isotopic dilution was assessed from a short term batch experiment and extrapolated for 36 days. Gross organic P mineralisation rates were determined as the difference between isotopic dilution in the incubated soils (physicochemical + biological processes) minus extrapolated values (physicochemical processes only). Additionally, enzyme addition assays on alkaline soil extracts were performed to quantify different soil organic P classes, using enzymes with a known substrate specificity. Results & Discussion: Gross organic P mineralisation rates were high during the first three days (5.5 - 34.3 mg P kg-1 d-1), possibly due to the soil disturbance at labelling soils with 33P. However, gross organic P mineralisation decreased rapidly to rates between 0

  17. Geochemical and mineralogical fingerprints to distinguish the exploited ferruginous mineralisations of Grotta della Monaca (Calabria, Italy).

    PubMed

    Dimuccio, Luca Antonio; Rodrigues, Nelson; Larocca, Felice; Pratas, João; Amado, Ana Margarida; de Carvalho, Luís A E Batista

    2017-02-15

    This study examines the geochemical and mineralogical variations in the ferruginous mineralisations that crop out within Grotta della Monaca, which is considered to be the most striking and best known example of a prehistoric iron mine-cave from the southern Apennines (Calabria, Italy). Previous archaeological research identified three local and distinct ancient exploitation phases of these ferruginous mineralisations: (1) an Upper Palaeolithic phase; (2) a Late Neolithic phase; and (3) a post-Medieval phase. These materials, which have various forms of complex mineralogical admixtures and range in colour from yellow-orange to red and darker brown shades, mainly consist of iron oxides/hydroxides (essentially goethite and lepidocrocite), which are often mixed with subordinate and variable amounts of other matrix components (carbonates, sulphates, arsenates, silicates and organic matter). Such ferruginous mineralisations generally correspond to geochemically heterogeneous massive dyke/vein/mammillary/stratiform facies that are exposed within the local caves along open fractures and inclined bedding planes and that partially cover cave wall niches/notches/pockets and ceiling cupolas/holes. Selected samples/sub-samples are analysed through a multi-technique approach with a handheld portable X-ray Fluorescence, X-ray Diffraction, micro-Raman and Fourier Transform Infrared spectroscope (both conventional and attenuated total reflection), which is combined with subsequent multivariate statistical analysis of the elemental concentration data. The geochemical and mineralogical results are used to individualise similar compositional clusters. As expected, the identified groups, each of which has very specific geochemical-mineralogical "fingerprints" and spatial distributions, enable us to identify the sampled ferruginous mineralisations. These specific mineral resources can be compared to similar raw materials that are found in other neighbouring archaeological sites, with

  18. Negative priming effect on organic matter mineralisation in NE Atlantic slope sediments.

    PubMed

    Gontikaki, Evangelia; Thornton, Barry; Huvenne, Veerle A I; Witte, Ursula

    2013-01-01

    The priming effect (PE) is a complex phenomenon which describes a modification (acceleration or retardation) in the mineralisation rate of refractory organic matter (OM) following inputs of labile material. PEs are well-studied in terrestrial ecosystems owing to their potential importance in the evolution of soil carbon stocks but have been largely ignored in aquatic systems despite the fact that the prerequisite for their occurrence, i.e. the co-existence of labile and refractory OM, is also true for sediments. We conducted stable isotope tracer experiments in continental margin sediments from the NE Atlantic (550-950 m) to study PE occurrence and intensity in relation to labile OM input. Sediment slurries were treated with increasing quantities of the (13)C-labelled diatom Thalassiosira rotula and PE was quantified after 7, 14 and 21 days. There was a stepwise effect of diatom quantity on its mineralisation although mineralisation efficiency dropped with increasing substrate amounts. The addition of diatomaceous OM yielded a negative PE (i.e. retardation of existing sediment OM mineralisation) at the end of the experiment regardless of diatom quantity. Negative PE is often the result of preferential utilisation of the newly deposited labile material by the microbial community ("preferential substrate utilization", PSU) which is usually observed at excessive substrate additions. The fact that PSU and the associated negative PE occurred even at low substrate levels in this study could be attributed to limited amounts of OM subject to priming in our study area (~0.2% organic carbon [OC]) which seems to be an exception among continental slopes (typically >0.5%OC). We postulate that PEs will normally be positive in continental slope sediments and that their intensity will be a direct function of sediment OC content. More experiments with varying supply of substrate targeting C-poor vs. C-rich sediments are needed to confirm these hypotheses.

  19. Geochemical and mineralogical fingerprints to distinguish the exploited ferruginous mineralisations of Grotta della Monaca (Calabria, Italy)

    NASA Astrophysics Data System (ADS)

    Dimuccio, Luca Antonio; Rodrigues, Nelson; Larocca, Felice; Pratas, João; Amado, Ana Margarida; de Carvalho, Luís A. E. Batista

    2017-02-01

    This study examines the geochemical and mineralogical variations in the ferruginous mineralisations that crop out within Grotta della Monaca, which is considered to be the most striking and best known example of a prehistoric iron mine-cave from the southern Apennines (Calabria, Italy). Previous archaeological research identified three local and distinct ancient exploitation phases of these ferruginous mineralisations: (1) an Upper Palaeolithic phase; (2) a Late Neolithic phase; and (3) a post-Medieval phase. These materials, which have various forms of complex mineralogical admixtures and range in colour from yellow-orange to red and darker brown shades, mainly consist of iron oxides/hydroxides (essentially goethite and lepidocrocite), which are often mixed with subordinate and variable amounts of other matrix components (carbonates, sulphates, arsenates, silicates and organic matter). Such ferruginous mineralisations generally correspond to geochemically heterogeneous massive dyke/vein/mammillary/stratiform facies that are exposed within the local caves along open fractures and inclined bedding planes and that partially cover cave wall niches/notches/pockets and ceiling cupolas/holes. Selected samples/sub-samples are analysed through a multi-technique approach with a handheld portable X-ray Fluorescence, X-ray Diffraction, micro-Raman and Fourier Transform Infrared spectroscope (both conventional and attenuated total reflection), which is combined with subsequent multivariate statistical analysis of the elemental concentration data. The geochemical and mineralogical results are used to individualise similar compositional clusters. As expected, the identified groups, each of which has very specific geochemical-mineralogical "fingerprints" and spatial distributions, enable us to identify the sampled ferruginous mineralisations. These specific mineral resources can be compared to similar raw materials that are found in other neighbouring archaeological sites, with

  20. Platiniferous gold-tourmaline aggregates in the gold-palladium belt of Minas Gerais, Brazil: implications for regional boron metasomatism

    NASA Astrophysics Data System (ADS)

    Cabral, Alexandre Raphael; Tupinambá, Miguel; Zeh, Armin; Lehmann, Bernd; Wiedenbeck, Michael; Brauns, Michael; Kwitko-Ribeiro, Rogerio

    2017-02-01

    The platiniferous gold-palladium belt of Minas Gerais, Brazil, forms an approximately 240-km-long, roughly north-south-trending domain that includes numerous auriferous lodes and platiniferous alluvium. The belt transects two Precambrian terranes, the Quadrilátero Ferrífero in the southern part, and the southern Serra do Espinhaço in the northern part. Both terranes were overprinted by regional fluid flow that led to tourmalinisation, with or without hematitisation, and precious-metal mineralisation. Here, we report the occurrence of coarse-grained gold-tourmaline aggregates and integrate recently obtained ages and tourmaline boron-isotope values published elsewhere. One type of aggregate is unique because it has patches that are close to stoichiometric PdPt, in which gold content varies from 2.5 to 33.5 at.%. The gold-tourmaline aggregates seem to be the ultimate expression of the boron metasomatism.

  1. Ammonium Concentrations in Produced Waters from a Mesothermic Oil Field Subjected to Nitrate Injection Decrease through Formation of Denitrifying Biomass and Anammox Activity▿ †

    PubMed Central

    Cornish Shartau, Sabrina L.; Yurkiw, Marcy; Lin, Shiping; Grigoryan, Aleksandr A.; Lambo, Adewale; Park, Hyung-Soo; Lomans, Bart P.; van der Biezen, Erwin; Jetten, Mike S. M.; Voordouw, Gerrit

    2010-01-01

    Community analysis of a mesothermic oil field, subjected to continuous field-wide injection of nitrate to remove sulfide, with denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes indicated the presence of heterotrophic and sulfide-oxidizing, nitrate-reducing bacteria (hNRB and soNRB). These reduce nitrate by dissimilatory nitrate reduction to ammonium (e.g., Sulfurospirillum and Denitrovibrio) or by denitrification (e.g., Sulfurimonas, Arcobacter, and Thauera). Monitoring of ammonium concentrations in producing wells (PWs) indicated that denitrification was the main pathway for nitrate reduction in the field: breakthrough of nitrate and nitrite in two PWs was not associated with an increase in the ammonium concentration, and no increase in the ammonium concentration was seen in any of 11 producing wells during periods of increased nitrate injection. Instead, ammonium concentrations in produced waters decreased on average from 0.3 to 0.2 mM during 2 years of nitrate injection. Physiological studies with produced water-derived hNRB microcosms indicated increased biomass formation associated with denitrification as a possible cause for decreasing ammonium concentrations. Use of anammox-specific primers and cloning of the resulting PCR product gave clones affiliated with the known anammox genera “Candidatus Brocadia” and “Candidatus Kuenenia,” indicating that the anammox reaction may also contribute to declining ammonium concentrations. Overall, the results indicate the following: (i) that nitrate injected into an oil field to oxidize sulfide is primarily reduced by denitrifying bacteria, of which many genera have been identified by DGGE, and (ii) that perhaps counterintuitively, nitrate injection leads to decreasing ammonium concentrations in produced waters. PMID:20562276

  2. Efficiency of the Regulation of Otolith Mineralisation and Susceptibility to kinetotic Behaviour in Parabolic Aircraft Flights

    NASA Astrophysics Data System (ADS)

    Knie, M.; Weigele, J.; Hilbig, R.; Anken, R.

    Under diminished gravity e g during the respective phase in the course of parabolic aircraft flight PF humans often suffer from motion sickness a kinetsosis due to sensorimotor disorders Using fish as a model system we previously provided ample evidence that an individually differently pronounced asymmetric mineralisation calcification of inner ear stones otoliths leads to the individually different susceptibility to such disorders Depending on the disposition of an individual fish the mineralisation of otoliths is more or less strictly regulated by the central nervous system via a gravity-dependent feedback loop Long-term hypergravity centrifuge e g slows down otolith mineralisation whereas simulated microgravity clinostat yields opposite results Such long-term experiments under altered gravity moreover affect otolith asymmetry According to our working hypothesis the efficiency of the respective regulatory mechanism differs among individual animals This efficiency is postulated to be high in animals who behave normally under microgravity conditions whereas it is assumed to be low in such individuals who reveal a kinetotic behaviour at diminished G-forces In order to test this hypothesis two groups of larval cichlid fish Oreochromis mossambicus were kept under long-term hypergravity centrifuge and simulated microgravity clinostat respectively in order to manipulate the efficiency of the aforementioned regulatory mechanism Subsequently the animals were subjected to diminished gravity in the course of PFs and it was analysed

  3. Microbial and diagenetic steps leading to the mineralisation of Great Salt Lake microbialites

    NASA Astrophysics Data System (ADS)

    Pace, Aurélie; Bourillot, Raphaël; Bouton, Anthony; Vennin, Emmanuelle; Galaup, Serge; Bundeleva, Irina; Patrier, Patricia; Dupraz, Christophe; Thomazo, Christophe; Sansjofre, Pierre; Yokoyama, Yusuke; Franceschi, Michel; Anguy, Yannick; Pigot, Léa; Virgone, Aurélien; Visscher, Pieter T.

    2016-08-01

    Microbialites are widespread in modern and fossil hypersaline environments, where they provide a unique sedimentary archive. Authigenic mineral precipitation in modern microbialites results from a complex interplay between microbial metabolisms, organic matrices and environmental parameters. Here, we combined mineralogical and microscopic analyses with measurements of metabolic activity in order to characterise the mineralisation of microbial mats forming microbialites in the Great Salt Lake (Utah, USA). Our results show that the mineralisation process takes place in three steps progressing along geochemical gradients produced through microbial activity. First, a poorly crystallized Mg-Si phase precipitates on alveolar extracellular organic matrix due to a rise of the pH in the zone of active oxygenic photosynthesis. Second, aragonite patches nucleate in close proximity to sulfate reduction hotspots, as a result of the degradation of cyanobacteria and extracellular organic matrix mediated by, among others, sulfate reducing bacteria. A final step consists of partial replacement of aragonite by dolomite, possibly in neutral to slightly acidic porewater. This might occur due to dissolution-precipitation reactions when the most recalcitrant part of the organic matrix is degraded. The mineralisation pathways proposed here provide pivotal insight for the interpretation of microbial processes in past hypersaline environments.

  4. Microbial and diagenetic steps leading to the mineralisation of Great Salt Lake microbialites

    PubMed Central

    Pace, Aurélie; Bourillot, Raphaël; Bouton, Anthony; Vennin, Emmanuelle; Galaup, Serge; Bundeleva, Irina; Patrier, Patricia; Dupraz, Christophe; Thomazo, Christophe; Sansjofre, Pierre; Yokoyama, Yusuke; Franceschi, Michel; Anguy, Yannick; Pigot, Léa; Virgone, Aurélien; Visscher, Pieter T.

    2016-01-01

    Microbialites are widespread in modern and fossil hypersaline environments, where they provide a unique sedimentary archive. Authigenic mineral precipitation in modern microbialites results from a complex interplay between microbial metabolisms, organic matrices and environmental parameters. Here, we combined mineralogical and microscopic analyses with measurements of metabolic activity in order to characterise the mineralisation of microbial mats forming microbialites in the Great Salt Lake (Utah, USA). Our results show that the mineralisation process takes place in three steps progressing along geochemical gradients produced through microbial activity. First, a poorly crystallized Mg-Si phase precipitates on alveolar extracellular organic matrix due to a rise of the pH in the zone of active oxygenic photosynthesis. Second, aragonite patches nucleate in close proximity to sulfate reduction hotspots, as a result of the degradation of cyanobacteria and extracellular organic matrix mediated by, among others, sulfate reducing bacteria. A final step consists of partial replacement of aragonite by dolomite, possibly in neutral to slightly acidic porewater. This might occur due to dissolution-precipitation reactions when the most recalcitrant part of the organic matrix is degraded. The mineralisation pathways proposed here provide pivotal insight for the interpretation of microbial processes in past hypersaline environments. PMID:27527125

  5. Epithermal and plutonic gold mineralizations related to paleoproterozoic acid magmatism in the Tapajós Gold province, Amazonian craton, Brazil

    NASA Astrophysics Data System (ADS)

    Juliani, C.; Corrêa-Silva, R. H.; Monteiro, L. V.; Bettencourt, J. S.; dall Agnol, R.

    2003-04-01

    The Tapajós Gold Province (TGP) is part of the Tapajós-Parima geologic province, that includes ˜2.1 Ga volcano-sedimentary sequences (Jacareacanga Group) and the magmatic arcs of the Cuiú-Cuiú Complex (˜2.01 Ga), Creporizäo Intrusive Suite (1.97-1.95 Ga), Rio das Tropas Tonalite (˜1.90 Ga) and Parauari Intrusive Suite (˜1.88 Ga). Andesitic to rhyolitic volcanic and volcaniclastic rocks of the Iriri Group (1.88 Ga) overlie plutonic rocks and are cut by anorogenic Maloquinha Intrusive Suite (˜1.87 Ga). Paleoproterozoic fluvial to marine sequences (Buiuçú Formation), and several mafic intrusion events are also identified in the TGP. Paleoproterozoic gold mineralizations in the TGP are mainly classified as mesothermal orogenic lodes, intrusion-related gold systems, and epithermal and mesothermal lodes in shear zones. Recently, it was discovered a 1.869 Ga epithermal high-sulfidation (quartz-alunite) and low-sulfidation (adularia-sericite) gold and base metal mineralizations hosted in calc-alkaline volcanic and volcaniclastic rocks of the Iriri Group. In the high-sulfidation mineralization, hydrothermal breccias are strongly affected by high-temperature advanced argillic alteration, with alunite, natroalunite, woodhouseiite-svanbergite, andalusite, diaspore and enargite, besides argillic and propylitic hydrothermal alterations. Over the hydrothermal breccia pipe occurs a hematite-rich silica cap and in the deeper zones sericitic alteration is also present. The epithermal high- and low-sulfidation mineralizations are geneticaly linked to stocks of hydrothermalized granophyry, and rhyolitic and rhyodacitic porphyry dikes and are hosted by late ring composite volcanoes, related to evolution of nested ash-flow caldera complexes. The caldera genesis is atributed to emplacement of shalow late- to post-tectonic calc-alkaline batholits of the Parauari Intrusive Suite in back-arc rifts. The mesozonal relatively reduced Batalha Granite hosts gold mineralizations and

  6. Application of gold compositional analyses to mineral exploration in the United States

    USGS Publications Warehouse

    Antweiler, J.C.; Campbell, W.L.

    1977-01-01

    Native gold is a mineral composed of Au, Ag and Cu in solid solution and it usually contains one or more trace metals as lattice impurities, as mineral inclusions, in grain boundaries or in surface coatings. Alloy proportions of Au, Ag and Cu, together with certain other elements, can be thought of as constituting a gold "signature". Gold is associated with a great variety of ore deposits and has characteristic signatures for each of several types of ore deposits. Signatures for gold derived from igneous-metamorphic, hypothermal, mesothermal and epithermal deposits reflect conditions of ore formation by their content of Ag, Cu and characteristic associated elements. At higher temperatures of ore formation, gold has low Ag and high Cu content, and Bi and Pb are the most abundant trace elements. But at lower temperatures of ore formation, Ag is high, Cu is low, and Pb is the most abundant trace element. The same trend in gold signatures is observable in gold mining districts, such as Central City, Colorado, where zoning as shown by mineral assemblages indicates ore deposition at progressively lower temperatures as the distance from a central high-temperature zone increases. The signatures of gold may be useful in searching for porphyry Cu deposits. Signatures from Butte (Montana), Mineral Park (Arizona) and Cala Abajo (Puerto Rico), on the basis of limited sampling, are similar and distinctive. They are characterized by a similar assemblage of trace elements and are relatively high in both Ag and Cu. Another application of gold compositional data is in tracing placer gold to its bedrock source. For example, the Ag content of placer gold in the Tarryall district of Colorado differed from that of nearly all of the bedrock sources of gold found by early prospectors. However, one lightly prospected area peripheral to the Tertiary quartz monzonite stock at Montgomery Gulch contains gold with a Ag content similar to that of the placer gold. This area is the most likely

  7. Comparison of Two AEM Groundwater Mineralisation Surveys in the Werra River Valley, Germany

    NASA Astrophysics Data System (ADS)

    Siemon, B.; Ullmann, A.; Vasterling, M.; Meyer, U.; Steuer, A.; Beer, W. W.; Pluemacher, J.

    2010-12-01

    The dissolution of Zechstein salt and the discharge of saltwater of the potash salt producing industry into the river Werra near the Hessian-Thuringian border in central Germany has led to a considerable mineralisation of ground and surface waters. In order to reduce the amount of saline water emissions directly into the river, the injection of waste water into the so called Plattendolomit was introduced. About 1000 million cubic meters have been stored in this porous and karstic limestone and dolomite bed of some ten metres thickness at about 500 meters depth. The waste water displaced the formation water upwards and in areas where fault zones exist saltwater rising occurred. Contracted by K+S KALI GmbH, BGR conducted a regional (1128 square kilometers) airborne geophysical survey in 2008 in addition to smaller survey (576 square kilometers) flown in 1996/97, both at 200/2000 meters line/tie-line spacing. Of particular interest was an area where a test disposal of saline waste water (9.5 million cubic meters) in the Gerstungen syncline took place between 1999 and 2007. Although complicated by the use of different helicopter-borne frequency-domain electromagnetic (HEM) systems (Dighem III and Resolve), it has been possible to quantitatively compare the results of both HEM surveys in order to map and outline changes of the near-surface groundwater mineralisation. Taking into account the challenging survey conditions, no significant increase in groundwater mineralisation could be substantiated within the achievable exploration depths of about 20 meters (saltwater ponds) and 200 meters (hard rock).

  8. Histology of the heterostracan dermal skeleton: Insight into the origin of the vertebrate mineralised skeleton

    PubMed Central

    Marquart, Chloe L.

    2015-01-01

    ABSTRACT Living vertebrates are divided into those that possess a fully formed and fully mineralised skeleton (gnathostomes) versus those that possess only unmineralised cartilaginous rudiments (cyclostomes). As such, extinct phylogenetic intermediates of these living lineages afford unique insights into the evolutionary assembly of the vertebrate mineralised skeleton and its canonical tissue types. Extinct jawless and jawed fishes assigned to the gnathostome stem evidence the piecemeal assembly of skeletal systems, revealing that the dermal skeleton is the earliest manifestation of a homologous mineralised skeleton. Yet the nature of the primitive dermal skeleton, itself, is poorly understood. This is principally because previous histological studies of early vertebrates lacked a phylogenetic framework required to derive evolutionary hypotheses. Nowhere is this more apparent than within Heterostraci, a diverse clade of primitive jawless vertebrates. To this end, we surveyed the dermal skeletal histology of heterostracans, inferred the plesiomorphic heterostracan skeleton and, through histological comparison to other skeletonising vertebrate clades, deduced the ancestral nature of the vertebrate dermal skeleton. Heterostracans primitively possess a four‐layered skeleton, comprising a superficial layer of odontodes composed of dentine and enameloid; a compact layer of acellular parallel‐fibred bone containing a network of vascular canals that supply the pulp canals (L1); a trabecular layer consisting of intersecting radial walls composed of acellular parallel‐fibred bone, showing osteon‐like development (L2); and a basal layer of isopedin (L3). A three layered skeleton, equivalent to the superficial layer L2 and L3 and composed of enameloid, dentine and acellular bone, is possessed by the ancestor of heterostracans + jawed vertebrates. We conclude that an osteogenic component is plesiomorphic with respect to the vertebrate dermal skeleton. Consequently, we

  9. Histology of the heterostracan dermal skeleton: Insight into the origin of the vertebrate mineralised skeleton.

    PubMed

    Keating, Joseph N; Marquart, Chloe L; Donoghue, Philip C J

    2015-06-01

    Living vertebrates are divided into those that possess a fully formed and fully mineralised skeleton (gnathostomes) versus those that possess only unmineralised cartilaginous rudiments (cyclostomes). As such, extinct phylogenetic intermediates of these living lineages afford unique insights into the evolutionary assembly of the vertebrate mineralised skeleton and its canonical tissue types. Extinct jawless and jawed fishes assigned to the gnathostome stem evidence the piecemeal assembly of skeletal systems, revealing that the dermal skeleton is the earliest manifestation of a homologous mineralised skeleton. Yet the nature of the primitive dermal skeleton, itself, is poorly understood. This is principally because previous histological studies of early vertebrates lacked a phylogenetic framework required to derive evolutionary hypotheses. Nowhere is this more apparent than within Heterostraci, a diverse clade of primitive jawless vertebrates. To this end, we surveyed the dermal skeletal histology of heterostracans, inferred the plesiomorphic heterostracan skeleton and, through histological comparison to other skeletonising vertebrate clades, deduced the ancestral nature of the vertebrate dermal skeleton. Heterostracans primitively possess a four-layered skeleton, comprising a superficial layer of odontodes composed of dentine and enameloid; a compact layer of acellular parallel-fibred bone containing a network of vascular canals that supply the pulp canals (L1); a trabecular layer consisting of intersecting radial walls composed of acellular parallel-fibred bone, showing osteon-like development (L2); and a basal layer of isopedin (L3). A three layered skeleton, equivalent to the superficial layer L2 and L3 and composed of enameloid, dentine and acellular bone, is possessed by the ancestor of heterostracans + jawed vertebrates. We conclude that an osteogenic component is plesiomorphic with respect to the vertebrate dermal skeleton. Consequently, we interpret the

  10. Mineralisation at the Carrock Fell Tungsten Mine, N. England: Paragenetic, fluid inclusion and geochemical study

    NASA Astrophysics Data System (ADS)

    Ball, T. K.; Fortey, N. J.; Shepherd, T. J.

    1985-01-01

    Tungsten ore at Carrock Fell Mine comprises wolframite and scheelite in polyminerallic quartz veins which traverse the Grainsgill Granite cupola and surrounding country rocks. In the veins, a wolframite-scheelite-apatite assemblage pre-dates a scheelite-arsenopyrite-pyrite (plus other sulphides) assemblages. Temperatures of mineralisation declined from a peak near 350°C to 170°C, and the hydrothermal fluid contained about 6 weight% NaCl and 3 wt% NaHCO3. Contemporaneous greisenisation involved loss of Na, Cr, Ca and Ba from granite, but Si and K were retained while B, Be and Al increased slightly. Sn also increased but is always a trace constituent, and F appears to have decreased. Zones of intense alteration contain high concentrations of quartzhosted fluid inclusions resulting from penetration of the granite by fluid chemically similar to that in the vein quartz. The W-rich, Sn-poor nature of the mineralisation may relate to the weakly saline, F-deficient but CO2-rich fluid chemistry. The alteration and mineralisation processes took place during late cooling of the Lower-Devonian Skiddaw Granite. Cross-cutting quartz-ankerite veins and argillitic zones which may be considerably younger than those producing the tungsten ore, have a distinct mineral suite lacking W and As and including major Pb and Zn. Temperatures at this late stage were below 150°C, and the fluid is estimated to have contained approximately 12 wt% NaCl and 15 wt% CaCl2.

  11. Gold deposition caused by carbonation of biotite during late-stage fluid flow

    NASA Astrophysics Data System (ADS)

    Pearce, Mark A.; White, Alistair J. R.; Fisher, Louise A.; Hough, Robert M.; Cleverley, James S.

    2015-12-01

    Alteration reactions associated with gold mineralisation can be used to elucidate the nature of the fluid that transported gold into a deposit. At the Junction gold deposit, Kambalda, Western Australia, gold is hosted in a metamorphosed and hydrothermally altered dolerite. Mineralisation at the deposit scale is associated with zones of K, CO2 and S metasomatism, as is common in many greenstone hosted gold deposits. However, at the thin-section scale gold is not closely associated with sulphide minerals but within zones of carbonate metasomatism and K-loss where pre-existing biotite has reacted to produce chlorite, muscovite and Fe-Mg carbonates. Gold precipitation is intimately associated with biotite breakdown where calcite is locally absent. Quantified mineral modes from detailed microstructural mapping are used to balance reactions describing the breakdown of biotite in the presence and absence of calcite. Using the basic assumption that Al is immobile during metasomatism the reactions are successfully balanced, even in a manifestly open system. Modelling of fluid-rock reactions using HCh constrains the fluid composition (0.11 < X(CO2) < 0.13) and fluid-rock ratios (< 12:1) that can produce the observed mineral assemblage. Additional modelling of solid solution mineral phases using THERMOCALC estimates alteration conditions of 390 °C, 4 kbar and also suggests a fluid X(CO2) ~ 0.1. Both these models show that the observed muscovite and chlorite compositions can be produced primarily through the removal of K from the measured precursor biotite. We show that it is not possible to transport and deposit all the gold observed in the alteration zone with the low fluid-rock ratios obtained from modelling of silicate alteration and inferred gold concentrations in these fluids. We suggest that this is typical of greenstone hosted gold deposits and that mechanisms other than aqueous solution, which can transport higher gold concentrations, must be considered.

  12. The Yatela gold deposit in Mali, West Africa: The final product of a long-lived history of hydrothermal alteration and weathering

    NASA Astrophysics Data System (ADS)

    Masurel, Quentin; Miller, John; Hein, Kim A. A.; Hanssen, Eric; Thébaud, Nicolas; Ulrich, Stanislav; Kaisin, Jean; Tessougue, Samuel

    2016-01-01

    The Yatela gold deposit is located in the Kédougou-Kénieba inlier (KKI), a window of ca. 2200-2050 Ma rocks that are exposed in eastern Senegal and western Mali. The geology of the KKI differs from other Paleoproterozoic granite-greenstone belts and sedimentary basins by the abundance of carbonate rocks. The Yatela deposit occurs within 8 km of the regional-scale Senegal-Mali Shear Zone. Country rocks in the Yatela region have been subjected to polycyclic deformation and regional greenschist-facies metamorphism. A syn-kinematic diorite stock has intruded the metasedimentary sequences in the open pit and is associated with a hornblende-hornfels contact aureole. Field relationships and micro-textural data indicate that the primary gold mineralisation is shear-hosted. The similar relative timing and structural setting between the Yatela primary gold mineralisation and other world-class deposits in the region (e.g., Loulo, Lawrence et al., 2013a; Massawa, Treloar et al., 2014; Sadiola Hill, Masurel et al., in press) suggest that regional orogenic gold mineralisation occurred during a period of transcurrent tectonics, after the cessation of regional compressional deformation. The primary gold mineralisation at Yatela, however, is low-grade and sub-economic. It is hosted by marbles and, to a lesser extent, diorite. The primary ore is pyrite-rich, with abundant chalcopyrite, minor arsenopyrite and accessory Zn-Pb-Sb-Fe-Ag-Co-Ni-bearing mineral species. Post-Birimian surficial dissolution of hydrothermally altered and mineralised host marbles resulted in the creation of troughs, which were draped and infilled with a ferruginous dissolution residue enriched in gold. This auriferous residuum formed the economic resource mined at Yatela until decommissioning in 2013. The Yatela gold deposit is unique with respect to mineralisation types encountered in West Africa because an auriferous residuum of economic interest (>1 Moz) derives from an underlying sub-economic Birimian

  13. A Palaeoproterozoic multi-stage hydrothermal alteration system at Nalunaq gold deposit, South Greenland

    NASA Astrophysics Data System (ADS)

    Bell, Robin-Marie; Kolb, Jochen; Waight, Tod Earle; Bagas, Leon; Thomsen, Tonny B.

    2017-03-01

    Nalunaq is an orogenic, high gold grade deposit situated on the Nanortalik Peninsula, South Greenland. Mineralisation is hosted in shear zone-controlled quartz veins, located in fine- and medium-grained amphibolite. The deposit was the site of Greenland's only operating metalliferous mine until its closure in 2014, having produced 10.67 t of gold. This study uses a combination of field investigation, petrography and U/Pb zircon and titanite geochronology to define a multi-stage hydrothermal alteration system at Nalunaq. A clinopyroxene-plagioclase-garnet(-sulphide) alteration zone (CPGZ) developed in the Nanortalik Peninsula, close to regional peak metamorphism and prior to gold-quartz vein formation. The ca. 1783-1762-Ma gold-quartz veins are hosted in reactivated shear zones with a hydrothermal alteration halo of biotite-arsenopyrite-sericite-actinolite-pyrrhotite(-chlorite-plagioclase-löllingite-tourmaline-titanite), which is best developed in areas of exceptionally high gold grades. Aplite dykes dated to ca. 1762 Ma cross-cut the gold-quartz veins, providing a minimum age for mineralisation. A hydrothermal calcite-titanite alteration assemblage is dated to ca. 1766 Ma; however, this alteration is highly isolated, and as a result, its field relationships are poorly constrained. The hydrothermal alteration and mineralisation is cut by several generations of ca. 1745-Ma biotite granodiorite accompanied by brittle deformation. A ca. 1745-Ma lower greenschist facies hydrothermal epidote-calcite-zoisite alteration assemblage with numerous accessory minerals forms halos surrounding the late-stage fractures. The contrasting hydrothermal alteration styles at Nalunaq indicate a complex history of exhumation from amphibolite facies conditions to lower greenschist facies conditions in an orogenic belt which resembles modern Phanerozoic orogens.

  14. A Palaeoproterozoic multi-stage hydrothermal alteration system at Nalunaq gold deposit, South Greenland

    NASA Astrophysics Data System (ADS)

    Bell, Robin-Marie; Kolb, Jochen; Waight, Tod Earle; Bagas, Leon; Thomsen, Tonny B.

    2016-07-01

    Nalunaq is an orogenic, high gold grade deposit situated on the Nanortalik Peninsula, South Greenland. Mineralisation is hosted in shear zone-controlled quartz veins, located in fine- and medium-grained amphibolite. The deposit was the site of Greenland's only operating metalliferous mine until its closure in 2014, having produced 10.67 t of gold. This study uses a combination of field investigation, petrography and U/Pb zircon and titanite geochronology to define a multi-stage hydrothermal alteration system at Nalunaq. A clinopyroxene-plagioclase-garnet(-sulphide) alteration zone (CPGZ) developed in the Nanortalik Peninsula, close to regional peak metamorphism and prior to gold-quartz vein formation. The ca. 1783-1762-Ma gold-quartz veins are hosted in reactivated shear zones with a hydrothermal alteration halo of biotite-arsenopyrite-sericite-actinolite-pyrrhotite(-chlorite-plagioclase-löllingite-tourmaline-titanite), which is best developed in areas of exceptionally high gold grades. Aplite dykes dated to ca. 1762 Ma cross-cut the gold-quartz veins, providing a minimum age for mineralisation. A hydrothermal calcite-titanite alteration assemblage is dated to ca. 1766 Ma; however, this alteration is highly isolated, and as a result, its field relationships are poorly constrained. The hydrothermal alteration and mineralisation is cut by several generations of ca. 1745-Ma biotite granodiorite accompanied by brittle deformation. A ca. 1745-Ma lower greenschist facies hydrothermal epidote-calcite-zoisite alteration assemblage with numerous accessory minerals forms halos surrounding the late-stage fractures. The contrasting hydrothermal alteration styles at Nalunaq indicate a complex history of exhumation from amphibolite facies conditions to lower greenschist facies conditions in an orogenic belt which resembles modern Phanerozoic orogens.

  15. Orogenesis, high-T thermal events, and gold vein formation within metamorphic rocks of the Alaskan Cordillera

    USGS Publications Warehouse

    Goldfarb, R.J.; Snee, L.W.; Pickthorn, W.J.

    1993-01-01

    Mesothermal, gold-bearing quartz veins are widespread within allochthonous terranes of Alaska that are composed dominantly of greenschist-facies metasedimentary rocks. The most productive lode deposits are concentrated in south-central and southeastern Alaska; small and generally nonproductive gold-bearing veins occur upstream from major placer deposits in interior and northern Alaska. Ore-forming fluids in all areas are consistent with derivation from metamorphic devolatilisation reactions, and a close temporal relationship exists between high-T tectonic deformation, igneous activity, and gold mineralization. Ore fluids were of consistently low salinity, CO2-rich, and had ??18O values of 7 ???-12??? and ??D values between -15??? and -35???. Upper-crustal temperatures within the metamorphosed terranes reached at least 450-500??C before onset of significant gold-forming hydrothermal activity. In southern Alaska, gold deposits formed during latter stages of Tertiary, subduction-related, collisional orogenesis and were often temporally coeval with calc-alkaline magmatism. -from Authors

  16. Monitoring the mineralisation of bone nodules in vitro by space- and time-resolved Raman micro-spectroscopy.

    PubMed

    Ghita, Adrian; Pascut, Flavius C; Sottile, Virginie; Notingher, Ioan

    2014-01-07

    Raman microscopy was used as a label-free method to study the mineralisation of bone nodules formed by mesenchymal stem cells cultured in osteogenic medium in vitro. Monitoring individual bone nodules over 28 days revealed temporal and spatial changes in the crystalline phase of the hydroxyapatite components of the nodules.

  17. Noble gases fingerprint a metasedimentary fluid source in the Macraes orogenic gold deposit, New Zealand

    NASA Astrophysics Data System (ADS)

    Goodwin, Nicholas R. J.; Burgess, Ray; Craw, Dave; Teagle, Damon A. H.; Ballentine, Chris J.

    2017-02-01

    The world-class Macraes orogenic gold deposit (˜10 Moz resource) formed during the late metamorphic uplift of a metasedimentary schist belt in southern New Zealand. Mineralising fluids, metals and metalloids were derived from within the metasedimentary host. Helium and argon extracted from fluid inclusions in sulphide mineral grains (three crush extractions from one sample) have crustal signatures, with no evidence for mantle input (R/Ra = 0.03). Xenon extracted from mineralised quartz samples provides evidence for extensive interaction between fluid and maturing organic material within the metasedimentary host rocks, with 132Xe/36Ar ratios up to 200 times greater than air. Similarly, I/Cl ratios for fluids extracted from mineralised quartz are similar to those of brines from marine sediments that have interacted with organic matter and are ten times higher than typical magmatic/mantle fluids. The Macraes mineralising fluids were compositionally variable, reflecting either mixing of two different crustal fluids in the metasedimentary pile or a single fluid type that has had varying degrees of interaction with the host metasediments. Evidence for additional input of meteoric water is equivocal, but minor meteoric incursion cannot be discounted. The Macraes deposit formed in a metasedimentary belt without associated coeval magmatism, and therefore represents a purely crustal metamorphogenic end member in a spectrum of orogenic hydrothermal processes that can include magmatic and/or mantle fluid input elsewhere in the world. There is no evidence for involvement of minor intercalated metabasic rocks in the Macraes mineralising system. Hydrothermal fluids that formed other, smaller, orogenic deposits in the same metamorphic belt have less pronounced noble gas and halogen evidence for crustal fluid-rock interaction than at Macraes, but these deposits also formed from broadly similar metamorphogenic processes.

  18. Oxidation and mineralisation of substituted phenols by Fenton's reagent and catalytic wet oxidation.

    PubMed

    Santos, A; Rodriguez, S; Garcia-Ochoa, F; Yustos, P

    2007-01-01

    Catalytic abatement of solutions of 1,000 mg/L in phenol, ortho and para nitrophenol and ortho and para cresols was acomplished by using two catalytic systems. Fenton's reagent was used at 50 degrees C by adding 10 mg/L of ferrous cation and different dosages of H2O2. The mixture was reacting isothermically in a batch way during 3 hours. Catalytic wet oxidation (CWO) was carried out by using a commercial Activated Carbon, Industrial React FE01606A, CWO runs were carried out in a fixed bed reactor (FBR) with concurrent upflow. Temperature and oxygen pressure of the reactor were set to 160 degrees C and 16 bar, respectively. While phenols are quicky oxidised by the Fenton reagent higher mineralisation was obtained in the CWO process.

  19. The importance of the SIBLING family of proteins on skeletal mineralisation and bone remodelling.

    PubMed

    Staines, Katherine A; MacRae, Vicky E; Farquharson, Colin

    2012-09-01

    The small integrin-binding ligand N-linked glycoprotein (SIBLING) family consists of osteopontin, bone sialoprotein, dentin matrix protein 1, dentin sialophosphoprotein and matrix extracellular phosphoglycoprotein. These proteins share many structural characteristics and are primarily located in bone and dentin. Accumulating evidence has implicated the SIBLING proteins in matrix mineralisation. Therefore, in this review, we discuss the individual role that each of the SIBLING proteins has in this highly orchestrated process. In particular, we emphasise how the nature and extent of their proteolytic processing and post-translational modification affect their functional role. Finally, we describe the likely roles of the SIBLING proteins in clinical disorders of hypophosphataemia and their potential therapeutic use.

  20. Identifying metabolites related to nitrogen mineralisation using 1H NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    . T McDonald, Noeleen; Graham, Stewart; Watson, Catherine; Gordon, Alan; Lalor, Stan; Laughlin, Ronnie; Elliott, Chris; . P Wall, David

    2015-04-01

    Exploring new analysis techniques to enhance our knowledge of the various metabolites within our soil systems is imperative. Principally, this knowledge would allow us to link key metabolites with functional influences on critical nutrient processes, such as the nitrogen (N) mineralisation in soils. Currently there are few studies that utilize proton nuclear magnetic resonance spectroscopy (1H NMR) to characterize multiple metabolites within a soil sample. The aim of this research study was to examine the effectiveness of 1H NMR for isolating multiple metabolites that are related to the mineralizable N (MN) capacity across a range of 35 Irish grassland soils. Soils were measured for MN using the standard seven day anaerobic incubation (AI-7). Additionally, soils were also analysed for a range of physio-chemical properties [e.g. total N, total C, mineral N, texture and soil organic matter (SOM)]. Proton NMR analysis was carried on these soils by extracting with 40% methanol:water, lyophilizing and reconstituting in deuterium oxide and recording the NMR spectra on a 400MHz Bruker AVANCE III spectrometer. Once the NMR data were spectrally processed and analysed using multivariate statistical analysis, seven metabolites were identified as having significant relationships with MN (glucose, trimethylamine, glutamic acid, serine, aspartic acid, 4-aminohippuirc acid and citric acid). Following quantification, glucose was shown to explain the largest percentage variability in MN (72%). These outcomes suggest that sources of labile carbon are essential in regulating N mineralisation and the capacity of plant available N derived from SOM-N pools in these soils. Although, smaller in concentration, the amino acids; 4-aminohippuirc acid, glutamic acid and serine also significantly (P<0.05) explained 43%, 27% and 19% of the variability in MN, respectively. This novel study highlights the effectiveness of using 1H NMR as a practical approach to profile multiple metabolites in

  1. Effect of material and structural factors on fracture behaviour of mineralised collagen microfibril using finite element simulation.

    PubMed

    Barkaoui, Abdelwahed; Hambli, Ridha; Tavares, João Manuel R S

    2015-08-01

    Bone is a multiscale heterogeneous material and its principal function is to support the body structure and to resist mechanical loads without fracturing. Numerical modelling of biocomposites at different length scales provides an improved understanding of the mechanical behaviour of structures such as bone, and also guides the development of multiscale mechanical models. Here, a three-dimensional nano-scale model of mineralised collagen microfibril based on the finite element method was employed to investigate the effect of material and structural factors on the mechanical equivalent of fracture properties. Fracture stress and damping capacity as functions of the number of cross-links were obtained under tensile loading conditions for different densities and Young's modulus of the mineral phase. The results show that the number of cross-links and the density of mineral as well as Young's modulus of mineral have an important influence on the strength of mineralised collagen microfibrils which in turn clarify the bone fracture on a macroscale.

  2. Fluid inclusion and sulphur isotope evidence for syntectonic mineralisation at the Elura mine, southeastern Australia

    NASA Astrophysics Data System (ADS)

    Seccombe, P. K.

    1990-10-01

    Fluid inclusion and sulphur isotope data for the discordant, metasediment-hosted massive sulphide deposit at Elura are consistent with a syntectonic origin of the orebodies. Thermometric and laser Raman microprobe analyses indicate that two-phase, primary fluid inclusions are low salinity and H2O-CO2-CH4 types. Inclusion fluids from quartz in ore yield homogenisation temperatures (Th) ranging from 298 ° to 354 °C (mean 320 °C). They are likely to have been trapped close to the solvus of the H2O-CO2-(CH4-NaCl) system and thus should give temperatures of the mineralising fluid. An additional, low Th population of later fluid inclusions is recognised in quartz from ore and syntectonic extension veins in the adjacent wallrock. Th's for these low CO2bearing inclusions range from 150 to 231 °C (mean 190 °C), and should be considerably lower than true trapping temperatures. Sulphur isotopic composition (δ34S) of pyrite, sphalerite, pyrrhotite and galena ranges from 4.7 to 12.6% and indicates a sulphur source from underlying Cobar Supergroup metasediments. An average temperature of 275 °C from the sphalerite-galena sulphur isotopic thermometer suggests isotopic re-equilibration below peak metamorphic temperatures.

  3. Gold Coating

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Epner Technology Inc. responded to a need from Goddard Space Flight Center for the ultimate in electroplated reflectivity needed for the Mars Global Surveyor Mars Orbiter Laser Altimeter (MOLA). Made of beryllium, the MOLA mirror was coated by Epner Technology Laser Gold process, specially improved for the project. Improved Laser Gold- coated reflectors have found use in an epitaxial reactor built for a large semiconductor manufacturer as well as the waveguide in Braun-Thermoscan tympanic thermometer and lasing cavities in various surgical instruments.

  4. Orogenic-type copper-gold-arsenic-(bismuth) mineralization at Flatschach (Eastern Alps), Austria

    NASA Astrophysics Data System (ADS)

    Raith, Johann G.; Leitner, Thomas; Paar, Werner H.

    2015-10-01

    Structurally controlled Cu-Au mineralization in the historic Flatschach mining district (Styria, Austria) occurs in a NE-SW to NNE-WSW oriented vein system as multiple steep-dipping calcite-(dolomite)-quartz veins in amphibolite facies metamorphic rocks (banded gneisses/amphibolites, orthogneisses, metagranitoids) of the poly-metamorphosed Austroalpine Silvretta-Seckau nappe. Vein formation postdated ductile deformation events and Eoalpine (Late Cretaceous) peak metamorphism but predated Early to Middle Miocene sediment deposition in the Fohnsdorf pull-apart basin; coal-bearing sediments cover the metamorphic basement plus the mineralized veins at the northern edge of the basin. Three gold-bearing ore stages consist of a stage 1 primary hydrothermal (mesothermal?) ore assemblage dominated by chalcopyrite, pyrite and arsenopyrite. Associated minor minerals include alloclasite, enargite, bornite, sphalerite, galena, bismuth and matildite. Gold in this stage is spatially associated with chalcopyrite occurring as inclusions, along re-healed micro-fractures or along grain boundaries of chalcopyrite with pyrite or arsenopyrite. Sericite-carbonate alteration is developed around the veins. Stage 2 ore minerals formed by the replacement of stage 1 sulfides and include digenite, anilite, "blue-remaining covellite" (spionkopite, yarrowite), bismuth, and the rare copper arsenides domeykite and koutekite. Gold in stage 2 is angular to rounded in shape and occurs primarily in the carbonate (calcite, Fe-dolomite) gangue and less commonly together with digenite, domeykite/koutekite and bismuth. Stage 3 is a strongly oxidized assemblage that includes hematite, cuprite, and various secondary Cu- and Fe-hydroxides and -carbonates. It formed during supergene weathering. Stage 1 and 2 gold consists mostly of electrum (gold fineness 640-860; mean = 725; n = 46), and rare near pure gold (fineness 930-940; n = 6). Gold in stage 3 is Ag-rich electrum (fineness 350-490, n = 12), and has a

  5. Gold Nanoantennas

    SciTech Connect

    2012-01-01

    An array of gold nanoantennas laced into an artificial membrane enhances the fluorescence intensity of three different molecules when they pass through plasmonic hot spots in the array. Watch for the blue, green and red flashes. The photobleaching at the end of each fluorescence event (white flashes) is indicative of single molecule observations.

  6. Gold potential in the Dalradian rocks of NW Northern Ireland: GIS-based prospectivity analysis using Tellus data

    NASA Astrophysics Data System (ADS)

    Lusty, P. A. J.; McDonnell, P. M.; Gunn, A. G.; Chacksfield, B. C.; Cooper, M.

    2009-04-01

    Geographic Information Systems (GIS) are essential tools for the management and integration of the large amounts of multivariate spatial data used in mineral exploration. Prospectivity analysis combines these datasets, in the context of a mineral deposit model, to produce a map showing the distribution of potential for a particular type of mineral deposit. In this example Arc-Spatial Data Modeller software has been used to analyse the prospectivity for orogenic vein gold mineralisation in the Dalradian rocks of north-western Northern Ireland. A knowledge-driven (fuzzy logic) approach was used because of the small number of gold deposits within the area. Fuzzy logic is used in situations where information is inexact and the use of classical set theory is inappropriate. Fuzzy logic allows assignment of weightings to exploration data on a continuous scale from 1 (full membership) to 0 (full non-membership). This allows a level of uncertainty or 'fuzziness' to be incorporated into the modelling. The key stages of prospectivity analysis are: (1) analysis of the deposit model to determine key exploration indicators; (2) data processing, interpretation and analysis to extract key indicators; (3) assignment of weightings, zones and styles of influence to key indicators; and (4) calculation of prospectivity. This research is based largely on new geochemical and geophysical data resulting from the Tellus Project in Northern Ireland. The Tellus Project involved geochemical and airborne geophysical surveys over the whole of Northern Ireland carried out between 2004-6 with funding from the Government of Northern Ireland. The study area (3074 km2) is underlain mainly by Neoproterozoic rocks of the Dalradian Supergroup (ca. 590 Ma) which form part of the Caledonide orogenic belt. The Dalradian Supergroup comprises a thick succession of semi-pelites, psammites and pelites, with graphitic pelite horizons that host much of the known gold mineralisation. In the Sperrin Mountains two

  7. Age and paragenesis of mineralisation at Coronation Hill uranium deposit, Northern Territory, Australia

    NASA Astrophysics Data System (ADS)

    Orth, Karin; Meffre, Sebastien; Davidson, Garry

    2014-06-01

    Coronation Hill is a U + Au + platinum group elements deposit in the South Alligator Valley (SAV) field in northern Australia, south of the better known unconformity-style U East Alligator Rivers (EAR) field. The SAV field differs from the EAR by having a more complex basin-basement architecture. A volcanically active fault trough (Jawoyn Sub-basin) developed on older basement and then was disrupted by renewed faulting, before being buried beneath regional McArthur Basin sandstones that are also the main hanging wall to the EAR deposits. Primary mineralisation at Coronation Hill formed at 1607 ± 26 Ma (rather than 600-900 Ma as previously thought), and so it is likely that the SAV was part of a single west McArthur Basin dilational event. Most ore is hosted in sub-vertical faults and breccias in the competent volcanic cover sequence. This favoured fluid mixing, acid buffering (forming illite) and oxidation of Fe2+ and reduced C-rich assemblages as important uranium depositional mechanisms. However, reduction of U in fractured older pyrite (Pb model age of 1833 ± 67 Ma) is an important trap in diorite. Some primary ore was remobilised at 675 ± 21 Ma to form coarse uraninite + Ni-Co pyrite networks containing radiogenic Pb. Coronation Hill is polymetallic, and in this respect resembles the `egress'-style U deposits in the Athabascan Basin (Canada). However, these are all cover-hosted. A hypothesis for further testing is that Coronation Hill is also egress-style, with ores formed by fluids rising through basement-hosted fault networks (U reduction by diorite pyrite and carbonaceous shale), and into veins and breccias in the overlying Jawoyn Sub-basin volcano-sedimentary succession.

  8. The Kohuamuri siliceous sinter as a vector for epithermal mineralisation, Coromandel Volcanic Zone, New Zealand

    NASA Astrophysics Data System (ADS)

    Hamilton, Ayrton; Campbell, Kathleen; Rowland, Julie; Browne, Patrick

    2017-02-01

    The Kohuamuri siliceous sinter is the largest known fossil hot-spring system in the Hauraki Goldfield, a 200 × 40 km volcanic terrain with at least 50 adularia-illite epithermal deposits formed 16.3-5.6 Ma within the Coromandel Volcanic Zone, New Zealand. The sinter is associated with rhyolite and ignimbrite of the Whitianga Caldera (Miocene-Pliocene) and consists of two deposits, the Kohuamuri deposit itself, a large in situ outcrop (47,000 m2) and its associated sinter boulder field (4500 m2), and the Kaitoke deposit 900 m to the southwest, comprising boulders in a landslide situated on a normal fault. The well-preserved macroscopic and microscopic textures at Kohuamuri are similar to actively forming and ancient hot-spring deposits elsewhere, derived from deep circulating, magmatically heated, near-neutral pH alkali chloride fluids oversaturated in amorphous silica and that discharge at the Earth's surface at ≤100 °C. Lithofacies, petrography, mineralogy, as well as trace element concentrations of the Kohuamuri/Kaitoke deposits were used to locate likely palaeo-thermal conduits from the deep reservoir and to reconstruct the palaeoenvironmental setting of the siliceous sinter as an aid to assessing the economic potential of the ancient geothermal system. Both deposits contain the high-temperature (>75 °C) geyserite lithofacies, with the Kohuamuri deposit also exhibiting textures affiliated with cooler middle and distal sinter apron areas, as well as geothermally influenced marsh facies. Trace element analysis of sinter lithofacies revealed concentrations and zonations of Au, Ag, base metals (Pb, Cu, Zn) and pathfinder elements (As, Sb) associated with epithermal deposits, elevated in the proximal vent area, and providing evidence of possible Au and Ag ore mineralisation at depth. The methodology used in this study could be utilised globally to identify and assess as yet unidentified epithermal deposits.

  9. The Kohuamuri siliceous sinter as a vector for epithermal mineralisation, Coromandel Volcanic Zone, New Zealand

    NASA Astrophysics Data System (ADS)

    Hamilton, Ayrton; Campbell, Kathleen; Rowland, Julie; Browne, Patrick

    2016-04-01

    The Kohuamuri siliceous sinter is the largest known fossil hot-spring system in the Hauraki Goldfield, a 200 × 40 km volcanic terrain with at least 50 adularia-illite epithermal deposits formed 16.3-5.6 Ma within the Coromandel Volcanic Zone, New Zealand. The sinter is associated with rhyolite and ignimbrite of the Whitianga Caldera (Miocene-Pliocene) and consists of two deposits, the Kohuamuri deposit itself, a large in situ outcrop (47,000 m2) and its associated sinter boulder field (4500 m2), and the Kaitoke deposit 900 m to the southwest, comprising boulders in a landslide situated on a normal fault. The well-preserved macroscopic and microscopic textures at Kohuamuri are similar to actively forming and ancient hot-spring deposits elsewhere, derived from deep circulating, magmatically heated, near-neutral pH alkali chloride fluids oversaturated in amorphous silica and that discharge at the Earth's surface at ≤100 °C. Lithofacies, petrography, mineralogy, as well as trace element concentrations of the Kohuamuri/Kaitoke deposits were used to locate likely palaeo-thermal conduits from the deep reservoir and to reconstruct the palaeoenvironmental setting of the siliceous sinter as an aid to assessing the economic potential of the ancient geothermal system. Both deposits contain the high-temperature (>75 °C) geyserite lithofacies, with the Kohuamuri deposit also exhibiting textures affiliated with cooler middle and distal sinter apron areas, as well as geothermally influenced marsh facies. Trace element analysis of sinter lithofacies revealed concentrations and zonations of Au, Ag, base metals (Pb, Cu, Zn) and pathfinder elements (As, Sb) associated with epithermal deposits, elevated in the proximal vent area, and providing evidence of possible Au and Ag ore mineralisation at depth. The methodology used in this study could be utilised globally to identify and assess as yet unidentified epithermal deposits.

  10. Hydrocarbon-mediated gold and uranium concentration in the Witwatersrand Basin, South Africa

    NASA Astrophysics Data System (ADS)

    Fuchs, Sebastian; Williams-Jones, Anthony; Schumann, Dirk; Couillard, Martin; Murray, Andrew

    2016-04-01

    The Witwatersrand deposits in South Africa represent the largest repository of gold in the World and a major resource of uranium. The genesis of the gold and uranium ores in the quartz-pebble conglomerates (reefs), however, is still a matter of considerable discussion. Opinion has been divided over whether they represent paleo-placers that have been partly remobilised by hydrothermal fluids or if the mineralisation is entirely hydrothermal in origin. In addition, recently published models have proposed a syngenetic origin for the gold involving bacterially-mediated precipitation from meteoric water and shallow seawater. An important feature of the gold and uranium mineralisation in the reefs is the strong spatial association with organic matter. In some reefs, up to 70% of the gold and almost the entire uranium resource is spatially associated with pyrobitumen seams, suggesting a genetic relationship of the gold-uranium mineralisation with hydrocarbons. Here we report results of a study of the Carbon Leader Reef, using high-resolution scanning and transmission electron microscopy (SEM / TEM) and LA-ICP-MS that provide new insights into the role of hydrocarbons in the concentration of the gold and uranium. A detailed examination revealed gold monocrystals containing numerous rounded or elliptical inclusions filled with pyrobitumen. We interpret these inclusions to record the crystallisation of the gold around droplets of a hydrocarbon liquid that migrated through the Witwatersrand basin, and was converted to pyrobitumen by being heated. We propose that the gold was transported in a hydrothermal fluid as a bisulphide complex and that this fluid mixed with the hydrocarbon liquid to form a water-oil emulsion. The interaction between the two fluids caused a sharp reduction in fO2 at the water-oil interface, which destabilised the gold-bisulphide complexes, causing gold monocrystals to precipitate around the oil droplets. In contrast to the gold, uraninite, the principal

  11. Passive airborne EM and ground IP\\resistivity results over the Romero intermediate sulphidation epithermal gold deposits, Dominican Republic

    NASA Astrophysics Data System (ADS)

    Legault, Jean M.; Niemi, Jeremy; Brett, Jeremy S. Zhao, Shengkai; Han, Zihao; Plastow, Geoffrey C.

    2016-04-01

    The Romero gold-copper-zinc-silver deposits are located in the Province of San Juan, Dominican Republic, ~165 km west-north-west of Santo Domingo. Romero and Romero South orebodies contain stratabound gold mineralisation with copper, silver and zinc of intermediate sulphidation (IS), epithermal style. The gold mineralisation is associated with disseminated to semi-massive sulphides, sulphide veinlets and quartz-sulphide veins within quartz-pyrite, quartz-illite-pyrite and illite-chlorite-pyrite alteration. Ground direct current (DC) resistivity and induced polarisation (IP) supported by ground magnetics remain the preferred geophysical targeting tools for drill follow-up along with geologic mapping and geochemistry. However, Z-axis tipper electromagnetics (ZTEM) passive airborne electromagnetics (AEM) and magnetics have recently also been applied with success for reconnaissance mapping of deep alteration and fault structures regionally. The airborne ZTEM-magnetic surveys, supported by three-dimensional (3D) inversions, show good correlation with the ground IP\\resistivity surveys in the Romero and Romero South gold-copper-zinc-silver IS deposit area. The results have provided targets for ground follow-up and deep targeted drilling, and were successful in identifying a previously unknown deep (>500 m) continuity between the Romero and Romero South deposits.

  12. VTEM airborne EM, aeromagnetic and gamma-ray spectrometric data over the Cerro Quema high sulphidation epithermal gold deposits, Panama

    NASA Astrophysics Data System (ADS)

    Kwan, Karl; Prikhodko, Alexander; Legault, Jean M. Plastow, Geoffrey C.; Kapetas, John; Druecker, Michael

    2016-03-01

    In March 2012, a helicopter-borne versatile time-domain electromagnetic (VTEM), magnetic and radiometric survey was flown over the Cerro Quema high sulphidation (HS) epithermal gold deposits and the surrounding area. The Cerro Quema deposits are located in the Azuero Peninsula, Panama, approximately 8 km east of Güerita. The gold mineralisation is associated with clay-pyrite alterations topped by an acid-leached resistive cap, and the principal ores are pyrite-rich sulphides located within mineralised vuggy silica rocks. The geophysical data over the Cerro Quema deposits have been analysed. The electromagnetic (EM) responses over the deposits are characterised by resistivity highs and chargeability lows, surrounded by resistivity lows and chargeability highs. Radiometric Th/K ratio highs and magnetic susceptibility lows are observed over the deposits. These geophysical signatures over the Cerro Quema deposits are characteristic responses from HS epithermal gold deposits. The success of the VTEM survey points to the applicability of the regional helicopter electromagnetic, magnetic and gamma-ray spectrometry (EM-Mag-Spec) surveys for the exploration of similar HS epithermal gold deposits to depths < 500 m in weathered terrains.

  13. Mineralisation of reconstituted collagen using polyvinylphosphonic acid/polyacrylic acid templating matrix protein analogues in the presence of calcium, phosphate and hydroxyl ions

    PubMed Central

    Kim, Young Kyung; Gu, Li-sha; Bryan, Thomas E.; Kim, Jong Ryul; Chen, Liang; Liu, Yan; Yoon, James C.; Breschi, Lorenzo; Pashley, David H.; Tay, Franklin R.

    2010-01-01

    The complex morphologies of mineralised collagen fibrils are regulated through interactions between the collagen matrix and non-collagenous extracellular proteins. In the present study, polyvinylphosphonic acid, a biomimetic analogue of matrix phosphoproteins, was synthesised and confirmed with FTIR and NMR. Biomimetic mineralisation of reconstituted collagen fibrils devoid of natural non-collagenous proteins was demonstrated with TEM using a Portland cement-containing resin composite and a phosphate-containing fluid in the presence of polyacrylic acid as sequestration, and polyvinylphosphonic acid as templating matrix protein analogues. In the presence of these dual biomimetic analogues in the mineralisation medium, intrafibrillar and extrafibrillar mineralisation via bottom-up nanoparticle assembly based on the nonclassical crystallisation pathway could be identified. Conversely, only large mineral spheres with no preferred association with collagen fibrils were observed in the absence of biomimetic analogues in the medium. Mineral phases were evident within the collagen fibrils as early as 4 hours after the initially-formed amorphous calcium phosphate nanoprecursors were transformed into apatite nanocrystals. Selected area electron diffraction patterns of highly mineralised collagen fibrils were nearly identical to those of natural bone, with apatite crystallites preferentially aligned along the collagen fibril axes. PMID:20621767

  14. Biomineralization of gold: biofilms on bacterioform gold.

    PubMed

    Reith, Frank; Rogers, Stephen L; McPhail, D C; Webb, Daryl

    2006-07-14

    Bacterial biofilms are associated with secondary gold grains from two sites in Australia. 16S ribosomal DNA clones of the genus Ralstonia that bear 99% similarity to the bacterium Ralstonia metallidurans-shown to precipitate gold from aqueous gold(III) tetrachloride-were present on all DNA-positive gold grains but were not detected in the surrounding soils. These results provide evidence for the bacterial contribution to the authigenic formation of secondary bacterioform gold grains and nuggets.

  15. Structures controlling U and Th mineralisation in the Gebel Felat area of the south Eastern Desert of Egypt

    NASA Astrophysics Data System (ADS)

    Kamel, Ahmed Farouk

    1997-05-01

    In the Eastern Desert of Egypt, younger granites host U and Th mineralisations which are concentrated along faults and joints. In particular, the Gebel Felat Pluton is characterised by a high level of radioactivity as shown by an aeroradiometric survey. The U content is 82 ppm and the Th content is 15 ppm in areas of high radioactivity. The rocks are cross-cut by two main sets of fractures trending east-west and northwest-southeast. The contour maps of these two trends can be correlated with the aeroradiometric map of the same area.

  16. Is It Real Gold?

    ERIC Educational Resources Information Center

    Harris, Harold H.

    1999-01-01

    Features acid tests for determining whether jewelry is "real" gold or simply gold-plated. Describes the carat system of denoting gold content and explains how alloys are used to create various shades of gold jewelry. Addresses the question of whether gold jewelry can turn a wearer's skin green by considering various oxidation reactions.…

  17. Mineralisation of collagen rich soft tissues and osteocyte lacunae in Enpp1−/− mice

    PubMed Central

    Hajjawi, Mark O.R.; MacRae, Vicky E.; Huesa, Carmen; Boyde, Alan; Millán, José Luis; Arnett, Timothy R.; Orriss, Isabel R.

    2014-01-01

    Ecto-nucleotide pyrophosphatase/phosphodiesterases (NPPs) hydrolyse nucleotide triphosphates to the corresponding nucleotide monophosphates and the mineralisation inhibitor, pyrophosphate (PPi). This study examined the role of NPP1 in osteocytes, osteoclasts and cortical bone, using a mouse model lacking NPP1 (Enpp1−/−). We used microcomputed tomography (μCT) to investigate how NPP1 deletion affects cortical bone structure; excised humerus bones from 8, 15 and 22-week old mice were scanned at 0.9 μm. Although no changes were evident in the cortical bone of 8-week old Enpp1−/− mice, significant differences were observed in older animals. Cortical bone volume was decreased 28% in 22-week Enpp1−/− mice, whilst cortical porosity was reduced 30% and 60% at 15 and 22-weeks, respectively. This was accompanied by up to a 15% decrease in closed pore diameter and a 55% reduction in the number of pores. Cortical thickness was reduced up to 35% in 15 and 22-week Enpp1−/− animals and the endosteal diameter was increased up to 23%. Thus, the cortical bone from Enpp1−/− mice was thinner and less porous, with a larger marrow space. Scanning electron microscopy (SEM) revealed a decrease in the size and number of blood vessel channels in the cortical bone as well as a 40% reduction in the mean plan area of osteocyte lacunae. We noted that the number of viable osteocytes isolated from the long bones of Enpp1−/− mice was decreased ≤ 50%. In contrast, osteoclast formation and resorptive activity were unaffected by NPP1 deletion. μCT and histological analysis of Enpp1−/− mice also revealed calcification of the joints and vertebrae as well as soft tissues including the whisker follicles, ear pinna and trachea. This calcification worsened as the animals aged. Together, these data highlight the key role of NPP1 in regulating calcification of both soft and skeletal tissues. PMID:25260930

  18. Coeval emplacement and orogen-parallel transport of gold in oblique convergent orogens

    NASA Astrophysics Data System (ADS)

    Upton, Phaedra; Craw, Dave

    2016-12-01

    Varying amounts of gold mineralisation is occurring in all young and active collisional mountain belts. Concurrently, these syn-orogenic hydrothermal deposits are being eroded and transported to form placer deposits. Local extension occurs in convergent orogens, especially oblique orogens, and facilitates emplacement of syn-orogenic gold-bearing deposits with or without associated magmatism. Numerical modelling has shown that extension results from directional variations in movement rates along the rock transport trajectory during convergence, and is most pronounced for highly oblique convergence with strong crustal rheology. On-going uplift during orogenesis exposes gold deposits to erosion, transport, and localised placer concentration. Drainage patterns in variably oblique convergent orogenic belts typically have an orogen-parallel or sub-parallel component; the details of which varies with convergence obliquity and the vagaries of underlying geological controls. This leads to lateral transport of eroded syn-orogenic gold on a range of scales, up to > 100 km. The presence of inherited crustal blocks with contrasting rheology in oblique orogenic collision zones can cause perturbations in drainage patterns, but numerical modelling suggests that orogen-parallel drainage is still a persistent and robust feature. The presence of an inherited block of weak crust enhances the orogen-parallel drainage by imposition of localised subsidence zones elongated along a plate boundary. Evolution and reorientation of orogen-parallel drainage can sever links between gold placer deposits and their syn-orogenic sources. Many of these modelled features of syn-orogenic gold emplacement and varying amounts of orogen-parallel detrital gold transport can be recognised in the Miocene to Recent New Zealand oblique convergent orogen. These processes contribute little gold to major placer goldfields, which require more long-term recycling and placer gold concentration. Most eroded syn

  19. Origin of the world-class PGE-Au mineralisation in the Skaergaard intrusion by bulk S-saturation, accumulation, partial dissolution, and secondary reef formation.

    NASA Astrophysics Data System (ADS)

    Daugaard Nielsen, Troels Frederik

    2013-04-01

    The Skaergaard intrusion is the type locality for stratiform "Skaergaard-type" PGE-Au mineralisations with layers rich in PGE, followed by Au and Cu. Models for stratiform PGE mineralisations divide into uppers and downers models. Downers models assume bulk liquid S-saturation followed by a variety of accumulation processes and the second model the scavenging of metals by fluids deep in intrusions and deposition in chemical traps above. This investigation is based on continuous profiling in roof, walls and floor. Cu anomalies in roof, walls and floor are contemporaneous and systematics in Pd/Pt and Pd/Au ratios document bulk liquid S-saturation, no loss of precious metal below the mineralisation and no obvious chemical traps. A classic downers process is documented. The timing of the mineralisation is controlled by composition of liquidus plagioclase and fraction of residual magma (F). PGE concentrations are an order of magnitude higher in the floor mineralisation due to accumulation. Systematics across the mineralisation shows in the centre of the intrusion 5 main levels of Pd-concentration followed by an Au and a Cu-level. All levels PGE and Au levels have c. 100 ppm Cu and show no correlation to PGE and Au. 90% of all PGE is contained in one phase, skaergaardite (PdCu).The lower and main PGE concentration has moderate Pd/Pt ratios. Overlying secondary reefs have high, basal Pd/Pt and show local S-saturation reflecting d-values of PGE between sulphide and silicate liquid. No basal high Pd/Pt anomaly occurs at Au and Cu levels and the floor shows four types of mineralisation. The main PGE reef (Pd5) has gradual increase and decrease in PGE and Pd/Pt, dissolution of sulphide, increasing PGE+Au/Cu due to reaction between interstial and documented reactive Fe-rich silicate melt and the bulk magma sulfides. Dissolution of Cu-sulfide increases PGE/Cu, reduces the size of droplets to 30µ (av.) and provides metals for secondary reefs above - formed by migration of

  20. Review of the Senegalo-Malian shear zone system - Timing, kinematics and implications for possible Au mineralisation styles

    NASA Astrophysics Data System (ADS)

    Diene, M.; Fullgraf, T.; Diatta, F.; Gloaguen, E.; Gueye, M.; Ndiaye, P. M.

    2015-12-01

    The Kédougou Kénieba Inlier (KKI) of eastern Senegal forms a typical Paleoproterozoic greenstone belt characterised by low-metamorphic sequences of volcanic rocks and volcano-sediments that have been intruded at various stages by gabbroic suites and calc-alkaline granitoids. The main structures of the KKI comprise two anastomosing structures about N-S trending shear belts that are distinguished into the western Main Transcurrent Zone (MTZ) and the eastern Senegalo-Malian shear zone system (SMSZ). These shear belts are taken to define the limits between the western Mako, the central Diale-Kéniebandi and the eastern Daléma-Kofi domains even though transitions exist between their characteristic deposition sequences. Remote sensing analysis of airborne geophysics and satellite data (Landsat, ENVI, SRTM) in combination with geological field mapping, structural analysis and geochronology suggests that the SMSZ represents a Birimian structure that records a main stage of deformation that could characterise the major transcurrent Eburnean tectonics (D2) dated from 2105 Ma (Feybesse et al., 2006a-e). This sinistral transpressive deformation marked by a major constraint oriented NNW-SSE, is accompanied by a NNE-SSW extension leading to the opening of dilational areas such as small pull-apart basins marked by local calk-alkaline volcanic sequences and several coeval intrusions of the Boboti Suite dated 2080 ± 0.9 Ma (Hirdes and Davis, 2002). A post-Birimian to pre-Neoproterozoic deformation post dates the transcurrent phase and is marked by regional N-S extension. Review of the existing Au-mineralisation models in combination with the spatial analysis of soil geochemical data suggest seven possible mineralisation styles that are related to the transpressional tectonics and coeval magmatism.

  1. Impact of the uranium (VI) speciation in mineralised urines on its extraction by calix[6]arene bearing hydroxamic groups used in chromatography columns.

    PubMed

    Baghdadi, S; Bouvier-Capely, C; Ritt, A; Peroux, A; Fevrier, L; Rebiere, F; Agarande, M; Cote, G

    2015-11-01

    Actinides determination in urine samples is part of the analyses performed to monitor internal contamination in case of an accident or a terrorist attack involving nuclear matter. Mineralisation is the first step of any of these analyses. It aims at reducing the sample volume and at destroying all organic compounds present. The mineralisation protocol is usually based on a wet ashing step, followed by actinides co-precipitation and a furnace ashing step, before redissolution and the quantification of the actinides by the appropriate techniques. Amongst the existing methods to perform the actinides co-precipitation, alkali-earth (typically calcium) precipitation is widely used. In the present work, the extraction of uranium(VI), plutonium(IV) and americium(III) from the redissolution solutions (called "mineralised urines") on calix[6]arene columns bearing hydroxamic groups was investigated as such an extraction is a necessary step before their determination by ICP-MS or alpha spectrometry. Difficulties were encountered in the transfer of uranium(VI) from raw to mineralised urines, with yield of transfer ranging between 0% and 85%, compared to about 90% for Pu and Am, depending on the starting raw urines. To understand the origin of such a difficulty, the speciation of uranium (VI) in mineralised urines was investigated by computer simulation using the MEDUSA software and the associated HYDRA database, compiled with recently published data. These calculations showed that the presence of phosphates in the "mineralised urines" leads to the formation of strong uranyl-phosphate complexes (such as UO2HPO4) which compete with the uranium (VI) extraction by the calix[6]arene bearing hydroxamic groups. The extraction constant of uranium (VI) by calix[6]arene bearing hydroxamic groups was determined in a 0.04 mol L(-1) sodium nitrate solution (logK=4.86±0.03) and implemented in an extraction model taking into account the speciation in the aqueous phase. This model allowed to

  2. New constraints on fluid sources in orogenic gold deposits, Victoria, Australia

    NASA Astrophysics Data System (ADS)

    Fu, Bin; Kendrick, Mark A.; Fairmaid, Alison M.; Phillips, David; Wilson, Christopher J. L.; Mernagh, Terrence P.

    2012-03-01

    Br/I ratios provide evidence for organic Br and I released during metamorphism of the shales. Therefore, the regional data provide strong evidence for the involvement of sedimentary components in gold mineralisation, but are consistent with deeper metamorphic fluid sources from basement volcano-sedimentary rocks. The overlying sediments are probably involved in gold mineralisation via fluid-rock interaction.

  3. New lithogeochemical and mineralogical exploration of Li-Sn greisen mineralisation in old mining adits of the Zinnwald deposit, Germany

    NASA Astrophysics Data System (ADS)

    Neßler, Jörg; Seifert, Thomas; Gutzmer, Jens; Müller, Armin; Henker, Jan; Kühn, Kersten

    2014-05-01

    The polymetallic Zinnwald-Cínovec deposit is represented by greisen-type mineralisation hosted within the apical portion of a small granite intrusion. Similar to other granitic stocks with Sn-W mineralisation in the Erzgebirge, the Zinnwald granite intruded during the post-collisional stage of the late-Variscan (Permo-Carboniferous) magmatic evolution. These intrusions are characterised by the prominent enrichment of incompatible elements (F, Li, Rb, Cs, Sn, Nb and Ta) and the depletion of P2O5. The deposit is located in the eastern part of the Erzgebirge region, Germany and straddles the border between Germany and the Czech Republic. It is characterised by flat dipping, sheet-like greisen ore bodies (up to 40 m in thickness) and veins (up to 1 m in thickness) located in the apical part and along the quaquaversal dipping edges of the granite stock. The greisen bodies predominantly consist of quartz, Li-Rb-Cs-bearing mica (named zinnwaldite), topaz, fluorite and accessory kaolinite and cassiterite. Historically mined for its cassiterite and wolframite ores since the 16th and 19th century, respectively, the deposit still provides access to a wide spread system of drifts and adits. Selected parts of the underground mine are now presented by the visitor's mine "Vereinigt Zwitterfeld zu Zinnwald". These local conditions are favourable for the re-examination of the exhibited greisen mineralisation. Within the framework of the ongoing Li and Sn exploration project of the SolarWorld Solicium GmbH in the German part of the deposit, an underground sampling campaign has been conducted, incorporating a series of 88 channel samples gained at two different levels (Tiefer Bünau adit = 750 m a.s.l.; Tiefe Hilfe Gottes adit = 720 m a.s.l.). Equally spaced channels of 2 m intervals and approximate dimensions of 180 x 5 x 2.5 cm have been created on pre-selected and detailed mapped walls of two different adits within the mine. The sample material has been gained for mineralogical

  4. The Proterozoic, albitite-hosted, Valhalla uranium deposit, Queensland, Australia: a description of the alteration assemblage associated with uranium mineralisation in diamond drill hole V39

    NASA Astrophysics Data System (ADS)

    Polito, Paul A.; Kyser, T. Kurt; Stanley, Cliff

    2009-01-01

    The Valhalla uranium deposit, located 40 km north of Mount Isa, Queensland, Australia, is an albitite-hosted, Mesoproterozoic U deposit similar to albitite-hosted uranium deposits in the Ukraine, Sweden, Brazil and Guyana. Uranium mineralisation is hosted by a thick package of interbedded fine-grained sandstones, arkoses and gritty siltstones that are bound by metabasalts belonging to the ca. 1,780 Ma Eastern Creek Volcanics in the Western Succession of the Mount Isa basin. Alteration associated with U mineralisation can be divided into an early, main and late stage. The early stage is dominated by laminated and intensely altered rock comprising albite, reibeckite, calcite, (titano)magnetite ± brannerite. The main stage of mineralisation is dominated by brecciated and intensely altered rocks that comprise laminated and intensely altered rock cemented by brannerite, apatite, (uranoan)-zircon, uraninite, anatase, albite, reibeckite, calcite and hematite. The late stage of mineralisation comprises uraninite, red hematite, dolomite, calcite, chlorite, quartz and Pb-, Fe-, Cu-sulfides. Brannerite has U-Pb and Pb-Pb ages that indicate formation between 1,555 and 1,510 Ma, with significant Pb loss evident at ca. 1,200 Ma, coincident with the assemblage of Rodinia. The oldest ages of the brannerite overlap with 40Ar/39Ar ages of 1,533 ± 9 Ma and 1,551 ± 7 Ma from early and main-stage reibeckite and are interpreted to represent the timing of formation of the deposit. These ages coincide with the timing of peak metamorphism in the Mount Isa area during the Isan Orogeny. Lithogeochemical assessment of whole rock data that includes mineralised and unmineralised samples from the greater Mount Isa district reveals that mineralisation involved the removal of K, Ba and Si and the addition of Na, Ca, U, V, Zr, P, Sr, F and Y. U/Th ratios indicate that the ore-forming fluid was oxidised, whereas the crystal chemistry of apatite and reibeckite within the ore zone suggests that F

  5. Tectonic controls on hydrothermal mineralisation in hot continental crust: Thermal modelling and spatial analysis

    NASA Astrophysics Data System (ADS)

    Gessner, K.; Porwal, A.

    2009-04-01

    Hydrothermal ore deposits provide a record of excess energy flux and mass transfer in the Earth's lithosphere. The heterogeneous distribution of ore deposits in space and time provides a challenge to uniformitarian geodynamic and tectonic concepts, but unusual thermal and structural events often coincide with high mineral endowment. In the Australian Proterozoic continental backarcs and intracratonic rifts host large resources of base metals, gold, and uranium. We present thermal models and spatial analyses of mineral occurrences within the Mount Isa Inlier, an inverted Mesoproterozoic rift in northwest Queensland, Australia, to demonstrate how thermal structure, tectonic style and crustal scale fluid flow are related. In the Mount Isa Inlier, radiogenic heat production contributes significantly to present day surface heat flow, and Mesoproterozoic geotherms of 40°C km-1 in the upper crust can be inferred from lithosphere-scale conductive models. The combination of thick continental crust and high temperatures implies that localization of deformation was limited to a thin upper crustal layer. During rifting mid-crustal rocks intruded by syn-extensional granites were exhumed as metamorphic core complexes in strike-parallel linear basement belts. The resulting horizontal strength contrast between sedimentary basins and shallow basement domains became a focus for deformation during subsequent crustal shortening. Our spatial analysis of mineral occurrences demonstrates that epigenetic copper mineralization at Mount Isa correlates positively with steep fault zones bounding linear basement domains, and granites within these domains. Mineralization potential is greatly increased, because high permeability along steep fault zones enables hydrothermal fluid flow between magmatic, metamorphic and sedimentary reservoirs. We argue that the deformation behavior of hot continental lithosphere generates a favorable environment for hydrothermal mineralization by linking shallow

  6. Quantitative proteomics provides new insights into chicken eggshell matrix protein functions during the primary events of mineralisation and the active calcification phase.

    PubMed

    Marie, Pauline; Labas, Valérie; Brionne, Aurélien; Harichaux, Grégoire; Hennequet-Antier, Christelle; Rodriguez-Navarro, Alejandro B; Nys, Yves; Gautron, Joël

    2015-08-03

    Eggshell is a bioceramic composed of 95% calcium carbonate mineral and 3.5% organic matrix. Its structural organisation is controlled by its organic matrix. We have used quantitative proteomics to study four key stages of shell mineralisation: 1) widespread deposition of amorphous calcium carbonate (ACC), 2) ACC transformation into crystalline calcite aggregates, 3) formation of larger calcite crystal units and 4) development of a columnar structure with preferential calcite crystal orientation. This approach explored the distribution of 216 shell matrix proteins found at the four stages. Variations in abundance according to these calcification events were observed for 175 proteins. A putative function related to the mineralisation process was predicted by bioinformatics for 77 of them and was further characterised. We confirmed the important role of lysozyme, ovotransferrin, ovocleidin-17 and ovocleidin-116 for shell calcification process, characterised major calcium binding proteins (EDIL3, ALB, MFGE8, NUCB2), and described novel proteoglycans core proteins (GPC4, HAPLN3). We suggest that OVAL and OC-17 play a role in the stabilisation of ACC. Finally, we report proteins involved in the regulation of proteins driving the mineralisation. They correspond to numerous molecular chaperones including CLU, PPIB and OCX21, protease and protease inhibitors including OVM and CST3, and regulators of phosphorylation.

  7. Nanomechanical properties of mineralised collagen microfibrils based on finite elements method: biomechanical role of cross-links.

    PubMed

    Barkaoui, Abdelwahed; Hambli, Ridha

    2014-01-01

    Hierarchical structures in bio-composites such as bone tissue have many scales or levels and synergic interactions between the different levels. They also have a highly complex architecture in order to fulfil their biological and mechanical functions. In this study, a new three-dimensional (3D) model based on the finite elements (FEs) method was used to model the relationship between the hierarchical structure and the properties of the constituents at the sub-structure scale (mineralised collagen microfibrils) and to investigate their apparent nanomechanical properties. The results of the proposed FE simulations show that the elastic properties of microfibrils depend on different factors such as the number of cross-links, the mechanical properties and the volume fraction of phases. The results obtained under compression loading at a small deformation < 2% show that the microfibrils have a Young's modulus (Ef) ranging from 0.4 to 1.16 GPa and a Poisson's ratio ranging from 0.26 to 0.3. These results are in excellent agreement with experimental data (X-ray, AFM and MEMS) and molecular simulations.

  8. Multifractal spatial organisation in hydrothermal gold systems of the Archaean Yilgarn craton, Western Australia

    NASA Astrophysics Data System (ADS)

    Munro, Mark; Ord, Alison; Hobbs, Bruce

    2015-04-01

    A range of factors controls the location of hydrothermal alteration and gold mineralisation in the Earth's crust. These include the broad-scale lithospheric architecture, availability of fluid sources, fluid composition and pH, pressure-temperature conditions, microscopic to macroscopic structural development, the distribution of primary lithologies, and the extent of fluid-rock interactions. Consequently, the spatial distribution of alteration and mineralization in hydrothermal systems is complex and often considered highly irregular. However, despite this, do they organize themselves in a configuration that can be documented and quantified? Wavelets, mathematical functions representing wave-like oscillations, are commonly used in digital signals analysis. Wavelet-based multifractal analysis involves incrementally scanning a wavelet across the dataset multiple times (varying its scale) and recording its degree of fit to the signal at each interval. This approach (the wavelet transform modulus maxima method) highlights patterns of self-similarity present in the dataset and addresses the range of scales over which these patterns replicate themselves (expressed by their range in 'fractal dimension'). Focusing on seven gold ore bodies in the Archaean Yilgarn craton of Western Australia, this study investigates whether different aspects of hydrothermal gold systems evolve to organize themselves spatially as multifractals. Four ore bodies were selected from the Sunrise Dam deposit (situated in the Laverton tectonic zone of the Kurnalpi terrane) in addition to the Imperial, Majestic and Salt Creek gold prospects, situated in the Yindarlgooda dome of the Mount Monger goldfield (approximately 40km due east of Kalgoorlie). The Vogue, GQ, Cosmo East and Astro ore bodies at Sunrise Dam were chosen because they exhibit different structural geometries and relationships between gold and associated host-rock alteration styles. Wavelet-based analysis was conducted on 0.5m and 1m

  9. GOLD PLATING PROCESS

    DOEpatents

    Seegmiller, R.

    1957-08-01

    An improved bath is reported for plating gold on other metals. The composition of the plating bath is as follows: Gold cyanide from about 15 to about 50 grams, potassium cyanide from about 70 to about 125 grams, and sulfonated castor oil from about 0.1 to about 10 cc. The gold plate produced from this bath is smooth, semi-hard, and nonporous.

  10. A reappraisal of the age, origin and structural setting of sulphide mineralisation in the UK North Pennines Orefield

    NASA Astrophysics Data System (ADS)

    Holdsworth, Bob; Dempsey, Eddie; Selby, David; Le Cornu, Chris; Young, Brian

    2015-04-01

    The North Pennines Orefield (NPO) is centred on the Alston block, a structural high of fractured Carboniferous sedimentary rocks that unconformably overlie a Devonian age (ca. 399 Ma) granite pluton buried at shallow depths (<0.5 km). The orefield has long been considered to be a classic example of a Mississippi Valley Type (MVT) deposit where the source of the metals and sulphur are derived by hydrothermal leaching of the host sedimentary (carbonate-rich) rocks. The vein-hosted part of the orefield consists of linked systems of shear and tensile fractures with a variety of regionally recognised orientations (ESE-WNW Quarter Point, NE-SW, NW-SE Cross Veins). These are associated with lead (galena), iron (pyrite, pyrrhotite, marcasite), copper (chalcopyrite), zinc (sphalerite), fluorite, barite and quartz mineralization. New Rhenium-Osmium (Re-Os) isotope geochemical analysis of the vein-hosted pyrite mineralization suggests that: (i) the metalliferous ores of the NPO formed ca. 294Ma (earliest Permian); and (ii) that they carry an initial Os ratio indicative of a mantle source similar to that indicated by the initial Os ratio of the Whin Sill dolerite suite (emplacement ages ca. 297-294 Ma). New field observations and stress inversion analyses show that at least two regional deformation events are recognised in the Carboniferous host rocks of the NPO. A initial phase of Late Carboniferous ('Variscan') N-S compression pre-dates mineralisation and leads to formation of the NW-SE fractures, initiation of the Burtreeford Disturbance as a N-S fault and compressional reactivation of the previously extensional E-W Lunedale Fault. A later phase of dextral transtension (NNE-SSW extension, ESE-WNW compression) leads to the formation of the ESE-WNW and NE-SW veins, together with compressional reactivation of the Burtreeford Disturbance and Lunedale Fault. Field and microstructural analyses show that the transtensional deformation is synchronous with the main phases of NPO

  11. The effect of soy isoflavones on egg quality and bone mineralisation during the late laying period of quail.

    PubMed

    Sahin, N; Onderci, M; Balci, T A; Cikim, G; Sahin, K; Kucuk, O

    2007-06-01

    1. Soy isoflavones play a role in calcium and bone metabolism. Poor egg quality, skeletal abnormalities and architectural deterioration of bone tissue are common problems under hot climate conditions and with increased age in poultry. 2. In this study, we investigated the effects of soy isoflavone supplementation on egg production, egg quality, bone mineral density (BMD), levels of osteocalcin (OC), vitamin D, calcium (Ca), phosphorus (P) and alkaline phosphatase (ALP) activity in quail (Coturnix coturnix japonica) during the late laying period. 3. The birds (n = 180; 28 weeks old) were randomly assigned to 6 treatment groups consisting of 6 replicates of 5 birds each in a 2 x 3 factorial arrangement of treatments (temperatures, soy isoflavone concentration). Birds were kept in wire cages in a temperature-controlled room at either 22 degrees C (thermo-neutral, TN) or 34 degrees C (heat stress, HS) for 8 h/d (09:00 to 17:00 h; until the end of the study) and fed either on a basal (control) diet or on the basal diet supplemented with either 400 or 800 mg of soy isoflavones/kg of diet. 4. Heat exposure reduced feed intake, egg production, egg quality, BMD, OC, vitamin D, Ca, P and ALP when the basal diet was given. Feed intake, egg production and egg weight were not affected, while eggshell thickness and eggshell weight increased in soy isoflavone-supplemented quails reared under TN conditions. However, feed intake, egg production, egg weight, eggshell thickness, eggshell weight and Haugh units were positively influenced by soy isoflavone supplementation in HS groups for quail during the late laying period. Bone mineral density, serum OC, vitamin D, Ca, P levels and ALP activity were significantly improved by soy isoflavone supplementation in both the TN and HS groups in quail during the late laying period. 5. Soy isoflavone supplementation of basal diet significantly improved egg quality and bone mineralisation in quail during the late laying period.

  12. Carbonate-silicate melt immiscibility, REE mineralising fluids, and the evolution of the Lofdal Intrusive Suite, Namibia

    NASA Astrophysics Data System (ADS)

    Bodeving, Sarah; Williams-Jones, Anthony E.; Swinden, Scott

    2017-01-01

    The Lofdal Intrusive Suite, Namibia, consists of calcio-carbonatite and silica-undersaturated alkaline intrusive rocks ranging in composition from phono-tephrite to phonolite (and nepheline syenite). The most primitive of these rocks is the phono-tephrite, which, on the basis of its Y/Ho and Nb/Ta ratios, is interpreted to have formed by partial melting of the mantle. Roughly linear trends in major and trace element contents from phono-tephrite to phonolite and nepheline syenite indicate that the latter two rock types evolved from the phono-tephrite by fractional crystallisation. The nepheline syenite, however, has a lower rare earth element (REE) content than the phonolite. The carbonatite has a primitive mantle-normalised REE profile roughly parallel to that of the silica-undersaturated alkaline igneous rocks, although the absolute REE concentrations are higher. Like the phono-tephrite, it also has a mantle Y/Ho ratio. However, the Nb/Ta and Zr/Hf ratios are significantly higher. Moreover, the carbonatite displays strong negative Ta, Zr and Hf anomalies on spidergrams, whereas the silicate rocks display positive anomalies for these elements. Significantly, this behaviour is predicted by the corresponding carbonatite-silicate melt partition coefficients, as is the behaviour of the REE. Based on these observations, we interpret the carbonatite to represent an immiscible liquid that exsolved from the phono-tephrite or possibly the phonolite melt. The result was a calcio-carbonatite that is enriched in the heavy REE (HREE) relative to most other carbonatites. Fluids released from the corresponding magma are interpreted to have been the source of the REE mineralisation that is currently the target of exploration.

  13. Structural, mineralogical and geochemical constraints on the atypical komatiite-hosted Turret deposit in the Agnew-Mt. White district, Western Australia

    NASA Astrophysics Data System (ADS)

    Voute, F.; Thébaud, N.

    2015-08-01

    In the Norseman-Wiluna belt, Yilgarn Craton, the Agnew-Mt. White district is the host of many gold deposits. Located in the hinge of the regional Lawlers anticline, the Turret gold deposit is structurally controlled by the Table Hill shear zone that transects the Agnew Ultramafic unit. Geochemistry, coupled with petrographic data, allowed the delineation of the paragenetic sequence associated with gold mineralisation and include (1) a pervasive talc-carbonate alteration assemblage, (2) a pre-mineralisation stage associated with pervasive arsenopyrite + chalcopyrite + pyrrhotite + pyrite alteration, followed by (3) a late deformation event along a dilatational segment of the main Table Hill shear zone, leading to the formation of a breccia hosting a Cu-Bi-Mo-Au (± Ag ± Zn ± Te ± W) metal assemblage. The presence of Au-Ag-Cu alloys, native bismuth, chalcopyrite and other Bi-Te-S phases in the mineralisation stage suggest that gold may have been scavenged from the hydrothermal fluids by composite Bi-Te-Cu-Au-Ag-S liquids or melts. Using this mineral paragenetic sequence, together with mineralogical re-equilibration textures observed, we show that the gold deposition at Turret occurred over a temperature range approximately between c. 350 and 270 °C. This temperature range, together with the structural control and typical mesothermal alteration pattern including carbonate-chlorite alteration, shows that the Turret deposit shares common characteristics with the orogenic gold deposit class. However, the metal association of Cu, Au, Bi, and Mo, the quartz-poor, and high copper-sulphide content (up to 15 %) are characteristics that depart from the typical orogenic gold deposit mineralogy. Through comparison with similar deposits in the Yilgarn Craton and worldwide, we propose that the Turret deposit represents an example of a porphyry-derived Au-Cu-Bi-Mo deposit.

  14. Characterisation of mineralisation of bone and cartilage: X-ray diffraction and Ca and Sr K α X-ray fluorescence microscopy

    NASA Astrophysics Data System (ADS)

    Bradley, D. A.; Muthuvelu, P.; Ellis, R. E.; Green, E. M.; Attenburrow, D.; Barrett, R.; Arkill, K.; Colridge, D. B.; Winlove, C. P.

    2007-10-01

    Bone is a dynamic structure, constantly remodelling in response to changing mechanical and environmental factors. This is particularly evident in the mineral component encrusting the collagenous framework. The mineral is principally in the form of calcium apatite, but calcium can exchange with strontium, both during the cellular processes of mineralisation and resorption and by passive exchange with the deposited crystals. Mineralisation is generally characterized by densitometry, but because of the differences in absorption cross sections of calcium and strontium it can be misleading in studies of composition. In this work we have used X-ray diffraction to identify calcium and strontium apatite and X-ray fluorescence to quantify strontium and calcium distribution. With the beam characteristics available from synchrotron radiation, this has enabled us to obtain microscopic resolution on thin sections of bone and cartilage from the equine metacarpophalangeal joint. Two issues have been investigated; the first is the distribution of mineral in the bone-cartilage interface and within individual trabeculae. In trabecular bone the ratio of strontium to calcium concentration was typically 0.0035 ± 0.0020, and higher by a factor of ∼3 at the periphery than in the centre of a trabeculum (possibly reflecting the more rapid turnover of mineral in the surface layer). In the dense subchondral bone the ratio was similar, approximately doubling in the calcified cartilage. The second objective was to explore the changes in mineralisation associated with development of osteoarthrosis. We analysed lesions showing cartilage thinning and changes in the trabecular organization and density of the underlying bone. At the centre of the lesion the ratio of strontium to calcium was much lower than that in normal tissue, although the calcified cartilage still showed a higher ratio than the underlying bone. In the superficially normal tissue around the lesion the calcified cartilage

  15. Microcomputed tomographic analysis of human condyles in unilateral condylar hyperplasia: increased cortical porosity and trabecular bone volume fraction with reduced mineralisation.

    PubMed

    Karssemakers, L H E; Nolte, J W; Tuinzing, D B; Langenbach, G E J; Raijmakers, P G; Becking, A G

    2014-12-01

    Unilateral condylar hyperplasia or hyperactivity is a disorder of growth that affects the mandible, and our aim was to visualise the 3-dimensional bony microstructure of resected mandibular condyles of affected patients. We prospectively studied 17 patients with a clinical presentation of progressive mandibular asymmetry and an abnormal single-photon emission computed tomographic (SPECT) scan. All patients were treated by condylectomy to arrest progression. The resected condyles were scanned with micro-CT (18 μm resolution). Rectangular volumes of interest were selected in 4 quadrants (lateromedial and superoinferior) of the trabecular bone of each condyle. Variables of bone architecture (volume fraction, trabecular number, thickness, and separation, degree of mineralisation, and degree of structural anisotrophy) were calculated with routine morphometric software. Eight of the 17 resected condyles showed clear destruction of the subchondral layer of cortical bone. There was a significant superoinferior gradient for all trabecular variables. Mean (SD) bone volume fraction (25.1 (6) %), trabecular number (1.69 (0.26) mm(-1)), trabecular thickness (0.17 (0.03) mm), and degree of mineralisation (695.39 (39.83) mg HA/cm(3)) were higher in the superior region. Trabecular separation (0.6 (0.16) mm) and structural anisotropy (1.84 (0.28)) were higher in the inferior region. The micro-CT analysis showed increased cortical porosity in many of the condyles studied. It also showed a higher bone volume fraction, greater trabecular thickness and trabecular separation, greater trabecular number, and less mineralisation in the condyles of the 17 patients compared with the known architecture of unaffected mandibular condyles.

  16. Effects of dietary DHA and α-tocopherol on bone development, early mineralisation and oxidative stress in Sparus aurata (Linnaeus, 1758) larvae.

    PubMed

    Izquierdo, M S; Scolamacchia, M; Betancor, M; Roo, J; Caballero, M J; Terova, G; Witten, P E

    2013-05-28

    DHA deficiency has been related to skeletal malformations in fish, but high DHA levels have produced controversial results that could relate to the oxidative status of fish tissues in the different reports. In the present study, gilthead seabream (Sparus aurata) larvae were fed deficient, adequate or high DHA levels, or high DHA levels supplemented with the antioxidant α-tocopherol. Larvae fed deficient DHA levels tended to be smaller, and showed the highest incidence of urinary bladder calculi, lordosis and kyphosis and the lowest number of mineralised vertebrae for any given size class. Elevation of dietary DHA increased larval growth and significantly enhanced the expression of the insulin-like growth factor 1 (IGF-1) gene. However, a DHA level increase up to 5 % raised the degree of lipid oxidation in larval tissues and deformities in cranial endochondral bones and in axial skeletal haemal and neural arches. The increase in dietary α-tocopherol supplementation in high-DHA feeds reduced again the occurrence of skeletal deformities. Moreover, the expression of genes coding for specific antioxidants such as catalase, superoxide dismutase or glutathione peroxidase, which neutralised reactive oxygen substances formed by increased dietary DHA, was significantly decreased in larvae fed high α-tocopherol levels. These results denoted the importance of DHA for early bone formation and mineralisation. Low dietary DHA levels delay early mineralisation and increase the risk of cranial and axial skeletal deformities. Excessive DHA levels, without an adequate balance of antioxidant nutrients, increase the production of free radicals damaging cartilaginous structures before bone formation.

  17. The utilisation of magnetic susceptibility as a vector toward mineralisation in common rock and ore forming minerals.

    NASA Astrophysics Data System (ADS)

    English, Matthew; Raub, Tim

    2015-04-01

    Aeromagnetic and ground magnetic surveys of mineral deposits and prospective terrain are a fundamental technique used in mining and economic geology. Inversion of survey data to source parameters (i.e., identification of ore zones) is often simplified by assuming a single, canonical or 'average' value for the magnetic susceptibility of each mappable unit. In some mineral deposits, canonical magnetic susceptibility values for several dominant ore and accessory minerals will be used to calculate mineral concentrations, 3-D distributions, etc. In general, magnetic susceptibility is widely recognised by economic geologists as a fundamental, easily-measured tool used to better understand the prospectivity of ore deposits. Despite this, the quantitative application of magnetic susceptibility, in context of detailed ore petrology, is still a developing field yet one with great potential. In order to assess to what extent, and in which systems, magnetic susceptibility is a vector toward mineralisation, we present aspects of an extensive database of single crystal and ore mineral aggregate samples. This reveals trends and magnitudes for several important rock-forming and ore-associated minerals during alteration, paragenesis, and enrichment. For example, current literature canonical values show that the magnetic susceptibility for pure quartz is strongly diamagnetic but ranges between -1.78x10-5 and -1.00x10-5 (k, vol. SI). However, metamorphic bull quartz and chrysoprase are commonly paramagnetic, with common values for chrysoprase as high as 2.11x10-3. In contrast, measurements from rose quartz samples are lower than those described for pure quartz with modal measurements as low as -2.08x10-5. Measurements for rock crystal quartz form a distribution best described by the canonical diamagnetic value of -1.40x10-5. Modelling should take into account that rock crystal quartz is rarely the best petrological analogue at deposit-scale or in a quartzose terrain. The difference

  18. Chalcogenide centred gold complexes.

    PubMed

    Gimeno, M Concepción; Laguna, Antonio

    2008-09-01

    Chalcogenide-centred gold complexes are an important class of compounds in which a central chalcogen is surrounded by several gold atoms or gold and other metals. They have special characteristics such as unusual geometries, electron deficiency and properties such as luminescence or non-linear optical properties. The best known species are the trinuclear [E(AuPR3)3]+, 'oxonium' type species, that have high synthetic applicability, not only in other chalcogen-centred species, but in many other organometallic derivatives. The aurophilic interactions play an important role in the stability, preference for a particular geometry and luminescence properties in this type of derivatives (critical review, 117 references).

  19. Application of airborne LiDAR to the detailed geological mapping of mineralised terrain: the Troodos ophiolite, Cyprus

    NASA Astrophysics Data System (ADS)

    Grebby, S.; Cunningham, D.; Naden, J.; Tansey, K.

    2009-04-01

    forest cover. To examine the efficacy of LiDAR in mineral exploration, an airborne survey was flown over approximately 375 km2 of the Troodos ophiolite, Cyprus—a region noted for its volcanogenic massive sulphide (VMS)-style mineralisation. Although most commonly found at the Lower Pillow Lava-Upper Pillow Lava interface, sulphide mineralisation occurs throughout the pillow lava sequence. Therefore, accurate identification of geological contacts is a key parameter for VMS exploration in the Troodos complex. However, the existing geological maps, produced using a combination of conventional field mapping and aerial photograph interpretation, have significant differences and do not adequately represent the geological complexity in high detail. In this study, we present a semi-automated algorithm for the detailed lithological mapping of a 16 km2 study area using high-resolution (4 m) airborne LiDAR topographic data in which non-ground features such as trees and buildings have been removed (i.e., bare-earth). Differences in the geomorphological characteristics of each major lithological unit result in each unit having a distinctive topographic signature in the bare-earth LiDAR DEM. Thematic maps (slope, curvature and surface roughness) are derived from the LiDAR DEM in order to quantify the topographic signatures associated with each lithological unit. With the thematic maps as the input layers, Kohonen's Self-Organising Map is used as a supervised artificial neural network to assign each pixel to a lithology to produce a geological map. The algorithm successfully identifies the major lithological units—Basal Group (> 50 % dykes and < 50 % pillow lavas), pillow lavas, alluvium and Lefkara Formation (chalks and marls)—in excellent detail and highlights geological features to a 20 m resolution. Although the ability to distinguish between lithologies in some areas is affected by anthropogenic activity (e.g., farming), the resultant lithological map easily surpasses the

  20. Timing of porphyry (Cu-Mo) and base metal (Zn-Pb-Ag-Cu) mineralisation in a magmatic-hydrothermal system—Morococha district, Peru

    NASA Astrophysics Data System (ADS)

    Catchpole, Honza; Kouzmanov, Kalin; Bendezú, Aldo; Ovtcharova, Maria; Spikings, Richard; Stein, Holly; Fontboté, Lluís

    2015-12-01

    The Morococha district in central Peru is characterised by economically important Cordilleran polymetallic (Zn-Pb-Ag-Cu) vein and replacement bodies and the large Toromocho porphyry Cu-Mo deposit in its centre. U-Pb, Re-Os, and 40Ar/39Ar geochronology data for various porphyry-related hydrothermal mineralisation styles record a 3.5-Ma multi-stage history of magmatic-hydrothermal activity in the district. In the late Miocene, three individual magmatic-hydrothermal centres were active: the Codiciada, Toromocho, and Ticlio centres, each separated in time and space. The Codiciada centre is the oldest magmatic-hydrothermal system in the district and consists of a composite porphyry stock associated with anhydrous skarn and quartz-molybdenite veins. The hydrothermal events are recorded by a titanite U-Pb age at 9.3 ± 0.2 Ma and a molybdenite Re-Os age at 9.26 ± 0.03 Ma. These ages are indistinguishable from zircon U-Pb ages for porphyry intrusions of the composite stock and indicate a time span of 0.2 Ma for magmatic-hydrothermal activity. The small Ticlio magmatic-hydrothermal centre in the west of the district has a maximum duration of 0.3 Ma, ranging from porphyry emplacement to porphyry mineralisation at 8.04 ± 0.14 Ma (40Ar/39Ar muscovite cooling age). The Toromocho magmatic-hydrothermal centre has a minimum of five recorded porphyry intrusions that span a total of 1.3 Ma and is responsible for the formation of the giant Toromocho Cu-Mo deposit. At least two hydrothermal pulses are identified. Post-dating a first pulse of molybdenite mineralisation, wide-spread hydrous skarn covers an area of over 6 km2 and is recorded by five 40Ar/39Ar cooling ages at 7.2-6.8 Ma. These ages mark the end of the slowly cooling and long-lived Toromocho magmatic-hydrothermal centre soon after last magmatic activity at 7.26 ± 0.02 Ma. District-wide (50 km2) Cordilleran base metal vein and replacement bodies post-date the youngest recorded porphyry mineralisation event at Toromocho

  1. Fluid inclusion gas chemistry as a potential minerals exploration tool: Case studies from Creede, CO, Jerritt Canyon, NV, Coeur d'Alene district, ID and MT, southern Alaska mesothermal veins, and mid-continent MVT's

    USGS Publications Warehouse

    Landis, G.P.; Hofstra, A.H.

    1991-01-01

    Recent advances in instrumentation now permit quantitative analysis of gas species from individual fluid inclusions. Fluid inclusion gas data can be applied to minerals exploration empirically to establish chemical (gas composition) signatures of the ore fluids, and conceptually through the development of genetic models of ore formation from a framework of integrated geologic, geochemical, and isotopic investigations. Case studies of fluid inclusion gas chemistry from ore deposits representing a spectrum of ore-forming processes and environments are presented to illustrate both the empirical and conceptual approaches. We consider epithermal silver-gold deposits of Creede, Colorado, Carlin-type sediment-hosted disseminated gold deposits of Jerritt Canyon, Nevada, metamorphic silver-base-metal veins of the Coeur d'Alene district, Idaho and Montana, gold-quartz veins in accreted terranes of southern Alaska, and the mid-continent base-metal sulfide deposits of Mississippi Valley-Type (MVT's). Variations in gas chemistry determine the redox state of the ore fluids, provide compositional input for gas geothermometers, characterize ore fluid chemistry (e.g., CH4CO2, H2SSO2, CO2/H2S, organic-rich fluids, gas-rich and gas-poor fluids), identify magmatic, meteoric, metamorphic, shallow and deep basin fluids in ore systems, locate upwelling plumes of magmatic-derived volatiles, zones of boiling and volatile separation, interfaces between contrasting fluids, and important zones of fluid mixing. Present techniques are immediately applicable to exploration programsas empirical studies that monitor fluid inclusion gas threshold concentration levels, presence or absence of certain gases, or changes in gas ratios. We suggest that the greater contribution of fluid inclusion gas analysis is in the integrated and comprehensive chemical dimension that gas data impart to genetic models, and in the exploration concepts based on processes and environments of ore formation derived from

  2. Gold nanoprobes for theranostics

    PubMed Central

    Panchapakesan, Balaji; Book-Newell, Brittany; Sethu, Palaniappan; Rao, Madhusudhana; Irudayaraj, Joseph

    2011-01-01

    Gold nanoprobes have become attractive diagnostic and therapeutic agents in medicine and life sciences research owing to their reproducible synthesis with atomic level precision, unique physical and chemical properties, versatility of their morphologies, flexibility in functionalization, ease of targeting, efficiency in drug delivery and opportunities for multimodal therapy. This review highlights some of the recent advances and the potential for gold nanoprobes in theranostics. PMID:22122586

  3. Gold-bearing skarns

    USGS Publications Warehouse

    Theodore, Ted G.; Orris, Greta J.; Hammerstrom, Jane M.; Bliss, James D.

    1991-01-01

    In recent years, a significant proportion of the mining industry's interest has been centered on discovery of gold deposits; this includes discovery of additional deposits where gold occurs in skarn, such as at Fortitude, Nevada, and at Red Dome, Australia. Under the classification of Au-bearing skarns, we have modeled these and similar gold-rich deposits that have a gold grade of at least 1 g/t and exhibit distinctive skarn mineralogy. Two subtypes, Au-skarns and byproduct Au-skarns, can be recognized on the basis of gold, silver, and base-metal grades, although many other geological factors apparently are still undistinguishable largely because of a lack of detailed studies of the Au-skarns. Median grades and tonnage for 40 Au-skarn deposits are 8.6 g/t Au, 5.0 g/t Ag, and 213,000 t. Median grades and tonnage for 50 byproduct and Au-skarn deposits are 3.7 g/t Au, 37 g/t Ag, and 330,000 t. Gold-bearing skarns are generally calcic exoskarns associated with intense retrograde hydrosilicate alteration. These skarns may contain economic amounts of numerous other commodities (Cu, Fe, Pb, Zn, As, Bi, W, Sb, Co, Cd, and S) as well as gold and silver. Most Au-bearing skarns are found in Paleozoic and Cenozoic orogenic-belt and island-arc settings and are associated with felsic to intermediate intrusive rocks of Paleozoic to Tertiary age. Native gold, electru, pyrite, pyrrhotite, chalcopyrite, arsenopyrite, sphalerite, galena, bismuth minerals, and magnetite or hematite are the most common opaque minerals. Gangue minerals typically include garnet (andradite-grossular), pyroxene (diopside-hedenbergite), wollastonite, chlorite, epidote, quartz, actinolite-tremolite, and (or) calcite.

  4. Possible genetic link between I-type granite and orogenic gold deposits in Egypt (metamorphic-magmatic interaction?)

    NASA Astrophysics Data System (ADS)

    Abd El Monsef, Mohamed

    2015-04-01

    The orogenic gold deposits are a distinctive type of deposits that revealed unique temporal and spatial association with an orogeny. Where, the system of gold veins and related ore minerals was confined to hydrothermal solutions formed during compressional to transpressional deformation processes at convergent plate margins in accretionary and collisional orogens, with the respect to ongoing deep-crustal, subduction-related thermal processes. In Egypt, most of vein-type and dyke-type gold mineralization are restricted to granitic rocks or at least near of granitic intrusion that seems to have had an important influence on gold mineralization. Shear zone-related, mesothermal gold deposits of Fatira and Gidami mines in the northern Eastern Desert of Egypt are found within granitic bodies or at the contact between granites and metavolcanic rocks. The hosting-granitic rocks in Fatira and Gidami areas are mainly of granodioritic composition (I-Type granite) which is related to calc-alkaline magmatic series. However, Fatira granitoids were developed within island arc tectonic settings related to mature island arc system (Late-orogenic stage), at relatively low temperature (around 660° C) and medium pressure between (5 - 10 Kbar). On the other hand, Gidami granitoids were developed during the collision stage in continental arc regime related to active continental margin (Syn-orogeny), which were crystallized at relatively high temperature (700-720° C) and low pressure (around 0.1 Kbar). The ore mineralogy includes pyrite, chalcopyrite, sphalerite, covellite, ilmenite, goethite ± pyrrhotite ± pentlandite ± galena ± molybdenite. Native gold is detected only in Gidami mineralization as small inclusions within pyrite and goethite or as tiny grains scattered within quartz vein (in close proximity to the sulfides). In Fatira deposits, it is detected only by microprobe analysis within the crystal lattice of pyrite and jarosite. Fluid inclusions study for the mineralized

  5. Getting the Gold Treatment

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Epner Technology, Inc., worked with Goddard Space Center to apply gold coating to the Vegetation Canopy Lidar (VCL) mirror. This partnership resulted in new commercial applications for Epner's LaserGold(R) process in the automotive industry. Previously, the company did not have equipment large enough to handle the plating of the stainless steel panels cost effectively. Seeing a chance to renew this effort, Epner Technology and Goddard entered into an agreement by which NASA would fund the facility needed to do the gold-plating, and Epner Technology would cover all other costs as part of their internal research and development. The VCL mirror project proceeded successfully, fulfilling Goddard's needs and leaving Epner Technology with a new facility to provide LaserGold for the automotive industry. The new capability means increased power savings and improvements in both quality and production time for BMW Manufacturing Corporation of Spartanburg, South Carolina, and Cadillac of Detroit, Michigan, as well as other manufacturers who have implemented Epner Technology's LaserGold process. LaserGold(R) is a registered trademark of Epner Technology, Inc.

  6. Gold in minerals and the composition of native gold

    USGS Publications Warehouse

    Jones, Robert Sprague; Fleischer, Michael

    1969-01-01

    Gold occurs in nature mainly as the metal and as various alloys. It forms complete series of solid solutions with silver, copper, nickel, palladium, and platinum. In association with the platinum metals, gold occurs as free gold as well as in solid solution. The native elements contain the most gold, followed by the sulfide minerals. Several gold tellurides are known, but no gold selenides have been reported, and only one sulfide, the telluride-sulfide mineral nagyagite, is known. The nonmetallic minerals carry the least gold, and the light-colored minerals generally contain less gold than the dark minerals. Some conclusions in the literature are conflicting in regard to the relation of fineness of native gold to its position laterally and vertically within a lode, the nature of the country rocks, and the location and size of nuggets in a streambed, as well as to the variation of fineness within an individual nugget.

  7. A comparative study of ordinary and mineralised Portland cement clinker from two different production units Part I: Composition and hydration of the clinkers

    SciTech Connect

    Emanuelson, Anna; Hansen, Staffan; Viggh, Erik

    2003-10-01

    Portland cement clinkers from two production units were investigated; Plant 1: ordinary clinker (P1) and clinker mineralised with CaF{sub 2}+CaSO{sub 4} (P1m); Plant 2: ordinary clinker (P2) and two clinkers mineralised with CaF{sub 2}+CaSO{sub 4} (P2m, low SO{sub 3} and P2m', high SO{sub 3}). The chemical composition of the clinkers was determined by X-ray fluorescence, ICP analysis, titration (free lime) and ion selective electrode measurements (F). Observed clinker parameters (LSF, SR, AR, R, wt.% MgO, F, SO{sub 3}, free lime): P1 (0.96, 2.72, 1.27, 1.04, 0.78, 0.06, 0.64, 0.71); P1m (1.03, 2.21, 1.58, 2.18, 0.87, 0.23, 1.95, 0.69); P2 (1.00, 2.66, 1.72, 0.75, 4.06, 0.20, 1.38, 1.51); P2m (1.01, 2.91, 1.96, 0.90, 3.21, 0.39, 1.72, 2.06); P2m' (0.97, 2.70, 1.84, 1.15, 3.86, 0.42, 2.48, 0.89). The qualitative and quantitative phase compositions were characterised using X-ray powder diffraction, backscattered electron imaging, X-ray microanalysis and elemental mapping, plus optical reflection microscopy. Phases observed in all clinkers were: alite, {beta}-belite, cubic aluminate, ferrite and free lime. Additional phases observed were: aphthitalite (P1, P2, P2m, P2m'), calcium langbeinite (P1m) and periclase (P2, P2m, P2m'). The clinker composition and texture differ more between the two plants, than between ordinary and mineralised clinker from the same production unit. Laboratory cements were prepared by mixing ground clinker with CaSO{sub 4}{center_dot}2H{sub 2}O. The cements were hydrated in an isothermal calorimeter at 20 deg. C (water/cement weight ratio=0.5) during 33 h. After 12 h, the laboratory cement based on P1m reached a higher level of reaction than the one based on P1. The P2m and P2m' laboratory cements had a slower reaction than the P2 cement.

  8. Simulation of substrate erosion and sulphate assimilation by Martian low-viscosity lava flows: implications for the genesis of precious metal-rich sulphide mineralisation on Mars

    NASA Astrophysics Data System (ADS)

    Baumgartner, Raphael; Baratoux, David; Gaillard, Fabrice; Fiorentini, Marco

    2016-04-01

    On Earth, high temperature mafic to ultramafic lava flows, such as komatiites and ferropicrites of the Archean and Proterozic eons, can be hosts to Ni-Cu-PGE sulphide mineralisation. Mechanical/thermo-mechanical erosion and assimilation of sulphur-rich crustal rocks is ascribed as the principal mechanism that leads to sulphide supersaturation, batch segregation and subsequent accumulation of metal-enriched magmatic sulphides (e.g., Bekker et al., Science, 2009). In order to investigate the likelihood of the occurrence of similar sulphide mineralisation in extraterrestrial magmatic systems, we numerically modelled erosion and assimilation during the turbulent emplacement of Martian lavas, some of which display chemical and rheological analogies with terrestrial komatiites and ferropicrites, on a variety of consolidated sedimentary sulphate-rich substrates. The modelling approach relies on the integration of i) mathematical lava erosion models for turbulent flows (Williams et al., J. Geophys. Res., 1998), ii) thermodynamic volatile degassing models (Gaillard et al., Space Sci. Rev., 2013), and iii) formulations on the stability of sulphides (Fortin et al., Geochim. Cosmochim. Acta, 2015). A series of scenarios are examined in which various Martian mafic to ultramafic mantle-derived melts emplace over, and assimilate consolidated sulphate-rich substrates, such as the sedimentary lithologies (i.e., conglomerates, sandstones and mudstones) recently discovered at the Gale Crater landing site. Our modellings show that lavas emplacing over consolidated sedimentary substrate rather than stiff basaltic crust, are governed by relatively high cooling and substrate erosion rates. The rapid assimilation of sulphate, which serves as a strongly oxidising agent, could result in dramatic sulphur loss due to increased volatile degassing rates at fO2 ≳QFM-1. This effect is further enhanced with increased temperature. Nevertheless, sulphide supersaturation in the way of sulphate

  9. Mineralisation of amethyst-bearing geodes in Ametista do Sul (Brazil) from low-temperature sedimentary brines: evidence from monophase liquid inclusions and stable isotopes

    NASA Astrophysics Data System (ADS)

    Gilg, H. Albert; Krüger, Yves; Taubald, Heinrich; van den Kerkhof, Alfons M.; Frenz, Martin; Morteani, Giulio

    2014-10-01

    Fluid inclusion studies in combination with hydrogen, oxygen and sulphur isotope data provide novel insights into the genesis of giant amethyst-bearing geodes in Early Cretaceous Paraná continental flood basalts at Amestita do Sul, Brazil. Monophase liquid inclusions in colourless quartz, amethyst, calcite, barite and gypsum were analysed by microthermometry after stimulating bubble nucleation using single femtosecond laser pulses. The salinity of the fluid inclusions was determined from ice-melting temperatures and a combination of prograde and retrograde homogenisation temperatures via the density maximum of the aqueous solutions. Four mineralisation stages are distinguished. In stage I, celadonite, chalcedony and pyrite formed under reducing conditions in a thermally stable environment. Low δ34SV-CDT values of pyrite (-25 to -32 ‰) suggest biogenic sulphate reduction by organotrophic bacteria. During the subsequent stages II (amethyst, goethite and anhydrite), III (early subhedral calcite) and IV (barite, late subhedral calcite and gypsum), the oxidation state of the fluid changed towards more oxidising conditions and microbial sulphate reduction ceased. Three distinct modes of fluid salinities around 5.3, 3.4 and 0.3 wt% NaCl-equivalent characterise the mineralisation stages II, III and IV, respectively. The salinity of the stage I fluid is unknown due to lack of fluid inclusions. Variation in homogenisation temperatures and in δ18O values of amethyst show evidence of repeated pulses of ascending hydrothermal fluids of up to 80-90 °C infiltrating a basaltic host rock of less than 45 °C. Colourless quartz and amethyst formed at temperatures between 40 and 80 °C, while the different calcite generations and late gypsum precipitated at temperatures below 45 °C. Calculated oxygen isotope composition of the amethyst-precipitating fluid in combination with δD values of amethyst-hosted fluid inclusions (-59 to -51 ‰) show a significant 18O-shift from the

  10. Influence of the mechanical environment on the engineering of mineralised tissues using human dental pulp stem cells and silk fibroin scaffolds.

    PubMed

    Woloszyk, Anna; Holsten Dircksen, Sabrina; Bostanci, Nagihan; Müller, Ralph; Hofmann, Sandra; Mitsiadis, Thimios A

    2014-01-01

    Teeth constitute a promising source of stem cells that can be used for tissue engineering and regenerative medicine purposes. Bone loss in the craniofacial complex due to pathological conditions and severe injuries could be treated with new materials combined with human dental pulp stem cells (hDPSCs) that have the same embryonic origin as craniofacial bones. Optimising combinations of scaffolds, cells, growth factors and culture conditions still remains a great challenge. In the present study, we evaluate the mineralisation potential of hDPSCs seeded on porous silk fibroin scaffolds in a mechanically dynamic environment provided by spinner flask bioreactors. Cell-seeded scaffolds were cultured in either standard or osteogenic media in both static and dynamic conditions for 47 days. Histological analysis and micro-computed tomography of the samples showed low levels of mineralisation when samples were cultured in static conditions (0.16±0.1 BV/TV%), while their culture in a dynamic environment with osteogenic medium and weekly µCT scans (4.9±1.6 BV/TV%) significantly increased the formation of homogeneously mineralised structures, which was also confirmed by the elevated calcium levels (4.5±1.0 vs. 8.8±1.7 mg/mL). Molecular analysis of the samples showed that the expression of tooth correlated genes such as Dentin Sialophosphoprotein and Nestin were downregulated by a factor of 6.7 and 7.4, respectively, in hDPSCs when cultured in presence of osteogenic medium. This finding indicates that hDPSCs are able to adopt a non-dental identity by changing the culture conditions only. Also an increased expression of Osteocalcin (1.4x) and Collagen type I (1.7x) was found after culture under mechanically dynamic conditions in control medium. In conclusion, the combination of hDPSCs and silk scaffolds cultured under mechanical loading in spinner flask bioreactors could offer a novel and promising approach for bone tissue engineering where appropriate and rapid bone

  11. Influence of the Mechanical Environment on the Engineering of Mineralised Tissues Using Human Dental Pulp Stem Cells and Silk Fibroin Scaffolds

    PubMed Central

    Woloszyk, Anna; Holsten Dircksen, Sabrina; Bostanci, Nagihan; Müller, Ralph; Hofmann, Sandra; Mitsiadis, Thimios A.

    2014-01-01

    Teeth constitute a promising source of stem cells that can be used for tissue engineering and regenerative medicine purposes. Bone loss in the craniofacial complex due to pathological conditions and severe injuries could be treated with new materials combined with human dental pulp stem cells (hDPSCs) that have the same embryonic origin as craniofacial bones. Optimising combinations of scaffolds, cells, growth factors and culture conditions still remains a great challenge. In the present study, we evaluate the mineralisation potential of hDPSCs seeded on porous silk fibroin scaffolds in a mechanically dynamic environment provided by spinner flask bioreactors. Cell-seeded scaffolds were cultured in either standard or osteogenic media in both static and dynamic conditions for 47 days. Histological analysis and micro-computed tomography of the samples showed low levels of mineralisation when samples were cultured in static conditions (0.16±0.1 BV/TV%), while their culture in a dynamic environment with osteogenic medium and weekly µCT scans (4.9±1.6 BV/TV%) significantly increased the formation of homogeneously mineralised structures, which was also confirmed by the elevated calcium levels (4.5±1.0 vs. 8.8±1.7 mg/mL). Molecular analysis of the samples showed that the expression of tooth correlated genes such as Dentin Sialophosphoprotein and Nestin were downregulated by a factor of 6.7 and 7.4, respectively, in hDPSCs when cultured in presence of osteogenic medium. This finding indicates that hDPSCs are able to adopt a non-dental identity by changing the culture conditions only. Also an increased expression of Osteocalcin (1.4x) and Collagen type I (1.7x) was found after culture under mechanically dynamic conditions in control medium. In conclusion, the combination of hDPSCs and silk scaffolds cultured under mechanical loading in spinner flask bioreactors could offer a novel and promising approach for bone tissue engineering where appropriate and rapid bone

  12. Gravity worms in the prospecting of epigenetic gold deposits: Example from the Northern Fennoscandian Shield

    NASA Astrophysics Data System (ADS)

    Lahti, Ilkka; Nykänen, Vesa; Niiranen, Tero

    2010-05-01

    ) or partly (Kiistala shear zone) whereas the presence of some major shear zones is indicated by truncation of worms at the location of the shear zone (Hanhimaa and Muusa shear zone). The important part of our work is the evaluation of the spatial correlation of gravity worms and known gold deposits using the weights-of-evidence calculation procedure. Our results show that presence of gravity worms are indicative of the structures controlling most epigenetic gold deposits in the CLGB area. Therefore, worming-technique proved to be an excellent tool in mapping of structures being prospective for epigenetic gold deposits in the study area and therefore likely in other areas of similar geology. References: Eilu, P., Pankka, H., Keinänen, V., Kortelainen, V., Niiranen, T., Pulkkinen, E., 2007. Characteristics of gold mineralisation in the greenstone belts of northern Finland. In: Gold in the Central Lapland Greenstone Belt. Geological Survey of Finland. Special Paper 44. Espoo: Geological Survey of Finland, 57-106. Hornby, P., Boschetti, F. & Horowitz, F., 1999. Analysis of potential field data in the wavelet domain. Geophysical Journal International, 137, 175 - 196.

  13. In vivo liberation of gold ions from gold implants. Autometallographic tracing of gold in cells adjacent to metallic gold.

    PubMed

    Danscher, Gorm

    2002-05-01

    For some years, the implantation of small pieces of gold has been used as an unauthorised remedy for osteoarthritis and pain. The aim of the present study was to evaluate whether gold ions are released from gold implants. Pieces of pure gold were placed in the connective tissue of skin, bone and brains of anaesthetised animals. Ten days to several months later the animals were anaesthetised and killed by transcardial perfusion. Tissue blocks containing the gold pieces were cut, and the sections were silver-enhanced by autometallography. It was found that gold ions are released from the implanted gold and diffuse out into the surrounding tissue. The gold-containing cells in connective tissues were macrophages, mast cells and fibroblasts. In the brain, gold accumulated in astrocytes and neurons. Proton-induced X-ray emission spectroscopy analysis of the tissue surrounding gold implants confirmed that gold ions are liberated. The findings suggest that the gold implant technique, on a local scale, mimics systemic treatment with a gold-containing drug.

  14. Effect of crude protein and phosphorus level on growth performance, bone mineralisation and phosphorus, calcium and nitrogen utilisation in grower-finisher pigs.

    PubMed

    Varley, Patrick F; Flynn, Bernie; Callan, James J; O'Doherty, John V

    2011-04-01

    Two experiments in a 2 x 2 factorial arrangement were conducted to evaluate the effect of crude protein (CP) (130 vs. 200 g/kg) and phosphorus (P) (4.0 vs. 6.0 g total P/kg) level in a phytase supplemented diet (500 FTU [phytase units]/kg) in grower-finisher pigs. Owing to the design of the experiment, as dietary P level increased, there was also an increase in dietary calcium (Ca) level in order to maintain a dietary Ca to P ratio of 1.6:1. In Experiment 1, four diets were fed to 56 pigs (n = 14, initial body weight [BW] 36.7 +/- 4.2 kg) to investigate the interaction between CP and P on growth performance, bone mineralisation and digesta pH. Experiment 2 consisted of 16 entire male pigs (n = 4; offered identical diets to that offered in Experiment 1) for the determination of total tract apparent digestibility and nitrogen (N), P and Ca utilisation. There was an interaction between CP and P level on bone ash, bone P and bone Ca concentrations (p < 0.05). Pigs offered low CP-low P diets had a higher bone ash, P and Ca concentrations than pigs offered high CP-low P diets. However, there was no effect of CP level at high P levels on bone ash, P and Ca concentrations. Pigs offered low P diets had a lower ileal pH compared with pigs offered high P diets (p < 0.05). In conclusion, offering pigs a high CP-low P, phytase-supplemented diet resulted in a decrease in bone mineralisation.

  15. Adhesion to sand and ability to mineralise low pesticide concentrations are required for efficient bioaugmentation of flow-through sand filters.

    PubMed

    Samuelsen, Elin Djurhuus; Badawi, Nora; Nybroe, Ole; Sørensen, Sebastian R; Aamand, Jens

    2017-01-01

    Pesticide-polluted drinking water may be remediated by inoculating waterworks sand filters with specific degrading bacteria. However, degradation efficiency is often hampered by the poor adhesion behaviour of the introduced bacteria. The phenoxy acid herbicide 4-chloro-2-methyl-phenoxy-acetic acid (MCPA) is a widespread groundwater contaminant. The aim of this study was to investigate whether specific surface characteristics of MCPA-degrading bacteria could be linked to their degrading capabilities in sand filters. Four MCPA degraders with different taxonomic affiliations and original habitats (Sphingomonas sp. PM2, Sphingomonas sp. ERG5, Burkholderia sp. TFD34, Cupriavidus sp. TFD38) were characterised with regard to their motility, cell surface hydrophobicity, biofilm formation, adhesion behaviour and ability to mineralise MCPA. Strains PM2 and ERG5 were non-motile and hydrophobic, whilst strains TFD34 and TFD38 were motile and less hydrophobic. All the strains except ERG5 showed low biofilm formation on polystyrene, although it was significantly higher on glass. PM2 was the most efficient MCPA degrader as it displayed no lag phase and reached >50 % mineralisation at all concentrations (0.0016-25 mg L(-1)). PM2 adhered significantly better to sand than the other strains. No link was found between motility, biofilm formation and the ability to adhere to sand. PM2 completely removed MCPA for 14 days when inoculated in sand columns with a constant inlet of 1 mg L(-1) MCPA. These results demonstrate that besides the ability to degrade the contaminant, surface hydrophobicity and adherence abilities are significant parameters controlling sustained degradation in flow-through sand columns and must be considered when selecting bacteria for bioaugmentation.

  16. Biorecovery of gold

    USGS Publications Warehouse

    Eisler, R.

    2003-01-01

    Recovery of ionic and metallic gold (Au) from a wide variety of solutions by selected species of bacteria, yeasts, fungi, algae, and higher plants is documented. Gold accumulations were up to 7.0 g/kg dry weight (DW) in various species of bacteria, 25.0 g/kg DW in freshwater algae, 84.0 g/kg DW in peat, and 100.0 g/kg DW in dried fungus mixed with keratinous material. Mechanisms of accumulation include oxidation, dissolution, reduction, leaching, and sorption. Uptake patterns are significantly modified by the physicochemical milieu. Crab exoskeletons accumulate up to 4.9 g Au/kg DW; however, gold accumulations in various tissues of living teleosts, decapod crustaceans, and bivalve molluscs are negligible.

  17. Gold-bismuth clusters.

    PubMed

    Martínez, Ana

    2014-08-07

    Metal clusters have interesting characteristics, such as the relationship between properties and size of the cluster. This is not always apparent, so theoretical studies can provide relevant information. In this report, optimized structures and electron donor-acceptor properties of AunBim clusters are reported (n + m = 2-7, 20). Density functional theory calculations were performed to obtain optimized structures. The ground states of gold clusters formed with up to seven atoms are planar. The presence of Bi modifies the structure, and the clusters become 3-D. Several optimized geometries have at least one Bi atom bonded to gold or bismuth atoms and form structures similar to NH3. This fragment is also present in clusters with 20 atoms, where the formation of Au3Bi stabilizes the structures. Bismuth clusters are better electron donors and worse electron acceptors than gold clusters. Mixed clusters fall in between these two extremes. The presence of Bi atoms in gold clusters modifies the electron donor-acceptor properties of the clusters, but there is no correlation between the number of Bi atoms present in the cluster and the capacity for donating electrons. The effect of planarity in Au19Bi clusters is the same as that in Au20 clusters. The properties of pure gold clusters are certainly interesting, but clusters formed by Bi and Au are more important because the introduction of different atoms modifies the geometry, the stability, and consequently the physical and chemical properties. Apparently, the presence of Bi may increase the reactivity of gold clusters, but further studies are necessary to corroborate this hypothesis.

  18. Chemistry for oncotheranostic gold nanoparticles.

    PubMed

    Trouiller, Anne Juliette; Hebié, Seydou; El Bahhaj, Fatima; Napporn, Teko W; Bertrand, Philippe

    2015-06-24

    This review presents in a comprehensive ways the chemical methods used to functionalize gold nanoparticles with focus on anti-cancer applications. The review covers the parameters required for the synthesis gold nanoparticles with defined shapes and sizes, method for targeted delivery in tumours, and selected examples of anti-cancers compounds delivered with gold nanoparticles. A short survey of bioassays for oncology based on gold nanoparticles is also presented.

  19. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, James F.; Furuya, Frederic R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab').sub.2 fragments thereof are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy.

  20. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.; Furuya, F.R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab')[sub 2] fragments are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy. 7 figs.

  1. Earth's continental crustal gold endowment

    NASA Astrophysics Data System (ADS)

    Frimmel, H. E.

    2008-03-01

    The analysis of the temporal distribution of gold deposits, combined with gold production data as well as reserve and resource estimates for different genetic types of gold deposit, revealed that the bulk of the gold known to be concentrated in ore bodies was added to the continental crust during a giant Mesoarchaean gold event at a time (3 Ga) when the mantle temperature reached a maximum and the dominant style of tectonic movement changed from vertical, plume-related to subhorizontal plate tectonic. A magmatic derivation of the first generation of crustal gold from a relatively hot mantle that was characterized by a high degree of partial melting is inferred from the gold chemistry, specifically high Os contents. While a large proportion of that gold is still present in only marginally modified palaeoplacer deposits of the Mesoarchaean Witwatersrand Basin in South Africa, accounting for about 40% of all known gold, the remainder has been recycled repeatedly on a lithospheric scale, predominantly by plate-tectonically induced magmatic and hydrothermal fluid circulation, to produce the current variety of gold deposit types. Post-Archaean juvenile gold addition to the continental crust has been limited, but a mantle contribution to some of the largest orogenic or intrusion-related gold deposits is indicated, notably for the Late Palaeozoic Tien Shan gold province. Magmatic fluids in active plate margins seem to be the most effective transport medium for gold mobilization, giving rise to a large proportion of volcanic-arc related gold deposits. Due to their generally shallow crustal level of formation, they have a low preservation potential. In contrast, those gold deposits that form at greater depth are more widespread also in older rocks. This explains the high proportion of orogenic (including intrusion-related) gold (32%) amongst all known gold deposits. The overall proportion of gold concentrated in known ore bodies is only 7 × 10- 7 of the estimated total

  2. Gold and gold working in Late Bronze Age Northern Greece.

    PubMed

    Vavelidis, M; Andreou, S

    2008-04-01

    Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium B.C: . Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.

  3. GOLD PRESSURE VESSEL SEAL

    DOEpatents

    Smith, A.E.

    1963-11-26

    An improved seal between the piston and die member of a piston-cylinder type pressure vessel is presented. A layer of gold, of sufficient thickness to provide an interference fit between the piston and die member, is plated on the contacting surface of at least one of the members. (AEC)

  4. Digging for Gold

    ERIC Educational Resources Information Center

    Waters, John K.

    2012-01-01

    In the case of higher education, the hills are more like mountains of data that "we're accumulating at a ferocious rate," according to Gerry McCartney, CIO of Purdue University (Indiana). "Every higher education institution has this data, but it just sits there like gold in the ground," complains McCartney. Big Data and the new tools people are…

  5. 'Cascade Gold' raspberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ‘Cascade Gold’ is a new gold fruited, floricane fruiting raspberry cultivar (Rubus idaeus L.) jointly released by Washington State University (WSU), Oregon State University (OSU) and the U.S. Department of Agriculture (USDA). It has been evaluated at Puyallup, Wash. in plantings from 1988 to 2008. ...

  6. Gold Nanoparticle Microwave Synthesis

    SciTech Connect

    Krantz, Kelsie E.; Christian, Jonathan H.; Coopersmith, Kaitlin; Washington, II, Aaron L.; Murph, Simona H.

    2016-07-27

    At the nanometer scale, numerous compounds display different properties than those found in bulk material that can prove useful in areas such as medicinal chemistry. Gold nanoparticles, for example, display promise in newly developed hyperthermia therapies for cancer treatment. Currently, gold nanoparticle synthesis is performed via the hot injection technique which has large variability in final particle size and a longer reaction time. One underdeveloped area by which these particles could be produced is through microwave synthesis. To initiate heating, microwaves agitate polar molecules creating a vibration that gives off the heat energy needed. Previous studies have used microwaves for gold nanoparticle synthesis; however, polar solvents were used that partially absorbed incident microwaves, leading to partial thermal heating of the sample rather than taking full advantage of the microwave to solely heat the gold nanoparticle precursors in a non-polar solution. Through this project, microwaves were utilized as the sole heat source, and non-polar solvents were used to explore the effects of microwave heating only as pertains to the precursor material. Our findings show that the use of non-polar solvents allows for more rapid heating as compared to polar solvents, and a reduction in reaction time from 10 minutes to 1 minute; this maximizes the efficiency of the reaction, and allows for reproducibility in the size/shape of the fabricated nanoparticles.

  7. Gold Nanoparticles Cytotoxicity

    NASA Astrophysics Data System (ADS)

    Mironava, Tatsiana

    Over the last two decades gold nanoparticles (AuNPs) have been used for many scientific applications and have attracted attention due to the specific chemical, electronic and optical size dependent properties that make them very promising agents in many fields such as medicine, imagine techniques and electronics. More specifically, biocompatible gold nanoparticles have a huge potential for use as the contrast augmentation agent in X-ray Computed Tomography and Photo Acoustic Tomography for early tumor diagnostic as well these nanoparticles are extensively researched for enhancing the targeted cancer treatment effectiveness such as photo-thermal and radiotherapy. In most biomedical applications biocompatible gold nanoparticles are labeled with specific tumor or other pathology targeting antibodies and used for site specific drug delivery. However, even though gold nanoparticles poses very high level of anti cancer properties, the question of their cytotoxicity ones they are released in normal tissue has to be researched. Moreover, the huge amount of industrially produced gold nanoparticles raises the question of these particles being a health hazard, since the penetration is fairly easy for the "nano" size substances. This study focuses on the effect of AuNPs on a human skin tissue, since it is fall in both categories -- the side effects for biomedical applications and industrial workers and users' exposure during production and handling. Therefore, in the present project, gold nanoparticles stabilized with the biocompatible agent citric acid were generated and characterized by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM). The cytotoxic effect of AuNPs release to healthy skin tissue was modeled on 3 different cell types: human keratinocytes, human dermal fibroblasts, and human adipose derived stromal (ADS) cells. The AuNPs localization inside the cell was found to be cell type dependent. Overall cytotoxicity was found to be dependent

  8. The effects of dietary 1, 25-dihydroxycholecalciferol and hydroalcoholic extract of Withania somnifera root on bone mineralisation, strength and histological characteristics in broiler chickens.

    PubMed

    Mirakzehi, M T; Kermanshahi, H; Golian, A; Raji, A R

    2013-01-01

    1. This study was carried out to investigate the effects of 1, 25-dihydroxycholecalciferol (1, 25 (OH)2 D3) and a hydroalcoholic extract of Withania somnifera (WS) root on performance, mineral retention, bone mineralisation, bone mechanical and bone histological characteristics of broiler chicks. 2. A 2 × 3 × 2 factorial experiment consisted of a positive control diet with adequate Ca and a negative control diet (Ca concentration reduced by 30%), three concentrations of WS (0, 75 and 150 mg/kg diet), and two concentrations of 1, 25 (OH)2 D3 (0 and 0.5 μg/kg diet). 3. A total of 600 male one-d-old Ross 308 broiler chicks were randomly distributed into 60 floor pens, with 10 birds each. Each treatment was replicated 5 times (50 birds). Diets were given ad libitum from one to 42 d of age. On d 21 and 42, one bird per replicate was killed and tibiae were removed. 4. Dietary treatments did not affect feed intake and feed conversion. The maximum body weight gain (2475 g) was noted in birds fed on a diet adequate in Ca and supplemented with 75 mg/kg WS. 5. The Ca and P retentions were significantly higher in birds that were given a diet with 30% less Ca. Supplementation of 150 mg/kg WS significantly improved Ca retention in birds receiving a negative control compared to those given a positive control diet (83.0% vs. 66.3%). Ca retention was significantly improved with the addition of 0.5 μg/kg 1, 25 (OH)2 D3 to the diet containing 75 mg/kg WS, regardless of dietary Ca concentration (79.5 vs. 73.3 and 77.9 vs. 68.9). 6. On d 21, birds that received WS had significantly higher tibia Ca compared to those of controls. No significant effects on tibia Ca were noted at 42 d. Birds given a negative control diet supplemented with 75 mg/kg WS and 0.5 μg/kg 1, 25 (OH)2 D3 displayed a similar tibia Ca compared to those given only 150 mg/kg WS. Dietary supplementation of 1, 25 (OH)2 D3 significantly increased tibia Ca and tibial mineralised zone width in birds at 42 d of age. 7

  9. Spiky gold nanoshells.

    PubMed

    Sanchez-Gaytan, Brenda L; Park, So-Jung

    2010-12-21

    We report a high-yield synthetic method for a new type of metal nanostructure, spiky gold nanoshells, which combine the morphological characteristics of hollow metal nanoshells and nanorods. Our method utilizes block copolymer assemblies and polymer beads as templates for the growth of spiky nanoshells. Various shapes of spiky metal nanoshells were prepared in addition to spherical nanoshells by using block copolymer assemblies such as rod-like micelles, vesicles, and bilayers as templates. Furthermore, spiky gold shells encapsulating magnetic nanoparticles or quantum dots were prepared based on the ability of block copolymers to self-assemble with various types of nanoparticles and molecules. The capability to encapsulate other materials in the core, the shape tunability, and the highly structured surface of spiky nanoshells should benefit a range of imaging, sensing, and medical applications of metal nanostructures.

  10. Radioactive gold ring dermatitis

    SciTech Connect

    Miller, R.A.; Aldrich, J.E. )

    1990-08-01

    A superficial squamous cell carcinoma developed in a woman who wore a radioactive gold ring for more than 30 years. Only part of the ring was radioactive. Radiation dose measurements indicated that the dose to basal skin layer was 2.4 Gy (240 rad) per week. If it is assumed that the woman continually wore her wedding ring for 37 years since purchase, she would have received a maximum dose of approximately 4600 Gy.

  11. 'Pot of Gold'

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows the rock dubbed 'Pot of Gold' (upper left), located near the base of the 'Columbia Hills' in Gusev Crater. The rock's nodules and layered appearance have inspired rover team members to investigate the rock's detailed chemistry in coming sols. This picture was taken on sol 158 (June 13, 2004).

  12. Gold-gold junction electrodes:the disconnection method.

    PubMed

    Dale, Sara E C; Vuorema, Anne; Ashmore, Ellen M Y; Kasprzyk-Horden, Barbara; Sillanpää, Mika; Denuault, Guy; Marken, Frank

    2012-02-01

    The formation of gold-gold junction electrodes for application in electroanalysis is described here based on electro-deposition from a non-cyanide gold plating bath. Converging growth of two hemispherical gold deposits on two adjacent platinum microelectrodes (both 100 µm diameter in glass, ca. 45 µm gap) followed by careful etching in aqueous chloride solution was employed. During growth both gold hemispheres "connect" and during etching "disconnection" is evident in a drop in current. Gold-gold junctions with sub-micron gaps are formed and applied for the electroanalytical detection of sub-micromolar concentrations of hydroquinone in 0.1 M phosphate buffer pH 7 (E(rev) = 0.04 V vs. SCE) and sub-micromolar concentration of dopamine in 0.1 M phosphate buffer pH 7 (E(rev) = 0.14 V vs. SCE). The potential future uses in analysis and limitations of gold-gold junction electrodes are discussed.

  13. Industry Forum Navy Gold Coast

    DTIC Science & Technology

    2014-08-13

    NAVFAC Southwest Lora E. Morrow Deputy for Small Business NAVFAC Southwest NAVFAC Southwest Industry Forum Navy Gold Coast August...REPORT DATE 13 AUG 2014 2. REPORT TYPE 3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Industry Forum Navy Gold Coast 5a...S) 12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES NDIA 27th Navy Gold Coast

  14. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  15. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  16. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Gold coin and gold certificates in... EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued before January 30, 1934, are exchangeable, as...

  17. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  18. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  19. Surface-stabilized gold nanocatalysts

    DOEpatents

    Dai, Sheng [Knoxville, TN; Yan, Wenfu [Oak Ridge, TN

    2009-12-08

    A surface-stabilized gold nanocatalyst includes a solid support having stabilizing surfaces for supporting gold nanoparticles, and a plurality of gold nanoparticles having an average particle size of less than 8 nm disposed on the stabilizing surfaces. The surface-stabilized gold nanocatalyst provides enhanced stability, such as at high temperature under oxygen containing environments. In one embodiment, the solid support is a multi-layer support comprising at least a first layer having a second layer providing the stabilizing surfaces disposed thereon, the first and second layer being chemically distinct.

  20. A study of radionuclides, metals and stable lead isotope ratios in sediments and soils in the vicinity of natural U-mineralisation areas in the Northern Territory.

    PubMed

    Frostick, A; Bollhöfer, A; Parry, D

    2011-10-01

    Australian guidelines recommend that tailings materials from uranium (U) mining and milling be contained without any detrimental impact on the environment for at least 1000 years. Natural analogue sites are being investigated to determine if they can provide data on the rates of natural erosion processes which occur over these timescales, for input into predictive geomorphic computer models. This paper presents radionuclide, metal and stable lead (Pb) isotope data from sediment cores and surface soils in the vicinity of two mineralised areas in the Alligator Rivers Region. Surface scrapes from the natural Anomaly #2, south of the Ranger mineral lease, exhibit radiogenic (206)Pb/(207)Pb and (208)Pb/(207)Pb ratios, and elevated U and metal concentrations typical for a near surface U anomaly. In contrast, samples taken from the Koongarra mineral lease (KML) show radionuclide activity and metal concentrations similar to natural areas elsewhere in the Alligator Rivers Region and Pb isotope ratios are closer to present day average crustal ratios (PDAC), as the orebodies at KML are covered by surficial sand. A sediment core collected from Anbangbang Billabong, downstream of KML, exhibits small variations in Pb isotope ratios that indicate that approximately 1% of the upper sediments in the sediment core may be derived from material originating from the U anomaly at Koongarra.

  1. The effect of polystyrene sodium sulfonate grafting on polyethylene terephthalate artificial ligaments on in vitro mineralisation and in vivo bone tissue integration

    PubMed Central

    Vaquette, Cédryck; Viateau, Véronique; Guérard, Sandra; Anagnostou, Fani; Manassero, Mathieu; Castner, David G.; Migonney, Véronique

    2013-01-01

    This study investigates the impact of polystyrene sodium sulfonate (PolyNaSS) grafting onto the osseointegration of a polyethylene terephthalate artificial ligament (Ligament Advanced Reinforcement System, LARS™) used for Anterior Cruciate Ligament (ACL). The performance of grafted and non-grafted ligaments was assessed in vitro by culturing human osteoblasts under osteogenic induction and this demonstrated that the surface modification was capable of up-regulating the secretion of ALP and induced higher level of mineralisation as measured 6 weeks post-seeding by Micro-Computed Tomography. Grafted and non-grafted LARS™ were subsequently implanted in an ovine model for ACL reconstruction and the ligament-to-bone interface was evaluated by histology and biomechanical testing 3 and 12 months post-implantation. The grafted ligaments exhibited more frequent direct ligament-to-bone contact and bone formation in the core of the ligament at the later time point than the nongrafted specimens, the grafting also significantly reduced the fibrous encapsulation of the ligament 12 months post-implantation. However, this improved osseo-integration was not translated into a significant increase in the biomechanical pull-out loads. These results provide evidences that PolyNaSS grafting improved the osseo-integration of the artificial ligament within the bone tunnels. This might positively influence the outcome of the surgical reconstructions, as higher ligament stability is believed to limit micro-movement and therefore permits earlier and enhanced healing. PMID:23790438

  2. Binding of RDX to Cell Wall Components of Pinus sylvestris and Picea glauca and Three-Year Mineralisation Study of Tissue-Associated RDX Residues.

    PubMed

    Schoenmuth, Bernd; Schenke, Detlef; Scharnhorst, Tanja; Combrinck, Sandra; McCrindle, Robert I; Mueller, Jakob O; Büttner, Carmen; Pestemer, Wilfried

    2015-01-01

    Contamination of soils with the explosive hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX, Research Department Explosive) as a result of military applications is a large-area problem globally. Since coniferous trees dominate the vegetation of large areas of military land in Central Europe, particularly in Germany, the long-term fate of (14)C-RDX in the conifers Scots pine and Dwarf Alberta spruce was studied. Acetic acid was the most effective solvent for the removal of extractable RDX residues from homogenates of RDX-laden tree material (85%, 80-90% and 64-80% for roots, wood and needles, respectively). On average, only a fifth of RDX-derived (14)C was bound in non-extractable residues (NER). Within the main cell wall compartments, lignin was the dominant binding site for NER (needles: 32-62%; roots: 38-42%). Hemicellulose (needles: 11-18%; roots: 6-11%) and cellulose (needles: 12-24%; roots: 1-2%) were less involved in binding and a considerable proportion of NER (needles: 15-24%; roots: 59-51%) was indigestible. After three-year incubation in rot chambers, mineralisation of tree-associated (14)C-RDX to (14)CO2 clearly dominated the mass balance in both tree species with 48-83%. 13-33% of (14)C-RDX-derived radioactivity remained in an unleachable form and the remobilisation by water leaching was negligible (< 2%).

  3. The nature and genesis of marginal Cu-PGE-Au sulphide mineralisation in Paleogene Macrodykes of the Kangerlussuaq region, East Greenland

    NASA Astrophysics Data System (ADS)

    Holwell, David A.; Abraham-James, Thomas; Keays, Reid R.; Boyce, Adrian J.

    2012-01-01

    The Kangerlussuaq region of East Greenland hosts a variety of early Tertiary extrusive and intrusive igneous rocks related to continental break up and the passage of the ancestral Iceland plume. These intrusive bodies include a number of gabbroic macrodykes, two of which—the Miki Fjord Macrodyke, and the newly discovered Togeda Macrodyke—contain Cu-PGE-Au sulphide mineralisation along their margins. Sulphides occur as disseminated interstitial blebs and rounded globules of chalcopyrite and pyrrhotite with some Fe-Ti oxides and platinum-group minerals, comprising largely Pd bismuthides and tellurides. The globules are interpreted to have formed from fractionation of trapped droplets of an immiscible Cu- and Pd-rich sulphide melt and show geopetal indicators. Sulphur isotopes imply a local crustal source of S in these from pyritic sediments of the Kangerlussuaq Basin. Thus, generation of these sulphide occurrences was controlled by local country rock type. Low Ni/Cu and Pt/Pd ratios, also present in the Platinova reefs in the Skaergaard Intrusion, indicate that early fractionation of olivine may have depleted the magma of Ni and suggest the likely presence of a large magma chamber at depth. Xenoliths of Ni-rich olivine cumulates in the Miki Fjord Macrodyke may have been sourced from such a body. The location of thus far unidentified conduit or feeder zones to the macrodykes beneath the present day surface may represent potential targets for more massive sulphide orebodies.

  4. Structural setting of gold deposits in the Oudalan-Gorouol volcano-sedimentary belt east of the Markoye Shear Zone, West African Craton

    NASA Astrophysics Data System (ADS)

    Tshibubudze, Asinne; Hein, Kim A. A.

    2013-04-01

    The Oudalan-Gorouol volcano-sedimentary belt (OGB) of Burkina Faso and Niger hosts meta-volcanic and metasedimentary sequences of the Birimian Supergroup that were folded and deformed during emplacement of the Dori Batholith (D1-x), the Tangaean Event (D1) and the Eburnean Orogeny (D2). The emplacement of the Dori Batholith accompanied aureole deformation (D1-x) and the development of proto-mylonite, migmatite, gneiss and schist on the northern margin of the batholith. Contact metamorphic grade reached granulite facies with partial melting of the supracrustal sequences. Emplacement of the Dori Batholith was succeeded by emplacement of monzonite dykes and sills through the OGB. The Tangaean Event (D1) accompanied formation of (a) the Saoga Branch of the Markoye Shear Zone (MSZ), (b) the Mukosi and Billiata mylonite zones that are hosted in the MSZ, (c) the Afu Branch of the Kargouna Shear Zone Complex (KSZC), and (d) northwest-trending thrust-folds (F1) that crosscut the OGB and coalesce with the MSZ. Metamorphic grade attained amphibolite facies in mylonite or proto-mylonite zones in the Saoga and Afu branches. D1 was succeeded by emplacement of alkali-granite plutons of the Dolbel Batholith. The Eburnean Orogeny, D2, accompanied formation of (a) the Korizéna Branch of the MSZ, (b) the Waho Branch of the KSZC, and (c) northeast-trending shear-faults that crosscut the OGB. D2 is manifested by refolding of F1 by northeast-trending F2, and development of a pervasive northeast-trending S2 to S2-C. Metamorphic grade attained greenschist facies during D2 with development of the mineral assemblage quartz-chlorite-muscovite ± actinolite. D2 was succeeded by emplacement of northwest-trending gabbro and dolerite dykes. The OGB hosts structurally-controlled gold deposits that are sited along five metallogenic corridors and include the Essakane, Tin-Fal, Bom Kodjelé, Kossa and Tassiri Trends. Gold mineralisation is preferentially located where northeast-trending faults and

  5. Age constraints on the hydrothermal history of the Prominent Hill iron oxide copper-gold deposit, South Australia

    NASA Astrophysics Data System (ADS)

    Bowden, Bryan; Fraser, Geoff; Davidson, Garry J.; Meffre, Sebastien; Skirrow, Roger; Bull, Stuart; Thompson, Jay

    2016-12-01

    The Mesoproterozoic Prominent Hill iron-oxide copper-gold deposit lies on the fault-bound southern edge of the Mt Woods Domain, Gawler Craton, South Australia. Chalcocite-bornite-chalcopyrite ores occur in a hematitic breccia complex that has similarities to the Olympic Dam deposit, but were emplaced in a shallow water clastic-carbonate package overlying a thick andesite-dacite pile. The sequence has been overturned against the major, steep, east-west, Hangingwall Fault, beyond which lies the clastic to potentially evaporitic Blue Duck Metasediments. Immediately north of the deposit, these metasediments have been intruded by dacite porphyry and granitoid and metasomatised to form magnetite-calc-silicate skarn ± pyrite-chalcopyrite. The hematitic breccia complex is strongly sericitised and silicified, has a large sericite ± chlorite halo, and was intruded by dykes during and after sericitisation. This paper evaluates the age of sericite formation in the mineralised breccias and provides constraints on the timing of granitoid intrusion and skarn formation in the terrain adjoining the mineralisation. The breccia complex contains fragments of granitoid and porphyry that are found here to be part of the Gawler Range Volcanics/Hiltaba Suite magmatic event at 1600-1570 Ma. This indicates that some breccia formation post-dated granitoid intrusion. Monazite and apatite in Fe-P-REE-albite metasomatised granitoid, paragenetically linked with magnetite skarn formation north of the Hangingwall Fault, grew soon after granitoid intrusion, although the apatite experienced U-Pb-LREE loss during later fluid-mineral interaction; this accounts for its calculated age of 1544 ± 39 Ma. To the south of the fault, within the breccia, 40Ar-39Ar ages yield a minimum age of sericitisation (+Cu+Fe+REE) of dykes and volcanics of ˜1575 Ma, firmly placing Prominent Hill ore formation as part of the Gawler Range Volcanics/Hiltaba Suite magmatic event within the Olympic Cu-Au province of the

  6. Experimental abrasion of detrital gold

    USGS Publications Warehouse

    Yeend, Warren E.

    1975-01-01

    The physical breakdown and abrasion rates of gold were studied using a tumbler to simulate natural high-energy environments. The gold fragments were tumbled for periods ranging from 30 to 240 h with different combinations of sand, cobbles, and water at velocities of 0.5 and 2.0 mi/h (0.85 and 3.22 km/h). With sand and gravel, the common bedload of the rivers that deposited the gold-bearing Tertiary sedimentary rocks of the Sierra Nevada, gold is abraded at rates of 0.015 to 0.007 percent (by weight) per hour of travel (at 0.5 mi/h or 0.845 km/h). Cobbles, rather than sand, are responsible for most of the physical changes and abrasion of the gold. Ten gold fragments tumbled for 120 h with cobbles and water (no sand) were broken down to 68 recoverable fragments and lost about 25 percent of their weight to particles smaller than could be recovered using conventional panning techniques. Gold tumbled for 120 h with sand and water lost less than 1 percent of its weight. Gold was abraded faster by wet sand than by dry sand. Velocity appears to be more important as a factor in abrasion of gold than travel distance a fourfold increase in velocity produced a tenfold increase in hourly abrasion rates of gold. Scanning electron microscope examination of the gold fragments after the tumbling experiments revealed differences in surface texture between fragments tumbled with (1) sand, (2) sand and cobbles, and (3) cobbles only.

  7. When cyclopropenes meet gold catalysts

    PubMed Central

    Miege, Frédéric

    2011-01-01

    Summary Cyclopropenes as substrates entered the field of gold catalysis in 2008 and have proven to be valuable partners in a variety of gold-catalyzed reactions. The different contributions in this growing research area are summarized in this review. PMID:21804867

  8. Antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.

    1988-06-28

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be about 5.0 nm. Methods and reagents are disclosed in which antibodies or Fab' fragments thereof are covalently bound to a stable cluster of gold atoms. 2 figs.

  9. Simulation with models of increasing complexity of CO2 emissions and nitrogen mineralisation, after soil application of labelled pig slurry and maize stalks

    NASA Astrophysics Data System (ADS)

    Bechini, Luca; Marino Gallina, Pietro; Geromel, Gabriele; Corti, Martina; Cavalli, Daniele

    2015-04-01

    High amounts of nitrogen are available per unit area in regions with intensive livestock operations. In swine farms, pig slurries are frequently incorporated in the soil together with maize stalks. Simulation models may help to understand nitrogen dynamics associated with animal manure and crop residue decomposition in the soil, and to support the definition of best management practices. The objective of this work was to test the ability of different models to simulate CO2 emissions and nitrogen mineralisation during a laboratory incubation (under optimal soil water content and constant temperature) of maize stalks (ST) and pig slurry (PS). A loam soil was amended with labelled (15N) or unlabelled maize stalks and pig slurries, in the presence of ammonium sulphate (AS). These treatments were established: unfertilised soil; ST15 + AS + PS; ST + AS15 + PS; and ST + AS + PS15. During 180 days, we measured CO2 emissions; microbial biomass C, N, and 15N; and soil mineral N (SMN and SM-15N). Three models of increasing complexity were calibrated using measured data. The models were two modifications of ICBM 2B/N (Kätterer and Andrén, 2001) and CN-SIM (Petersen et al., 2005). The three models simulated rather accurately the emissions of CO2 throughout the incubation period (Relative Root Mean Squared Error, RRMSE = 8-25). The simplest model (with one pool for ST and one for PS) strongly overestimated SMN immobilisation from day 3 to day 21, both in the treatments with AS15 and PS15 (RRMSE = 27-30%). The other two models represented rather well the dynamics of SMN in the soil (RRMSE = 21-25%), simulating a fast increase of nitrate concentration in the first days, and slower rates of nitrification thereafter. Worse performances were obtained with all models for the simulation of SM-15N in the treatment with ST15 (RRMSE = 64-104%): experimental data showed positive mineralization of stalk-derived N from the beginning of the incubation, while models strongly underestimated

  10. Synthesis of gold structures by gold-binding peptide governed by concentration of gold ion and peptide.

    PubMed

    Kim, Jungok; Kim, Dong-Hun; Lee, Sylvia J; Rheem, Youngwoo; Myung, Nosang V; Hur, Hor-Gil

    2016-08-01

    Although biological synthesis methods for the production of gold structures by microorganisms, plant extracts, proteins, and peptide have recently been introduced, there have been few reports pertaining to controlling their size and morphology. The gold ion and peptide concentrations affected on the size and uniformity of gold plates by a gold-binding peptide Midas-11. The higher concentration of gold ions produced a larger size of gold structures reached 125.5 μm, but an increased amount of Midas-11 produced a smaller size of gold platelets and increased the yield percentage of polygonal gold particles rather than platelets. The mechanisms governing factors controlling the production of gold structures were primarily related to nucleation and growth. These results indicate that the synthesis of gold architectures can be controlled by newly isolated and substituted peptides under different reaction conditions.

  11. 20th-Century Gold Rush.

    ERIC Educational Resources Information Center

    Wargo, Joseph G.

    1992-01-01

    Presents Nevada's gold rush activities spurred by technological advancements in search methods. Describes the events that led to the twentieth-century gold rush, the techniques for finding deposits and the geological formation process of disseminated gold deposits. Vignettes present the gold extraction process, cross-section, and profile of a…

  12. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 41 Public Contracts and Property Management 2 2014-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  13. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 2 2013-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  14. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 41 Public Contracts and Property Management 2 2012-07-01 2012-07-01 false Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  15. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 41 Public Contracts and Property Management 2 2011-07-01 2007-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  16. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  17. Enhancement of gold recovery using bioleaching from gold concentrate

    NASA Astrophysics Data System (ADS)

    Choi, S. H.; Cho, K. H.; Kim, B. J.; Choi, N. C.; Park, C. Y.

    2012-04-01

    The gold in refractory ores is encapsulated as fine particles (sometimes at a molecular level) in the crystal structure of the sulfide (typically pyrite with or without arsenopyrite) matrix. This makes it impossible to extract a significant amount of refractory gold by cyanidation since the cyanide solution cannot penetrate the pyrite/arsenopyrite crystals and dissolve gold particles, even after fine grinding. To effectively extract gold from these ores, an oxidative pretreatment is necessary to break down the sulfide matrix. The most popular methods of pretreatment include nitric acid oxidation, roasting, pressure oxidation and biological oxidation by microorganisms. This study investigated the bioleaching efficiency of Au concentrate under batch experimental conditions (adaptation cycles and chemical composition adaptation) using the indigenous acidophilic bacteria collected from gold mine leachate in Sunsin gold mine, Korea. We conducted the batch experiments at two different chemical composition (CuSO4 and ZnSO4), two different adaptation cycles 1'st (3 weeks) and 2'nd (6 weeks). The results showed that the pH in the bacteria inoculating sample decreased than initial condition and Eh increased. In the chemical composition adaptation case, the leached accumulation content of Fe and Pb was exhibited in CuSO4 adaptation bacteria sample more than in ZnSO4 adaptation bacteria samples, possibly due to pre-adaptation effect on chalcopyrite (CuFeS2) in gold concentrate. And after 21 days on the CuSO4 adaptation cycles case, content of Fe and Pb was appeared at 1'st adaptation bacteria sample(Fe - 1.82 and Pb - 25.81 times per control sample) lower than at 2'nd adaptation bacteria sample(Fe - 2.87 and Pb - 62.05 times per control sample). This study indicates that adaptation chemical composition and adaptation cycles can play an important role in bioleaching of gold concentrate in eco-/economic metallurgy process.

  18. Magnetic signatures related to orogenic gold mineralization, Central Lapland Greenstone Belt, Finland

    NASA Astrophysics Data System (ADS)

    Airo, M.-L.; Mertanen, S.

    2008-03-01

    A number of lode-gold occurrences are hosted by hydrothermally altered greenstones along the southern boundary of the Palaeoproterozoic Central Lapland Greenstone Belt. The hydrothermally altered and mineralised zones are related to a major thrust and shear zone system that extends much across northern Finland. Spatial correlation between mineralized zones, brittle structural features and chemical alteration was explored and identified from high-resolution aeromagnetic data, in combination with airborne electromagnetic and gamma-ray spectrometric data and coupled with petrophysical and palaeomagnetic studies. The most prominent magnetic, ductile signatures formed during the Svecofennian Orogeny (1900-1800 Ma), resulting in elastic, curved, continuous magnetic patterns. These elastic anomaly patterns were disturbed by tectonic stress from S-SW, resulting in parallel, regularly oriented fracture families and thrust faults normal to the main stress direction. According to aeromagnetic, palaeomagnetic and structural evidence, the thrust zone was active during the latest stage of the orogenic event, but was also reactivated at a later date. Airborne gamma-ray data reveals zones of potassic alteration in the ultramafic rock units in the vicinity of cross-sections of these two fault sets. Chemical and mineralogical changes during alteration and metamorphism strongly affected the mafic and ultramafic host rocks throughout the deformation zone. The strong potassium enrichment and coinciding destruction of magnetic minerals resulted in enhanced potassium concentration and reduction of magnetic anomaly amplitudes. Palaeomagnetic results indicate that the remanent magnetization for the altered ultramafic rocks along the thrust zone is of chemical origin (CRM) and was acquired at 1880-1840 Ma, which is presumed also to be the age of the chemical alteration related to gold mineralization.

  19. Colloidal Synthesis of Gold Semishells

    PubMed Central

    Rodríguez-Fernández, Denis; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel; Liz-Marzán, Luis M

    2012-01-01

    This work describes a novel and scalable colloid chemistry strategy to fabricate gold semishells based on the selective growth of gold on Janus silica particles (500 nm in diameter) partly functionalized with amino groups. The modulation of the geometry of the Janus silica particles allows us to tune the final morphology of the gold semishells. This method also provides a route to fabricating hollow gold semishells through etching of the silica cores with hydrofluoric acid. The optical properties were characterized by visible near-infrared (vis-NIR) spectroscopy and compared with simulations performed using the boundary element method (BEM). These revealed that the main optical features are located beyond the NIR region because of the large core size. PMID:24551496

  20. Gold, currencies and market efficiency

    NASA Astrophysics Data System (ADS)

    Kristoufek, Ladislav; Vosvrda, Miloslav

    2016-05-01

    Gold and currency markets form a unique pair with specific interactions and dynamics. We focus on the efficiency ranking of gold markets with respect to the currency of purchase. By utilizing the Efficiency Index (EI) based on fractal dimension, approximate entropy and long-term memory on a wide portfolio of 142 gold price series for different currencies, we construct the efficiency ranking based on the extended EI methodology we provide. Rather unexpected results are uncovered as the gold prices in major currencies lay among the least efficient ones whereas very minor currencies are among the most efficient ones. We argue that such counterintuitive results can be partly attributed to a unique period of examination (2011-2014) characteristic by quantitative easing and rather unorthodox monetary policies together with the investigated illegal collusion of major foreign exchange market participants, as well as some other factors discussed in some detail.

  1. GOLD: The Genomes Online Database

    DOE Data Explorer

    Kyrpides, Nikos; Liolios, Dinos; Chen, Amy; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor; Bernal, Alex

    Since its inception in 1997, GOLD has continuously monitored genome sequencing projects worldwide and has provided the community with a unique centralized resource that integrates diverse information related to Archaea, Bacteria, Eukaryotic and more recently Metagenomic sequencing projects. As of September 2007, GOLD recorded 639 completed genome projects. These projects have their complete sequence deposited into the public archival sequence databases such as GenBank EMBL,and DDBJ. From the total of 639 complete and published genome projects as of 9/2007, 527 were bacterial, 47 were archaeal and 65 were eukaryotic. In addition to the complete projects, there were 2158 ongoing sequencing projects. 1328 of those were bacterial, 59 archaeal and 771 eukaryotic projects. Two types of metadata are provided by GOLD: (i) project metadata and (ii) organism/environment metadata. GOLD CARD pages for every project are available from the link of every GOLD_STAMP ID. The information in every one of these pages is organized into three tables: (a) Organism information, (b) Genome project information and (c) External links. [The Genomes On Line Database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata, Konstantinos Liolios, Konstantinos Mavromatis, Nektarios Tavernarakis and Nikos C. Kyrpides, Nucleic Acids Research Advance Access published online on November 2, 2007, Nucleic Acids Research, doi:10.1093/nar/gkm884]

    The basic tables in the GOLD database that can be browsed or searched include the following information:

    • Gold Stamp ID
    • Organism name
    • Domain
    • Links to information sources
    • Size and link to a map, when available
    • Chromosome number, Plas number, and GC content
    • A link for downloading the actual genome data
    • Institution that did the sequencing
    • Funding source
    • Database where information resides
    • Publication status and information

    • Gold, coal and oil.

      PubMed

      Dani, Sergio U

      2010-03-01

      Jared Diamond has hypothesized that guns, germs and steel account for the fate of human societies. Here I propose an extension of Diamond's hypothesis and put it in other terms and dimensions: gold, coal and oil account not only for the fate of human societies but also for the fate of mankind through the bodily accumulation of anthropogenic arsenic, an invisible weapon of mass extinction and evolutionary change. The background is clear; arsenic species fulfill seven criteria for a weapon of mass extinction and evolutionary change: (i) bioavailability to all living organisms; (ii) imperceptibility; (iii) acute toxicity; (iv) bioaccumulation and chronic toxicity; (v) adverse impact on reproductive fitness and reproductive outcomes and early-age development and growth in a wide range of microbial, plant and animal species including man; (vi) widespread geographical distribution, mobility and ecological persistence on a centennial to millennial basis and (vii) availability in necessary and sufficient amounts to exert evolutionarily meaningful effects. The proof is becoming increasingly feasible as human exploitation of gold, coal and oil deposits cause sustainable rises of arsenic concentrations in the biosphere. Paradoxically, humans are among the least arsenic-resistant organisms because humans are long-lived, encephalized and complex social metazoans. An arsenic accumulation model is presented here to describe how arsenic accumulates in the human body with increasing age and at different provisionally safe exposure levels. Arsenic accumulates in the human body even at daily exposure levels which are within the lowest possible WHO provisional tolerance limits, yielding bodily arsenic concentrations which are above WHO provisional limits. Ongoing consequences of global scale arsenic poisoning of mankind include age-specific rises in morbidity and mortality followed by adaptive changes. The potential rise of successful forms of inborn resistance to arsenic in humans

    • A metamorphic mineral source for tungsten in the turbidite-hosted orogenic gold deposits of the Otago Schist, New Zealand

      NASA Astrophysics Data System (ADS)

      Cave, Ben J.; Pitcairn, Iain K.; Craw, Dave; Large, Ross R.; Thompson, Jay M.; Johnson, Sean C.

      2016-09-01

      The orogenic gold deposits of the Otago Schist, New Zealand, are enriched in a variety of trace elements including Au, As, Ag, Hg, W and Sb. We combine laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) traverses and images to show that detrital rutile is the most important host mineral for W in the subgreenschist facies rocks. Furthermore, the prograde metamorphic recrystallisation of detrital rutile to titanite releases significant amounts of W (potentially 0.41 g/tonne of rock). Scheelite development closely follows the progression of this W-liberating reaction. Scheelite micrograins form early within the fabric of the rock evolving to locally and regionally sourced scheelite-bearing veins. Scheelite from syn-metamorphic veins at Fiddlers Flat and Lake Hāwea shows distinct differences in composition compared with scheelite from late-metamorphic veins at the Macraes Mine, the latter of which is enriched in REEs, Y and Sr. We suggest that the scheelite at Macraes became enriched due to the liberation of these elements during alteration of the Ca-silicate minerals epidote and titanite by the ore-forming fluid. These results are supportive of recent models for orogenic gold mineralisation in the Otago Schist, whereby prograde metamorphic recrystallisation of diagenetic or detrital metal-rich mineral phases (pyrite to pyrrhotite: Au, As, Ag, Hg and Sb; rutile to titanite: W) releases significant amounts of metals into the concurrently developing metamorphic fluids that can be subsequently focussed into regional structures and form significant tungsten-bearing orogenic gold deposits.

    • New insights into the petrogenesis of the Jameson Range layered intrusion and associated Fe-Ti-P-V-PGE-Au mineralisation, West Musgrave Province, Western Australia

      NASA Astrophysics Data System (ADS)

      Karykowski, Bartosz T.; Polito, Paul A.; Maier, Wolfgang D.; Gutzmer, Jens; Krause, Joachim

      2017-02-01

      The Mesoproterozoic Jameson Range intrusion forms part of the Giles Complex, Musgrave Province, Western Australia. It is predominantly mafic in composition comprising olivine-bearing gabbroic lithologies with variable amounts of magnetite and ilmenite. Lithologies containing more than 50 vol% magnetite and ilmenite are classified as magnetitites. The Jameson Range hosts several of these magnetitites forming laterally extensive layers, which can be traced for at least 19 km as continuous magnetic anomalies. Similar occurrences of magnetitites are known from the upper parts of other layered intrusions, such as the Bushveld Complex. In addition, the intrusion hosts several P-rich zones, one of which is at least 59 m in thickness containing 1.0 wt% P2O5. The P-rich zones are not directly associated with the magnetitites, but they mostly occur slightly above them. The mineral chemistry of the Jameson Range cumulates is relatively evolved with olivine compositions ranging from Fo44 to Fo60 and plagioclase compositions varying between An56 and An59. The Mg# (100 × Mg / (Mg + Fe)) of ortho- and clinopyroxene ranges from 60 to 61 and from 70 to 75, respectively. Magnetite compositions are characterised by low TiO2 concentrations varying from 0.39 to 3.04 wt% representing near end-member magnetite with up to 1.2 wt% Cr and 1.3 wt% V, respectively. The basal magnetite layer reaches up to 68.8 wt% Fe2O3(t) and 24.2 wt% TiO2, and it is also markedly enriched in Cu (up to 0.3 wt% Cu), V (up to 1.05 wt% V2O5) and platinum-group elements (PGE) (up to 2 ppm Pt + Pd). Sulphide minerals comprising bornite, chalcopyrite and minor pentlandite occur finely disseminated in the magnetitite and account for the elevated base metal and PGE concentrations. Modelling indicates that the PGE mineralisation was formed at very high R factors of up to 100,000, which is typical for PGE reefs in layered intrusions. Whole rock geochemical and mineralogical data of the magnetite layers and their host

    • The effects of phytase and root hydroalcoholic extract of Withania somnifera on productive performance and bone mineralisation of laying hens in the late phase of production.

      PubMed

      Tahmasbi, A M; Mirakzehi, M T; Hosseini, S J; Agah, M J; Fard, M Kazemi

      2012-01-01

      1. A 6-week study was conducted to investigate the effects of phytase and hydroalcoholic extract of Withania somnifera root (WS) on productive performance and bone mineralisation of laying hens in the late phase of production. 2. Diets were arranged factorially (3 × 2 × 2) and consisted of a positive control with adequate Ca (4·37%) and nonphytate P (NPP; 0·39%) and a negative control diet with Ca (4·06%) and NPP (0·36 %); three concentrations of Withania somnifera (0, 65 and 130 mg/kg diet); and two concentrations of microbial phytase (0 and 300 U/kg diet). 3. A total of 144 72-week-old Hy-Line W36 laying hens were randomly assigned to the 12 treatment groups. Each treatment was replicated 4 times (4 x 3 hens). Egg production and egg weight were recorded daily, while feed intake and egg quality traits were recorded every two weeks. Bone quality traits were evaluated at the end of experiment. 4. Withania somnifera supplementation increased egg production and lowered egg weight only in the second two weeks of the experiment. Addition of phytase significantly depressed specific gravity of the eggs for the entire experiment period. No dietary treatment effects were observed on egg shell thickness and yolk weight. 5. Withania somnifera at 130 mg/kg did not affect feed intake. The hens fed on the positive control diet had higher albumen weight than the negative control diet in the second two-week period. Supplementation of the positive control diet with 65 mg/kg Withania somnifera in the absence of phytase significantly improved shell weight compared with the negative control (5·779 vs. 5·273 g respectively). 6. Supplementing Withania somnifera significantly improved Ca and P retention in tibia bone. In addition, an increase in tibia bone P was observed with phytase supplementation. There were significant interactions between Withania somnifera content and phytase for tibia bone Ca and P. 7. The results of this experiment indicated that dietary

    • New insights into the petrogenesis of the Jameson Range layered intrusion and associated Fe-Ti-P-V-PGE-Au mineralisation, West Musgrave Province, Western Australia

      NASA Astrophysics Data System (ADS)

      Karykowski, Bartosz T.; Polito, Paul A.; Maier, Wolfgang D.; Gutzmer, Jens; Krause, Joachim

      2016-05-01

      The Mesoproterozoic Jameson Range intrusion forms part of the Giles Complex, Musgrave Province, Western Australia. It is predominantly mafic in composition comprising olivine-bearing gabbroic lithologies with variable amounts of magnetite and ilmenite. Lithologies containing more than 50 vol% magnetite and ilmenite are classified as magnetitites. The Jameson Range hosts several of these magnetitites forming laterally extensive layers, which can be traced for at least 19 km as continuous magnetic anomalies. Similar occurrences of magnetitites are known from the upper parts of other layered intrusions, such as the Bushveld Complex. In addition, the intrusion hosts several P-rich zones, one of which is at least 59 m in thickness containing 1.0 wt% P2O5. The P-rich zones are not directly associated with the magnetitites, but they mostly occur slightly above them. The mineral chemistry of the Jameson Range cumulates is relatively evolved with olivine compositions ranging from Fo44 to Fo60 and plagioclase compositions varying between An56 and An59. The Mg# (100 × Mg / (Mg + Fe)) of ortho- and clinopyroxene ranges from 60 to 61 and from 70 to 75, respectively. Magnetite compositions are characterised by low TiO2 concentrations varying from 0.39 to 3.04 wt% representing near end-member magnetite with up to 1.2 wt% Cr and 1.3 wt% V, respectively. The basal magnetite layer reaches up to 68.8 wt% Fe2O3(t) and 24.2 wt% TiO2, and it is also markedly enriched in Cu (up to 0.3 wt% Cu), V (up to 1.05 wt% V2O5) and platinum-group elements (PGE) (up to 2 ppm Pt + Pd). Sulphide minerals comprising bornite, chalcopyrite and minor pentlandite occur finely disseminated in the magnetitite and account for the elevated base metal and PGE concentrations. Modelling indicates that the PGE mineralisation was formed at very high R factors of up to 100,000, which is typical for PGE reefs in layered intrusions. Whole rock geochemical and mineralogical data of the magnetite layers and their host

    • Gold nanoparticle (AuNPs) and gold nanopore (AuNPore) catalysts in organic synthesis.

      PubMed

      Takale, Balaram S; Bao, Ming; Yamamoto, Yoshinori

      2014-04-07

      Organic synthesis using gold has gained tremendous attention in last few years, especially heterogeneous gold catalysis based on gold nanoparticles has made its place in almost all organic reactions, because of the robust and green nature of gold catalysts. In this context, gold nanopore (AuNPore) with a 3D metal framework is giving a new dimension to heterogeneous gold catalysts. Interestingly, AuNPore chemistry is proving better than gold nanoparticles based chemistry. In this review, along with recent advances, major discoveries in heterogeneous gold catalysis are discussed.

    • Modeling of gold production in Malaysia

      NASA Astrophysics Data System (ADS)

      Muda, Nora; Ainuddeen, Nasihah Rasyiqah; Ismail, Hamizun; Umor, Mohd Rozi

      2013-04-01

      This study was conducted to identify the main factors that contribute to the gold production and hence determine the factors that affect to the development of the mining industry in Malaysia. An econometric approach was used by performing the cointegration analysis among the factors to determine the existence of long term relationship between the gold prices, the number of gold mines, the number of workers in gold mines and the gold production. The study continued with the Granger analysis to determine the relationship between factors and gold production. Results have found that there are long term relationship between price, gold production and number of employees. Granger causality analysis shows that there is only one way relationship between the number of employees with gold production in Malaysia and the number of gold mines in Malaysia.

    • Monoclonal antibody "gold rush".

      PubMed

      Maggon, Krishan

      2007-01-01

      The market, sales and regulatory approval of new human medicines, during the past few years, indicates increasing number and share of new biologics and emergence of new multibillion dollar molecules. The global sale of monoclonal antibodies in 2006 were $20.6 billion. Remicade had annual sales gain of $1 billion during the past 3 years and five brands had similar increase in 2006. Rituxan with 2006 sales of $4.7 billion was the best selling monoclonal antibody and biological product and the 6th among the top selling medicinal brand. It may be the first biologic and monoclonal antibody to reach $10 billion annual sales in the near future. The strong demand from cancer and arthritis patients has surpassed almost all commercial market research reports and sales forecast. Seven monoclonal antibody brands in 2006 had sales exceeding $1 billion. Humanized or fully human monoclonal antibodies with low immunogenicity, enhanced antigen binding and reduced cellular toxicity provide better clinical efficacy. The higher technical and clinical success rate, overcoming of technical hurdles in large scale manufacturing, low cost of market entry and IND filing, use of fully human and humanized monoclonal antibodies has attracted funds and resources towards R&D. Review of industry research pipeline and sales data during the past 3 years indicate a real paradigm shift in industrial R&D from pharmaceutical to biologics and monoclonal antibodies. The antibody bandwagon has been joined by 200 companies with hundreds of new projects and targets and has attracted billions of dollars in R&D investment, acquisitions and licensing deals leading to the current Monoclonal Antibody Gold Rush.

    • Goldschlager allergy in a gold allergic patient.

      PubMed

      Guenthner, T; Stork, C M; Cantor, R M

      1999-08-01

      We describe the case of gold allergy after ingestion of GOLDSCHLAGER, a gold-containing liquor, in a patient with a previous allergy to gold jewelry. The patient was not aware that genuine gold particles were contained in the schnapps liquor and that ingestion could result in a reaction similar to that experienced by individuals sensitive to gold jewelry. Clinicians should be familiar with the presence of gold particles in GOLDSCHLAGER liquor and the potential for allergic reactions to occur in those so predisposed.

    • Phage based green chemistry for gold ion reduction and gold retrieval.

      PubMed

      Setyawati, Magdiel I; Xie, Jianping; Leong, David T

      2014-01-22

      The gold mining industry has taken its toll on the environment, triggering the development of more environmentally benign processes to alleviate the waste load release. Here, we demonstrate the use of bacteriophages (phages) for biosorption and bioreduction of gold ions from aqueous solution, which potentially can be applied to remediate gold ions from gold mining waste effluent. Phage has shown a remarkably efficient sorption of gold ions with a maximum gold adsorption capacity of 571 mg gold/g dry weight phage. The product of this phage mediated process is gold nanocrystals with the size of 30-630 nm. Biosorption and bioreduction processes are mediated by the ionic and covalent interaction between gold ions and the reducing groups on the phage protein coat. The strategy offers a simple, ecofriendly and feasible option to recover of gold ions to form readily recoverable products of gold nanoparticles within 24 h.

    • Gold nanoparticles for photoacoustic imaging

      PubMed Central

      Li, Wanwan; Chen, Xiaoyuan

      2015-01-01

      Photoacoustic (PA) imaging is a biomedical imaging modality that provides functional information regarding the cellular and molecular signatures of tissue by using endogenous and exogenous contrast agents. There has been tremendous effort devoted to the development of PA imaging agents, and gold nanoparticles as exogenous contrast agents have great potential for PA imaging due to their inherent and geometrically induced optical properties. The gold-based nanoparticles that are most commonly employed for PA imaging include spheres, rods, shells, prisms, cages, stars and vesicles. This article provides an overview of the current state of research in utilizing these gold nanomaterials for PA imaging of cancer, atherosclerotic plaques, brain function and image-guided therapy. PMID:25600972

    • Economic geology: Gold buried by oxygen

      NASA Astrophysics Data System (ADS)

      Gaillard, Fabrice; Copard, Yoann

      2015-03-01

      The Witwatersrand Basin in South Africa contains extraordinary amounts of gold. Thermodynamic calculations suggest that the gold may have accumulated there in response to a perfect storm of conditions available only during the Archaean.

    • Recent Developments in Australian Gold Extraction.

      ERIC Educational Resources Information Center

      Thiele, Rodney B.

      1995-01-01

      Describes new technologies that have greatly improved the extraction efficiency of gold ore, including: altering plant layout to promote efficiency, engaging Filiblast forced oxidation and bioxidation systems, and updating the electrowinning procedure at the gold recovery stage. (JRH)

    • Formation, structure, and orientation of gold silicide on gold surfaces

      NASA Technical Reports Server (NTRS)

      Green, A. K.; Bauer, E.

      1976-01-01

      The formation of gold silicide on Au films evaporated onto Si(111) surfaces is studied by Auger electron spectroscopy (AES) and low-energy electron diffraction (LEED). Surface condition, film thickness, deposition temperature, annealing temperature, and heating rate during annealing are varied. Several oriented crystalline silicide layers are observed.

    • Arsenic microdistribution and speciation in toenail clippings of children living in a historic gold mining area.

      PubMed

      Pearce, Dora C; Dowling, Kim; Gerson, Andrea R; Sim, Malcolm R; Sutton, Stephen R; Newville, Matthew; Russell, Robert; McOrist, Gordon

      2010-05-15

      Arsenic is naturally associated with gold mineralisation and elevated in some soils and mine waste around historical gold mining activity in Victoria, Australia. To explore uptake, arsenic concentrations in children's toenail clippings and household soils were measured, and the microdistribution and speciation of arsenic in situ in toenail clipping thin sections investigated using synchrotron-based X-ray microprobe techniques. The ability to differentiate exogenous arsenic was explored by investigating surface contamination on cleaned clippings using depth profiling, and direct diffusion of arsenic into incubated clippings. Total arsenic concentrations ranged from 0.15 to 2.1 microg/g (n=29) in clipping samples and from 3.3 to 130 microg/g (n=22) in household soils, with significant correlation between transformed arsenic concentrations (Pearson's r=0.42, P=0.023) when household soil was treated as independent. In clipping thin sections (n=2), X-ray fluorescence (XRF) mapping showed discrete layering of arsenic consistent with nail structure, and irregular arsenic incorporation along the nail growth axis. Arsenic concentrations were heterogeneous at 10x10 microm microprobe spot locations investigated (<0.1 to 13.3 microg/g). X-ray absorption near-edge structure (XANES) spectra suggested the presence of two distinct arsenic species: a lower oxidation state species, possibly with mixed sulphur and methyl coordination (denoted As(approximately III)(-S, -CH3)); and a higher oxidation state species (denoted As(approximately V)(-O)). Depth profiling suggested that surface contamination was unlikely (n=4), and XRF and XANES analyses of thin sections of clippings incubated in dry or wet mine waste, or untreated, suggested direct diffusion of arsenic occurred under moist conditions. These findings suggest that arsenic in soil contributes to some systemic absorption associated with periodic exposures among children resident in areas of historic gold mining activity in

    • Single-crystalline gold nanoplates from a commercial gold plating solution.

      PubMed

      Li, Zhonghao; Lapeyre, Véronique; Ravaine, Valérie; Ravaine, Serge; Kuhn, Alexander

      2009-03-01

      A novel route was proposed to synthesize gold nanoplates using a commercial gold plating solution as the reactant. Single-crystalline gold nanoplates can be successfully synthesized by reacting gold plating solution with HCl. The as-prepared nanoplates are from several micrometers to tens of micrometers in size. The effects of reactant concentration and temperature on the morphology of the gold products were investigated. The size of the gold nanoplate increases with the decrease of the amount of gold plating solution, while irregular gold nanoparticles are formed as the HCl concentration becomes low. When the reaction temperature is as low as room temperature, nanoplates with a concavity form. Specifically, it is found that the Cl- plays an important role for the formation of these gold nanoplates. The formation mechanism of the gold nanoplates is studied in detail.

    • Trace element and isotope (Sr, Nd) geochemistry of porphyry- and skarn-mineralising Late Cretaceous intrusions from Banat, western South Carpathians, Romania

      NASA Astrophysics Data System (ADS)

      Dupont, Alain; Vander Auwera, Jacqueline; Pin, Christian; Marincea, Ştefan; Berza, Tudor

      2002-08-01

      whereas in southern Banat, porphyry-style copper and molybdenum deposits predominate. These differences result from a combination of several parameters: (1) magma composition, whereby copper- and molybdenum-rich deposits tend to be associated with calc-alkaline compositions; (2) an increase of the present-day erosion level, from south to north, as indicated by the presence of large equigranular plutons in northern Banat, and of porphyritic cupolas and apophyses associated with porphyry-style mineralisation in southern Banat; (3) the nature of the host rocks, with skarns preferentially developed in calcareous host rocks; and (4) local variations of conditions controlling the infiltration of fluids and the precipitation of ore minerals.

    • Structural change from doping the gold cluster.

      PubMed

      Tang, Yiji; Wang, Shu-Guang; Li, Jia

      2011-05-01

      Doping gold clusters with a transition metal (M@Au(n)) causes structural change. To determine the mechanism by which these changes occur, the central gold atom of Au(5) was doped with its same row transition metals Pt, Ir, Os, Re, and W. Based on theoretical calculations, a similar trend was found in other gold clusters.

    • Highly active thermally stable nanoporous gold catalyst

      SciTech Connect

      Biener, Juergen; Wittstock, Arne; Biener, Monika M.; Bagge-Hansen, Michael; Baeumer, Marcus; Wichmann, Andre; Neuman, Bjoern

      2016-12-20

      In one embodiment, a system includes a nanoporous gold structure and a plurality of oxide particles deposited on the nanoporous gold structure; the oxide particles are characterized by a crystalline phase. In another embodiment, a method includes depositing oxide nanoparticles on a nanoporous gold support to form an active structure and functionalizing the deposited oxide nanoparticles.

  1. Gold, Silver and Bronze Citations.

    ERIC Educational Resources Information Center

    American School & University, 2003

    2003-01-01

    Presents the gold, silver, and bronze winners of a competition, which judged the most outstanding learning environments at educational institutions nationwide. Jurors spent two days reviewing projects, focusing on concepts and ideas that made them exceptional. For each citation, the article offers information on the firm, client, total area, total…

  2. Bimodal porous gold opals for molecular sensing

    NASA Astrophysics Data System (ADS)

    Chae, Weon-Sik; Yu, Hyunung; Ham, Sung-Kyoung; Lee, Myung-Jin; Jung, Jin-Seung; Robinson, David B.

    2013-11-01

    We have fabricated bimodal porous gold skeletons by double-templating routes using poly(styrene) colloidal opals as templates. The fabricated gold skeletons show a bimodal pore-size distribution, with small pores within spheres and large pores between spheres. The templated bimodal porous gold skeletons were applied in Raman scattering experiments to study sensing efficiency for probe molecules. We found that the bimodal porous gold skeletons showed obvious enhancement of Raman scattering signals versus that of the unimodal porous gold which only has interstitial pores of several hundred nanometers.

  3. Gold nephropathy in juvenile rheumatoid arthritis.

    PubMed

    Husserl, F E; Shuler, S E

    1979-01-01

    A 2-year-old girl was treated with gold salts for juvenile rheumatoid arthritis. Treatment had to be discontinued when persistent proteinuria was detected. As this case report indicates, close monitoring of the urine is mandatory during treatment with gold salts to detect early signs of toxicity: hematuria followed by casts and then proteinuria as therapy is continued. Histologic examination with electron microscopy will help to differentiate the different forms of gold toxicity. When the findings are consistent with gold-induced renal involvement, therapy should be discontinued. The gold nephropathy usually resolves in time, with no permanent renal damage.

  4. Gold recycling; a materials flow study

    USGS Publications Warehouse

    Amey, Earle B.

    2000-01-01

    This materials flow study includes a description of trends in consumption, loss, and recycling of gold-containing materials in the United States in 1998 in order to illustrate the extent to which gold is presently being recycled and to identify recycling trends. The quantity of gold recycled, as a percent of the apparent supply of gold, was estimated to be about 30 percent. Of the approximately 446 metric tons of gold refined in the United States in 1998, the fabricating and industrial use losses were 3 percent.

  5. Dating native gold by noble gas analyses

    NASA Technical Reports Server (NTRS)

    Niedermann, S.; Eugster, O.; Hofmann, B.; Thalmann, CH.; Reimold, W. U.

    1993-01-01

    Our recent work on He, Ne, and Ar in Alpine gold samples has demonstrated that gold is extremely retentive for He and could thus, in principle, be used for U/Th-He-4 dating. For vein-type gold from Brusson, Northern Italy, we derived a U/Th-He-4 age of 36 Ma, in agreement with the K-Ar formation age of associated muscovites and biotites. However, in placer gold from the Napf area, Central Switzerland, we observed large excesses of both He-4 and radiogenic Ar-40 (Ar-40 sub rad, defined as Ar-40-295.5-Ar-.36). The gas release systematics indicate two distinct noble gas components, one of which is released below about 800 C and the other one at the melting point of gold (1064 C). We now present results of He and Xe measurements in a 1 g placer gold sample from the river Kruempelgraben, as well as He and Ar data for Brusson vein-type gold and for gold from the Lily Gold Mine, South Africa. We calculate reasonable U/Th-He-4 as well as U-Xe ages based on those gases which are released at approximately 800 C. Probably the low-temperature components represent in-situ-produced radiogenic He and fission Xe, whereas the gases evolving when gold melts have been trapped during gold formation. Therefore, only the low-temperature components are relevant for dating purposes.

  6. Mammalian sensitivity to elemental gold (Au?)

    USGS Publications Warehouse

    Eisler, R.

    2004-01-01

    There is increasing documentation of allergic contact dermatitis and other effects from gold jewelry, gold dental restorations, and gold implants. These effects were especially pronounced among females wearing body-piercing gold objects. One estimate of the prevalence of gold allergy worldwide is 13%, as judged by patch tests with monovalent organogold salts. Eczema of the head and neck was the most common response of individuals hypersensitive to gold, and sensitivity can last for at least several years. Ingestion of beverages containing flake gold can result in allergic-type reactions similar to those seen in gold-allergic individuals exposed to gold through dermal contact and other routes. Studies with small laboratory mammals and injected doses of colloidal gold showed increased body temperatures, accumulations in reticular cells, and dose enhancement in tumor therapy; gold implants were associated with tissue injuries. It is proposed that Au? toxicity to mammals is associated, in part, with formation of the more reactive Au+ and Au3+ species.

  7. Bending Gold Nanorods with Light.

    PubMed

    Babynina, Anastasia; Fedoruk, Michael; Kühler, Paul; Meledin, Alexander; Döblinger, Markus; Lohmüller, Theobald

    2016-10-12

    V-shaped gold nanoantennas are the functional components of plasmonic metasurfaces, which are capable of manipulating light in unprecedented ways. Designing a metasurface requires the custom arrangement of individual antennas with controlled shape and orientation. Here, we show how highly crystalline gold nanorods in solution can be bent, one-by-one, into a V-shaped geometry and printed to the surface of a solid support through a combination of plasmonic heating and optical force. Significantly, we demonstrate that both the bending angle and the orientation of each rod-antenna can be adjusted independent from each other by tuning the laser intensity and polarization. This approach is applicable for the patterning of V-shaped plasmonic antennas on almost any substrate, which holds great potential for the fabrication of ultrathin optical components and devices.

  8. Biomolecular Assembly of Gold Nanocrystals

    SciTech Connect

    Micheel, Christine Marya

    2005-05-20

    Over the past ten years, methods have been developed to construct discrete nanostructures using nanocrystals and biomolecules. While these frequently consist of gold nanocrystals and DNA, semiconductor nanocrystals as well as antibodies and enzymes have also been used. One example of discrete nanostructures is dimers of gold nanocrystals linked together with complementary DNA. This type of nanostructure is also known as a nanocrystal molecule. Discrete nanostructures of this kind have a number of potential applications, from highly parallel self-assembly of electronics components and rapid read-out of DNA computations to biological imaging and a variety of bioassays. My research focused in three main areas. The first area, the refinement of electrophoresis as a purification and characterization method, included application of agarose gel electrophoresis to the purification of discrete gold nanocrystal/DNA conjugates and nanocrystal molecules, as well as development of a more detailed understanding of the hydrodynamic behavior of these materials in gels. The second area, the development of methods for quantitative analysis of transmission electron microscope data, used computer programs written to find pair correlations as well as higher order correlations. With these programs, it is possible to reliably locate and measure nanocrystal molecules in TEM images. The final area of research explored the use of DNA ligase in the formation of nanocrystal molecules. Synthesis of dimers of gold particles linked with a single strand of DNA possible through the use of DNA ligase opens the possibility for amplification of nanostructures in a manner similar to polymerase chain reaction. These three areas are discussed in the context of the work in the Alivisatos group, as well as the field as a whole.

  9. DNA-templated gold nanowires

    NASA Astrophysics Data System (ADS)

    Mohammadzadegan, Reza; Mohabatkar, Hassan; Sheikhi, Mohammad Hossein; Safavi, Afsaneh; Khajouee, Mahmood Barati

    2008-10-01

    We have developed simple methods of reproducibly creating deoxyribonucleic acid (DNA)-templated gold nanowires on silicon. First DNA nanowires were aligned on silicon surfaces. Briefly, modified silicon wafer was soaked in the DNA solution, and then the solution was removed using micropipettes; the surface tension at the moving air-solution interface is sufficient to align the DNA nanowires on the silicon wafer. In another attempt, an aqueous dispersion of sodium azide-stabilized gold nanoparticles was prepared. The nanoparticles aligned double-stranded λ-DNA to form a linear nanoparticle array. Continuous gold nanowires were obtained. The above nanowires were structurally characterized using scanning electron microscopy. The results of the characterizations show the wires to be 57-323 nm wide, to be continuous with a length of 2.8-9.5 μm. The use of DNA as a template for the self-assembly of conducting nanowires represents a potentially important approach in the fabrication of nanoscale interconnects.

  10. Distinguishing Between Legally and Illegally Produced Gold in South Africa.

    PubMed

    Roberts, Richard J; Dixon, Roger D; Merkle, Roland K W

    2016-01-01

    The identification of gold-bearing material is essential for combating the theft of gold in South Africa. Material seized in police operations is generally a mixture of gold from different mines, and as such cannot be traced back to a single location. ICP-OES analysis of material dissolved by acid dissolution provided a database of gold compositions comprising gold from South African mines, illegal gold stolen from the mines, and commercial gold alloys and jewelery. Discrimination between legal and illegal gold was possible due to the presence of Pb, As, Sb, Sn, Se, and Te in the stolen material, elements which are not present in legally produced gold. The presence of these elements is a quick and simple way to distinguish between gold alloys based on refined gold, such as in commercially manufactured jewelery, and gold alloys containing a proportion of unrefined and therefore illegally obtained gold.

  11. Physiological investigation of gold nanorods toward watermelon.

    PubMed

    Wan, Yujie; Li, Junli; Ren, Hongxuan; Huang, Jin; Yuan, Hong

    2014-08-01

    The objective of the present study was to evaluate the phytotoxicity and oxidant stress of the gold nanorods toward watermelon, and hence give a quantitative risk assessment of both seeds and plants phase. The seed germination, the activity of antioxidant enzymes, and the contents of soluble protein and malondialdehyde (MDA) have been measured while the plant roots were observed by transmission electron microscopy (TEM). It was found that the gold nanorods significantly promoted the root elongation. Furthermore, the results on the enzymes activities of plant indicated that oxidative stress happened in the plant treated with gold nanorods. However, the gold nanorods resulted in the phytotoxicity toward plant especially at high concentration. The TEM images of the plant roots with and without the treatment of gold nanorods showed the significant different size of starch granules. In conclusion, significant physiological changes of plant occurred after treatment with the gold nanorods.

  12. Template based synthesis of gold nanotubes using biologically synthesized gold nanoparticles.

    PubMed

    Ballabh, R; Nara, S

    2015-12-01

    Reliable experimental protocols using green technologies to synthesize metallic nanostructures widen their applications, both biological as well as biomedical. Here, we describe a method for synthesizing gold nanotubes using biologically synthesized gold nanoparticles in a template based approach. E. coli DH5α was used as bionanofactory to synthesize gold nanoparticles. These nanoparticles were then deposited on sodium sulfate (Na2SO4) nanowires which were employed as sacrificial template for gold nanotube (Au-NT) formation. The gold nanoparticles, sodium sulphate nanowires and gold nanotubes were appropriately characterized using transmission electron microscopy. The TEM results showed that the average diameter of gold nanotubes was 72 nm and length up to 4-7 μm. The method discussed herein is better than other reported conventional chemical synthesis approaches as it uses biologically synthesized gold nanoparticles, and does not employ any harsh conditions/solvents for template removal which makes it a clean and ecofriendly method.

  13. Electrochemical Assay of Gold-Plating Solutions

    NASA Technical Reports Server (NTRS)

    Chiodo, R.

    1982-01-01

    Gold content of plating solution is assayed by simple method that required only ordinary electrochemical laboratory equipment and materials. Technique involves electrodeposition of gold from solution onto electrode, the weight gain of which is measured. Suitable fast assay methods are economically and practically necessary in electronics and decorative-plating industries. If gold content in plating bath is too low, poor plating may result, with consequent economic loss to user.

  14. Formation of Gold(III) Alkyls from Gold Alkoxide Complexes

    PubMed Central

    2017-01-01

    The gold(III) methoxide complex (C∧N∧C)AuOMe (1) reacts with tris(p-tolyl)phosphine in benzene at room temperature under O abstraction to give the methylgold product (C∧N∧C)AuMe (2) together with O=P(p-tol)3 ((C∧N∧C) = [2,6-(C6H3tBu-4)2pyridine]2–). Calculations show that this reaction is energetically favorable (ΔG = −32.3 kcal mol–1). The side products in this reaction, the Au(II) complex [Au(C∧N∧C)]2 (3) and the phosphorane (p-tol)3P(OMe)2, suggest that at least two reaction pathways may operate, including one involving (C∧N∧C)Au• radicals. Attempts to model the reaction by DFT methods showed that PPh3 can approach 1 to give a near-linear Au–O–P arrangement, without phosphine coordination to gold. The analogous reaction of (C∧N∧C)AuOEt, on the other hand, gives exclusively a mixture of 3 and (p-tol)3P(OEt)2. Whereas the reaction of (C∧N∧C)AuOR (R = But, p-C6H4F) with P(p-tol)3 proceeds over a period of hours, compounds with R = CH2CF3, CH(CF3)2 react almost instantaneously, to give 3 and O=P(p-tol)3. In chlorinated solvents, treatment of the alkoxides (C∧N∧C)AuOR with phosphines generates [(C∧N∧C)Au(PR3)]Cl, via Cl abstraction from the solvent. Attempts to extend the synthesis of gold(III) alkoxides to allyl alcohols were unsuccessful; the reaction of (C∧N∧C)AuOH with an excess of CH2=CHCH2OH in toluene led instead to allyl alcohol isomerization to give a mixture of gold alkyls, (C∧N∧C)AuR′ (R′ = −CH2CH2CHO (10), −CH2CH(CH2OH)OCH2CH=CH2 (11)), while 2-methallyl alcohol affords R′ = CH2CH(Me)CHO (12). The crystal structure of 11 was determined. The formation of Au–C instead of the expected Au–O products is in line with the trend in metal–ligand bond dissociation energies for Au(III): M–H > M–C > M–O.

  15. Native gold in Hawaiian alkalic magma

    USGS Publications Warehouse

    Sisson, T.W.

    2003-01-01

    Native gold found in fresh basanite glass from the early submarine phase of Kilauea volcano, Hawaii, may be the first documented case of the transport of gold as a distinct precious metal phase in a mantle-derived magma. The gold-bearing glass is a grain in bedded volcanic glass sandstone (Japan Marine Science and Technology Center (JAMSTEC) sample S508-R3) collected by the submersible Shinkai 6500 at 3879 m depth off Kilauea's south flank. Extensive outcrops there expose debris-flow breccias and sandstones containing submarine-erupted alkalic rock fragments and glasses from early Kilauea. Precipitation of an immiscible gold liquid resulted from resorption of magmatic sulfides during crystallization-differentiation, with consequent liberation of sulfide-hosted gold. Elevated whole-rock gold concentrations (to 36 ppb) for fresh lavas and clasts from early Kilauea further show that some magmas erupted at the beginning stages of Hawaiian shield volcanoes were distinctly gold rich, most likely owing to limited residual sulfide in their mantle source. Alkalic magmas at other ocean islands may also be gold rich, and oceanic hot-spot provinces may contain underappreciated gold resources.

  16. Gold ink coating of thermocouple sheaths

    DOEpatents

    Ruhl, H. Kenneth

    1992-01-01

    A method is provided for applying a gold ink coating to a thermocouple sheath which includes the steps of electropolishing and oxidizing the surface of the thermocouple sheath, then dipping the sheath into liquid gold ink, and finally heat curing the coating. The gold coating applied in this manner is highly reflective and does not degrade when used for an extended period of time in an environment having a temperature over 1000.degree. F. Depending on the application, a portion of the gold coating covering the tip of the thermocouple sheath is removed by abrasion.

  17. Gold Fever! Seattle Outfits the Klondike Gold Rush. Teaching with Historic Places.

    ERIC Educational Resources Information Center

    Blackburn, Marc K.

    This lesson is based on the National Register of Historic Places registration file, "Pioneer Square Historic District," and other sources about Seattle (Washington) and the Klondike Gold Rush. The lesson helps students understand how Seattle exemplified the prosperity of the Klondike Gold Rush after 1897 when news of a gold strike in…

  18. Gold nanorod plasmonic upconversion microlaser.

    PubMed

    Shi, Ce; Soltani, Soheil; Armani, Andrea M

    2013-01-01

    Plasmonic-photonic interactions have stimulated significant interdisciplinary interest, leading to rapid innovations in solar design and biosensors. However, the development of an optically pumped plasmonic laser has failed to keep pace due to the difficulty of integrating a plasmonic gain material with a suitable pump source. In the present work, we develop a method for coating high quality factor toroidal optical cavities with gold nanorods, forming a photonic-plasmonic laser. By leveraging the two-photon upconversion capability of the nanorods, lasing at 581 nm with a 20 μW threshold is demonstrated.

  19. Precision gold conductors for HMCs

    NASA Astrophysics Data System (ADS)

    Widmer, M. R.

    1994-08-01

    Ti/Pd/Au multiple code coded switch (MCCS) networks were built and compared to Cr/Au MCCS networks. The data showed no measurable difference between the two systems. Interface resistance of both types of networks was measured as a diagnostic aid to determine if hydrogen was affecting the Ti/Pd/Au MCCS networks. The data showed that although hydrogen does affect Ti/Pd/Au, the changes are not significant with respect to MCCS environments. An evaluation of several proprietary gold electroplating solutions for use in the production of Ti/Pd/Au conductors was performed. All the testing results were comparable to the current product requirements.

  20. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry..., Silver, and Platinum Industry Products (a) Exemptions recognized in the industry and not to be considered... in any assay for quality of a silver industry product include screws, rivets, springs, spring...

  1. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry..., Silver, and Platinum Industry Products (a) Exemptions recognized in the industry and not to be considered... in any assay for quality of a silver industry product include screws, rivets, springs, spring...

  2. A Placer-Gold Evaluation Exercise.

    ERIC Educational Resources Information Center

    Tunley, A. Tom

    1984-01-01

    A laboratory exercise allowing students to use drillhole data to simulate the process of locating a placer gold paystreak is presented. As part of the activity students arithmetically compute the value of their gold, mining costs, and personal profits or losses, and decide on development plans for the claim. (BC)

  3. RF Sputtering of Gold Contacts On Niobium

    NASA Technical Reports Server (NTRS)

    Barr, D. W.

    1983-01-01

    Reliable gold contacts are deposited on niobium by combination of RF sputtering and photolithography. Process results in structures having gold only where desired for electrical contact. Contacts are stable under repeated cycling from room temperature to 4.2 K and show room-temperature contact resistance as much as 40 percent below indium contacts made by thermalcompression bonding.

  4. Sesquicentennial: Gold Rush to Golden Statehood.

    ERIC Educational Resources Information Center

    Sabato, George

    1998-01-01

    Provides an annotated bibliography of educational resources that can be used to support instructional units on the Gold Rush or the sesquicentennial of California's statehood. The materials include workbooks, videos, teacher's guides, monographs, and magazines. Offers a brief history of the Gold Rush and a set of relevant discussion questions.…

  5. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1990-07-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99% gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  6. The Gold Mining Camp: A Simulation Game.

    ERIC Educational Resources Information Center

    Stoltman, Joseph P.; Keach, Everett T., Jr.

    This economics simulation game complements the third grade Gold Mining Unit developed by Project Social Studies at the University of Minnesota. The simulation is designed for three purposes: 1) to reinforce the prior learning which occurs in the gold mining camp unit; 2) to involve eight-year-olds in the process of solving simulated economic…

  7. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1995-01-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99 gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  8. Gold-Collar Workers. ERIC Digest.

    ERIC Educational Resources Information Center

    Wonacott, Michael E.

    The gold-collar worker has problem-solving abilities, creativity, talent, and intelligence; performs non-repetitive and complex work difficult to evaluate; and prefers self management. Gold-collar information technology workers learn continually from experience; recognize the synergy of teams; can demonstrate leadership; and are strategic thinkers…

  9. Gold of the Pharaohs 6000 years of gold mining in Egypt and Nubia

    NASA Astrophysics Data System (ADS)

    Klemm, Dietrich; Klemm, Rosemarie; Murr, Andreas

    2001-08-01

    The legendary wealth in gold of ancient Egypt seems to correspond with an unexpected high number of gold production sites in the Eastern Desert of Egypt and Nubia. This contribution introduces briefly the general geology of these vast regions and discusses the geology of the different varieties of the primary gold occurrences (always related to auriferous quartz mineralization in veins or shear zones) as well as the variable physico-chemical genesis of the gold concentrations. The development of gold mining over time, from Predynastic (ca. 3000 BC) until the end of Arab gold production times (about 1350 AD), including the spectacular Pharaonic periods is outlined, with examples of its remaining artefacts, settlements and mining sites in remote regions of the Eastern Desert of Egypt and Nubia. Finally, some estimates on the scale of gold production are presented.

  10. Preparation of conductive gold nanowires in confined environment of gold-filled polymer nanotubes.

    PubMed

    Mitschang, Fabian; Langner, Markus; Vieker, Henning; Beyer, André; Greiner, Andreas

    2015-02-01

    Continuous conductive gold nanofibers are prepared via the "tubes by fiber templates" process. First, poly(l-lactide) (PLLA)-stabilized gold nanoparticles (AuNP) with over 60 wt% gold are synthesized and characterized, including gel permeation chromatography coupled with a diode array detector. Subsequent electrospinning of these AuNP with template PLLA results in composite nanofibers featuring a high gold content of 57 wt%. Highly homogeneous gold nanowires are obtained after chemical vapor deposition of 345 nm of poly(p-xylylene) (PPX) onto the composite fibers followed by pyrolysis of the polymers at 1050 °C. The corresponding heat-induced transition from continuous gold-loaded polymer tubes to smooth gold nanofibers is studied by transmission electron microscopy and helium ion microscopy using both secondary electrons and Rutherford backscattered ions.

  11. Gold emissivities for hydrocode applications

    NASA Astrophysics Data System (ADS)

    Bowen, C.; Wagon, F.; Galmiche, D.; Loiseau, P.; Dattolo, E.; Babonneau, D.

    2004-10-01

    The Radiom model [M. Busquet, Phys Fluids B 5, 4191 (1993)] is designed to provide a radiative-hydrodynamic code with non-local thermodynamic equilibrium (non-LTE) data efficiently by using LTE tables. Comparison with benchmark data [M. Klapisch and A. Bar-Shalom, J. Quant. Spectrosc. Radiat. Transf. 58, 687 (1997)] has shown Radiom to be inaccurate far from LTE and for heavy ions. In particular, the emissivity was found to be strongly underestimated. A recent algorithm, Gondor [C. Bowen and P. Kaiser, J. Quant. Spectrosc. Radiat. Transf. 81, 85 (2003)], was introduced to improve the gold non-LTE ionization and corresponding opacity. It relies on fitting the collisional ionization rate to reproduce benchmark data given by the Averroès superconfiguration code [O. Peyrusse, J. Phys. B 33, 4303 (2000)]. Gondor is extended here to gold emissivity calculations, with two simple modifications of the two-level atom line source function used by Radiom: (a) a larger collisional excitation rate and (b) the addition of a Planckian source term, fitted to spectrally integrated Averroès emissivity data. This approach improves the agreement between experiments and hydrodynamic simulations.

  12. Switchable imbibition in nanoporous gold

    PubMed Central

    Xue, Yahui; Markmann, Jürgen; Duan, Huiling; Weissmüller, Jörg; Huber, Patrick

    2014-01-01

    Spontaneous imbibition enables the elegant propelling of nano-flows because of the dominance of capillarity at small length scales. The imbibition kinetics are, however, solely determined by the static host geometry, the capillarity, and the fluidity of the imbibed liquid. This makes active control particularly challenging. Here we show for aqueous electrolyte imbibition in nanoporous gold that the fluid flow can be reversibly switched on and off through electric potential control of the solid–liquid interfacial tension, that is, we can accelerate the imbibition front, stop it, and have it proceed at will. Simultaneous measurements of the mass flux and the electrical current allow us to document simple scaling laws for the imbibition kinetics, and to explore the charge transport in the metallic nanopores. Our findings demonstrate that the high electric conductivity along with the pathways for fluid/ionic transport render nanoporous gold a versatile, accurately controllable electrocapillary pump and flow sensor for minute amounts of liquids with exceptionally low operating voltages. PMID:24980062

  13. C, O, Sr and Nd isotope systematics of carbonates of Papaghni sub-basin, Andhra Pradesh, India: Implications for genesis of carbonate-hosted stratiform uranium mineralisation and geodynamic evolution of the Cuddapah basin

    NASA Astrophysics Data System (ADS)

    Absar, Nurul; Nizamudheen, B. M.; Augustine, Sminto; Managave, Shreyas; Balakrishnan, S.

    2016-10-01

    The Cuddapah basin (CB) is one of a series of Proterozoic basins that overlie the Archaean cratons of India, and contains a unique stratiform carbonate-hosted uranium mineralisation. In the present work, we discuss stable (C, O) and radiogenic (Nd, Sr) isotope systematics of carbonates of the Papaghni sub-basin in order to understand uranium ore forming processes and geodynamic evolution of the CB. Uranium mineralised dolomites (UMDs) of the basal Vempalle Formation show a significantly lighter (~ 1.5‰) C-isotope signature compared to that of open-marine stromatolitic sub-tidal facies, suggesting input of isotopically lighter carbon through in situ remineralisation of organic matter (OM). This implies deposition in a hydrologically-restricted, redox-stratified lagoonal basin wherein exchange with open oceanic dissolved inorganic carbon (DIC) was limited. Persistent bottom water anoxia was created and maintained through consumption of dissolved oxygen (DO) by decaying OM produced in oxidised surface water zone. Significantly more radiogenic εNd(t) of UMD (- 6.31 ± 0.54) compared to that of Dharwar upper crust (- 8.64 ± 3.11) indicates that dissolved constituents did not originate from the Dharwar craton, rather were derived from more juvenile exotic sources - possibly from a continental arc. Dissolved uranyl ions (U+ 6) were introduced to the basin through fluvial run-off and were reduced to immobile uranous ions (U+ 4) at the redox interface resulting in precipitation of pitchblende and coffinite. Carbonate horizons of upper Vempalle Formation and Tadpatri Formation show progressively more radiogenic Nd isotope compositions signifying increased juvenile arc contribution to the Papaghni sub-basin through time, which is also corroborated by the presence of younger zircons (1923 ± 22 Ma) in Pulivendla quartzites. We propose that the Papaghni sub-basin opened as a back-arc extensional basin at ~ 2 Ga as a result of westerly-directed subduction of oceanic crust

  14. The interaction of gold with gallium arsenide

    NASA Technical Reports Server (NTRS)

    Weizer, Victor G.; Fatemi, Navid S.

    1988-01-01

    Gold and gold-based alloys, commonly used as solar-cell contact materials, are known to react readily with gallium arsenide. Experiments designed to identify the mechanisms involved in these GaAs-metal interactions have yielded several interesting results. It is shown that the reaction of GaAs with gold takes place via a dissociative diffusion process. It is shown further that the GaAs-metal reaction rate is controlled to a very great extent by the condition of the free surface of the contact metal, an interesting example of which is the previously unexplained increase in the reaction rate that has been observed for samples annealed in a vacuum environment as compared to those annealed in a gaseous ambient. A number of other hard-to-explain observations, such as the low-temperature formation of voids in the gold lattice and crystallite growth on the gold surface, are also explained by invoking this mechanism.

  15. Synthesis of camptothecin-loaded gold nanomaterials

    NASA Astrophysics Data System (ADS)

    Xing, Zhimin; Liu, Zhiguo; Zu, Yuangang; Fu, Yujie; Zhao, Chunjian; Zhao, Xiuhua; Meng, Ronghua; Tan, Shengnan

    2010-04-01

    Camptothecin-loaded gold nanomaterials have been synthesized by the sodium borohydride reduction method under a strong basic condition. The obtained gold nanomaterials have been characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM) and UV-vis absorption spectroscopy. The camptothecin-loaded gold colloidal solution was very stable and can be stored for more than two months at room temperature without obvious changes. The color of the colloidal solution can change from wine red to purple and blue during the acidifying process. It was revealed that the release of camptothecin and the aggregation of gold nanoparticles can be controlled by tuning the solution pH. The present study implied that the gold nanomaterials can be used as the potential carrier for CPT delivery.

  16. Ordering Gold Nanoparticles with DNA Origami Nanoflowers.

    PubMed

    Schreiber, Robert; Santiago, Ibon; Ardavan, Arzhang; Turberfield, Andrew J

    2016-08-23

    Nanostructured materials, including plasmonic metamaterials made from gold and silver nanoparticles, provide access to new materials properties. The assembly of nanoparticles into extended arrays can be controlled through surface functionalization and the use of increasingly sophisticated linkers. We present a versatile way to control the bonding symmetry of gold nanoparticles by wrapping them in flower-shaped DNA origami structures. These "nanoflowers" assemble into two-dimensonal gold nanoparticle lattices with symmetries that can be controlled through auxiliary DNA linker strands. Nanoflower lattices are true composites: interactions between the gold nanoparticles are mediated entirely by DNA, and the DNA origami will fold into its designed form only in the presence of the gold nanoparticles.

  17. Tailored nanoporous gold for ultrahigh fluorescence enhancement.

    PubMed

    Lang, X Y; Guan, P F; Fujita, T; Chen, M W

    2011-03-07

    We report molecular fluorescence enhancement of free-standing nanoporous gold in which the nanoporosity can be arbitrarily tailored by the combination of dealloying and electroless gold plating. The nanoporous gold fabricated by this facile method possesses unique porous structures with large gold ligaments and very small pores, and exhibits significant improvements in surface enhanced fluorescence as well as structure rigidity. It demonstrates that the confluence effect of improved quantum yield and excitation of fluorophores is responsible for the large fluorescence enhancement due to the near-field enhancement of nanoporous gold, which arises from the strong electromagnetic coupling between neighboring ligaments and the weakening of plasmon damping of the large ligaments because of the small pore size and large ligament size, respectively.

  18. Magnetically mediated vortexlike assembly of gold nanoshells.

    PubMed

    Sun, Jianfei; Dong, Jian; Sun, Dongke; Guo, Zhirui; Gu, Ning

    2012-04-24

    Gold nanoshells currently attract increasing research interests due to the important role in many subjects. For practical applications, random arrangement of the nanoparticles is often unfavored so that the assembly of gold nanoshells is becoming a central issue. We here proposed to utilize time-variant magnetic field to direct the assembly of gold nanoshells. It was discovered that the alternating magnetic field can mediate the vortex-like assembly of gold nanoshells. The mechanism was explored and thought to be relative with the electric field of induction which caused the thermal gradient on the substrate and the electric force. The vortexlike structure as well as the assembly mechanism will play an important role in research and application of gold nanomaterials.

  19. Molecular Beam Optical Study of Gold Sulfide and Gold Oxide

    NASA Astrophysics Data System (ADS)

    Zhang, Ruohan; Yu, Yuanqin; Steimle, Timothy

    2016-06-01

    Gold-sulfur and gold-oxygen bonds are key components to numerous established and emerging technologies that have applications as far ranging as medical imaging, catalysis, electronics, and material science. A major theoretical challenge for describing this bonding is correctly accounting for the large relativistic and electron correlation effects. Such effects are best studied in diatomic, AuX, molecules. Recently, the observed AuS electronic state energy ordering was measured and compared to a simple molecular orbital diagram prediction. Here we more thoroughly investigate the nature of the electronic states of both AuS and AuO from the analysis of high-resolution (FWHM\\cong35MHz) optical Zeeman spectroscopy of the (0,0){B}2Σ--{X}2Π3/2 bands. The determined fine and hyperfine parameters for the {B}2Σ- state of AuO differ from those extracted from the analysis of a hot, Doppler-limited, spectrum. It is demonstrated that the nature of the {B}2Σ- states of AuO and AuS are radically different. The magnetic tuning of AuO and AuS indicates that the {B}2Σ- states are heavily contaminated. Supported by the National Science Foundation under Grant No.1265885. D. L. Kokkin, R. Zhang, T. C. Steimle, I. A. Wyse, B. W. Pearlman and T. D. Varberg, J. Phys. Chem. A., 119(48), 4412, 2015. L. C. O'Brien, B. A. Borchert, A. Farquhar, S. Shaji, J. J. O'Brien and R. W. Field, J. Mol. Spectrosc., 252(2), 136, 2008

  20. Gold's future role in fuel cell systems

    NASA Astrophysics Data System (ADS)

    Cameron, Don; Holliday, Richard; Thompson, David

    Innovative recent research has suggested that gold-based catalysts are potentially capable of being effectively employed in fuel cells and related hydrogen fuel processing. The justification for developing the gold catalyst technologies described, is not only based on their promising technical performance, but also the relatively low stable price and greater availability of gold compared with the platinum group metals. The employment of gold catalysts could therefore produce a welcome reduction in the capital cost of fuel cell installations. The most likely first use for gold catalysts is for the removal of carbon monoxide impurities from the hydrogen feedstock streams used for fuel cells. Such hydrogen is usually obtained from reforming reactions (from hydrocarbons or methanol) either from free-standing plant or from an on-board reformer in a vehicle in the case of transport applications. Absence of carbon monoxide would enable fuel cells to run at lower temperatures and with improved efficiency. Effectiveness of gold catalysts in this application has already been demonstrated. Preferential oxidation (PROX) of carbon monoxide in hydrogen-rich reformer gas is best effected by a gold catalyst (Au/α-Fe 2O 3) which is significantly more active at lower temperatures than the commercial PROX catalyst, i.e. Pt/γ-Al 2O 3 currently used for this purpose. Supported gold catalysts are also very active in the water gas shift reaction used for producing hydrogen from carbon monoxide and water. Research has shown that gold supported on iron oxide (Au/α-Fe 2O 3) catalyst is more active at lower temperatures than both the α-Fe 2O 3 support and the mixed copper/zinc oxide (CuO/ZnO) catalyst currently used commercially. Preparation of gold on iron oxide and gold on titania (Au/Fe 2O 3 and Au/TiO 2) by deposition-precipitation produces more active catalysts than by conventional co-precipitation. Other applications for gold in fuel cells are described and include its use as a

  1. Coal-gold agglomeration: an alternative separation process in gold recovery

    SciTech Connect

    Akcil, A.; Wu, X.Q.; Aksay, E.K.

    2009-07-01

    Considering the increasing environmental concerns and the potential for small gold deposits to be exploited in the future, the uses of environmentally friendly processes are essential. Recent developments point to the potential for greatly increased plant performance through a separation process that combines the cyanide and flotation processes. In addition, this kind of alternative treatment processes to the traditional gold recovery processes may reduce the environmental risks of present small-scale gold mining. Gold recovery processes that applied to different types of gold bearing ore deposits show that the type of deposits plays an important role for the selection of mineral processing technologies in the production of gold and other precious metals. In the last 25 years, different alternative processes have been investigated on gold deposits located in areas where environmental issues are a great concern. In 1988, gold particles were first recovered by successful pilot trial of coal-gold agglomeration (CGA) process in Australia. The current paper reviews the importance of CGA in the production of gold ore and identifies areas for further development work.

  2. Exposure to metallic gold in patients with contact allergy to gold sodium thiosulfate.

    PubMed

    Ahnlide, I; Björkner, B; Bruze, M; Möller, H

    2000-12-01

    Gold allergy is common, with approximately 10% of patients patch tested because of eczematous disease being positive to gold sodium thiosulfate (GSTS). However, clinical relevance seems to be rare. The aim of this prospective double-blind study was to demonstrate the effects of exposure to metallic gold, in this case earrings, in gold-positive patients. 60 female patients with pierced earlobes test-positive to GSTS were included in the study. The patients were randomized into 2 groups, 30 patients receiving earrings with a surface layer consisting of 24-carat gold and 30 patients earrings with a surface layer of titanium nitride, virtually indistinguishable from gold. The patients wore the earrings for 8 weeks. During the study, any dermatitis on the earlobes, as well as on other body sites, was registered. The skin reactions observed were weak but, in total, 17 of the 60 patients had a skin reaction (local or remote) during the study, 12 of whom had received gold earrings and 5 titanium (p<0.05). 11 patients had a reaction on the earlobes, 7 of whom had received gold earrings and 4 titanium (NS). With these facts it is hard to exclude that exposure to gold jewelry can be clinically relevant in persons hypersensitive to gold.

  3. Gold-catalyzed naphthalene functionalization

    PubMed Central

    Rivilla, Iván

    2011-01-01

    Summary The complexes IPrMCl (IPr = 1,3-bis(diisopropylphenyl)imidazol-2-ylidene, M = Cu, 1a; M = Au, 1b), in the presence of one equiv of NaBAr'4 (Ar' = 3,5-bis(trifluoromethyl)phenyl), catalyze the transfer of carbene groups: C(R)CO2Et (R = H, Me) from N2C(R)CO2Et to afford products that depend on the nature of the metal center. The copper-based catalyst yields exclusively a cycloheptatriene derivative from the Buchner reaction, whereas the gold analog affords a mixture of products derived either from the formal insertion of the carbene unit into the aromatic C–H bond or from its addition to a double bond. In addition, no byproducts derived from carbene coupling were observed. PMID:21647320

  4. Gold nanoparticles in cardiovascular imaging.

    PubMed

    Varna, Mariana; Xuan, Hoa V; Fort, Emmanuel

    2017-04-06

    Although originally applied in the field of oncology, recent results have illustrated the considerable potential of gold nanoparticles (GNPs) in the imaging of cardiovascular diseases (CVDs). CVDs represent the leading cause of mortality and disability in the world. The principal cause underpinning CVDs is atherosclerosis, which develops into mid and large blood vessels, often leading to severe complications. Thanks to their unique physicochemical properties, GNPs have drawn much attention from the research community in cardiovascular imaging. Thus, the optical properties of GNPs have led to their utilization as contrast agents for optical or X-ray imaging modalities allowing the detection of atherosclerotic plaques, intravascular thrombus, or fibrotic tissue. In this study, we detail the most promising preclinical scientific progresses based on the use of GNPs for imaging in cardiovascular field and their improvements for a potential clinical application. For further resources related to this article, please visit the WIREs website.

  5. Cancer theranostics with gold nanoshells.

    PubMed

    Zhao, Jun; Wallace, Michael; Melancon, Marites P

    2014-09-01

    Gold nanoshells (AuNSs) present a vivid example of integrating nanoscience in order to solve a biomedical problem. AuNSs exhibit tunable surface plasmon resonance, which can be tuned to the near-infrared region in order to realize optimal tissue penetration. The highly efficient light-to-heat transformation by AuNSs during laser irradiation causes thermal damage to the tumor without damaging healthy organs. Transient nanobubbles can form around AuNSs during laser treatment and induce mechanical stress specifically in tumor cells. AuNSs also serve as a versatile platform for the delivery of various diagnostic and therapeutic agents. In this article, we describe the physicochemical properties of AuNSs in the context of their design, preparation and application in cancer theranostics. Ultimately, we look beyond the current research on AuNSs and discussed future challenges to their successful translation into clinical use.

  6. Annealing of gold nanostructures sputtered on polytetrafluoroethylene

    PubMed Central

    2011-01-01

    Gold nanolayers sputtered on polytetrafluoroethylene (PTFE) surface and their changes induced by post-deposition annealing at 100°C to 300°C are studied. Changes in surface morphology and roughness are examined by atomic force microscopy, electrical sheet resistance by two point technique, zeta potential by electrokinetic analysis and chemical composition by X-ray photoelectron spectroscopy (XPS) in dependence on the gold layer thickness. Transition from discontinuous to continuous gold coverage takes place at the layer thicknesses 10 to 15 nm and this threshold remains practically unchanged after the annealing at the temperatures below 200°C. The annealing at 300°C, however, leads to significant rearrangement of the gold layer and the transition threshold increases to 70 nm. Significant carbon contamination and the presence of oxidized structures on gold-coated samples are observed in XPS spectra. Gold coating leads to a decrease in the sample surface roughness. Annealing at 300°C of pristine PTFE and gold-coated PTFE results in significant increase of the sample surface roughness. PMID:22078024

  7. Functionalization of gold nanoparticles as antidiabetic nanomaterial

    NASA Astrophysics Data System (ADS)

    Venkatachalam, M.; Govindaraju, K.; Mohamed Sadiq, A.; Tamilselvan, S.; Ganesh Kumar, V.; Singaravelu, G.

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS, FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0 mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p < 0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5 mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  8. Gold nano-particles fixed on glass

    NASA Astrophysics Data System (ADS)

    Worsch, Christian; Wisniewski, Wolfgang; Kracker, Michael; Rüssel, Christian

    2012-09-01

    A simple process for producing wear resistant gold nano-particle coatings on transparent substrates is proposed. Soda-lime-silica glasses were sputtered with gold and subsequently coated with SiO2 using a combustion chemical vapor deposition technique. Some samples were first coated with silica, sputtered with gold and then coated with a second layer of silica. The samples were annealed for 20 min at either 550 or 600 °C. This resulted in the formation of round, well separated gold nano-particles with sizes from 15 to 200 nm. The color of the coated glass was equivalent to that of gold-ruby glasses. Silica/gold/silica coatings annealed at 600 °C for 20 min were strongly adherent and scratch resistant. X-ray diffraction and electron backscatter diffraction (EBSD) were used to describe the crystal orientations of the embedded particles. The gold particles are preferably oriented with their (1 1 1) planes perpendicular to the surface.

  9. Gold metal liquid-like droplets.

    PubMed

    Smirnov, Evgeny; Scanlon, Micheál D; Momotenko, Dmitry; Vrubel, Heron; Méndez, Manuel A; Brevet, Pierre-Francois; Girault, Hubert H

    2014-09-23

    Simple methods to self-assemble coatings and films encompassing nanoparticles are highly desirable in many practical scenarios, yet scarcely any examples of simple, robust approaches to coat macroscopic droplets with continuous, thick (multilayer), reflective and stable liquid nanoparticle films exist. Here, we introduce a facile and rapid one-step route to form films of reflective liquid-like gold that encase macroscopic droplets, and we denote these as gold metal liquid-like droplets (MeLLDs). The present approach takes advantage of the inherent self-assembly of gold nanoparticles at liquid-liquid interfaces and the increase in rates of nanoparticle aggregate trapping at the interface during emulsification. The ease of displacement of the stabilizing citrate ligands by appropriate redox active molecules that act as a lubricating molecular glue is key. Specifically, the heterogeneous interaction of citrate stabilized aqueous gold nanoparticles with the lipophilic electron donor tetrathiafulvalene under emulsified conditions produces gold MeLLDs. This methodology relies exclusively on electrochemical reactions, i.e., the oxidation of tetrathiafulvalene to its radical cation by the gold nanoparticle, and electrostatic interactions between the radical cation and nanoparticles. The gold MeLLDs are reversibly deformable upon compression and decompression and kinetically stable for extended periods of time in excess of a year.

  10. Gold nanoparticles produced in a microalga

    NASA Astrophysics Data System (ADS)

    Luangpipat, Tiyaporn; Beattie, Isabel R.; Chisti, Yusuf; Haverkamp, Richard G.

    2011-12-01

    An efficient biological route to production of gold nanoparticles which allows the nanoparticles to be easily recovered remains elusive. Live cells of the green microalga Chlorella vulgaris were incubated with a solution of gold chloride and harvested by centrifugation. Nanoparticles inside intact cells were identified by transmission electron microscopy and confirmed to be metallic gold by synchrotron based X-ray powder diffraction and X-ray absorption spectroscopy. These intracellular gold nanoparticles were 40-60 nm in diameter. At a concentration of 1.4% Au in the alga, a better than 97% recovery of the gold from solution was achieved. A maximum of 4.2% Au in the alga was obtained. Exposure of C. vulgaris to solutions containing dissolved salts of palladium, ruthenium, and rhodium also resulted in the production of the corresponding nanoparticles within the cells. These were surmised to be also metallic, but were produced at a much lower intracellular concentration than achieved with gold. Iridium was apparently toxic to the alga. No nanoparticles were observed using platinum solutions. C. vulgaris provides a possible route to large scale production of gold nanoparticles.

  11. Functionalization of gold nanoparticles as antidiabetic nanomaterial.

    PubMed

    Venkatachalam, M; Govindaraju, K; Mohamed Sadiq, A; Tamilselvan, S; Ganesh Kumar, V; Singaravelu, G

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS,FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p<0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  12. Nature vs. nurture: gold perpetuates "stemness".

    PubMed

    Paul, Willi; Sharma, Chandra P; Deb, Kaushik Dilip

    2011-01-01

    Adult tissues contain quiescent reservoirs of multipotent somatic stem cells and pluripotent embryonic-like stem cells (ELSCs). Credited with regenerative properties gold is used across both -contemporary and -ancient medicines. Here, we show that gold exerted these effects by enhancing the pool of pluripotent ELSC while improving their stemness. We used hESCs as an in-vitro model to understand if gold could enhance self-renewal and pluripotency. Swarna-bhasma (SB), an ancient Indian gold microparticulate (41.1 nm), preparation, reduced spontaneous-differentiation, improved self-renewal, pluripotency and proliferation of hESCs. Colloidal gold-nanoparticles (GNP) (15.59 nm) were tested to confirm that the observations were attributable to nanoparticulate-gold. SB and GNP exposure: maintained -stemness, -karyotypic stability, enhanced pluripotency till day-12, increased average colony-sizes, and reduced the number of autonomously-derived differentiated FGFR1 positive fibroblast-niche-cells/colony. Particulate-gold induced upregulation of FGFR1 and IGF2 expression, and decrease in IGF1 secretion indicates IGF1/2 mediated support for enhanced pluripotency and self-renewal in hESCs.

  13. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGES

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  14. Alkanetelluroxide-protected gold nanoparticles.

    PubMed

    Li, Ying; Silverton, Latoya C; Haasch, Richard; Tong, Yu Ye

    2008-07-15

    The synthesis and characterization of the first air-stable tellurium-containing ligand-protected gold nanoparticles (NPs) are reported. Although the synthesis largely followed the well-known Brust two-phase approach, the starting ligand was dioctyl ditelluride rather than alkanetellurol, which is an analogue of the widely used alkanethiol. Dioctyl ditelluride was used because alkanetellurol is unstable. The 1H and 13C NMR spectra, as well as infrared spectra (IR) of the formed Au NPs, indicated that the Te-Te bond in the starting ligand was broken but the octyl group was intact. This was further corroborated by the solid-state 125Te NMR spectrum that displayed a very broad and significantly downfield-shifted peak, indicating that tellurium was directly bound to the Au core. Furthermore, the O 1s and Te 3d XPS spectra of the Au NPs indicated that the capping ligands were octanetelluroxide. An average particle size of 2.7 nm diameter as measured by transmission electron microscopy (TEM) corresponded to an Au607 core. A two-step weight loss of approximately 22.2% in total was observed in the thermogravimetric analysis, which indicated about 53% ligand monolayer coverage (i.e., Au607(Te(=O)C8H17)133). Additionally, dioctyl ditelluride demonstrated an intriguing reductive power that led to a more sophisticated chemistry of forming the air-stable octanetelluroxide-protected gold NPs. It has been found that (1) when the ratio of Au to Te was about 1.5 a colorless intermediate state similar to Au(I)-SR (the intermediate state widely accepted in the synthesis of thiolate-protected Au NPs) could be obtained and (2) this kind of intermediate state played a key role in the formation of stable Au NPs.

  15. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  16. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  17. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  18. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  19. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  20. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  1. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  2. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  3. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  4. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  5. Colloidal-gold electrosensor measuring device

    DOEpatents

    Wegner, S.; Harpold, M.A.; McCaffrey, T.M.; Morris, S.E.; Wojciechowski, M.; Zhao, J.; Henkens, R.W.; Naser, N.; O`Daly, J.P.

    1995-11-21

    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 {micro}g/dL in blood samples as small as 10 {micro}L. 9 figs.

  6. Colloidal-gold electrosensor measuring device

    DOEpatents

    Wegner, Steven; Harpold, Michael A.; McCaffrey, Terence M.; Morris, Susan E.; Wojciechowski, Marek; Zhao, Junguo; Henkens, Robert W.; Naser, Najih; O'Daly, John P.

    1995-01-01

    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 .mu.g/dL in blood samples as small as 10 .mu.L.

  7. Designing hollow nano gold golf balls.

    PubMed

    Landon, Preston B; Mo, Alexander H; Zhang, Chen; Emerson, Chris D; Printz, Adam D; Gomez, Alan F; DeLaTorre, Christopher J; Colburn, David A M; Anzenberg, Paula; Eliceiri, Matthew; O'Connell, Connor; Lal, Ratnesh

    2014-07-09

    Hollow/porous nanoparticles, including nanocarriers, nanoshells, and mesoporous materials have applications in catalysis, photonics, biosensing, and delivery of theranostic agents. Using a hierarchical template synthesis scheme, we have synthesized a nanocarrier mimicking a golf ball, consisting of (i) solid silica core with a pitted gold surface and (ii) a hollow/porous gold shell without silica. The template consisted of 100 nm polystyrene beads attached to a larger silica core. Selective gold plating of the core followed by removal of the polystyrene beads produced a golf ball-like nanostructure with 100 nm pits. Dissolution of the silica core produced a hollow/porous golf ball-like nanostructure.

  8. Gold nanoparticles extraction from dielectric scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin

    2014-11-01

    The unique advantages such as brightness, non-photobleaching, good bio-compatibility make gold nanoparticles desirable labels and play important roles in biotech and related research and applications. Distinguishing gold nanoparticles from other dielectric scattering particles is of more importance, especially in bio-tracing and imaging. The enhancement image results from the localized surface plasmon resonance associated with gold nanopartilces makes themselves distinguishable from other dielectric particles, based on which, we propose a dual-wavelength detection method by employing a high sensitive cross-polarization microscopy.

  9. Electrochemical control of creep in nanoporous gold

    SciTech Connect

    Ye, Xing-Long; Jin, Hai-Jun

    2013-11-11

    We have investigated the mechanical stability of nanoporous gold (npg) in an electrochemical environment, using in situ dilatometry and compression experiments. It is demonstrated that the gold nano-ligaments creep under the action of surface stress which leads to spontaneous volume contractions in macroscopic npg samples. The creep of npg, under or without external forces, can be controlled electrochemically. The creep rate increases with increasing potential in double-layer potential region, and deceases to almost zero when the gold surface is adsorbed with oxygen. Surprisingly, we also noticed a correlation between creep and surface diffusivity, which links the deformation of nanocrystals to mobility of surface atoms.

  10. Electrically Conductive Polyimide Films Containing Gold Surface

    NASA Technical Reports Server (NTRS)

    Caplan, Maggie L.; Stoakley, Diane M.; St. Clair, Anne K.

    1994-01-01

    Polyimide films exhibiting high thermo-oxidative stability and including electrically conductive surface layers containing gold made by casting process. Many variations of basic process conditions, ingredients, and sequence of operations possible, and not all resulting versions of process yield electrically conductive films. Gold-containing layer formed on film surface during cure. These metallic gold-containing polyimides used in film and coating applications requiring electrical conductivity, high reflectivity, exceptional thermal stability, and/or mechanical integrity. They also find commercial potential in areas ranging from thin films for satellite antennas to decorative coatings and packaging.

  11. Gold nanodumbbell-seeded growth of silver nanobars and nanobipyramids

    NASA Astrophysics Data System (ADS)

    Deng, Jin-Pei; Chen, Chih-Wei; Hsieh, Wei-Chi; Wang, Chao-Hsien; Hsu, Cheng-Yung; Lin, Jyun-Hao

    2014-03-01

    Gold nanodumbbells (NDs) are prepared by the reduction of gold ions in the presence of gold nanorods. Gold NDs are then employed for the synthesis of gold-silver core-shell nanoparticles (Au@Ag NPs). The quasi-ellipsoidal NPs could be found at room temperature, but Au@Ag bar and triangular bipyramid (TBP) NPs were obtained at 75 °C. Our results show that the long ends of gold NDs are in the position of the bar center and closely paralleled the shorter edge of TBP. Mechanisms in the growth of silver on gold NDs are proposed for the formations of these Au@Ag NPs.

  12. Gold and gold-iron oxide magnetic glyconanoparticles: synthesis, characterization and magnetic properties.

    PubMed

    de la Fuente, Jesús M; Alcántara, David; Eaton, Peter; Crespo, Patricia; Rojas, Teresa C; Fernandez, Asunción; Hernando, Antonio; Penadés, Soledad

    2006-07-06

    The preparation, characterization and the magnetic properties of gold and gold-iron oxide glyconanoparticles (GNPs) are described. Glyconanoparticles were prepared in a single step procedure in the presence of aqueous solution of thiol functionalized neoglycoconjugates and either gold salts or both gold and iron salts. Neoglycoconjugates of lactose and maltose disaccharides with different linkers were used. Iron-free gold or gold-iron oxide GNPs with controlled gold-iron ratios were obtained. The average core-size diameters are in the range of 1.5-2.5 nm. The GNPs are fully characterized by (1)H NMR spectrometry, transmission electron microscopy (TEM), and UV-vis and X-ray absorption (XAS) spectroscopies. Inductive plasma-atomic emission spectrometry (ICP) and elemental analysis gave the average number of neoglycoconjugates per cluster. The magnetic properties were measured in a SQUID magnetometer. The most remarkable results was the observation of a permanent magnetism up to room temperature in the iron-free gold GNPs, that was not present in the corresponding gold-iron oxide GNPs.

  13. Structural controls on Carlin-type gold mineralization in the gold bar district, Eureka County, Nevada

    USGS Publications Warehouse

    Yigit, O.; Nelson, E.P.; Hitzman, M.W.; Hofstra, A.H.

    2003-01-01

    The Gold Bar district in the southern Roberts Mountains, 48 km northwest of Eureka, Nevada, contains one main deposit (Gold Bar), five satellite deposits, and other resources. Approximately 0.5 Moz of gold have been recovered from a resource of 1,639,000 oz of gold in Carlin-type gold deposits in lower plate, miogeoclinal carbonate rocks below the Roberts Mountains thrust. Host rocks are unit 2 of the Upper Member of the Devonian Denay Formation and the Bartine Member of the McColley Canyon Formation. Spatial and temporal relations between structures and gold mineralization indicate that both pre-Tertiary and Tertiary structures were important controls on gold mineralization. Gold mineralization occurs primarily along high-angle Tertiary normal faults, some of which are reactivated reverse faults of Paleozoic or Mesozoic age. Most deposits are localized at the intersection of northwest- and northeast-striking faults. Alteration includes decalcification, and to a lesser extent, silicification along high-angle faults. Jasperoid (pervasive silicification), which formed along most faults and in some strata-bound zones, accounts for a small portion of the ore in every deposit. In the Gold Canyon deposit, a high-grade jasperoid pipe formed along a Tertiary normal fault which was localized along a zone of overturned fault-propagation folds and thrust faults of Paleozoic or Mesozoic age.

  14. Emergency Response to Gold King Mine Release

    EPA Pesticide Factsheets

    Description of August 5, 2015 release of contaminated waters from the Gold King Mine into Cement Creek and the Animas River, and the resulting emergency response remediation efforts, including monitoring of affected waterways.

  15. Novel Catalysis by Gold: A Modern Alchemy

    NASA Astrophysics Data System (ADS)

    Haruta, Masatake

    Gold has long been neglected as a catalyst because of its chemical inertness. However, when gold is deposited as nanoparticles on carbon and polymer materials as well as on base metal oxides and hydroxides, it exhibits unique catalytic properties for many reactions such as CO oxidation at a temperature as low as 200 K, gas phase direct epoxidation of propylene, and aerobic oxidation of glucose to gluconic acid. The structure-catalytic activity correlations are discussed with emphasis on the contact structure, support selection, and the size control of gold particles. Gold clusters with diameters smaller than 2 nm are expected to exhibit novel properties in catalysis, optics, and electronics depending on the size (number of atoms), shape, and the electronic and chemical interaction with the support materials. The above achievements and attempts can be regarded as a modern alchemy that creates valuables by means of the noblest element with little practical use.

  16. Anatomy of gold catalysts: facts and myths

    PubMed Central

    Ranieri, Beatrice; Escofet, Imma

    2015-01-01

    This review article covers the main types of gold(i) complexes used as precatalysts under homogeneous conditions in organic synthesis and discusses the different ways of catalyst activation as well as ligand, silver, and anion effects. PMID:26055272

  17. Aqueous Black Colloids of Reticular Nanostructured Gold

    NASA Astrophysics Data System (ADS)

    Stanca, S. E.; Fritzsche, W.; Dellith, J.; Froehlich, F.; Undisz, A.; Deckert, V.; Krafft, C.; Popp, J.

    2015-01-01

    Since ancient times, noble gold has continuously contributed to several aspects of life from medicine to electronics. It perpetually reveals its new features. We report the finding of a unique form of gold, reticular nanostructured gold (RNG), as an aqueous black colloid, for which we present a one-step synthesis. The reticules consist of gold crystals that interconnect to form compact strands. RNG exhibits high conductivity and low reflection, and these features, coupled with the high specific surface area of the material, could prove valuable for applications in electronics and catalysis. Due to high absorption throughout the visible and infrared domain, RNG has the potential to be applied in the construction of sensitive solar cells or as a substrate for Raman spectroscopy.

  18. Radiochemical separation of gold by amalgam exchange

    USGS Publications Warehouse

    Ruch, R.R.

    1970-01-01

    A rapid and simple method for the radiochemical separation of gold after neutron activation. The technique is based on treatment with a dilute indium-gold amalgam, both chemical reduction and isotopic exchange being involved. The counting efficiency for 198Au in small volumes of the amalgam is good. Few interferences occur and the method is applicable to clays, rocks, salts and metals. The possibility of determining silver, platinum and palladium by a similar method is mentioned. ?? 1970.

  19. Silver and gold-catalyzed multicomponent reactions

    PubMed Central

    Abbiati, Giorgio

    2014-01-01

    Summary Silver and gold salts and complexes mainly act as soft and carbophilic Lewis acids even if their use as σ-activators has been rarely reported. Recently, transformations involving Au(I)/Au(III)-redox catalytic systems have been reported in the literature. In this review we highlight all these aspects of silver and gold-mediated processes and their application in multicomponent reactions. PMID:24605168

  20. U. S. GEOLOGICAL SURVEY ALASKAN GOLD PROJECT.

    USGS Publications Warehouse

    Antweiler, John C.; Cathrall, John; Tripp, Richard

    1984-01-01

    The United States Geological Survey has begun a state-wide study of Alaskan gold deposits. The immediate goals are to determine the relationship of gold in placer deposits to possible primary sources, to determine how nuggets form, to contribute to existing knowledge of principles for prospecting for placer deposits, and determine if minerals associated with placer deposits might suggest important deposits of other metals. The project started in 1982 with a study of placer mines in the Brooks Range.

  1. Orientations of polyoxometalate anions on gold nanoparticles.

    PubMed

    Sharet, Shelly; Sandars, Ella; Wang, Yifeng; Zeiri, Offer; Neyman, Alevtina; Meshi, Louisa; Weinstock, Ira A

    2012-09-07

    Cryogenic transmission electron microscopy of polyoxometalate-protected gold nanoparticles reveals that the Preyssler ion, [NaP(5)W(30)O(110)](14-), lies "face down" with its C(5) axis perpendicular to the gold surface, while the Finke-Droege ion, [P(4)W(30)Zn(4)(H(2)O)(2)O(112)](16-), is "tilted", with its long axis close to 60° from the normal to the surface.

  2. Effective PEGylation of gold nanorods

    NASA Astrophysics Data System (ADS)

    Schulz, F.; Friedrich, W.; Hoppe, K.; Vossmeyer, T.; Weller, H.; Lange, H.

    2016-03-01

    Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to dramatically improve the ligand exchange and to synthesize PEGylated AuNR with high chemical and colloidal stability and high PEG grafting densities. Such AuNR are especially interesting for applications in nanomedicine.Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to

  3. The gold rush 1925-35.

    PubMed

    Keers, R Y

    1980-12-01

    Although from the time of Koch onwards there had been desultory experiments with a variety of gold preparations in the management of pulmonary tuberculosis, gold as a recognised and accepted treatment did not emerge until 1925. In that year Holger Mollgaard of Copenhagen introduced sanocrysin, a double thiosulphate of gold and sodium, with which he had conducted an extensive series of animal experiments. The results of these were considered to justify its use in clinical practice and two physicians, Secher and Faber, undeterred by its toxicity, reported enthusiastically in its favour. Other Danish physicians followed but, alarmed by violent reactions, modified the dosage, an example followed by British workers. Encouraging results continued to be reported although each series contained a significant proportion of failures, and toxicity remained high. The first properly planned and fully controlled clinical trial took place in the United States and produced a report which was wholly adverse and which sounded the death knell of gold therapy throughout America. Until 1934-35 gold was used extensively in Europe but thereafter there was a sudden and largely universal cessation of interest and within a few years gold, introduced with such éclat and carrying so many high hopes, had vanished from the therapy of tuberculosis even though, at that point, no better alternative was available.

  4. Acoustic vibrations of single suspended gold nanostructures

    NASA Astrophysics Data System (ADS)

    Major, Todd A.

    The acoustic vibrations for single gold nanowires and gold plates were studied using time-resolved ultrafast transient absorption. The objective of this work was to remove the contribution of the supporting substrate from the damping of the acoustic vibrations of the metal nano-objects. This was achieved by suspending the nano-objects across trenches created by photolithography and reactive ion etching. Transient absorption measurements for single suspended gold nanowires were initially completed in air and water environments. The acoustic vibrations for gold nanowires over the trench in air last typically for several nanoseconds, whereas gold nanowires in water are damped more quickly. Continuum mechanics models suggest that the acoustic impedance mismatch between air and water dominates the damping rate. Later transient absorption studies on single suspended gold nanowires were completed in glycerol and ethylene glycol environments. However, our continuum mechanical model suggests nearly complete damping in glycerol due to its high viscosity, but similar damping rates are seen between the two liquids. The continuum mechanics model thus incorrectly addresses high viscosity effects on the lifetimes of the acoustic vibrations, and more complicated viscoelastic interactions occur for the higher viscosity liquids. (Abstract shortened by UMI.).

  5. Gold mobility during Palaeoarchaean submarine alteration

    NASA Astrophysics Data System (ADS)

    Hofmann, Axel; Pitcairn, Iain; Wilson, Allan

    2017-03-01

    Seafloor alteration provides large amounts of solutes to the hydrosphere. In order to investigate gold mobility during water-rock interaction prior to 3-billion-years ago, low detection limit analysis of Au concentrations was carried out on rocks from marine alteration zones. Stratiform zones recording low-temperature (≤150 °C) seafloor alteration are a characteristic feature of greenstone belts older than 3.0 Ga. Hydrothermal processes were operating on, and immediately below, the seafloor, giving rise to extensive silicification of sub-seafloor volcanic rocks and silicification of seafloor sediments. In order to investigate gold mobility during silicification, unaltered and variably silicified volcanic rocks and associated cherts from Palaeoarchaean greenstone successions (c. 3.4 Ga) of South Africa were analyzed. Results show mobility of gold during silicification of mafic/ultramafic rocks and transfer to the Archaean ocean. Some gold was incorporated into carbonaceous marine sediments overlying the alteration zones. A combination of pervasive silicification, rarity of black shales, and low gold content in komatiites can explain the low mineralization potential of Palaeoarchaean greenstone belts for orogenic gold deposits.

  6. [Sunrise gold foil jacket crown].

    PubMed

    Lecardonnel, A

    1989-09-01

    This technique permits the preparation of ceramic jacket crowns made on Sunrise laminated precious metal alloy. The Sunrise foil is gold-colored, made of 99% of precious metals and is 50 microns thick. The die is prepared in order to display a moderate and regular undercut beyond the cervical limit. The margin will be underlined with a red pencil. The Sunrise foil is cut according to predetermined templates. Then the foil is applied without burnishing, according to the technique of jacket crowns on platinum foil only by finger pressure. The double folding on closure is preferably done distally or mesially. Then, the metal base is disinserted, sandblasted with 100 microns aluminum oxide, replaced on its die, and placed in a rubber casing before being placed in the isostatic press, to be subjected to a pressure of 2,000 TSI (14 kg par cm2). Sunrise's orange color reinforces rather subtetly the overall color, making these reconstructions particularly esthetic. The color of the Sunrise metal does not require, therefore a too thick opaque. Any ceramic intended to be fired on a metal base, may be used in respecting its firing protocol. Sunrise, as any other technique of this type, require a careful preparation with a shoulder that has a rounded gingivoaxial line angle. Bridges may be built on the "thimbles" crowns, fitted on Sunrise cores, the pontics being made as a ceramo-metal framework.

  7. Gold Nanoparticle Mediated Cancer Immunotherapy

    PubMed Central

    Almeida, Joao Paulo Mattos; Figueroa, Elizabeth Raquel; Drezek, Rebekah Anna

    2013-01-01

    Significant progress has been made in the field of cancer immunotherapy, where the goal is to activate or modulate the body’s immune response against cancer. However, current immunotherapy approaches exhibit limitations of safety and efficacy due to systemic delivery. In this context, the use of nanotechnology for the delivery of cancer vaccines and immune adjuvants presents a number of advantages such as targeted delivery to immune cells, enhanced therapeutic effect, and reduced adverse outcomes. Recently, gold nanoparticles (AuNP) have been explored as immunotherapy carriers, creating new AuNP applications that merit a critical overview. This review highlights recent advances in the development of AuNP mediated immunotherapies that harness AuNP biodistribution, optical properties and their ability to deliver macromolecules such as peptides and oligonucleotides. It has been demonstrated that the use of AuNP carriers can improve the delivery and safety of immunotherapy agents, and that AuNP immunotherapies are well suited for synergistic combination therapy with existing cancer therapies like photothermal ablation. PMID:24103304

  8. Curcumin: the Indian solid gold.

    PubMed

    Aggarwal, Bharat B; Sundaram, Chitra; Malani, Nikita; Ichikawa, Haruyo

    2007-01-01

    Turmeric, derived from the plant Curcuma longa, is a gold-colored spice commonly used in the Indian subcontinent, not only for health care but also for the preservation of food and as a yellow dye for textiles. Curcumin, which gives the yellow color to turmeric, was first isolated almost two centuries ago, and its structure as diferuloylmethane was determined in 1910. Since the time of Ayurveda (1900 Bc) numerous therapeutic activities have been assigned to turmeric for a wide variety of diseases and conditions, including those of the skin, pulmonary, and gastrointestinal systems, aches, pains, wounds, sprains, and liver disorders. Extensive research within the last half century has proven that most of these activities, once associated with turmeric, are due to curcumin. Curcumin has been shown to exhibit antioxidant, anti-inflammatory, antiviral, antibacterial, antifungal, and anticancer activities and thus has a potential against various malignant diseases, diabetes, allergies, arthritis, Alzheimer's disease, and other chronic illnesses. These effects are mediated through the regulation of various transcription factors, growth factors, inflammatory cytokines, protein kinases, and other enzymes. Curcumin exhibits activities similar to recently discovered tumor necrosis factor blockers (e.g., HUMIRA, REMICADE, and ENBREL), a vascular endothelial cell growth factor blocker (e.g., AVASTIN), human epidermal growth factor receptor blockers (e.g., ERBITUX, ERLOTINIB, and GEFTINIB), and a HER2 blocker (e.g., HERCEPTIN). Considering the recent scientific bandwagon that multitargeted therapy is better than monotargeted therapy for most diseases, curcumin can be considered an ideal "Spice for Life".

  9. Evaluation of a Bacillus direct-fed microbial candidate on digesta viscosity, bacterial translocation, microbiota composition and bone mineralisation in broiler chickens fed on a rye-based diet.

    PubMed

    Latorre, J D; Hernandez-Velasco, X; Bielke, L R; Vicente, J L; Wolfenden, R; Menconi, A; Hargis, B M; Tellez, G

    2015-01-01

    1. The effects of the dietary inclusion of a Bacillus-based direct-fed microbial (DFM) candidate on digesta viscosity, bacterial translocation, microbiota composition and bone mineralisation were evaluated in broilers consuming rye-based diets. 2. In the present study, control mash rye-based diets (CON) or Bacillus-DFM supplemented diets (TRT) were administered ad libitum to male broilers in three independent experiments. 3. In Experiments 1 and 2 (n = 25/group), liver samples were taken to evaluate bacterial translocation, digesta samples were used for viscosity measurements and the intestinal microbial flora was evaluated from different intestinal sections to enumerate total recovered gram-negative bacteria (TGB), lactic acid bacteria (LAB) and anaerobic bacteria (TAB). Additionally, both tibias were removed for assessment of bone quality. 4. In Experiment 3, each experimental group had 8 replicates of 20 chickens (n = 160/group). Weekly, body weight (BW), feed intake (FI) and feed conversion ratio (FCR) were evaluated. At d 28-of-age, samples were taken to determine bacterial translocation, digesta viscosity and bone quality characteristics. 5. In all experiments, consumption of Bacillus-DFM reduced bacterial translocation to the liver and digesta viscosity. Additionally, DFM supplementation improved BW, bone quality measurements and FCR. Moreover, chickens fed on the Bacillus-DFM diet in Experiments 1 and 2 showed a significant reduction in the number of gram-negative and anaerobic bacteria in the duodenal content compared to control. 6. In summary, chickens fed on a rye-based diet without DFM inclusion showed an increase in bacterial translocation and digesta viscosity, accompanied by reduced performance and bone quality variables relative to the Bacillus-DFM candidate group. Hence, incorporation into the feed of a selected DFM ameliorated the adverse anti-nutritional effects related to utilisation of rye-based diets in broilers chickens.

  10. Tectonic setting of Late Cenozoic gold mineralization in the gold belt of Costa Rica

    SciTech Connect

    Deruyter, V.D.

    1985-01-01

    The Gold Belt of Costa Rica is a northwest-elongated zone 15 km wide by 120 km long containing numerous auriferous quartz veins and pyritic silicified patterns upon which abundant small mines are developed. Gold veins are related principally to northeast-southwest and north-south striking, steeply dipping faults. Higher grade ore and thicker veins invariably occur at intersections of these fracture orientations, indicating simultaneous opening at the time of gold introduction. Restriction of gold veins to the northwest-trending arc of Miocene Aguacate Group andesite volcanic rocks, a product of Cocos Plate subduction, suggested approximately coeval formation, but recognition by the writer of the important role played by 2-5 m.y. old altered, gold mineralized rhyolite dikes intruded along north-south gold vein structures and intimately involved with high grade ores at the Esperanza Mine and Rio Chiquito prospect, for example, suggest a much younger period of fracturing and gold introduction. The rhyolite intrusions are more brittle and stockwork mineralized than andesite host rocks and form bulk tonnage gold targets. Initiation of right-lateral movement along the north-south Panama Fracture Zone at 5 m.y.a. within the pattern of northeastward Cocos Plate subduction may have tapped rhyolites from subvolcanic magma chambers into new faults.

  11. Gold(I) Carbenoids: On-Demand Access to Gold(I) Carbenes in Solution.

    PubMed

    Sarria Toro, Juan M; García-Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S; Echavarren, Antonio M

    2017-02-06

    Chloromethylgold(I) complexes of phosphine, phosphite, and N-heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene.

  12. Gold(I) Carbenoids: On‐Demand Access to Gold(I) Carbenes in Solution

    PubMed Central

    Sarria Toro, Juan M.; García‐Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S.

    2017-01-01

    Abstract Chloromethylgold(I) complexes of phosphine, phosphite, and N‐heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene. PMID:28090747

  13. East asian gold: Deciphering the anomaly of phanerozoic gold in precambrian cratons

    USGS Publications Warehouse

    Goldfarb, R.J.; Hart, C.; Davis, G.; Groves, D.

    2007-01-01

    Early Cretaceous orogenic gold deposits in eastern Asia are globally unique in that large Phanerozoic lode gold deposits occur in Archean-Paleoproterozoic cratons. In the northern Pacific region, ca. 125 Ma orogenic gold deposits in the North China, Yangzte, and Siberian craton margins, as well as in young terranes in California, may ultimately relate to the giant Cretaceous mantle plume in the southern Pacific basin and the relatively rapid tectonic consequences along both continental margins from resulting Pacific plate reconfigurations. In eastern Asia, such consequences include reactivation of and fluid flow along major fault systems, with fluid focusing into simultaneously forming, isolated core complexes of uncertain genesis. Deposition of gold ores in previously devolatilized high-grade Precambrian metamorphic rocks requires an exotic source of ore fluid, most likely subducted Mesozoic oceanic crust and/or overlying sediment. An implication is that Phanerozoic metamorphic core complexes in other destabilized craton margins could host large gold resources. ?? 2007 by Economic Geology.

  14. Silver, gold, and alloyed silver-gold nanoparticles: characterization and comparative cell-biologic action

    NASA Astrophysics Data System (ADS)

    Mahl, Dirk; Diendorf, Jörg; Ristig, Simon; Greulich, Christina; Li, Zi-An; Farle, Michael; Köller, Manfred; Epple, Matthias

    2012-10-01

    Silver, gold, and silver-gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly( N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15-25 nm), gold (5-6 nm), and silver-gold (50:50; 10-12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver-gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver-gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver-gold nanoparticles in the concentration range of 5-20 μg mL-1 induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.

  15. Oxidation state of gold and arsenic in gold-bearing arsenian pyrite

    SciTech Connect

    Simon, G.; Huang, H.; Penner-Hahn, J.E.; Kesler, S.E.; Kao, L.S.

    1999-07-01

    XANES measurements on gold-bearing arsenian pyrite from the Twin Creeks Carlin-type gold deposits show that gold is present as both Au{sup 0} and Au{sup 1+} and arsenic is present as As{sup 1{minus}}. Au{sup 0} is attributed to sub-micrometer size inclusions of free gold, whereas Au{sup 1+} is attributed to gold in the lattice of the arsenian pyrite. STEM observations suggest that As{sup 1{minus}} is probably concentrated in angstrom-scale, randomly distributed layers with a marcasite or arsenopyrite structure. Ionic gold (Au{sup 1+}) could be concentrated in these layers as well, and is present in both twofold- and fourfold-coordinated forms, with fourfold-coordinated Au{sup 1+} more abundant. Twofold-coordinated Au{sup 1+} is similar to gold in Au{sub 2}S in which it is linearly coordinated to two sulfur atoms. The nature of fourfold-coordinated Au{sup 1+} is not well understood, although it might be present as an Au-As-S compound where gold is bonded in fourfold coordination to sulfur and arsenic atoms, or in vacancy positions on a cation site in the arsenian pyrite. Au{sup 1+} was probably incorporated into arsenian pyrite by adsorption onto pyrite surfaces during crystal growth. The most likely compound in the case of twofold-coordinated Au{sup 1+} was probably a tri-atomic surface complex such as S{sub pyrite}-Au{sup 1+}-S{sub bi-sulfide}H or Au{sup 1+}-S-Au{sup 1+}. The correlation between gold and arsenic might be related to the role of arsenic in enhancing the adsorption of gold complexes of this type on pyrite surfaces, possibly through semiconductor effects.

  16. Precipitation of lamellar gold nanocrystals in molten polymers

    NASA Astrophysics Data System (ADS)

    Palomba, M.; Carotenuto, G.

    2016-05-01

    Non-aggregated lamellar gold crystals with regular shape (triangles, squares, pentagons, etc.) have been produced by thermal decomposition of gold chloride (AuCl) molecules in molten amorphous polymers (polystyrene and poly(methyl methacrylate)). Such covalent inorganic gold salt is high soluble into non-polar polymers and it thermally decomposes at temperatures compatible with the polymer thermal stability, producing gold atoms and chlorine radicals. At the end of the gold precipitation process, the polymer matrix resulted chemically modified because of the partial cross-linking process due to the gold atom formation reaction.

  17. Engineered Gold Nanoparticles and Plant Adaptation Potential

    NASA Astrophysics Data System (ADS)

    Siddiqi, Khwaja Salahuddin; Husen, Azamal

    2016-09-01

    Use of metal nanoparticles in biological system has recently been recognised although little is known about their possible effects on plant growth and development. Nanoparticles accumulation, translocation, growth response and stress modulation in plant system is not well understood. Plants exposed to gold and gold nanoparticles have been demonstrated to exhibit both positive and negative effects. Their growth and yield vary from species to species. Cytoxicity of engineered gold nanoparticles depends on the concentration, particle size and shape. They exhibit increase in vegetative growth and yield of fruit/seed at lower concentration and decrease them at higher concentration. Studies have shown that the gold nanoparticles exposure has improved free radical scavenging potential and antioxidant enzymatic activities and alter micro RNAs expression that regulate different morphological, physiological and metabolic processes in plants. These modulations lead to improved plant growth and yields. Prior to the use of gold nanoparticles, it has been suggested that its cost may be calculated to see if it is economically feasible.

  18. Radiofrequency Heating Pathways for Gold Nanoparticles

    PubMed Central

    Collins, C. B.; McCoy, R. S.; Ackerson, B. J.; Collins, G. J.

    2015-01-01

    This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry and physics, including the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell may all strongly influence to what extent a nanoparticle heats in an RF field. Aspects of RF include: power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields, and also influence the extent to which a gold nanoparticle heats in RF. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments. PMID:24962620

  19. Therapeutic gold, silver, and platinum nanoparticles.

    PubMed

    Yamada, Miko; Foote, Matthew; Prow, Tarl W

    2015-01-01

    There are an abundance of nanoparticle technologies being developed for use as part of therapeutic strategies. This review focuses on a narrow class of metal nanoparticles that have therapeutic potential that is a consequence of elemental composition and size. The most widely known of these are gold nanoshells that have been developed over the last two decades for photothermal ablation in superficial cancers. The therapeutic effect is the outcome of the thickness and diameter of the gold shell that enables fine tuning of the plasmon resonance. When these metal nanoparticles are exposed to the relevant wavelength of light, their temperature rapidly increases. This in turn induces a localized photothermal ablation that kills the surrounding tumor tissue. Similarly, gold nanoparticles have been developed to enhance radiotherapy. The high-Z nature of gold dramatically increases the photoelectric cross-section. Thus, the photoelectric effects are significantly increased. The outcome of these interactions is enhanced tumor killing with lower doses of radiation, all while sparing tissue without gold nanoparticles. Silver nanoparticles have been used for their wound healing properties in addition to enhancing the tumor-killing effects of anticancer drugs. Finally, platinum nanoparticles are thought to serve as a reservoir for platinum ions that can induce DNA damage in cancer cells. The future is bright with the path to clinical trials is largely cleared for some of the less complex therapeutic metal nanoparticle systems.

  20. Amplitude enhancement by a gold dimer

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin; Jin, Zheng

    2016-10-01

    The unique optical properties such as brightness, non-bleaching, good bio-compatibility make gold particles ideal label candidates for molecular probes. Due to the strongly enhanced field, aggregation of gold nanoparticles finds themselves plenty of applications in bio-imaging. But limited by its small cross-section associated with nanometer sized particle, it is a big challenge to employ it in a single molecular detection. The field enhancement results from the effect of plasmonic coupling between two closely attached gold nanoparticle under the right excitation condition. With the aim to apply the gold dimer probe to find the molecules in our recently established optical detection method, we compared of the amplitude enhancement by the dimer relative to a single particle. The amplitude distribution under a highly focused illumination objective was calculated, whose results suggest that at the optimized excitation condition, the local field can be enhanced 190 fold. In consequence, experimental detection was carried out. Gold dimers were linked together by the hybridization of two single chain DNAs. Dimer and single particle probes were mixed together in one detection. Overwhelming contrast between these two kinds of probes were clearly exhibited in the experimental detection image. This method can provide a way to a high specific detection in early diagnosis.

  1. Controlling Gold Nanoclusters by Diphospine Ligands

    SciTech Connect

    Chen, Jing; Zhang, Qianfan; Bonaccorso, Timary A.; Williard, Paul G.; Wang, Lai S.

    2014-01-08

    We report the synthesis and structure determination of a new Au22 nanocluster coordinated by six bidentate diphosphine ligands: 1,8-bis(diphenylphosphino) octane (L8 for short). Single crystal x-ray crystallography and electrospray ionization mass spectrometry show that the cluster assembly is neutral and can be formulated as Au22(L8)6. The Au22 core consists of two Au11 units clipped together by four L8 ligands, while the additional two ligands coordinate to each Au11 unit in a bidentate fashion. Eight gold atoms at the interface of the two Au11 units are not coordinated by any ligands. Four short gold-gold distances (2.64?2.65 Å) are observed at the interface of the two Au11 clusters as a result of the clamping force of the four clipping ligands and strong electronic interactions. The eight uncoordinated surface gold atoms in the Au22(L8)6 nanocluster are unprecedented in atom-precise gold nanoparticles and can be considered as potential in-situ active sites for catalysis.

  2. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    NASA Technical Reports Server (NTRS)

    Venkatasubbarao, Srivatsa

    2008-01-01

    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  3. Gold grade variation and particle microchemistry in exploration pits of the Batouri gold district, SE Cameroon

    NASA Astrophysics Data System (ADS)

    Vishiti, A.; Suh, C. E.; Lehmann, B.; Egbe, J. A.; Shemang, E. M.

    2015-11-01

    The Batouri area hosts lode-gold mineralization under several-m-thick lateritic cover. Pitting to bed rock on a geochemical Au anomaly defined from previous reconnaissance soil sampling identified five horizons ranging from saprock at the base to laterite at the top. Analysis of bulk samples from each horizon by fire assay shows that most of the horizons are barren although 119 ppb and 48 ppb Au values were obtained from one laterite horizon and one saprolite horizon, respectively, from two separate pits. All the horizons were panned and particulate gold was also recovered only from these two horizons. The gold grains from both horizons are morphologically and compositionally indistinguishable with rare quartz, pyrite and galena inclusions. The grains have irregular, sub-rounded, bean to elongated shapes and they show a remarkable core-rim zonation. Electron microprobe analysis of the grains recorded high gold content in the rims (86.3-100 wt%) and along fissures within the grains (95.1-100 wt%). The cores are relatively Ag rich (11.8-14 wt% Ag) while the rims (0.63-13.7 wt% Ag, most of the values fall within the lower limit of this range) and fissures (0.03-5.02 wt% Ag) are poor in Ag. The low Ag concentration in the rims and along fissures is attributed to preferential leaching of Ag; a process recognized in gold grains and platiniferous alloys from alluvia. The core composition of the grains is similar to that of primary gold composition in the bedrock. These results show that gold in the soil is relic particulate gold derived from the primary source with no evidence of secondary gold precipitation in the weathering cycle. In all the pits no horizon was systematically enriched in gold suggesting there has been no chemical remobilization of gold in this environment. Rather the dispersion of gold here is in the particulate form. Therefore combining particulate gold features with assay data is relevant to exploration in such tropical environments.

  4. Gold nanocrystals with DNA-directed morphologies

    NASA Astrophysics Data System (ADS)

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-09-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology.

  5. Gold nanocrystals with DNA-directed morphologies

    PubMed Central

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-01-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology. PMID:27633935

  6. Galvanic gold plating for fixed dental prosthesis.

    PubMed

    Ozcelik, Tuncer Burak; Yilmaz, Burak

    2013-07-01

    Metal ceramic partial fixed dental prostheses have been commonly used for the replacement of missing teeth for many years. Because of an increase in the price of gold, base metal alloys have been the choice of alloy for the fabrication of metal ceramic restorations in many dental clinics. Some major disadvantages of base metals are their corrosion and the dark coloration they may cause at the crown margins. This article describes a galvanic gold-plating technique, which is used to minimize corrosion and improve the esthetics of metal ceramic restorations fabricated with Cr-Co base metal alloys. This technique involves the deposition of a 6 μm to 8 μm 24 K gold layer directly onto the Cr-Co cast prosthesis framework. The technique improves metal surface properties, making them more biocompatible and usable, however, requires additional equipment and experienced laboratory technicians. Clinical studies should be performed to corroborate the long term success of this technique.

  7. Catalysis by unsupported skeletal gold catalysts.

    PubMed

    Wittstock, Arne; Bäumer, Marcus

    2014-03-18

    Catalysis is one of the key technologies for the 21st century for achieving the required sustainability of chemical processes. Critical improvements are based on the development of new catalysts and catalytic concepts. In this context, gold holds great promise because it is more active and selective than other precious metal catalysts at low temperatures. However, gold becomes only chemically and catalytically active when it is nanostructured. Since the 1970s and 1980s, the first type of gold catalysts that chemists studied were small nanoparticles on oxidic supports. With the later onset of nanotechnology, a variety of nanostructured materials not requiring a support or organic stabilizers became available within about the last 10 years. Among these are gold nanofoams generated by combustion of gold compounds, nanotube membranes prepared by electroless deposition of gold inside a template, and corrosion-derived nanoporous gold. Even though these materials are macroscopic in their geometric dimensions (e.g., disks, cubes, and membranes with dimensions of millimeters), they are comprised of gold nanostructures, for example, in the form of ligaments as small as 15 nm in diameter (nanoporous gold, npAu). The nanostructure brings about a high surface to volume ratio and a large fraction of low coordinated surface atoms. In this Account, we discuss how unsupported materials are active catalysts for aerobic oxidation reaction in gas phase (oxidation of CO and primary alcohols), as well as liquid phase oxidation and reduction reactions. It turns out that the bonding and activation of molecular oxygen for gas phase oxidations strongly profits from trace amounts of an ad-metal residue such as silver. It is noteworthy that these catalysts still exhibit the special gold type chemistry, characterized by activity at very low temperatures and high selectivity for partial oxidations. For example, we can oxidize CO over these unsupported catalysts (npAu, nanotubes, and powder) at

  8. Ultrasonic-aided fabrication of gold nanofluids.

    PubMed

    Chen, Hui-Jiuan; Wen, Dongsheng

    2011-03-07

    A novel ultrasonic-aided one-step method for the fabrication of gold nanofluids is proposed in this study. Both spherical- and plate-shaped gold nanoparticles (GNPs) in the size range of 10-300 nm are synthesized. Subsequent purification produces well-controlled nanofluids with known solid and liquid contents. The morphology and properties of the nanoparticle and nanofluids are characterized by transmission electron microscopy, scanning electron microscope, energy dispersive X-ray spectroscope, X-ray diffraction spectroscopy, and dynamic light scattering, as well as effective thermal conductivities. The ultrasonication technique is found to be a very powerful tool in engineering the size and shape of GNPs. Subsequent property measurement shows that both particle size and particle shape play significant roles in determining the effective thermal conductivity. A large increase in effective thermal conductivity can be achieved (approximately 65%) for gold nanofluids using plate-shaped particles under low particle concentrations (i.e.764 μM/L).

  9. Gold(III) complexes in medicinal chemistry.

    PubMed

    Maia, Pedro Ivo da Silva; Deflon, Victor M; Abram, Ulrich

    2014-09-01

    A number of gold(III) compounds has been designed with the objective of overcoming the disadvantages associated with the platinum-based drugs for cancer treatment. Compounds of a remarkable structural manifold show significant antiproliferative effects in vitro against a number of cancer cells, including cisplatin resistant ones. The target of most of them is, unlike that of cisplatin, not the DNA. Although the mechanisms of action displayed by the gold compounds in biological media are still under investigation, many studies show evidence that the cellular targets are mitochondria-based. Recent advances in gold(III) medicinal chemistry also recommend such compounds for other pharmacological applications such as the treatment of viral or parasitic diseases. The radioactive isotopes (198)Au and (199)Au present potential in radiotherapy.

  10. Layering-induced Superlubricity: Gold on Graphite

    NASA Astrophysics Data System (ADS)

    Vanossi, Andrea; Guerra, Roberto; Tosatti, Erio; Nanofriction Group Sissa Team

    2015-03-01

    By means of realistic MD simulations, we explore the static friction trend as a function of the true contact area and the model dimensionality for 2D gold nanoislands and 3D gold nanoclusters deposited on graphite, interesting tribological systems whose slow and fast dynamics have been previously investigated. For increasing island size, because of the relative gold-graphite lattice mismatch, the interface stress energy has the chance to pile up by forming frustrated unmatched (i.e., incommensurate) regions and to develop a continuous solitonic pathway, foreshadowing a possible condition for the occurrence of ultra-low friction regimes. The significant reduction of the depinning threshold, towards superlubricity, with the system dimensionality can be ascribed to a layering-induced effective stiffness of the interface contact, favoring the natural Au-C lattice incommensurability. Partly sponsored under SNSF Sinergia Grant CRSII2 136287/1, EU ERC Grant No. 320796 MODPHYSFRICT, EU COST Action MP1303.

  11. OCT imaging enhancement of ovarian cancer using gold and gold/silver nanorods

    NASA Astrophysics Data System (ADS)

    Shi, Yiwen; Fan, Shanhui; Chen, Shuohui; Jiang, Xia; Zhao, Qingliang; Ren, Qiushi; Cui, Daxiang; Zhou, Chuanqing

    2014-11-01

    For OCT imaging, enhancing contrast efficiency will lead to significant improvements in the detection limits in cancer. Recently, noble metal nanoparticles are considered to be better contrast agents than traditional ones, especially for gold and silver. Silver nanoparticles have more attractive optical properties than gold nanoparticles. But they are employed far less because of its poor chemical stability. In this paper, we introduced our recent progress on a new application of using gold/silver alloy nanoparticles as OCT contrast agents in the detection of ovarian cancer. The scattering properties and sensitivity of silver were investigated. By means of tuning LSPR wavelengths of the nanoparticles, they were able to match the central wavelength of light used in OCT. Before carrying out animal experiments, we evaluated the different performances of alloy nanoparticles and gold nanorods in vitro. It has been sufficiently demonstrated that the alloy nanoparticles revealed stronger OCT signals than gold nanorods because of the better scattering properties. Then in vivo study, we compared the contrast enhancement of gold/silver alloy nanoparticles and gold nanorods on the ovarian cancer model mice. This study contributes a new kind of contrast agent in OCT imaging, which has a profound effect on drug delivery and further therapeutic action.

  12. Luminescent gold nanoparticles for bioimaging

    NASA Astrophysics Data System (ADS)

    Zhou, Chen

    Inorganic nanoparticles (NPs) with tunable and diverse material properties hold great potential as contrast agents for better disease management. Over the past decades, luminescent gold nanoparticles (AuNPs) with intrinsic emissions ranging from the visible to the near infrared have been synthesized and emerge as a new class of fluorophores for bioimaging. This dissertation aims to fundamentally understand the structure-property relationships in luminescent AuNPs and apply them as contrast agents to address some critical challenges in bioimaging at both the in vitro and in vivo level. In Chapter 2, we described the synthesized ~20 nm polycrystalline AuNPs (pAuNPs), which successfully integrated and enhanced plasmonic and fluorescence properties into a single AuNP through the grain size effect. The combination of these properties in one NP enabled AuNPs to serve as a multimodal contrast agent for in vitro optical microscopic imaging, making it possible to develop correlative microscopic imaging techniques. In Chapters 3-5, we proposed a feasible approach to optimize the in vivo kinetics and clearance profile of nanoprobes for multimodality in vivo bioimaging applications by using straightforward surface chemistry with luminescent AuNPs as a model. Luminescent glutathione-coated AuNPs of ~2 nm were synthesized. Investigation of the biodistribution showed that these glutathione-coated AuNPs (GS-AuNPs) exhibit stealthiness to the reticuloendothelial system (RES) organs and efficient renal clearance, with only 3.7+/-1.9% and 0.3+/-0.1% accumulating in the liver and spleen, and over 65% of the injection dose cleared out via the urine within the first 72 hours. In addition, ~2.5 nm NIR-emitting radioactive glutathione-coated [198Au]AuNPs (GS-[198Au]AuNPs) were synthesized for further evaluation of the pharmacokinetic profile of GS-AuNPs and potential multimodal imaging. The results showed that the GS-[198Au]AuNPs behave like small-molecule contrast agents in

  13. Major brazilian gold deposits - 1982 to 1999

    USGS Publications Warehouse

    Thorman, C.H.; Dewitt, E.; Maron, M.A.; Ladeira, E.A.

    2001-01-01

    Brazil has been a major but intermittent producer of gold since its discovery in 1500. Brazil led the world in gold production during the 18th and early 19th centuries. From the late 19th century to the late 20th century, total mining company and garimpeiro production was small and relatively constant at about 5 to 8 t/year. The discovery of alluvial deposits in the Amazon by garimpeiros in the 1970s and the opening of eight mines by mining companies from 1983 to 1990 fueled a major boom in Brazil's gold production, exceeding 100 t/year in 1988 and 1989. However, garimpeiro alluvial production decreased 'rapidly in the 1990s, to about 10 t/year by 1999. Company production increased about tenfold from about 4 t/year in 1982 to 40 t in 1992. Production from 1992 to the present remained relatively stable, even though several mines were closed or were in the process of closing and no new major mines were put into production during that period. Based on their production history from 1982-1999, 17 gold mines are ranked as major (> 20 t) and minor (3-8 t) mines. From 1982-1999, deposits hosted in Archean rocks produced 66% of the gold in Brazil, whereas deposits in Paleoproterozoic and Neoproterozoic rocks accounted for 19% and 15%, respectively. Deposits in metamorphosed sedimentary rocks, especially carbonate-rich rocks and carbonate iron-formation, yielded the great bulk of the gold. Deposits in igneous rocks were of much less importance. The Archean and Paleoproterozoic terranes of Brazil largely lack base-metal-rich volcanogenic massive sulfide deposits, porphyry deposits, and polymetallic veins and sedimentary exhalative deposits. An exception to this is in the Caraja??s Mineral Province.

  14. Rheumatoid arthritis, gold therapy, contact allergy and blood cytokines

    PubMed Central

    Svensson, Åke; Möller, Halvor; Björkner, Bert; Bruze, Magnus; Leden, Ido; Theander, Jan; Ohlsson, Kjell; Linder, Carina

    2002-01-01

    Objective To study the clinical and biochemical effects of a low starting dose for gold therapy in rheumatoid arthritis patients with a contact allergy to gold. Methods Serum cytokines were assayed before and 24 h after the first injection of gold sodium thiomalate (GSTM). Results Contact allergy to gold was found in 4 of 19 patients. Compared to gold-negative patients (starting dose: 10 mg GSTM), there was a larger increase in serum TNFalpha (p < 0.05), sTNF-R1 (NS), and IL-1 ra (p < 0.05) in gold-allergic patients. Conclusions Cytokines are released in blood by GSTM in RA patients with gold allergy. To minimize the risk of acute adverse reactions the starting dose of GSTM should be lowered to 5 mg. Alternatively, patients should be patch-tested before gold therapy; in test-positive cases, 5 mg is recommended as the first dose. PMID:11860615

  15. 14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, c. 1937. DATE BASED ON USE IN PUBLICATION. CREDIT WR. - Bald Mountain Gold Mill, Nevada Gulch at head of False Bottom Creek, Lead, Lawrence County, SD

  16. OVERVIEW OF GOLD HILL MILL, ROAD, AND WARM SPRINGS CAMP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OVERVIEW OF GOLD HILL MILL, ROAD, AND WARM SPRINGS CAMP BUILDINGS, LOOKING SOUTH SOUTHEAST. THE FUNCTION OF THE FLAT AREA AT CENTER RIGHT IS UNKNOWN. - Gold Hill Mill, Warm Spring Canyon Road, Death Valley Junction, Inyo County, CA

  17. Nanosecond laser ablation of gold nanoparticle films

    SciTech Connect

    Ko, Seung H.; Choi, Yeonho; Hwang, David J.; Grigoropoulos, Costas P.; Chung, Jaewon; Poulikakos, Dimos

    2006-10-02

    Ablation of self-assembled monolayer protected gold nanoparticle films on polyimide was explored using a nanosecond laser. When the nanoparticle film was ablated and subsequently thermally sintered to a continuous film, the elevated rim structure by the expulsion of molten pool could be avoided and the ablation threshold fluence was reduced to a value at least ten times lower than the reported threshold for the gold film. This could be explained by the unusual properties of nanoparticle film such as low melting temperature, weak bonding between nanoparticles, efficient laser energy deposition, and reduced heat loss. Finally, submicron lines were demonstrated.

  18. Plasmonics of Gold Nanorods. Considerations for Biosensing

    NASA Astrophysics Data System (ADS)

    Liz-Marzán, Luis M.; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel

    In this chapter, we explore the sensitivity of gold nanorods toward changes in the dielectric constant of the surrounding medium. Experimental data for pure and silica-coated nanorods with varying shell thickness are compared to calculations based on the boundary element method (BEM). They indicate that anisotropy and sharp tips make nanoparticles more environmentally sensitive. We also find that sensitivity decreases as silica shell thickness increases, as expected from a dielectric screening effect. Even when coated with thin shells, gold nanorods are found to be excellent candidates for biosensing applications.

  19. Current methods for synthesis of gold nanoparticles.

    PubMed

    Herizchi, Roya; Abbasi, Elham; Milani, Morteza; Akbarzadeh, Abolfazl

    2016-01-01

    Metal nanoparticles, such as nanoparticles synthesized using gold, have numerous uncommon chemical and physical properties due to the effects of their quantum size and their large surface area, in comparison with other metal atoms or bulk metal. Gold nanoparticles (GNPs), in particular, are very attractive because of their size and shape-dependent properties. Metal nanoparticles have gathered extensive attention due to their uncommon properties and promising applications in photonics, electronics, biochemical sensing, and imaging. This review covers recent advances in the synthesis of GNPs.

  20. Functionalized Gold Nanoparticles and Their Biomedical Applications

    PubMed Central

    Tiwari, Pooja M.; Vig, Komal; Dennis, Vida A.; Singh, Shree R.

    2011-01-01

    Metal nanoparticles are being extensively used in various biomedical applications due to their small size to volume ratio and extensive thermal stability. Gold nanoparticles (GNPs) are an obvious choice due to their amenability of synthesis and functionalization, less toxicity and ease of detection. The present review focuses on various methods of functionalization of GNPs and their applications in biomedical research. Functionalization facilitates targeted delivery of these nanoparticles to various cell types, bioimaging, gene delivery, drug delivery and other therapeutic and diagnostic applications. This review is an amalgamation of recent advances in the field of functionalization of gold nanoparticles and their potential applications in the field of medicine and biology.

  1. Crack injection in silver gold alloys

    NASA Astrophysics Data System (ADS)

    Chen, Xiying

    Stress corrosion cracking (SCC) is a materials degradation phenomena resulting from a combination of stress and a corrosive environment. Among the alphabet soup of proposed mechanism of SCC the most important are film-rupture, film-induced cleavage and hydrogen embrittlement. This work examines various aspects of film-induced cleavage in gold alloys for which the operation of hydrogen embrittlement processes can be strictly ruled out on thermodynamic grounds. This is so because in such alloys SCC occurs under electrochemical conditions within which water is stable to hydrogen gas evolution. The alloy system examined in this work is AgAu since the corrosion processes in this system occur by a dealloying mechanism that results in the formation of nanoporous gold. The physics behind the dealloying process as well as the resulting formation of nanoporous gold is today well understood. Two important aspects of the film-induced cleavage mechanism are examined in this work: dynamic fracture in monolithic nanoporous gold and crack injection. In crack injection there is a finite thickness dealloyed layer formed on a AgAu alloy sample and the question of whether or not a crack that nucleates within this layer can travel for some finite distance into the un-corroded parent phase alloy is addressed. Dynamic fracture tests were performed on single edge-notched monolithic nanoporous gold samples as well as "infinite strip" sample configurations for which the stress intensity remains constant over a significant portion of the crack length. High-speed photography was used to measure the crack velocity. In the dynamic fracture experiments cracks were observed to travel at speeds as large as 270 m/s corresponding to about 68% of the Raleigh wave velocity. Crack injection experiments were performed on single crystal Ag77Au23, polycrystalline Ag72Au28 and pure gold, all of which had thin nanoporous gold layers on the surface of samples. Through-thickness fracture was seen in both the

  2. Shape-controlled Synthesis of Gold Nanoparticles from Gold(III)-chelates of β-diketones

    NASA Astrophysics Data System (ADS)

    Kundu, Subrata; Pal, Anjali; Ghosh, Sujit Kumar; Nath, Sudip; Panigrahi, Sudipa; Praharaj, Snigdhamayee; Basu, Soumen; Pal, Tarasankar

    2005-12-01

    Chelating ligands with β-diketone skeleton have been employed for the first time as reductant to produce ligand stabilized gold nanoparticles of different shapes out of aqueous HAuCl4 solutions. Evolution of stable gold nanoparticles happens to be first order with respect to gold particles having rate constants ˜ ˜10-2 min-1 and subsequent chlorine insertion in the β-diketone skeleton is reported as a general feature. Spherical or triangular or hexagonal particle evolution goes selectively under the influence of different β-diketones in terms of capping and reducing capabilities of the reductants.

  3. Self-assembly of 4-ferrocene thiophenol capped electroactive gold nanoparticles onto gold electrode

    NASA Astrophysics Data System (ADS)

    Li, Di; Li, Jinghong

    2003-01-01

    Gold nanoparticles capped by 4-ferrocene thiophenol with an average core size of 2.5 nm and surface plasmon absorbance at 522 nm were place-exchanged with 1,8-octanedithiol, and then self-assembled onto the gold electrode via tail SH group. The self-assembly was characterized by X-ray photoelectron spectroscopy. Cyclic voltammograms examined the coverage fraction of the self-assembled monolayers of the electroactive gold nanoparticles and the formal potential of the indicated SAMs. Further experiments exhibited that the electrode process was controlled by surface confined faradic reactions.

  4. Fractionation of gold in a differentiated tholeiitic dolerite

    USGS Publications Warehouse

    Rowe, J.J.

    1969-01-01

    Gold content was determined, by neutron-activation analysis, in samples from a drill core through the Great Lake sheet, Tasmania, a differentiated tholeiitic dolerite. The gold content of parts of the core seems to be related to the mafic index. The variation of gold content with depth and mafic index is similar to that of copper, indicating that gold and copper may have been concomitantly crystallized from the magma. ?? 1969.

  5. Early Yellowstone hotspot magmatism and gold metallogeny

    NASA Astrophysics Data System (ADS)

    Hames, Willis; Unger, Derick; Saunders, James; Kamenov, George

    2009-11-01

    High-grade epithermal gold deposits in the Northern Great Basin have long been associated with regional Miocene basaltic to rhyolitic volcanism. Previous models for the low-sulfidation epithermal gold ores in this region have generally portrayed the bimodal magmas as a source of heat to drive large-scale convection of meteoritic water that leached gold from crustal sources and deposited it in hydrothermal vein systems, or required that the gold evolve from fractionated silicic magmas. New data of the present study indicate a more direct genetic link to the plume-related basaltic magmas of the region. Laser 40Ar/ 39Ar incremental heating plateau ages for single crystals of adularia from several of these low-sulfidation epithermal gold deposits range from 16.6 Ma to 15.5 Ma. Adularia from the Jumbo deposit yields three concordant plateau ages with a combined statistical result of 16.54 ± 0.04 Ma (95% confidence level, MSWD = 0.23). Plateau ages for adularia from other deposits in the region, and from gold-bearing veins in the Owyhee Mountains of southwestern Idaho, yield similar ages up to ~16.5 Ma, however some veins are as young as ca. 15.5 Ma and the grain-to-grain ages for a given sample can vary by up to ca. 0.5 Ma. Observed variations in age among the adularia crystals of a given rock sample indicate varying amounts of extraneous argon, and also loss of radiogenic 40Ar, among the population of grains for a particular sample. The single-crystal results are interpreted to indicate a 16.5-15.5 Ma interval for formation of gold-bearing adularia veins in the region. The initiation and duration of this gold-forming event appears contemporaneous (within uncertainties) with the basaltic volcanism at the Steens Mountain section and an ensuing one-million-year episode of basaltic volcanism from multiple centers in the region ( Brueseke et al., 2007). Trace amounts of lead are alloyed with gold in the deposits studied. The isotopic compositions of this lead are not

  6. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.

    2007-06-05

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  7. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.

    2009-07-07

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  8. Link between ridge subduction and gold mineralization in southern Alaska

    USGS Publications Warehouse

    Haeussler, Peter J.; Bradley, Dwight C.; Goldfarb, Richard; Snee, Lawrence W.; Taylor, Cliff D.

    1995-01-01

    40Ar/39Ar geochronology reveals that turbidite-hosted gold deposits in the southern Alaska accretionary prism are the same age as nearby near-trench plutons. These early Tertiary plutons and gold lodes formed above a slab window during subduction of an oceanic spreading center. Ridge subduction is a previously unrecognized tectonic process for the generation of lode gold.

  9. Gold nanoparticles: preparation, functionalisation and applications in biochemistry and immunochemistry

    NASA Astrophysics Data System (ADS)

    Dykman, Lev A.; Bogatyrev, Vladimir A.

    2007-02-01

    The review summarises data on the synthesis and functionalisation of gold nanoparticles and their applications in biological investigations. Particular attention is given to applications of colloidal gold in solid-phase assays, immunoassay and studies of biologically active compounds by vibrational spectroscopy. A special section deals with the use of gold nanoparticles as antigen carriers in immunisation.

  10. 77 FR 60279 - Gold Star Mother's and Family's Day, 2012

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-03

    ... Documents#0;#0; ] Proclamation 8872 of September 28, 2012 Gold Star Mother's and Family's Day, 2012 By the... upholding the sacred trust we share with our Gold Star families and the heroes we have laid to rest. Let us... designated the last Sunday in September as ``Gold Star Mother's Day.'' NOW, THEREFORE, I, BARACK...

  11. 76 FR 60355 - Gold Star Mother's and Family's Day, 2011

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-28

    ... Documents#0;#0; ] Proclamation 8722 of September 23, 2011 Gold Star Mother's and Family's Day, 2011 By the... never fully repay, and the enormity of the grief their families carry we can never fully know. Gold Star... heartbreaking loss, our Gold Star families continue to support one another, serve their communities, and...

  12. 75 FR 60283 - Gold Star Mother's and Families' Day, 2010

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-29

    ... Documents#0;#0; ] Proclamation 8569 of September 24, 2010 Gold Star Mother's and Families' Day, 2010 By the... those who share in that ultimate sacrifice: America's Gold Star Mothers and Families. For those in our... exceptional spirit of service dwells in the pride of Gold Star parents, who instilled the values that...

  13. 78 FR 60179 - Gold Star Mother's and Family's Day, 2013

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... Documents#0;#0; ] Proclamation 9025 of September 26, 2013 Gold Star Mother's and Family's Day, 2013 By the... their example. On this day, we remember our commitment to the Gold Star mothers and families who carry... is over, we will continue to give our military and Gold Star families the care and support...

  14. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  15. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  16. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  17. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  18. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  19. Gold in meteorites and in the earth's crust

    USGS Publications Warehouse

    Jones, Robert Sprague

    1968-01-01

    The reported gold contents of meteorites range from 0.0003 to 8.74 parts per million. Gold is siderophilic, and the greatest amounts in meteorites are in the iron phases. Estimates ,of the gold content of the earth's crust are in the range of 0.001 to 0.006 parts per million.

  20. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  1. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  2. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  3. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  4. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  5. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  6. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  7. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  8. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  9. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  10. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  11. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  12. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  13. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  14. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  15. Noble gases, K, U, Th, and Pb in native gold

    NASA Astrophysics Data System (ADS)

    Engster, O.; Niedermann, S.; Thalmann, C.; Frei, R.; Kramers, J.; KräHenbühl, U.; Liu, Y. Z.; Hofmann, B.; Boer, R. H.; Reimold, W. U.; Bruno, L.

    1995-12-01

    We present determinations of the noble gas and Pb isotopic abundances and of K, Th, and U concentrations of native gold. Our results demonstrate that gold is an excellent carrier for crustal volatiles, but direct dating of gold using the U, Th-4He, 40K-40Ar, and U fission Xe methods was not successful for various reasons. The main significance of this work is the great sensitivity of gold for trapped gases as well as for gases that were produced in situ which gives the prospects of using gold and its fluid and solid inclusions for the study of paleogas composition. Numerous nuclear effects characterize the noble gas inventory of placer gold from Switzerland and Italy, vein gold from Italy, South Africa, and Venezuela, and lode gold from South Africa. The degassing patterns obtained by mass spectrometry show a low-temperature release of volatiles around 500°C from fluid inclusions mainly in vein gold and a high-temperature release from solid inclusions and the gold itself. The low-temperature volatiles represent species that were trapped when the gold crystallized. We investigated the following trapped species: the isotopes of He, Ne, Ar, Kr, Xe, and Pb, and the abundances of K, U, Th, H2O, and CO2. The crustal gases trapped by gold comprise 3He from 6Li(n,α)3H → β- → 3He, 4He and 40Ar from the U, Th, and K decay, and Xe from 238U fission. We observe 4He/40Ar = 3.9 for the radiogenic trapped gases of tertiary gold and a ratio of 1.4 for Archean gold. These ratios are consistent with the production ratios from U and K at the respective times and demonstrate that gold can be used as a sampler of ancient atmospheric gases. The concentrations of U and Th range from a few parts per billion to a few parts per million, and those of K and Pb range up to some tens of parts per million. The antiquity of trapped Pb is indicated by the Pb-Pb model age of about 3000 Ma for the lead extracted from vein gold and quartz of the Lily gold mine (South Africa). Gold also

  16. Demonstration of enhancement of x-ray flux with foam gold compared to solid gold

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Ding, Yongkun; Lin, Zhiwei; Li, Hang; Jing, Longfei; Yuan, Zheng; Yang, Zhiwen; Tan, Xiulan; Kuang, Longyu; Zhang, Wenhai; Li, Liling; Li, Ping; Yuan, Guanghui; Jiang, Shaoen; Zhang, Baohan

    2016-03-01

    Experiments have been conducted to compare the re-emission from foam gold with a 0.3 g cc-1 density and solid gold in a SGIII prototype laser facility. Measurements of the re-emission x-ray flux demonstrate that emission is enhanced by the low density foam gold compared to the solid gold under the same conditions. The emission fraction increases with time and is concentrated on soft x-ray flux between 0.1-1 keV. The simulation results with Multi 1D agree with the experimental results. There are potential advantages to using foam walls for improving the emission and soft x-ray flux in hohlraums.

  17. Near Infrared Resonant Gold / Gold Sulfide Nanoparticles as a Photothermal Cancer Therapeutic Agent

    PubMed Central

    Gobin, André M.; Watkins, Emily M.; Quevedo, Elizabeth; Colvin, Vicki L.; West, Jennifer L.

    2010-01-01

    The development and optimization of near-infrared (nIR) absorbing nanoparticles for use as photothermal cancer therapeutic agents has been ongoing. We have previously reported on larger layered gold / silica nanoshells (~140 nm) for combined therapy and imaging applications. This work exploits the properties of smaller gold / gold sulfide (GGS) nIR absorbing nanoparticles (~35–55 nm) that provide higher absorption (98% absorption & 2% scattering for GGS versus 70% absorption & 30% scattering for gold/silica nanoshells) as well as potentially better tumor penetration. In this work we demonstrate ability to ablate tumor cells in vitro, and efficacy for photothermal cancer therapy, where in an in vivo model we show significantly increased long-term, tumor-free survival. Further, enhanced circulation and bio-distribution is observed in vivo. This class of nIR absorbing nanoparticles has potential to improve upon photothermal tumor ablation for cancer therapy. PMID:20183810

  18. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates.

    PubMed

    Dorel, Ruth; Echavarren, Antonio M

    2015-08-07

    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes.

  19. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates

    PubMed Central

    2015-01-01

    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes. PMID:26061916

  20. Gold Nanoparticle Hyperthermia Reduces Radiotherapy Dose

    PubMed Central

    Lin, Lynn; Slatkin, Daniel N.; Dilmanian, F. Avraham; Vadas, Timothy M.; Smilowitz, Henry M.

    2014-01-01

    Gold nanoparticles can absorb near infrared light, resulting in heating and ablation of tumors. Gold nanoparticles have also been used for enhancing the dose of X-rays in tumors during radiotherapy. The combination of hyperthermia and radiotherapy is synergistic, importantly allowing a reduction in X-ray dose with improved therapeutic results. Here we intratumorally infused small 15 nm gold nanoparticles engineered to be transformed from infrared-transparent to infrared-absorptive by the tumor, which were then heated by infrared followed by X-ray treatment. Synergy was studied using a very radioresistant subcutaneous squamous cell carcinoma (SCCVII) in mice. It was found that the dose required to control 50% of the tumors, normally 55 Gy, could be reduced to <15 Gy (a factor of >3.7). Gold nanoparticles therefore provide a method to combine hyperthermia and radiotherapy to drastically reduce the X-ray radiation needed, thus sparing normal tissue, reducing the side effects, and making radiotherapy more effective. PMID:24990355

  1. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-01-01

    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24198458

  2. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2013-01-01

    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24163578

  3. Gold Creek: Preserving an Environmental Studies Center.

    ERIC Educational Resources Information Center

    Brooks, Suzanne

    In response to a Board of Trustees request for information and recommendations concerning the future use of the Gold Creek property owned by the Los Angeles Community College District, this report emphasizes that the use of this site for instructional field experiences enhances the quality of environmental education for the district's diverse…

  4. Crystalline and amorphous gold in chrysiasis.

    PubMed

    Benn, H P; von Gaudecker, B; Czank, M; Loeffler, H

    1990-01-01

    Skin biopsy specimens from five patients (three females and two males) treated parenterally with gold were investigated using transmission electron microscopy. X-ray microanalysis and electron diffraction were used to determine the dermal heavy metal content. Additional sections were stained for light microscopic examination. The amount of elemental gold administered to the patients over a period of years to alleviate rheumatoid arthritis lay between a minimum of 4.0 g and a maximum of 10.0 g. In one and the same patient dermal histiocytic gold aggregations in sun-exposed areas of skin displayed a different pattern and divergent physiochemical states from the gold deposits in non-UV-exposed skin, where aurosome-like amorphous formations are found in the cells of the upper dermis. Additional spherical particles are associated predominantly with phagolysosomes in melanophages beneath solar-irradiated epidermis. Convergent beam electron diffraction proves the crystalline nature of the spherical auriferous deposits. The occurrence of skin rash was not related to different physicochemical states of the precious metal.

  5. Applications of gold nanoparticles in cancer nanotechnology.

    PubMed

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-09-19

    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  6. Applications of gold nanoparticles in cancer nanotechnology.

    PubMed

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-09-01

    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  7. Functionalized gold nanorods for molecular optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Eghtedari, Mohammad; Oraevsky, Alexander; Conjusteau, Andre; Copland, John A.; Kotov, Nicholas A.; Motamedi, Massoud

    2007-02-01

    The development of gold nanoparticles for molecular optoacoustic imaging is a very promising area of research and development. Enhancement of optoacoustic imaging for molecular detection of tumors requires the engineering of nanoparticles with geometrical and molecular features that can enhance selective targeting of malignant cells while optimizing the sensitivity of optoacoustic detection. In this article, cylindrical gold nanoparticles (i.e. gold nanorods) were fabricated with a plasmon resonance frequency in the near infra-red region of the spectrum, where deep irradiation of tissue is possible using an Alexandrite laser. Gold nanorods (Au-NRs) were functionalized by covalent attachment of Poly(ethylene glycol) to enhance their biocompatibility. These particles were further functionalized with the aim of targeting breast cancer cells using monoclonal antibodies that binds to Her2/neu receptors, which are over expressed on the surface of breast cancer cells. A custom Laser Optoacoustic Imaging System (LOIS) was designed and employed to image nanoparticle-targeted cancer cells in a phantom and PEGylated Au-NRs that were injected subcutaneously into a nude mouse. The results of our experiments show that functionalized Au-NRs with a plasmon resonance frequency at near infra-red region of the spectrum can be detected and imaged in vivo using laser optoacoustic imaging system.

  8. The golden age: gold nanoparticles for biomedicine.

    PubMed

    Dreaden, Erik C; Alkilany, Alaaldin M; Huang, Xiaohua; Murphy, Catherine J; El-Sayed, Mostafa A

    2012-04-07

    Gold nanoparticles have been used in biomedical applications since their first colloidal syntheses more than three centuries ago. However, over the past two decades, their beautiful colors and unique electronic properties have also attracted tremendous attention due to their historical applications in art and ancient medicine and current applications in enhanced optoelectronics and photovoltaics. In spite of their modest alchemical beginnings, gold nanoparticles exhibit physical properties that are truly different from both small molecules and bulk materials, as well as from other nanoscale particles. Their unique combination of properties is just beginning to be fully realized in range of medical diagnostic and therapeutic applications. This critical review will provide insights into the design, synthesis, functionalization, and applications of these artificial molecules in biomedicine and discuss their tailored interactions with biological systems to achieve improved patient health. Further, we provide a survey of the rapidly expanding body of literature on this topic and argue that gold nanotechnology-enabled biomedicine is not simply an act of 'gilding the (nanomedicinal) lily', but that a new 'Golden Age' of biomedical nanotechnology is truly upon us. Moving forward, the most challenging nanoscience ahead of us will be to find new chemical and physical methods of functionalizing gold nanoparticles with compounds that can promote efficient binding, clearance, and biocompatibility and to assess their safety to other biological systems and their long-term term effects on human health and reproduction (472 references).

  9. Gold Creek: An Environmental Studies Center.

    ERIC Educational Resources Information Center

    Woodley, Laurel

    A description is provided of the Gold Creek Ecological Reserve, 240 acres of undisturbed land in Northeast Los Angeles County, which serves the Los Angeles Community College District (LACCD) as an outdoor laboratory for students and faculty in numerous disciplines. Section I provides introductory information on the reserve and its features, which…

  10. Gold(III)-Catalyzed Hydration of Phenylacetylene

    ERIC Educational Resources Information Center

    Leslie, J. Michelle; Tzeel, Benjamin A.

    2016-01-01

    A guided inquiry-based experiment exploring the regioselectivity of the hydration of phenylacetylene is described. The experiment uses an acidic gold(III) catalyst in a benign methanol/water solvent system to introduce students to alkyne chemistry and key principles of green chemistry. The experiment can be easily completed in approximately 2 h,…

  11. Hydroquinone Based Synthesis of Gold Nanorods.

    PubMed

    Picciolini, Silvia; Mehn, Dora; Ojea-Jiménez, Isaac; Gramatica, Furio; Morasso, Carlo

    2016-08-10

    Gold nanorods are an important kind of nanoparticles characterized by peculiar plasmonic properties. Despite their widespread use in nanotechnology, the synthetic methods for the preparation of gold nanorods are still not fully optimized. In this paper we describe a new, highly efficient, two-step protocol based on the use of hydroquinone as a mild reducing agent. Our approach allows the preparation of nanorods with a good control of size and aspect ratio (AR) simply by varying the amount of hexadecyl trimethylammonium bromide (CTAB) and silver ions (Ag(+)) present in the "growth solution". By using this method, it is possible to markedly reduce the amount of CTAB, an expensive and cytotoxic reagent, necessary to obtain the elongated shape. Gold nanorods with an aspect ratio of about 3 can be obtained in the presence of just 50 mM of CTAB (versus 100 mM used in the standard protocol based on the use of ascorbic acid), while shorter gold nanorods are obtained using a concentration as low as 10 mM.

  12. Shape-Controlled Gold Nanoparticle Synthesis

    DTIC Science & Technology

    2013-09-01

    shaped nanoparticles were produced. Liu and Guyot -Sionnest (9) showed through high-resolution transmission electron microscopy (TEM) that citrate-capped...14317. 9. Liu, M.; Guyot -Sionnest, P. Mechanism of Silver (I)-Assisted Growth of Gold Nanorods and Bipyramids. The Journal of Physical Chemistry B

  13. WILLIAM GOLDING'S NOVEL--THE BACKWARD LOOK.

    ERIC Educational Resources Information Center

    PECK, CAROL FAULKNER

    THE "SURPRISE ENDINGS" IN EACH OF WILLIAM GOLDING'S FIRST FOUR NOVELS OCCUR WHEN THE POINT OF VIEW SHIFTS FROM THE LIMITED WORLD OF THE NOVEL TO THE UNLIMITED WORLD OF REALITY. THE BOYS' RESCUE BY THE UNCOMPREHENDING OFFICER IN "LORD OF THE FLIES," REFOCUSES AND REINFORCES ALL THAT PRECEDES IT, AND THE FABLE, SUPERIMPOSED UPON REAL LIFE, BECOMES…

  14. Understanding gold nanoisland formation using transport measurement

    NASA Astrophysics Data System (ADS)

    Joshi, Toyanath

    Novel metal nano-clusters are always being an interest of scientists and researchers because of their unique optical and chemical properties. This thesis studies the formation mechanism of gold nanoisland film by studying transport properties. We used layer-by-layer self-assembled multilayer gold samples and annealed them at the temperature ranging from room temperature to 625°C. Transport properties, particularly the resistance and capacitance, were measured in situ during annealing and compared with the surface morphology and UV-vis studies. Five films of the 8-layer gold and one film of the 5-layer silver and 5-layer gold nanoparticle sequentially self-assembled samples were measured. Temperature dependent resistance curves were plotted and analyzed. From the resistance curves, we were able to identify the actual temperature for polymer evaporation and nanoisland formation. These data were re-verified by comparing them with the temperature dependent studies of surface morphology and UV-vis spectroscopy. The effect of measuring condition, like heating rate and pre-annealing time factor, was also analyzed. Particularly, the slow heating and long pre-annealing time effected nanoisland growth mechanism.

  15. Atmospheric Turbulence Statistics from GOLD Experiments

    NASA Technical Reports Server (NTRS)

    Jeganathan, Muthu; Wilson, Keith; Lesh, Jim

    1996-01-01

    Ground-Orbiter Lasercomm Demonstration (GOLD) includes the following: (1) Optical communication experiments between Table Mountain Observatory (TMF) and Japanese Engineering Test Satellite (ETS-VI); (2) International cooperative effort between NASA, NASDA, CRL and JPL; and (3) Phase 1 transmissions from October 1995 to January 1996 and Phase 2 transmissions from March 1996 to May 1996.

  16. X-ray laser driven gold targets

    SciTech Connect

    Petrova, Tz. B. Whitney, K. G.; Davis, J.

    2014-03-15

    The femtosecond population dynamics of gold irradiated by a coherent high-intensity (>10{sup 17} W/cm{sup 2}) x-ray laser pulse is investigated theoretically. There are two aspects to the assembled model. One is the construction of a detailed model of platinum-like gold inclusive of all inner-shell states that are created by photoionization of atomic gold and decay either by radiative or Auger processes. Second is the computation of the population dynamics that ensues when an x-ray pulse is absorbed in gold. The hole state generation depends on the intensity and wavelength of the driving x-ray pulse. The excited state populations reached during a few femtosecond timescales are high enough to generate population inversions, whose gain coefficients are calculated. These amplified lines in the emitted x-ray spectrum provide important diagnostics of the radiation dynamics and also suggest a nonlinear way to increase the frequency of the coherent output x-ray pulses relative to the frequency of the driver input x-ray pulse.

  17. Catalysis of Gold and Gold-Silver Alloy Nanoparticles Supported on Mesoporous Silica

    DTIC Science & Technology

    2009-11-26

    catalysts greatly and an acidic silica support may solve this problem. Our purpose here is to develop stable gold-based nanocatalysts for the...Discussion: (1) Au system: We first demonstrate the use of pure gold nanocatalyst in catalysis of CO oxidation. While there are a large number of recent...studies of Au nanocatalysts supported on metal oxides, low-temperature CO oxidation under an acidic environment has not yet been accomplished. Over

  18. Analysis of gold(I/III)-complexes by HPLC-ICP-MS demonstrates gold(III) stability in surface waters.

    PubMed

    Ta, Christine; Reith, Frank; Brugger, Joël; Pring, Allan; Lenehan, Claire E

    2014-05-20

    Understanding the form in which gold is transported in surface- and groundwaters underpins our understanding of gold dispersion and (bio)geochemical cycling. Yet, to date, there are no direct techniques capable of identifying the oxidation state and complexation of gold in natural waters. We present a reversed phase ion-pairing HPLC-ICP-MS method for the separation and determination of aqueous gold(III)-chloro-hydroxyl, gold(III)-bromo-hydroxyl, gold(I)-thiosulfate, and gold(I)-cyanide complexes. Detection limits for the gold species range from 0.05 to 0.30 μg L(-1). The [Au(CN)2](-) gold cyanide complex was detected in five of six waters from tailings and adjacent monitoring bores of working gold mines. Contrary to thermodynamic predictions, evidence was obtained for the existence of Au(III)-complexes in circumneutral, hypersaline waters of a natural lake overlying a gold deposit in Western Australia. This first direct evidence for the existence and stability of Au(III)-complexes in natural surface waters suggests that Au(III)-complexes may be important for the transport and biogeochemical cycling of gold in surface environments. Overall, these results show that near-μg L(-1) enrichments of Au in environmental waters result from metastable ligands (e.g., CN(-)) as well as kinetically controlled redox processes leading to the stability of highly soluble Au(III)-complexes.

  19. Bioaccumulation of gold by sulfate-reducing bacteria cultured in the presence of gold(I)-thiosulfate complex

    NASA Astrophysics Data System (ADS)

    Lengke, Maggy; Southam, Gordon

    2006-07-01

    A sulfate-reducing bacterial (SRB) enrichment, from the Driefontein Consolidated Gold Mine, Witwatersrand Basin, Republic of South Africa, was able to destabilize gold(I)-thiosulfate complex (Au(SO)23-) and precipitate elemental gold. The precipitation of gold was observed in the presence of active (live) SRB due to the formation and release of hydrogen sulfide as an end-product of metabolism, and occurred by three possible mechanisms involving iron sulfide, localized reducing conditions, and metabolism. The presence of biogenic iron sulfide caused significant removal of gold from solutions by adsorption and reduction processes on the iron sulfide surfaces. The presence of gold nanoparticles within and immediately surrounding the bacterial cell envelope highlights the presence of localized reducing conditions produced by the bacterial electron transport chain via energy generating reactions within the cell. Specifically, the decrease in redox conditions caused by the release of hydrogen sulfide from the bacterial cells destabilized the Au(SO)23- solutions. The presence of gold as nanoparticles (<10 nm) inside a sub-population of SRB suggests that the reduction of gold was a part of metabolic process. In late stationary phase or death phase, gold nanoparticles that were initially precipitated inside the bacterial cells, were released from the cells and deposited in the bulk solution as addition of gold nanoparticles that already precipitated in the solution. Ultimately, the formation of micrometer-scale sub-octahedral and octahedral gold and spherical aggregates containing octahedral gold was observed.

  20. Gold-Catalyzed Rearrangements and Beyond

    PubMed Central

    2013-01-01

    Cycloisomerizations of enynes are probably the most representative carbon–carbon bond forming reactions catalyzed by electrophilic metal complexes. These transformations are synthetically useful because chemists can use them to build complex architectures under mild conditions from readily assembled starting materials. However, these transformations can have complex mechanisms. In general, gold(I) activates alkynes in the presence of any other unsaturated functional group by forming an (η2-alkyne)–gold complex. This species reacts readily with nucleophiles, including electron-rich alkenes. In this case, the reaction forms cyclopropyl gold(I) carbene-like intermediates. These can come from different pathways depending on the substitution pattern of the alkyne and the alkene. In the absence of external nucleophiles, 1,n-enynes can form products of skeletal rearrangement in fully intramolecular reactions, which are mechanistically very different from metathesis reactions initiated by the [2 + 2] cycloaddition of a Grubbs-type carbene or other related metal carbenes. In this Account, we discuss how cycloisomerization and addition reactions of substituted enynes, as well as intermolecular reactions between alkynes and alkenes, are best interpreted as proceeding through discrete cationic intermediates in which gold(I) plays a significant role in the stabilization of the positive charge. The most important intermediates are highly delocalized cationic species that some chemists describe as cyclopropyl gold(I) carbenes or gold(I)-stabilized cyclopropylmethyl/cyclobutyl/homoallyl carbocations. However, we prefer the cyclopropyl gold(I) carbene formulation for its simplicity and mnemonic value, highlighting the tendency of these intermediates to undergo cyclopropanation reactions with alkenes. We can add a variety of hetero- and carbonucleophiles to the enynes in the presence of gold(I) in intra- or intermolecular reactions, leading to the corresponding adducts with

  1. Gold surface with gold nitride-a surface enhanced Raman scattering active substrate

    NASA Astrophysics Data System (ADS)

    Brieva, A. C.; Alves, L.; Krishnamurthy, S.; Šiller, L.

    2009-03-01

    The nitration of gold surfaces is a nonpolluting method, which can lead to large scale production of substrates with remarkable properties and applications. We present a topographical study of the nanoscale structure of the gold nitride surfaces produced by radio frequency (rf) nitrogen plasma etching of thin gold films. Atomic force microscopy images taken after rf etching reveal the striking appearance of the cluster assembly with large clusters surrounded by small clusters (7.9±1.4 and 2.3±0.9 nm, respectively) appearing to exhibit an attractive interaction. We discuss the possible mechanism for this attraction based on a colloid model by Messina et al. [Phys. Rev. Lett. 85, 872 (2000)]. This surface exhibits a notable surface enhanced Raman scattering effect demonstrated with L-alanine and rhodamine-6G. The significance of this work is that we found that this SERS active gold nitride surface can be prepared in just one step: by nitrogen plasma etching a thin gold film. Until now most SERS active gold cluster covered surfaces have been prepared in several steps very often requiring complex lithography.

  2. A halogen-free synthesis of gold nanoparticles using gold(III) oxide

    NASA Astrophysics Data System (ADS)

    Sashuk, Volodymyr; Rogaczewski, Konrad

    2016-09-01

    Gold nanoparticles are one of the most used nanomaterials. They are usually synthesized by the reduction of gold(III) chloride. However, the presence of halide ions in the reaction mixture is not always welcome. In some cases, these ions have detrimental influence on the morphology and structure of resulting nanoparticles. Here, we present a simple and halogen-free procedure to prepare gold nanoparticles by reduction of gold(III) oxide in neat oleylamine. The method provides the particles with an average size below 10 nm and dispersity of tens of percent. The process of nanoparticle formation was monitored using UV-Vis spectroscopy. The structure and chemical composition of the nanoparticles was determined by SEM, XPS and EDX. We also proposed the mechanism of reduction of gold(III) oxide based on MS, IR and NMR data. Importantly, the synthetic protocol is general and applicable for the preparation of other coinage metal nanoparticles from the corresponding metal oxides. For instance, we demonstrated that the absence of halogen enables efficient alloying of metals when preparing gold-silver bimetallic nanoparticles.

  3. Magnetic resonance investigation of gold-doped and gold-hydrogen-doped silicon

    NASA Astrophysics Data System (ADS)

    Huy, P. T.; Ammerlaan, C. A.

    2002-10-01

    Three paramagnetic centers related to gold have been observed in gold-doped and gold-doped hydrogenated silicon by magnetic resonance. One spectrum, labeled Si-NL62, corresponding to a center with monoclinic-I symmetry, presents fourfold splitting due to the hyperfine interaction with one gold atom and further hyperfine interaction with two silicon nearest-neighbor atoms. After being diffused with hydrogen in a wet atmosphere of water vapor at 1300 °C for about 30 min, a second electron paramagnetic resonance spectrum, labeled Si-NL63, is detected, also of the monoclinic-I symmetry. The spectrum of the center is characterized by a complex hyperfine structure, in which, depending on magnetic field orientation, a sevenfold splitting with the intensities 1:2:3:4:3:2:1, a fourfold splitting 4:4:4:4, and other more arbitrary structures are observed. Extra small splitting is observed in the sample diffused with deuterium, indicating hydrogen involvement in the microscopic structure of the Si-NL63 center. Under band gap illumination the third center of a one-gold-two-hydrogen complex is observed. The center, labeled Si-NL64, has low triclinic symmetry and features the hyperfine interactions with one gold and two nearly equivalent hydrogen atoms. This results in a (1:2:1):(1:2:1):(1:2:1):(1:2:1) structure of each group of spectral lines. Spin-Hamiltonian parameters for the three spectra are determined and microscopic models are discussed.

  4. Detailed energy distributions in laser-produced plasmas of solid gold and foam gold planar targets

    SciTech Connect

    Dong, Yunsong; Zhang, Lu; Yang, Jiamin; Shang, Wanli

    2013-12-15

    Foam gold was proposed to increase the laser to x-ray conversion efficiency due to its important applications. To understand the mechanism of x-ray enhancement, the detailed energy distributions and plasma profiles for laser-irradiated solid gold and foam gold targets were studied comparatively by hydrodynamic simulations using the code Multi-1D. It is confirmed that the radiation heat wave is subsonic for the normal solid gold target, while supersonic for the foam gold target. The shock wave, which is behind the supersonic radiation heat wave for the foam gold target, generates a plasma temperature gradient with high temperature near the shock wave front to produce an additional net outward radiation for enhancement of the x-ray emission. Much larger inward plasma velocity is also driven by the shock wave as an initial plasma velocity for the laser deposition and electron thermal conduct zone, which decreases the expanding plasma kinetic energy loss and helps to increase the x-ray radiation.

  5. Polymer decorated gold nanoparticles in nanomedicine conjugates.

    PubMed

    Capek, Ignác

    2017-02-15

    Noble metal, especially gold nanoparticles and their conjugates with biopolymers have immense potential for disease diagnosis and therapy on account of their surface plasmon resonance (SPR) enhanced light scattering and absorption. Conjugation of noble metal nanoparticles to ligands specifically targeted to biomarkers on diseased cells allows molecular-specific imaging and detection of disease. The development of smart gold nanoparticles (AuNPs) that can deliver therapeutics at a sustained rate directly to cancer cells may provide better efficacy and lower toxicity for treating cancer tumors. We highlight some of the promising classes of targeting systems that are under development for the delivery of gold nanoparticles. Nanoparticles designed for biomedical applications are often coated with polymers containing reactive functional groups to conjugate targeting ligands, cell receptors or drugs. Using targeted nanoparticles to deliver chemotherapeutic agents in cancer therapy offers many advantages to improve drug/gene delivery and to overcome many problems associated with conventional radiotherapy and chemotherapy. The targeted nanoparticles were found to be effective in killing cancer cells which were studied using various anticancer assays. Cell morphological analysis shows the changes occurred in cancer cells during the treatment with AuNPs. The results determine the influence of particle size and concentration of AuNPs on their absorption, accumulation, and cytotoxicity in model normal and cancer cells. As the mean particle diameter of the AuNPs decreased, their rate of absorption by the intestinal epithelium cells increased. These results provide important insights into the relationship between the dimensions of AuNPs and their gastrointestinal uptake and potential cytotoxicity. Furthermore gold nanoparticles efficiently convert the absorbed light into localized heat, which can be exploited for the selective laser photothermal therapy of cancer. We also review

  6. RAPID COMMUNICATION: Surface vertical deposition for gold nanoparticle film

    NASA Astrophysics Data System (ADS)

    Diao, J. J.; Qiu, F. S.; Chen, G. D.; Reeves, M. E.

    2003-02-01

    In this rapid communication, we present the surface vertical deposition (SVD) method to synthesize the gold nanoparticle films. Under conditions where the surface of the gold nanoparticle suspension descends slowly by evaporation, the gold nanoparticles in the solid-liquid-gas junction of the suspension aggregate together on the substrate by the force of solid and liquid interface. When the surface properties of the substrate and colloidal nanoparticle suspension define for the SVD, the density of gold nanoparticles in the thin film made by SVD only depends on the descending velocity of the suspension surface and on the concentration of the gold nanoparticle suspension.

  7. Formation of gold mineralization in ultramafic alkalic magmatic complexes

    NASA Astrophysics Data System (ADS)

    Ryabchikov, I. D.; Kogarko, L. N.; Sazonov, A. M.; Kononkova, N. N.

    2016-06-01

    Study of mineral inclusions within alluvial gold particles of the Guli Complex (East Siberia) and findings of lode gold in rocks of the same intrusion have demonstrated that gold mineralization occurs in interstitions of both early high-magnesium rocks (dunite) and later alkalic and carbonatite rocks. In dunite the native gold occurs in association with Fe-Ni sulfides (monosulfide solid solution, pentlandite, and heazlewoodite). Formation of the gold-bearing alloys took place under a low oxygen potential over a broad range of temperatures: from those close to 600°C down to below 400°C.

  8. Synchrotron X-Ray Synthesized Gold Nanoparticles for Tumor Therapy

    SciTech Connect

    Chien, C. C.; Wang, C. H.; Tseng, P. Y.; Yang, T. Y.; Hua, T. E.; Hwu, Y.; Chen, Y. J.; Chung, K. H.; Je, J. H.; Margaritondo, G.

    2007-01-19

    Highly concentrated gold nanoparticles (20 {+-} 5 nm) were produced by an x-ray irradiation method. The particles were then examined for the interactions between gold and tumor cells under x-ray radiation conditions. The biological effects of gold nanoparticles were investigated in terms of the internalization, cytotoxicity and capability to enhance x-ray radiotherapy. The results of this investigation indicated that x-ray derived gold nanoparticles were nontoxic to CT-26 cell line and immobilized within cytoplasm. The irradiation experiments provided further evidence that gold nanoparticles were capable of enhancing the efficiency of radiotherapy.

  9. Radicals Are Required for Thiol Etching of Gold Particles.

    PubMed

    Dreier, Timothy A; Ackerson, Christopher J

    2015-08-03

    Etching of gold with an excess of thiol ligand is used in both synthesis and analysis of gold particles. Mechanistically, the process of etching gold with excess thiol is unclear. Previous studies have obliquely considered the role of oxygen in thiolate etching of gold. Herein, we show that oxygen or a radical initiator is a necessary component for efficient etching of gold by thiolates. Attenuation of the etching process by radical scavengers in the presence of oxygen, and the restoration of activity by radical initiators under inert atmosphere, strongly implicate the oxygen radical. These data led us to propose an atomistic mechanism in which the oxygen radical initiates the etching process.

  10. Fluid evolution in a volcanic-hosted epithermal carbonate-base metal-gold vein system: Alto de la Blenda, Farallón Negro, Argentina

    NASA Astrophysics Data System (ADS)

    Márquez-Zavalía, M. Florencia; Heinrich, Christoph A.

    2016-10-01

    Alto de la Blenda is a ˜6.6-Ma intermediate-sulphidation epithermal vein system in the Farallón Negro Volcanic Complex, which also hosts the 7.1-Ma porphyry-Cu-Au deposit of Bajo de la Alumbrera. The epithermal vein system is characterised by a large extent and continuity (2 km × 400 m open to depth × 6 m maximum width) and an average gold grade of ˜8 g/t. The vein is best developed within an intrusion of a fine-grained equigranular monzonite, interpreted as the central conduit of a stratovolcano whose extrusive activity ended prior to porphyry-Cu-Au emplacement at Bajo de la Alumbrera, which is in turn cut by minor epithermal veins. The Alto de la Blenda vein consists predominantly of variably Mn-rich carbonates and quartz, with a few percent of pyrite, sphalerite, galena and other sulphide and sulphosalt minerals. Four phases of vein opening, hydrothermal mineralisation and repeated brecciation can be correlated between different vein segments. Stages 2 and 3 contain the greatest fraction of sulphide and gold. They are separated by the emplacement of a polymictic breccia containing clasts of quartz feldspar porphyry as well as basement rocks. Fluid inclusions in quartz related to stages 2 to 4 are liquid rich with 2-4 wt% NaCl(eq). They homogenise between 160 and 300 °C, with very consistent values within each assemblage. Vapour inclusions are practically absent in the epithermal vein. Quartz fragments in the polymictic breccia contain inclusions of intermediate to vapour-like density and similar low salinity (˜3 wt% NaCl(eq)), besides rare brine inclusions containing halite. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) analyses of epithermal inclusions indicate high concentrations of K, Fe, As, Sb, Cs, and Pb that significantly vary within and through subsequent vein stages. Careful consideration of detection limits for individual inclusions shows high gold concentrations of ˜0.5 to 3 ppm dissolved in the ore fluid, which

  11. The gold-sulfur interface at the nanoscale.

    PubMed

    Häkkinen, Hannu

    2012-05-22

    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  12. In vitro cytotoxicity of gold nanorods in A549 cells.

    PubMed

    Tang, Ying; Shen, Yafeng; Huang, Libin; Lv, Gaojian; Lei, Changhai; Fan, Xiaoyan; Lin, Fangxing; Zhang, Yuxia; Wu, Lihui; Yang, Yongji

    2015-03-01

    Gold nanoparticles, which have unique physicochemical characteristics, are being used for an increasingly wide range of applications in biomedical research. In this study, gold nanorods (width of 25 nm, length of 52 nm) were found to be internalized by A549 cells and were primarily localized in the lysosomes and membranous vesicles. The integrity of the membranes of A549 cells exposed to gold nanorods for 4h was damaged, as indicated by laser scanning confocal microscopy (LSCM). Increased lactate dehydrogenase (LDH) leakage and decreased cell viability further indicated the concentration-dependent cytotoxicity of the gold nanorods to the A549 cells. Reactive oxygen species (ROS) production was induced in the A549 cells by the gold nanorods, and this effect was positively correlated with the concentration of the gold nanorods. The results of this study indicated that exposure to gold nanorods caused dose-dependent cytotoxicity in A549 cells and that oxidative stress may be the main factor causing cytotoxicity.

  13. Preparation and characterization of gold-decorated graphite nanosheet composites.

    PubMed

    Kim, Jungsoo; Nam, Dae Geun; Oh, Weon Tae

    2013-05-01

    Some composites of gold nanoparticles and graphite nanosheets were prepared by electrostatic interaction, and structurally and electrochemically characterized using X-ray diffraction, X-ray photoelectron spectroscopy, UVNis spectroscopy, transmission electron microscopy, and cyclic-voltammetry. Pristine graphite was chemically treated using aqueous acid solution, and dispersed inpoly(diallyldimethylammonium) chloride aqueous solution to prepare positively charged graphite nanosheets. The gold nanoparticles (GNPs) in this work were stabilized by sodium dodecyl sulfate, poly(sodium 4-styrene sulfonate), or poly(vinylpyrrolidone). Gold nanoparticles and graphite nanosheet composites with gold nanoparticles showed the characteristic surface plasmon band at -530 nm. The electrochemical properties of the graphite nanosheet composites with gold nanoparticles were studied by cyclic voltammetry, in which reduction potential and reduction current of gold nanoparticles were strongly dependent on the gold-wrapped stabilizer in the composites.

  14. The gold-sulfur interface at the nanoscale

    NASA Astrophysics Data System (ADS)

    Häkkinen, Hannu

    2012-06-01

    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  15. Chirality in thiolate-protected gold clusters.

    PubMed

    Knoppe, Stefan; Bürgi, Thomas

    2014-04-15

    Over recent years, research on thiolate-protected gold clusters Au(m)(SR)n has gained significant interest. Milestones were the successful determination of a series of crystal structures (Au102(SR)44, Au25(SR)18, Au38(SR)24, Au36(SR)24, and Au28(SR)20). For Au102(SR)44, Au38(SR)24, and Au28(SR)20, intrinsic chirality was found. Strong Cotton effects (circular dichroism, CD) of gold clusters protected by chiral ligands have been reported a long time ago, indicating the transfer of chiral information from the ligand into the cluster core. Our lab has done extensive studies on chiral thiolate-protected gold clusters, including those protected with chiral ligands. We demonstrated that vibrational circular dichroism can serve as a useful tool for the determination of conformation of the ligand on the surface of the cluster. The first reports on crystal structures of Au102(SR)44 and Au38(SR)24 revealed the intrinsic chirality of these clusters. Their chirality mainly arises from the arrangement of the ligands on the surface of the cluster cores. As achiral ligands are used to stabilize the clusters, racemic mixtures are obtained. However, the separation of the enantiomers by HPLC was demonstrated which enabled the measurement of their CD spectra. Thermally induced inversion allows determination of the activation parameters for their racemization. The inversion demonstrates that the gold-thiolate interface is anything but fixed; in contrast, it is rather flexible. This result is of fundamental interest and needs to be considered in future applications. A second line of our research is the selective introduction of chiral, bidentate ligands into the ligand layer of intrinsically chiral gold clusters. The ligand exchange reaction is highly diastereoselective. The bidentate ligand connects two of the protecting units on the cluster surface and thus effectively stabilizes the cluster against thermally induced inversion. A minor (but significant) influence of chiral ligands to

  16. Antifungal activity of gold nanoparticles prepared by solvothermal method

    SciTech Connect

    Ahmad, Tokeer; Wani, Irshad A.; Lone, Irfan H.; Ganguly, Aparna; Manzoor, Nikhat; Ahmad, Aijaz; Ahmed, Jahangeer; Al-Shihri, Ayed S.

    2013-01-15

    Graphical abstract: Gold nanoparticles (7 and 15 nm) of very high surface area (329 and 269 m{sup 2}/g) have been successfully synthesized through solvothermal method by using tin chloride and sodium borohydride as reducing agents. As-prepared gold nanoparticles shows very excellent antifungal activity against Candida isolates and activity increases with decrease in the particle size. Display Omitted Highlights: ► Effect of reducing agents on the morphology of gold nanoparticles. ► Highly uniform and monodisperse gold nanoparticles (7 nm). ► Highest surface area of gold nanoparticles (329 m{sup 2/}g). ► Excellent antifungal activity of gold nanoparticles against Candida strains. -- Abstract: Gold nanoparticles have been successfully synthesized by solvothermal method using SnCl{sub 2} and NaBH{sub 4} as reducing agents. X-ray diffraction studies show highly crystalline and monophasic nature of the gold nanoparticles with face centred cubic structure. The transmission electron microscopic studies show the formation of nearly spherical gold nanoparticles of average size of 15 nm using SnCl{sub 2}, however, NaBH{sub 4} produced highly uniform, monodispersed and spherical gold nanoparticles of average grain size of 7 nm. A high surface area of 329 m{sup 2}/g for 7 nm and 269 m{sup 2}/g for 15 nm gold nanoparticles was observed. UV–vis studies assert the excitations over the visible region due to transverse and longitudinal surface plasmon modes. The gold nanoparticles exhibit excellent size dependant antifungal activity and greater biocidal action against Candida isolates for 7 nm sized gold nanoparticles restricting the transmembrane H{sup +} efflux of the Candida species than 15 nm sized gold nanoparticles.

  17. Ultraviolet imaging detectors for the GOLD mission

    NASA Astrophysics Data System (ADS)

    Siegmund, O. H. W.; McPhate, J.; Curtis, T.; Jelinsky, S.; Vallerga, J. V.; Hull, J.; Tedesco, J.

    2016-07-01

    The GOLD mission is a NASA Explorer class ultraviolet Earth observing spectroscopy instrument that will be flown on a telecommunications satellite in geostationary orbit in 2018. Microchannel plate detectors operating in the 132 nm to 162 nm FUV bandpass with 2D imaging cross delay line readouts and electronics have been built for each of the two spectrometer channels for GOLD. The detectors are "open face" with CsI photocathodes, providing 30% efficiency at 130.4 nm and 15% efficiency at 160.8 nm. These detectors with their position encoding electronics provide 600 x 500 FWHM resolution elements and are photon counting, with event handling rates of > 200 KHz. The operational details of the detectors and their performance are discussed.

  18. Tamper indicating gold nanocup plasmonic films

    NASA Astrophysics Data System (ADS)

    DeVetter, Brent M.; Bernacki, Bruce E.; Bennett, Wendy D.; Schemer-Kohrn, Alan; Alvine, Kyle J.

    2017-02-01

    The spectral signatures of nanoplasmonic films are both robust and tailorable with optical responses ranging from the visible to the near-infrared. We present the development of flexible, elastomeric nanoplasmonic films consisting of periodic arrays of gold nanocups as tamper indicating films. Gold nanocups have polarization-sensitive optical properties that may be manufactured into films that offer unique advantages for tamper indication. These flexible films can be made quickly and at low-cost using the commercially available monodisperse polystyrene nanospheres through self-assembly followed by plasma etching, metal deposition, and lift-off from a sacrificial substrate. The polarization- and angle-dependent optical spectroscopic measurements were performed to characterize the fabricated films. Using polarization-sensitive hyperspectral imaging, we demonstrate how these films can be applied to tamper indication and counterfeit resistance applications.

  19. Synthesis and spectroscopic characterization of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Philip, Daizy

    2008-11-01

    Photoluminescent nanoparticles of gold with size 3, 4, 6, and 9 nm are prepared by borohydride/citrate reduction in presence of polyethylene glycol (PEG)/tannic acid. The prepared nanomaterials are characterized by UV-vis spectroscopy and dynamic light scattering (DLS) technique. Intense photoluminescence (PL) is observed in nanoparticles prepared by fast reduction with borohydride in presence of PEG. A red shift of PL emission from 408 to 456 nm is observed for the change of size from 4 to 6 nm. Increase in PL intensity is observed for all the nanoparticles on the addition of KCl. Citrate reduced gold colloid which consists of large particles of size ˜35 nm with anisotropic shapes showing two plasmon peaks is also prepared. The anisotropy is confirmed by TEM measurement. SERS activity of this colloid is tested using glutamic acid as an adsorbate probe. Assignment of the observed bands is given.

  20. Gold nanodisk array surface plasmon resonance sensor

    NASA Astrophysics Data System (ADS)

    Tian, Xueli

    Surface plasmon resonances in periodic metal nanostructures have been investigated for sensing applications over the last decade. The resonance wavelengths of the nanostructures are usually measured in the transmission or reflection spectrum for chemical and biological sensing. In this thesis, I introduce a nanoscale gap mediated surface plasmon resonance nanodisk array for displacement sensing and a super-period gold nanodisk grating enabled surface plasmon resonance spectrometer sensor. The super-period gold nanodisk grating has a small subwavelength period and a large diffraction grating period. Surface plasmon resonance spectra are measured in the first order diffraction spatial profiles captured by a charge-coupled device (CCD). A surface plasmon resonance sensor for the bovine serum albumin (BSA) protein nanolayer bonding is demonstrated by measuring the surface plasmon resonance shift in the first order diffraction spatial intensity profiles captured by the CCD.

  1. Interconnecting Gold Islands with DNA Origami Nanotubes

    PubMed Central

    Ding, Baoquan; Wu, Hao; Xu, Wei; Zhao, Zhao; Liu, Yan; Yu, Hongbin; Yan, Hao

    2012-01-01

    Scaffolded DNA origami has recently emerged as a versatile, programmable method to fold DNA into arbitrarily shaped nanostructures that are spatially addressable, with sub-10 nm resolution. Toward functional DNA nanotechnology, one of the key challenges is to integrate the bottom up self-assembly of DNA origami with the top-down lithographic methods used to generate surface patterning. In this report we demonstrate that fixed length DNA origami nanotubes, modified with multiple thiol groups near both ends, can be used to connect surface patterned gold islands (tens of nanometers in diameter) fabricated by electron beam lithography (EBL). Atomic force microscopic imaging verified that the DNA origami nanotubes can be efficiently aligned between gold islands with various inter-island distances and relative locations. This development represents progress toward the goal of bridging bottom up and top down assembly approaches. PMID:21070012

  2. Gold resource modeling using pod indicator kriging

    NASA Astrophysics Data System (ADS)

    Bargawa, Waterman Sulistyana; Rauf, Abdul; Amri, Nur Ali

    2016-02-01

    This paper describes an implementation of the pod indicator kriging method used to gold resource modeling. Method such as ordinary kriging estimate the mean grade of a block that is fairly large. The usual outcome is that large blocks rarely turn out to be all ore or all waste, thus making reserve estimates an incorrect estimate of what will be mined. Pod indicator kriging offers a solution to this problem by estimating the distribution of grade values within a large block, rather than just estimating the mean grade of the block. Knowing the distribution of grade value within the block, it is then easy to calculate the proportion of the block that is above cutoff grade and the grade of the ore above cutoff grade. This research shows that the pod indicator kriging model is quite applicable and reliable in gold resourcemodeling.

  3. Topological states on the gold surface.

    PubMed

    Yan, Binghai; Stadtmüller, Benjamin; Haag, Norman; Jakobs, Sebastian; Seidel, Johannes; Jungkenn, Dominik; Mathias, Stefan; Cinchetti, Mirko; Aeschlimann, Martin; Felser, Claudia

    2015-12-14

    Gold surfaces host special electronic states that have been understood as a prototype of Shockley surface states. These surface states are commonly employed to benchmark the capability of angle-resolved photoemission spectroscopy (ARPES) and scanning tunnelling spectroscopy. Here we show that these Shockley surface states can be reinterpreted as topologically derived surface states (TDSSs) of a topological insulator (TI), a recently discovered quantum state. Based on band structure calculations, the Z2-type invariants of gold can be well-defined to characterize a TI. Further, our ARPES measurement validates TDSSs by detecting the dispersion of unoccupied surface states. The same TDSSs are also recognized on surfaces of other well-known noble metals (for example, silver, copper, platinum and palladium), which shines a new light on these long-known surface states.

  4. Gold Nanoparticles for Neural Prosthetics Devices

    PubMed Central

    Zhang, Huanan; Shih, Jimmy; Zhu, Jian; Kotov, Nicholas A.

    2012-01-01

    Treatments of neurological diseases and the realization of brain-computer interfaces require ultrasmall electrodes which are “invisible” to resident immune cells. Functional electrodes smaller than 50μm are impossible to produce with traditional materials due to high interfacial impedance at the characteristic frequency of neural activity and insufficient charge storage capacity. The problem can be resolved by using gold nanoparticle nanocomposites. Careful comparison indicates that layer-by-layer assembled films from Au NPs provide more than threefold improvement in interfacial impedance and one order of magnitude increase in charge storage capacity. Prototypes of microelectrodes could be made using traditional photolithography. Integration of unique nanocomposite materials with microfabrication techniques opens the door for practical realization of the ultrasmall implantable electrodes. Further improvement of electrical properties is expected when using special shapes of gold nanoparticles. PMID:22734673

  5. Biological synthesis of triangular gold nanoprisms

    NASA Astrophysics Data System (ADS)

    Shankar, S. Shiv; Rai, Akhilesh; Ankamwar, Balaprasad; Singh, Amit; Ahmad, Absar; Sastry, Murali

    2004-07-01

    The optoelectronic and physicochemical properties of nanoscale matter are a strong function of particle size. Nanoparticle shape also contributes significantly to modulating their electronic properties. Several shapes ranging from rods to wires to plates to teardrop structures may be obtained by chemical methods; triangular nanoparticles have been synthesized by using a seeded growth process. Here, we report the discovery that the extract from the lemongrass plant, when reacted with aqueous chloroaurate ions, yields a high percentage of thin, flat, single-crystalline gold nanotriangles. The nanotriangles seem to grow by a process involving rapid reduction, assembly and room-temperature sintering of 'liquid-like' spherical gold nanoparticles. The anisotropy in nanoparticle shape results in large near-infrared absorption by the particles, and highly anisotropic electron transport in films of the nanotriangles.

  6. Prospecting for gold in the United States

    USGS Publications Warehouse

    ,

    1967-01-01

    Prospecting for gold is something that probably everyone dreams of trying at least once. To the person who is mainly concerned with this activity as a vacation diversion, prospecting offers a special excitement. There is a constant hope that the next pan of sediment may be "pay dirt," and no other thrill can compare with that experienced when one sees even a few tiny flecks of gold glittering in the black sand at the bottom of his pan. The search itself is its own reward for the efforts expended by the vacation prospector. The would-be prospector hoping for financial gain, however, should carefully consider all the facts of the situation before deciding to set out on a prospecting expedition.

  7. Superlubricity of graphene nanoribbons on gold surfaces.

    PubMed

    Kawai, Shigeki; Benassi, Andrea; Gnecco, Enrico; Söde, Hajo; Pawlak, Rémy; Feng, Xinliang; Müllen, Klaus; Passerone, Daniele; Pignedoli, Carlo A; Ruffieux, Pascal; Fasel, Roman; Meyer, Ernst

    2016-02-26

    The state of vanishing friction known as superlubricity has important applications for energy saving and increasing the lifetime of devices. Superlubricity, as detected with atomic force microscopy, appears when sliding large graphite flakes or gold nanoclusters across surfaces, for example. However, the origin of the behavior is poorly understood because of the lack of a controllable nanocontact. We demonstrated the superlubricity of graphene nanoribbons when sliding on gold with a joint experimental and computational approach. The atomically well-defined contact allows us to trace the origin of superlubricity, unraveling the role played by ribbon size and elasticity, as well as by surface reconstruction. Our results pave the way to the scale-up of superlubricity and thus to the realization of frictionless coatings.

  8. Atomic Diffusion within Individual Gold Nanocrystal

    PubMed Central

    Xiong, Gang; Clark, Jesse N.; Nicklin, Chris; Rawle, Jonathan; Robinson, Ian K.

    2014-01-01

    Due to their excess surface free energy and structural instabilities, nanoparticles exhibit interesting physical and chemical properties. There has been an ever-growing interest in investigating these properties, driven by the desire to further miniaturize electronic devices, develop new functional materials and catalysts. Here, the intriguing question of how diffusion evolves in a single nanoparticle is investigated by measuring the spatial and temporal variations of the diffracted coherent X-ray intensity during copper diffusion into a gold nanocrystal. Dislocation loops formed from the insertion of single layer of extra atoms between neighbouring gold host lattice planes are detected. Au-Cu alloy channels are found to penetrate the nanocrystal due to the differential diffusion rate along different directions. With the advent of higher brilliance sources and free-electron-lasers, Bragg Coherent X-ray Diffraction Imaging can play an important role in unveiling atomic behaviours in three dimensions for nanomaterials during various fundamental processes. PMID:25341377

  9. A 'Pot of Gold' Rich with Nuggets

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This close-up image taken by the Mars Exploration Rover Spirit highlights the nodular nuggets that cover the rock dubbed 'Pot of Gold.' These nuggets appear to stand on the end of stalk-like features. The surface of the rock is dotted with fine-scale pits. Data from the rover's scientific instruments have shown that Pot of Gold contains the mineral hematite, which can be formed with or without water.

    Scientists are planning further observations of this rock, which they hope will yield more insight into the hematite's origins as well as how the enigmatic nuggets formed.

    This image was taken by Spirit's microscopic imager on sol 162 (June 17, 2004). The observed area is 3 centimeters by 3 centimeters (1.2 inches by 1.2 inches)

  10. Local density variation of gold nanoparticles in aquatic environments

    NASA Astrophysics Data System (ADS)

    Hosseinzadeh, F.; Shirazian, F.; Shahsavari, R.; Khoei, A. R.

    2016-10-01

    Gold (Au) nanoparticles are widely used in diagnosing cancer, imaging, and identification of therapeutic methods due to their particular quantum characteristics. This research presents different types of aqueous models and potentials used in TIP3P, to study the effect of the particle size and density of Au clusters in aquatic environments; so it can be useful to facilitate future investigation of the interaction of proteins with Au nanoparticles. The EAM potential is used to model the structure of gold clusters. It is observed that in the systems with identical gold/water density and different cluster radii, gold particles are distributed in aqueous environment almost identically. Thus, Au particles have identical local densities, and the root mean square displacement (RMSD) increases with a constant slope. However in systems with constant cluster radii and different gold/water densities, Au particle dispersion increases with density; as a result, the local density decreases and the RMSD increases with a larger slope. In such systems, the larger densities result in more blunted second peaks in gold-gold radial distribution functions, owing to more intermixing of the clusters and less FCC crystalline features at longer range, a mechanism that is mediated by the competing effects of gold-water and gold-gold interactions.

  11. Irradiation stability and cytotoxicity of gold nanoparticles for radiotherapy

    PubMed Central

    Zhang, Xiao-Dong; Guo, Mei-Li; Wu, Hong-Ying; Sun, Yuan-Ming; Ding, Yan-Qiu; Feng, Xin; Zhang, Liang-An

    2009-01-01

    Gold nanoparticles are promising as a kind of novel radiosensitizer in radiotherapy. If gold nanoparticles are shown to have good irradiation stability and biocompatibility, they would play an important role in radiotherapy. In this work, we investigated irradiation effects of gold nanoparticles under 2–10 kR gamma irradiation and cytotoxicity of gold nanoparticles with human K562 cells by using Cell Titre-Glo™ luminescent cell viability assay. The results revealed that gamma irradiation had not induced any obvious instability and size variations in gold nanoparticles. We found that gold nanoparticles showed excellent radiation hardness with an absorbed dose conversation factor of 9.491 rad/R. Meanwhile, the surface plasmon resonance of gold nanoparticles was enhanced obviously after 2–10 kR gamma irradiation. Subsequently, cytotoxicity tests indicated that the extremely high concentration of gold nanoparticles could cause a sharp decrease in K562 cell viability, while the low concentration of gold nanoparticles had no obvious influence on the cell viability. Our results revealed that gold nanoparticles were stable under high-energy ray irradiation and showed concentration-dependent cytotoxicity. PMID:19774115

  12. Role of CO2 in the formation of gold deposits.

    PubMed

    Phillips, G N; Evans, K A

    2004-06-24

    Much of global gold production has come from deposits with uneconomic concentrations of base metals, such as copper, lead and zinc. These 'gold-only' deposits are thought to have formed from hot, aqueous fluids rich in carbon dioxide, but only minor significance has been attached to the role of the CO2 in the process of gold transport. This is because chemical bonding between gold ions and CO2 species is not strong, and so it is unlikely that CO2 has a direct role in gold transport. An alternative indirect role for CO2 as a weak acid that buffers pH has also appeared unlikely, because previously inferred pH values for such gold-bearing fluids are variable. Here we show that such calculated pH values are unlikely to record conditions of gold transport, and propose that CO2 may play a critical role during gold transport by buffering the fluid in a pH range where elevated gold concentration can be maintained by complexation with reduced sulphur. Our conclusions, which are supported by geochemical modelling, may provide a platform for new gold exploration methods.

  13. Gold fingerprinting by laser ablation inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Watling, R. John; Herbert, Hugh K.; Delev, Dianne; Abell, Ian D.

    1994-02-01

    Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) has been applied to the characterization of the trace element composition "fingerprint" of selected gold samples from Western Australia and South Africa. By comparison of the elemental associations it is possible to relate gold to a specific mineralizing event, mine or bullion sample. This methodology facilitates identification of the provenance of stolen gold or gold used in salting activities. In this latter case, it is common for gold from a number of sources to be used in the salting process. Consequently, gold in the prospect being salted will not come from a single source and identification of multiple sources for this gold will establish that salting has occurred. Preliminary results also indicate that specific elemental associations could be used to identify the country of origin of gold. The technique has already been applied in 17 cases involving gold theft in Western Australia, where it is estimated that up to 2% of gold production is "relocated" each year as a result of criminal activities.

  14. Assembly of functional gold nanoparticle on silica microsphere.

    PubMed

    Wang, Hsuan-Lan; Lee, Fu-Cheng; Tang, Tse-Yu; Zhou, Chenguang; Tsai, De-Hao

    2016-05-01

    We demonstrate a controlled synthesis of silica microsphere with the surface-decorated functional gold nanoparticles. Surface of silica microsphere was modified by 3-aminopropypltriethoxysilane and 3-aminopropyldimethylethoxysilane to generate a positive electric field, by which the gold nanoparticles with the negative charges (unconjugated, thiolated polyethylene glycol functionalized with the traceable packing density and conformation) were able to be attracted to the silica microsphere. Results show that both the molecular conjugation on gold nanoparticle and the uniformity in the amino-silanization of silica microsphere influenced the loading and the homogeneity of gold nanoparticles on silica microsphere. The 3-aminopropyldimethylethoxysilane-functionalized silica microsphere provided an uniform field to attract gold nanoparticles. Increasing the ethanol content in aminosilane solution significantly improved the homogeneity and the loading of gold nanoparticles on the surface of silica microsphere. For the gold nanoparticle, increasing the molecular mass of polyethylene glycol yielded a greater homogeneity but a lower loading on silica microsphere. Bovine serum albumin induced the desorption of gold nanoparticles from silica microsphere, where the extent of desorption was suppressed by the presence of high-molecular mass polyethylene glycol on gold nanoparticles. This work provides the fundamental understanding for the synthesis of gold nanoparticle-silica microsphere constructs useful to the applications in chemo-radioactive therapeutics.

  15. A novel 'Gold on Gold' biosensing scheme for an on-fiber immunoassay

    NASA Astrophysics Data System (ADS)

    Punjabi, N.; Satija, J.; Mukherji, S.

    2015-05-01

    In this paper, we propose a novel „gold on gold‟ biosensing scheme for absorbance based fiber-optic biosensor. First, a self-assembled monolayer of gold nanoparticles is formed at the sensing region of the fiber-optic probe by incubating an amino-silanized probe in a colloidal gold solution. Thereafter, the receptor moieties, i.e. Human immunoglobulin G (HIgG) were immobilized by using standard alkanethiol and classic carbodiimide coupling chemistry. Finally, biosensing experiments were performed with different concentrations of gold nanoparticle-tagged analyte, i.e. Goat anti- Human immunoglobulin G (Nanogold-GaHIgG). The sensor response was observed to be more than five-fold compared to the control bioassay, in which the sensor matrix was devoid of gold nanoparticle film. Also, the response was found to be ~10 times higher compared to the FITC-tagged scheme and ~14.5 times better compared to untagged scheme. This novel scheme also demonstrated the potential in improving the limit of detection for the fiber-optic biosensors.

  16. Differential interferences with clinical chemistry assays by gold nanorods, and gold and silica nanospheres.

    PubMed

    Hinkley, Georgia K; Carpinone, Paul L; Munson, John W; Powers, Kevin W; Roberts, Stephen M

    2015-02-01

    Nanomaterials are known to cause interference with several standard toxicological assays. As part of an in vivo study of PEG-coated gold nanorods in mice, nanorods were added to reference serum, and results for standard clinical chemistry parameters were compared with serum analyzed without nanorods. PEG-coated gold nanorods produced several concentration-dependent interferences. Comparisons were then made with PEG-coated gold and silica nanospheres. Interferences were observed for both materials that differed from gold nanorods. Removal of the particles from serum by centrifugation prior to analysis resolved most, but not all of the interferences. Additional clinical chemistry analyzers were used to further investigate trends in assay interference. We conclude that PEG-coated gold and silica nanoparticles can interfere with standard clinical chemistry tests in ways that vary depending upon material, shape, and specific assay methodology employed. Assay interferences by nanomaterials cannot always be predicted, underscoring the need to verify that nanomaterials under study do not interfere with methods used to evaluate potential biological effects.

  17. Silver- and gold-mediated nucleobase bonding.

    PubMed

    Acioli, Paulo H; Srinivas, Sudha

    2014-08-01

    We report the results of a density functional theory investigation of the bonding of nucleobases mediated by silver and gold atoms in the gas phase. Our calculations use the Becke exchange and Perdew-Wang correlation functional (BPW91) combined with the Stuttgart effective core potentials to represent the valence electrons of gold, silver, and platinum, and the all-electron DGTZVP basis set for C, H, N, and O. This combination was chosen based on tests on the metal atoms and tautomers of adenine, cytosine, and guanine. To establish a benchmark to understand the metal-mediated bonding, we calculated the binding energy of each of the base pairs in their canonical forms. Our calculations show rather strong bonds between the Watson-Crick base pairs when compared with typical values for N-H-N and N-H-O hydrogen bonds. The neutral metal atoms tend to bond near the nitrogen atoms. The effect of the metal atoms on the bonding of nucleobases differs depending on whether or not the metal atoms bond to one of the hydrogen-bonding sites. When the silver or gold atoms bond to a non-hydrogen-bonding site, the effect is a slight enhancement of the cytosine-guanine bonding, but there is almost no effect on the adenine-thymine pairing. The metal atoms can block one of the hydrogen-bonding sites, thus preventing the normal cytosine-guanine and adenine-thymine pairings. We also find that both silver and gold can bond to consecutive guanines in a similar fashion to platinum, albeit with a significantly lower binding energy.

  18. Optical Limiting Materials Based on Gold Nanoparticles

    DTIC Science & Technology

    2014-04-30

    AFRL-OSR-VA-TR-2014-0104 OPTICAL LIMITING MATERIALS BASED ON GOLD NANOPARTICLES John Dawson SOUTH CAROLINA RESEARCH FOUNDATION Final Report 04/30...2009; therefore, the award was modified so that her former department chair, John Dawson, became the PI of the award, with Murphy as a subcontract at...Mediated Synthesis to Nanoscale Sculpting,” Curr. Opin. Colloid. Interfac. Sci. 2011, 16, 128-134. • Sivapalan, S. T.; Vella, J. H.; Yang, T. K.; Dalton

  19. 'Pot of Gold' Close-up

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows a close-up of the rock dubbed 'Pot of Gold' (left), which is located near the base of the 'Columbia Hills' in Gusev Crater. Scientists are intrigued by this unusual-looking, nodule-covered rock and plan to investigate its detailed chemistry in coming sols. This picture was taken on sol 159 (June 14, 2004).

  20. Backhoe 3D "gold standard" image

    NASA Astrophysics Data System (ADS)

    Gorham, LeRoy; Naidu, Kiranmai D.; Majumder, Uttam; Minardi, Michael A.

    2005-05-01

    ViSUAl-D (VIsual Sar Using ALl Dimensions), a 2004 DARPA/IXO seedling effort, is developing a capability for reliable high confidence ID from standoff ranges. Recent conflicts have demonstrated that the warfighter would greatly benefit from the ability to ID targets beyond visual and electro-optical ranges[1]. Forming optical-quality SAR images while exploiting full polarization, wide angles, and large bandwidth would be key evidence such a capability is achievable. Using data generated by the Xpatch EM scattering code, ViSUAl-D investigates all degrees of freedom available to the radar designer, including 6 GHz bandwidth, full polarization and angle sampling over 2π steradians (upper hemisphere), in order to produce a "literal" image or representation of the target. This effort includes the generation of a "Gold Standard" image that can be produced at X-band utilizing all available target data. This "Gold Standard" image of the backhoe will serve as a test bed for future more relevant military targets and their image development. The seedling team produced a public release data which was released at the 2004 SPIE conference, as well as a 3D "Gold Standard" backhoe image using a 3D image formation algorithm. This paper describes the full backhoe data set, the image formation algorithm, the visualization process and the resulting image.

  1. Identification of Paracoccidioides brasiliensis by gold nanoprobes

    NASA Astrophysics Data System (ADS)

    Martins, Jaciara F. S.; Castilho, Maiara L.; Cardoso, Maria A. G.; Carreiro, Andrea P.; Martin, Airton A.; Raniero, Leandro

    2012-01-01

    Paracoccidioides brasiliensis (P. brasiliensis) is a thermal dimorphic fungus and causal agent of paracoccidioidomycosis. Epidemiological data shows that it is mainly concentrated in Central and South America countries, with most registered cases in Colombia, Brazil, and Venezuela. The histopathological similarity with others fungal infection makes the diagnosis of P. brasiliensis more complicated. Therefore, the aim of this work was to find a positive and negative test for P. brasiliensis using gold nanoprobes as a new tool for P. brasiliensis detection. Gold nanoparticles were synthesized by reduction of gold chloride with sodium citrate. The results of this procedure is a wine-red solution with a maximum absorption in the range of ~520-530nm. A specific P. brasiliensis sequence of oligonucleotide was bonded to the nanoparticles, which maintained the wine-red color. The color changes from red to blue for negative diagnostic and is unchanged for a positive test. The H-bond interaction of DNA with the complementary DNA keeps strands together and forms double helical structure, maintaining the colloid stability. However, for non-complimentary DNA sequence the nanoprobes merge into a cluster, changing the light absorption.

  2. Ion beam analysis of gold jewelry

    NASA Astrophysics Data System (ADS)

    Demortier, Guy

    1992-02-01

    PIXE milliprobe in a nonvacuum assembly has been proven to be a very rapid and accurate method for the elemental analysis of gold jewelry artefacts. Using protons whose energy is lower than 3 MeV, it is possible to obtain, in a few minutes, the actual composition (copper, iron, gold, silver, etc.) of narrow parts of artefacts, without any sampling, even at microscopic level. Most of the studies of our group in this field concern solders on these jewelry items. Narrow regions of gold artefacts have also been studied with a PIXE microprobe. They were then irradiated in vacuum. Nuclear reaction analyses induced by 2 MeV deuterons are also performed to identify the presence of light elements and, particularly O, N and S. Traces of these elements are of primary importance to characterize the origin of the ores used in various workmanships. Interferences of X-ray lines of Au with those of traces of Cu and Zn are solved using a method of selective excitation of X-rays of these elements. Analytical results have been interpreted in order to understand the workmanship of goldsmiths from the Antiquity. Fakes and repairs (or ornaments added to original artefacts) may also be identified. The ancient recipes are improved to give new soldering procedures at low temperature.

  3. Photoswitchable NIR-Emitting Gold Nanoparticles.

    PubMed

    Bonacchi, Sara; Cantelli, Andrea; Battistelli, Giulia; Guidetti, Gloria; Calvaresi, Matteo; Manzi, Jeannette; Gabrielli, Luca; Ramadori, Federico; Gambarin, Alessandro; Mancin, Fabrizio; Montalti, Marco

    2016-09-05

    Photo-switching of the NIR emission of gold nanoparticles (GNP) upon photo-isomerization of azobenzene ligands, bound to the surface, is demonstrated. Photophysical results confirm the occurrence of an excitation energy transfer process from the ligands to the GNP that produces sensitized NIR emission. Because of this process, the excitation efficiency of the gold core, upon excitation of the ligands, is much higher for the trans form than for the cis one, and t→c photo-isomerization causes a relevant decrease of the GNP NIR emission. As a consequence, photo-isomerization can be monitored by ratiometric detection of the NIR emission upon dual excitation. The photo-isomerization process was followed in real-time through the simultaneous detection of absorbance and luminescence changes using a dedicated setup. Surprisingly, the photo-isomerization rate of the ligands, bound to the GNP surface, was the same as measured for the chromophores in solution. This outcome demonstrated that excitation energy transfer to gold assists photo-isomerization, rather than competing with it. These results pave the road to the development of new, NIR-emitting, stimuli-responsive nanomaterials for theranostics.

  4. Biosynthesis of gold nanoparticles: A green approach.

    PubMed

    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima

    2016-08-01

    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed.

  5. Titration of gold nanoparticles in phase extraction.

    PubMed

    Cheng, Han-Wen; Schadt, Mark J; Zhong, Chuan-Jian

    2015-12-07

    In the organic-aqueous phase transfer process of gold nanoparticles, there are two types of distinctive interfaces involving hydrophilic and hydrophobic ligands, the understanding of which is important for the design of functional nanomaterials for analytical/bioanalytical applications and the control over the nanoparticles' nanoactivity and nanotoxicity in different phases. This report describes new findings of an investigation of the quantitative aspect of ligand ion pairing at the capping monolayer structure that drives the phase extraction of gold nanoparticles. Alkanethiolate-capped gold nanoparticles of 8 nm diameter with high size monodispersity (RSD ∼ 5%) were first derivatized by a ligand place exchange reaction with 11-mercaptoundecanoic acid to form a mixed monolayer shell consisting of both hydrophobic (-CH3) and hydrophilic (-COOH) groups. It was followed by quantitative titration of the resulting nanoparticles with a cationic species (-NR4(+)) in a toluene phase, yielding ion pairing of -NR4(+) and -COO(-) on part of the capping monolayer. Analysis of the phase extraction allowed a quantitative determination of the percentage of ion pairing and structural changes in the capping monolayer on the nanoparticles. The results, along with morphological characterization, are discussed in terms of the interfacial structural changes and their implications on the rational design of surface-functionalized nanoparticles and fine tuning of the interfacial reactivity.

  6. Gold nanorods: contrast agents for photoacoustic imaging?

    NASA Astrophysics Data System (ADS)

    Ungureanu, C.; Gopal, R. Raja; van Leeuwen, T. G.; Manohar, S.

    2007-07-01

    Gold nanorods are seen as possible contrast agents for photoacoustic imaging since they have strong absorption peaks at near-infrared wavelengths. Also they are easy to conjugate with various proteins. If these particles can be conjugated with cancer affinity proteins then these particles can accumulate specifically at a tumor site. By detecting the presence of accumulation of gold nanorods inside the tissue the indirect detection of tumor can be realized. When these particles are irradiated with light pulses of appropriate temporal properties and energy the temperature around these particles can be high enough to induce apoptosis or necrosis in the surrounding cells. In order to use these particles at their full potential we must determine precisely their optical properties. We simulated the optical properties of gold nanorods synthesized by us using the DDSCAT code. The simulated spectra agree qualitatively with the spectra determined using spectrometry and also determined using photoacoustic spectroscopy. Further the values of molar extinction coefficient derived from the simulations were similar to the data measured experimentally by other groups. These results validated qualitatively the model used in the simulations. During simulations we found that the choice of the dielectric function used in simulations plays an important role in the results.

  7. Determination of the concentration and the average number of gold atoms in a gold nanoparticle by osmotic pressure.

    PubMed

    Lu, Yan; Wang, Lixia; Chen, Dejun; Wang, Gongke

    2012-06-26

    For an ideal solution, an analytical expression for the macromolecule concentration, electrolyte concentration, and solution osmotic pressure is obtained on the basis of the van't Hoff equation and the Donnan equilibrium. The expression was further applied to a colloid solution of about 3 nm glutathione-stabilized gold nanoparticles. The concentration of the colloid solution and the average net ion charge number for each gold nanoparticle were determined with the measured osmotic pressure data. Meanwhile, the gold contents of the solutions were analyzed by means of atomic absorption spectrophotometry, and the results were combined with the determined concentration of gold nanoparticle colloids to determine that the average number of gold atoms per 3 nm gold nanoparticle is 479, which is 1/1.7 times the number of atoms in bulk metallic gold of the same size. The same proportion also occurred in the 2 nm 4-mercaptobenzoic acid monolayer-protected gold nanoparticles prepared by Ackerson et al., who utilized the quantitative high-angle annular dark-field scanning transmission electron microscope to determine the average number of gold atoms per nanoparticle (Ackerson, C. J.; Jadzinsky, P. D.; Sexton J. Z.; Bushnell, D. A.; Kornberg, R. D. Synthesis and Bioconjugation of 2 and 3 nm-Diameter Gold Nanoparticles. Bioconjugate Chem. 2010, 21, 214-218).

  8. Manganese oxides supported on gold nanoparticles: new findings and current controversies for the role of gold.

    PubMed

    Najafpour, Mohammad Mahdi; Hosseini, Seyedeh Maedeh; Hołyńska, Małgorzata; Tomo, Tatsuya; Allakhverdiev, Suleyman I

    2015-12-01

    We synthesized manganese oxides supported on gold nanoparticles (diameter <100 nm) by the reaction of KMnO4 with gold nanoparticles under hydrothermal conditions. In this green method Mn oxide is deposited on the gold nanoparticles. The compounds were characterized by scanning electron microscopy, energy-dispersive spectrometry, high-resolution transmission electron microscopy, X-ray diffraction, UV-Vis spectroscopy, Fourier transform infrared spectroscopy, and atomic absorption spectroscopy. In the next step, the water-oxidizing activities of these compounds in the presence of cerium(IV) ammonium nitrate as a non-oxo transfer oxidant were studied. The results show that these compounds are good catalysts toward water oxidation with a turnover frequency of 1.0 ± 0.1 (mmol O2/(mol Mn·s)). A comparison with other previously reported Mn oxides and important factors influencing the water-oxidizing activities of Mn oxides is also discussed.

  9. Plasmonic phototherapy using gold nanospheres and gold nanorods irradiated with light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Poorani, Gananathan; Rao, Aruna Prakasa; Singaravelu, Ganesan; Manickam, Elanchezhiyan

    2016-04-01

    Gold nanoparticles (GNPs) provide different modes of therapeutic responses in cells depending on their size and shape. We have studied two modifications of GNPs exhibiting surface plasmon resonances (SPRs) with phototherapeutic effects in nonmalignant Vero and malignant HeLa cell lines. The cells were treated with 30-nm-size gold nanospheres (GNSs) (having SPR at a wavelength of 530 nm) and with gold nanorods (GNRs) (having SPR at 630 nm). The plasmonic phototherapy effect in cells was provided by irradiating them with green and red light-emitting diodes (LEDs). The cytotoxicities of GNPs were determined by MTT assay. Both the GNSs and GNRs were found to be biocompatible and have efficient phototherapeutic activity with LEDs.

  10. Electron-Impurity Interactions in the Relaxation of Hot Electrons in Gold-Gold Sulfide Nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah; Wolfgang, John; Nordlander, Peter; Halas, Naomi

    2000-10-01

    Hot electron dynamics can be modified in metallic nanostructures compared to bulk metals. In this experiment, ultrafast pump-probe spectroscopy permits observation of the effects of the local environment on hot electron relaxation in gold nanoshell particles. These nanoparticles consist of spherical (40 nm diameter) gold sulfide cores surrounded by ultrathin (5 nm) gold shells and possess a structure-dependent plasmon resonance.^1 Following excitation by a pump pulse at the plasmon resonance, the relaxation of the hot electrons in the nanoparticle's shell layer was observed. When molecules were adsorbed onto the nanoshell surface, increased electronic relaxation rates were observed for those molecular species with the greatest induced dipole moments near the nanoparticle surface. The effect of impurity adsorbates on the nanoparticle's electron dynamics is attributed to a perturbation in the electronic potential in the metal by the presence of the nearby impurities. ^1 R. D. Averitt, D. Sarkar, and N. J. Halas, Phys. Rev. Lett. 78, 4217 (1997).

  11. Constraints of mineralogical characterization of gold ore: Implication for genesis, controls and evolution of gold from Kundarkocha gold deposit, eastern India

    NASA Astrophysics Data System (ADS)

    Sahoo, P. R.; Venkatesh, A. S.

    2015-01-01

    Gold mineralization in Kundarkocha gold deposit occurs in the eastern Indian Craton that is hosted by sheared quartz-carbonate-sulfide veins emplaced within the graphitic schist, carbonaceous phyllite and talc-chlorite-serpentine schist belongs to Gorumahisani-Badampahar schist belt of Iron Ore Group. Gold mineralization exhibits both lithological and structural controls in the study area, albeit the stratigraphic control is more ubiquitously observed. Detailed mineralogical characterization coupled with electron probe microanalysis of the sulfide phases reveal the occurrences of gold in three distinct forms (i) as lattice-bound form within sulfides especially enriched in arsenopyrite, loellingite, pyrite, pyrrhotite and chalcopyrite in decreasing order of abundance; (ii) as micro inclusions or nano-scale gold inclusions within pyrite and arsenopyrite especially along the growth zones and micro-fractures as substrates and (iii) as free milling nugget gold grains either along the grain boundaries of sulfides or within the host rocks. Three generations of pyrite (Py-I, Py-II and Py-III) and arsenopyrite (Asp-I, Asp-II, Asp-III) have been identified based on textural, morphological characteristics and mineral chemistry. The lattice-bound gold content in pyrite and arsenopyrite varies from 600 to 2700 ppm and 900 to 3600 ppm respectively and increase in concentration of such refractory gold is seen in the order of chalcopyrite > pyrrhotite > pyrite > loellingite/arsenopyrite. The evolutionary stages of different forms of gold include remobilization of the lattice-bound grains in pyrite and arsenopyrite (Py-I and Asp-I) and re-concentration along the zoned-pyrite and arsenopyrite (Py-II and Asp-II) and ultimately as native gold/nuggets surrounding the sulfides as well as within the main mineralized zone. Lattice-bound gold distribution could have resulted due to metamorphic devolatilization reactions which are further aided by the influx of hydrothermal fluids. These

  12. Ultrafast electron dynamics in gold nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah Linda

    2001-10-01

    In metallic nanostructures, the interaction of excited electrons with the nanostructure surface may result in electron relaxation dynamics that are significantly different than those predicted by electron-lattice coupling. These ultrafast electron dynamics were monitored by pump-probe measurements of the time-resolved change in transmission. Using femtosecond pulses from a cavity-dumped titanium-doped sapphire laser, two types of nanoparticles with a core-shell geometry were studied. Nanoshells are nanoparticles with a dielectric core surrounded by a continuous thin metal shell. For nanoshells, the plasmon resonance wavelength is tunable by changing the core and shell dimensions. For nanoshells with a gold sulfide core and a gold shell, two conditions were observed under which electron relaxation was different than predicted by electron-phonon coupling. First, electron relaxation occurred more rapidly for gold-gold sulfide nanoshells embedded in polymer films than for nanoshells dispersed in water, with lifetimes of 1.6 ps and 3 to 5 ps, respectively. Second, for nanoshells dispersed in water, the electron relaxation lifetime decreased with adsorption of p-aminobenzoic acid (to 1.7 ps) or aniline (to 1.9 ps) on the nanoshells. With adsorbed n-propylamine or p-mercaptobenzoic acid, electron relaxation transpired in 2.8 ps or 2.4 ps, respectively. Density functional theory calculations indicated that the molecules leading to the fastest electron relaxation possessed the largest induced dipole moments near a metal surface. Semicontinuous gold films grown around a silica nanoparticle core exhibited spectral and dynamical optical signatures of the percolation threshold. Compared to continuous shells, the electron dynamics in the semicontinuous shell layer were dramatically different as additional induced bleaching was observed in the first 500 fs. The observed dynamics are consistent with a rate equation model in which the electrons are initially excited in localized

  13. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  14. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued in excess... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  15. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  16. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  17. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  18. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  19. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  20. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued in excess... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  1. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  2. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  3. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  4. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  5. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  6. Stabilization of 4H hexagonal phase in gold nanoribbons

    PubMed Central

    Fan, Zhanxi; Bosman, Michel; Huang, Xiao; Huang, Ding; Yu, Yi; Ong, Khuong P.; Akimov, Yuriy A.; Wu, Lin; Li, Bing; Wu, Jumiati; Huang, Ying; Liu, Qing; Eng Png, Ching; Lip Gan, Chee; Yang, Peidong; Zhang, Hua

    2015-01-01

    Gold, silver, platinum and palladium typically crystallize with the face-centred cubic structure. Here we report the high-yield solution synthesis of gold nanoribbons in the 4H hexagonal polytype, a previously unreported metastable phase of gold. These gold nanoribbons undergo a phase transition from the original 4H hexagonal to face-centred cubic structure on ligand exchange under ambient conditions. Using monochromated electron energy-loss spectroscopy, the strong infrared plasmon absorption of single 4H gold nanoribbons is observed. Furthermore, the 4H hexagonal phases of silver, palladium and platinum can be readily stabilized through direct epitaxial growth of these metals on the 4H gold nanoribbon surface. Our findings may open up new strategies for the crystal phase-controlled synthesis of advanced noble metal nanomaterials. PMID:26216712

  7. Annealing of gold nanostructures sputtered on glass substrate

    NASA Astrophysics Data System (ADS)

    Švorčík, V.; Siegel, J.; Šutta, P.; Mistrík, J.; Janíček, P.; Worsch, P.; Kolská, Z.

    2011-03-01

    The effects of annealing at 300 °C on gold nanostructures sputtered onto glass substrate were studied using XRD, SAXSees, the Van der Pauw method and ellipsometry. As-sputtered and annealed samples exhibit a different dependence of the gold lattice parameter on the sputtering time. With increasing sputtering time the average thickness of the layer and the size of gold crystallites increased. Another rapid enlargement of the crystallites is observed after annealing. The volume resistivity decreases rapidly with the increasing sputtering time for both, as-deposited and annealed structures. With increasing sputtering time initially discontinuous gold coverage changes gradually in a continuous one. Electrically continuous gold coverage on the as-sputtered and annealed samples exhibits the same concentration of free charge carriers and Hall mobility. Optical constants of as-deposited and annealed gold films determined by ellipsometry support resistivity measurements and clearly manifest the presence of plasmons in discontinuous films.

  8. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  9. Microbial synthesis of gold nanoparticles: current status and future prospects.

    PubMed

    Shedbalkar, Utkarsha; Singh, Richa; Wadhwani, Sweety; Gaidhani, Sharvari; Chopade, B A

    2014-07-01

    Gold nanoparticles have been employed in biomedicine since the last decade because of their unique optical, electrical and photothermal properties. Present review discusses the microbial synthesis, properties and biomedical applications of gold nanoparticles. Different microbial synthesis strategies used so far for obtaining better yield and stability have been described. It also includes different methods used for the characterization and analysis of gold nanoparticles, viz. UV-visible spectroscopy, Fourier transform infrared spectroscopy, X ray diffraction spectroscopy, scanning electron microscopy, ransmission electron microscopy, atomic force microscopy, electron dispersive X ray, X ray photoelectron spectroscopy and cyclic voltametry. The different mechanisms involved in microbial synthesis of gold nanoparticles have been discussed. The information related to applications of microbially synthesized gold nanoparticles and patents on microbial synthesis of gold nanoparticles has been summarized.

  10. Establishment of gold-quartz standard GQS-1

    USGS Publications Warehouse

    Millard, Hugh T.; Marinenko, John; McLane, John E.

    1969-01-01

    A homogeneous gold-quartz standard, GQS-1, was prepared from a heterogeneous gold-bearing quartz by chemical treatment. The concentration of gold in GQS-1 was determined by both instrumental neutron activation analysis and radioisotope dilution analysis to be 2.61?0.10 parts per million. Analysis of 10 samples of the standard by both instrumental neutron activation analysis and radioisotope dilution analysis failed to reveal heterogeneity within the standard. The precision of the analytical methods, expressed as standard error, was approximately 0.1 part per million. The analytical data were also used to estimate the average size of gold particles. The chemical treatment apparently reduced the average diameter of the gold particles by at least an order of magnitude and increased the concentration of gold grains by a factor of at least 4,000.

  11. Detection of squamous carcinoma cells using gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Dai, Wei-Yun; Lee, Sze-tsen; Hsu, Yih-Chih

    2015-03-01

    The goal of this study is to use gold nanoparticle as a diagnostic agent to detect human squamous carcinoma cells. Gold nanoparticles were synthesized and the gold nanoparticle size was 34.3 ± 6.2 nm. Based on the over-expression of epidermal growth factor receptor (EGFR) biomarkers in squamous carcinoma cells, we hypothesized that EGFR could be a feasible biomarker with a target moiety for detection. We further modified polyclonal antibodies of EGFR on the surface of gold nanoparticles. We found selected squamous carcinoma cells can be selectively detected using EGFR antibody-modified gold nanoparticles via receptor-mediated endocytosis. Cell death was also examined to determine the survival status of squamous carcinoma cells with respect to gold nanoparticle treatment and EGFR polyclonal antibody modification.

  12. SERS decoding of micro gold shells moving in microfluidic systems.

    PubMed

    Lee, Saram; Joo, Segyeong; Park, Sejin; Kim, Soyoun; Kim, Hee Chan; Chung, Taek Dong

    2010-05-01

    In this study, in situ surface-enhanced Raman scattering (SERS) decoding was demonstrated in microfluidic chips using novel thin micro gold shells modified with Raman tags. The micro gold shells were fabricated using electroless gold plating on PMMA beads with diameter of 15 microm. These shells were sophisticatedly optimized to produce the maximum SERS intensity, which minimized the exposure time for quick and safe decoding. The shell surfaces produced well-defined SERS spectra even at an extremely short exposure time, 1 ms, for a single micro gold shell combined with Raman tags such as 2-naphthalenethiol and benzenethiol. The consecutive SERS spectra from a variety of combinations of Raman tags were successfully acquired from the micro gold shells moving in 25 microm deep and 75 microm wide channels on a glass microfluidic chip. The proposed functionalized micro gold shells exhibited the potential of an on-chip microfluidic SERS decoding strategy for micro suspension array.

  13. Diffuse reflectivity of gold plating with high power laser irradiation

    NASA Astrophysics Data System (ADS)

    Wu, Yong; Zhang, Lei; Yang, Pengling; Wang, Zhenbao; Tao, Mengmeng; Liu, Fuhua; Feng, Guobin

    2015-05-01

    The discoloration and optical characteristics of the gold plating film under long-time high power laser irradiation are investigated. The fabrication process of gold plating on nickel underplate on rough surface of copper and aluminum alloy substrates is introduced. The measurement results of the diffuse reflectivity for the samples with different surface roughness indicate that roughness of the gold layer surface should be 4μm to obtain the maximum value of diffuse reflectivity. The discoloration and variation of diffuse reflectivity are experimentally studied under 2000W irradiation. The research results show that the discoloration and degrading of reflectivity are caused by the diffusion of Ni to the gold plating surface and forming NiO thin film due to the porosity of the gold film and high temperature treatment. A change of diffuse reflectivity related mechanism is described. Several plating solution recipes are used to eliminate the discoloration and mitigate the degrading of the reflectivity on gold surface.

  14. Gold over Branched Palladium Nanostructures for Photothermal Cancer Therapy.

    PubMed

    McGrath, Andrew J; Chien, Yi-Hsin; Cheong, Soshan; Herman, David A J; Watt, John; Henning, Anna M; Gloag, Lucy; Yeh, Chen-Sheng; Tilley, Richard D

    2015-12-22

    Bimetallic nanostructures show exciting potential as materials for effective photothermal hyperthermia therapy. We report the seed-mediated synthesis of palladium-gold (Pd-Au) nanostructures containing multiple gold nanocrystals on highly branched palladium seeds. The nanostructures were synthesized via the addition of a gold precursor to a palladium seed solution in the presence of oleylamine, which acts as both a reducing and a stabilizing agent. The interaction and the electronic coupling between gold nanocrystals and between palladium and gold broadened and red-shifted the localized surface plasmon resonance absorption maximum of the gold nanocrystals into the near-infrared region, to give enhanced suitability for photothermal hyperthermia therapy. Pd-Au heterostructures irradiated with an 808 nm laser light caused destruction of HeLa cancer cells in vitro, as well as complete destruction of tumor xenographs in mouse models in vivo for effective photothermal hyperthermia.

  15. Solution-based metal enhanced fluorescence with gold and gold/silver core-shell nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Zebin; Li, Xiaoyi; Guo, Jingxia; Wang, Ruibo; Wu, Yanni; Zhang, Mingdi; Li, Caixia; Han, Qingyan; Dong, Jun; Zheng, Hairong

    2015-12-01

    Metal enhanced fluorescence of Oxazine720 fluorophore with gold and gold/silver core-shell nanorods is investigated experimentally in aqueous solution system. Metallic nanorods are synthesized for providing proper localized surface plasmon resonance and necessary enhancement to the fluorophore molecule. The experimental observation shows that the fluorescence enhancement increases firstly and then decreases when the concentration of metallic nanorods increases, which is resulted by the competition between enhanced emission and inner-filtering effect. Further investigation with different amounts of metallic nanorods shows that the relationship between metal enhanced fluorescence and spectral correlation strongly depends on the concentration of metallic nanorods.

  16. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    SciTech Connect

    Pattabi, Manjunatha M, Krishnaprabha

    2015-06-24

    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl{sub 4}). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  17. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    NASA Astrophysics Data System (ADS)

    Pattabi, Manjunatha; M, Krishnaprabha

    2015-06-01

    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl4). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  18. Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods

    DTIC Science & Technology

    2014-12-04

    AFRL-OSR-VA-TR-2014-0334 NOVEL ORGANO-SOLUBLE OPTICALLY TUNABLE CHIRAL HYBRID GOLD NANORODS Quan Li KENT STATE UNIV OH Final Report 12/04/2014...Prescribed by ANSI Std. Z39.18 1 FINAL REPORT Title: Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods AFOSR...Now this project has accomplished all the proposed objectives and beyond. Organo-soluble chiral azo thiol monolayer-protected gold nanorods, the

  19. Gold Ion-Angiotensin Peptide Interaction by Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Lee, Jenny; Jayathilaka, Lasanthi P.; Gupta, Shalini; Huang, Jin-Sheng; Lee, Bao-Shiang

    2012-05-01

    Stimulated by the interest in developing gold compounds for treating cancer, gold ion-angiotensin peptide interactions are investigated by mass spectrometry. Under the experimental conditions used, the majority of gold ion-angiotensin peptide complexes contain gold in the oxidation states I and III. Both ESI-MS and MALDI-TOF MS detect singly/multiply charged ions for mononuclear/multinuclear gold-attached peptides, which are represented as [peptide + a Au(I) + b Au(III) + (e - a -3b) H]e+, where a,b ≥ 0 and e is charge. ESI-MS data shows singly/multiply charged ions of Au(I)-peptide and Au(III)-peptide complexes. This study reveals that MALDI-TOF MS mainly detects singly charged Au(I)-peptide complexes, presumably due to the ionization process. The electrons in the MALDI plume seem to efficiently reduce Au(III) to Au(I). MALDI also tends to enhance the higher polymeric forms of gold-peptide complexes regardless of the laser power used. Collision-induced dissociation experiments of the mononuclear and dinuclear gold-attached peptide ions for angiotensin peptides show that the gold ion (a soft acid) binding sites are in the vicinity of Cys (a soft ligand), His (a major anchor of peptide for metal ion chelation), and the basic residue Arg. Data also suggests that the abundance of gold-attached peptides increases with higher gold concentration until saturation, after which an increase in gold ion concentration leads to the aggregation and/or precipitation of gold-bound peptides.

  20. Multiple gold-dimer detection from large scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Jin, Zheng

    2016-10-01

    Gold nanoparticles exhibit unique plasmonic optical properties in visible to near infrared band. Especially the coupling effect existing at the gap between a closely linked particle pair can make the local field strongly enhanced. These properties make gold particles more attractive to be employed as molecular probes in biomedical related fundamental and clinical researches. However in the bio-system exist many large molecules or groups, whose optical signals can strongly depress the gold particles without detectable. In this paper, we proposed a method to extract the targets which are labelled by gold dimer pairs from large scattering background.

  1. Preparation and characterization of graphene oxide encapsulated gold nanoparticles.

    PubMed

    Yun, Yong Ju; Song, Ki-Bong

    2013-11-01

    We present a simple approach for the fabrication of graphene oxide-encapsulated gold nanoparticles using graphene oxide sheet-wrapping via electrostatic self-assembly. By mixing bovine serum albumin molecule-functionalized gold nanoparticles with graphene oxide dispersion, positively charged bovine serum albumin/gold nanoparticles easily assembled with negatively charged graphene oxide sheets through electrostatic interaction. Transmittance electron microscopy, scanning electron microscopy, atomic force microscopy, and Raman spectroscopy were used to confirm the encapsulation of graphene oxide on gold nanoparticles. Interestingly, graphene oxide sheets wrapping mainly occurs along the main body of single or a few gold nanoparticles. Additionally, by measuring the ultraviolet-visible spectroscopy spectrum, we found that the surface plasmon resonances band of the graphene oxide-encapsulated gold nanoparticles was found to become red-shifted compared to that of pristine gold nanoparticles, whereas similar to that of bovine serum albumin-coated gold nanoparticles. These results indicating that most of graphene oxide-encapsulated gold nanoparticles have good monodispersity and spherical shape. These resulting materials may potentially serve as a platform for plasmon resonance electron transfer spectroscopy or a probe for low level biosensing.

  2. Accelerated atmospheric corrosion testing of electroplated gold mirror coatings

    NASA Astrophysics Data System (ADS)

    Chu, C.-T.; Alaan, D. R.; Taylor, D. P.

    2010-08-01

    Gold-coated mirrors are widely used in infrared optics for industrial, space, and military applications. These mirrors are often made of aluminum or beryllium substrates with polished nickel plating. Gold is deposited on the nickel layer by either electroplating or vacuum deposition processes. Atmospheric corrosion of gold-coated electrical connectors and contacts was a well-known problem in the electronic industry and studied extensively. However, there is limited literature data that correlates atmospheric corrosion to the optical properties of gold mirror coatings. In this paper, the atmospheric corrosion of different electroplated gold mirror coatings were investigated with an accelerated mixed flowing gas (MFG) test for up to 50 days. The MFG test utilizes a combination of low-level air pollutants, humidity, and temperatures to achieve a simulated indoor environment. Depending on the gold coating thickness, pore corrosion started to appear on samples after about 10 days of the MFG exposure. The corrosion behavior of the gold mirror coatings demonstrated the porous nature of the electroplated gold coatings as well as the variation of porosity to the coating thickness. The changes of optical properties of the gold mirrors were correlated to the morphology of corrosion features on the mirror surface.

  3. The graphene-gold interface and its implications for nanoelectronics.

    PubMed

    Sundaram, Ravi S; Steiner, Mathias; Chiu, Hsin-Ying; Engel, Michael; Bol, Ageeth A; Krupke, Ralph; Burghard, Marko; Kern, Klaus; Avouris, Phaedon

    2011-09-14

    We combine optical microspectroscopy and electronic measurements to study how gold deposition affects the physical properties of graphene. We find that the electronic structure, the electron-phonon coupling, and the doping level in gold-plated graphene are largely preserved. The transfer lengths for electrons and holes at the graphene-gold contact have values as high as 1.6 μm. However, the interfacial coupling of graphene and gold causes local temperature drops of up to 500 K in operating electronic devices.

  4. Methanobactin-mediated one-step synthesis of gold nanoparticles.

    PubMed

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu

    2013-11-01

    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months.

  5. Methanobactin-Mediated One-Step Synthesis of Gold Nanoparticles

    PubMed Central

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu

    2013-01-01

    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months. PMID:24189217

  6. Reflectance spectroscopy of gold nanoshells: computational predictions and experimental measurements

    NASA Astrophysics Data System (ADS)

    Lin, Alex W. H.; Lewinski, Nastassja A.; Lee, Min-Ho; Drezek, Rebekah A.

    2006-10-01

    Gold nanoshells are concentric spherical constructs that possess highly desirable optical responses in the near infrared. Gold nanoshells consist of a thin outer gold shell and a silica core and can be used for both diagnostic and therapeutic purposes by tuning the optical response through changing the core-shell ratio as well as the overall size. Although optical properties of gold nanoshells have already been well documented, the reflectance characteristics are not well understood and have not yet been elucidated by experimental measurements. Yet, in order to use gold nanoshells as an optical contrast agent for scattering-based optical methods such as reflectance spectroscopy, it is critical to characterize the reflectance behavior. With this in mind, we used a fiber-optic-based spectrometer to measure diffuse reflectance of gold nanoshell suspensions from 500 nm to 900 nm. Experimental results show that gold nanoshells cause a significant increase in the measured reflectance. Spectral features associated with scattering from large angles ( 180°) were observed at low nanoshell concentrations. Monte Carlo modeling of gold nanoshells reflectance demonstrated the efficacy of using such methods to predict diffuse reflectance. Our studies suggest that gold nanoshells are an excellent candidate as optical contrast agents and that Monte Carlo methods are a useful tool for optimizing nanoshells best suited for scattering-based optical methods.

  7. Mercury contamination from historical gold mining in California

    USGS Publications Warehouse

    Alpers, Charles N.; Hunerlach, Michael P.; May, Jason T.; Hothem, Roger L.

    2005-01-01

    Mercury contamination from historical gold mines represents a potential risk to human health and the environment. This fact sheet provides background information on the use of mercury in historical gold mining and processing operations in California, with emphasis on historical hydraulic mining areas. It also describes results of recent USGS projects that address the potential risks associated with mercury contamination. Miners used mercury (quicksilver) to recover gold throughout the western United States. Gold deposits were either hardrock (lode, gold-quartz veins) or placer (alluvial, unconsolidated gravels). Underground methods (adits and shafts) were used to mine hardrock gold deposits. Hydraulic, drift, or dredging methods were used to mine the placer gold deposits. Mercury was used to enhance gold recovery in all the various types of mining operations; historical records indicate that more mercury was used and lost at hydraulic mines than at other types of mines. On the basis of USGS studies and other recent work, a better understanding is emerging of mercury distribution, ongoing transport, transformation processes, and the extent of biological uptake in areas affected by historical gold mining. This information has been used extensively by federal, state, and local agencies responsible for resource management and public health in California.

  8. Gold Carbene or Carbenoid: Is There a Difference?

    PubMed Central

    Wang, Yahui; Muratore, Michael E; Echavarren, Antonio M

    2015-01-01

    By reviewing the recent progress on the elucidation of the structure of gold carbenes and the definitions of metal carbenes and carbenoids, we recommend to use the term gold carbene to describe gold carbene-like intermediates, regardless of whether the carbene or carbocation extreme resonance dominates. Gold carbenes, because of the weak metal-to-carbene π-back-donation and their strongly electrophilic reactivity, could be classified into the broader family of Fischer carbenes, although their behavior and properties are very specific. PMID:25786384

  9. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection

    NASA Astrophysics Data System (ADS)

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo

    2014-07-01

    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  10. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection.

    PubMed

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo

    2014-01-01

    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  11. Nature, diversity of deposit types and metallogenic relations of South China

    USGS Publications Warehouse

    Zaw, K.; Peters, S.G.; Cromie, P.; Burrett, C.; Hou, Z.

    2007-01-01

    the 'Northern Golden Triangle' of China. These deposits are mostly epigenetic hydrothermal micron-disseminated gold deposits with associated As, Hg, Sb + Tl mineralisation similar to Carlin-type deposits in USA. The important deposits in the Southern Golden Triangle are Jinfeng (Lannigou), Zimudang, Getang, Yata and Banqi in Guizhou Province, and the Jinya and Gaolong deposits in Guangxi District. The most important deposits in the Northern Golden Triangle are the Dongbeizhai and Qiaoqiaoshang deposits. Many porphyry-related polymetallic copper-lead-zinc and gold skarn deposits occur in South China. These deposits are related to Indosinian (Triassic) and Yanshanian (Jurassic to Cretaceous) magmatism associated with collision of the South China and North China Cratons and westward subduction of the Palaeo-Pacific Plate. Most of these deposits are distributed along the Lower to Middle Yangtze River metallogenic belt. The most significant deposits are Tonglushan, Jilongshan, Fengshandong, Shitouzui and Jiguanzui. Au-(Ag-Mo)-rich porphyry-related Cu-Fe skarn deposits are also present (Chengmenshan and Wushan in Jiangxi Province and Xinqiao, Mashan-Tianmashan, Shizishan and Huangshilaoshan in Anhui Province). The South China fold belt extending from Fujian to Zhejiang Provinces is characterised by well-developed Yanshanian intrusive to subvolcanic rocks associated with porphyry to epithermal type mineralisation and mesothermal vein deposits. The largest porphyry copper deposit in China, Dexing, occurs in Jiangxi Province and is hosted by Yanshanian granodiorite. The high-sulphidation epithermal system occurs at the Zijinshan district in Fujian Province and epithermal to mesothermal vein-type deposits are also found in the Zhejiang Province (e.g., Zhilingtou). Part of Shandong Province is located at the northern margin of the South China Craton and the province has unique world class granite-hosted orogenic gold deposits. Occurrences of Pt-Pd-Ni-Cu-Co are found in Permian

  12. Ligand-Assisted Gold-Catalyzed Cross-Coupling with Aryldiazonium Salts: Redox Gold Catalysis without an External Oxidant.

    PubMed

    Cai, Rong; Lu, Mei; Aguilera, Ellen Y; Xi, Yumeng; Akhmedov, Novruz G; Petersen, Jeffrey L; Chen, Hao; Shi, Xiaodong

    2015-07-20

    Gold-catalyzed C(sp)-C(sp(2)) and C(sp(2))-C(sp(2)) cross-coupling reactions are accomplished with aryldiazonium salts as the coupling partner. With the assistance of bpy ligand, gold(I) species were oxidized to gold(III) by diazonium without any external oxidants. Monitoring the reaction with NMR and ESI-MS provided strong evidence for the nitrogen extrusion followed by Au(III) reductive elimination as the key step.

  13. Nanomanufacturing of gold nanoparticle superstructures from the "bottom-up"

    NASA Astrophysics Data System (ADS)

    Rao, Tingling

    Gold nanoparticles that can generate surface plasmons under appropriate conditions have attracted significant interest for their potential in optics, photonics, data storage and biological sensors. Developing high fidelity fabrication methods that yield gold nanoparticles with well-defined size, shape, composition and self-assembly allows manipulation of surface plasmonic properties for novel applications as well as revealing new aspects of the underlying science. This dissertation demonstrates multiple techniques that describe cost-effective bottom-up" fabrication methods that yield gold nano-superstructures. In my initial work, I outline the solution conditions for fabricating Janus nanoparticles composed of one gold nanoparticle per micelle. Poly(ethylene oxide)-b-polystyrene (PEO-b-PS) was synthesized and processed into spherical micelles, which served as the template to induce gold nanoparticles growth within the PEO corona in situ. Organic-inorganic hybrid nanoparticle formation was controlled kinetically by manipulating the concentration of both the micelle and reducing agent (HEPES). We also found that under certain condition, PEO-b-PS yielded micelles with pearl-like morphology, which possessed concentrated PEO domains at the interface between two adjacent PS cores. Careful manipulation of reaction conditions afforded gold nanoparticles that grew from the core-shell interface to form 1-dimensional (1-D) periodical gold nanoparticle chains. Based on similar principles, gold-gold dimers were synthesized by growing a second gold nanoparticle from a gold nanoparticle template surface-functionalized with PEO ligands. Gold dimers fabricated with this method exhibited strong enhancement properties via surface-enhanced Raman scattering (SERS). Instead of kinetic control, the number of newly grown gold nanoparticles on each particle template heavily relied on the PEO density on the nanoparticle template. As the size of the particle template increased from 10 nm to

  14. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.

    2014-04-01

    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  15. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.

    2013-04-01

    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  16. Turning Plastic into Gold: An Analogy to Demonstrate The Rutherford Gold Foil Experiment

    ERIC Educational Resources Information Center

    Gregory, Robert B.

    2007-01-01

    The Rutherford-Geiger-Marsden gold foil experiment is demonstrated to give students a useful mental image of the concept or principle of chemistry. The experiment shows students that in a short time one unexpected result can change the way science looks at the world.

  17. Where Are the Facts? "Jason's Gold" Gives Meaning to the Yukon Gold Rush

    ERIC Educational Resources Information Center

    Wasta, Stephanie; Lott, Carolyn

    2006-01-01

    This article discusses how fictional works can give a purposeful context and an appropriate venue for developing essential social studies concepts in middle-school students. The author uses the example of a National Council for the Social Studies (NCSS) notable book, "Jason's Gold" that blends history with story to become historical…

  18. Modulation of Fano resonances in symmetry-broken gold-SiO2-gold nanotube dimers

    NASA Astrophysics Data System (ADS)

    Wu, DaJian; Yu, HaiQun; Jiang, ShuMin; Wu, XueWei; Liu, XiaoJun

    2014-06-01

    Fano resonances in the symmetry-broken gold-SiO2-gold (BGSG) nanotubes and the associated dimers have been investigated based on the finite element method. In the BGSG nanotube, the symmetry breaking induced the interactions of the inner gold core and outer gold nanoshell plasmons of all multipolar orders and hence the red-shifts of the plasmon resonance modes and the enhanced quadrupole mode peaks were observed. The interference of the quadrupole mode peak with the subradiant dipole mode caused a Fano-dip in the scattering spectrum. By increasing the core offset-value in the BGSG nanotube, the Fano dip with low energy showed a red-shift and became deeper. Unexpectedly the plasmon coupling between a GSG nanotube and a BGSG nanotube can lead to two strong Fano dips in the scattering spectra of the dimer. It was further noted that the thin side of the BGSG nanotube located at two sides of the dimer gap can lead to the strong near-field coupling between two BGSG nanotubes and hence a deeper and broader Fano dip.

  19. Electronic transport in arrays of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Parthasarathy, Raghuveer

    We examine electronic transport through two-dimensional arrays of gold nanocrystals. Recently developed techniques of particle synthesis and array self-assembly provide ordered (and disordered) monolayers of six-nanometer diameter gold nanocrystals on substrates with in-plane electrodes. These well-characterized superlattices allow investigation of basic questions about electronic conduction in metal quantum dot assemblies, answers to which have previously remained elusive. We first address the relation between current and voltage. Central to transport is the Coulomb blockade, the energetic cost of adding a single electron to a nanocrystal. Theoretical studies suggest power-law scaling of current beyond a threshold voltage in Coulomb blockade dominated systems. In ordered arrays, our data follow a power-law form, but with a scaling exponent significantly higher than the theoretical prediction. In disordered arrays, power-law scaling is violated; we explain that disorder disturbs the branching of current-carrying paths responsible for power-law conduction. Second, we examine the effect of temperature on transport. We find a large low-temperature regime (up to about 100 K) in which thermal energy acts only to linearly suppress the threshold voltage, leaving the current scale unaffected. We provide a simple, analytic model of thermally assisted tunneling which quantitatively describes the data. Third, we develop a simple and novel technique to tune the interparticle electronic couplings of the arrays---deposition of small amounts of germanium on the monolayers. The germanium dopant lowers the voltage threshold, and also increases conductivity. It also increases the temperature dependence of transport, suggesting the introduction of trapped states between the gold nanocrystal cores.

  20. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  1. Gold in the oceans through time

    NASA Astrophysics Data System (ADS)

    Large, Ross R.; Gregory, Daniel D.; Steadman, Jeffrey A.; Tomkins, Andrew G.; Lounejeva, Elena; Danyushevsky, Leonid V.; Halpin, Jacqueline A.; Maslennikov, Valeriy; Sack, Patrick J.; Mukherjee, Indrani; Berry, Ron; Hickman, Arthur

    2015-10-01

    During sedimentation and diagenesis of carbonaceous shales in marine continental margin settings, Au is adsorbed from seawater and organic matter and becomes incorporated into sedimentary pyrite. LA-ICPMS analysis of over 4000 sedimentary pyrite grains in 308 samples from 33 locations around the world, grouped over 123 determined ages, has enabled us to track, in a first order sense, the Au content of the ocean over the last 3.5 billion years. Gold was enriched in the Meso- and Neoarchean oceans, several times above present values, then dropped by an order of magnitude from the first Great Oxidation Event (GOE1) through the Paleoproterozoic to reach a minimum value around 1600 Ma. Gold content of the oceans then rose, with perturbations, through the Meso- and Neoproterozoic, showing a steady rise at the end of the Proterozoic (800 to 520 Ma), which most likely represents the effects of the second Great Oxidation Event (GOE2). Gold in the oceans was at a maximum at 520 Ma, when oxygen in the oceans rose to match current maximum values. In the Archean and Proterozoic, the Au content of seawater correlates with the time distribution of high-Mg greenstone belts, black shales and banded iron formations, suggesting that increases in atmospheric oxygen and marine bio-productivity, combined with the higher background of Au in komatiitic and Mg-rich basalts were the first order causes of the pattern of Au enrichment in seawater. We suggest the lack of major Au deposits from 1800 to 800 Ma, is explained by the low levels of Au in the oceans during this period.

  2. Fugitive Mercury Emissions From Nevada Gold Mines

    NASA Astrophysics Data System (ADS)

    Miller, M. B.; Eckley, C. S.; Gustin, M.; Marsik, F.

    2008-12-01

    Mercury (Hg) can be released from point sources at gold mines (e.g. stacks associated with ore processing facilities) as well as from diffuse fugitive sources (e.g. waste rock dumps, heap leaches, etc). Fugitive Hg emissions have not been quantified for active gold mines and as such a large knowledge gap exists concerning the magnitude of total emissions from this source type. This study measured fugitive Hg emissions from two active gold mines in Northern Nevada. To contextualize the magnitude of the mine emissions with respect to those associated with natural surfaces, data were collected from undisturbed areas near the mines that are of similar geologic character. The initial results from this project have shown that there is a large range in surface Hg concentrations and associated emissions to the atmosphere from different surface types within a mine as well as between the two mines. At both mines, the lowest surface Hg concentrations and emissions were associated with the alluvium/overburden waste rock dumps. Surface Hg concentrations and emissions at nearby undisturbed sites were of similar magnitude. Surface concentrations and emissions were substantially higher from active heap leaches. In addition to the difference in fluxes for specific materials, measured emissions must be put within the context of material spatial extent and temporal variability. Here we compare Hg emission contributions from mining and undisturbed materials as a function of space and time (diel and seasonal), and illustrate the need for collection of these types of data in order to reduce uncertainties in understanding air-surface Hg exchange.

  3. Solidification of gold nanoparticles in carbon nanotubes.

    PubMed

    Arcidiacono, S; Walther, J H; Poulikakos, D; Passerone, D; Koumoutsakos, P

    2005-03-18

    The structure and the solidification of gold nanoparticles in a carbon nanotube are investigated using molecular dynamics simulations. The simulations indicate that the predicted solidification temperature of the enclosed particle is lower than its bulk counterpart, but higher than that observed for clusters placed in vacuum. A comparison with a phenomenological model indicates that, in the considered range of tube radii (R(CNT)) of 0.5 < R(CNT) < 1.6 nm, the solidification temperature depends mainly on the length of the particle with a minor dependence on R(CNT).

  4. Gold(I) Fluorohalides: Theory and Experiment.

    PubMed

    Baya, Miguel; Pérez-Bitrián, Alberto; Martínez-Salvador, Sonia; Casas, José M; Menjón, Babil; Orduna, Jesús

    2017-01-31

    The anionic trifluoromethylgold(I) derivatives [CF3 AuX](-) , which have been prepared and isolated as their [PPh4 ](+) salts in good yield, undergo thermally induced difluorocarbene extrusion in the gas phase, giving rise to the mixed gold(I) fluorohalide complexes [F-Au-X](-) (X=Cl, Br, I). These triatomic species have been detected by tandem mass spectrometry (MS2) experiments and their properties have been analyzed by DFT methods. The CF2 extrusion mechanism from the Au-CF3 moiety serves as a model for the CF2 insertion into the Au-F bond, since both reactivity channels are connected by the microreversibility principle.

  5. Structural and plasmonic properties of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Sivapalan, Sean T.

    The design of gold nanoparticles for surface-enhanced Raman scattering (SERS) and plasmonic enhanced fluorescence are more involved than simply maximizing the local field enhancement. The enhancement is a function of the excitation wavelength relative to the plasmon resonance as well as the distance of the reporter molecules from the nanoparticles' surface. For suspension based measurements, additional considerations must also be made regarding absorption and scattering effects as light propagates through the sample. These effects are in addition to the other more commonly observed effects such as nanocrystal shape. With such a wide number of variables in play, a series of studies breaking down each of these components and their contribution to the observed enhancement is warranted. In this thesis, a series of experiments were undertaken using a platform based on polyelectrolyte coating of gold nanoparticles by layer-by-layer deposition. The reporter molecules are bound onto the surface of polyelectrolyte coated nanoparticles before trap coating them with an additional oppositely charged polyelectrolyte layer. By etching away the gold nanoparticle using potassium cyanide, we are then able to quantify the number of reporter molecule per nanoparticle using mass spectrometry. With this quantitative approach, we can the directly compare the effects of the aforementioned enhancement mechanisms on the observed signal intensity. This method overcomes some of the disparities in literature between reported values of enhancement due to assumption in the number of reporter molecules contribution to the signal intensity. Using our group's expertise, we synthesized gold nanoparticle libraries of nanorods, cubes, trisoctahedra and spheres of different sizes. Each geometric configuration was characterized using a recently developed TEM technique---nano-beam coherent area diffraction. The as-synthesized were exposed to a coherent electron beam with probe size similar to that of

  6. Overgrowth of Rhodium on Gold Nanorods

    PubMed Central

    2012-01-01

    This study focuses on the deposition and growth mode of rhodium (Rh) on gold (Au) seed nanorods (NRs). Using a combination of scanning transmission electron microscopy imaging, energy-dispersive X-ray spectroscopy, and UV–visible absorption spectroscopy, we show that Rh deposition results in an uneven overlayer morphology on the Au NR seeds, with a tendency for Rh deposition to occur preferentially on the Au NR ends. The results suggest that complex and kinetically driven metal–metal interactions take place in this system. PMID:22582111

  7. Mortality of white South African gold miners.

    PubMed Central

    Reid, P J; Sluis-Cremer, G K

    1996-01-01

    OBJECTIVES--This two part study aimed to determine whether there was an excess mortality generally or for some diseases among middle aged white South African gold miners on the Witwatersrand and whether the underground dust exposure of these miners contributed to the development of lung cancer, chronic obstructive pulmonary disease (COPD), or ischaemic heart disease (IHD). METHODS--A cohort of 4925 white miners in South Africa, born between 1 January 1916 and 31 December 1930 who were alive and working in the vicinity of Johannesburg on 1 January 1970, then aged between 39 and 54, was followed up for 20 years by which time 2032 had died. Most were gold miners (about 87% had worked 85% or more of their shifts in gold mines). Standardised mortality ratios (SMRs) were calculated as percentages of the number of deaths observed in the cohort for a condition as stated on the death certificate divided by the number expected on the basis of concurrent mortality in the reference population (the total age specific white male population of South Africa). A case-control analysis was performed for three diseases (lung cancer, COPD, and IHD), the results of which are presented for those miners in the cohort who had spent at least 85% of their service on gold mines and had worked at least 15% of their shifts underground. RESULTS--The SMR for all causes of death was 129.6%, raised because of excess mortality due to the following causes: lung cancer (SMR = 139.8%), IHD (124.1%), COPD (189%) and cirrhosis of the liver (155.3%). Smoking was confirmed to be the main risk factor for lung cancer and COPD although cumulative dust exposure was found to increase the risk of COPD in conjunction with smoking. No significant risk of lung cancer resulted from exposure to dust. High blood pressure and smoking were found to increase the risk of IHD, but no association between IHD and the quetelet index (weight/height2) was found. CONCLUSIONS--The most significant and unexpected finding was the

  8. Monolayer coated gold nanoparticles for delivery applications

    PubMed Central

    Rana, Subinoy; Bajaj, Avinash; Mout, Rubul; Rotello, Vincent M.

    2011-01-01

    Gold nanoparticles (AuNPs) provide attractive vehicles for delivery of drugs, genetic materials, proteins, and small molecules. AuNPs feature low core toxicity coupled with the ability to parametrically control particle size and surface properties. In this review, we focus on engineering of the AuNP surface monolayer, highlighting recent advances in tuning monolayer structures for efficient delivery of drugs and biomolecules. This review covers two broad categories of particle functionalization, organic monolayers and biomolecule coatings, and discusses their applications in drug, DNA/RNA, protein and small molecule delivery. PMID:21925556

  9. Method for aqueous gold thiosulfate extraction using copper-cyanide pretreated carbon adsorption

    SciTech Connect

    Young, Courtney; Melashvili, Mariam; Gow, Nicholas V

    2013-08-06

    A gold thiosulfate leaching process uses carbon to remove gold from the leach liquor. The activated carbon is pretreated with copper cyanide. A copper (on the carbon) to gold (in solution) ratio of at least 1.5 optimizes gold recovery from solution. To recover the gold from the carbon, conventional elution technology works but is dependent on the copper to gold ratio on the carbon.

  10. Adsorption of cellulose derivatives on flat gold surfaces and on spherical gold particles.

    PubMed

    Amirkhani, Masoud; Volden, Sondre; Zhu, Kaizheng; Glomm, Wilhelm R; Nyström, Bo

    2008-12-01

    The adsorption of hydroxyethylcellulose (HEC), ethyl(hydroxyethyl)cellulose (EHEC), and their hydrophobically modified counterparts HM-HEC and HM-EHEC has been studied on planar gold and citrate-covered gold surfaces by means of quartz crystal microbalance with dissipation monitoring (QCM-D), and on citrate-covered gold particles with the aid of dynamic light scattering (DLS). The QCM-D results indicate that larger amounts of polymer are adsorbed from aqueous solutions of HM-HEC and HM-EHEC on both substrates than from solutions of their unmodified analogues. The adsorption affinity for all the polymers, except EHEC, is higher on the citrate-covered surfaces than on the bare gold substrate. This indicates that more adsorption sites are activated in the presence of the citrate layer. The experimental adsorption data for all the polymers can be described fairly well by the Langmuir adsorption isotherm. However, at very low polymer concentrations significant deviations from the model are observed. The value of the hydrodynamic thickness of the adsorbed polymer layer (delta h), determined from DLS, rises with increasing polymer concentration for all the cellulose derivatives; a Langmuir type of isotherm can be used to roughly describe the adsorption behavior. Because of good solvent conditions for HEC the chains extend far out in the bulk at higher concentrations and the value of delta h is much higher than that of HM-HEC. The adsorption of EHEC and HM-EHEC onto gold particles discloses that the values of delta h are considerably higher for the hydrophobically modified cellulose derivative, and this finding is compatible with the trend in layer thickness estimated from the QCM-D measurements.

  11. Shape and surface effects on the cytotoxicity of nanoparticles: Gold nanospheres versus gold nanostars.

    PubMed

    Favi, Pelagie Marlene; Gao, Ming; Johana Sepúlveda Arango, Liuda; Ospina, Sandra Patricia; Morales, Mariana; Pavon, Juan Jose; Webster, Thomas Jay

    2015-11-01

    Gold nanoparticles are materials with unique optical properties that have made them very attractive for numerous biomedical applications. With the increasing discovery of techniques to synthesize novel nanoparticles such as star-shaped gold nanoparticles for biomedical applications, the safety and performance of these new nanomaterials must be systematically assessed before use. In this study, gold nanostars (AuNSTs) with multibranched surface structures were synthesized, and their influence on the cytotoxicity of human skin fibroblasts and rat fat pad endothelial cells (RFPECs) were assessed and compared with that of gold nanospheres (AuNSPs) with unbranched surfaces. Results showed that the AuNSPs with diameters of approximately 61.46 nm showed greater toxicity with fibroblast cells and RFPECs compared with the synthesized AuNSTs with diameters of approximately 33.69 nm. The AuNSPs were lethal at concentrations of 40 μg/mL for both cell lines, whereas the AuNSTs were less toxic at higher concentrations (400 μg/mL). The calculated IC50 (50% inhibitory concentration) values of the AuNSPs exposed to fibroblast cells were greater at 1 and 4 days of culture (26.4 and 27.7 μg/mL, respectively) compared with the RFPECs (13.6 and 13.8 μg/mL, respectively), indicating that the AuNSPs have a greater toxicity to endothelial cells. It was proposed that possible factors that could be promoting the reduced toxicity effects of the AuNSTs to fibroblast cells and RFPECs, compared with the AuNSPs may be size, surface chemistry, and shape of the gold nanoparticles. The reduced cell toxicity observed with the AuNSTs suggests that AuNSTs may be a promising material for use in biomedical applications.

  12. Synthesis of Barbaralones and Bullvalenes Made Easy by Gold Catalysis.

    PubMed

    Ferrer, Sofia; Echavarren, Antonio M

    2016-09-05

    The gold(I)-catalyzed oxidative cyclization of 7-ethynyl-1,3,5-cycloheptatrienes gives 1-substituted barbaralones in a general manner, which simplifies the access to other fluxional molecules. As an example, we report the shortest syntheses of bullvalene, phenylbullvalene, and disubstituted bullvalenes, and a readily accessible route to complex cage-type structures by further gold(I)-catalyzed reactions.

  13. Intriguing mechanistic labyrinths in gold(i) catalysis

    PubMed Central

    Obradors, Carla

    2014-01-01

    Many mechanistically intriguing reactions have been developed in the last decade using gold(i) as catalyst. Here we review the main mechanistic proposals in gold-catalysed activation of alkynes and allenes, in which this metal plays a central role by stabilising a variety of complex cationic intermediates. PMID:24176910

  14. Why Gold and Copper Are Colored but Silver Is Not.

    ERIC Educational Resources Information Center

    Guerrero, Ariel H.; Fasoli, Hector J.; Costa, Jose Luis

    1999-01-01

    Explains why silver, which has the same external electronic configuration as copper and gold, does not appear yellow: white light reflects on most metals without color absorption or change to the naked eye; however, copper and gold appear yellow because they absorb "blue" and "red" photons during electron transitions between…

  15. Gold Mining in Papua New Guinea: A Curricular Omission?

    ERIC Educational Resources Information Center

    Palmer, W. P.

    1989-01-01

    What criteria should be used to include or exclude particular topics within a country's science curriculum? It will be argued here that gold/gold mining is a suitable and relevant topic for inclusion in PNG's science curricula and suggestions towards achieving that end will be offered. The teaching of the mining of copper ore and the metal's…

  16. News from El Dorado: Newspapers and the California Gold Rush.

    ERIC Educational Resources Information Center

    Kurutz, Gary F.

    When James Wilson Marshall discovered gold at Sutter's Mill (California) in 1848, he not only touched off the greatest gold rush the world had ever seen, but also ignited one of the great writing frenzies in American history. Guidebooks, diaries, and letters all told of a new El Dorado where unimaginable riches could be found simply by picking…

  17. An electrochemical investigation of gold, tin and titanium compounds

    SciTech Connect

    Sawtelle, S.M.

    1992-01-01

    The determination of the electron transfer properties of gold, tin, and titanium compounds using electrochemical and spectroelectrochemical techniques is the focus of this dissertation. The investigations of the gold compounds include the determination of the properties of Au[PR[sub 3

  18. [Gold amulets of Ra: a step towards immortality].

    PubMed

    Janot, F

    2000-06-01

    In Ancient Egypt, the priest-embalmer laid the gold on the whole of the king's body. For simple citizens, he more modestly applied fine leaves or amulets of golden wax for certain parts. Possessing the same magical powers as gold, they participated in the complete preservation.

  19. The source of Witwatersrand gold: evidence from uraninite chemistry

    USGS Publications Warehouse

    Frimmel, Hartwig E.; Emsbo, Poul; Koenig, Alan E.

    2009-01-01

    An in-situ LA-ICP-MS study of different generations of uraninite from the Mesoarchaean Witwatersrand gold palaeoplacer deposits revealed unusually high Au concentrations in rounded, detrital uraninite grains but no detectable Au in secondary, hydrothermally mobilised uraninite. A Au-enriched uraninite-bearing magmatic host is suggested as a significant source for detrital gold in the Witwatersrand sediments.

  20. Gold-silica quantum rattles for multimodal imaging and therapy.

    PubMed

    Hembury, Mathew; Chiappini, Ciro; Bertazzo, Sergio; Kalber, Tammy L; Drisko, Glenna L; Ogunlade, Olumide; Walker-Samuel, Simon; Krishna, Katla Sai; Jumeaux, Coline; Beard, Paul; Kumar, Challa S S R; Porter, Alexandra E; Lythgoe, Mark F; Boissière, Cédric; Sanchez, Clément; Stevens, Molly M

    2015-02-17

    Gold quantum dots exhibit distinctive optical and magnetic behaviors compared with larger gold nanoparticles. However, their unfavorable interaction with living systems and lack of stability in aqueous solvents has so far prevented their adoption in biology and medicine. Here, a simple synthetic pathway integrates gold quantum dots within a mesoporous silica shell, alongside larger gold nanoparticles within the shell's central cavity. This "quantum rattle" structure is stable in aqueous solutions, does not elicit cell toxicity, preserves the attractive near-infrared photonics and paramagnetism of gold quantum dots, and enhances the drug-carrier performance of the silica shell. In vivo, the quantum rattles reduced tumor burden in a single course of photothermal therapy while coupling three complementary imaging modalities: near-infrared fluorescence, photoacoustic, and magnetic resonance imaging. The incorporation of gold within the quantum rattles significantly enhanced the drug-carrier performance of the silica shell. This innovative material design based on the mutually beneficial interaction of gold and silica introduces the use of gold quantum dots for imaging and therapeutic applications.