Strategic Planning for Institutions of Higher Education: A Content Analysis for the Universidad Tecnica del Estado Planning System.

ERIC Educational Resources Information Center

Karadima, Oscar

Ten-year development plans of each of the eight campuses of the Universidad de Santiago de Chile, formerly called Universidad Tecnica del Estado, are evaluated, using content analysis. In addition to narrative descriptions, diagrams illustrate the features of each plan, which covers the period 1983-1993. Topics covered by the plans were grouped…

[Proposal for early detection of ethanol consumption in students of the Universidad Autónoma del Estado de Morelos].

PubMed

García-Jiménez, Sara; Erazo-Mijares, Miguel; Toledano-Jaimes, Cairo D; Monroy-Noyola, Antonio; Bilbao-Marcos, Fernando; Sánchez-Alemán, Miguel A; Déciga-Campos, Myrna

2016-01-01

The present study determined through analytic techniques the quantification of some biomarkers that have been useful to detect early ethanol consumption in a college population. A group of 117 students of recent entry to the Universidad Autónoma del Estado de Morelos was analyzed. The enzyme determination of aspartate aminotransferase, alanine aminotransferase, and gamma glutamyltransferase as metabolic markers of ethanol, as well as the carbohydrate-deficient transferrin (CDT) detected by high chromatographic liquid (up to 1.8% of CDT), allowed us to identify that 6% of the college population presented a potential risk of alcohol consumption. The use of the biochemical-analytical method overall with the psychological drug and a risk factor instrument established by the Universidad Autónoma del Estado de Morelos permit us to identify students whose substance abuse consumption puts their terminal efficiency at risk as well as their academic level. The timely detection on admission to college can monitor and support a student consumer's substance abuse.

[Relation of leptin in plasma with oxidative damage in indigenous tepehuán and mestizo populations from Durango].

PubMed

Delgadillo-Guzmán, Dealmy; Quintanar-Escorza, Martha Angélica; Carrera-Gracia, Manuela de la A; Lares-Aseff, Ismael

2015-01-01

Obesity is a multifactorial metabolic disorder that involves lipid peroxidation (LPX), activating the antioxidant systems to counteract cellular damage. Objective: To evaluate the correlation between the antioxidant capacity and LPX levels of /eptin, in indigenous Tepehuan and Mestizo populations of the State of Durango. We conducted a nutritional clinical study and lipid profile to confirm the state of health of a group of 60 indigenous Tepehuan of Mezquital and 68 mestizos subjects of Durango city, aged between 18 to 59 years. We determined the concentrations of leptin, antioxidant capacity and LPX in fasting conditions on plasma of participants, comparing averages, minimum, maximum, and standard deviation through ANOVA and Kruskai-Wal/is. For the correlation of variables, Pearson test was applied, getting the r value. Leptin levels were lower in indigenous Tepehuan than mestizos independent of body mass index. Mestizo subjects and Tepehuan with overweight and obesity (OW/0) or both ethnic groups show a greater degree of LPX (3.39 ± 0.31, 2.72 ± 0.54 MDA J.lmol/1, respectively; p < 0.05); however, OW/0 mestizos show more activation of its (0.37±0. 03 meqltrolox) than Tepehuan normal weight (NW) and OW/0 (0.32 ±0. 01 meq/trolox). The correlation between antioxidant capacity and LPX in mixed OW/0 was positive (r = 0.9; p < 0. 001). There is a correlation between levels of leptin and the antioxidant capacity of Tepehuan subjects both NW and OW/0 (r = 0.40; p < 0.05 and r = -0.66; p < 0.0001, respectively). Tepehuan groups with OW/0 have less oxidative damage, while antioxidant mechanisms have a smaller activation than the top crosses of the same nutritional condition. The results suggest that antioxidant capacity has an implication on the regulation of leptin levels in Tepehuan subjects.

Differences in idiopathic inflammatory myopathy phenotypes and genotypes between Mesoamerican Mestizos and North American Caucasians: ethnogeographic influences in the genetics and clinical expression of myositis.

PubMed

Shamim, Ejaz A; Rider, Lisa G; Pandey, Janardan P; O'Hanlon, Terrance P; Jara, Luis J; Samayoa, Eduardo A; Burgos-Vargas, Ruben; Vazquez-Mellado, Janitzia; Alcocer-Varela, Jorge; Salazar-Paramo, Mario; Kutzbach, Abraham Garcia; Malley, James D; Targoff, Ira N; Garcia-De la Torre, Ignacio; Miller, Frederick W

2002-07-01

As part of a larger, worldwide study of the ethnogeography of myositis, we evaluated the clinical, serologic, and immunogenetic features of Mestizo (Mexican and Guatemalan) and North American Caucasian patients with idiopathic inflammatory myopathy (IIM). Clinical manifestations, autoantibodies, HLA-DRB1 and DQA1 alleles, and immunoglobulin Gm/Km allotypes were compared between 138 Mestizos with IIM and 287 Caucasians with IIM, using the same classification criteria and standardized questionnaires. IIM in Mestizo patients was characterized by a higher proportion of dermatomyositis (69% of adult Mestizos versus 35% of adult Caucasians; P < 0.001) and anti-Mi-2 autoantibodies (30% versus 7% of adults, respectively, and 32% versus 4% of children, respectively; P < 0.01). Genetic risk factors also differed in these populations. Whereas Mestizos had no HLA risk factors for IIM, HLA-DRB1*0301, the linked allele DQA1*0501, and DRB1 alleles sharing the first hypervariable region motif (9)EYSTS(13) were major risk factors in Caucasian patients with IIM. Furthermore, different HLA-DRB1 and DQA1 alleles were associated with anti-Mi-2 autoantibodies (DRB1*04 and DQA1*03 in Mestizos and DRB1*07 and DQA1*02 in Caucasians). Immunoglobulin gamma-chain allotypes Gm(1), Gm(17) (odds ratio for both 11.3, P = 0.008), and Gm(21) (odds ratio 7.3, P = 0.005) and kappa-chain allotype Km(3) (odds ratio 7.3, P = 0.005) were risk factors for IIM in Mestizos; however, no Gm or Km allotypes were risk or protective factors in Caucasians. In addition, Gm and Km phenotypes were unique risk factors (Gm 1,3,17 5,13,21 and Gm 1,17 23 21 and Km 3,3) or protective factors (Km 1,1) for the development of myositis and anti-Mi-2 autoantibodies (Gm 1,2,3,17 23 5,13,21) in adult Mestizos. IIM in Mesoamerican Mestizos differs from IIM in North American Caucasians in the frequency of phenotypic features and in the immune-response genes predisposing to and protecting from myositis and anti-Mi-2 autoantibodies

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary.

PubMed

Ugarte-Gil, Manuel F; Pons-Estel, Guillermo J; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K; Pons-Estel, Bernardo A; Alarcón-Riquelme, Marta; Alarcón, Graciela S

2016-03-01

To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student's t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights

Forensic parameters for 15 autosomal STRs in Mestizo population from the state of Guerrero (South, Mexico).

PubMed

Locia-Aguilar, G J; López-Saucedo, B; Deheza-Bautista, S; Salado-Beltrán, O V; Martínez-Sevilla, V M; Rangel-Villalobos, H

2018-03-31

Allele distribution and forensic parameters were estimated for 15 STR loci (AmpFlSTR Identifiler kit) in 251 Mexican-Mestizos from the state of Guerrero (South, Mexico). Genotype distribution was in agreement with Hardy-Weinberg expectations for all 15 STRs. Similarly, linkage disequilibrium test demonstrated no association between pair of loci. The power of exclusion and power of discrimination values were 99.999634444% and >99.99999999%, respectively. Genetic relationship analysis regarding Mestizo populations from the main geographic regions of Mexico suggests that the Center and the present South regions conform one population cluster, separated from the Southeast and Northwest regions. Copyright © 2018 Elsevier B.V. All rights reserved.

Lactase persistence and dairy intake in Mapuche and Mestizo populations from southern Chile.

PubMed

Fernández, Catalina I; Flores, Sergio V

2014-11-01

Lactase persistence (LP) occurs at a very low frequency in indigenous populations from Latin America, offering an opportunity to understand the relationship between this genetic trait and patterns of dairy consumption. Here, the frequency of LP is analyzed from Mapuche and -an adjacent- mestizo population inhabiting the Araucanía region. In addition to genotyping for LP, participants were surveyed in relation to general perception and consumption habits of dairy products. Low LP frequency (10%) and very low dairy intake was found among the Mapuche population as compared with Mestizo populations inhabiting Chile. The survey reported that the main reasons for avoidance of dairy were the gastrointestinal symptoms after dairy intake and cultural dietary habits. The interaction between low LP genotype frequency, low dairy intake, and sociocultural determinants is here discussed in the light of their potential health outcomes. © 2014 Wiley Periodicals, Inc.

Developing Flexible Dual Master's Degree Programs at UPAEP (Universidad Popular Autonoma del Estado de Puebla) and OSU (Oklahoma State University)

ERIC Educational Resources Information Center

Fabregas-Janeiro, Maria G.; de la Parra, Pablo Nuno

2012-01-01

In 2006, UPAEP (Universidad Popular Autonoma del Estado de Puebla) and OSU (Oklahoma State University) signed a MOU (memorandum of understanding) to develop more than 20 dual master's degree programs. This special partnership has allowed students from Mexico and the United States to study two master degree programs, in two languages, in two…

Nasal valve evaluation in the Mexican-Hispanic (mestizo) nose.

PubMed

Jasso-Ramírez, Elizabeth; Sánchez Y Béjar, Fernando; Arcaute Aizpuru, Fernando; Maulen Radován, Irene E; de la Garza Hesles, Héctor

2018-04-01

Our aim in this study was to determine the angle of the internal nasal valve in Mexican patients with the "mestizo nose" feature and without nasal obstructive symptoms. The work was prospective, comparative, and observational in nature and included patients >14 years of age who were seen in the Otolaryngology Department at the Los Angeles Lomas Hospital between April and May 2016. The angle of the internal nasal valve was measured in 30 patients without obstructive symptoms. Endoscopic examination was performed with a 0° endoscope framed with tape at a 13-mm distance from the endoscope's tip, and digital photographs of the internal nasal valve were taken. The measurement of the angle of the internal nasal valve was made in sexagesimal degrees using Golden Ratio v3.1 (2012) software. Statistical analysis was performed using Excel v15.13.3. The angles of the internal nasal valve of the patients were (mean ± standard deviation) 24.07 ± 4.8° for the right nasal cavity and 25.07 ± 5.0° for the left nasal cavity, wider than the angle reported in the normal Caucasian nose established in the literature. According to our results, the Mexican-Hispanic mestizo nose has a wider angle in the internal nasal valve than that considered normal in the literature (10°-15°). We believe it is necessary to undertake a second study and add an airflow resistance measurement with a rhinomanometry procedure so we can compare the results with those in the Caucasian population. © 2018 ARS-AAOA, LLC.

Forensic parameters and admixture in Mestizos from five geographic regions of Mexico based on 20 autosomal STRs (Powerplex 21 system).

PubMed

Aguilar-Velázquez, J A; Martínez-Cortés, G; Inclán-Sánchez, A; Favela-Mendoza, A F; Velarde-Félix, J S; Rangel-Villalobos, H

2018-03-01

We analyzed Mestizo (admixed) population samples from different geographic regions of Mexico (n = 1283) with 20 autosomal STRs (PowerPlex® 21, Promega Corp.). Allele frequencies and forensic parameters from the Northwest, Northeast, West, Center, and Southeast regions are reported, as well as from the pooled Mexican population sample. The combined PD and PE for this 20 STR system were > 0.9999999999 and > 0.99999996593% in all five population samples, respectively. Analysis of molecular variance (AMOVA) of these Mexican population samples, plus Monterrey (Northeast) and Mexico (Center) Cities, showed low but significant differences among Mexican-Mestizos from the seven populations (Fst = 0.20%; p = 0.0000). Structure analysis showed the highest proportion of Native American ancestry in Mexico City, Center, and Southeast regions, respectively, which was in agreement with the estimated genetic distances represented in a MDS plot and a NJ tree. The best fit of population clusters (K = 4) obtained with the Structure software indicates that Mexican-Mestizos are mainly composed by European, African, and two Native American ancestries. The European and Native American ancestries displayed a contrary gradient, increasing toward the North-West and South-Southeast, respectively. These 20 autosomal STR loci improved the admixture estimation regarding previous studies with the 13 CODIS-STRs, as supported by the higher similarity with previous estimates based on genome-wide SNP. In brief, this study validates the confident use of the PowerPlex® 21 system for human identification purposes in Mestizo populations throughout the Mexican territory.

H3+: superficies de energía potencial, estados y transiciones rovibracionales

NASA Astrophysics Data System (ADS)

Aguado, M. Paniagua Y. A.

Hemos calculado varias superficies globales de energía potencial para el estado fundamental y excitados del sistema H3+ en más de ocho mil geometrías diferentes usando una base (9s 3p 1d)/[4s 3p 1d] en cada átomo de Hidrógeno y mediante un método de cálculo de interacción de configuraciones completa (FCI). Hemos ajustado las superficies a formas analíticas del tipo Aguado y Paniagua con un error promedio menor de 50 cm-1 y menor en el pozo de potencial del estado fundamental. Finalmente hemos calculado y analizado los niveles vibracionales para los dos estados electrónicos más bajos, siendo la desviación respecto de los mejores valores publicados, tanto experimentales como teóricos, de unos pocos números de onda.

Cultural significance of wild mammals in Mayan and mestizo communities of the Lacandon Rainforest, Chiapas, Mexico.

PubMed

García Del Valle, Yasminda; Naranjo, Eduardo J; Caballero, Javier; Martorell, Carlos; Ruan-Soto, Felipe; Enríquez, Paula L

2015-05-07

Several ethnobiology studies evaluate the cultural significance (CS) of plants and mushrooms. However, this is not the case for mammals. It is important to make studies of CS allowing the comparison of cultural groups because the value given to groups of organisms may be based on different criteria. Such information would be valuable for wildlife preservation plans. In this study, the most culturally significant species of mammals from the Lacandon Rainforest (Chiapas, Mexico) for people from two Mayan-Lacandon and mestizo communities were identified. The reasons behind the CS of the studied species were explored and the existence of differences among the cultural groups was evaluated. One hundred ninety-eight semi-structured and structured interviews were applied to compile socio-demographic information, qualitative data on CS categories, and free listings. Frequency of mention was a relative indicator to evaluate the CS of each species of mammal. Comparison of responses between communities was carried out through multivariate analyses. The non-parametric Mann-Whitney U test was used to compare the number of mentioned species by Lacandons and mestizos as well as different responses in the qualitative categories. A χ2 test was used to compare frequency of categories. 38 wild mammal species were identified. The classification and Principal Components Analyses show an apparent separation between Lacandon and mestizo sites based on the relative importance of species. All four communities mentioned the lowland paca the most, followed by peccary, white-tailed deer, armadillo, and jaguar. No significant difference was found in the number of mentioned species between the two groups. Eight CS categories were identified. The most important category was "harmful mammals", which included 28 species. Other relevant categories were edible, medicinal, and appearing in narratives. The data obtained in this study demonstrates the existence of differential cultural patterns in the

Analysis of Polymorphisms in Interleukin-10, Interleukin-6, and Interleukin-1 Receptor Antagonist in Mexican-Mestizo Women with Pre-eclampsia

PubMed Central

Valencia Villalvazo, Elith Yazmin; Canto-Cetina, Thelma; Romero Arauz, Juan Fernando; Coral-Vázquez, Ramón Mauricio; Canizales-Quinteros, Samuel; Coronel, Agustín; Carlos Falcón, Juan; Hernández Rivera, Jaime; Ibarra, Roberto; Polanco Reyes, Lucila

2012-01-01

Due to the fact that studies seeking associations of polymorphisms in regulatory regions of cytokine genes with pre-eclampsia (PE) have not always been consistent in different population analyses, the aim of this study was to investigate the possible association between rs1800896 of interleukin-10 (IL-10), rs1800795 of interleukin-6 (IL-6), and the variable number of tandem repeats (VNTR) in intron 2 of interleukin-1 receptor antagonist (IL-1Ra), as well as gene–gene interactions between these three polymorphisms with the presence of PE in Mexican-Mestizo women and one Amerindian population from México (Maya). A case–control study was performed where 411 pre-eclamptic cases and 613 controls were genotyped. For the rs1800896 of IL-10 and rs1800795 of IL-6, we used real-time polymerase chain reaction (PCR) allelic discrimination and for the VNTR of IL-1Ra, PCR. Allele frequency differences were assessed by Chi-squared test; logistic regression was used to test for associations; a gene–gene interaction was conducted. Genotypic and allelic distribution of the polymorphisms was similar in our population. The estimated of the gene–gene interaction between the polymorphisms did not differ significantly. However, we observed important differences in the distribution of the alleles and genotypes of the three polymorphisms analyzed between Mestiza-Mexicanas and Maya-Mestizo women. In conclusion, we did not find an association between polymorphisms in IL-10, IL-6, and IL-1Ra and PE in Mexican-Mestizo and Maya-Mestizo women. To our knowledge, this is the first time that these three polymorphisms were analyzed together with gene–gene interaction in women with PE. PMID:23013217

Genetic Obesity Risk and Attenuation Effect of Physical Fitness in Mexican-Mestizo Population: a Case-Control Study.

PubMed

Costa-Urrutia, Paula; Abud, Carolina; Franco-Trecu, Valentina; Colistro, Valentina; Rodríguez-Arellano, Martha Eunice; Vázquez-Pérez, Joel; Granados, Julio; Seelaender, Marilia

2017-05-01

We analyzed commonly reported European and Asian obesity-related gene variants in a Mexican-Mestizo population through each single nucleotide polymorphism (SNP) and a genetic risk score (GRS) based on 23 selected SNPs. Study subjects were physically active Mexican-Mestizo adults (n  =  608) with body mass index (BMI) values from 18 to 55 kg/m 2 . For each SNP and for the GRS, logistic models were performed to test for simple SNP associations with BMI, fat mass percentage (FMP), waist circumference (WC), and the interaction with VO 2max and muscular endurance (ME). To further understand the SNP or GRS*physical fitness components, generalized linear models were performed. Obesity risk was significantly associated to 6 SNPs (ADRB2 rs1042713, APOB rs512535, PPARA rs1800206, TNFA rs361525, TRHR rs7832552 and rs16892496) after adjustment by gender, age, ancestry, VO 2max , and ME. ME attenuated the influence of APOB rs512535 and TNFA rs361525 on obesity risk in FMP. WC was significantly associated to GRS. Both ME and VO 2max attenuated GRS effect on WC. We report associations for 6 out of 23 SNPs and for the GRS, which confer obesity risk, a novel finding for Mexican-Mestizo physically active population. Also, the importance of including physical fitness components variables in obesity genetic risk studies is highlighted, with special regard to intervention purposes. © 2017 John Wiley & Sons Ltd/University College London.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases.

PubMed

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-10-01

Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi resistant bacteria or yeast. The study aimed

VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.

PubMed

Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2015-01-01

Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases

PubMed Central

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-01-01

Context: Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). Material and Method: The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Results: Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. Conclusion: This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. SUMMARY This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36

Actividad funcional cerebral en estado de reposo: REDES EN CONEXIÓN

PubMed Central

Proal, Erika; Alvarez-Segura, Mar; de la Iglesia-Vayá, Maria; Martí-Bonmatí, Luis; Castellanos, F. Xavier

2015-01-01

Resumen El análisis de la conectividad funcional mediante resonancia magnética funcional (RMf) puede llevarse a cabo durante la realización de una tarea, la percepción de un estímulo o en estado de reposo. Estos análisis han demostrado su fiabilidad y reproducibilidad con diferentes enfoques (matemáticos, estadísticos, físicos) para seleccionar los vóxeles activados. El estudio de la señal de baja frecuencia en la actividad cerebral a través del contraste BOLD en estado de reposo ha revelado patrones de actividad cortical sincronizados, permitiendo describir la arquitectura funcional intrínseca del cerebro humano. La comunidad científica internacional dispone de recursos compartidos que contribuirán mediante este análisis de RMf en estado de reposo a la obtención de diagnósticos y tratamientos más precisos y avanzados en el campo de las neurociencias. PMID:21365601

Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

PubMed

Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

2012-01-01

Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

PubMed

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

DD genotype of angiotensin-converting enzyme in type 2 diabetes mellitus with renal disease in Mexican Mestizos.

PubMed

Palomo-Piñón, Silvia; Gutiérrez-Rodríguez, Margarita E; Díaz-Flores, Margarita; Sánchez-Barrera, Reyna; Valladares-Salgado, Adán; Utrera-Barillas, Dolores; Durán-Reyes, Genoveva; Galván-Duarte, Rosa E; Trinidad-Ramos, Pedro; Cruz, Miguel

2009-04-01

The DD genotype of angiotensin-converting enzyme (ACE) has been suggested as a major contributor of diabetic nephropathy in several populations. The purpose of the present study was to determine whether micro/macroalbuminuria is associated with ACE insertion/deletion (I/D) polymorphism in Mexican Mestizos with type 2 diabetes mellitus. A total of 435 patients with type 2 diabetes mellitus, of whom 233 had albuminuria, were characterized for the ACE I/D polymorphism by the polymerase chain reaction method. Clinical and biochemical characteristics and frequencies according to DD, ID and II genotypes in patients with and without albuminuria showed no significant differences. However, only females with micro/macroalbuminuria showed higher frequency of a DD genotype than those without albuminuria (27.9%, 21.2% and 10.5%, respectively; P Mestizo females with type 2 diabetes, indicating a possible DD genotype-associated sex effect in renal disease.

Higher prepregnancy body mass index is a risk factor for developing preeclampsia in Maya-Mestizo women: a cohort study.

PubMed

Canto-Cetina, Thelma; Coral-Vázquez, Ramón Mauricio; Rojano-Mejía, David; Pérez Godoy, Sergio; Coronel, Agustín; Canto, Patricia

2018-08-01

Preeclampsia and obesity are two closely related syndromes. The high maternal prepregnancy body mass index (BMI) is a risk factor for present preeclampsia, independently of the ethnic background of the studied population. The aim of this study was to analyse in a prospective cohort study the relation between prepregnancy BMI and development of preeclampsia in Maya-Mestizo women. This is a prospective cohort study of 642 pregnant women that were included in the first trimester of the pregnancy (gestational age ≤12 weeks at the first antenatal visit) and all of them were of Maya-Mestizo ethnic origin from the state of Yucatán, México. We assessed the potential risk factors for preeclampsia and documented the prepregnancy BMI (kg/m 2 ) that was based on measured height and maternal self-report of prepregnancy weight at the initial visit. Besides, in the antenatal visit we documented if the pregnant women developed preeclampsia. Of the 642 pregnant Maya-Mestizo women, 49 developed preeclampsia, with an incidence of 7.6% (44.9% had severe and 55% mild). The prepregnancy BMI was higher in women with developed preeclampsia than in those with normal pregnancies. Women with overweight or obesity in comparison with normal weight presented a RR = 2.82 (95% CI: 1.32-6.03; P = 0.008) and RR= 4.22 (95% CI: 2.07-8.61; P = 0.001), respectively. Our findings expand the previous studies to show that the higher prepregnancy BMI is a strong, independent risk factor for preeclampsia.

Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

PubMed Central

Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

2016-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

Polymorphisms of APLN-APLNR system are associated with essential hypertension in Mexican-Mestizo individuals.

PubMed

Esteban-Martínez, Rosa Lilia; Pérez-Razo, Juan Carlos; Vargas-Alarcón, Gilberto; Martínez-Rodríguez, Nancy; Cano-Martínez, Luis Javier; López-Hernández, Luz Berenice; Rojano-Mejía, David; Canto, Patricia; Coral-Vazquez, Ramón Mauricio

2016-08-01

The aim of this study was to evaluate if polymorphisms of APLN and APLNR genes may play a role as susceptibility markers for hypertension in a group of Mexican-Mestizo patients. A case-control study was carried out including normotensive and hypertensive individuals. For these, two polymorphisms of APLN (rs3761581 and rs56204867) and two of APLNR () genes were genotyped by 5' exonuclease TaqMan assay in 400 normotensive individuals and 383 patients. The results showed that, under an additive model adjusted by BMI, HDL, triglycerides, glucose and family history of essential hypertension, the rs7119375 and rs10501367 polymorphisms of APLNR gene were associated significantly with a decreased risk of essential hypertension (P=0.039 and P=0.029, respectively). Besides, the haplotypes analysis of these polymorphisms showed that H1 haplotype was associated with an increased risk of essential hypertension (P=0.026), while the H2 haplotype was associated with a decreased risk (P=0.032). Contrary, the rs3761581 and rs56204867 polymorphisms of APLN gene were not associated with essential hypertension (P=0.1707 and P=0.0769, respectively). The data suggest that APLNR rs7119375 and rs10501367 are associated with a decreased risk of essential hypertension in our Mexican-Mestizo studied group, but further studies are warranted. Copyright © 2016 Elsevier Inc. All rights reserved.

Admixture and genetic relationships of Mexican Mestizos regarding Latin American and Caribbean populations based on 13 CODIS-STRs.

PubMed

Salazar-Flores, J; Zuñiga-Chiquette, F; Rubi-Castellanos, R; Álvarez-Miranda, J L; Zetina-Hérnandez, A; Martínez-Sevilla, V M; González-Andrade, F; Corach, D; Vullo, C; Álvarez, J C; Lorente, J A; Sánchez-Diz, P; Herrera, R J; Cerda-Flores, R M; Muñoz-Valle, J F; Rangel-Villalobos, H

2015-02-01

Short tandem repeats (STRs) of the combined DNA index system (CODIS) are probably the most employed markers for human identification purposes. STR databases generated to interpret DNA profiles are also helpful for anthropological purposes. In this work, we report admixture, population structure, and genetic relationships of Mexican Mestizos with respect to Latin American and Caribbean populations based on 13 CODIS-STRs. In addition, new STR population data were included from Tijuana, Baja California (Northwest, Mexico), which represents an interesting case of elevated genetic flow as a bordering city with the USA. Inter-population analyses included CODIS-STR data from 11 Mexican Mestizo, 12 Latin American and four Caribbean populations, in addition to European, Amerindian, and African genetic pools as ancestral references. We report allele frequencies and statistical parameters of forensic interest (PD, PE, Het, PIC, typical PI), for 15 STRs in Tijuana, Baja California. This Mexican border city was peculiar by the increase of African ancestry, and by presenting three STRs in Hardy-Weinberg disequilibrium, probably explained by recurrent gene flow. The Amerindian ancestry in Central and Southeast of Mexico was the greatest in Latin America (50.9-68.6%), only comparable with the North of Central America and Ecuador (48.8-56.4%), whereas the European ancestry was prevalent in South America (66.7-75%). The African ancestry in Mexico was the smallest (2.2-6.3%) in Latin America (≥ 2.6%), particularly regarding Brazil (21%), Honduras (62%), and the Caribbean (43.2-65.2%). CODIS-STRs allowed detecting significant population structure in Latin America based on greater presence of European, Amerindian, and African ancestries in Central/South America, Mexican Mestizos, and the Caribbean, respectively. Copyright © 2014 Elsevier GmbH. All rights reserved.

Forensic efficiency parameters of the Investigator Argus X-12 kit in women from two Mestizo and seven Amerindian populations from Mexico.

PubMed

Cortés-Trujillo, I; Ramos-González, B; Salas-Salas, O; Zuñiga-Chiquette, F; Zetina Hernández, A; Martínez-Cortés, G; Ruiz-Hernández, M; González-Martín, A; Ferragut, J F; Rangel-Villalobos, H

2017-05-01

Allele frequency distribution and statistical parameters of forensic efficiency concerning the Investigator Argus X-12 kit (Qiagen, Hilden, Germany) were determined in a total sample of 641 unrelated Mexican females, including two Mestizo-admixed- populations (n=309) and seven Amerindian groups (n=332) from the main regions of the country. Most of the 12 X-STRs were in agreement with Hardy-Weinberg expectations in all nine Mexican populations. The power of discrimination in females (PD) and Median exclusion chance for trios (MEC T ) and duos (MEC D ) of this genetic system based on X-STRs were >99.99%. Although Mexican populations showed significant pairwise differentiation, a closer relationship was evident between Amerindian groups and nearby Mestizos, in agreement with historical records, previous genetic studies, and X-linked inheritance pattern expectations. Copyright © 2017 Elsevier B.V. All rights reserved.

Vigilando la Calidad del Agua de los Grandes Rios de la Nacion: El Programa NASQAN del Rio Grande (Rio Bravo del Norte)

USGS Publications Warehouse

Lurry, Dee L.; Reutter, David C.; Wells, Frank C.; Rivera, M.C.; Munoz, A.

1998-01-01

La Oficina del Estudio Geologico de los Estados Unidos (U.S. Geological Survey, 0 USGS) ha monitoreado la calidad del agua de la cuenca del Rio Grande (Rio Bravo del Norte) desde 1995 como parte de la rediseiiada Red Nacional para Contabilizar la Calidad del Agua de los Rios (National Stream Quality Accounting Network, o NASOAN) (Hooper and others, 1997). EI programa NASOAN fue diseiiado para caracterizar las concentraciones y el transporte de sedimento y constituyentes quimicos seleccionados, encontrados en los grandes rios de los Estados Unidos - incluyendo el Misisipi, el Colorado y el Columbia, ademas del Rio Grande. En estas cuatro cuencas, el USGS opera actualmente (1998) una red de 40 puntos de muestreo pertenecientes a NASOAN, con un enfasis en cuantificar el flujo en masa (la cantidad de material que pasa por la estacion, expresado en toneladas por dial para cada constituyente. Aplicacando un enfoque consistente, basado en la cuantificacion de flujos en la cuenca del Rio Grande, el programa NASOAN esta generando la informacion necesaria para identificar fuentes regionales de diversos contaminantes, incluyendo sustancias qui micas agricolas y trazas elementos en la cuenca. EI efecto de las grandes reservas en el Rio Grande se puede observar segun los flujos de constituyentes discurren a 10 largo del rio. EI analisis de los flujos de constituyentes a escala de la cuenca proveera los medios para evaluar la influencia de la actividad humana sobre las condiciones de calidad del agua del Rio Grande.

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico

PubMed Central

2014-01-01

Background Worldwide, mestizo communities’s ethnobotanical knowledge has been poorly studied. Based on a mestizo group in Mexico, this study assesses a) the use value (UV) of the local flora, b) gendered differences in plant species, and c) the association between socio-economic variables and ethnobotanical knowledge. Methods To assess the degree of knowledge of plant resources, we conducted 41 interviews collecting information on knowledge of local plant resources and the socio-economic situation of the informant. We also collected free listings of useful plants by category of use to identify the UV of each species. With the support of key informants, we photographed and collected the plant material recorded during the interviews and free listings on five different habitats. Paired t-tests and a Wilcoxon signed rank test were used to determine differences in the number of species known by men and women. Differences in distribution were analyzed by means of the Shapiro–Wilk’s W normality tests. To determine the association of socio-economic factors and ethnobotanical knowledge, we used a non-metric multidimensional scaling analysis (NMDS). Results Informants listed 185 species. Medicinal plants constituted the most diverse group (90 species). Tropical deciduous forest is the habitat that concentrates the highest proportion of plant resources (80 species). The use-values were classified into three groups: A (4–6 UV; three species), B (0.35-1.37 UV; 39 species) and C (0–0.29 UV; 143 species). High-quality wood species and those associated to religious ceremonies had the highest UV. Women’s and men’s knowledge of plant species showed statistically significant differences at the interspecific and the intracategorical levels (Student’s test, T15 = 4.8, p < 0.001). Occupation, gender and age were statistically significant associated to ethnobotanical knowledge (p < 0.05), whereas income, education level, and place of origin were not. Conclusion This

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico.

PubMed

Beltrán-Rodríguez, Leonardo; Ortiz-Sánchez, Amanda; Mariano, Nestor A; Maldonado-Almanza, Belinda; Reyes-García, Victoria

2014-01-27

Worldwide, mestizo communities' ethnobotanical knowledge has been poorly studied. Based on a mestizo group in Mexico, this study assesses a) the use value (UV) of the local flora, b) gendered differences in plant species, and c) the association between socio-economic variables and ethnobotanical knowledge. To assess the degree of knowledge of plant resources, we conducted 41 interviews collecting information on knowledge of local plant resources and the socio-economic situation of the informant. We also collected free listings of useful plants by category of use to identify the UV of each species. With the support of key informants, we photographed and collected the plant material recorded during the interviews and free listings on five different habitats. Paired t-tests and a Wilcoxon signed rank test were used to determine differences in the number of species known by men and women. Differences in distribution were analyzed by means of the Shapiro-Wilk's W normality tests. To determine the association of socio-economic factors and ethnobotanical knowledge, we used a non-metric multidimensional scaling analysis (NMDS). Informants listed 185 species. Medicinal plants constituted the most diverse group (90 species). Tropical deciduous forest is the habitat that concentrates the highest proportion of plant resources (80 species). The use-values were classified into three groups: A (4-6 UV; three species), B (0.35-1.37 UV; 39 species) and C (0-0.29 UV; 143 species). High-quality wood species and those associated to religious ceremonies had the highest UV. Women's and men's knowledge of plant species showed statistically significant differences at the interspecific and the intracategorical levels (Student's test, T15 = 4.8, p < 0.001). Occupation, gender and age were statistically significant associated to ethnobotanical knowledge (p < 0.05), whereas income, education level, and place of origin were not. This research improves our understanding of the socio

Bone mineral density in postmenopausal Mexican-Mestizo women with normal body mass index, overweight, or obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Pedraza, Javier; Coral-Vázquez, Ramón Mauricio; Soriano, Ruth; García-García, Eduardo; Aguirre-García, María Del Carmen; Coronel, Agustín; Canto, Patricia

2013-05-01

Obesity and osteoporosis are two important public health problems that greatly impact mortality and morbidity. Several similarities between these complex diseases have been identified. The aim of this study was to analyze if different body mass indexes (BMIs) are associated with variations in bone mineral density (BMD) among postmenopausal Mexican-Mestizo women with normal weight, overweight, or different degrees of obesity. We studied 813 postmenopausal Mexican-Mestizo women. A structured questionnaire for risk factors was applied. Height and weight were used to calculate BMI, whereas BMD in the lumbar spine (LS) and total hip (TH) was measured by dual-energy x-ray absorptiometry. We used ANCOVA to examine the relationship between BMI and BMDs of the LS, TH, and femoral neck (FN), adjusting for confounding factors. Based on World Health Organization criteria, 15.13% of women had normal BMI, 39.11% were overweight, 25.96% had grade 1 obesity, 11.81% had grade 2 obesity, and 7.99% had grade 3 obesity. The higher the BMI, the higher was the BMD at the LS, TH, and FN. The greatest differences in size variations in BMD at these three sites were observed when comparing women with normal BMI versus women with grade 3 obesity. A higher BMI is associated significantly and positively with a higher BMD at the LS, TH, and FN.

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

PubMed

Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha

2010-01-01

Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.

Association between the APOE ε4 Allele and Late-Onset Alzheimer's Disease in an Ecuadorian Mestizo Population

PubMed Central

Calero, Cristian; Vinueza, Rodrigo; Correa, Patricio; Carrera-Gonzalez, Andrea; Villegas, Franklin; Moreta, Germania; Paredes, Rosario

2017-01-01

Alzheimer's disease (AD) is the most common neurodegenerative disease. It has two main pathological hallmarks: amyloid plaques and neurofibrillary tangles. The APOE ε4 allele has been recognized as the strongest genetic risk factor for late-onset Alzheimer's disease (LOAD) in several populations worldwide, yet the risk varies by region and ethnicity. The aims of this study were to describe APOE allele and genotype frequencies and examine the relationship between the APOE ε4 allele and LOAD risk in an Ecuadorian Mestizo population. We carried out a case-control study comprising 56 individuals clinically diagnosed with probable AD (≥65 years of age) and 58 unrelated healthy control subjects (≥65 years of age). Genotyping was performed using the real-time PCR method. Our data showed that allelic and genotypic frequencies follow the trends observed in most worldwide populations. We also found a high-risk association between APOE ε4 allele carriers and LOAD (OR = 7.286; 95% CI = 2.824–18.799; p < 0.001). Therefore, we concluded that APOE ε4 must be considered an important genetic risk factor for LOAD in the Ecuadorian Mestizo population. Additionally, we suggest that in mixed populations the effects of admixture and ethnic identity should be differentiated when evaluating genetic contributions to Alzheimer's disease risk. PMID:29348964

Distribution of CYP2D6 and CYP2C19 Polymorphisms Associated with Poor Metabolizer Phenotype in Five Amerindian Groups and Western Mestizos from Mexico

PubMed Central

Salazar-Flores, Joel; Torres-Reyes, Luis A.; Martínez-Cortés, Gabriela; Rubi-Castellanos, Rodrigo; Sosa-Macías, Martha; Muñoz-Valle, José F.; González-González, César; Ramírez, Angélica; Román, Raquel; Méndez, José L.; Barrera, Andrés; Torres, Alfredo; Medina, Rafael

2012-01-01

Background: The distribution of polymorphisms in the CYP2D6 and CYP2C19 genes allows inferring the potential risk for specific adverse drug reactions and lack of therapeutic effects in humans. This variability shows differences among human populations. The aim of this study was to analyze single-nucleotide polymorphisms related to a poor metabolizer (PM) phenotype in nonpreviously studied Amerindian groups and Mestizos (general admixed population) from Mexico. Methods: We detected by SNaPshot® different polymorphisms located in CYP2D6 (*3, *4, *6, *7, and *8) and CYP2C19 (*2, *3, *4 and *5) in western Mestizos (n=145) and five Amerindian groups from Mexico: Tarahumaras from the North (n=88); Purépechas from the Center (n=101); and Tojolabales (n=68), Tzotziles (n=88), and Tzeltales (n=20) from the Southeast. Genotypes were observed by capillary electrophoresis. The genetic relationships among these populations were estimated based on these genes. Results and Discussion: The wild-type allele (*1) of both genes was predominant in the Mexican populations studied. The most widely observed alleles were CYP2C19*2 (range, 0%–31%) and CYP2D6*4 (range, 1.2%–7.3%), whereas CYP2D6*3 was exclusively detected in Mestizos. Conversely, CYP2C19*4 and *5, as well as CYP2D6*3, *6, *7, and *8, were not observed in the majority of the Mexican populations. The Tarahumaras presented a high frequency of the allele CYP2C19*2 (31%) and of homozygotes *2/*2 (10.7%), which represent a high frequency of potentially PM phenotypes in this Amerindian group. The genetic distances showed high differentiation of Tarahumaras (principally for CYP2C19 gene). In general, a relative proximity was observed between most of the Amerindian, Mexican-Mestizo, and Latin-American populations. Conclusion: In general, the wild-type allele (*1) predominates in Mexican populations, outlining a relatively homogeneous distribution for CYP2C19 and CYP2D6. The exception is the Tarahumara group that displays a

PPARGC1A and ADIPOQ polymorphisms are associated with aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity.

PubMed

Canto, Patricia; Granados, Jesús Benítez; Feria-Bernal, Guillermo; Coral-Vázquez, Ramón Mauricio; García-García, Eduardo; Tejeda, María Elena; Tapia, André; Rojano-Mejía, David; Méndez, Juan Pablo

2017-07-04

Obesity constitutes a risk factor for the development of aggressive forms of prostate cancer. It has been proposed, that prostate cancer has a genetic predisposition and that PPARGC1A and ADIPOQ polymorphisms play a role in the development of this condition. To analyse the association of two PPARGC1A and ADIPOQ polymorphisms as well as their haplotypes, with the development of aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity. Two hundred fifty seven men with prostate cancer of Mexican-Mestizo origin were included. Body mass index (BMI) was determined and the degree of prostate cancer aggressiveness by the D'Amico classification. DNA was obtained. Rs7665116 and rs2970870 of PPARGC1A, and rs266729 and rs1501299 of ADIPOQ were studied by real-time PCR allelic discrimination. Pairwise linkage disequilibrium, between single nucleotide polymorphisms was calculated and haplotype analysis was performed. A higher-risk (D'Amico classification) was observed in 21.8% of patients. An association of cancer aggressiveness with rs2970870 of PPARGC1A, and rs501299 of ADIPOQ, as well as with one haplotype of ADIPOQ was documented. This is the first study regarding the relationship of PPARGC1A and ADIPOQ polymorphisms, and the aggressiveness of prostate cancer in men with overweight or obesity.

Tierra del Fuego, Argentina, South America

NASA Technical Reports Server (NTRS)

1991-01-01

The Mitre Peninsula is the easternmost tip of Tierra del Fuego, Argentina, (54.5S, 65.5W). Early winter snow can be seen on this south tip of the Andes Mountains. These same mountains continue underwater to Antarctica. The Strait of Magellan, separating the South American mainland from Tierra del Fuego is off the scene to the north and west, but the Strait of LeMaire, separating Tierra del Fuego from the Isla de los Estados can be seen.

Contribution of Common Genetic Variation to the Risk of Type 2 Diabetes in the Mexican Mestizo Population

PubMed Central

Gamboa-Meléndez, Marco Alberto; Huerta-Chagoya, Alicia; Moreno-Macías, Hortensia; Vázquez-Cárdenas, Paola; Ordóñez-Sánchez, María Luisa; Rodríguez-Guillén, Rosario; Riba, Laura; Rodríguez-Torres, Maribel; Guerra-García, María Teresa; Guillén-Pineda, Luz Elizabeth; Choudhry, Shweta; del Bosque-Plata, Laura; Canizales-Quinteros, Samuel; Pérez-Ortiz, Gustavo; Escobedo-Aguirre, Fernando; Parra, Adalberto; Lerman-Garber, Israel; Aguilar-Salinas, Carlos Alberto; Tusié-Luna, María Teresa

2012-01-01

Several studies have identified nearly 40 different type 2 diabetes susceptibility loci, mainly in European populations, but few of them have been evaluated in the Mexican population. The aim of this study was to examine the extent to which 24 common genetic variants previously associated with type 2 diabetes are associated in Mexican Mestizos. Twenty-four single nucleotide polymorphisms (SNPs) in or near genes (KCNJ11, PPARG, TCF7L2, SLC30A8, HHEX, CDKN2A/2B, CDKAL1, IGF2BP2, ARHGEF11, JAZF1, CDC123/CAMK1D, FTO, TSPAN8/LGR5, KCNQ1, THADA, ADAMTS9, NOTCH2, NXPH1, RORA, UBQLNL, and RALGPS2) were genotyped in Mexican Mestizos. A case-control association study comprising 1,027 type 2 diabetic individuals and 990 control individuals was conducted. To account for population stratification, a panel of 104 ancestry-informative markers was analyzed. Association to type 2 diabetes was found for rs13266634 (SLC30A8), rs7923837 (HHEX), rs10811661 (CDKN2A/2B), rs4402960 (IGF2BP2), rs12779790 (CDC123/CAMK1D), and rs2237892 (KCNQ1). In addition, rs7754840 (CDKAL1) was associated in the nonobese type 2 diabetic subgroup, and for rs7903146 (TCF7L2), association was observed for early-onset type 2 diabetes. Lack of association for the rest of the variants may have resulted from insufficient power to detect smaller allele effects. PMID:22923468

El Atlas del Bosque Nacional El Yunque

Treesearch

Maya Quiñones; Isabel K. Parés-Ramos; William A. Gould; Grizelle Gonzalez; Kathleen McGinley; Pedro. Ríos

2018-01-01

Esta publicación es un esfuerzo colaborativo entre el Instituto Internacional de Dasonomía Tropical y el Bosque Nacional El Yunque para proveer mapas y análisis de información espacial actualizados sobre una importante reserva natural en Puerto Rico y el único bosque tropical dentro del Sistema de Bosques Nacionales de los Estados Unidos. El Atlas del Bosque Nacional...

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Estrategia innovadora enfocada en parejas del mismo sexo para disminuir la infección del VIH en hombres Latinos

PubMed Central

Martinez, Omar; Wu, Elwin; Sandfort, Theo; Shultz, Andrew Z.; Capote, Jonathan; Chávez, Silvia; Moya, Eva; Dodge, Brian; Morales, Gabriel; Porras, Antonio; Ovejero, Hugo

2014-01-01

Resumen El VIH es un problema de salud importante dentro de la comunidad latina de los Estados Unidos. Gracias a los esfuerzos de prevención, los niveles de contagio entre los latinos se han mantenido estables por más de una década. Sin embargo, esta población sigue siendo afectada a niveles muy altos, en particular entre hombres que tienen sexo con hombres (HSH), de origen latino y que hablan principalmente el idioma español. Existen varios factores que contribuyen a la transmisión del VIH entre esta población, como son: el uso de drogas; la violencia dentro de la pareja; la presencia de infecciones de transmisión sexual; relaciones sexuales sin protección, dentro y fuera de la pareja; el evadir la búsqueda de recursos (prueba y tratamiento adecuado) por temor a ser discriminado o por su estatus migratorio; la escasez de recursos económicos o estado de pobreza y los patrones relacionados a la migración. En particular, Investigaciones Epidemiológicas de Comportamientos han determinado: cómo algunas dinámicas en parejas están directamente asociadas a los comportamientos sexuales de riesgos. En consecuencia, es necesaria mayor investigación para identificar esas dinámicas, y a su vez, realizar intervenciones dirigidas a la reducción de conductas de riesgo enfocadas en parejas de hombres del mismo sexo. En este escrito, se describe la importancia del uso de las relaciones de pareja como estrategia en la reducción de la trasmisión del VIH/SIDA en HSH de origen latino y que hablan principalmente el idioma español en los Estados Unidos. PMID:25580466

Genetic structure of Mexican Mestizo women with breast cancer based on three STR loci.

PubMed

Calderón-Garcidueñas, Ana L; Rivera-Prieto, Roxana A; Ortíz-Lopez, Rocio; Rivas, Fernando; Barrera-Saldaña, Hugo A; Peñaloza-Espinosa, Rosenda I; Cerda-Flores, Ricardo M

2008-01-01

The aim of this population genetics study was to compare the genetic structure of Mexican women with breast cancer (BrCa) with previously reported data of four random populations (Nuevo León, Hispanics, Chihuahua, and Central Region of Mexico). A sample of 115 unrelated women with BrCa and whose four grandparents were born in five zones of Mexico were interviewed at a reference hospital in Northeastern Mexico. Noncodifying STRs D7S820, D13S317, and D16S39 were analyzed; genotype distribution was in agreement with Hardy-Weinberg expectations for all three markers. Similar allele frequencies among four random populations and this selected population were found. According with this and previous studies using molecular and nonmolecular nuclear DNA markers not associated with any disease, Mexican Mestizo population is genetically homogeneous and therefore, genetic causes of BrCa are less heterogeneous, simplifying genetic epidemiologic studies.

A Pilot Genome-Wide Association Study in Postmenopausal Mexican-Mestizo Women Implicates the RMND1/CCDC170 Locus Is Associated with Bone Mineral Density

PubMed Central

Villalobos-Comparán, Marisela; Estrada, Karol; Parra-Torres, Alma Y.; González-Mercado, Anahí; Patiño, Nelly; Castillejos-López, Manuel; Quiterio, Manuel; Fernandez-López, Juan Carlos; Ibarra, Bertha; Romero-Hidalgo, Sandra; Salmerón, Jorge

2017-01-01

To identify genetic variants influencing bone mineral density (BMD) in the Mexican-Mestizo population, we performed a GWAS for femoral neck (FN) and lumbar spine (LS) in Mexican-Mestizo postmenopausal women. In the discovery sample, 300,000 SNPs were genotyped in a cohort of 411 postmenopausal women and seven SNPs were analyzed in the replication cohort (n = 420). The combined results of a meta-analysis from the discovery and replication samples identified two loci, RMND1 (rs6904364, P = 2.77 × 10−4) and CCDC170 (rs17081341, P = 1.62 × 10−5), associated with FN BMD. We also compared our results with those of the Genetic Factors for Osteoporosis (GEFOS) Consortium meta-analysis. The comparison revealed two loci previously reported in the GEFOS meta-analysis: SOX6 (rs7128738) and PKDCC (rs11887431) associated with FN and LS BMD, respectively, in our study population. Interestingly, rs17081341 rare in Caucasians (minor allele frequency < 0.03) was found in high frequency in our population, which suggests that this association could be specific to non-Caucasian populations. In conclusion, the first pilot Mexican GWA study of BMD confirmed previously identified loci and also demonstrated the importance of studying variability in diverse populations and/or specific populations. PMID:28840121

Ultrasound, histopathological, and genetic features of uveal melanoma in a Mexican-Mestizo population.

PubMed

Delgado, S; Rodriguez Reyes, A; Mora Rios, L; Dueñas-González, A; Taja-Chayeb, L; Moragrega Adame, E

2018-01-01

To describe the ultrasound, histopathological and genetic characteristics of uveal melanoma in a Mexican-Mestizo population. A total of 39 enucleated eyes with a histopathological diagnosis of uveal melanoma were assessed by describing the clinical findings, and ultrasound, histopathological and genetic features. A high correlation was observed between tumour height measurement using ultrasound and histopathology. In our cases, tumour size and reflectivity were higher compared with those reported in the literature. The preliminary data on the molecular assessment of the tumours show the presence of an unreported polymorphism (T>C IVS5+34) and one sample with GNAQ mutation (A>C CAA>CCA Gln 209 Pro). Ultrasound is a reliable method to identify the size of the tumour. Furthermore, knowledge of the molecular mechanisms promises new perspectives for the development of new targeted therapeutics. Fortunately this leads to progress in the treatment of patients with metastatic disease or prevents it in those at high risk. Copyright © 2017 Sociedad Española de Oftalmología. Publicado por Elsevier España, S.L.U. All rights reserved.

EBV+ lymphoepithelial carcinoma of the parotid gland in Mexican Mestizo patients with chronic autoimmune diseases.

PubMed

Saqui-Salces, Milena; Martinez-Benitez, Braulio; Gamboa-Dominguez, Armando

2006-01-01

Lymphoepithelial carcinomas of the salivary gland are rare tumors constantly associated with Epstein-Barr virus (EBV) and mainly identified in Asiatic and Greenlander population. Four cases have been described in Caucasians, only two with EBV infection. We describe two cases of parotid gland lymphoepithelial carcinomas in Mexican mestizo women in which chronic latent EBV infection was documented by immunohistochemistry and in situ hybridization. One patient had primary Sjögren's syndrome and the other systemic lupus erythematosus of six and three years of evolution, respectively. Epithelial neoplastic cells showed latency pattern II (LMP1+, EBNA-2-, EBER+) with a dense inflammatory infiltrate composed mainly by CD8+ T lymphocytes. Follow-up excluded nasopharyngeal involvement in both patients. This report expands the ethnic groups in which salivary lymphoepithelial carcinomas associated with chronic latent EBV infection have been described, and illustrates for the first time its association with autoimmune diseases in two women living in a region non-endemic for this unusual neoplasm.

Estudio de la fotoabsorción y fotoionización de la molécula de alta relevancia atmosférica no a través de los estados Rydberg con la metodología MQDO

NASA Astrophysics Data System (ADS)

Bustos, E.; Velasco, A. M.; Martín, I.; Lavín, C.

Los procesos de fotoionización son de una importancia fundamental [1] y encuentran aplicación en un gran número de contextos científicos: Astrofísica [2], química de las radiaciones, biología. Los investigadores de dichos campos, necesitan de valores de fiables de secciones eficaces para la fotoionización parcial, la Fotoabsorción, así como para los procesos de fotofragmentación en amplios intervalos espectrales, particularmente en estudios de modelización [3-5]. En este trabajo se ha centrado la atención sobre el oxido nítrico, que se ha considerado apropiado y relevante por varios motivos: por el trascendental papel que representa en la física y química de la alta atmosfera [6], aparte de por estar íntimamente relacionado con los problemas de contaminación. Los procesos de recombinación disociativa [7] del NO, donde los estados Rydberg se encuentran directamente implicados, son relevantes, por ejemplo, en las regiones E y F de la ionosfera [7]. En este trabajo se estudia la fotoionización del NO desde el estado fundamental con la versión molecular del método del orbital de defecto cuántico (MQDO). Para ello se calcula el diferencial de las fuerzas de oscilador parciales que constituyen los canales de fotoionización del NO desde el estado fundamental. La continuidad del diferencial de fuerza de oscilador calculada a través del umbral de fotoionización, esto es, en las regiones del espectro discreta y del continua, se adopta como criterio de calidad la escasez de datos comparativos [8].

Observaciones del CH interestelar y el continuo en 3,3 GHz

NASA Astrophysics Data System (ADS)

Olano, C. A.; Combi, J. A.; Pöppel, W.; Benaglia, P.; Sanz, A. J.; Bava, J. A.

Se informa sobre el proyecto que se lleva a cabo en el IAR con el propósito de observar las líneas hiperfinas del estado fundamental del CH y el continuo en la banda de 3,3 GHz. El nuevo receptor construído en nuestro laboratorio para tal fin se instaló sobre uno de los radiotelescopios, funcionando conjuntamente con los sistemas de procesamiento actuales del IAR. Los resultados de las primeras observaciones, realizadas tanto en las líneas espectrales como en el continuo sobre fuentes conocidas, fueron satisfactorios.

Paleoenvironmental and paleoclimatic investigations on Isla de los Estados, Argentina

NASA Astrophysics Data System (ADS)

Björck, S.; Fernandez, M.; Hjort, C.; Ljung, K.; Martinez, O.; Möller, P.; Ponce, F.; Rabassa, J.; Roig, F.; Unkel, I.; Wohlfarth, B.

2007-05-01

The expedition in November-December 2005 to Isla de los Estados (Staten Island) off the southeastern tip of South America was a cooperative venture between Lund University (LU) and Stockholm University (SU) in Sweden and the CADIC-CONICET Institute in Ushuaia, Argentina. The aim of the expedition was threefold: (1) to extend the Swedish paleoclimatic "ATLANTIS"-project (Greenland, Iceland, Faroe Islands, Azores, Grenada, Tristan da Cunha; PI S Björck) to the southern part of the South American continent, (2) to connect earlier glacial and climate history reconstructions from the Antarctic Peninsula to equivalents north of the Drake Passage in southernmost South America, and (3) to complement paleo-information available from the Tierra del Fuego mainland with information from Isla de los Estados. Focus was on two areas in the northern and north-western part of the island, Bahía Colnett and Bahia Crossley. Detailed geomorphologic and stratigraphic mapping of glacial deposits were combined with sampling sediments for OSL dating. To reconstruct the paleoclimatic development of Isla de los Estados since the last ice retreat, four main peat bog/lake sites were cored and sampled. In addition, living trees of Nothofagus and old logs preserved in the peat were sampled for dendrochronological and dendroclimatological studies. Preliminary results show that the deglaciation of the study area occurred before 16500 cal yr BP. Detailed multi- proxy analyses of the four sequences are under way and first results will be presented.

Medicinal use of wild fauna by mestizo communities living near San Guillermo Biosphere Reserve (San Juan, Argentina).

PubMed

Hernandez, Jorge; Campos, Claudia M; Borghi, Carlos E

2015-01-21

Wild and domestic animals and their by-products are important ingredients in the preparation of curative, protective and preventive medicines. Despite the medicinal use of animals worldwide, this topic has received less attention than the use of medicinal plants. This study assessed the medicinal use of animals by mestizo communities living near San Guillermo MaB Reserve by addressing the following questions: What animal species and body parts are used? What ailments or diseases are treated with remedies from these species? To what extent do mestizo people use animals as a source of medicine? Is the use related to people's age? We conducted semi-structured interviews with 171 inhabitants (15-93 years old) of four villages close to the Reserve: Tudcúm, Angualasto, Malimán and Colangüil. We calculated the informant consensus factor and fidelity level to test homogeneity of knowledge and to know the importance of different medicinal uses for a given species. The medicinal use of animals was reported by 57% of the surveyed people. Seven species were mentioned: Rhea pennata, Lama guanicoe, Puma concolor, Pseudalopex sp., Lama vicugna, Lepus europaeus and Conepatus chinga. Several body parts were used: fat, leg, bezoar-stone, stomach, feather, meat, blood, feces, wool, and liver. The fat of R. pennata was the most frequently used animal part, followed by the bezoar stone and the leg of L. guanicoe. Animals were used to treat 22 ailments, with respiratory and nervous system disorders being the most frequently treated diseases with a high degree of consensus. Old people used animals as remedies more frequently than young residents, showing some differences among villages. A low number of animal species was mentioned as used for medicinal purposes, which could be explained by the perception of strong control related the legislation that bans hunting and the erosion of traditional knowledge produced by mestizaje. However, the presence of a traditional medicine is deeply

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population.

PubMed

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly- phenotype. Subjects with PPARG2 Ala- phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased.

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population

PubMed Central

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly− phenotype. Subjects with PPARG2 Ala− phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased. PMID:26185753

Cirugía de los trastornos del comportamiento: el estado del arte

PubMed Central

Yampolsky, Claudio; Bendersky, Damián

2014-01-01

Introducción: La cirugía de los trastornos del comportamiento (CTC) se está convirtiendo en un tratamiento más común desde el desarrollo de la neuromodulación. Métodos: Este artículo es una revisión no sistemática de la historia, indicaciones actuales, técnicas y blancos quirúrgicos de la CTC. Dividimos su historia en 3 eras: la primera comienza en los inicios de la psicocirugía y termina con el desarrollo de las tícnicas estereotácticas, cuando comienza la segunda era. Ésta se caracteriza por la realización de lesiones estereotácticas. Nos encontramos transitando la tercera era, que comienza cuando la estimulación cerebral profunda (ECP) comienza a ser usada en CTC. Resultados: A pesar de los errores graves cometidos en el pasado, hoy en día, la CTC está renaciendo. Los trastornos psiquiátricos que se más frecuentemente se tratan con cirugía son: depresión refractaria, trastorno obsesivo-compulsivo y síndrome de Tourette. Además, algunos pacientes con agresividad fueron tratados quirúrgicamente. Hay varios blancos estereotácticos descriptos para estos trastornos. La estimulación vagal puede ser usada también para depresión. Conclusión: Los resultados de la ECP en estos trastornos parecen alentadores. Sin embargo, se necesitan más estudios randomizados para establecer la efectividad de la CTC. Debe tenerse en cuenta que una apropiada selección de pacientes nos ayudará a realizar un procedimiento más seguro así como también a lograr mejores resultados quirúrgicos, conduciendo a la CTC a ser más aceptada por psiquiatras, pacientes y sus familias. Se necesita mayor investigación en varios temas como: fisiopatología de los trastornos del comportamiento, indicaciones de CTC y nuevos blancos quirúrgicos. PMID:25165612

Archivo de placas astrométricas del Observatorio de La Plata

NASA Astrophysics Data System (ADS)

di Sisto, R.; Orellana, R. B.

Se ha realizado una base de datos con las placas fotográficas obtenidas con el Astrográfico del Observatorio de La Plata. Se han clasificado un total de 3000 placas obtenidas para asteroides y cometas. El acceso a la base de datos se hará por FTP y la misma contendrá la siguiente información: fecha y tiempo de exposición, coordenadas del centro de placa, tipo de emulsión fotográfica, estado de la placa, objeto fotografiado.

Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

PubMed

Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2013-01-01

Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

Estrategia de Aprendizaje Basado en Problemas (ABP) para explorar las concepciones alternativas relacionadas al tema estados de agregacion de la materia en estudiantes de nivel elemental =

NASA Astrophysics Data System (ADS)

Rosado Olivieri, Wilda Y.

Gran parte de la investigacion acerca de la ensenanza de las ciencias se dedica a estudiar la forma o manera en que los estudiantes visualizan los conceptos cientificos. Para Driver (1983) esas ideas o concepciones se conocen como concepciones alternativas; las cuales pueden ocasionar dificultad para comprender los conceptos de las diferentes areas del conocimiento. El proposito de este estudio fue: (a) indagar como las distintas etapas del ABP permiten explorar las concepciones alternativas que poseen los estudiantes de nivel elemental acerca de los estados de agregacion de la materia y, (b) explorar en que medida el ABP permite identificar e incorporar las concepciones alternativas que poseen los estudiantes de nivel elemental con relacion al concepto de estados de agregacion de la materia para facilitar su aprendizaje. Con el fin de explorar las concepciones alternativas en el tema de los estados agregados de la materia se implanto la estrategia de Aprendizaje Basado en Problemas (ABP) con estudiantes de quinto grado de nivel elemental. Se utilizo la metodologia mixta con varias estrategias de recopilacion de datos, como una pre y pos prueba para elucidar el conocimiento previo y al mismo tiempo las concepciones alternativas sobre el tema bajo estudio y luego verificar el aprendizaje en los estudiantes. Asimismo, el uso de mapas conceptuales para determinar la profundidad del tema estudiado y el entrelazamiento de los conceptos Una tercera estrategia fue el grupo focal para tomar en cuenta la impresion de los estudiantes acerca del proyecto ABP. El aspecto colaborativo y cooperativo fue un factor fundamental, ya que el aprendizaje ocurrio en ese contexto educativo. Para los hallazgos de esta investigacion fue tan importante el conocimiento previo como los procesos que se generaban para que la adquisicion del mismo fuera de forma significativa y funcional (Escribano & Del Valle, 2010). La estrategia de ABP constituyo en este estudio una forma para indagar las

Forensic-paternity effectiveness and genetics population analysis of six non-CODIS mini-STR loci (D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and SE33 in Mestizo and Amerindian populations from Mexico.

PubMed

Burguete-Argueta, Nelsi; Martínez De la Cruz, Braulio; Camacho-Mejorado, Rafael; Santana, Carla; Noris, Gino; López-Bayghen, Esther; Arellano-Galindo, José; Majluf-Cruz, Abraham; Antonio Meraz-Ríos, Marco; Gómez, Rocío

2016-11-01

STRs are powerful tools intensively used in forensic and kinship studies. In order to assess the effectiveness of non-CODIS genetic markers in forensic and paternity tests, the genetic composition of six mini short tandem repeats-mini-STRs-(D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and the microsatellite SE33 in Mestizo and Amerindian populations from Mexico were studied. Using multiplex polymerase chain reactions and capillary electrophoresis, this study genotyped all loci from 870 chromosomes and evaluated the statistical genetic parameters. All mini-STRs studied were in agreement with HW and linkage equilibrium; however, an important HW departure for SE33 was found in the Mestizo population (p ≤ 0.0001). Regarding paternity and forensic statistical parameters, high values of combined power discrimination and mean power of exclusion were found using these seven markers. The principal co-ordinate analysis based on allele frequencies of three mini-STRs showed the complex genetic architecture of the Mestizo population. The results indicate that this set of loci is suitable to genetically identify individuals in the Mexican population, supporting its effectiveness in human identification casework. In addition, these findings add new statistical values and emphasise the importance of the use of non-CODIS markers in complex populations in order to avoid erroneous assumptions.

Reconversion Militar del Ejercito en la Frontera Dominico-Haitiana (Military Restructuring of the Army on the Dominican-Haitian Border)

DTIC Science & Technology

2013-05-22

Estado Mayor del Ejército de EE. UU. en cumplimiento parcial de los requisitos para la obtención del grado de MAESTRÍA EN CIENCIAS Y ARTES...MILITARES Estudios Generales Por MAYOR FELIPE CÉSPEDES TEJERA, EJÉRCITO NACIONAL DOMINICANO Licenciado en Ciencias Sociales, Universidad...ANSI Std. Z39.18 ii MAESTRÍA EN ARTES Y CIENCIAS MILITARES PÁGINA DE APROBACIÓN DE LA TESIS Nombre del Candidato: Mayor Felipe Céspedes Tejera

HLA Alleles are Genetic Markers for Susceptibility and Resistance towards Leprosy in a Mexican Mestizo Population.

PubMed

Aguilar-Medina, Maribel; Escamilla-Tilch, Monica; Frías-Castro, Luis Octavio; Romero-Quintana, Geovanni; Estrada-García, Iris; Estrada-Parra, Sergio; Granados, Julio; Arambula Meraz, Eliakym; Sánchez-Schmitz, Guzman; Khader, Shabaana Abdul; Rangel-Moreno, Javier; Ramos-Payán, Rosalío

2017-01-01

Despite the use of multidrug therapy, leprosy remains endemic in some countries. The association of several human leucocyte antigen (HLA) alleles and gene polymorphisms with leprosy has been demonstrated in many populations, but the major immune contributors associated to the spectrum of leprosy have not been defined yet. In this study, genotyping of HLA-A, -B, -DR, and -DQ alleles was performed in leprosy patients (n = 113) and control subjects (n = 117) from the region with the highest incidence for the disease in México. The odds of developing leprosy and lepromatous subtype were 2.12- and 2.74-fold higher in carriers of HLA-A*28, and 2.48- and 4.14-fold higher for leprosy and dimorphic subtype in carriers of DQB1*06. Interestingly, DQB1*07 was overrepresented in healthy individuals, compared to patients with leprosy (OR = 0.08) and the lepromatous subtype (OR = 0.06). These results suggest that HLA-A*28 is a marker for predisposition to leprosy and the lepromatous subtype and DQB1*06 to leprosy and the dimorphic subtype, while DQB1*07 might be a resistance marker in this Mestizo population. © 2016 John Wiley & Sons Ltd/University College London.

Cardiovascular health status and metabolic syndrome in Ecuadorian natives/Mestizos aged 40 years or more with and without stroke and ischemic heart disease--an atahualpa project case-control nested study.

PubMed

Del Brutto, Oscar H; Mera, Robertino M; Montalván, Martha; Del Brutto, Victor J; Zambrano, Mauricio; Santamaría, Milton; Tettamanti, Daniel

2014-04-01

Knowledge of regional-specific cardiovascular risk factors is mandatory to reduce the growing burden of stroke and ischemic heart disease in Latin American populations. We conducted a population-based case-control study to assess which risk factors are associated with the occurrence of vascular events in natives/mestizos living in rural coastal Ecuador. We assessed the cardiovascular health (CVH) status and the presence of the metabolic syndrome in all Atahualpa residents aged 40 years or more with stroke and ischemic heart disease and in randomly selected healthy persons to evaluate differences in the prevalence of such risk factors between patients and controls. A total of 120 persons (24 with stroke or ischemic heart disease and 96 matched controls) were included. A poor CVH status (according to the American Heart Association) was found in 87.5% case-patients and 81.3% controls (P = .464). The metabolic syndrome was present in the same proportion (58.3%) of case-patients and controls. Likewise, both sets of risk factors (poor CVH status and the metabolic syndrome) were equally prevalent among both groups (58.3% versus 49%, P = .501). This case-control study suggests that none of the measured risk factors is associated with the occurrence of vascular events. It is possible that some yet unmeasured risk factors or an unknown genetic predisposition may account for a sizable proportion of stroke and ischemic heart disease occurring in the native/mestizo population of rural coastal Ecuador. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Intestinal microbiota assessment in cirrhotic patients from a Mexican mestizo population.

PubMed

Pérez-Monter, C; Escalona-Nandez, I; Estanes-Hernández, A; Noriega-López, L G; Torre-Delgadillo, A

2018-06-11

The intestinal microbiota is significantly altered in cirrhotic patients, but the composition of the intestinal microbiota in Mexican patients with the pathology has not been reported. The present study is an attempt to determine the type of intestinal microbiota in healthy subjects and in patients of Mexican mestizo origin that present with cirrhosis of the liver. Biochemical liver function parameters (ALT, AST, GGT, BIL-T, etc.) were determined in 23 cirrhotic patients and 21 control subjects. The intestinal microbiota was established through 16S ribosomal RNA gene sequencing. The cirrhotic patients had elevated levels of ALT, AST, GGT (105.2±77.7 vs. 20.99±8.5UI/L, 110±68.6 vs. 23.39±5.2, and 119.1±79.1 vs. 19.3±15.2UI/L, respectively), IL-6 (1.64±0.38pg/ml, P<.001), or TNFα (1.78±0.3, P<.05). The intestinal microbiota of the cirrhotic patients was less diverse, compared with that of the control subjects. At the level of the phylum, there was a significant increase in Proteobacteria and Bacteroidetes in the patients with cirrhosis, compared with the controls (6.2 vs. 4.9% and 44 vs. 46%, respectively, P<.01). In contrast, there was a decrease in Firmicutes, Actinobacteria, and Fusobacteria in the cirrhotic patients. There was an increase in the Campylobacter and Gemella families in the cirrhotic patients, whereas Streptococcus and Veillonella had a positive association with serum ALT or AST levels. To the best of our knowledge, the present study is the first to demonstrate the type of intestinal microbiota in Mexican patients with cirrhosis of the liver. The extension of the findings in a larger cohort of subjects and the metagenome analysis will enable the creation of data that can have relevant treatment implications for this group of patients in Mexico. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

The 3'UTR 1188A/C polymorphism of IL-12p40 is not associated with susceptibility for developing plaque psoriasis in Mestizo population from western Mexico.

PubMed

Sandoval-Talamantes, Ana Karen; Brito-Luna, Myrian Johanna; Fafutis-Morris, Mary; Villanueva-Quintero, Delfina Guadalupe; Graciano-Machuca, Omar; Ramírez-Dueñas, María Guadalupe; Alvarado-Navarro, Anabell

2015-02-01

Psoriasis is a chronic autoimmune inflammatory disease that affects the skin and the joints. Psoriasis is characterized by the keratinocyte proliferation, which is induced by cytokines Th1 and Th17. Patients with plaque psoriasis present a chronic inflammatory response with high levels of interleukin (IL)-12 and IL-23. Various single-nucleotide polymorphisms (SNP) have been identified in the IL12B gene, such as SNP 3' UTR 1188 A/C (SNP rs3212227), which has been associated with susceptibility to developing plaque psoriasis and with the production of IL-12 and IL-23 in individuals of different ethnic groups. In this study, we determined whether there is an association of SNP rs3212227 with the susceptibility of developing plaque psoriasis and with serum levels of IL-12 and IL-23 in Mestizo population in western Mexico. We included 112 patients with psoriasis and 112 clinical healthy individuals in the study. The frequencies of genotypes A/A, A/C, and C/C in patients with plaque psoriasis were 41, 53, and 6%, respectively, while in the control group, these were 37, 53, and 10%, respectively, without finding statistically significant differences between both groups (p>0.05). Although IL-12 and IL-23 serum levels were higher in patients than in controls, we found no significant differences. The group of patients with genotype CC presented the highest levels of IL-23 (p<0.05). These data suggest that the SNP rs3212227 phenotype is not associated with the risk of developing plaque psoriasis or with IL-12 and IL-23 levels in Mestizo population in western Mexico. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

Servicio de Mapas en Internet para la Salud Ambiental en la Region Fronteriza Entre los Estados Unidos y Mexico

USGS Publications Warehouse

Buckler, Denny; Stefanov, Jim

2004-01-01

La region fronteriza de los Estados Unidos y Mexico abarca una gran diversidad de ambientes fisicos y habitaciones, entre los cuales estan los humedales, desiertos, pastos, montanas, y bosques. Estos a su vez son unicos en cuanto a su diversidad de recursos acuaticos minerales, y biologicos. La region se interconecta economica, politica, y socialmente debido a su herencia binacional. En 1995, cerca de 11 millones de habitantes vivian en la zona adyacente a la frontera. Un estudio sugiere que esa poblacion podria doblarse antes del ano 2020.

Breast Cancer Risk Associated with Genotype Polymorphisms of the Aurora Kinase a Gene (AURKA): a Case-Control Study in a High Altitude Ecuadorian Mestizo Population.

PubMed

López-Cortés, Andrés; Cabrera-Andrade, Alejandro; Oña-Cisneros, Fabián; Rosales, Felipe; Ortiz, Malena; Tejera, Eduardo; Paz-Y-Miño, César

2018-07-01

Breast cancer (BC) is the leading cause of cancer related death among women in 2014. The AURKA gene that encodes the protein called Aurora kinase A plays an important role in the progression of the cell cycle, by controlling and promoting the entry into the phase of mitosis. The single nucleotide polymorphism AURKA T91A (rs2273535) (Phe21Ile) has been identified as functional alternator of this kinase, the Ile allele is associated with the occurrence of chromosome segregation errors and tumor progression. Therefore, it is essential to know how BC risk is associated with histopathological characteristics, immunohistochemical characteristics, and genotype polymorphism in a high altitude Ecuadorian mestizo population. In this retrospective case-control study 200 individuals were analyzed. DNA was extracted from 100 healthy and 100 affected women. Genotypes were determined by genomic sequencing. We found significant association between the AURKA T91A (rs2273535) (Phe21Ile) genotype and an increased risk of BC development: Phe/Ile (odds ratio [OR] = 2.6; 95% confidence interval [CI] = 1.4-4.9; P = 0.004), Ile/Ile (OR = 3.8; 95% CI = 1.6-9.0; P = 0.002), and Phe/Ile + Ile/Ile (OR = 2.9; 95% CI = 1.6-5.2; P = 0.001). Additionally, the rs2273535 variant was associated with the tumor grade SBR III (OR = 9.6; 95% CI = 1.0-91.9; P = 0.048) and the Ki-67 ≥ 20 (OR = 16.5; 95% CI = 2.7-101.3; P = 0.002). In brief, this study provides the first evidence where the Ile allele of the AURKA gene could act as potentially predictive biomarker of BC in the high altitude Ecuadorian mestizo population that lives at 2800 m above sea level (masl).

Genetic structure of Mexican Mestizos with type 2 diabetes mellitus based on three STR loci.

PubMed

Cerda-Flores, Ricardo M; Rivera-Prieto, Roxana A; Pereyra-Alférez, Benito; Calderón-Garcidueñas, Ana L; Barrera-Saldaña, Hugo A; Gallardo-Blanco, Hugo L; Ortiz-López, Rocío; Flores-Peña, Yolanda; Cárdenas-Villarreal, Velia M; Rivas, Fernando; Figueroa, Andrés; Kshatriya, Gautam

2013-08-01

The aims of this population genetics study were: 1) to ascertain whether Mexicans with type 2 diabetes mellitus (DM) were genetically homogeneous and 2) to compare the genetic structure of this selected population with the previously reported data of four random populations (Nuevo León, Hispanics, Chihuahua, and Central Region of Mexico). A sample of 103 unrelated individuals with DM and whose 4 grandparents were born in five zones of Mexico was interviewed in 32 Medical Units in the Mexican Institute of Social Security (IMSS). The non-coding STRs D16S539, D7S820, and D13S317 were analyzed. Genotype distribution was in agreement with Hardy-Weinberg expectations for all three markers. Allele frequencies were found to be similar between the selected population and the four random populations. Gene diversity analysis suggested that more than 99.57% of the total gene diversity could be attributed to variation between individuals within the population and 0.43% between the populations. According to the present and previous studies using molecular and non-molecular nuclear DNA markers not associated with any disease, the Mexican Mestizo population is found to be genetically homogeneous and therefore the genetic causes of DM are less heterogeneous, thereby simplifying genetic epidemiological studies as has been found in a previous study with the same design in Mexican women with breast cancer. Published by Elsevier B.V.

Preparación de los adultos mayores en los Estados Unidos para hacer frente a los desastres naturales: encuesta a escala nacional*

PubMed Central

Al-rousan, Tala M.; Rubenstein, Linda M.; Wallace, Robert B.

2015-01-01

Objetivos. Nos propusimos determinar el grado de preparación frente a los desastres naturales de los adultos mayores en los Estados Unidos y evaluar los factores que pueden afectar negativamente la salud y la seguridad durante este tipo de incidentes. Métodos. Obtuvimos una muestra de adultos de 50 años en adelante (n = 1 304) de la encuesta del 2010 del Estudio de la Salud y la Jubilación (HRS por su sigla en inglés). La encuesta recogió datos sobre las características demográficas generales, el estado de discapacidad o las limitaciones funcionales, y también sobre factores y comportamientos relacionados con la preparación frente a los desastres. Calculamos una puntuación global de preparación mediante indicadores individuales a fin de evaluar el grado de preparación general. Resultados. La media de la edad de los participantes (n = 1 304) fue de 70 años (desviación estándar [DE] = 9,3). Solo 34,3% informaron que habían participado en un programa formativo o que habían leído materiales sobre la preparación para los desastres. Casi 15% indicaron que usaban dispositivos médicos eléctricos que podían correr riesgo de no funcionar si se interrumpiera el suministro eléctrico. La puntuación de preparación indicó que la edad más avanzada, la discapacidad física y el menor nivel de escolaridad y de ingresos se asociaban independiente y significativamente a un grado de preparación general inferior. Conclusiones. A pesar de la mayor vulnerabilidad ante los desastres y del número cada vez mayor de adultos mayores en los Estados Unidos, muchos de los problemas sustanciales que encontramos son remediables y requieren atención en los sectores de la sociedad dedicados a la atención clínica, a la salud pública y al manejo de situaciones de emergencia.

Comparison of statin eligibility according to the Adult Treatment Panel III, ACC/AHA blood cholesterol guideline, and presence of carotid plaque by ultrasound in Mexican mestizo patients with rheumatoid arthritis.

PubMed

Galarza-Delgado, Dionicio A; Azpiri-Lopez, Jose R; Colunga-Pedraza, Iris J; Cardenas-de la Garza, Jesus A; Vera-Pineda, Raymundo; Garcia-Colunga, Judith I; Arvizu-Rivera, Rosa I; Martinez-Moreno, Adrian; Villarreal-Perez, Jesus Z; Elizondo-Riojas, Guillermo; Garza Elizondo, Mario A

2016-11-01

Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death in rheumatoid arthritis (RA) patients. Guidelines of the American College of Cardiology and the American Heart Association (ACC/AHA) 2013 and the Adult Treatment Panel III (ATP-III) differ in their strategies to recommend initiation of statin therapy. The presence of carotid plaque (CP) by carotid ultrasound is an indication to begin statin therapy. We aimed to compare the recommendation to initiate statin therapy according to the ACC/AHA 2013 guidelines, ATP-III guidelines, and CP by carotid ultrasound. We then carried out an observational, cross-sectional study of 62 statin-naive Mexican mestizo RA patients, aged 40 to 75, who fulfilled the 1987 or 2010 ACR/European League Against Rheumatism (EULAR) classification criteria. CP was evaluated with B-mode ultrasound. Cohen's kappa (k) was used to assess agreement between ACC/AHA 2013 guidelines, ATP-III guidelines, and the presence of CP, considering a p < 0.05 as statistically significant. Agreement was classified as slight (0.01-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and an almost perfect agreement (0.81-1.00). Slight agreement (k = 0.096) was found when comparing statin recommendation between CP and ATP-III. Fair agreement (k = 0.242) was revealed between ACC/AHA 2013 and ATP-III. Comparison between ACC/AHA 2013 and CP showed moderate agreement (k = 0.438). ACC/AHA 2013 guidelines could be an adequate and cost-effective tool to evaluate the need of statin therapy in Mexican mestizo RA patients, with moderate agreement with the presence of CP by ultrasound.

Extensión del Formalismo de Orbitales de Defecto Cuántico al tratamiento del efecto Stark (SQDO).

NASA Astrophysics Data System (ADS)

Menéndez, J. M.; Martín, I.; Velasco, A. M.

El estudio experimental de las interacciones de átomos Rydberg altamente excitados con campos eléctricos ha experimentado un creciente interés durante las dos últimas décadas debido, en gran medida, al desarrollo de nuevas técnicas para crear y estudiar átomos Rydberg en el laboratorio. Acompañando a estas nuevas técnicas experimentales, es necesario el desarrollo de modelos teóricos que nos permitan contrastar sus medidas y conocer mejor los fundamentos de los mismos. Desde el punto de vista teórico el conocimiento del desdoblamiento de los niveles energéticos de un átomo en función de la magnitud del campo eléctrico aplicado (lo que se conoce como mapa Stark) es el mejor punto de partida para la descripción del sistema y un prerrequisito fundamental para el cálculo de distintas propiedades atómicas en presencia del campo eléctrico tales como intensidades de transición, umbrales de ionización de campo eléctrico, tiempos de vida, posición y anchura de cruces evitados, etc. En este trabajo presentamos la adaptación del método de orbitales de defecto cuántico [1,2,3] al tratamiento del efecto Stark (SQDO) [4] y su aplicación al cálculo de los desdoblamientos energéticos y fuerzas de oscilador de estados Rydberg en los átomos de Li, Na y K. El propósito de este estudio es, por un lado, desarrollar métodos fiables para la determinación de propiedades atómicas en presencia de campos eléctricos y, por otro, mostrar la fiabilidad de las funciones de onda QDO en la descripción del efecto Stark en sistemas atómicos.

Calpain-10 gene polymorphisms and risk of type 2 diabetes mellitus in Mexican mestizos.

PubMed

Picos-Cárdenas, V J; Sáinz-González, E; Miliar-García, A; Romero-Zazueta, A; Quintero-Osuna, R; Leal-Ugarte, E; Peralta-Leal, V; Meza-Espinoza, J P

2015-03-27

The calpain-10 gene is expressed primarily in tissues important in glucose metabolism; thus, some of its polymorphisms have been associated with type 2 diabetes. In this study, we examined the association between the calpain-10 single-nucleotide polymorphism (SNP)-43, SNP-19, and SNP-63 and type 2 diabetes in Mexican mestizos. We included 211 patients and 152 non-diabetic subjects. Polymerase chain reaction was used to identify alleles. We compared allele, genotype, haplotype, and diplotype frequencies between both groups and used the chi-square test to calculate the risk. The allele frequency of SNP-43 allele 1 was 70% in controls and 72% in patients; the GG, GA, and AA genotype frequencies were 48.7, 42.8, and 8.5% in controls and 51.2, 41.7, and 7.1% in patients, respectively. For SNP- 19, the prevalence of allele 1 (2R) was 32% in controls and 39% in patients. In controls, homozygosity (2R/2R) was 10.5%, heterozygosity was 42.8%, and 3R/3R was 46.7%; in cases, these values were 13.3, 50.7, and 36.0%, respectively. For SNP-63, the frequency of allele 1 was 87% in controls and 83% in patients; genotype frequencies in controls were 75.7% (CC), 23% (CT), and 1.3% (TT), and were 69.7, 27.5, and 2.8%, respectively for the cases. Genotype distributions were consistent with Hardy-Weinberg equilibrium. No significant intergroup differences for allele, genotype, haplotype, or diplotype frequencies were observed. We found no association between these polymorphisms and diabetes. However, our sample size was small, so the role of calpain-10 risk alleles should be further examined.

El Mejoramiento de la Efectividad del Personal de las Diferentes Unidades del Ejrcito de Guatemala Involucradas en la Integracin de Contingentes Desplegados en Diferentes Misiones de Paz de la Organizacin de las Naciones Unidas (Improving the Effectiveness of Guatemalan Army Units that Provide Soldiers to Units Deployed in United Nations Peace Missions)

DTIC Science & Technology

2017-06-09

del Ejército de EE.UU. Colegio de Comando y Estado Mayor en el cumplimiento parcial de los requisitos para el grado de MAESTRÍA EN CIENCIAS Y...Rev. 8-98) Prescribed by ANSI Std. Z39.18 iii MAESTRÍA EN CIENCIAS Y ARTES MILITARES PAGINA DE APROBACIÓN DE LA TESIS Name of Candidate: Major... Ciencias Militares. A mi honorable comité de tesis, Doctor Edwin Roldán, Coronel Francisco Rivera Pérez del Ejército de Guatemala y al Mayor Rafael

HPV-16 and HLA-DRB1 alleles are associated with cervical carcinoma in Mexican Mestizo women.

PubMed

Alaez-Verson, Carmen; Berumen-Campos, Jaime; Munguía-Saldaña, Andrea; Flores-Aguilar, Hilario; Guardado-Estrada, Mariano; Rodríguez-Gomez, Araceli; Gorodezky-Lauferman, Clara

2011-07-01

The aim of this report was to investigate the contribution of HLA-DRB1/DQB1 alleles to the expression of cervical cancer (CC) and squamous intraepithelial lesion (SIL) in Mexican patients. A total of 257 women were included in the study: 61with low-grade squamous intraepithelial lesions (LSIL), 30 with high-grade (HSIL), 73 with CC and 93 healthy females. All were Mexican Mestizos. For HLA class II typing, PCR-SSOP methodology was used. HPV-16 viral DNA was detected by PCR with specific primers for E6-E7 region. HPV-16 was found in 52% of the patients with CC as well as in 19% of women with HSIL and in 12.5% of females with LSIL. HLA-DRB1∗04:03 (OR = 5.88) was found increased in patients with HSIL as compared with controls, although significance (p = 0.04) was lost after correction (pc =NS). HLA-DRB1∗04:03 seems to influence the risk for developing HSIL, disregarding the presence of HPV-16. HLA-DRB1∗01:01 (OR = 0.12; p = 0.01) may confer protection to the development of CC. An analysis performed stratifying by the presence of HPV-16 infection showed that the frequency of HLA-DRB1∗04:07 (OR = 2.71) was increased in CC patients infected with HPV-16, confirming that the HLA association is HPV dependent. These results shed light on the influence that this virus may have in the expression of CC in the susceptible host. Genetic background is, therefore, a crucial factor in understanding the etiopathogenesis of CC in HPV-positive patients. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

Genetic variations in toll-like receptor 4 in Mexican-Mestizo patients with intra-abdominal infection and/or pneumonia.

PubMed

Rodriguez-Osorio, Carlos A; Lima, Guadalupe; Herrera-Caceres, Jaime O; Villegas-Torres, Beatriz E; Zuñiga, Joaquin; Ponce-de-Leon, Sergio; Llorente, Luis; Sifuentes-Osornio, Jose

2013-06-01

Sepsis is a leading cause of death around the world, and 73-83% of all sepsis cases requiring attention in intensive care units are linked to intra-abdominal infection (IAI) or pneumonia. The activation of innate immunity is central to the manifestation of sepsis, and toll-like receptor (TLR) 4 plays an important role in this activation process. The 299G and 399I alleles of TLR4 have been linked with an increased risk of Gram-negative bacteria (GNB) infections and septic shock in some populations. This case-control study evaluated the prevalence of D299G/T399I polymorphisms in Mexican patients with IAI and/or pneumonia and in healthy controls. Genotyping revealed that 1 in 44 patients (2.3%; CI 95%: 0.05-12.0%) and 4 in 126 controls (3.2%; CI 95%: 0.9-7.9%) were heterozygous for both the D299G and T399l polymorphisms (OR: 0.71, CI 95%: 0.01-7.44, p = NS), confirming the co-segregation of these alleles in this population. Furthermore, the patients with a GNB infection and severe sepsis were not carriers of the risk alleles. In summary, this report shows that the frequency of the D299G and T399I polymorphisms in Mexican-Mestizos is lower than anticipated in comparison with other ethnic groups, emphasizing the variable distribution of TLR4 polymorphisms among different populations. Consequently, this study was not able to detect associations between TLR4 polymorphisms and sepsis in this population. Copyright © 2013 Elsevier B.V. All rights reserved.

Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

PubMed

Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

2017-08-01

Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

Seguridad del paciente en Radioterapia Intraoperatoria: Impacto de los elementos controlados por el Radiofisico

NASA Astrophysics Data System (ADS)

Tarjuelo, Juan Lopez

Introduccion: En la administracion de la radioterapia intervienen profesionales y equipos de tratamiento, por lo que existe el riesgo de error y se precisa que dicho equipamiento funcione conforme a lo esperado. A los radiofisicos les corresponde participar en las actividades de garantia o aseguramiento de la calidad, incluyendo el control de calidad de los equipos, y en la evaluacion de los riesgos asociados. La radioterapia intraoperatoria (RIO) es una tecnica radioterapica de intensificacion de dosis, altamente selectiva, dirigida a volumenes anatomicos restringidos durante el tratamiento quirurgico oncologico, basada en la administracion de una dosis absorbida alta por medio de un haz de electrones tras el examen visual directo del lecho tumoral. Como incorporar los ultimos avances en el refuerzo de la seguridad en radioterapia es una tarea ambiciosa y compleja, resulta mas concreta y de inmediata aplicacion su introduccion en la RIO. El objetivo es analizar los elementos que reducen los riesgos y aumentan la seguridad en la RIO y su dosimetria, y valorar la funcion del radiofisico en esta labor. Material y metodos: Se emplearon el planificador Radiance de GMV y el acelerador lineal de los tratamientos de RIO Elekta Precise, controlado con el verificador diario de haces Daily QA Check 1090 y medido con las camaras de ionizacion PPC 40, FC65-G y FC65-P de PTW-Freiburg, a su vez verificadas con fuentes radiactivas adecuadas de estroncio-90 modelos CDP y CDC de IBA Dosimetry. Se realizo un analisis de modos de fallo y efectos (failure mode and effect analysis, FMEA) con el fin de identificar los elementos que forman la RIO y aplicar las herramientas necesarias para la minimizacion de los riesgos y la mejora de la seguridad en la tecnica. Se estudiaron las verificaciones diarias de dicho acelerador Precise con el control estadistico de procesos (statistical process control, SPC) y se simularon intervenciones para devolverlo al estado llamado en control. El SPC

La guerra de los Estados Unidos contra la inmigración. Efectos paradójicos1

PubMed Central

Massey, Douglas S.; Pren, Karen A.

2016-01-01

Resumen A finales de la década de los cincuenta, Estados Unidos permitía la entrada de aproximadamente medio millón de inmigrantes mexicanos al año, de los cuales 450.000 entraban con visados de trabajo temporal y 50.000 llegaban con visados de residentes permanentes. A mediados de los años sesenta, los cambios en la política migratoria de Estados Unidos realizados en nombre de los derechos civiles redujeron drásticamente las oportunidades de entrada legal a Estados Unidos. Se eliminaron los visados de trabajo temporal y se limitaron los visados de residentes a 20.000 por año. Con las oportunidades de entrada legal restringidas, los flujos migratorios ya establecidos simplemente continuaron, fuera de los límites legales, dando comienzo a una inesperada reacción en cadena de eventos que culminaron en una guerra total contra los inmigrantes y el rápido crecimiento -sin precedentes- de población residente no autorizada en Estados Unidos. El presente artículo demuestra que el aumento de inmigración indocumentada en los Estados Unidos y el crecimiento de la población sin papeles son un producto de políticas migratorias y fronterizas mal concebidas. PMID:27076695

Biochemical differences in ethnic groups in Durango, Mexico.

PubMed

Lares-Asseff, Ismael; Lujín-García, Azalia; Sosa-Macías, Martha; Lazalde-Ramos, Blanca; Loera-Castañeda, Veronica; Galaviz-Hernández, Carlos; Villanueva-Fierro, Ignacio

2012-01-01

The aim of this study was to assess biochemical differences between Tepehuano indigenous people, and Mennonite and Mestizo populations of Durango, Mexico. Our study involved 334 volunteers aged 15 to 80 years; 132 Mennonite and 130 Mestizo individuals from Nuevo Ideal Municipality and 72 Tepehuano indigenous people from Mezquital Durango were evaluated. A clinical history and fast determination of aspartate aminotransferase (AST), alanine aminotransferase (ALT), uric acid, urea and creatinine were performed on each studied case. Statistically significant differences between the three studied groups were found for age, weight and height (P < .05), with higher values observed in men. The highest plasma urea levels were found in Mennonite compared to Mestizo people, followed by the Tepehuano indigenous. Higher biochemical parameters were found in men (vs women) in the studied groups. The percentage of individuals with abnormal levels for AST, ALT and uric acid were higher in Tepehuano indigenous people than in Mestizo, whereas the urea and creatinine percentages were higher in Mestizo people. The differences found on biochemical tests, could be explained by differences in lifestyle such as diet and sanitary habits.

Honduran-U.S. Relations

DTIC Science & Technology

2009-08-04

Miami Herald, July 16, 2009; “Informe Preliminar: Violaciones a Derechos Humanos en el Marco del Golpe de Estado en Honduras,” Comité de Familiares de...Detenidos Desaparecidos en Honduras (CONFADEH), July 15, 2009; “Reporte de Violaciones a Derechos Humanos Después del Golpe de Estado Político-Militar...del 28 de Junio de 2009,” Centro de Investigacion y Promocion de los Derechos Humanos (CIPRODEH), July 17, 2009. 31 For more on the U.S. response

Analysis of Polymorphisms in Genes (AGT, MTHFR, GPIIIa, and GSTP1) Associated with Hypertension, Thrombophilia and Oxidative Stress in Mestizo and Amerindian Populations of México

PubMed Central

Juárez-Velázquez, Rocio; Canto, Patricia; Canto-Cetina, Thelma; Rangel-Villalobos, Hector; Rosas-Vargas, Haydee; Rodríguez, Maricela; Canizales-Quinteros, Samuel; Velázquez Wong, Ana Claudia; Ordoñez-Razo, Rosa María; Vilchis-Dorantes, Guadalupe; Coral-Vázquez, Ramón Mauricio

2010-01-01

Several polymorphisms related to hypertension, thrombophilia, and oxidative stress has been associated with the development of cardiovascular disease. We analyzed the frequency of M235T angiotensinogen (AGT), A222V 5,10 methylenete-trahydrofolate reductase (MTHFR), L33P glycoprotein IIIa (GPIIIa), and I105V glutathione S-transferase P1 (GSTP1) polymorphisms in 285 individuals belonging to Mexican-Mestizo and five Amerindian population from México, by real time PCR allelic discrimination. Allele and genotype frequencies were compared using χ2 tests. All populations followed the Hardy Weinberg equilibrium for assay markers with the exception of the Triki, whose were in Hardy Weinberg dysequilibrium for the glutathione S-transferase P1 polymorphism. Interestingly, according to all the analyzed single nucleotide polymorphisms (SNPs), the Triki population was the most differentiated and homogeneous group of the six populations analyzed. A comparison of our data with those previously published for some Caucasian, Asian and Black populations showed quite significant differences. These differences were remarkable with all the Mexican populations having a lower frequency of the 105V allele of the glutathione S-transferase P1 and reduced occurrence of the 222A allele of the 5,10 methylenetetrahydrofolate reductase. Our results show the genetic diversity among different Mexican populations and with other racial groups. PMID:20592457

Seroprevalence of human Trypanosoma cruzi infection in the North of Estado de Mexico.

PubMed

González-Guzmán, Saúl; Pichardo-Ávila, Sergio; Mimbrera-Rodríguez, Eulalia; Crescencio-Trujillo, José Antonio; Gasca-Leyva, María de Lourdes; Martínez-Hernández, Fernando; Rivas, Nancy; Alejandre-Aguilar, Ricardo

2017-01-01

Chagas disease is a neglected public health problem in Mexico; however, detailed studies to determine the seroprevalence in some states have not been performed. A total 1,504 human serum from thirteen communities in Estado de Mexico, were analyzed with three diagnostics techniques. The overall seroprevalence was 9.1%, with high prevalence among people aged 51-60 years, while people aged 0-29 years were seronegative against T. cruzi. Our data demonstrated the seroprevalence of T. cruzi in the North of the Estado de Mexico, an area considered as non-endemic; however, epidemiological conditions necessary for natural transmission were found.

The Light Infantry Division Regionally Focused for Low Intensity Conflict

DTIC Science & Technology

1990-06-01

The= offical languages are Spanish, Quechua and Aymara. (3) Education: Illiteracy: 20%. (4) Ethnic Composition: Indian 45%; mestizo 37%; Caucasian 15... Quechua , and Aymara are the offical languages. (3) Education: Illiteracy: 37%. (4) Ethnic Composition: Quechua 30%; Aymara 25%; Mestizo 31%; European

Desarrollo de fotonovelas para concienciar sobre trastornos de la conducta alimentaria en latinos en los Estados Unidos

PubMed Central

Reyes-Rodríguez, Mae Lynn; García, Marissa; Silva, Yormeri; Sala, Margarita; Quaranta, Michela; Bulik, Cynthia M.

2016-01-01

Resumen El objetivo de este estudio fue desarrollar fotonovelas, un tipo de novela gráfica popular en la población latina, para crear conciencia y educar sobre los trastornos de la conducta alimentaria (TCA). Cuatro caricaturas ilustradas y guiones adaptados para adultos y adolescentes de ambos sexos fueron presentados en discusiones focales y en una entrevista de profundidad. Diecisiete latinos adultos (14 mujeres; 3 hombres) y 10 adolescentes (9 féminas; 1 varón) participaron en el estudio. Los participantes encontraron las fotonovelas interesantes y que captaban más la atención que los folletos tradicionales. El uso del espanglish y la clarificación de las diferencias entre los TCA fueron sugeridos por las adolescentes femeninas. Los adultos varones sugirieron cambiar el título, que se enfocara en las consecuencias en la salud de los TCA para que llame la atención en los hombres a leer la historia. Basado en la aceptación encontrada en este estudio, la fotonovela pudiera ser una avenida prometedora para crear conciencia y educar a la comunidad latina sobre los TCA en los Estados Unidos. PMID:27313838

Civil-Military Relations in Latin America: The Hedgehog and the Fox Revisited

DTIC Science & Technology

2005-01-01

and the Fox Revisited Thomas C. Bruneau Naval Postgraduate School, Estados Unidos Resumen El siguiente artículo propone un nuevo enfoque hacia el...puede lograr solamente por medio de la creación de instituciones que incorporan y personifican conocimientos y mecanismos de control tanto del poder...ejecutivo como legislativo del estado democrático. Abstract This article argues for a new focus in the study of civil-military relations. It seeks to

The Mexican Military Approaches the 21st Century: Coping with a New World Order

DTIC Science & Technology

1994-02-21

known today by the initials PRI (Partido Revolucionario Institucional ), began the process of institutionalizing civilian political power.1 The...Herrera Lasso M. and Gonzalez, Balance y Perspectivas, pp. 397-399. 8. Roberto Vizcaino, "La Seguridad del Pafs, Fin Primordial del Estado ," Proceso...pp. 120-121. 10. Raud Benitez Manaut, "Las Fuerzas Armadas Mexicaras y su Relaci6n con el Estado , el Sistema Politico y la Sociedad," paper presented

Arrecifes de coral en los Estados Unidos

EPA Pesticide Factsheets

Los factores de estrés locales y mundiales han afectado considerablemente a los arrecifes de coral del Caribe. Se ha informado una disminución masiva de los corales en toda la región de la cuenca del Caribe,

IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

PubMed

Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

2016-01-01

In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

A Global Overview of Narcotics-Funded Terrorist and Other Extremist Groups

DTIC Science & Technology

2002-05-01

del Estado —SIDE), told O Estado de São Paulo’s Buenos Aires correspondent that the event had two elements of great significance to continental...embaixada dos EUA” (Paraguay Extradites Terrorist to Canada: The Houdini Arab is Suspected of a Plot Against the U.S. Embassy), O Estado de S. Paulo...Triborder Region of Argentina, Brazil, and Paraguay.64 In early January 1998, the Brazilian newspaper Estado de São Paulo cited Argentine reporter

Investigación del USGS sobre el ecosistema de arrecifes de coral en el Atlántico

USGS Publications Warehouse

Kuffner, Ilsa B.; Yates, Kimberly K.; Zawada, David G.; Richey, Julie N.; Kellogg, Christina A.; Toth, Lauren T.; Torres-Garcia, Legna M.

2015-10-23

Los arrecifes de coral son estructuras sólidas, biomineralizadas que protegen comunidades costeras actuando como barreras protectoras de peligros tales como los huracanes y los tsunamis. Estos proveen arena a las playas a través de procesos naturales de erosión, fomentan la industria del turismo, las actividades recreacionales y proveen hábitats pesqueros esenciales. La conti-nua degradación mundial de ecosistemas de arrecifes de coral está bien documentada. Existe la necesidad de enfoque y organización de la ciencia para entender los procesos complejos físicos y biológicos e interacciones que están afectando el estado de los arrecifes coralinos y su capacidad para responder a un entorno cambiante.

Incentivos para atraer y retener personal de salud de zonas rurales del Perú: un estudio cualitativo

PubMed Central

Huicho, Luis; Canseco, Francisco Díez; Lema, Claudia; Miranda, J. Jaime; Lescano, Andrés G.

2014-01-01

El objetivo fue identificar incentivos de atracción y retención en zonas rurales y distantes de Ayacucho, Perú. Fueron realizadas entrevistas en profundidad con 80 médicos, enfermeras, obstetras y técnicos (20 por grupo) de las zonas más pobres y con 11 funcionarios. No existen políticas sistemáticas de atracción y retención de personal de salud en Ayacucho. Los principales incentivos, en orden de importancia, fueron mejoras salariales, oportunidades de formación y capacitación, estabilidad laboral y nombramiento, mejoras en infraestructura y equipos, e incremento del personal. Se mencionaron también mejoras en la vivienda y alimentación, mayor cercanía con la familia y reconocimiento por el sistema de salud. Existen coincidencias y singularidades entre los distintos grupos sobre los incentivos clave para estimular el trabajo rural, que deben considerarse al diseñar políticas públicas. Las iniciativas del Estado deben comprender procesos rigurosos de monitoreo y evaluación, para asegurar que las mismas tengan el impacto deseado. PMID:22488318

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

DEL phenotype.

PubMed

Kwon, Dong H; Sandler, S G; Flegel, Willy A

2017-09-01

DEL red blood cells (RBCs) type as D- by routine serologic methods and are transfused routinely, without being identified as expressing a very weak D antigen, to D- recipients. DEL RBCs are detected only by adsorption and elution of anti-D or by molecular methods. Most DEL phenotypes have been reported in population studies conducted in East Asia, although DEL phenotypes have been detected also among Caucasian individuals. Approximately 98 percent of DEL phenotypes in East Asians are associated with the RHD*DEL1 or RHD*01EL.01 allele. The prevalence of DEL phenotypes has been reported among D- Han Chinese (30%), Japanese (28%), and Korean (17%) populations. The prevalence of DEL phenotypes is significantly lower among D- Caucasian populations (0.1%). Among the 3-5 percent of African individuals who are D-, there are no reports of the DEL phenotype. Case reports from East Asia indicate that transfusion of DEL RBCs to D- recipients has been associated with D alloimmunization. East Asian immigrants constitute 2.1 percent of the 318.9 million persons residing in the United States, and an estimated 2.8 percent are blood donors. Using these statistics, we estimate that 68-683 units of DEL RBCs from donors of East Asian ancestry are transfused as D- annually in the United States. Given the reports from East Asia of D alloimmunization attributed to transfusion of DEL RBCs, one would expect an occasional report of D alloimmunization in the United States following transfusion of DEL RBCs to a D- recipient. If such cases do occur, the most likely reason that they are not detected is the absence of active post-transfusion monitoring for formation of anti-D.

16 de Septiembre, 1810 Module. Secondary Level. [16 of September, 1810 Module. Secondary Level.

ERIC Educational Resources Information Center

Crystal City Independent School District, TX.

Independence for Mexico took 11 years to achieve. Before its independence Mexico was ruled by Spain and had a basic caste system of indios, mestizos, criollos, and gachupines. The gachupines and criollos ruled the government and exploited the indios and mestizos. When the criollos became dissatisfied with being secondary to the gachupines, they…

Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population

PubMed Central

Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

2017-01-01

Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (KATP). Single nucleotide polymorphisms (SNPs) of the KATP coding genes, potassium voltage-gated channel subfamily J member 11 (KCNJ11) and ATP binding cassette subfamily C member 8 (ABCC8) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (−3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0.397, TT

Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population.

PubMed

Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

2017-07-01

Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (K ATP ). Single nucleotide polymorphisms (SNPs) of the K ATP coding genes, potassium voltage-gated channel subfamily J member 11 ( KCNJ11 ) and ATP binding cassette subfamily C member 8 ( ABCC8 ) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (-3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0

[Not Available].

PubMed

López-Fuenzalida, Antonio; Valdés-Badilla, Pablo; Herrera-Valenzuela, Tomás; Rodríguez Canales, Carolina; Reyes Ponc, Álvaro; Arriaza Ardiles, Enrique; Durán Agüero, Samuel

2016-06-30

Introducción: la categorización del estado nutricional a través del índice de masa corporal (IMC) es uno de los recursos de valoración clínica más utilizados en el síndrome metabólico (SM). Sin embargo, es desconocida su capacidad para identificar las diferencias en la composición corporal.Objetivo: determinar si las variaciones en el estado nutricional se reflejan en la composición corporal en mujeres con SM e identificar la concordancia de clasificación del riesgo cardiometabólico entre el estado nutricional e índices antropométricos.Material y métodos: la muestra incluyó 136 mujeres (edad 42 ± 3,5 años) con SM. Se evaluó el estado nutricional, masa muscular, masa adiposa, perímetro de cintura (PC), índice cintura-cadera (ICC) e índice cintura-estatura (ICE). Se compararon los valores de composición corporale índices antropométricos; adicionalmente se determinó la concordancia clasificatoria del riesgo cardiometabólico entre los índices y el IMC.Resultados: solo la edad (p = 0,358), estatura (p = 0,209) y porcentaje de adiposidad (p = 0,234) no mostraron diferencias significativas entre los grupos. La mejor concordancia clasificatoria del riesgo cardiometabólico se observó en el PC > 88 cm (94,9%) e ICE ≥ 0,5 (94,1%) al categorizar el IMC en normopeso vs. exceso de peso; mientras que el PC > 88 cm obtuvo mejor concordancia separando al grupo en normopeso-sobrepesovs. obesidad (85,3%), aunque la sensibilidad y especificidad fueron más homogéneas con el ICC ≥ 0,85.Conclusión: el IMC no logra identificar las variaciones de la adiposidad corporal en mujeres con SM agrupadas según su estado nutricional. El IMC presenta mejor sensibilidad que especificidad respecto a los índices considerados para determinar riesgo cardiometabólico en mujeres con SM.

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population

PubMed Central

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aldrete, Maria Elena Aguilar; Oregon-Romero, Edith; Mercado, Monica Vazquez-Del; Navarro-Hernandez, Rosa-Elena

2012-01-01

Purpose Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. Subjects and methods In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. Results sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson’s r = −0.169 to −0.465) were found. Conclusion In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels. PMID:23118546

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population.

PubMed

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aguilar Aldrete, Maria Elena; Oregon-Romero, Edith; Vazquez-Del Mercado, Monica; Navarro-Hernandez, Rosa-Elena

2012-01-01

Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson's r = -0.169 to -0.465) were found. In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels.

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Moléculas orgánicas obtenidas en simulaciones experimentales del medio interestelar.

NASA Astrophysics Data System (ADS)

Muñoz-Caro, Guillermo Manuel

Las nubes moleculares son regiones de formación de estrellas, con temperaturas cinéticas entre 10-50 K y densidades de 103-106 átomos cm-3. Su materia está formada por gas y polvo interestelar. Estas partículas de polvo están cubiertas por una fina capa de hielo, de unos 0.01 μm, que contiene H2O y a menudo CO, CO2, CH3OH y NH3. El hielo es presumiblemente irradiado por fotones ultravioleta y rayos cósmicos en las zonas poco profundas de las nubes moleculares y las regiones circunestelares. En un sistema de vacío, P ˜ 10-7 mbar, simulamos la deposición de hielo a partir de 10 K y la irradiación ultravioleta por medio de una lámpara de descarga de hidrógeno activada con microondas. La evolución del hielo se observa por medio de un espectrómetro infrarrojo. De este modo es posible determinar la composición del hielo observado en el medio interestelar y predecir la presencia de moléculas aún no detectadas en el espacio, que han sido producto del procesamiento del hielo en nuestros experimentos. También es posible calentar el sistema hasta temperatura ambiente para sublimar el hielo depositado. Cuando el hielo ha sido previamente irradiado, se observa un residuo compuesto por moléculas orgánicas complejas, algunas prebióticas, como varios ácidos carboxílicos, aminas, amidas, ésteres y en menor proporción moléculas heterocíclicas y aminoácidos. Algunas de estas moléculas podrían detectarse en estado gaseoso por medio de observaciones milimétricas y de radio. También podrían estar presentes en el polvo cometario, cuyo análisis químico está planeado por las misiones Stardust y Rosetta. Mientras tanto, nuestro grupo está llevando a cabo el análisis de partículas de polvo interplanetario (IDPs), algunas de las cuales pueden ser de origen cometario. Al igual que ocurre con los productos obtenidos por irradiación del hielo en nuestros experimentos, algunas IDPs son ricas en material orgánico que contiene oxígeno.

Acerca del moho

EPA Pesticide Factsheets

El moho forma parte del medio ambiente natural. Afuera del hogar, el moho juega un papel en la naturaleza al desintegrar materias organicas tales como las hojas que se han caido o los arboles muertos. El moho puede crecer adentro del hogar cuando las espor

Produccion Gaseosa del Cometa Halley: Erupciones Y Fotodisociacion del Radical OH

NASA Astrophysics Data System (ADS)

Silva, A. M.; Mirabel, I. F.

1990-11-01

RESUMEN:En este trabajo informamos la detecci6n de 20 erupciones en la li'nea de =18cm (1667MHz) del radical OH en el Cometa Halley.Las observaciones incluyen todos los monitoreos existentes y se extienden desde 120 dias antes del perihelio hasta 90 dias despues.Se detectan bruscos crecimientos en el flujo medido,hasta un factor 1O,seguidos por decaimientos lentos asociados con la fotodisociaci6n del OH. Se obtuvieron valores para el tiempo de vida fotoquimico del OH y del H2O basandose en el modelo desarrollado previamente por Silva(1988). Esos tiempos de vida estan de acuerdo con predicciones teoricas y con las observaciones en el Ultravioleta, y los resultados, los que son fuertemente dependientes de la velocidad heliocentrica del Coineta (variando hasta un factor 6), han sido calculados para varios rangos de velocidad entre +28 y -28 km/seg. Key wo'L :

The Armed Forces and the Fight against Drug-Trafficking in Honduras (Las FUERZAS ARMADAS EN EL COMBATE AL NARCOTR FICO EN HONDURAS)

DTIC Science & Technology

2013-06-13

Estado Mayor del Ejército de EE. UU. En cumplimiento parcial de los requisitos para la obtención del grado de MAESTRÍA EN CIENCIAS Y ARTES MILITARES...Estudios Generales Por WALTER D. HERNANDEZ CARVAJAL, MAYOR DEL EJÉRCITO DE HONDURAS Licenciado en Ciencias Militares...Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 ii MAESTRÍA EN ARTES Y CIENCIAS MILITARES PÁGINA DE APROBACIÓN DE LA TESIS Nombre del

Distribution and persistence of sterile screwworms (Diptera: Calliphoridae) released at the Panama-Colombia border

USDA-ARS?s Scientific Manuscript database

The sterile insect technique is currently used by the Comisión Panamá - Estados Unidos para la Erradicación y Prevención del Gusano Barrenador del Ganado (COPEG) to maintain a barrier at the border between Panama and Colombia that prevents screwworms, Cochliomyia hominivorax (Coquerel), from South A...

Los bosques de Puerto Rico, 2009

Treesearch

Humfredo Marcano Vega; Thomas J. Brandeis; Jeffery A. Turner; No Other

2015-01-01

Este informe presenta los resultados del cuarto inventario forestal de las islas del Estado Libre Asociado de Puerto Rico. El área de bosque en la isla grande de Puerto Rico se mantuvo constante o aumentó ligeramente del año 2004 al 2009. Este cambio parece indicar que la tasa de incremento de cubierta forestal en la isla grande de Puerto Rico ha disminuido desde que...

Estudio ab initio del mecanismo de la reacción HSO + O3

NASA Astrophysics Data System (ADS)

Nebot Gil, I.

La reacción entre el radical HSO y el ozono ha sido ampliamente estudiada desde el punto de vista experimental debido a la importancia que tiene el radical HSO en la oxidación de los compuestos de azufre reductores y a que puede contribuir a la producción de H2SO4 [1-4]. Se realizaron diversos estudios teóricos sobre la cinética de la reacción entre el radical HSO y el ozono. La reacción del HSO con el ozono presenta tres canales diferentes : HSO + O3 &rightarrow &HSO2 + O2 &rightarrow &HS + 2 O2 &rightarrow &SO + OH + O2 La controversia existente entre los grupos experimentales sobre cuál de las tres vías es la predominante, se ha resuelto mediante un estudio teórico de todas ellas utilizando métodos ab initio. La estructura de todos los reactivos, productos, intermedios y estados de transición ha sido optimizada a nivel ab initio utilizando los métodos UMP2 /6-31G** y QCISD/6-31G**.

Impact of genetic variants of IL-6, IL6R, LRP5, ESR1 and SP7 genes on bone mineral density in postmenopausal Mexican-Mestizo women with obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia

2013-10-10

Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations.

PubMed

Cardoso-Saldaña, G; De La Peña-Díaz, A; Zamora-González, J; Gomez-Ortega, R; Posadas-Romero, C; Izaguirre-Avila, R; Malvido-Miranda, E; Morales-Anduaga, M E; Anglés-Cano, E

2006-01-01

Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin binding with plasminogen, inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a) have been reported in several populations. The study examined the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin binding by immuno-enzymatic assay and short tandem repeat (STR) polymorphic marker genetic analysis by capillary electrophoresis. Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg dL(-1)) relative to Mazahuas (8.2 mg dL(-1)), Mayas (8.25 mg dL(-1)) and Mayos (6.5 mg dL(-1)). Phenotype distribution was different in Mayas and Mazahuas as compared with the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in the Native Mexican and the Mestizo group.

Genetic structure and forensic parameters of 38 Indels for human identification purposes in eight Mexican populations.

PubMed

Martínez-Cortés, G; Gusmão, L; Pereira, R; Salcido, V H; Favela-Mendoza, A F; Muñoz-Valle, J F; Inclán-Sánchez, A; López-Hernández, L B; Rangel-Villalobos, H

2015-07-01

Insertion-deletions for human identification purposes (HID-Indels) offer advantages to solve particular forensic situations and complex paternity cases. In Mexico, admixed population known as Mestizos is the largest (∼90%), plus a number of Amerindian groups (∼10%), which have not been studied with HID-Indels. For this reason, allele frequencies and forensic parameters for 38 HID-Indels were estimated in 531 unrelated individuals from one Amerindian (Purépecha) and seven Mestizo populations from different regions of the country. Genotype distribution was in agreement with Hardy-Weinberg expectations in almost all loci/populations. The linkage disequilibrium (LD) test did not reveal possible associations between loci pairs in all eight Mexican populations. The combined power of discrimination was high in all populations (PD >99.99999999998%). However, the power of exclusion of the 38 HID-Indel system (PE >99.6863%) was reduced regarding most of autosomal STR kits. The assessment of genetic structure (AMOVA) and relationships between populations (FST) demonstrated significant differences among Mexican populations, mainly of the Purépecha Amerindian group. Among Mexican-Mestizos, three population clusters consistent with geography were defined: (i) North-West region: Chihuahua, Sinaloa, and Jalisco; (ii) Central-Southern region: Mexico City, Veracruz and Yucatan; (iii) South region: Chiapas. In brief, this report validates the inclusion of the 38 HID-Indel system in forensic casework and paternity cases in seven Mexican-Mestizo populations from different regions, and in one Mexican Amerindian group. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Analysis of ancestry informative markers in three main ethnic groups from Ecuador supports a trihybrid origin of Ecuadorians.

PubMed

Santangelo, Roberta; González-Andrade, Fabricio; Børsting, Claus; Torroni, Antonio; Pereira, Vania; Morling, Niels

2017-11-01

Ancestry inference is traditionally done using autosomal SNPs that present great allele frequency differences among populations from different geographic regions. These ancestry informative markers (AIMs) are useful for determining the most likely biogeographic ancestry or population of origin of an individual. Due to the growing interest in AIMs and their applicability in different fields, commercial companies have started to develop AIM multiplexes targeted for Massive Parallel Sequencing platforms. This project focused on the study of three main ethnic groups from Ecuador (Kichwa, Mestizo, and Afro-Ecuadorian) using the Precision ID Ancestry panel (Thermo Fisher Scientific). In total, 162 Ecuadorian individuals were investigated. The Afro-Ecuadorian and Mestizo showed higher average genetic diversities compared to the Kichwa. These results are consistent with the highly admixed nature of the first two groups. The Kichwa showed the highest proportion of Native Amerindian (NAM) ancestry relative to the other two groups. The Mestizo had an admixed ancestry of NAM and European with a larger European component, whereas the Afro-Ecuadorian were highly admixed presenting proportions of African, Native Amerindian, and European ancestries. The comparison of our results with previous studies based on uniparental markers (i.e. Y chromosome and mtDNA) highlighted the sex-biased admixture process in the Ecuadorian Mestizo. Overall, the data generated in this work represent one important step to assess the application of ancestry inference in admixed populations in a forensic context. Copyright © 2017 Elsevier B.V. All rights reserved.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations

PubMed Central

Cardoso-Saldaña, Guillermo; De La Peña-Díaz, Aurora; Zamora-González, José; Gomez-Ortega, Rocio; Posadas-Romero, Carlos; Izaguirre-Avila, Raul; Malvido-Miranda, Elsa; Morales-Anduaga, Maria Elena; Angles-Cano, Eduardo

2006-01-01

Background Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin-binding with plasminogen inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a), have been reported in several populations. Aim To study the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. Methods We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin-binding by immuno-enzymatic assay and STR polymorphic markers genetic analysis by capillary electrophoresis. Results Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg/dL) relative to Mazahuas (8.2 mg/dL), Mayas (8.25 mg/dL) and Mayos (6.5 mg/dL). Phenotype distribution was different in Mayas and Mazahuas as compared to the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. Conclusion There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in Native Mexican and the Mestizo group. PMID:16684693

Determinacion del error sistematico del momentum de muones producidos por interacciones neutrino-nucleon en el detector MINER$$\

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diaz Bautista, Gonzalo A.

El Modelo Estandar describe todas las partculas observadas en el naturaleza hasta el momento as como las caractersticas que gobiernan a las interacciones fundamentales entre ellas. En especial es posible identicar a las interacciones electromagnetica y debil, las cuales bajo determinadas condiciones de temperatura y energa pueden ser descritas a traves de una sola teora que engloba a ambas. A esta teora se le denomina electrodebil y tiene como nalidad caracterizar las propiedades de la interaccion maniesta a partir de la mezcla de las interacciones electromagnetica y debil, la que tambien lleva como nombre interaccion electrodebil. Particularmente, los neutrinos sonmore » de especial interes ya que, por un lado, interactuan por medio de la interaccion debil muy raramente en comparacion con otras partculas y, por el otro, no son acertadamente descritos por el Modelo Estandar. Por medio de observaciones experimentales que demostraban que los neutrinos cambian de sabor al propagarse, fenomeno llamado oscilaciones de neutrinos, se pudo llegar a la conclusion de que la implicancia de este fenomeno da como consecuencia que los neutrinos efectivamente s tienen masa, algo que entra en contradiccion con la descripcion inicial del Modelo Estandar, el cual los describe como partculas sin masa. Es de esta manera que las oscilaciones de neutrinos han sido y siguen siendo en la actualidad objeto de interes en la Fsica de Altas Energas tanto teorica como experimental. A n de poder realizar mediciones precisas de oscilaciones de neutrinos, los experimentos encargados de estas mediciones deben tratar de reducir sus incertidumbres en lo posible. Una de estas proviene de la caracterizacion de las secciones de choque de los neutrinos cuando interactuan con la materia, particularmente los nucleones al interior de los nucleos atomicos. El experimento MINERA esta orientado, entre otras cosas, a hacer una correcta caracterizacion de secciones de choque neutrino-nucleon por medio del

Radio-Observaciones del OH EN la Coma del Cometa Halley Desde EL Hemisferio Sur

NASA Astrophysics Data System (ADS)

Silva, A. M.; Bajaja, E.; Morras, R.; Cersosimo, J. C.; Martin, M. C.; Arnal, E. M.; Poppel, W. G. L.; Colomb, F. R.; Mazzaro, J.; Olalde, J. C.; Boriakoff, V.; Mirabel, I. F.

1987-05-01

Se utilizó una antena de 30 metros del Instituto Argentino de Radioastronomía para observaciones diarias Cf ebrero a abril de 1986) de la transición en 1667 MHz ( λ = 18 cm) del OH en la coma del cometa Halley. De las observaciones realizadas se concluye: 1) El número promedio de moléculas de OH en la coma durante 37 días de observación fue de (8.9±3.5)x1034 moléculas, lo que implica una tasa de producción promedio de OH de 1.8x1029 moléculas seg-1 y consecuentemente una pérdida de masa promedio de 17±6 toneladas seg-1 . Este valor está de acuerdo con las mediciones realizadas por las sondas Vega y Giotto. 2) El monitoreo desde el lAR revela la existencia de variaciones bruscas en los flujos de absorción del OH. Estas variaciones son consistentes con los modelos que representan la producción gaseosa a partir de ejecciones y/o desprendimientos discretos de materia congelada del núcleo. 3) Las variaciones en la densidad de flujo son consistentes con las estimaciones de los tiem- pos de vida medios del H2O y del OH en presencia del campo de radiación solar. 4) Se encuentra una correlación entre la intensidad del flujo absorbido y anisotropías en Ia dinamica de la coma.

Contribution of Common Genetic Variants to Obesity and Obesity-Related Traits in Mexican Children and Adults

PubMed Central

Villalobos-Comparán, Marisela; Villarreal-Molina, Teresa; Romero-Hidalgo, Sandra; López-Contreras, Blanca; Gutiérrez-Vidal, Roxana; Vega-Badillo, Joel; Jacobo-Albavera, Leonor; Posadas-Romeros, Carlos; Canizalez-Román, Adrián; Río-Navarro, Blanca Del; Campos-Pérez, Francisco; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel

2013-01-01

Background Several studies have identified multiple obesity-associated loci mainly in European populations. However, their contribution to obesity in other ethnicities such as Mexicans is largely unknown. The aim of this study was to examine 26 obesity-associated single-nucleotide polymorphisms (SNP) in a sample of Mexican mestizos. Methods 9 SNPs in biological candidate genes showing replications (PPARG, ADRB3, ADRB2, LEPR, GNB3, UCP3, ADIPOQ, UCP2, and NR3C1), and 17 SNPs in or near genes associated with obesity in first, second and third wave GWAS (INSIG2, FTO, MC4R, TMEM18, FAIM2/BCDIN3, BDNF, SH2B1, GNPDA2, NEGR1, KCTD15, SEC16B/RASAL2, NPC1, SFRF10/ETV5, MAF, PRL, MTCH2, and PTER) were genotyped in 1,156 unrelated Mexican-Mestizos including 683 cases (441 obese class I/II and 242 obese class III) and 473 normal-weight controls. In a second stage we selected 12 of the SNPs showing nominal associations with obesity, to seek associations with quantitative obesity-related traits in 3 cohorts including 1,218 Mexican Mestizo children, 945 Mexican Mestizo adults, and 543 Indigenous Mexican adults. Results After adjusting for age, sex and admixture, significant associations with obesity were found for 6 genes in the case-control study (ADIPOQ, FTO, TMEM18, INSIG2, FAIM2/BCDIN3 and BDNF). In addition, SH2B1 was associated only with class I/II obesity and MC4R only with class III obesity. SNPs located at or near FAIM2/BCDIN3, TMEM18, INSIG2, GNPDA2 and SEC16B/RASAL2 were significantly associated with BMI and/or WC in the combined analysis of Mexican-mestizo children and adults, and FTO locus was significantly associated with increased BMI in Indigenous Mexican populations. Conclusions Our findings replicate the association of 8 obesity-related SNPs with obesity risk in Mexican adults, and confirm the role of some of these SNPs in BMI in Mexican adults and children. PMID:23950976

Mexico’s National Security Challenges and the Military Endeavor

DTIC Science & Technology

2013-03-01

liberalizing the economy) and on global economic integration. 11 So for a long time, political and economic considerations were the main priorities of...Constitucion Politica de los Estados Unidos Mexicanos, art 89 fracc. X Camara de Diputados del H. Congreso de la Union (Mexico: D.F. Gobierno de la...Convert Action Quarterly, No. 59 (Winter 1996-1997): 43. 8 Contitucion Politica de los Estados Unidos Mexicanos, art. 89 fracc. VI, 86. 9 Hernandez

Espectroscopia del Cometa Halley

NASA Astrophysics Data System (ADS)

Naranjo, O.; Fuenmayor, F.; Ferrin, L.; Bulka, P.; Mendoza, C.

1987-05-01

Se reportan observaciones espectroscópicas del cometa Halley. Los espectros fueron tomados usando el espectrógrafo del telescopio reflector de 1 metro del Observatorio Nacional de Venezuela. Se utilizó óptica azul, con una red de difracción de 600 lineas/min, obteniéndose una dispersión de 74.2 A/mm y una resolución de 2.5 A, en el rango espectral de 3500 a 6500 A. Seis placas fueron tomadas con emulsión IIa-O y dos con IIa-D. Los tiempos de exposición fueron entre 10 y 150 minutos. El cometa se encontraba entre 0.70 y 1.04 UA del Sol, y entre 1.28 y 0.73 UA de la Tierra. Las emisiones más prominentes en el espectro, son las del CN, C2, y C3. Otras emisiones detectadas corresponden a CH, NH2 y Na. Los espectros muestran un fuerte continuo, indicando un contenido significativo de polvo. Se detectó mayor intensidad del contínuo, en la dirección anti solar, lo cual es evidencia de la cola de polvo.

[Not Available].

PubMed

Curilem Gatica, Cristian; Almagià Flores, Atilio; Rodríguez Rodríguez, Fernando; Yuing Farias, Tuillang; Berral de la Rosa, Francisco; Martínez Salazar, Cristian; Jorquera Aguilera, Carlos; Bahamondes Ávila, Carlos; Soís Urra, Patricio; Cristi Montero, Carlos; Bruneau Chávez, José; Pinto Aguilante, Juan; Niedmann Brunet, Luis

2016-06-30

El índice de masa corporal (IMC) otorga uno de los índices más usados para determinar el estado nutricional de la población a nivel mundial, donde a pesar de existir recomendaciones claras y definidas para su interpretación como el sexo, edad, raza, entre otros, normalmente se estandariza su clasificación, independiente de las variables, aumentando el error en el resultado y en la clasificación del estado nutricional.El uso de la composición corporal a través de la antropometría entrega mayor información que el IMC, siendo la masa grasa y la masa muscular los principales resultados útiles.Este artículo presenta una revisión de las ecuaciones existentes y propone aquellas más simples y con menor error de estimación para ser usadas como una herramienta que reemplace o complemente al IMC, favoreciendo una mejor comprensión e interpretación del estado nutricional y nivelde actividad física en niños y adolescentes.

Intertextual Sexual Politics: Illness and Desire in Enrique Gomez Carrillo's "Del amor", "del dolor y del vicio" and Aurora Caceres's "La rosa muerta"

ERIC Educational Resources Information Center

LaGreca, Nancy

2012-01-01

This study explores the intertextuality between Aurora Caceres's "La rosa muerta" (1914) and the novel "Del amor, del dolor y del vicio" (1898) by her ex-husband, Enrique Gomez Carrillo. Caceres strategically mentions Gomez Carrillo's novel in "La rosa muerta" to invite a reading of her work in dialogue with his. Both narratives follow the sexual…

Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

PubMed

Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

2016-11-03

Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

[Not Available].

PubMed

Flores Navarro-Pérez, Carmen; González-Jiménez, Emilio; Schmidt-RioVilla, Jacqueline; Meneses-Echávez, José Francisco; Correa-Bautista, Jorge Enrique; Correa-Rodríguez, María; Ramírez-Vélez, Robinson

2016-07-19

Objetivos: los objetivos de este estudio fueron analizar el nivel nutricional en una población de niños y adolescentes colombianos y determinar la posible relación entre el nivel nutricional y el estado nutricional según el índice de masa corporal (IMC) y la circunferencia de cintura (CC).Material y métodos: estudio transversal en 6.383 niños y adolescentes de entre 9 y 17,9 años de edad, de Bogotá, Colombia. Se aplicó de manera autodiligenciada el cuestionario Krece Plus validado en el estudio enKid como indicador del nivel nutricional con las categorías alto (test ≥ 9), medio (test 6-8) y bajo (test ≤ 5). Se tomaron medidas de peso, talla, CC, y se calculó el IMC como marcadores del estado nutricional.Resultados: de la población general, el 57,9% eran chicas (promedio de edad 12,7 ± 2,3 años). En todas las categorías del IMC, más del 50% de chicos y chicas siguen una dieta de muy baja calidad, que empeora progresivamente con el avance en edad. En ambos sexos, se observaron tendencias entre un nivel nutricional muy bajo con el desarrollo de sobrepeso. Asimismo, la obesidad abdominal por CC se relacionó con una puntuación baja en el Krece Plus en ambos sexos.Conclusiones: en escolares de Bogotá, una dieta de muy baja calidad se relacionó con alteraciones del estado nutricional (IMC y CC), especialmente entre chicas y adolescentes. Estos resultados deben alentar el desarrollo de intervenciones orientadas a mejorar los hábitos nutricionales entre los escolares colombianos.

PubMed

Rodríguez-Villalba, Luisa Fernanda; Ramírez-Vélez, Robinson; Correa-Bautista, Jorge Enrique

2016-09-20

Objetivo: el propósito del estudio fue relacionar la etapa en el cambio en el comportamiento frente a la actividad física y el estado nutricional en escolares de Bogotá, Colombia, pertenecientes al estudio FUPRECOL.Método: se trata de un estudio transversal, realizado en 8.000 niños y adolescentes de entre 9 y 17 años, pertenecientes a 24 instituciones educativas. Se aplicó de manera autodiligenciada el cuestionario de cambio de comportamiento en función de la intención de realizar actividad física (CCC-FUPRECOL) y se midió el peso y la estatura para determinar el estado nutricional con el índice de masa corporal (IMC).Resultados: el porcentaje de respuesta fue del 82,5% y se consideraron válidos 6.606 registros, siendo el 58,3% (n = 3.850) niñas, con un promedio de edad de 12,7 ± 2,3 años. En la población general, el 5,3% de los escolares se encontraba en etapa de precontemplación, el 31,8% en contemplación, el 26,7% en acción y el 36,2% en etapa de mantenimiento. Al comparar la etapa de cambio con el estado nutricional por IMC, los escolares clasificados como obesos mostraron mayor frecuencia de respuesta en la etapa de precontemplación, mientras que los escolares con peso saludable acusaron mayores porcentajes en la etapa de mantenimiento.Conclusión: en escolares de Bogotá, Colombia, se encontró una relación estadísticamente significativa entre la intención de realizar actividad con el estado nutricional medido con el IMC. Fomentar la promoción de la actividad física y monitorizar el estado nutricional deberá ser una prioridad en las agendas y políticas públicas dentro del ámbito escolar.

?`Es necesario calcular detalladamente funciones de partición atómicas?

NASA Astrophysics Data System (ADS)

Milone, L. A.; Merlo, D. C.

Basándonos en extensos y precisos cómputos de funciones de partición realizados por nosotros para distintos átomos, se muestra que en el cálculo u obtención de ciertas magnitudes (notablemente la presión electrónica, la abundancia de un elemento deducida a partir de un estado fuertemente ionizado, etc.) el error porcentual que se comete es pequeño (inferior a 1 %) si se adopta, como valor de la función de partición, el peso estadístico del término correspondiente al estado fundamental del átomo. Esta notable simplificación acelera el cálculo, por ejemplo, de un modelo de atmósfera estelar, sin disminuir la precisión de los resultados.

Implementation Of A Marine Altimeter Calibration Campaign In The Area Of Ibiza Island

NASA Astrophysics Data System (ADS)

Martinez-Benjamin, Juan Jose; Bravo, Rogelio Lopez; Gomez, Begona Perez; Ripoll, Josep Gili; Gomez, Ana Tapia; Gonzalez, Juan Carlos; Conde, Mercedes Sanz; Gracia, Carlos

2013-12-01

Sea level monitoring geodetic improvements has been made in specific coastal Spanish sites as Ibiza harbour. At Ibiza site new measurements and levelling between the GPS reference station and a radar MIROS tide gauge, both from Puertos del Estado, has been made in the last years. The goal is to maintain and improve the quality of the observation of the sea level. The information is coming from Puertos del Estado www.puertos.es. The presentation is directed mainly to the description of the actual situation of the Ibiza site in preparation for a new altimeter calibration marine campaign of Jason-2 and Saral/AltiKa satellites to be made in September 2013. A description of the two geometric levelling campaigns made in June and September 2013 is included.

Conceptos Basicos Sobre el Propano (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

El propano provee energia a mas de 143.000 vehiculos en los Estados Unidos y 23 millones en todo el mundo. Flotas de todos los Estados Unidos han implementado con exito el uso de vehiculos que funcionan con gas propano, y en la actualidad varios funcionan gracias a este gas, incluyendo autobuses escolares, lanzaderas y autobuses publicos, asi como tambien furgonetas, taxis, vehiculos utilizados por las fuerzas del orden, barredoras de calles y camiones para uso profesional. El propano tambien se utiliza con frecuencia en aplicaciones fuera de la carretera, tales como montacargas, podadoras y equipos de uso profesional y otrosmore » equipos agricolas. Las ventajas del propano incluyen la disponibilidad interna, su rendimiento y el hecho de que genera menos emisiones de gases contaminantes que otras alternativas energeticas.« less

PubMed

Martínez Carrión, José Miguel; Cámara, Antonio D; Pérez-Castroviejo, Pedro María

2016-12-12

Objetivo: analizar la geografía del estado nutricional en España y su evolución entre mediados del siglo xixy comienzos del siglo xx, etapa previa a la transición nutricional con alta prevalencia de malnutrición.Métodos: se utilizan datos antropométricos agregados (promedios provinciales de estatura) del reclutamiento militar en 1858 y 1913, así como promedios provinciales de estatura y peso procedentes de una revisión realizada entre 119.571 soldados en 1903-1906. Con estos datos se elaboran cartografía y estadísticos descriptivos.Resultados: los parámetros antropométricos de los españoles se situaban entre los valores de complexión más bajos de Europa antes de la transición nutricional. Entre 1858 y 1913, la altura media creció solo 1,43 cm. En ese periodo hubo cambios significativos en la geografía antropométrica marcados por la configuración de una polaridad nutricional a las puertas de la I Guerra Mundial: las provincias del centro y del sur de país exhiben mayor incidencia de la malnutrición crónica que las provincias del arco Noreste, que disfrutan de ventaja relativa en términos nutricionales.Conclusión:las desigualdades territoriales que configuraron una geografía polarizada del estado nutricional en España pueden asociarse en parte a los cambios ambientales del periodo, caracterizados por el inicio de la modernización y la industrialización y, asimismo, por la privación derivada de las crisis agrarias, las enfermedades y el relativo atraso tecnológico. Se destaca la relevancia de la historia antropométrica para el estudio de los niveles de vida en poblaciones del pasado y del proceso de transición nutricional.

High Rate of Infection by Only Oncogenic Human Papillomavirus in Amerindians.

PubMed

Vargas-Robles, Daniela; Magris, Magda; Morales, Natalia; de Koning, Maurits N C; Rodríguez, Iveth; Nieves, Tahidid; Godoy-Vitorino, Filipa; Sánchez, Gloria I; Alcaraz, Luis David; Forney, Larry J; Pérez, María-Eglée; García-Briceño, Luis; van Doorn, Leen-Jan; Domínguez-Bello, María Gloria

2018-06-27

Human papillomavirus (HPV), an etiological agent of cervical cancer (CC), has infected humans since ancient times. Amerindians are the furthest migrants out of Africa, and they reached the Americas more than 14,000 years ago. Some groups still remain isolated, and some migrate to towns, forming a gradient spanning urbanization. We hypothesized that, by virtue of their history, lifestyle, and isolation from the global society, remote Amerindian women have lower HPV diversity than do urban women (Amerindian or mestizo). Here we determined the diversity of the 25 most relevant cervical HPV types in 82 Amerindians spanning urbanization (low, medium, and high, consistent with the exposure to urban lifestyles of the town of Puerto Ayacucho in the Venezuelan Amazonas State), and in 29 urban mestizos from the town. Cervical, anal, oral, and introitus samples were taken, and HPVs were typed using reverse DNA hybridization. A total of 23 HPV types were detected, including 11 oncogenic or high-risk types, most associated with CC. Cervical HPV prevalence was 75%, with no differences by group, but Amerindians from low and medium urbanization level had significantly lower HPV diversity than mestizos did. In Amerindians, but not in mestizos, infections by only high-risk HPVs were higher than coinfections or by exclusively low-risk HPVs. Cervical abnormalities only were observed in Amerindians (9/82), consistent with their high HPV infection. The lower cervical HPV diversity in more isolated Amerindians is consistent with their lower exposure to the global pool, and transculturation to urban lifestyles could have implications on HPV ecology, infection, and virulence. IMPORTANCE The role of HPV type distribution on the disparity of cervical cancer (CC) incidence between human populations remains unknown. The incidence of CC in the Amazonas State of Venezuela is higher than the national average. In this study, we determined the diversity of known HPV types (the viral agent of CC

Prevalence of the metabolic syndrome and its correlation with the cardiovascular health status in stroke- and ischemic heart disease-free Ecuadorian natives/mestizos aged ≥40 years living in Atahualpa: a population-based study.

PubMed

Del Brutto, Oscar H; Zambrano, Mauricio; Peñaherrera, Ernesto; Montalván, Martha; Pow-Chon-Long, Freddy; Tettamanti, Daniel

2013-01-01

Epidemiologic studies assessing cardiovascular risk factors affecting a given population may prove cost-effective to reduce the burden of cardiovascular diseases in the developing world. We evaluated the prevalence of the metabolic syndrome in Atahualpa, a village representative of rural coastal Ecuador. Prevalence of the metabolic syndrome and its correlation with the cardiovascular (CVH) status was assessed in a door-to-door survey performed in stroke- and ischemic heart disease-free Ecuadorian native/mestizos aged ≥40 years. The metabolic syndrome was diagnosed in 288 (55.7%) out of 517 persons. Worst individual components were: increased waist circumference (75%), increased fasting glucose (68.1%) and high blood pressure (56.5%). Prevalence of individual components of this condition varied according to age, gender, education, and alcohol intake. However, no differences were found in the odds for having the metabolic syndrome when persons were stratified according to these parameters. A poor CVH status was found in 80.2% persons with and in 55.9% without the metabolic syndrome (p<0.0001). Prevalence of the metabolic syndrome in Atahualpa is high. Most persons with the metabolic syndrome also have a poor CVH status. However, sizable subsets only have either the metabolic syndrome or a poor CVH status. Stratification of cardiovascular risk according to whether the person has both, one, or none of these two sets of risk factors would be of value to evaluate if the metabolic syndrome, a poor CVH status or the combination of both, better predict the occurrence of vascular outcomes in the long-term follow-up. Copyright © 2013 Diabetes India. Published by Elsevier Ltd. All rights reserved.

[Homocysteinemia and its relationship with the methylentetrahydrofolate reductase polymorphism in various ethnic groups from western Venezuela].

PubMed

Vizcaíno, Gilberto; Diez-Ewald, María; Herrmann, Falko H; Schuster, Gudrun; Torres-Guerra, Enrique; Arteaga-Vizcaíno, Melvis

2005-12-01

The prevalence of hyperhomocysteinemia and C677T MTHFR polymorphism was studied in various ethnic groups from Western Venezuela (60 Wayuu Indians, 42 italian immigrants and 77 Venezuelan mestizos) in relation with the prevalence of hyperhomocysteinemia and the C677T MTHFR polymorphism. Homocysteinemia was determined by polarized fluorescence immunoassay in an IMX system, serum folate was measured by radioimmunoanalysis and the MTHFR genotype was determined by PCR and restriction analysis. Hyperhomocysteinemia was defined as a value over 2 SD above the mean value for normal MTHFR (CC677) in each group. The prevalence of MTHFR variants (C677T and 677TT) was elevated in all ethnic groups (78% among the wayuu, 76% among Italians and 63% among mestizos) with a significant association between the concentrations of homocysteine and the levels of serum folate among the wayuu (p < 0.0001) and the mestizos (p < 0.001) only. Hyperhomocysteinemia was associated with MTHFR variants in 23% of the wayuu (OR: 6.17, CI 95: 0.74-51.36), 9.5% of the Italians (OR: 0.93, CI 95: 0.085-10.10) and 20.7 of the Venezuelans mestizos (OR: 5.2, CI 95: 1.08-24.90, p > 0.03). There was no relationship between hyperhomocysteinemia and folate deficiency in any of the groups studied. In conclusion, despite a high prevalence of C677T MTHFR variants in these ethnic groups of western Venezuela, the lack of no evidence of hyperhomocysteinemia combined with folate deficiency may imply that the nutritional status of these groups plays an important role in the control of hyperhomocysteinemia as a risk factor for cardiovascular disease.

Evaluacion de los recursos potenciales del petroleo y gas, en Centro y Suramerica [Evaluation of potential petroleum and gas resources in Central and South America

USGS Publications Warehouse

Schenk, C.S.

2001-01-01

El Servicio Geológico de los Estados Unidos (USGS, por sus siglas en inglés) completó recientemente un estudio evaluativo de recursos potenciales de petróleo y gas en 130 provincias de petróleo seleccionadas en diferentes partes del mundo (USGS, 2000). De estas 130 provincias, 23 se encuentran en Suramérica, Centroamérica, y la región del Caribe (fig. 1). El estudio comprendió desde las provincias de petróleo establecidas con un largo historial de producción, como la Cuenca de Maracaibo, hasta las provincias fronterizas de poca o ninguna producción, como la Cuenca de Guyana-Suriname. No todas las provincias con historial de producción o con potencial de producción fueron evaluadas en el Estudio Evaluativo USGS 2000. Al presente, el USGS está evaluando muchas de las provincias restantes de petróleo y gas, en Centro y Suramérica. En cada provincia hemos (1) definido geológicamente el total de los sistemas de petróleo, (2) definido las unidades evaluadas que forman parte de todos los sistemas de petróleo, y (3) evaluado el volumen potencial de petróleo y gas convencional en cada unidad evaluada. Definimos un total de 26 sistemas de petróleo y 55 unidades evaluadas en las 23 provincias

Amylin S20G mutation in Mexican population.

PubMed

Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

2007-04-01

Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

Cultural and social determinants of health among indigenous Mexican migrants in the United States.

PubMed

Lee, Junghee; Donlan, William; Cardoso, Edgar Ezequiel Orea; Paz, Juan Jesus

2013-01-01

Despite growing numbers, indigenous Mexican migrants are relatively invisible to health practitioners who group them with nonindigenous, mestizo Mexican-origin populations. Associations between indigenous and mestizo cultural identifications with psychosocial characteristics and health indicators among indigenous Mexican migrants were examined. Results revealed gender differences in cultural identifications, perceived discrimination, self-esteem, self-efficacy, and various health indicators including depression severity, culture-bound syndromes, and self-rated health. Multivariate regression and structural equation path modeling demonstrated how indigenous cultural identification and perceived discrimination affects health. Findings suggest that interventions should utilize indigenous community-based activities designed to promote self-esteem and the value of indigenous culture, with a focus on females.

Mood Disorders - Multiple Languages

MedlinePlus

... Expand Section Mood Disorders: MedlinePlus Health Topic - English Trastornos del estado de ánimo: Tema de salud de MedlinePlus - español (Spanish) National Library of Medicine Bipolar Disorder (An Introduction) - English PDF Bipolar Disorder (An ...

Gas in the land of Gauchos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelley, T.

The author discusses the natural gas industry in Argentina. Despite a troubled past, Argentina looks toward a future brightened by the growing prominence of natural gas use. A state-run company, Gas del Estado, controls the exploration, production, transmission and distribution of natural gas. Natural gas reserves, measured in tons of oil equivalent, grew from 51 percent of oil reserves in 1970 to 187 percent in 1983. This growth is expected to continue with gas reserves predicted to nearly triple in absolute terms to 70 Tcf, by the turn of the century. This article discusses some of the problems that Argentinamore » has in using its natural gas. The immediate obstacle is one of funds. Gas del Estado has no technical limitations but may be handicapped in its growth by economic and financial problems.« less

Generacion de Nuevas Capacidades en el Ejercito de Guatemala para el Combate al Trafico de Drogas y Delitos Conexos (Generating New Capacities within the Guatemalan Army in Order to Combat Drug Trafficking and Related Crimes)

DTIC Science & Technology

2014-06-13

la pérdida de control territorial por parte del Estado en el tema de seguridad y la poca credibilidad que la sociedad tiene en sus fuerzas...de seguridad civil y segundo: como efecto no buscado de la presión ejercida por el gobierno de Colombia y el de México en alianza con los Estados...naturales y líneas rectas que unen detalles topográficos fijados y descritos en el mismo Laudo. Para la defensa de la seguridad nacional, el Ejército

[Not Available].

PubMed

Sellés, Sergio; Fernández-Sáez, José; López-Lluch, Guillermo; Cejuela, Roberto

2016-02-16

El proceso de formación de futuros deportistas debe ser un trabajo estructurado y planificado para poder alcanzar el máximo nivel deportivo. Es fundamental en este periodo tener presentes los ritmos de desarrollo y maduración de los jóvenes deportistas para así adecuar las cargas de entrenamientos a sus estados evolutivos. El objetivo del estudio fue determinar y analizar la edad morfológica en nadadores y triatletas adolescentes, estableciendo diferencias entre su edad cronológica, grupos y género. A través del método antropométrico se determinó el estado de maduración biológica en un grupo de 37 deportistas jóvenes tecnificados. Los resultados muestran que la mayoría de la muestra (70,8%) se encuentra en un estado avanzado de desarrollo con respecto a su edad cronológica, siendo más notorio en el caso de los nadadores este estado de madurez avanzado. Tener una edad morfológica más avanzada respecto a su edad cronológica podría favorecer a los deportistas adolescentes a la hora de conseguir mejores marcas y resultados en las competiciones y de esta manera acceder con más facilidad a los programas de tecnificación. El índice de desarrollo corporal modificado (IDCm) se presenta como un método validado, fiable y no invasivo para tener presente el grado de desarrollo y maduración en la selección de talentos deportivos y adecuar las cargas de entrenamiento al estado evolutivo de los deportistas.

33 CFR 80.1118 - Marina Del Rey, CA.

Code of Federal Regulations, 2010 CFR

2010-07-01

... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1118 Marina Del Rey, CA. (a) A line drawn from Marina Del Rey Breakwater South Light 1 to Marina Del Rey Light 4. (b) A line drawn from Marina Del Rey... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Marina Del Rey, CA. 80.1118...

33 CFR 80.1118 - Marina Del Rey, CA.

Code of Federal Regulations, 2012 CFR

2012-07-01

... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1118 Marina Del Rey, CA. (a) A line drawn from Marina Del Rey Breakwater South Light 1 to Marina Del Rey Light 4. (b) A line drawn from Marina Del Rey... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Marina Del Rey, CA. 80.1118...

33 CFR 80.1118 - Marina Del Rey, CA.

Code of Federal Regulations, 2013 CFR

2013-07-01

... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1118 Marina Del Rey, CA. (a) A line drawn from Marina Del Rey Breakwater South Light 1 to Marina Del Rey Light 4. (b) A line drawn from Marina Del Rey... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Marina Del Rey, CA. 80.1118...

33 CFR 80.1118 - Marina Del Rey, CA.

Code of Federal Regulations, 2011 CFR

2011-07-01

... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1118 Marina Del Rey, CA. (a) A line drawn from Marina Del Rey Breakwater South Light 1 to Marina Del Rey Light 4. (b) A line drawn from Marina Del Rey... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Marina Del Rey, CA. 80.1118...

33 CFR 80.1118 - Marina Del Rey, CA.

Code of Federal Regulations, 2014 CFR

2014-07-01

... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1118 Marina Del Rey, CA. (a) A line drawn from Marina Del Rey Breakwater South Light 1 to Marina Del Rey Light 4. (b) A line drawn from Marina Del Rey... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Marina Del Rey, CA. 80.1118...

16 CFR 455.5 - Spanish language sales.

Code of Federal Regulations, 2010 CFR

2010-01-01

... pueden darle a usted algunos derechos y hacer que el vendedor resuelva problemas graves que no fueron... implícitas” de acuerdo a la ley del estado pueden concederle derechos adicionales. EC29SE91.053 EC29SE91.054...

Colombia’s Resurrection: Alternative Development is the Key to Democratic Security

DTIC Science & Technology

2004-09-01

regional economic strength. This implies 73 Sesin. 74 Departamento Nacional de Planeación (DNP), Bases del Plan Nacional de Desarrollo “Hacia un...Estado Comunitario .” Page 54 (Web version). 38 that the government is willing to adopt more flexible

Manual del McVCO 1999

USGS Publications Warehouse

McChesney, P.J.

1999-01-01

El McVCO es un generador de frecuencias basado en un microcontrolador que reemplaza al oscilador controlado por voltaje (VCO) utilizado en telemetría analógica de datos sísmicas. Acepta señales de baja potencia desde un sismómetro y produce una señal subportadora modulada en frecuencia adecuada para enlaces telefónicos o vía radio a un lugar remoto de recolección de datos. La frecuencia de la subportadora y la ganancia pueden ser seleccionadas mediante un interruptor. Tiene la opción de poder operar con dos canales para la observación con ganancia alta y baja. El McVCO fue diseñado con el propósito de mejorar la telemetría analógica de las señales dentro de la Pacific Northwest Seismograph Network (PNSN) (Red Sismográfica del Noroeste del Pacífico). Su desarrollo recibió el respaldo del Programa de Geofísica de la Universidad de Washington y del "Volcano Hazards and Earthquake Hazards programs of the United States Geological Survey (USGS) (Programa de Investigaciones de Riesgos Volcánicos y Programa de Investigaciones de Riesgos Sísmicos de los EEUU). Cientos de instrumentos se han construido e instalado. Además de utilizarlo el PNSN, el McVCO es usado por el Observatorio Vulcanológico de Alaska para monitorear los volcanes aleutianos y por el USGS Volcano Disaster Assistance Program (Programa de Ayuda en las Catástrofes Volcánicas del USGS) para responder a crisis volcánicas en otros países. Este manual cubre el funcionamiento del McVCO, es una referencia técnica para aquellos que necesitan saber con más detalle cómo funciona el McVCO, y cubre una serie de temas que requieren un trato explícito o que derivan del despliegue del instrumento.

Ácaros del mango

USDA-ARS?s Scientific Manuscript database

Los ácaros constituyen un grupo abundante y diverso que ocupa diferentes hábitats en árboles frutales y la estructura y disposición del follaje y ramas del mango, contribuyen significativamente a que se presente gran diversidad de ácaros benéficos y dañinos asociados a esta especie frutal. En Colomb...

Metabolic effects of the contraceptive skin patch and subdermal contraceptive implant in Mexican women: A prospective study

PubMed Central

2014-01-01

Background The contraceptive skin patch (CSP) accepted by the U.S. FDA in 2001 includes ethinylestradiol and norelgestromine, whereas the subdermal contraceptive implant (SCI) has etonogestrel and is also approved by the FDA. In Mexico, both are now widely used for contraception but their effects on Mexican population are unknown. The objective of the study was to evaluate if these treatments induce metabolic changes in a sample of indigenous and mestizo Mexican women. Methods An observational, prospective, longitudinal, non-randomized study of women between 18 and 35 years of age assigned to CSP or SCI. We performed several laboratory tests: clinical chemistry, lipid profile, and liver and thyroid function tests. Also, serum levels of insulin, C-peptide, IGF-1, leptin, adiponectin, and C reactive protein were assayed. Results Sixty-two women were enrolled, 25 used CSP (0 indigenous; 25 mestizos) and 37 used SCI (18 indigenous; 19 mestizos). Clinical symptoms were relatively more frequent in the SCI group. Thirty-four contraceptive users gained weight without other clinical significant changes. After 4 months of treatment, significant changes were found in some biochemical parameters in both treatment groups. Most were clinically irrelevant. Interestingly, the percentage of users with an abnormal atherogenic index diminished from 75% to 41.6% after follow-up. Conclusions The CSP slightly modified the metabolic variables. Most changes were nonsignificant, whereas for SCI users changes were more evident and perhaps beneficial. Results of this attempt to evaluate the effects of contraceptives in mestizo and native-American populations show that clinical symptoms are frequent in Mexican users of CSP and SCI. Although these medications may affect some metabolic variables, these changes seem clinically irrelevant. Induction of abnormalities in other physiological pathways cannot be ruled out. PMID:24767248

Factors that enable or limit the sustained use of improved firewood cookstoves: Qualitative findings eight years after an intervention in rural Mexico.

PubMed

Catalán-Vázquez, Minerva; Fernández-Plata, Rosario; Martínez-Briseño, David; Pelcastre-Villafuerte, Blanca; Riojas-Rodríguez, Horacio; Suárez-González, Laura; Pérez-Padilla, Rogelio; Schilmann, Astrid

2018-01-01

The aim of this study was to analyze the factors enabling/limiting the use of improved cookstoves among rural fuel wood users from one mestizo and two indigenous communities eight years after an intervention in the state of Michoacan, in Mexico. A qualitative study with an ethnographic perspective was conducted in 2013/2014 based on 62 interviews with women who had participated in an improved firewood cookstove program in 2005. Thematic qualitative content analysis was performed. Very few women from the indigenous communities were using the improved cookstove at the time of the study; the majority had dismantled or had ceased using it; whereas most of those from the mestizo community were using it for all of their cooking activities. In the indigenous communities, characterized by extended families, uptake of new technology was limited by traditional routine practices, rearrangement of rooms in the house, attachment to the traditional stove, a low- or non-risk perception of woodsmoke; gender relations, insufficient training, non-compliance with program recommendations and design-related aspects. Conversely, in the mestizo community, the uptake of the improved cookstove was favored by routine cooking practices in a nuclear family, a previous use of a raised cookstove and social representations on the health-disease-death effects of woodsmoke vs. the health benefits of cooking with improved stoves. The sociocultural dimension of communities and the cookstove design are aspects that either favor or limit the use of improved cookstoves in indigenous and mestizo populations. Effective cookstove programs must take these elements into account from their early planning stages, and blend them into implementation and follow-up. Project communication, training and differentiated follow-up activities ensuring the operation and maintenance of the cookstove, should be designed according to the specific needs and traditions of each community; they should be based on the

Fragilidad y su asociación con mortalidad, hospitalizaciones y dependencia funcional en mexicanos de 60 años o más

PubMed Central

de León González, Enrique Díaz; Pérez, Héctor Eloy Tamez; Hermosillo, Hugo Gutiérrez; Rodríguez, Javier Armando Cedillo; Torres, Gabriela

2016-01-01

Fundamento y objetivo Determinar la asociación entre fragilidad y mortalidad, dependencia funcional, caídas y hospitalizaciones en el Estudio Nacional de Salud y Envejecimiento en México (ENASEM). Sujetos y métodos Estudio prospectivo poblacional en México en el que se seleccionaron sujetos de 60 años o más, que fueron evaluados en las variables de fragilidad durante la primera vuelta del estudio en el año 2001 y que incluyó: dificultad para levantarse de una silla después de haber estado sentado(a) durante largo tiempo, pérdida de peso de 5 kilogramos o más en los últimos dos años y falta de energía. Los sujetos fueron catalogados como robustos, prefrágiles y frágiles cuando tenían cero, una o dos de las características anteriores, respectivamente. La mortalidad, hospitalizaciones, caídas y dependencia funcional fueron evaluadas en la segunda vuelta del estudio en el año 2003. Se calculó el riesgo relativo para cada una de las complicaciones, así como análisis multivariado con regresión de Cox para el caso de mortalidad y regresión logística para el resto. Resultados Los estados de prefragilidad y fragilidad se asociaron independientemente con mortalidad, con índices de riesgo ajustados de 1,61 (intervalo de confianza del 95% [IC 95%] 1,01-2,55) y 1,94 (IC 95% 1,20-3,13), respectivamente. Sólo el estado de fragilidad se asoció independientemente con hospitalización y dependencia funcional, con una razón de momios ajustada de 1,53 (IC 95% 1,13-2,07) y 3,07 (IC 95% 1,76-5,34), respectivamente. No hubo asociación entre los estados de prefragilidad y fragilidad con caídas. Conclusión El estado de fragilidad se asocia independientemente con mortalidad, hospitalizaciones y disfuncionalidad en actividades básicas de la vida diaria en los siguientes dos años en población mexicana. PMID:21612803

FLOATING COMMUNITIES OF ALGAE IN AN ARTIFICIAL POND IN THE PARQUE DO ESTADO, SÃO PAULO, BRAZIL(1).

PubMed

de Mattos Bicudo, C E; Teixeira Bicudo, R M

1967-12-01

A fresluvater floating algal community was repeatedly observed in an artificial pond in the Parque do Estado São Paulo, Brazil. The ontogeny and composition of the community are discussed and are related to oxygen liberation during photosynthesis of the periphyton, or of the pond-bottom algne, which carries up portions of the algae growing there.

Torres del Paine National Park

NASA Image and Video Library

2017-12-08

Grinding glaciers and granite peaks mingle in Chile’s Torres del Paine National Park. The Advanced Land Imager (ALI) on NASA’s Earth Observing-1 (EO-1) satellite captured this summertime image of the park on January 21, 2013. This image shows just a portion of the park, including Grey Glacier and the mountain range of Cordillera del Paine. The rivers of glacial ice in Torres del Paine National Park grind over bedrock, turning some of that rock to dust. Many of the glaciers terminate in freshwater lakes, which are rich with glacial flour that colors them brown to turquoise. Skinny rivers connect some of the lakes to each other (image upper and lower right). Cordillera del Paine rises between some of the wide glacial valleys. The compact mountain range is a combination of soaring peaks and small glaciers, most notably the Torres del Paine (Towers of Paine), three closely spaced peaks emblematic of the mountain range and the larger park. By human standards, the mountains of Cordillera del Paine are quite old. But compared to the Rocky Mountains (70 million years old), and the Appalachians (about 480 million years), the Cordillera del Paine are very young—only about 12 million years old. A study published in 2008 described how scientists used zircon crystals to estimate the age of Cordillera del Paine. The authors concluded that the mountain range was built in three pulses, creating a granite laccolith, or dome-shaped feature, more than 2,000 meters (7,000 feet) thick. NASA Earth Observatory image created by Jesse Allen and Robert Simmon, using Advanced Land Imager data from the NASA EO-1 team. Caption by Michon Scott. Instrument: EO-1 - ALI View more info: earthobservatory.nasa.gov/IOTD/view.php?id=80266 Credit: NASA Earth Observatory NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA�

Tezacaftor/Ivacaftor in Subjects with Cystic Fibrosis and F508del/F508del-CFTR or F508del/G551D-CFTR.

PubMed

Donaldson, Scott H; Pilewski, Joseph M; Griese, Matthias; Cooke, Jon; Viswanathan, Lakshmi; Tullis, Elizabeth; Davies, Jane C; Lekstrom-Himes, Julie A; Wang, Linda T

2018-01-15

Tezacaftor (formerly VX-661) is an investigational small molecule that improves processing and trafficking of the cystic fibrosis transmembrane conductance regulator (CFTR) in vitro, and improves CFTR function alone and in combination with ivacaftor. To evaluate the safety and efficacy of tezacaftor monotherapy and of tezacaftor/ivacaftor combination therapy in subjects with cystic fibrosis homozygous for F508del or compound heterozygous for F508del and G551D. This was a randomized, placebo-controlled, double-blind, multicenter, phase 2 study (NCT01531673). Subjects homozygous for F508del received tezacaftor (10 to 150 mg) every day alone or in combination with ivacaftor (150 mg every 12 h) in a dose escalation phase, as well as in a dosage regimen testing phase. Subjects compound heterozygous for F508del and G551D, taking physician-prescribed ivacaftor, received tezacaftor (100 mg every day). Primary endpoints were safety through Day 56 and change in sweat chloride from baseline through Day 28. Secondary endpoints included change in percent predicted FEV 1 (ppFEV 1 ) from baseline through Day 28 and pharmacokinetics. The incidence of adverse events was similar across treatment arms. Tezacaftor (100 mg every day)/ivacaftor (150 mg every 12 h) resulted in a 6.04 mmol/L decrease in sweat chloride and 3.75 percentage point increase in ppFEV 1 in subjects homozygous for F508del, and a 7.02 mmol/L decrease in sweat chloride and 4.60 percentage point increase in ppFEV 1 in subjects compound heterozygous for F508del and G551D from baseline through Day 28 (P < 0.05 for all). These results support continued clinical development of tezacaftor (100 mg every day) in combination with ivacaftor (150 mg every 12 h) in subjects with cystic fibrosis. Clinical trial registered with www.clinicaltrials.gov (NCT01531673).

Kurt Gödels Brünner Verwandte

NASA Astrophysics Data System (ADS)

Müller, Dora

2007-11-01

The author of this memoir Dora Müller (born 1920) belongs - as well as Kurt Gödel-to the German minority playing an important role in the past life of Brno. The marriage of his son included her among the Gödels collaterals. She was chemist, but also pianist, historician, participant of antinacist movement and iniciator of Czech-German understanding after war. Following her personal experiences, remembrances of Gödels relatives and documental materials, she evokes the atmosphere of broader family milieu of Kurt Gödel.

A Basis for a Command, Control and Communications (C3) System Architecture for the Argentine Army

DTIC Science & Technology

1990-03-01

needed on the bat- tlefield, Most commanders derive important situational clues by listening to how their subordinates sound in their verbal reports. F...0142 2 Naval Postgraduate School Monterey, CA 93943-5002 3. Estado Mayor General del Ejercito Argentino 5 Direccion de Comunicaciones Azopardo 250

Building Intercultural Competence through Intercultural Competency Certification of Undergraduate Students

ERIC Educational Resources Information Center

Janeiro, Maria G. Fabregas; Fabre, Ricardo Lopez; Nuno de la Parra, Jose Pablo

2014-01-01

The Intercultural Competency Certificate (CCI in Spanish) designed for the Universidad Popular Autonoma del Estado de Puebla (UPAEP University) is a theory based comprehensive plan to develop undergraduate students' intercultural competence. This Certificate is based in the Developmental Model of Intercultural Sensitivity (DMIS) developed by…

The novel c.247_249delTTC (p.F83del) GJB2 mutation in a family with prelingual sensorineural deafness.

PubMed

Petersen, Michael B; Grigoriadou, Maria; Koutroumpe, Maria; Kokotas, Haris

2012-07-01

Non-syndromic hearing loss is one of the most common hereditary determined diseases in human, and the disease is a genetically heterogeneous disorder. Mutations in the GJB2 gene, encoding connexin 26 (Cx26), are a major cause of non-syndromic recessive hearing impairment in many countries and are largely dependent on ethnic groups. Due to the high frequency of the c.35delG GJB2 mutation in the Greek population, we have previously suggested that Greek patients with sensorineural, non-syndromic deafness should be tested for the c.35delG mutation and the coding region of the GJB2 gene should be sequenced in c.35delG heterozygotes. Here we present on the clinical and molecular genetic evaluation of a family suffering from prelingual, sensorineural, non-syndromic deafness. A novel c.247_249delTTC (p.F83del) GJB2 mutation was detected in compound heterozygosity with the c.35delG GJB2 mutation in the proband and was later confirmed in the father, while the mother was homozygous for the c.35delG GJB2 mutation. We conclude that compound heterozygosity of the novel c.247_249delTTC (p.F83del) and the c.35delG mutations in the GJB2 gene was the cause of deafness in the proband and his father. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Estudio del CH interestelar

NASA Astrophysics Data System (ADS)

Olano, C.; Lemarchand, G.; Sanz, A. J.; Bava, J. A.

El objetivo principal de este proyecto consiste en el estudio de la distribución y abundancia del CH en nubes interestelares a través de la observación de las líneas hiperfinas del CH en 3,3 GHz. El CH es una molécula de amplia distribución en el espacio interestelar y una de las pocas especies que han sido observadas tanto con técnicas de radio como ópticas. Desde el punto de vista tecnológico se ha desarrollado un cabezal de receptor que permitirá la realización de observaciones polarimétricas en la frecuencia de 3,3 GHz, con una temperatura del sistema de 60 K y un ancho de banda de 140 MHz, y que será instalado en el foco primario de la antena parabólica del IAR. El cabezal del receptor es capaz de detectar señales polarizadas, separando las componentes de polarización circular derecha e izquierda. Para tal fin el cabezal consta de dos ramas receptoras que amplificarán la señal y la trasladarán a una frecuencia más baja (frecuencia intermedia), permitiendo de esa forma un mejor transporte de la señal a la sala de control para su posterior procesamiento. El receptor además de tener características polarimétricas, podrá ser usado en el continuo y en la línea, utilizando las ventajas observacionales y de procesamiento de señal que actualmente posee el IAR.

Características del viento en estrellas Be derivadas del perfil Hα

NASA Astrophysics Data System (ADS)

Rohrmann, R.; Cidale, L.

El estudio teórico de perfiles Hα y su variabilidad en estrellas Be ha sido frecuentemente desarrollado en base a modelos de envolturas circunestelares inhomogéneas, donde la geometría del material es responsable de la forma del perfil dependiendo de la dirección de observación. Nosotros damos una interpretación alternativa y proponemos que la mayoría de las propiedades de esta línea tienen origen en la base de un viento estelar y de una estructura cromosférica anexa a la fotósfera. Encontramos que típicos perfiles Hα en Be, como son los llamados pole-on y winebottle, pueden ser reproducidos cualitativamente sin recurrir a la existencia de una envoltura asimétrica. Analizamos como la línea Hα permite identificar la posible estructura del viento en la región donde éste se inicia.

Nuevos escenarios de la migración México-Estados Unidos. Las consecuencias de la guerra antiinmigrante

PubMed Central

MASSEY, Douglas S.; PREN, Karen A.; DURAND, Jorge

2010-01-01

La historia de la migración México-Estados Unidos se caracteriza por una serie de periodos durante los cuales los patrones migratorios se transforman y evolucionan como respuesta a los cambios en la política migratoria de Estados Unidos. En la década de 1990 se dio uno de estos cambios, lo que provocó el paso de la ‘era de la contradicción’ a la ‘era de la marginalización’. Actualmente, un gran número de migrantes indocumentados permanecen al margen de la ley, precisamente en un periodo en el que las penas se han incrementado y la persecución ha alcanzado niveles récord. De manera cada vez más notoria, los migrantes indocumentados, por la represión interna y fronteriza, quedan obligados a romper los lazos que los vinculaban con sus lugares de destino, pero al mismo tiempo se sienten cada vez más extraños en una tierra donde la aplicación de políticas antiinmigrantes es cosa de todos los días, lo que los sitúa en una posición de marginalización y gran vulnerabilidad. PMID:21209790

Estudio del comportamiento tribologico y de las interacciones de superficie de nuevos nanofluidos ionicos

NASA Astrophysics Data System (ADS)

Espinosa Rodriguez, Tulia

tribocorrosion processes. The formation of a coating layer on magnesium alloys from phosphonate imidazolium ionic liquids by immersion and by chronoamperometry has been described. The new coatings reduce the abrasive wear in the magnesium-aluminium alloy but they are not effective in the magnesium-zinc alloy, which prevent the formation of continuous coatings. Los liquidos ionicos son sales liquidas a temperatura ambiente o bajas temperaturas que presentan excelentes propiedades fisico-quimicas. En el presente trabajo se estudian como lubricantes en problemas tribologicos complejos como la lubricacion de metales contra si mismos, el desarrollo de lubricantes base agua y de nuevas superficies autolubricadas. Cuando no es posible reducir la friccion y desgaste mediante lubricacion, como en las aleaciones de magnesio, los liquidos ionicos se han estudiado como precursores de recubrimientos protectores. Se han determinado las interacciones superficiales y los procesos de corrosion sobre cobre y sobre acero con diferentes liquidos ionicos proticos y aproticos para desarrollar nuevos lubricantes y aditivos. En el contacto cobre/cobre, excepto el liquido ionico protico derivado del oleato, todos los liquidos ionicos estudiados presentan mejor comportamiento tribologico que el lubricante comercial Polialfaolefina 6. En el contacto acero/zafiro, los nuevos liquidos ionicos proticos son buenos lubricantes cuando se utilizan en estado puro, y, como aditivos en agua, generan peliculas adsorbidas sobre la superficie del metal reduciendo la friccion y el desgaste tras la evaporacion del agua. Para evitar el periodo de alta friccion inicial en presencia de agua, se han generado peliculas superficiales de liquido ionico sobre el acero en condiciones estaticas. El mejor comportamiento lubricante tanto en el contacto cobre/cobre como en el contacto acero/zafiro se obtiene para el liquido ionico protico derivado del anion adipato, con dos grupos carboxilicos. Las interacciones de los grupos

Unidades del paisaje de Puerto Rico: la influencia del clima, el substrato y la topografia

Treesearch

William Gould; Michael E. Jimenez; Gary Potts; Maya Quinones; Sebastian Martinuzzi

2008-01-01

El mapa de unidades del paisaje de Puerto Rico representa variaciones climaticas, topograficas y del substrato mediante la integracion de seis zonas climaticas (Ewel y Whitmore, 1973), seis substratos (Bawiec, 2001; USGS, 2005), cinco posiciones topograficas, o topoformas (Martinuzzi et al. 2007), y cuerpos de agua (USGS 2005). Los substratos representan el conjunto...

NOAA Weather Radio

Science.gov Websites

. -------------------------------------------------------------------------------- La DESCRIPCIÓN DE COLUMNAS EN TABLAS DE ESTADOS Al hacer un clic en un estado o territorio de la la radio. (Todas áreas de ahora en adelante serán llamados condados.) Entonces la radio les mensaje de la emisión, los oyentes oirán un corto estallido estático digital que señala el fin del

Formación y evolución de planetas gigantes

NASA Astrophysics Data System (ADS)

Benvenuto, O. G.; Brunini, A.

Presentamos el estado actual del trabajo que estamos realizando en el estudio de la formación de planetas gigantes. Detallamos los algoritmos numéricos necesarios para realizar este tipo de cálculo. Presentamos algunos resultados de la formación de objetos con masas de hasta una docena de veces la del planeta Júpiter, resaltando las principales caracteríticas. Finalmente detallamos los problemas que pensamos abordar en un futuro cercano en este tema de investigación.

Radioactive source materials in Los Estados Unidos de Venezuela

USGS Publications Warehouse

Wyant, Donald G.; Sharp, William N.; Rodriguez, Carlos Ponte

1953-01-01

This report summarizes the data available on radioactive source materials in Los Estados Unidos de Venezuela accumulated by geologists of the Direccions Tecnica de Geolgia and antecedent agencies prior to June 1951, and the writers from June to November 1951. The investigation comprised preliminary study, field examination, office studies, and the preparation of this report, in which the areas and localities examined are described in detail, the uranium potentialities of Venezuela are summarized, and recommendations are made. Preliminary study was made to select areas and rock types that were known or reported to be radioactive or that geologic experience suggests would be favorable host for uranium deposits, In the office, a study of gamma-ray well logs was started as one means of amassing general radiometric data and of rapidly scanning many of ye rocks in northern Venezuela; gamma-ray logs from about 140 representative wells were examined and their peaks of gamma intensity evaluated; in addition samples were analyzed radiometrically, and petrographically. Radiometic reconnaissance was made in the field during about 3 months of 1951, or about 12 areas, including over 100 localities in the State of Miranda, Carabobo, Yaracuy, Falcon, Lara, Trujillo, Zulia, Merida, Tachira, Bolivar, and Territory Delta Amacuro. During the course of the investigation, both in the filed and office, information was given about geology of uranium deposits, and in techniques used in prospecting and analysis. All studies and this report are designed to supplement and to strengthen the Direccion Tecnica de Geologias's program of investigation of radioactive source in Venezuela now in progress. The uranium potentialities of Los Estados de Venezuela are excellent for large, low-grade deposits of uraniferous phospahtic shales containing from 0.002 to 0.027 percent uranium; fair, for small or moderate-sized, low-grade placer deposits of thorium, rare-earth, and uranium minerals; poor, for

Sobre el estado evolutivo de β Pictoris

NASA Astrophysics Data System (ADS)

Brunini, A.; Benvenuto, O. G.

Desde el descubrimiento de fuertes excesos infrarrojos en β Pictoris, esta estrella ha sido muy estudiada y es considerada candidata a poseer un sistema planetario propio. β Pic está rodeada de un disco asimétrico de polvo que se observa de canto y que esta vacío a distancias <= 40 AU. Esto se considera una fuerte evidencia en favor de la presencia de (al menos) un planeta gigante. Recientemente se han observado líneas de material circunestelar que se han interpretado como consecuencia de la caída de objetos cometarios sobre esta estrella. Recientemente se ha utilizado la existencia del disco de polvo para atribuir una edad corta (pre - secuencia principal) a βPic. Sin embargo, la evaporación de estos cometas provee suficiente polvo como para explicar la presencia del disco observado sin necesidad de edades cortas. En este trabajo mostramos que la comparación entre la tasa de impactos cometarios estimada en el Sistema Solar para diferentes etapas de su evolución y los datos observados en β Pic indica edades avanzadas para β Pic. Esta estimación debe tomarse con cautela ya que depende de la estructura de los sistemas planetarios. Además mostramos que, desde el punto de vista de la evolución estelar y con las incertezas presentes en la luminosidad y la temperatura efectiva, existe un continuo de edades posible para β Pic. Sin embargo, empleando los datos provenientes de los flujos cometarios encontramos que una edad prolongada es consistente con ambos tratamientos.

Analisis del contenido curricular de los Documentos Normativos del Programa de Ciencias en el area de biologia para la escuela superior del sistema de educacion publica de Puerto Rico: 1993-2012

NASA Astrophysics Data System (ADS)

Davila Montanez, Melissa

Esta investigacion de naturaleza cualitativa se ocupo de realizar un analisis de contenido documental de los Documentos Normativos del Programa de Ciencias en el area de biologia de la escuela superior del sistema de educacion publica de Puerto Rico del periodo 1993-2012. Los documentos analizados fueron: Guia Curricular, 1995; Marco Curricular, 2003; Estandares de Excelencia, 1996, 2000 y Estandares de Contenido y Expectativas de Grado, 2007. Se indago si hubo cambios en significados en los Componentes Estructurales: Naturaleza de la ciencia, Paradigmas para la ensenanza de la ciencia, Funcion del curriculo formal, Mision de la ensenanza de la ciencia; Contenidos, destrezas y competencias, Estrategias de ensenanza y Evaluacion/Assessment del aprendizaje. El analisis sugiere que no hubo cambios sustanciales en los significados de los Componentes Estructurales. Los documentos estudiados muestran mayormente caracteristicas similares, aunque los documentos mas recientes eran mas descriptivos, explicativos y especificos.

Estudio teórico del CO2. Orbitales de valencia y del ``core''

NASA Astrophysics Data System (ADS)

Olalla Gutiérrez, E.

Hemos calculado las intensidades de las transiciones E1 a los miembros de las series de Rydberg con origen en los orbitales ``no enlazantes'' del dióxido de carbono, especie de conocida relevancia atmosférica. Se han computado, asimismo, los continuos de fotoionización correspondientes a los distintos canales de ionización, representándolos como densidad espectral de fuerza de oscilador frente a la energía del fotón incidente; mostramos los resultados df/dE para la fotoionización total de esta especie en el intervalo 15-60 eV. Todos los cálculos se han llevado a cabo mediante la formulación Molecular del Método de los Orbitales de Defecto Cuántico, MQDO [1,2]. La calidad de los resultados que presentamos se ha evaluado en base a la comparación con los datos, tanto experimentales como teóricos, disponibles en la bibliografía. El acuerdo encontrado es altamente satisfactorio

Visiting the Gödel universe.

PubMed

Grave, Frank; Buser, Michael

2008-01-01

Visualization of general relativity illustrates aspects of Einstein's insights into the curved nature of space and time to the expert as well as the layperson. One of the most interesting models which came up with Einstein's theory was developed by Kurt Gödel in 1949. The Gödel universe is a valid solution of Einstein's field equations, making it a possible physical description of our universe. It offers remarkable features like the existence of an optical horizon beyond which time travel is possible. Although we know that our universe is not a Gödel universe, it is interesting to visualize physical aspects of a world model resulting from a theory which is highly confirmed in scientific history. Standard techniques to adopt an egocentric point of view in a relativistic world model have shortcomings with respect to the time needed to render an image as well as difficulties in applying a direct illumination model. In this paper we want to face both issues to reduce the gap between common visualization standards and relativistic visualization. We will introduce two techniques to speed up recalculation of images by means of preprocessing and lookup tables and to increase image quality through a special optimization applicable to the Gödel universe. The first technique allows the physicist to understand the different effects of general relativity faster and better by generating images from existing datasets interactively. By using the intrinsic symmetries of Gödel's spacetime which are expressed by the Killing vector field, we are able to reduce the necessary calculations to simple cases using the second technique. This even makes it feasible to account for a direct illumination model during the rendering process. Although the presented methods are applied to Gödel's universe, they can also be extended to other manifolds, for example light propagation in moving dielectric media. Therefore, other areas of research can benefit from these generic improvements.

Implementation of Barcelona, L'estartit and Ibiza Sites for Altimeter Calibration

NASA Astrophysics Data System (ADS)

Martinez-Benjamin, J. J.; Gili, J.; Lopez, R.; Tapia, A.; Bosch, E.; Perez, B.; Pros, F.

2012-12-01

A marine campaign to compute the sea surface data along the Spanish Mediterranean coastline and Balearic Islands is being prepared for 2013. Jason-2 (period ~10 days) and Saral/AltiKa (period of 35 days and expected launch in 2012) altimetric data and on-board GPS data will be used. Many GPS Buoy sessions along the ship route will be performed.Sea height estimates (instantaneous and mean sea levels) will be compared. Recently some geodetic improvements has been made in specific coastal spanish sites in the NW Mediterranean Sea for monitoring sea level. The goal is to maintain and improve the quality of the observation of the sea level change in the three sites. The information is coming from Puertos del Estado www.puertos.es L'Estartit tide gauge has been co-located with geodetic techniques (GPS measurements of XU, Utilitary Network, and XdA, Levelling Network,) and it is tied to the SPGIC (Integrated Geodetic Positioning System of Catalonia) project of the Cartographic Institute of Catalunya (ICC). In the past three calibration campaigns for Topex/Poseidon and Jason-1 in March 1999, August 2000 and July 2002 near Cape of Begur. At Barcelona harbour there is one MIROS radar tide gauge belonging to Puertos del Estado (Spanish Harbours).The radar sensor is over the water surface, on a L-shaped structure which elevates it a few meters above the quay shelf. 1-min data are transmitted to the ENAGAS Control Center by cable and then sent each 1 min to Puertos del Estado by e-mail. The information includes wave forescast (mean period, significant wave height, sea level, etc.This sensor also measures agitation and sends wave parameters each 20 min. There is a GPS station Leica Geosystems GRX1200 GG Pro and antenna 1202. Bathymetric campaigns inside the harbour have been made. At Ibiza site new measurements and levelling between the GPS reference station and a Radar MIROS, both from Puertos del Estado, has been made recently. A calibration campaign for Jason-1 was made in

Tailoring Nutritional Advice for Mexicans Based on Prevalence Profiles of Diet-Related Adaptive Gene Polymorphisms

PubMed Central

Ojeda-Granados, Claudia; Panduro, Arturo; Gonzalez-Aldaco, Karina; Sepulveda-Villegas, Maricruz; Rivera-Iñiguez, Ingrid

2017-01-01

Diet-related adaptive gene (DRAG) polymorphisms identified in specific populations are associated with chronic disorders in carriers of the adaptive alleles due to changes in dietary and lifestyle patterns in recent times. Mexico’s population is comprised of Amerindians (AM) and Mestizos who have variable AM, European (EUR) and African genetic ancestry and an increased risk of nutrition-related chronic diseases. Nutritional advice based on the Mexican genome and the traditional food culture is needed to develop preventive and therapeutic strategies. Therefore, we aimed to provide a prevalence profile of several DRAG polymorphisms in the Mexican population, including Central West (CW) Mexico subpopulations. Geographic heat maps were built using ArcGIS10 (Esri, Redlands, CA, USA) software, based on the published data of the MTHFR C677T (rs1801133), ABCA1 Arg230Cys (rs9282541), APOE T388C (rs429358)/C526T (rs7412), LCT C-13910T (rs4988235) polymorphisms and AMY1 copy number variation (CNV). Also, new data obtained by allelic discrimination-real-time polymerase chain reaction (RT-PCR) assays for the MTHFR, ABCA1, and APOE polymorphisms as well as the AMY1 CNV in the CW Mexico subpopulations with different proportions of AM and EUR ancestry were included. In the CW region, the highest frequency of the MTHFR 677T, ABCA1 230C and APOE ε4 adaptive alleles was observed in the AM groups, followed by Mestizos with intermediate AM ancestry. The LCT-13910T allele frequency was highest in Mestizos-EUR but extremely low in AM, while the AMY1 diploid copy number was 6.82 ± 3.3 copies. Overall, the heat maps showed a heterogeneous distribution of the DRAG polymorphisms, in which the AM groups revealed the highest frequencies of the adaptive alleles followed by Mestizos. Given these genetic differences, genome-based nutritional advice should be tailored in a regionalized and individualized manner according to the available foods and Mexican traditional food culture that may lead

Factors that enable or limit the sustained use of improved firewood cookstoves: Qualitative findings eight years after an intervention in rural Mexico

PubMed Central

Catalán-Vázquez, Minerva; Fernández-Plata, Rosario; Martínez-Briseño, David; Pelcastre-Villafuerte, Blanca; Riojas-Rodríguez, Horacio; Suárez-González, Laura; Pérez-Padilla, Rogelio

2018-01-01

Objective The aim of this study was to analyze the factors enabling/limiting the use of improved cookstoves among rural fuel wood users from one mestizo and two indigenous communities eight years after an intervention in the state of Michoacan, in Mexico. Methods A qualitative study with an ethnographic perspective was conducted in 2013/2014 based on 62 interviews with women who had participated in an improved firewood cookstove program in 2005. Thematic qualitative content analysis was performed. Results Very few women from the indigenous communities were using the improved cookstove at the time of the study; the majority had dismantled or had ceased using it; whereas most of those from the mestizo community were using it for all of their cooking activities. In the indigenous communities, characterized by extended families, uptake of new technology was limited by traditional routine practices, rearrangement of rooms in the house, attachment to the traditional stove, a low- or non-risk perception of woodsmoke; gender relations, insufficient training, non-compliance with program recommendations and design-related aspects. Conversely, in the mestizo community, the uptake of the improved cookstove was favored by routine cooking practices in a nuclear family, a previous use of a raised cookstove and social representations on the health-disease-death effects of woodsmoke vs. the health benefits of cooking with improved stoves. The sociocultural dimension of communities and the cookstove design are aspects that either favor or limit the use of improved cookstoves in indigenous and mestizo populations. Conclusions Effective cookstove programs must take these elements into account from their early planning stages, and blend them into implementation and follow-up. Project communication, training and differentiated follow-up activities ensuring the operation and maintenance of the cookstove, should be designed according to the specific needs and traditions of each community

E-cadherin expression in sporadic gastric cancer from Mexico: exon 8 and 9 deletions are infrequent events associated with poor survival.

PubMed

Gamboa-Dominguez, Armando; Dominguez-Fonseca, Claudia; Chavarri-Guerra, Yanin; Vargas, Roberto; Reyes-Gutierrez, Edgardo; Green, Dan; Quintanilla-Martinez, Leticia; Luber, Birgit; Busch, Raymonde; Becker, Karl-Friedrich; Becker, Ingrid; Höfler, Heinz; Fend, Falko

2005-01-01

Aberrant expression and mutation of E-cadherin is frequent in gastric carcinoma (GC) especially of the diffuse type. The frequency of CDH1 (gene encoding E-cadherin) mutation in populations with high incidence of diffuse GC and its prognostic significance is unknown. One hundred seventy-seven gastrectomies from Mexican mestizo patients with intestinal (53), mixed (55), or diffuse (69) GC were included. In addition, 101 endoscopic biopsies from patients with GC not subjected to surgery were analyzed. Immunohistochemistry against wild-type E-cadherin (clone 36) and against 2 mutation-specific antibodies (MSA) recognizing mutant CDH1 lacking exon-8 (del 8) or exon-9 (del 9) were performed. Staining was correlated with histotype, tumor node metastasis stage, and follow-up. Abnormal or absent E-cadherin expression (clone 36) was identified in 84% GC, predominantly in diffuse or mixed tumors (P = 0.004) in advanced stages (P = 0.003). No survival differences at 1 and 2 years were observed among patients showing normal, abnormal, or absent wild type E-cadherin expression. Overall reactivity with the MSA was observed in 10 (5.6%) patients who were treated with surgery. In 140 patients, dead from the disease or alive with the disease, the survival at 1 and 2 years was 37% versus 17% and 14% versus 0 for patients without and with del 8/9 positivity, respectively (log rank P = 0.01). Biopsies from patients with inoperable-GC (101) rendered 5 (4.95%) with del 8 or 9 immunoreactivity. Abnormal E-cadherin expression is frequent in GC. However, exon 8 or 9 deletions were observed in only 5.3% tumors in this series from Mexico, at a lower rate than previously published, but associated with a worse prognosis.

The Genetics of Mexico Recapitulates Native American Substructure and Affects Biomedical Traits

PubMed Central

Moreno-Estrada, Andrés; Gignoux, Christopher R.; Fernández-López, Juan Carlos; Zakharia, Fouad; Sikora, Martin; Contreras, Alejandra V.; Acuña-Alonzo, Victor; Sandoval, Karla; Eng, Celeste; Romero-Hidalgo, Sandra; Ortiz-Tello, Patricia; Robles, Victoria; Kenny, Eimear E.; Nuño-Arana, Ismael; Barquera-Lozano, Rodrigo; Macín-Pérez, Gastón; Granados-Arriola, Julio; Huntsman, Scott; Galanter, Joshua M.; Via, Marc; Ford, Jean G.; Chapela, Rocío; Rodriguez-Cintron, William; Rodríguez-Santana, Jose R.; Romieu, Isabelle; Sienra-Monge, Juan José; Navarro, Blanca del Rio; London, Stephanie J.; Ruiz-Linares, Andrés; Garcia-Herrera, Rodrigo; Estrada, Karol; Hidalgo-Miranda, Alfredo; Jimenez-Sanchez, Gerardo; Carnevale, Alessandra; Soberón, Xavier; Canizales-Quinteros, Samuel; Rangel-Villalobos, Héctor; Silva-Zolezzi, Irma; Burchard, Esteban Gonzalez; Bustamante, Carlos D.

2014-01-01

Mexico harbors great cultural and ethnic diversity, yet fine-scale patterns of human genome-wide variation from this region remain largely uncharacterized. We studied genomic variation within Mexico from over 1,000 individuals representing 20 indigenous and 11 mestizo populations. We found striking genetic stratification among indigenous populations within Mexico at varying degrees of geographic isolation. Some groups were as differentiated as Europeans are from East Asians. Pre-Columbian genetic substructure is recapitulated in the indigenous ancestry of admixed mestizo individuals across the country. Furthermore, two independently phenotyped cohorts of Mexicans and Mexican Americans showed a significant association between sub-continental ancestry and lung function. Thus, accounting for fine-scale ancestry patterns is critical for medical and population genetic studies within Mexico, in Mexican-descent populations, and likely in many other populations worldwide. PMID:24926019

Gödel universes in string theory

NASA Astrophysics Data System (ADS)

Barrow, John D.; Dabrowski, Mariusz P.

1998-11-01

We show that homogeneous Gödel spacetimes need not contain closed timelike curves in low-energy-effective string theories. We find exact solutions for the Gödel metric in string theory for the full O(α') action including both dilaton and axion fields. The results are valid for bosonic, heterotic and super-strings. To first order in the inverse string tension α', these solutions display a simple relation between the angular velocity of the Gödel universe, Ω, and the inverse string tension of the form α'=1/Ω2 in the absence of the axion field. The generalization of this relationship is also found when the axion field is present.

Múltiples estados de desorden en el etanol sólido

NASA Astrophysics Data System (ADS)

Fernández-Perea, R.

El diagrama de fases del etanol por debajo de los 169 K será presentado. Se mostrará que el etanol puede solidificarse en tres fases con diversos niveles de desorden,(como un vidrio(G), como un vidrio orientacional (OG) y como un cristal de fase rotora (RP)) además de en una fase totalmente cristalina. Las estructuras de estas tres fases serán presentadas tal y como se deducen a partir de diversas medidas de difracción de neutrones al igual que las proporciones de los isómeros de dicho material en las fases desordenadas y se compararán con los resultados de la fase cristalina y del líquido superenfriado. Igualmente diversas medidas sobre su dinámica serán presentadas, tanto de dispersión de neutrones, como de capacidad calorífica y de medidas dieléctricas y comparadas con modelos teóricos y simulaciones para tratar de explicar los procesos de relajación observados y las transiciones entre las diversas fases.

La inserción en el mercado laboral de los inmigrantes latinos en España y en los Estados Unidos: Diferencias por país de origen y estatus legal

PubMed Central

Connor, Phillip; Massey, Douglas

2013-01-01

Resumen Este artículo compara los resultados económicos entre los inmigrantes latinoamericanos en España y Estados Unidos. Detectamos un efecto de selección por el que la mayoría de los inmigrantes latinoamericanos en España proceden de Sudamérica de un entorno de clases medias, mientras la mayoría de los inmigrantes que van a los Estados Unidos son centroamericanos de clase baja. Este efecto de selección explica las diferencias transnacionales en la probabilidad de empleo, logro ocupacional y salarios obtenidos. A pesar de las diferencias en los orígenes y las características de los latinoamericanos en ambos países, los factores demográficos, humanos y de capital social parecen operar de forma similar en ambos países; y cuando los modelos se estiman separadamente por estatus legal, descubrimos que los efectos se acentúan más entre los inmigrantes irregulares cuando se los compara con los regulares, especialmente en Estados Unidos. PMID:24532857

Calidad de Imagen del Telescopio UNAM212

NASA Astrophysics Data System (ADS)

Cobos, F. J.; Teiada de Vargas, C.

1987-05-01

El telescopio UNAM2l2, del Observatorio Astronómico Nacional, situado en la Sierra de San Pedro Mártir (Baja California, México), cumplira en un futuro muy cercano siete años de uso para fines de investigación astronómica. Aunque en este tiempo no se ha efectuado un estudio sistemático acerca de su comportamiento óptico y de los factores que influyen en la calidad de las imágenes, se han realizado pruebas diversas, estudios parciales y reuniones especificas, cuyos resultados no siempre se han difundido ampliamente y generalmente no se han presentado por escrito. Es por ello que hemos creido necesario intentar una recopilación de la información existente para poder con ella establecer un diagnóstjco que, aunque no sea definitivo, sirva de base para futuros trabajos tendientes a optimizar el comportamiento óptico del telescopio. Es evidente que un buen número de las conclusiones que se presentan son resultado del trabajo de muchas personas ó de esfuerzos colectivos. Asimismo, hemos tratado de localizar información bibliográfica que pueda ser de utilidad. Nuestro objetivo primordial ha consistido en centrarnos en la óptica del telescopio y su calidad, pero también se han considerado otros aspectos que puedan afectar las imágenes obtenidas tales como: celda del primario, `seeing' local y externo, flexiones posibles en la estructura mecánica del telescopio, etc.

[In Process Citation].

PubMed

López-Fuenzalida, Antonio; Rodríguez Canales, Carolina; Reyes Ponce, Álvaro; Contreras Molina, Ángela; Fernández Quezada, Javiera; Aguirre Polanco, Carolina

2016-03-25

Introducción: dado el incremento del sobrepeso y obesidad infantil, es relevante estudiar no solo las consecuencias metabólicas, sino también aquellas de índole musculoesqueléticas que pueden afectar la funcionalidad motriz, como es el pie plano, en esta población. Objetivo: identificar la asociación entre el estado nutricional y la prevalencia de pie plano en niños y niñas chilenos de 6 a 10 años. Métodos: el z-score del índice de masa corporal (IMC) y el registro y análisis de las huellas plantares según la metodología de Hernández-Corvo fue llevado a cabo en 388 escolares (52,3% niñas). Un test de diferencia para dos proporciones fue utilizado para evaluar las diferencias entre los grupos. Se considera una significancia estadística con p ≤ 0,05. Resultados: la prevalencia del exceso de peso fue de más del 40%. Esta prevalencia fue más alta en las niñas (47,8%) que en los niños (42,7%). La prevalencia de pie plano en todos los niños fue del 17%, presentando valores más elevados el pie derecho (18,3%) que el izquierdo (15,7%). Hay un incremento significativo de la prevalencia de pie plano en los niños obesos en relación con los niños con sobrepeso y normopeso. Conclusión: el estado nutricional está asociado con incrementos en la prevalencia de pie plano en niños. En la población infantil de 6 a 10 años de edad, la obesidad está asociada con la alteración morfológica del pie.

Conservacion de truchas del Pacifico

Treesearch

Brooke E. Penaluna

2016-01-01

La historia de las truchas del Pacífico, pertenecientes al género Oncorhynchus, es una historia muy interesante que se basa en la persistencia y diversificación de sus especies debido, en gran parte, al dinamismo propio que existe en su medio ambiente. Desde el oeste de Norteamérica, extendiéndose hasta el este de Asia, las truchas del Pacífico han experimentado la...

Postinfectious bronchiolitis obliterans

PubMed

2018-06-01

La bronquiolitis obliterante es una enfermedad pulmonar crónica infrecuente y grave producto de una lesión del tracto respiratorio inferior. En nuestro país, es más frecuente observarla secundaria a una lesión viral grave, en especial, por adenovirus. La bronquiolitis obliterante se caracteriza por la oclusión parcial o total del lumen de los bronquiolos respiratorios y terminales por tejido inflamatorio y fibrosis, que produce la obstrucción crónica de la vía aérea. Este consenso discute el estado actual del conocimiento en las diferentes áreas de la bronquiolitis obliterante secundaria a una lesión infecciosa.

Capacitación-acción participativa: una experiencia de 24 años en las comunidades rurales de Oaxaca, México.

PubMed

Ysunza, Alberto M; Diez-Urdanivia, Silvia; Pérez-Gil, Sara E

2017-12-01

Resumen: En este artículo presentamos el proyecto de capacitación llevado a cabo en comunidades de la sierra y costa de Oaxaca, México, desde 1991, por el Centro de Capacitación Integral para Promotores Comunitarios (CECIPROC). La decisión de hacer este trabajo en Oaxaca responde a que ese estado ocupa uno de los primeros lugares de marginación y de desnutrición en menores de 5 años. El objetivo es describir un modelo de capacitación y compartir parte de las experiencias derivadas, tanto del modelo como del trabajo realizado en las distintas áreas (nutrición y alimentación, salud comunitaria, ecología y etnobotánica, y educación y organización), por promotores mujeres y hombres en sus comunidades. La experiencia obtenida en 24 años muestra la factibilidad técnica y social del proyecto en el ámbito de la salud, el reconocimiento social del proyecto del CECIPROC como un organismo civil que ha aportado alternativas como solución a la problemática de salud, el hacer suyo el proyecto por algunos promotores y los diferentes obstáculos a los que se ha enfrentado. Enfatizamos el hecho de que la situación socioeconómica y política prevaleciente en el estado de Oaxaca es una limitante para el buen desarrollo de los programas colectivos de salud, e insistimos en la necesidad de compartir nuestras experiencias para que puedan ser utilizadas en la planificación y ejecución de otros proyectos.

Developing Students' Autonomy and Self-Regulation through a Co-Teaching Research Methods Experience

ERIC Educational Resources Information Center

Fabregas Janeiro, Maria G.; Gaeta González, Martha L.

2008-01-01

The College of Human Sciences at Oklahoma State University (OSU) and Universidad Popular Autónoma del Estado de Puebla (UPAEP) decided to offer Pedagogy Doctoral students from Mexico a 3 week co-teaching research methods experience. Two professors, one from each institution (OSU and UPAEP), designed the syllabus to offer a co-teaching experience…

Association of Lactase Persistence Genotypes with High Intake of Dairy Saturated Fat and High Prevalence of Lactase Non-Persistence among the Mexican Population.

PubMed

Ojeda-Granados, Claudia; Panduro, Arturo; Rebello Pinho, João Renato; Ramos-Lopez, Omar; Gleyzer, Ketti; Malta, Fernanda de Mello; Gonzalez-Aldaco, Karina; Roman, Sonia

2016-01-01

Lactase (LCT) -13910 C>T and -22018 G>A polymorphisms associated with the lactase non-persistence (LNP)/persistence (LP) phenotypes vary globally. LP has been associated with obesity in Europeans. However, it has not been genetically evaluated in Mexico, a country with admixed population, recent introduction of dairy, and a high prevalence of obesity. Thus, we aimed to determine the distribution of the LCT polymorphisms and their association with the nutritional profile of West Mexico's populations. Genotyping of 1,196 individuals (natives and mestizos) was carried out by a Taqman allelic discrimination assay. Descriptive statistics and interpopulation analyzes were performed by SPSS, Arlequin, and Structure software. Demographic, anthropometric, biochemical and dietary data were analyzed in 212 mestizos. LNP genotypes mainly prevailed (CC 68.7% and GG 68.2%); both predominated in native Huicholes and Nahuas (>97.7%). Among the mestizos, the LP genotypes were associated with a higher intake of saturated fat (9.9 ± 3.9% vs. 8.5 ± 4.0%, p = 0.018; OR = 2.55, 95% CI 1.29-5.03, p = 0.006) and a daily/more frequent consumption of dairy (88.8 vs. 78.0%; p = 0.049) than LNP genotypes. The LNP trait was predominant in Mexicans with a major Amerindian ancestry. A daily consumption of dairy was associated with a higher intake of saturated fat in LP individuals. © 2016 S. Karger AG, Basel.

Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

PubMed

González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

2018-02-03

The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

The Prince, the Captain and "The State": An Examination of the Mesquita Family Ownership of "O Estado de Sao Paulo" to 1969.

ERIC Educational Resources Information Center

Etsinger, Jean

Julio Mesquita joined the staff of "O Estado de Sao Paulo" in 1885 and became a director in 1891, when he also began his first term as a deputy of the Sao Paulo state assembly. Until his death in 1927, Mesquita guided the newspaper's growth in all respects--editorial, political, technological, and economic. Julio de Mesquita Filho…

Morphology, geology and geochemistry of the "Salar del Gran Bajo del Gualicho" (Rio Negro, Argentina)

USGS Publications Warehouse

Angelucci, A.; Barbieri, M.; Brodtkorb, A.; Ciccacci, S.; Civitelli, G.; De Barrio, R.; Di, Filippo M.; Fredi, P.; Friedman, I.; Lombardi, S.; Schalamuk, A.I.; Toro, B.

1996-01-01

A multidisciplinary study of the Gran Bajo del Gualicho area (Rio Negro - Argentina) was carried out; the aim was to delineate its geological and geomorphological evolution and to estabilish the genesis of salts filling the depression. Climatic conditions were analized first to individuate their role in the present morphogenetic processes; moreover the main morphological features of present landscape were examined as well as the stratigraphy of the outcropping formations, and of the Gran Bajo del Gualicho Formation in particular. Finally, a possible geomorphological evolution of the studied area was traced. Geophysical analyses allowed to estabilish that the paleosurface shaped on the crystalline basement is strongly uneven and shows evidence of the strong tectonic phases it underwent. The result of isotope analyses confirmed that the salt deposits on the Gran Bajo del Gualicho bottom were produced by fresh water evaporation, while strontium isotope ratio suggested that such waters were responsible for solubilization of more ancient evaporitic deposits.

Nevado del Huila, Columbia

NASA Technical Reports Server (NTRS)

2007-01-01

Nevado del Huila Volcano in Colombia is actually a volcanic chain running north to south, capped by a glacier. With peaks ranging in height from 2,600 to 5,780 meters (8,530 to 18,960 feet), Nevado del Huila is a stratovolcano composed of alternating layers of hardened lava, solidified ash, and volcanic rocks. Its first recorded eruption occurred in the mid-sixteenth century. The long-dormant volcano erupted again in mid-April 2007. A few months before the eruption, the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) on NASA's Terra satellite captured this image of Nevado del Huila, on February 23, 2007. In this image, the bright white area just east of the central summit is ice. Immediately west of the summit are bare rocks, appearing as blue-gray. West of those rocks, white reappears, but this patch of white results from clouds hovering in the nearby valley. In the east, the colors turn to brown (indicating bare rock) and bright green (indicating vegetation). ASTER photographed Nevado del Huila near the end of a long phase of quietude. On April 17, 2007, local authorities recorded seismic activity associated with rock fracturing on the volcano's central summit, according to the ReliefWeb Website. Activity intensified the following day with an eruption and mudflows, forcing thousands of nearby residents to evacuate. As the Associated Press reported, the eruption caused avalanches and floods that wiped away both houses and bridges. It marked the volcano's first recorded eruption since the Spanish colonized the area five centuries earlier. NASA image created by Jesse Allen, using data provided courtesy of the NASA/GSFC/MITI/ERSDAC/JAROS, and U.S./Japan ASTER Science Team.

Trastornos mentales y consumo de drogas en la población víctima del conflicto armado en tres ciudades de Colombia.

PubMed

Castaño, Guillermo; Sierra, Gloria; Sánchez, Daniela; Torres, Yolanda; Salas, Carolina; Buitrago, Carolina

2018-05-01

Introducción. La violencia en sus diferentes modalidades incrementa el riesgo de trastornos mentales y de consumo de drogas.Objetivos. Estimar la prevalencia de los trastornos mentales, del uso y abuso de drogas, así como los factores asociados en víctimas de desplazamiento forzado en tres ciudades colombianas.Materiales y métodos. Se hizo un estudio de prevalencia en una muestra de 1.026 personas entre los 13 y los 65 años de edad, a quienes se entrevistó utilizando el instrumento Composite International Diagnostic Interview y el Alcohol Use Disorders Identification Test de la Organización Mundial de la Salud, así como un cuestionario sobre el consumo de drogas modificado a partir de la encuesta del Sistema Interamericano de Datos Uniformes sobre Drogas de la Comisión Interamericana para el Control del Abuso de Drogas de la Organización de Estados Americanos, y otro sobre aspectos relacionados con el desplazamiento forzado. El análisis se hizo mediante el programa estadístico SPSS™, versión 21.Resultados. La prevalencia de vida de los trastornos mentales fue la siguiente: fobia específica, 17,7 %; depresión mayor, 16,4 %; estrés postraumático, 9,9 %; trastorno oposicionista desafiante, 8,9 %; ansiedad por separación, 7,2 %; trastornos de conducta, 5,8 %, y déficit de atención, 5,6 %. La prevalencia de vida del consumo de alcohol fue de 68,7 %; de tabaco, 31,3 %, de marihuana, 11,2 %, de cocaína, 3,5 %, de basuco, 2,0 %, de inhalables, 2,3 %, y de medicamentos ansiolíticos sin receta, 2,5 %, en tanto que 0,7 % de los entrevistados se había inyectado drogas. El presentar cualquiera de los trastornos mentales se asoció con el sexo femenino (odds ratio, OR=1,61; IC95% 1,21-2,14), así como el haber sido sometido a más de un desplazamiento forzado (OR=1,47; IC95 1,05-2,05). El consumo de cualquiera de las drogas se asoció con ser hombre (OR=5,38; IC95% 2,35-12,34).Conclusiones. La alta prevalencia de trastornos mentales y de consumo de

Calidad del aire interior en las escuelas

EPA Pesticide Factsheets

EPA ha desarrollado el Programa de Herramientas de Calidad del Aire Interior para las Escuelas para reducir la exposición a los contaminantes ambientales en las mismas a través de la adopción voluntaria de las prácticas para manejar la calidad del aire int

Susceptibility mapping in the Río El Estado watershed, Pico de Orizaba volcano, Mexico

NASA Astrophysics Data System (ADS)

Legorreta Paulin, G.; Bursik, M. I.; Lugo Hubp, J.; Paredes Mejía, L.; Aceves Quesada, F.

2013-12-01

In volcanic terrains, dormant stratovolcanoes are very common and can trigger landslides and debris flows continually along stream systems, thereby affecting human settlements and economic activities. It is important to assess their potential impact and damage through the use of landslide inventory maps and landslide models. This poster provides an overview of the on-going research project (Grant SEP-CONACYT no 167495) from the Institute of Geography at the National Autonomous University of Mexico (UNAM) that seeks to conduct a multi-temporal landslide inventory and produce a landslide susceptibility map by using Geographic Information Systems (GIS). The Río El Estado watershed on the southwestern flank of Pico de Orizaba volcano, the highest mountain in Mexico, is selected as a study area. The catchment covers 5.2 km2 with elevations ranging from 2676.79 to 4248.2 m a.s.l. and hillslopes between 5° and 56°. The stream system of Río El Estado catchment erodes Tertiary and Quaternary lavas, pyroclastic flows, and fall deposits. The geologic and geomorphologic factors in combination with high seasonal precipitation, high degree of weathering, and steep slopes predispose the study area to landslides. The method encompasses two main levels of analysis to assess landslide susceptibility. The first level builds a historic landslide inventory. In the study area, an inventory of more than 100 landslides was mapped from interpretation of multi-temporal aerial orthophotographs and local field surveys to assess and describe landslide distribution. All landslides were digitized into a GIS, and the spatial geo-database of landslides was constructed from standardized GIS datasets. The second level calculates the susceptibility for the watershed. Multiple Logistic Regression (MLR) was used to examine the relationship between landsliding and several independent variables (elevation, slope, terrain curvature, flow direction, saturation, contributing area, land use, and geology

May Gödel's Ideas Be Addressed Philosophically?

NASA Astrophysics Data System (ADS)

Dokulil, Miloš

2007-11-01

Gödel emphasised philosophy as an important tool in science. Much less is known about his religious background. We should bear in mind that our evaluational perspective differs very much from the one in which Gödel lived. He was personally sure that there must be another existence after death-an afterlife (''of unlimited life span''). As a ''Baptized Lutheran'' he did not include ''Trinity'' in his creed. He was also certain that mind is separate from matter. This text tries to include Libet's ''readiness potential'' into the debate concerning the specificity of the mind. Neither Gödel's identification of materialism with mechanism nor his vision of the ''spirit'' are a viable solution of the problem.

A New Strategy for Latin America

DTIC Science & Technology

1992-04-01

resulted in six significant racial groups; Indians, Europeans, Mestizo (Indians & Europeans); Black, Mulattoes (Black & Europeans), and Zambos (Indians...slice of the budget pie , a priority ranking of these countries would establish where the best benefits lie for US national security. As discussed, Latin

Toxoplasmosis gondii and schizophrenia: a case control study in a low Toxoplasma gondii seroprevalence Mexican population

USDA-ARS?s Scientific Manuscript database

There are conflicting reports concerning the association of T. gondii infection and schizophrenia. Therefore, we determined such association in a Mexican population of Mestizo ethnicity. Through a case-control study design, 50 schizophrenic patients and 150 control subjects matched by gender, age, r...

Efecto del Programa de Entrenamiento “Manejo del Dolor” en la Documentación de Enfermería en el Expediente Electrónico

PubMed Central

Monsiváis, María Guadalupe Moreno; Guzmán, Ma. Guadalupe Interial; Flores, Paz Francisco Sauceda; Arreola, Leticia Vázquez

2012-01-01

Resumen En el presente trabajo se muestra la importancia de entrenar al personal de enfermería para mejorar la documentación en el expediente electrónico. Se eligió el manejo del dolor por ser un área prioritaria; una alta proporción de pacientes en período post operatorio cursa con dolor, por lo tanto, la documentación debe ser útil para la toma de decisiones clínicas. Se implementó un programa de entrenamiento denominado “Manejo del Dolor” dirigido al personal de enfermería. Se utilizó la tecnología de la información como herramienta para fortalecer el conocimiento con base en la revisión sistemática de la literatura; el personal de enfermería participante seleccionó la mejor evidencia; posteriormente se trabajó en la transferencia de este conocimiento a la práctica a través del diseño de un protocolo para el manejo del dolor. Se concluye que el conocimiento del manejo del dolor es fundamental para que enfermería documente con mayor precisión sus intervenciones. PMID:24199106

Beta 2 adrenergic receptor polymorphisms, at codons 16 and 27, and bronchodilator responses in adult Venezuelan asthmatic patients.

PubMed

Larocca, Nancy; Moreno, Dolores; Garmendia, Jenny Valentina; Velasquez, Olga; Martin-Rojo, Joana; Talamo, Carlos; Garcia, Alexis; De Sanctis, Juan Bautista

2013-12-01

One of the gene polymorphisms often studied in asthmatic patients is the β2 adrenergic receptor (ADRβ2). Even though in the Venezuelan Mestizo population there is a high incidence of asthma, there are no direct reports of ADRβ2 gene polymorphism, and treatment response. The aim of this study was to assess, in this population, the gene frequency of ADRβ2 polymorphisms at codons 16 Arg/Gly and 27 Gln/Glu, allergen sensitization, and its relationship to bronchodilator response. Purified genomic DNA was obtained form 105 Mestizo asthmatic and 100 Mestizo healthy individuals from Venezuela. The two polymorphisms were assessed by PCR-RFLP. Patient sensitization to aeroallergens and their response to bronchodilatation were correlated. Significant differences between patients and controls were recorded in: 1) the prevalence of Arg/Arg at codon 16 (28.6% in patients vs. 47% in controls, P<0.01), 2) the frequency of heterozygotes Arg/Gly (55% in patients vs. 35% in controls, P<0.01). Conversely, no differences in polymorphism frequencies were found at codon 27. The haplotypes Arg/Gly-Gln/Gln were more common in patients than controls (P <0.01), whereas the Arg/Arg-Gln/Glu combination prevailed in the control group (P<0.01). The Arg/Gly and Gln/Glu genotypes were associated with better responses after salbutamol. The asthmatic homozygotes Arg/Arg have higher sensitivity to aeroallergens. The difference in Arg/Arg frequency between groups suggests that this could be a protective genotype although the asthmatic group had a higher sensitivity to aeroallergens. The asthmatic heterozygotes had better bronchodilator responses than the homozygotes.

Ahorre Energía: Consejos sobre el ahorro de dinero y energía en el hogar (Spanish Brochure), Energy Savers Guide (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

La versión en castellano de la guía del Departamento de Energía de los Estados Unidos que ayuda a consumidores a ahorrar energía y dinero en el hogar y en las carreteras. The Spanish-language version of U.S. Department of Energy's consumer guide to saving energy and money at home and on the road.

Effects of a 12-hour shift on mood states and sleepiness of Neonatal Intensive Care Unit nurses.

PubMed

Ferreira, Tadeu Sartini; Moreira, Clarice Zinato; Guo, James; Noce, Franco

2017-03-09

To assess the effect of a 12-hour shift on mood states and sleepiness at the beginning and end of the shift. Quantitative, cross-sectional and descriptive study.It was conducted with 70 neonatal intensive care unit nurses. The Brunel Mood Scale (BRUMS), Karolinska Sleepiness Scale (KSS), and a socio-demographic profile questionnaire were administered. When the KSS and BRUMS scores were compared at the beginning of the shift associations were found with previous sleep quality (p ≤ 0.01), and quality of life (p ≤ 0.05). Statistical significant effects on BRUMS scores were also associated with previous sleep quality, quality of life, liquid ingestion, healthy diet, marital status, and shift work stress. When the beginning and end of the shift were compared, different KSS scores were seen in the group of all nurses and in the night shift one. Significant vigor and fatigue scores were observed within shift groups. A good night's sleep has positive effects on the individual`s mood states both at the beginning and the end of the shift. The self-perception of a good quality of life also positively influenced KSS and BRUMS scores at the beginning and end of the shift. Proper liquid ingestion led to better KSS and BRUMS scores. Evaluar el efecto de un turno de 12 horas en estados de ánimo y somnolencia al principio y al final del turno. Estudio cuantitativo, transversal y descriptivo.Se realizó con 70 enfermeras de unidades de cuidados intensivos neonatales. Se administró la Escala de Humor Brunel (BRUMS), la Escala de Somnolencia de Karolinska (KSS) y un cuestionario de perfil sociodemográfico. Cuando se compararon las puntuaciones de KSS y BRUMS al comienzo del turno se encontraron asociaciones con calidad de sueño previa (p ≤ 0,01) y calidad de vida (p ≤ 0,05). Los efectos estadísticos significativos en las puntuaciones de BRUMS también se asociaron con la calidad previa del sueño, la calidad de vida, la ingestión de líquidos, la dieta saludable, el

[Men of the sugarcane fields and their hospitals: the architecture of health under the Estado Novo].

PubMed

Monteiro, Marcia Rocha

2011-12-01

The article explores the emergence of an architectural heritage in the realm of healthcare assistance for workers in the sugarcane agroindustry in Brazil following enactment of the law known as the Estatuto da Lavoura Canavieira (1941), under the auspices of the Instituto do Açúcar e do Álcool and as part of Estado Novo policies (1937-1945). The institute proposed solutions based on surveys conducted at sugarcane mills in cane-producing states and on the medical and hospital system adopted by the institute's enlightened bureaucracy in the 1940s, which took the U.S. system as its model. Special focus is given to the central hospitals in Pernambuco and especially in Alagoas, which opposed institute guidelines.

33 CFR 110.65 - Indian River Bay, Del.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Indian River Bay, Del. 110.65 Section 110.65 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.65 Indian River Bay, Del. Beginning at a point bearing...

Argentina; A country profile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This paper reports that like so many other countries, Argentina is in the throes of privatization and restructuring of its economic programs. This has had a direct effect on the LPG industry. Argentina is a country with many natural resources. However, natural gas and crude, while present, are not in abundance. Imports of these and their associated products are needed to satisfy the growing need of the population from time to time. This is especially true with LPGs. Production of the fuel averages about 1 million tons, not enough to satisfy internal needs in the winter but enough to permitmore » some exports in the summer to nearby Brazil. The Country's Congress approved a plan to sell-off or lease parts of the natural gas distribution network and other businesses of Gas del Estado. Subsequent new legislation has called for ten new natural gas distribution zones. Included in the sell-off is the company's propane distribution division. What is left of Gas del Estado and YPF will become a corporation in the true sense of the word. Stocks in YPF are to be sold to the public.« less

33 CFR 110.65 - Indian River Bay, Del.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Indian River Bay, Del. 110.65... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.65 Indian River Bay, Del. Beginning at a point bearing... State highway bridge across Indian River Inlet; thence 174°, 600 feet; thence 264°, 800 feet; thence 354...

33 CFR 110.65 - Indian River Bay, Del.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Indian River Bay, Del. 110.65... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.65 Indian River Bay, Del. Beginning at a point bearing... State highway bridge across Indian River Inlet; thence 174°, 600 feet; thence 264°, 800 feet; thence 354...

33 CFR 110.65 - Indian River Bay, Del.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Indian River Bay, Del. 110.65... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.65 Indian River Bay, Del. Beginning at a point bearing... State highway bridge across Indian River Inlet; thence 174°, 600 feet; thence 264°, 800 feet; thence 354...

33 CFR 110.65 - Indian River Bay, Del.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Indian River Bay, Del. 110.65... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.65 Indian River Bay, Del. Beginning at a point bearing... State highway bridge across Indian River Inlet; thence 174°, 600 feet; thence 264°, 800 feet; thence 354...

Epidemic hecatomb in the New World.

PubMed

Naranjo, P

1992-01-01

The American population developed, during thousands of years, free of epidemics that had been attacking Europe, Asia and Africa. The European and African migrations, after Columbus's first trip, produced an epidemic invasion of influenza, smallpox, measles, yellow fever, malaria, diphtheria, typhus, and other diseases that attacked the immunologically virgin populations and produced a very high mortality, with a diminution of the indigenous population of more than 90% in many places. According to historical evidence, the first epidemic was influenza, produced by swine strain of virus, immediately followed by smallpox. The Spaniards mated freely with the Indians producing a mixed race called the Mestizo, who were immunologically more capable of defending themselves against various viruses, bacteria, and parasites brought over from the Old World. Marriage between the races also was sanctioned by Queen Isabella (1503) and Fernando I (1515). With these new genetic immunologic defenses against infections, the Mestizo eventually made up the majority of the population of Indians in the New World.

Periodontal microbiology in Latin America.

PubMed

Contreras, Adolfo; Moreno, Sandra M; Jaramillo, Adriana; Pelaez, Melissa; Duque, Andres; Botero, Javier E; Slots, Jørgen

2015-02-01

This review article describes the microbiota associated with periodontal disease in Latin America. This vast territory includes 22 nations, which show great ethnic diversity, with large groups of White people, Black people, Mestizo people and Native people. Widespread poverty and limited access to education and health-care services, including periodontal care, are prominent predisposing factors for destructive periodontal disease in Latin America. Black people and Mestizo people seem to have particularly severe periodontal disease and are frequently colonized by the major periodontal pathogens Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. The 'red complex' bacterial pathogens and A. actinomycetemcomitans predominate in chronic and aggressive periodontitis, but gram-negative enteric rods and herpesviruses can also play important periodontopathic roles in Latin America. The key to minimizing the risk of periodontal disease is control of the pathogens, and new low-cost periodontal treatments deserve serious consideration in Latin America. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Del-1 Expression as a Potential Biomarker in Triple-Negative Early Breast Cancer.

PubMed

Lee, Soo Jung; Lee, Jeeyeon; Kim, Wan Wook; Jung, Jin Hyang; Park, Ho Yong; Park, Ji-Young; Chae, Yee Soo

2018-01-01

A differential diagnostic role for plasma Del-1 was proposed for early breast cancer (EBC) in our previous study. We examined tumoral Del-1 expression and analyzed its prognostic impact among patients with EBC. Del-1 mRNA expression was assessed in breast epithelial and cancer cells. Meanwhile, the tumoral expression of Del-1 was determined based on tissue microarrays and immunohistochemistry results from 440 patients. While a high Del-1 mRNA expression was found in all the breast cancer cell lines, the expression was significantly higher in MDA-MB-231. Tumoral expression of Del-1 was also significantly associated with a negative expression of estrogen receptor or progesterone receptor, and low expression of Ki-67, particularly in the case of triple-negative breast cancer (TNBC) (p < 0.036). Furthermore, a correlation was found between Del-1 expression and an aggressive histological grade, nuclear mitosis, and polymorphism, suggesting a possible role in tumor progression. In the survival analysis, a worse distant disease-free survival trend was noted for the group overexpressing Del-1. While all the investigated breast cancer cell lines exhibited Del-1 expression, the expression rate and intensity were specifically prominent in TNBC. In addition, based on its relationship to an unfavorable histology and worse survival trend, Del-1 could act as a molecular target in TNBC patients. © 2018 S. Karger AG, Basel.

A Study of Fire Hazards from Combustible Ammunition: Effects of Scale and Confinement

DTIC Science & Technology

1984-12-01

2268 171 02 Solna, Sweden Major Vincente Garcia Estado Major del Ejercito Division de Logistica Calle Prim. Madrid, Spain ...distance standards and classification test procedures for munition items in storage and transport with particular emphasis on items that present mainly...Operations 3 National Defence Headquarters 191 Colonel By Drive Ottawa, Ontario, Canada K1A 0K2 Cdt. P. Denecker Centre Logistique de la Force Terrestre

Manufacturing Methods and Technology Program for Ruggedized Tactical Fiber Optic Cable.

DTIC Science & Technology

1979-10-26

cores manufactured on this unit since the improvements were incorporated. An automatic diameter control unit with a laser micrometer sensor has been...fiber optic sensor systems for the TACA-MO aircraft and power encoding, an 18-port single fiber data bus for the Autonetics information transfer...echnica del Estado, Santiago, Chile in 1958. He received a degree in Industrial Chemical Engineering from Escuela de Ingenieros Industriales , Santiago

Ahorre Energía: Consejos para ahorro dinero y energía en su hogar (Spanish Brochure), Energy Saver Guide (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

La versión en castellano de la guía del Departamento de Energía de los Estados Unidos que ayuda a consumidores a ahorrar energía y dinero en su hogar y en las carreteras. The Spanish-language version of U.S. Department of Energy's Energy Saver consumer guide to saving energy and money at home and on the road.

Forensic applicability of multi-allelic InDels with mononucleotide homopolymer structures.

PubMed

Zhang, Shu; Zhu, Qiang; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Yang, Yiwen; Gao, Zehua; Fang, Ting; Wang, Yufang; Zhang, Ji

2018-04-27

Insertion/deletion polymorphisms (InDels), which possess the characteristics of low mutation rates and a short amplicon size, have been regarded as promising markers for forensic DNA analysis. InDels can be classified as bi-allelic or multi-allelic, depending on the number of alleles. Many studies have explored the use of bi-allelic InDels in forensic applications, such as individual identification and ancestry inference. However, multi-allelic InDels have received relatively little attention. In this study, InDels with 2-6 alleles and a minor allele frequency ≥0.01, in Chinese Southern Han (CHS), were retrieved from the 1000 Genomes Project Phase III. Based on the structural analysis of all retrieved InDels, 17 multi-allelic markers with mononucleotide homopolymer structures were selected and combined in one multiplex PCR reaction system. Sensitivity, species specificity and applicability in forensic case work of the multiplex were analyzed. A total of 218 unrelated individuals from a Chinese Han population were genotyped. The combined discriminatory power (CDP), the combined match probability (CMP) and the cumulative probability of exclusion (CPE) were 0.9999999999609, 3.91E-13 and 0.9956, respectively. The results demonstrated that this InDel multiplex panel was highly informative in the investigated population and most of the 26 populations of the 1000 Genomes Project. The data also suggested that multi-allelic InDel markers with monomeric base pair expansions are useful for forensic applications. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The Role of Learning Strategies in Second Language Acquisition: Strategy Use by Students of English

DTIC Science & Technology

1987-01-01

pasar y pienso en lo dema’s y si me puede recordar de vuelta, o sea, me trato de grabar la palabra pero sigo con la lectura . Entonces le entiendo lo... la soluccion del problema. If you’re thinking of a picture, say so. If you’re thinking about something A-i -IW ~ 4w’ ~~~~~~~~~’ u~~~~~~~’V17-6,r P ’W...del Estado de Michoacan, el 25% de los pobladores se dedican a la alfarerifa. - -Cuantos habitantes de esta pequena poblaci6n son alfareros? CHAVE THE

The Hispanicization of the United States.

ERIC Educational Resources Information Center

Nostrand, Richard L.

Two strikingly contrasting culture groups, Latin Americans and Anglo Americans, overlap in a Borderlands that straddles the international boundary between the United States and Mexico. This overlap began with the Aztec conquest by Cortes which triggered the intermixing and miscegenation between Spaniards and Indians that produced a mestizo people…

High‐altitude ancestry protects against hypoxia‐associated reductions in fetal growth

PubMed Central

Julian, Colleen Glyde; Vargas, Enrique; Armaza, J Fernando; Wilson, Megan J; Niermeyer, Susan; Moore, Lorna G

2007-01-01

Objective The chronic hypoxia of high‐altitude (⩾2500 m) residence has been shown to decrease birth weight in all populations studied to date. However, multigenerational high‐altitude populations appear protected relative to newcomer groups. This study aimed to determine whether such protection exists independently of other factors known to influence fetal growth and whether admixed populations (ie, people having both high‐ and low‐altitude ancestry) show an intermediate level of protection. Design 3551 medical records from consecutive deliveries to Andean, European or Mestizo (ie, admixed) women at low, intermediate or high altitudes in Bolivia were evaluated for maternal characteristics influencing fetal growth as measured by birth weight and the frequency of small for gestational age births (SGA or ⩽10th percentile birth weight for gestational age and sex). Two‐way analysis of variance and χ2 tests were used to compare maternal and infant characteristics. The effects of ancestry or altitude on SGA and birth weight were assessed using logistic or linear regression models, respectively. Results Altitude decreased birth weight and increased SGA in all ancestry groups. Andean infants weighed more and were less often SGA than Mestizo or European infants at high altitude (13%, 16% and 33% respectively, p<0.01). After accounting for the influences of maternal hypertensive complications of pregnancy, parity, body weight, and number of prenatal visits, European relative to Andean ancestry increased the frequency of SGA at high altitude nearly fivefold. Conclusions Andean relative to European ancestry protects against altitude‐associated reductions in fetal growth. The intermediate protection seen in the admixed (Mestizo) group is consistent with the influence of genetic or other Andean‐specific protective characteristics. PMID:17329275

Effects of ethnic attributes on the quality of family planning services in Lima, Peru: a randomized crossover trial.

PubMed

Planas, Maria-Elena; García, Patricia J; Bustelo, Monserrat; Carcamo, Cesar P; Martinez, Sebastian; Nopo, Hugo; Rodriguez, Julio; Merino, Maria-Fernanda; Morrison, Andrew

2015-01-01

Most studies reporting ethnic disparities in the quality of healthcare come from developed countries and rely on observational methods. We conducted the first experimental study to evaluate whether health providers in Peru provide differential quality of care for family planning services, based on the indigenous or mestizo (mixed ethnoracial ancestry) profile of the patient. In a crossover randomized controlled trial conducted in 2012, a sample of 351 out of the 408 public health establishments in Metropolitan Lima, Peru were randomly assigned to receive unannounced simulated patients enacting indigenous and mestizo profiles (sequence-1) or mestizo and then indigenous profiles (sequence-2), with a five week wash-out period. Both ethnic profiles used the same scripted scenario for seeking contraceptive advice but had distinctive cultural attributes such as clothing, styling of hair, make-up, accessories, posture and patterns of movement and speech. Our primary outcome measure of quality of care is the proportion of technical tasks performed by providers, as established by Peruvian family planning clinical guidelines. Providers and data analysts were kept blinded to the allocation. We found a non-significant mean difference of -0.7% (p = 0.23) between ethnic profiles in the percentage of technical tasks performed by providers. However we report large deficiencies in the compliance with quality standards of care for both profiles. Differential provider behaviour based on the patient's ethnic profiles compared in the study did not contribute to deficiencies in family planning outcomes observed. The study highlights the need to explore other determinants for poor compliance with quality standards, including demand and supply side factors, and calls for interventions to improve the quality of care for family planning services in Metropolitan Lima.

Design, aerodynamics and autonomy of the DelFly.

PubMed

de Croon, G C H E; Groen, M A; De Wagter, C; Remes, B; Ruijsink, R; van Oudheusden, B W

2012-06-01

One of the major challenges in robotics is to develop a fly-like robot that can autonomously fly around in unknown environments. In this paper, we discuss the current state of the DelFly project, in which we follow a top-down approach to ever smaller and more autonomous ornithopters. The presented findings concerning the design, aerodynamics and autonomy of the DelFly illustrate some of the properties of the top-down approach, which allows the identification and resolution of issues that also play a role at smaller scales. A parametric variation of the wing stiffener layout produced a 5% more power-efficient wing. An experimental aerodynamic investigation revealed that this could be associated with an improved stiffness of the wing, while further providing evidence of the vortex development during the flap cycle. The presented experiments resulted in an improvement in the generated lift, allowing the inclusion of a yaw rate gyro, pressure sensor and microcontroller onboard the DelFly. The autonomy of the DelFly is expanded by achieving (1) an improved turning logic to obtain better vision-based obstacle avoidance performance in environments with varying texture and (2) successful onboard height control based on the pressure sensor.

Funciones de partición atómicas: Fuentes confiables de datos

NASA Astrophysics Data System (ADS)

Merlo, D. C.; Milone, L. A.

Se llevó a cabo una revisión minuciosa del cálculo de funciones de partición atómicas de átomos livianos, en estados neutro y una vez ionizados, partiendo del Hidrógeno y llegando al Sodio, incluyendo también al K I y el Ca II. Al respecto, se realizó una investigación exhaustiva de referencias bibliográficas existentes hasta el presente, las cuales fueron cotejadas con cálculos propios llevados a cabo mediante el procedimiento de depresión del contínuo (0.001 a 0.5 eV). Nuestros resultados muestran un muy buen acuerdo con las expresiones interpolatorias de Traving et al (1966), al presente, la referencia más completa en cuanto a especies atómicas consideradas. Puntualizamos, además, ciertas deficiencias de estas relaciones de ajuste para decrementos del potencial de ionización altos (Δ χ >= 0.5) eV).

Mejoras en la exactitud del reloj de ángulo horario del telescopio de 2,15 mts de CASLEO

NASA Astrophysics Data System (ADS)

Aballay, J. L.; Pereyra, P. F.; Marún, A. H.

Para aumentar la exactitud en el control del ángulo horario del telescopio, se está implementando el uso de un reloj con una precisión de 1/100 seg. En conjunto con el encoder que otorga la posición con un acierto de 0,012 seg. de arco, se podrá implementar otro dígito en el reloj de ángulo horario con la posibilidad de ver las décimas. Esto, sumado a la precisión ya lograda en declinación, permitirá realizar offsets con mayor exactitud.

Estudio comparativo de las moléculas isovalentes de interés atmosférico CF3Cl y CF3Br y sus correspondientes halógenos aislados Cl y Br.

NASA Astrophysics Data System (ADS)

Mayor, E.; Velasco, A. M.; Martín, I.; Lavín, C.

Los estados Rydberg moleculares han suscitado en los últimos años un creciente interés entre los espectroscopistas experimentales, motivado en parte por el desarrollo de nuevas técnicas espectroscópicas capaces de investigar estos estados altamente excitados electrónicamente. Los procesos de fotoabsorción que implican estados Rydberg en los derivados halogenados del metano son de gran importancia, debido a su abundancia en la atmósfera y a sus implicaciones medioambientales. Por ello, la obtención de datos relativos a sus fuerzas de oscilador es de gran interés. En este trabajo se aborda el estudio de dichas propiedades para las moléculas isovalentes CF3Cl y CF3Br. Ambas moléculas presentan idéntica estructura electrónica para el estado fundamental por lo que se espera que sus espectros Rydberg presenten grandes similitudes, en ausencia de perturbaciones. Por ello y dada la escasez de datos relativos a fuerzas de oscilador, hemos establecido la corrección de nuestros resultados en base a las analogías esperadas en las intensidades espectrales correspondientes a transiciones análogas. Por otro lado, Novak y col. [1] han encontrado experimentalmente un marcado carácter atómico en el espectro correspondiente a estas moléculas, siendo muy similar a los de los átomos de Cl y Br. Por ello en el presente trabajo, además de establecer la comparación entre ambas moléculas hemos buscado las similitudes con sus respectivos halógenos. Los cálculos relativos a las especies moleculares se han realizado utilizando la Metodología Molécular de Orbítales de Defecto Cuántico (MQDO) [2], mientras que para el estudio de los átomos de Cl y Br se empleó la versión relativista del método (RQDO) [3].

Case Study: del Amo Bioventing

EPA Science Inventory

The attached presentation discusses the fundamentals of bioventing in the vadose zone. The basics of bioventing are presented. The experience to date with the del Amo Superfund Site is presented as a case study.

Nicaragua: Educational Policy for Ethnic Minorities.

ERIC Educational Resources Information Center

Rippberger, Susan

Since taking power, the Sandinista government has made a commitment to educating all Nicaraguans. Under its direction, literacy increased from approximately 50 to 88 percent. Thousands of new teachers were hired, and the number of elementary schools doubled. The official language is Spanish, and the dominant culture, Mestizo (mixed Spanish and…

Resist This! Embodying the Contradictory Positions and Collective Possibilities of Transformative Resistance

ERIC Educational Resources Information Center

Quijada Cerecer, David Alberto; Cahill, Caitlin; Bradley, Matt

2011-01-01

Youth participatory action research (YPAR) and arts-informed approaches reflect a source of critical resistance at the intersection of theory and practice (praxis). Our discussion draws upon "Mestizo Arts & Activism" ("MAA"), a participatory action research collective made up of young people who focused their research on the educational rights of…

Let Jorge Do It: An Approach to Rural Nonformal Education.

ERIC Educational Resources Information Center

Hoxeng, James

Operating under the philosophy that people can learn from each other, the Nonformal Education Project trained 24 Ecuadorian campesinos in seven rural mestizo villages to instruct their peers in basic litaracy skills, negotiating techniques, and the development of self-esteem. Within a year of operation some of the original "facilitators"…

Mexico: The Crisis of Identity.

ERIC Educational Resources Information Center

Ewen, Alexander

1994-01-01

Examines the place of Indian people in Mexican society and politics, from the conquest to the 1994 Zapatista uprising in Chiapas (fueled by the threat to rural indigenous communal lands posed by economic reforms). Although Indianness is celebrated as contributing to the idealized mestizo "race," self-identification as Indian threatens…

Amerindian and Translingual Literacies across Time and Space

ERIC Educational Resources Information Center

Coronel-Molina, Serafín M.; Cowan, Peter M.

2017-01-01

Recent studies have examined Indigenous and mestizo communities that engage in social practices of transculturated, Amerindian and translingual literacies, often to resist efforts by powerful groups to oppress them. By drawing on data from studies conducted in Peru and the United States, we trace the trajectories of Amerindian and translingual…

Percepcion de los profesores universitarios acerca del concepto cultura cientifica y de sus implicaciones en el nuevo bachillerato del Recinto de Rio Piedras de la Universidad de Puerto Rico

NASA Astrophysics Data System (ADS)

Ramos Pastrana, Nilsa

El Senado Academico del Recinto de Rio Piedras de la Universidad de Puerto Rico aprobo en el ano academico 2005-2006 la Certificacion 46, que contiene los lineamientos de un nuevo bachillerato. Este nuevo bachillerato introdujo cambios significativos en el curriculo tradicional. Entre ellos se encuentra la reduccion del componente de educacion general y el de Ciencias Biologicas en particular. La reduccion de creditos en el componente de Ciencias Biologicas ha obligado a reevaluar el concepto de cultura cientifica que desarrollan esos cursos. El proposito del estudio consistio en auscultar las percepciones de los profesores de las Facultades de Administracion de Empresas, Humanidades, Ciencias Sociales, Ciencias Naturales, Educacion y Estudios Generales del Recinto de Rio Piedras de la Universidad de Puerto Rico en torno al concepto de cultura cientifica, los contenidos disciplinares del curso de Ciencias Biologicas y la reduccion de creditos en el nuevo bachillerato. Las preguntas que guiaron la investigacion fueron: ¿cuales son las percepciones que tienen los profesores de las Facultades de Administracion de Empresas, Ciencias Sociales, Estudios Generales, Ciencias Naturales, Humanidades y Educacion, en torno al concepto de cultura cientifica y los contenidos disciplinares del curso de Ciencias Biologicas? ¿cuales son las percepciones que tienen los profesores de Ciencias Biologicas en torno al concepto cultura cientifica y los contenidos disciplinares del curso de Ciencias Biologicas? ¿existen diferencias significativas por facultad, genero, experiencia, rango y nombramiento en las percepciones que tienen los profesores del Recinto de Rio Piedras de la Universidad de Puerto Rico sobre los elementos que caracterizan la cultura cientifica y los contenidos biologicos que deben tener los egresados del Recinto? ¿que implicaciones curriculares tienen estos testimonios en el desarrollo del concepto de cultura cientifica en el nuevo bachillerato? Para realizar la

An evaluation of Delaware's DelTrac program : building an integrated transportation management system

DOT National Transportation Integrated Search

2004-06-01

The DelTrac deployment experience included both successes and unmet challenges. Programmatically, the DelTrac approach to managing ITS has been successful at creating a great deal of integration and cooperation between organizations at DelDOT. Stakeh...

El uso de la neuromodulación para el tratamiento del temblor

PubMed Central

Bendersky, Damián; Ajler, Pablo; Yampolsky, Claudio

2014-01-01

Introducción: El temblor puede ser un desorden incapacitante y el tratamiento de primera línea para estos pacientes es farmacológico. Sin embargo, este tratamiento puede llevar a una reducción satisfactoria del temblor en sólo el 50% de los pacientes con temblor esencial. La talamotomía era el tratamiento de elección para el temblor refractario al tratamiento médico hasta que comenzó a utilizarse la estimulación cerebral profunda (ECP) del núcleo ventral intermedio (Vim) del tálamo. En la actualidad, raramente se realiza la talamotomía. Métodos: Este artículo es una revisión no sistemática de las indicaciones, resultados, parámetros de programación y técnica quirúrgica de la ECP del Vim para el tratamiento del temblor. Resultados: Aunque los resultados clínicos son similares usando la talamotomía o la ECP del Vim, la primera causa más efectos adversos que la última. Además, la ECP puede ser usada bilateralmente, mientras que la talamotomía tiene un alto riesgo de causar disartria cuando se realiza de ambos lados. La ECP del Vim logró una adecuada mejoría del temblor en varias series de pacientes con temblor causado por temblor esencial, enfermedad de Parkinson o esclerosis múltiple. Además del Vim, hay otros blancos que están siendo usados por varios autores, tales como la zona incerta y las radiaciones prelemniscales. Conclusión: La ECP del Vim es un tratamiento útil para el temblor incapacitante refractario al tratamiento médico. Es esencial realizar una precisa selección de pacientes, así como utilizar una técnica quirúrgica correcta. Aún se desconoce el mejor blanco estereotáctico para el temblor, aunque el Vim es el más usado. PMID:25165613

New gas-pipeline system planned for Argentina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrich, V.

1979-03-01

A new gas-pipeline system planned for Argentina by Gas del Estado will carry up to 10 million cu m/day to Mendoza, San Juan, and San Luis from the Neuquen basin. Operating on a toll system of transport payment, the Centro-Oeste pipeline system will consist of 1100 km of over 30 in. dia trunk line and 600 km of 8, 12, and 18 in. dia lateral lines.

JPRS Report, Environmental Issues

DTIC Science & Technology

1991-06-26

been coordinated by the National Environ- mental Policy Commission [Comision Nacional de Politica Ambiental ]. The first step was the creation of a...May 91 [Text] Santiago, 30 May (EFE)—The Permanent South Pacific Commission (CPPS), which comprises Colombia, Chile, Ecuador , and Peru, has lodged a...decisions. We are adopting measures that will create the State Secretariat for the Environment [Secretaria de Estado del Medio Ambiente ], which will be

CHEK2 1100delC and male breast cancer in the Netherlands.

PubMed

Wasielewski, Marijke; den Bakker, Michael A; van den Ouweland, Ans; Meijer-van Gelder, Marion E; Portengen, Henk; Klijn, Jan G M; Meijers-Heijboer, Hanne; Foekens, John A; Schutte, Mieke

2009-07-01

Mutations in the breast cancer susceptibility genes BRCA1, BRCA2, and CHEK2 are known risk factors for female breast cancer. Mutations in BRCA1 and BRCA2 also are associated with male breast cancer (MBC). Similarly, it had been suggested in the original CHEK2 identification report that the CHEK2 1100delC mutation confers an increased risk for MBC. Here, we have evaluated the risk of CHEK2 1100delC for MBC by genotyping CHEK2 1100delC in 23 familial and 71 unselected Dutch MBC cases. None of the 23 familial MBC cases carried the CHEK2 1100delC mutation. In contrast, CHEK2 1100delC was present in 3 of the 71 (4.2%) unselected MBC cases, which was significantly more prevalent than the 1.1% Dutch population frequency assessed in 1,692 individuals (P = 0.05, OR = 4.1, 95% CI 1.2-14.3). Our data suggest that, in the Netherlands, CHEK2 1100delC is associated with an increased risk for MBC.

Field measurements of del13C in ecosystem respiration

NASA Astrophysics Data System (ADS)

van Asperen, Hella; Sabbatini, Simone; Nicolini, Giacomo; Warneke, Thorsten; Papale, Dario; Notholt, Justus

2014-05-01

Stable carbon isotope del13C-measurements are extensively used to study ecological and biogeochemical processes in ecosystems. Above terrestrial ecosystems, atmospheric del13C can vary largely due to photosynthetic fractionation. Photosynthetic processes prefer the uptake of the lighter isotope 12C (in CO2), thereby enriching the atmosphere in 13C and depleting the ecosystem carbon. At night, when ecosystem respiratory fluxes are dominant, 13C-depleted CO2 is respired and thereby depletes the atmospheric del13C-content. Different ecosystems and different parts of one ecosystem (type of plant, leaves, and roots) fractionate and respire with a different del13C-ratio signature. By determining the del13C-signature of ecosystem respiration in temporal and spatial scale, an analysis can be made of the composition of respiratory sources of the ecosystem. A field study at a dry cropland after harvest (province of Viterbo, Lazio, Italy) was performed in the summer of 2013. A FTIR (Fourier Transform Infrared Spectrometer) was set up to continuously measure CO2-, CH4-, N2O-, CO- and del13C-concentrations. The FTIR was connected to 2 different flux measurements systems: a Flux Gradient system (sampling every half hour at 1.3m and 4.2m) and 2 flux chambers (measured every hour), providing a continuous data set of the biosphere-atmosphere gas fluxes and of the gas concentrations at different heights. Keeling plot intercept values of respiratory CO2, measured by the Flux Gradient system at night, were determined to be between -25‰ and -20‰. Keeling plot intercept values of respiratory CO2, measured by the flux chamber system, varied between -24‰ and -29‰, and showed a clear diurnal pattern, suggesting different (dominant) respiratory processes between day and night.

Nuevos sistemas de frecuencia intermedia para el IAR

NASA Astrophysics Data System (ADS)

Olalde, J. C.; Perilli, D.; Larrarte, J. J.

Se presenta el diagrama en bloques de los nuevos sistemas de Frecuencia Intermedia para los dos radiómetros instalados en el IAR. Entre las características más importantes del sistema podemos mencionar la posibilidad de conectar cualquiera de las dos antenas a los ``backend" disponibles: analizador espectral de alta resolución (META II) de 0,05 Hz, autocorrelador de 1008 canales y contínuo. Se incorporan al sistema nuevos sintetizadores de frecuencia implementados con PLL y la moderna técnica de síntesis digital directa. Por último, el conjunto del sistema es susceptible de ser configurado por las computadoras de adquisición de datos, supervisadas por otra, que entrega el estado de funcionamiento actual y evita la selección de configuraciones incorrectas por parte del usuario.

[Strengths and future of the Revista Médica del Instituto Mexicano del Seguro Social].

PubMed

Fajardo-Dolci, Germán

2014-01-01

The journals of medicine arose as a communication tool more than 200 years ago. At the beginning, their nature was local; later, their aim was to spread medical information along the nation; and, finally, they sought to reach the world distribution. The Revista Médica del Instituto Mexicano del Seguro Social was published for the first time 52 years ago, and it has walked its way from local to international distribution. This journal has 23 000 subscribers, it is included in Medline and it reached a 0.112 SCImago Journal Rank in 2012. Its website receives around 200 000 visits monthly and 45 % are foreign visits. In the future, the peer review system is going to be strengthened, and the journal is going to offer audio, video, and applications to reinforce interactive participation between authors, readers in order to reach modernity and draw young new attention.

Teaching English Critically to Mexican Children

ERIC Educational Resources Information Center

López-Gopar, Mario E.

2014-01-01

The purpose of this article is to present one significant part of a large-scale critical-ethnographic-action-research project (CEAR Project) carried out in Oaxaca, Mexico. The overall CEAR Project has been conducted since 2007 in different Oaxacan elementary schools serving indigenous and mestizo (mixed-race) children. In the CEAR Project, teacher…

Historical Development of the Concept of the Multicultural Personality: A Mixed Ethnic Heritage Perspective.

ERIC Educational Resources Information Center

Ramirez, Manuel, III

The Mestizo (mixed ethnic heritage) Civil Rights Movement in the United States can be divided into five phases: Pre-Civil Rights, Civil Rights, Bilingual-Multicultural Education, Political Conservatism, and the current period, an Assault on Civil Rights. The paper describes how a personal research career has been influenced by the different stages…

Schooling, Environment and Cognitive Development: A Cross-Cultural Study.

ERIC Educational Resources Information Center

Stevenson, Harold W.; And Others

1978-01-01

Investigated the influence of schooling and environment on young children's memory and cognitive skills. Subjects were five- and six-year-old Mestizo and Quechua Indian children living in jungle villages or city slums in Peru. Samples of upper-middle-class children in Lima and poor children in Detroit were also tested. (JMB)

Pastoral del Nino: Bringing the Abundant Life to Paraguayan Children

ERIC Educational Resources Information Center

Austin, Ann Berghout; Aquino, Cyle; Burro, Elizabeth

2007-01-01

Pastoral del Nino is transforming children's lives in rural Paraguay. Part of Pastoral Social (Catholic Social Services), Pastoral del Nino's primary focus is to bring "vida en abundancia" (the abundant life) to families by ensuring that mothers survive childbirth and children reach their first birthdays. In addition, the organization…

Features associated with hematologic abnormalities and their impact in patients with systemic lupus erythematosus: Data from a multiethnic Latin American cohort.

PubMed

González-Naranjo, Luis A; Betancur, Octavio Martínez; Alarcón, Graciela S; Ugarte-Gil, Manuel F; Jaramillo-Arroyave, Daniel; Wojdyla, Daniel; Pons-Estel, Guillermo J; Rondón-Herrera, Federico; Vásquez-Duque, Gloria M; Quintana-López, Gerardo; Da Silva, Nilzio A; Tavares Brenol, João C; Reyes-Llerena, Gil; Pascual-Ramos, Virginia; Amigo, Mary C; Massardo, Loreto; Alfaro-Lozano, José; Segami, María I; Esteva-Spinetti, María H; Iglesias-Gamarra, Antonio; Pons-Estel, Bernardo A

2016-06-01

To examine hematological manifestations' correlates and their impact on damage accrual and mortality in SLE patients from the multiethnic, Latin American, GLADEL cohort. In patients with recent SLE diagnosis (≤2 years), the association between follow-up hematological manifestations (per ACR criteria) and socio-demographic and clinical variables was examined by univariable and multivariable logistic regressions; their impact on damage accrual and mortality was examined by Poisson and Cox proportional-hazards regression analyses, respectively. Of 1437 patients, 948 (66.0%) developed ≥1 hematological manifestation [5.5% hemolytic anemia (AHA), 16.3% thrombocytopenia, and 56.4% lymphopenia] over 4.3 (3.3) follow-up years. Younger age, Mestizo ethnicity, hematologic disorder (at/or before SLE diagnosis), and first damage recorded were associated with hematological manifestations while antimalarials were negatively associated. AHA (at/or before SLE diagnosis), anti-Sm, and anti-RNP antibodies were associated with subsequent AHA occurrence while musculoskeletal involvement was negatively associated. Thrombocytopenia (at/or before SLE diagnosis), AHA, anti-phospholipid antibodies (aPLs), anti-SSA/Ro, anti-SSB/La antibodies, and first damage recorded were associated with later thrombocytopenia occurrence. Lymphopenia (at/or before SLE diagnosis), younger age at diagnosis, Mestizo ethnicity, having medical insurance, and first damage recorded were associated with subsequent lymphopenia occurrence while antimalarials and azathioprine treatment were negatively associated. AHA was associated with damage accrual and mortality after adjusting for variables known to affect these outcomes. Mestizo ethnicity and early hematological manifestations are risk factors for their subsequent occurrence while antimalarials have a protective effect. The associations between AHA and aPLs and thrombocytopenia were corroborated. AHA contributes independently to damage accrual and diminished

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components

PubMed Central

Martínez-Hernández, Angélica; Córdova, Emilio J.; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals. PMID:25933176

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components.

PubMed

Martínez-Hernández, Angélica; Córdova, Emilio J; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals.

Effects of Ethnic Attributes on the Quality of Family Planning Services in Lima, Peru: A Randomized Crossover Trial

PubMed Central

Planas, Maria-Elena; García, Patricia J.; Bustelo, Monserrat; Carcamo, Cesar P.; Martinez, Sebastian; Nopo, Hugo; Rodriguez, Julio; Merino, Maria-Fernanda; Morrison, Andrew

2015-01-01

Most studies reporting ethnic disparities in the quality of healthcare come from developed countries and rely on observational methods. We conducted the first experimental study to evaluate whether health providers in Peru provide differential quality of care for family planning services, based on the indigenous or mestizo (mixed ethnoracial ancestry) profile of the patient. In a crossover randomized controlled trial conducted in 2012, a sample of 351 out of the 408 public health establishments in Metropolitan Lima, Peru were randomly assigned to receive unannounced simulated patients enacting indigenous and mestizo profiles (sequence-1) or mestizo and then indigenous profiles (sequence-2), with a five week wash-out period. Both ethnic profiles used the same scripted scenario for seeking contraceptive advice but had distinctive cultural attributes such as clothing, styling of hair, make-up, accessories, posture and patterns of movement and speech. Our primary outcome measure of quality of care is the proportion of technical tasks performed by providers, as established by Peruvian family planning clinical guidelines. Providers and data analysts were kept blinded to the allocation. We found a non-significant mean difference of -0·7% (p = 0·23) between ethnic profiles in the percentage of technical tasks performed by providers. However we report large deficiencies in the compliance with quality standards of care for both profiles. Differential provider behaviour based on the patient's ethnic profiles compared in the study did not contribute to deficiencies in family planning outcomes observed. The study highlights the need to explore other determinants for poor compliance with quality standards, including demand and supply side factors, and calls for interventions to improve the quality of care for family planning services in Metropolitan Lima. PMID:25671664

Influence of School and Environment on Selective Memory.

ERIC Educational Resources Information Center

Wilkinson, Alex; And Others

1979-01-01

Subjects were 943 mestizo and Quechua Indian children aged five and six years who lived in jungle villages near Lanas and in slum settlements in Lima, Peru. Some six year olds attended school and others did not. The children were tested with a task that assessed memory for central and incidental features of drawings. (JMB)

Perk Ablation Ameliorates Myelination in S63del-Charcot–Marie–Tooth 1B Neuropathy

PubMed Central

Musner, Nicolò; Sidoli, Mariapaola; Zambroni, Desireè; Del Carro, Ubaldo; Ungaro, Daniela; D’Antonio, Maurizio; Feltri, Maria L.

2016-01-01

In peripheral nerves, P0 glycoprotein accounts for more than 20% of myelin protein content. P0 is synthesized by Schwann cells, processed in the endoplasmic reticulum (ER) and enters the secretory pathway. However, the mutant P0 with S63 deleted (P0S63del) accumulates in the ER lumen and induces a demyelinating neuropathy in Charcot–Marie–Tooth disease type 1B (CMT1B)–S63del mice. Accumulation of P0S63del in the ER triggers a persistent unfolded protein response. Protein kinase RNA-like endoplasmic reticulum kinase (PERK) is an ER stress sensor that phosphorylates eukaryotic initiation factor 2 alpha (eIF2alpha) in order to attenuate protein synthesis. We have shown that increasing phosphophorylated-eIF2alpha (P-eIF2alpha) is a potent therapeutic strategy, improving myelination and motor function in S63del mice. Here, we explore the converse experiment: Perk haploinsufficiency reduces P-eIF2alpha in S63del nerves as expected, but surprisingly, ameliorates, rather than worsens S63del neuropathy. Motor performance and myelin abnormalities improved in S63del//Perk+/− compared with S63del mice. These data suggest that mechanisms other than protein translation might be involved in CMT1B/S63del neuropathy. In addition, Perk deficiency in other cells may contribute to demyelination in a non–Schwann-cell autonomous manner. PMID:27095827

Hepatitis B virus infection in Latin America: A genomic medicine approach

PubMed Central

Roman, Sonia; Jose-Abrego, Alexis; Fierro, Nora Alma; Escobedo-Melendez, Griselda; Ojeda-Granados, Claudia; Martinez-Lopez, Erika; Panduro, Arturo

2014-01-01

Hepatitis B virus (HBV) infection is the leading cause of severe chronic liver disease. This article provides a critical view of the importance of genomic medicine for the study of HBV infection and its clinical outcomes in Latin America. Three levels of evolutionary adaptation may correlate with the clinical outcomes of HBV infection. Infections in Latin America are predominantly of genotype H in Mexico and genotype F in Central and South America; these strains have historically circulated among the indigenous population. Both genotypes appear to be linked to a benign course of disease among the native and mestizo Mexicans and native South Americans. In contrast, genotypes F, A and D are common in acute and chronic infections among mestizos with Caucasian ancestry. Hepatocellular carcinoma is rare in Mexicans, but it has been associated with genotype F1b among Argentineans. This observation illustrates the significance of ascertaining the genetic and environmental factors involved in the development of HBV-related liver disease in Latin America, which contrast with those reported in other regions of the world. PMID:24966588

Epidemiology of diabetes mellitus in Mexico.

PubMed

Bello-Chavolla, Omar Y; Rojas-Martinez, Rosalba; Aguilar-Salinas, Carlos A; Hernández-Avila, Mauricio

2017-01-01

Type 2 diabetes is the main health problem in Mexico. The large and growing number of cases and the remarkable economic impact of the disease support this statement. The condition is expressed at an earlier age and at a lower body mass index in Mexican mestizos compared with the age and body mass index reported in Caucasians. In addition, Mexican mestizos have an increased susceptibility to developing diabetic nephropathy. The Mexican health system needs major adjustments in order to prevent and treat type 2 diabetes. Treatment is not currently based on the needs and expectations of the patient. As a result, it is insufficient, belated, and costly. Close to 20% of the preventable deaths in Mexico are caused by diabetes and related metabolic diseases. Even a small decrease in this rate could result in substantial savings for the Mexican healthcare system. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Plants used by native Amazonian groups from the Nanay River (Peru) for the treatment of malaria.

PubMed

Ruiz, Lastenia; Ruiz, Liliana; Maco, Martha; Cobos, Marianela; Gutierrez-Choquevilca, Andréa-Luz; Roumy, Vincent

2011-01-27

In order to evaluate the antimalarial potential of traditional remedies used in Peru, Indigenous and Mestizo populations from the river Nanay in Loreto were interviewed about traditional medication for the treatment of malaria. The survey took place on six villages and led to the collection of 59 plants. 35 hydro-alcoholic extractions were performed on the 21 most cited plants. The extracts were then tested for antiplasmodial activity in vitro on Plasmodium falciparum chloroquine resistant strain (FCR-3), and ferriprotoporphyrin inhibition test was also performed in order to assume pharmacological properties. Extracts from 9 plants on twenty-one tested (Abuta rufescens, Ayapana lanceolata, Capsiandra angustifolia, Citrus limon, Citrus paradise, Minquartia guianensis, Potalia resinífera, Scoparia dulcis, and Physalis angulata) displayed an interesting antiplasmodial activity (IC(50)<10 μg/ml) and 16 remedies were active on the ferriprotoporphyrin inhibition test. The results give scientific validation to the traditional medical knowledge of the Amerindian and Mestizo populations from Loreto and exhibit a source of potentially active plants. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

JPRS Report: Environmental Issues.

DTIC Science & Technology

1991-12-27

Officials Decry ’Internationalization’ of Amazon [O ESTADO DE SAO PAULO 11 Oct] 30 CHILE Study Reveals Carcinogen Content of Santiago’s Air [EL...first meeting was held in Vina del Mar, Chile , and the final two in Madrid, Spain. Mr. Naude Steyn, chief director of the Department of Foreign...is more important than a starving northeastern boy?" the general asked the audience, who applauded him. [passage omitted] CHILE Study Reveals

Crisis and Legitimacy: The Role of the Mexican Military in Politics and Society

DTIC Science & Technology

1990-01-01

Clark, ed. Las relaciones: Mdxico-Estados Unidos ( Lecturas 43). Mexico: Fondo de Cultura Econ6mica, 1981. Temas Mexicanos 2: IV informe del...rebellion heard throughout New Spain, and abroad. Hidalgo’s rebel army, la tropa insurgents (insurgent troops), was Mexico’s first popular armed force - a...opponents occurred over rumors of rebellion; such was the fate of General Garcia de la Cadena. State governors were all Porfirian appointees, trusted

Hollow Threats: Why Coercive Diplomacy Fails

DTIC Science & Technology

2015-06-01

IDE from the Curso del Estado Mayor de las Fuerzas Armadas in Madrid, Spain. Maj Schore has a bachelor’s degree in Economics from the University...this element presupposes that the nature of a liberal democracy not only reduces its credibility to administer a severe level of hurt, but damages...of resistance increased Aidid’s ability to portray his forces as national liberators and augmented his support among the Somali people.40 This

Multiplex pyrosequencing of InDel markers for forensic DNA analysis.

PubMed

Bus, Magdalena M; Karas, Ognjen; Allen, Marie

2016-12-01

The capillary electrophoresis (CE) technology is commonly used for fragment length separation of markers in forensic DNA analysis. In this study, pyrosequencing technology was used as an alternative and rapid tool for the analysis of biallelic InDel (insertion/deletion) markers for individual identification. The DNA typing is based on a subset of the InDel markers that are included in the Investigator ® DIPplex Kit, which are sequenced in a multiplex pyrosequencing analysis. To facilitate the analysis of degraded DNA, the polymerase chain reaction (PCR) fragments were kept short in the primer design. Samples from individuals of Swedish origin were genotyped using the pyrosequencing strategy and analysis of the Investigator ® DIPplex markers with CE. A comparison between the pyrosequencing and CE data revealed concordant results demonstrating a robust and correct genotyping by pyrosequencing. Using optimal marker combination and a directed dispensation strategy, five markers could be multiplexed and analyzed simultaneously. In this proof-of-principle study, we demonstrate that multiplex InDel pyrosequencing analysis is possible. However, further studies on degraded samples, lower DNA quantities, and mixtures will be required to fully optimize InDel analysis by pyrosequencing for forensic applications. Overall, although CE analysis is implemented in most forensic laboratories, multiplex InDel pyrosequencing offers a cost-effective alternative for some applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Trattamento del disturbo da uso di alcol da un punto di vista psicologico].

PubMed

Coriale, Giovanna; Fiorentino, Daniela; De Rosa, Francesca; Solombrino, Simona; Scalese, Bruna; Ciccarelli, Rosaria; Attilia, Fabio; Vitali, Mario; Musetti, Alessia; Fiore, Marco; Ceccanti, Mauro

2018-01-01

RIASSUNTO. L'elaborazione del piano di trattamento rappresenta un momento molto delicato e complesso del processo terapeutico del disturbo da abuso di alcol (DUA). È la fase in cui le informazioni raccolte da un'équipe di professionisti (medici, psicologi e assistenti sociali) (modello bio-psico-sociale del DUA) vengono messe insieme per decidere il percorso terapeutico più adatto. Per quanto riguarda la parte psicologica, è di notevole importanza scegliere un trattamento clinico in grado di ridurre al minimo la mancata adesione al trattamento e, per i soggetti che rimangono in trattamento, di garantirne l'efficacia. Se da una parte, le tecniche psicoanalitiche e comportamentali hanno fornito le basi della terapia psicologica dell'alcolismo, dall'altra, gli approcci basati sull'evidenza scientifica sono stati elaborati a partire dai principi del colloquio motivazionale e della terapia cognitivo-comportamentale. In questo articolo viene fornita una panoramica dei trattamenti che sono risultati più efficaci nel trattare il DUA e delle modalità temporali più adeguate per monitorare l'efficacia del trattamento.

Multi-InDel Analysis for Ancestry Inference of Sub-Populations in China

PubMed Central

Sun, Kuan; Ye, Yi; Luo, Tao; Hou, Yiping

2016-01-01

Ancestry inference is of great interest in diverse areas of scientific researches, including the forensic biology, medical genetics and anthropology. Various methods have been published for distinguishing populations. However, few reports refer to sub-populations (like ethnic groups) within Asian populations for the limitation of markers. Several InDel loci located very tightly in physical positions were treated as one marker by us, which is multi-InDel. The multi-InDel shows potential as Ancestry Inference Marker (AIM). In this study, we performed a genome-wide scan for multi-InDels as AIM. After examining the FST distributions in the 1000 Genomes Database, 12 candidates were selected and validated for eastern Asian populations. A multiplexed assay was developed as a panel to genotype 12 multi-InDel markers simultaneously. Ancestry component analysis with STRUCTURE and principal component analysis (PCA) were employed to estimate its capability for ancestry inference. Furthermore, ancestry assignments of trial individuals were conducted. It proved to be very effective when 210 samples from Han and Tibetan individuals in China were tested. The panel consisting of multi-InDel markers exhibited considerable potency in ancestry inference, and was suggested to be applied in forensic practices and genetic population studies. PMID:28004788

Genetic modifiers of CHEK2*1100delC-associated breast cancer risk.

PubMed

Muranen, Taru A; Greco, Dario; Blomqvist, Carl; Aittomäki, Kristiina; Khan, Sofia; Hogervorst, Frans; Verhoef, Senno; Pharoah, Paul D P; Dunning, Alison M; Shah, Mitul; Luben, Robert; Bojesen, Stig E; Nordestgaard, Børge G; Schoemaker, Minouk; Swerdlow, Anthony; García-Closas, Montserrat; Figueroa, Jonine; Dörk, Thilo; Bogdanova, Natalia V; Hall, Per; Li, Jingmei; Khusnutdinova, Elza; Bermisheva, Marina; Kristensen, Vessela; Borresen-Dale, Anne-Lise; Investigators, Nbcs; Peto, Julian; Dos Santos Silva, Isabel; Couch, Fergus J; Olson, Janet E; Hillemans, Peter; Park-Simon, Tjoung-Won; Brauch, Hiltrud; Hamann, Ute; Burwinkel, Barbara; Marme, Frederik; Meindl, Alfons; Schmutzler, Rita K; Cox, Angela; Cross, Simon S; Sawyer, Elinor J; Tomlinson, Ian; Lambrechts, Diether; Moisse, Matthieu; Lindblom, Annika; Margolin, Sara; Hollestelle, Antoinette; Martens, John W M; Fasching, Peter A; Beckmann, Matthias W; Andrulis, Irene L; Knight, Julia A; Investigators, kConFab/Aocs; Anton-Culver, Hoda; Ziogas, Argyrios; Giles, Graham G; Milne, Roger L; Brenner, Hermann; Arndt, Volker; Mannermaa, Arto; Kosma, Veli-Matti; Chang-Claude, Jenny; Rudolph, Anja; Devilee, Peter; Seynaeve, Caroline; Hopper, John L; Southey, Melissa C; John, Esther M; Whittemore, Alice S; Bolla, Manjeet K; Wang, Qin; Michailidou, Kyriaki; Dennis, Joe; Easton, Douglas F; Schmidt, Marjanka K; Nevanlinna, Heli

2017-05-01

CHEK2*1100delC is a founder variant in European populations that confers a two- to threefold increased risk of breast cancer (BC). Epidemiologic and family studies have suggested that the risk associated with CHEK2*1100delC is modified by other genetic factors in a multiplicative fashion. We have investigated this empirically using data from the Breast Cancer Association Consortium (BCAC). Using genotype data from 39,139 (624 1100delC carriers) BC patients and 40,063 (224) healthy controls from 32 BCAC studies, we analyzed the combined risk effects of CHEK2*1100delC and 77 common variants in terms of a polygenic risk score (PRS) and pairwise interaction. The PRS conferred odds ratios (OR) of 1.59 (95% CI: 1.21-2.09) per standard deviation for BC for CHEK2*1100delC carriers and 1.58 (1.55-1.62) for noncarriers. No evidence of deviation from the multiplicative model was found. The OR for the highest quintile of the PRS was 2.03 (0.86-4.78) for CHEK2*1100delC carriers, placing them in the high risk category according to UK NICE guidelines. The OR for the lowest quintile was 0.52 (0.16-1.74), indicating a lifetime risk close to the population average. Our results confirm the multiplicative nature of risk effects conferred by CHEK2*1100delC and the common susceptibility variants. Furthermore, the PRS could identify carriers at a high lifetime risk for clinical actions.Genet Med advance online publication 06 October 2016.

Hernan Cortes; Conquistador and Colonizer. The Tinker Pamphlet Series for the Teaching of Mexican American Heritage.

ERIC Educational Resources Information Center

Miller, Hubert J.

The conquest and colonization of Mexico initiated by Hernan Cortes resulted in the fusion of the Indian and Hispanic cultures. This fusion led to the "mestizo" culture. Cortes was the bearer of the Hispanic heritage just as the Aztecs and other Indians in Mexico and the Southwest were the carriers of the Indian heritage. In studying the…

Linguistic Purism in Cuzco, Peru: A Historical Perspective.

ERIC Educational Resources Information Center

Nino-Murcia, Mercedes

1997-01-01

Notes that a group of mestizo intellectuals in Peru claims that "Qhpaj'simi" is the Quechua used by the ancient Inca nobility and is the purest form of Quechua. Explains that a social hierarchy has arisen with the use of this "imperial language" demarcating its users from the common people and that these purist attitudes play a…

The Cuernos del Paine mountains in Torres del Paine National Park, Chile, during NASA's AirSAR 2004 campaign

NASA Image and Video Library

2004-03-11

The Cuernos del Paine mountains in Torres del Paine National Park, Chile, during NASA's AirSAR 2004 campaign. AirSAR 2004 is a three-week expedition in Central and South America by an international team of scientists that is using an all-weather imaging tool, called the Airborne Synthetic Aperture Radar (AirSAR), located onboard NASA's DC-8 airborne laboratory. Scientists from many parts of the world are combining ground research with NASA's AirSAR technology to improve and expand on the quality of research they are able to conduct. Founded in 1959, Torres del Paine National Park encompasses 450,000 acres in the Patagonia region of Chile. This region is being studied by NASA using a DC-8 equipped with an Airborne Synthetic Aperture Radar (AirSAR) developed by scientists from NASA’s Jet Propulsion Laboratory. This is a very sensitive region that is important to scientists because the temperature has been consistently rising causing a subsequent melting of the region’s glaciers. AirSAR will provide a baseline model and unprecedented mapping of the region. This data will make it possible to determine whether the warming trend is slowing, continuing or accelerating. AirSAR will also provide reliable information on ice shelf thickness to measure the contribution of the glaciers to sea level.

Modelo semi-empírico de protuberancia solar a partir del diagnóstico de densidades

NASA Astrophysics Data System (ADS)

Cirigliano, D.; Vial, J. C.; Rovira, M.

A partir de la observación del espectro del quintuplete de C III alrededor de 1175 Å, se ha realizado el diagnóstico de la densidad y presión electrónica, basado en el cálculo del cociente de las intensidades observadas. Una vez establecida la densidad electrónica, y con el cálculo de las velocidades Doppler, hemos investigado el flujo de masa en la protuberancia en función de la temperatura. Estableciendo como hipótesis la conservación del número de partículas que ingresan y salen del cuerpo de la protuberancia, se investiga la variación del área de un tubo de flujo semi-empírico en función de la temperatura. A partir de dicho diagnóstico, se examina el comportamiento del radio del tubo magnético en función de la temperatura, los que dan cuenta de la abertura de las líneas de campo magnético que confinan el plasma y de la divergencia del campo magnético en diferentes alturas de la atmósfera solar.

Uso Del Condón en Adolescentes Nahuas, un Modelo Explicativo.

PubMed

Tirado, María de Los Ángeles Meneses; Benavides-Torres, Raquel A; Navarro, Sergio Meneses; de la Colina, Juan Antonio Doncel; Rodríguez, Dora Julia Onofre; Hernández, Francisco Javier Baéz

2018-03-01

En México, la población indígena supera los siete millones de habitantes, en Puebla el grupo más representativo es el Náhuatl. Sin embargo, las condiciones de vida, salud, educación y transporte son precarias para esta población. En los adolescentes, las responsabilidades como el matrimonio, la familia y los compromisos ante la comunidad, favorecen conductas de riesgo sexual que dificultan su desarrollo económico, social y reproductivo. El objetivo fue proponer un modelo explicativo del uso del condón en adolescentes nahuas. Método. Bajo el marco de la teoría social cognitiva, el concepto de valores culturales de Leininger y el proceso de la sustracción teórica, se desarrolló este artículo. Se muestran las relaciones del modelo con las proposiciones y los factores que influyen en el uso del condón para este grupo específico. Finalmente, el modelo explica las variables de interés, los niveles de abstracción y las relaciones entre sí en el contexto náhuatl. El siguiente paso será implementar los indicadores empíricos para conocer el grado de influencia de los factores personales y ambientales hacia el uso del condón en adolescentes nahuas. Resultados que aportarán información para el desarrollo del conocimiento en enfermería y la reducción de riesgo sexual de esta población.

Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications.

PubMed

Muranen, Taru A; Greco, Dario; Fagerholm, Rainer; Kilpivaara, Outi; Kämpjärvi, Kati; Aittomäki, Kristiina; Blomqvist, Carl; Heikkilä, Päivi; Borg, Ake; Nevanlinna, Heli

2011-09-20

Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels.Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation 1100delC. On these regions, we identified

Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications

PubMed Central

2011-01-01

Introduction Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. Methods In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. Results We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels. Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. Conclusions We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation

Max Brödel: his art, legacy, and contributions to neurosurgery through medical illustration.

PubMed

Patel, Smruti K; Couldwell, William T; Liu, James K

2011-07-01

Max Brödel is considered the father of modern medical illustration. This report reviews his contributions to neurosurgery as a medical illustrator. Max Brödel, a young artist from Leipzig, Germany, was hired at Johns Hopkins Hospital in 1894, where he illustrated an operative textbook of gynecology for Howard A. Kelly. Although Brödel did not have any formal medical training, he quickly acquired knowledge of anatomy, pathology, physiology, and surgery. Brödel's extraordinary illustrations were characterized by an aerial perspective that conveyed the surgeon's operative viewpoint and precise surgical anatomy. He masterfully incorporated tissue realism with cross-sectional anatomy to accentuate concepts while maintaining topographical accuracy. Brödel's reputation spread quickly and resulted in collaborations with prominent surgeons, such as Cushing, Halsted, and Dandy. Cushing, who also possessed artistic talent, became a pupil of Brödel and remained a very close friend. In 1911, Brödel was appointed the director of the Department of Art as Applied to Medicine at Johns Hopkins, the first academic department of its kind in the world. For the next several decades, he trained generations of renowned medical illustrators. Just as Osler, Halsted, and Cushing passed their skills and knowledge to future leaders of medicine and surgery, Brödel did the same for the field of medical illustration. The advancement of neurosurgical education has been greatly facilitated by Max Brödel's artistic contributions. His unique ability to synthesize art and medicine resulted in timeless illustrations that remain indispensable to surgeons. The art produced by his legacy of illustrators continues to flourish in neurosurgical literature today.

Genetic modifiers of CHEK2*1100delC associated breast cancer risk

PubMed Central

Muranen, Taru A.; Greco, Dario; Blomqvist, Carl; Aittomäki, Kristiina; Khan, Sofia; Hogervorst, Frans; Verhoef, Senno; Pharoah, Paul D.P.; Dunning, Alison M.; Shah, Mitul; Luben, Robert; Bojesen, Stig E.; Nordestgaard, Børge G.; Schoemaker, Minouk; Swerdlow, Anthony; García-Closas, Montserrat; Figueroa, Jonine; Dörk, Thilo; Bogdanova, Natalia V.; Hall, Per; Li, Jingmei; Khusnutdinova, Elza; Bermisheva, Marina; Kristensen, Vessela; Borresen-Dale, Anne-Lise; Peto, Julian; dos Santos Silva, Isabel; Couch, Fergus J.; Olson, Janet E.; Hillemans, Peter; Park-Simon, Tjoung-Won; Brauch, Hiltrud; Hamann, Ute; Burwinkel, Barbara; Marme, Frederik; Meindl, Alfons; Schmutzler, Rita K.; Cox, Angela; Cross, Simon S.; Sawyer, Elinor J.; Tomlinson, Ian; Lambrechts, Diether; Moisse, Matthieu; Lindblom, Annika; Margolin, Sara; Hollestelle, Antoinette; Martens, John W.M.; Fasching, Peter A.; Beckmann, Matthias W.; Andrulis, Irene L.; Knight, Julia A.; Anton-Culver, Hoda; Ziogas, Argyrios; Giles, Graham G.; Milne, Roger L.; Brenner, Hermann; Arndt, Volker; Mannermaa, Arto; Kosma, Veli-Matti; Chang-Claude, Jenny; Rudolph, Anja; Devilee, Peter; Seynaeve, Caroline; Hopper, John L.; Southey, Melissa C.; John, Esther M.; Whittemore, Alice S.; Bolla, Manjeet K.; Wang, Qin; Michailidou, Kyriaki; Dennis, Joe; Easton, Douglas F.; Schmidt, Marjanka K.; Nevanlinna, Heli

2016-01-01

Purpose CHEK2*1100delC is a founder variant in European populations conferring a 2–3 fold increased risk of breast cancer (BC). Epidemiologic and family studies have suggested that the risk associated with CHEK2*1100delC is modified by other genetic factors in a multiplicative fashion. We have investigated this empirically using data from the Breast Cancer Association Consortium (BCAC). Methods With genotype data of 39,139 (624 1100delC carriers) BC patients and 40,063 (224) healthy controls from 32 BCAC studies, we analyzed the combined risk effects of CHEK2*1100delC and 77 common variants in terms of a polygenic risk score (PRS) and pairwise interaction. Results The PRS conferred an odds ratio (OR) of 1.59 [95% CI 1.21–2.09] per standard deviation for BC for CHEK2*1100delC carriers and 1.58 [1.55–1.62] for non-carriers. No evidence for deviation from the multiplicative model was found. The OR for the highest quintile of the PRS was 2.03 [0.86–4.78] for CHEK2*1100delC carriers placing them to the high risk category according to UK NICE guidelines. OR for the lowest quintile was 0.52 [0.16–1.74], indicating life-time risk close to population average. Conclusion Our results confirm the multiplicative nature of risk effects conferred by CHEK2*1100delC and the common susceptibility variants. Furthermore, the PRS could identify the carriers at a high life-time risk for clinical actions. PMID:27711073

Gödel metrics with chronology protection in Horndeski gravities

NASA Astrophysics Data System (ADS)

Geng, Wei-Jian; Li, Shou-Long; Lü, H.; Wei, Hao

2018-05-01

Gödel universe, one of the most interesting exact solutions predicted by General Relativity, describes a homogeneous rotating universe containing naked closed time-like curves (CTCs). It was shown that such CTCs are the consequence of the null energy condition in General Relativity. In this paper, we show that the Gödel-type metrics with chronology protection can emerge in Einstein-Horndeski gravity. We construct such exact solutions also in Einstein-Horndeski-Maxwell and Einstein-Horndeski-Proca theories.

Columbia’s Democratic Security and Defense Policy in the Demobilization of the Paramilitaries

DTIC Science & Technology

2007-03-29

B. Uribe, Colombia peleando una Guerra perdida, Santiago de Chile : RIL Impresores, 2002, pp. 13-14. 3 Jorge Eliecer Gaitán was an outstanding...Colombia. 4 Luis Restrepo, Más allá del terror: Abordaje cultural de la violencia en Colombia, Bogotá: Distribuidora y Editora Aguilar, Altea, Taurus...27 November 2006 46 “Crece el numero de extraditados” El Colombiano, February 20, 2004, p. 12. 47 “Paramilitares en la mira de estados Unidos” El

Determinacion de Caracteristicas Opticas del Telescopio OAN150

NASA Astrophysics Data System (ADS)

Galan, M. J.; Cobos, F. J.

1987-05-01

En el Observatorio de Calar Alto, en Almería, España, está ubicado un telescopio de 15O-cms de diámetro -construído por REOSC- perteneciente al Observatorio Astronómico Nacional, con sede en Madrid, España. La infraestructura técnica del OAN ha sido tradicionalmente débil y actualmente se está haciendo un esfuerzo por fortalecerla. Existe una información muy limitada del telescopio en general; de su óptica en particular se conocían los valores de los parámetros principales pero sin saber si éstos corresponden a valores teóricos ó de construcción. Por ello se consideró necesario iniciar una investigación para conocer en detalle los valores reales de las componentes ópticas del telescopio, obteniéndose algunos resultados de interés. El primario del telescopio OANl5O es aproximadamente F/3 y el siste ma en su conjunto es F/8.2, con su sistema corrector de campo. En términos generales, la imagen es satisfactoria en todo el campo y, sin sistema corrector, la imagen axial también es buena. En un futuro muy cercano se piensa diseñar instrumentación adicional para este telescopio. Conocer con mayor precisión sus características puede ser de gran utilidad para tal fin, pues se efectúan los cálculos considerando conjuntamente al telescopio y al instrumento.

Pseudomonas aeruginosa Reduces VX-809 Stimulated F508del-CFTR Chloride Secretion by Airway Epithelial Cells

PubMed Central

Stanton, Bruce A.; Coutermarsh, Bonita; Barnaby, Roxanna; Hogan, Deborah

2015-01-01

Background P. aeruginosa is an opportunistic pathogen that chronically infects the lungs of 85% of adult patients with Cystic Fibrosis (CF). Previously, we demonstrated that P. aeruginosa reduced wt-CFTR Cl secretion by airway epithelial cells. Recently, a new investigational drug VX-809 has been shown to increase F508del-CFTR Cl secretion in human bronchial epithelial (HBE) cells, and, in combination with VX-770, to increase FEV1 (forced expiratory volume in 1 second) by an average of 3-5% in CF patients homozygous for the F508del-CFTR mutation. We propose that P. aeruginosa infection of CF lungs reduces VX-809 + VX-770- stimulated F508del-CFTR Cl secretion, and thereby reduces the clinical efficacy of VX-809 + VX-770. Methods and Results F508del-CFBE cells and primary cultures of CF-HBE cells (F508del/F508del) were exposed to VX-809 alone or a combination of VX-809 + VX-770 for 48 hours and the effect of P. aeruginosa on F508del-CFTR Cl secretion was measured in Ussing chambers. The effect of VX-809 on F508del-CFTR abundance was measured by cell surface biotinylation and western blot analysis. PAO1, PA14, PAK and 6 clinical isolates of P. aeruginosa (3 mucoid and 3 non-mucoid) significantly reduced drug stimulated F508del-CFTR Cl secretion, and plasma membrane F508del-CFTR. Conclusion The observation that P. aeruginosa reduces VX-809 and VX-809 + VX-770 stimulated F508del CFTR Cl secretion may explain, in part, why VX-809 + VX-770 has modest efficacy in clinical trials. PMID:26018799

Pseudomonas aeruginosa Reduces VX-809 Stimulated F508del-CFTR Chloride Secretion by Airway Epithelial Cells.

PubMed

Stanton, Bruce A; Coutermarsh, Bonita; Barnaby, Roxanna; Hogan, Deborah

2015-01-01

P. aeruginosa is an opportunistic pathogen that chronically infects the lungs of 85% of adult patients with Cystic Fibrosis (CF). Previously, we demonstrated that P. aeruginosa reduced wt-CFTR Cl secretion by airway epithelial cells. Recently, a new investigational drug VX-809 has been shown to increase F508del-CFTR Cl secretion in human bronchial epithelial (HBE) cells, and, in combination with VX-770, to increase FEV1 (forced expiratory volume in 1 second) by an average of 3-5% in CF patients homozygous for the F508del-CFTR mutation. We propose that P. aeruginosa infection of CF lungs reduces VX-809 + VX-770- stimulated F508del-CFTR Cl secretion, and thereby reduces the clinical efficacy of VX-809 + VX-770. F508del-CFBE cells and primary cultures of CF-HBE cells (F508del/F508del) were exposed to VX-809 alone or a combination of VX-809 + VX-770 for 48 hours and the effect of P. aeruginosa on F508del-CFTR Cl secretion was measured in Ussing chambers. The effect of VX-809 on F508del-CFTR abundance was measured by cell surface biotinylation and western blot analysis. PAO1, PA14, PAK and 6 clinical isolates of P. aeruginosa (3 mucoid and 3 non-mucoid) significantly reduced drug stimulated F508del-CFTR Cl secretion, and plasma membrane F508del-CFTR. The observation that P. aeruginosa reduces VX-809 and VX-809 + VX-770 stimulated F508del CFTR Cl secretion may explain, in part, why VX-809 + VX-770 has modest efficacy in clinical trials.

Status and distribution of Chihuahuan Desert Grasslands in the United States and Mexico (Evaluacion del estado y distribucion de los pastizales del Desierto Chihuahuense en los Estados Unidos y Mexico)

Treesearch

Martha Desmond; Jennifer Atchley Montoya

2006-01-01

Grasslands comprise a small part of the Chihuahuan Desert but are vital to the biological diversity of the ecoregion. Characteristic grasses of the Chihuahuan Desert are tobosa (Pleuraphis mutica) and black grama (Bouteloua eriopoda) but other common species include alakali sacaton (Sporobolus airoides), big alkali sacaton (S. wrightii), mesa dropseed (S. flexuosus),...

Genomic profiling of CHEK2*1100delC-mutated breast carcinomas.

PubMed

Massink, Maarten P G; Kooi, Irsan E; Martens, John W M; Waisfisz, Quinten; Meijers-Heijboer, Hanne

2015-11-09

CHEK2*1100delC is a moderate-risk breast cancer susceptibility allele with a high prevalence in the Netherlands. We performed copy number and gene expression profiling to investigate whether CHEK2*1100delC breast cancers harbor characteristic genomic aberrations, as seen for BRCA1 mutated breast cancers. We performed high-resolution SNP array and gene expression profiling of 120 familial breast carcinomas selected from a larger cohort of 155 familial breast tumors, including BRCA1, BRCA2, and CHEK2 mutant tumors. Gene expression analyses based on a mRNA immune signature was used to identify samples with relative low amounts of tumor infiltrating lymphocytes (TILs), which were previously found to disturb tumor copy number and LOH (loss of heterozygosity) profiling. We specifically compared the genomic and gene expression profiles of CHEK2*1100delC breast cancers (n = 14) with BRCAX (familial non-BRCA1/BRCA2/CHEK2*1100delC mutated) breast cancers (n = 34) of the luminal intrinsic subtypes for which both SNP-array and gene expression data is available. High amounts of TILs were found in a relatively small number of luminal breast cancers as compared to breast cancers of the basal-like subtype. As expected, these samples mostly have very few copy number aberrations and no detectable regions of LOH. By unsupervised hierarchical clustering of copy number data we observed a great degree of heterogeneity amongst the CHEK2*1100delC breast cancers, comparable to the BRCAX breast cancers. Furthermore, copy number aberrations were mostly seen at low frequencies in both the CHEK2*1100delC and BRCAX group of breast cancers. However, supervised class comparison identified copy number loss of chromosomal arm 1p to be associated with CHEK2*1100delC status. In conclusion, in contrast to basal-like BRCA1 mutated breast cancers, no apparent specific somatic copy number aberration (CNA) profile for CHEK2*1100delC breast cancers was found. With the possible exception of copy

Summary of a Gas Transport Tracer Test in the Deep Cerros Del Rio Basalts, Mesita del Buey, Los Alamos NM.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stauffer, Philip H.; Rahn, Thomas A.; Ortiz, John Philip

Here we describe results from a tracer test in the Cerros del Rio basalt beneath Mesita del Buey, Technical Area 54 (TA-54) at Los Alamos National Laboratory (LANL or the Laboratory). This report follows from plans outlined in our previous Tracer Test Work Plan (LANL 2016). These activities were conducted by LANL to further characterize subsurface properties of the Cerros del Rio basalts at Material Disposal Area (MDA) L (Figure 1.1-1). The work presented follows from the “Interim Measures Work Plan for Soil-Vapor Extraction of Volatile Organic Compounds from Material Disposal Area L, Technical Area 54, Revision 1,” submitted tomore » the New Mexico Environment Department (NMED) in September 2014 (LANL 2014). Remediation of the MDA L vapor plume by soil-vapor extraction (SVE) is recommended as part of the final remedy in the “Corrective Measures Evaluation Report for Material Disposal Area L, Solid Waste Management Unit 54-006, at Technical Area 54, Revision 2” to meet a remedial action objective of preventing groundwater from being impacted above a regulatory standard by the transport of volatile organic compounds (VOCs) to groundwater through soil vapor (LANL 2011).« less

Manipulating proteostasis to repair the F508del-CFTR defect in cystic fibrosis.

PubMed

Esposito, Speranza; Tosco, Antonella; Villella, Valeria R; Raia, Valeria; Kroemer, Guido; Maiuri, Luigi

2016-12-01

Cystic fibrosis (CF) is a lethal monogenic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that entails the (diagnostic) increase in sweat electrolyte concentrations, progressive lung disease with chronic inflammation and recurrent bacterial infections, pancreatic insufficiency, and male infertility. Therapies aimed at restoring the CFTR defect have emerged. Thus, a small molecule which facilitates chloride channel opening, the potentiator Ivacaftor, has been approved for the treatment of CF patients bearing a particular class of rare CFTR mutations. However, small molecules that directly target the most common misfolded CFTR mutant, F508del, and improve its intracellular trafficking in vitro, have been less effective than expected when tested in CF patients, even in combination with Ivacaftor. Thus, new strategies are required to circumvent the F508del-CFTR defect. Airway and intestinal epithelial cells from CF patients bearing the F508del-CFTR mutation exhibit an impressive derangement of cellular proteostasis, with oxidative stress, overactivation of the tissue transglutaminase (TG2), and disabled autophagy. Proteostasis regulators such as cysteamine can rescue and stabilize a functional F508del-CFTR protein through suppressing TG2 activation and restoring autophagy in vivo in F508del-CFTR homozygous mice, in vitro in CF patient-derived cell lines, ex vivo in freshly collected primary patient's nasal cells, as well as in a pilot clinical trial involving homozygous F508del-CFTR patients. Here, we discuss how the therapeutic normalization of defective proteostasis can be harnessed for the treatment of CF patients with the F508del-CFTR mutation.

Estudio multifrecuencia del medio interestelar cercano a HD 192281

NASA Astrophysics Data System (ADS)

Arnal, E. M.; Cappa, C.; Cichowolski, S.; Pineault, S.; St-Louis, N.

Una de las causas que modifica la estructura y dinámica del medio interestelar es la acción que los vientos de las estrellas de gran masa ejercen sobre el mismo. En este trabajo, mediante el uso de datos interferométricos obtenidos en la banda de radio en la transición de 21-cm del Hidrógeno neutro y de imágenes de la emisión de continuo en las bandas de 408 y 1420 MHz, de imágenes HIRES del satélite IRAS en 60 y 100 micrones, y de observaciones de continuo obtenidas con radiotelescopios de disco simple en 2695, 4850 y 8350 MHz se ha realizado un estudio multifrecuencia de los efectos que los vientos estelares de HD 192281, una estrella de tipo espectral O5 Vn((f))p, han tenido sobre el medio interestelar que rodea a la misma.

Estudio multifrecuencia del medio interestelar cercano a HD 192281

NASA Astrophysics Data System (ADS)

Arnal, E. M.; Cappa, C. E.; Cichowolski, S.; Pineault, S.; St-Louis, N.

Una de las causas que modifica la estructura y dinámica del medio interestelar es la acción que los vientos de las estrellas de gran masa ejercen sobre el mismo. En este trabajo, mediante el uso de datos interferométricos obtenidos en la banda de radio en la transición de λ˜21-cm del hidrógeno neutro y de imágenes de la emisión de continuo en las bandas de 408 y 1420 MHz, de imágenes HIRES del satélite IRAS en 60 y 100μm, y de observaciones de continuo obtenidas con radiotelescopios de disco simple en 2695, 4850 y 8350 MHz se ha realizado un estudio multifrecuencia de los efectos que los vientos estelares de HD 192281, una estrella de tipo espectral O5,Vn((f))p, han tenido sobre el medio interestelar que rodea a la misma.

TGS pipeline primed for Argentine growth, CEO says

DOE Office of Scientific and Technical Information (OSTI.GOV)

Share, J.

Nowhere in Latin America has the privatization process been more aggressively pursued than in Argentina where President Carlos Menem has successfully turned over the bulk of state companies to the private sector. In the energy sector, that meant the divestiture in 1992 of Gas del Estado, the state-owned integrated gas transportation and distribution company. It was split in two transportation companies: Transportadora de Gas del Sur (TGS) and Transportadora de Gas del Norte (TGN), and eight distribution companies. TGS is the largest transporter of natural gas in Argentina, delivering more than 60 percent of that nation`s total gas consumption withmore » a capacity of 1.9 Bcf/d. This is the second in a series of Pipeline and Gas Journal special reports that discuss the evolving strategies of the natural gas industry as it continues to restructure amid deregulation. The article focuses on TGS, the Argentine pipeline system in which Enron Corp. is a key participant.« less

[La diagnosi del disturbo da uso di alcol dal punto di vista psicologico].

PubMed

Coriale, Giovanna; Fiorentino, Daniela; Porrari, Raffaella; Battagliese, Gemma; Capriglione, Ida; Cereatti, Federica; Iannuzzi, Silvia; Mauri, Benilde; Galli, Domenica; Fiore, Marco; Attilia, Maria Luisa; Ceccanti, Mauro

2018-01-01

RIASSUNTO. Il disturbo da uso di alcol (DUA) è uno dei disturbi psichiatrici più comuni nella popolazione generale. Il DUA è caratterizzato da un pattern di bere eccessivo, che si mantiene nonostante gli effetti negativi che l'alcol ha sul funzionamento lavorativo, sulla salute, sulle problematiche legali, sull'educazione e sulla vita sociale. Attualmente, il modello bio-psico-sociale è quello che spiega meglio il DUA. Infatti, molte ricerche hanno fornito evidenze su come il DUA sia una patologia multidimensionale. Variabili biologiche, psicologiche e socio-culturali entrano in gioco nell'eziologia, nella natura, nel mantenimento e nel cambiamento nel tempo del disturbo. La fase diagnostica è un momento importante del processo di cura, perché il successo del trattamento dipende in larga misura dall'esattezza e dall'adeguatezza della diagnosi. La diagnosi clinica si basa su una valutazione globale del funzionamento del paziente e utilizza il colloquio e gli strumenti psicometrici come mezzo di raccolta di informazioni. Questo articolo fornirà una panoramica delle dimensioni psicologiche più importanti da valutare e sui migliori strumenti psicometrici da usare per una diagnosi adeguata.

Estado y rendimiento del espectrógrafo infrarrojo criogénico F2

NASA Astrophysics Data System (ADS)

Diaz, R. J.; Gomez, P.; Schirmer, M.; Navarrete, F.; Stephens, A.; Bosch, G.; Gaspar, G.; Camperi, J.; Gunthardt, G.

First results related to the commissioning phase of Flamingos-2 spectrograph are reported. The available operation modes for observation and expected performance for 2014 are also presented. After the replacement of the first collimator lens; broken in 2012; a problem persisted in the optical alignment. The troubleshooting will require a new instrument refurbishing schedule; meanwhile; the available operation modes are limited to direct image and longslit spectroscopy. We found that the direct image () achieves its highest quality (0.4'') only in the inner 3' of the field and resolution drops toward the spectrum ends. The longslit mode provides for the / ranges; and for the R3k grism in the ranges ; or . We also determine the uncertainties for emission line kinematics; and study the relative flexion between the guiding system; the slit and the detector. FULL TEXT IN SPANISH

Reacciones de intercambio de carga

NASA Astrophysics Data System (ADS)

Errea, L. F.

Se discute la validez de diversas metodologías y su aplicación al estudio de procesos de intercambio de carga electrónico entre iones y blancos atómicos y moleculares. Para energías de impacto entre 0.05 y 5 eV / amu se emplea el método cuántico de la Coordenada de Reacción Común (CRC). A mayores energías, se utiliza el método semiclásico iconal con un desarrollo de la función de onda dinámica en estados moleculares adiabáticos, modificados con un factor de traslación común (FTC). Estos estados pueden obtenerse con cálculos ab initio o empleando potenciales modelo. Cuando la ionización compite con la transferencia de carga, la inclusión de pseudoestados en estos desarrollos permite calcular simultáneamente las secciones eficaces de ambos procesos. Otra técnica utilizada es el método estadístico CTMC. En el tratamiento de colisiones ión-molécula (diatómica) contrastamos la aplicabilidad de distintos métodos, desde la llamada aproximación Franck-Condon hasta un desarrollo en estados vibrónicos, pasando por la aproximación súbita vibro-rotacional, obteniéndose secciones eficaces de captura electrónica total y a estados individuales, así como secciones de excitación vibracional a estados ligados y del continuo (disociación). En todos los casos es necesario calcular superficies de energía y los correspondientes acoplamientos dinámicos entre los estados. La aplicación de estos métodos permite determinar el grado de contaminación de los haces por estados metaestables en un experimento dado, el cambio en los resultados con diferentes isótopos, la importancia de procesos de doble captura, seguida de explosión culombiana, todo ello con precisión comparable a la de medidas experimentales, para sistemas de interés en distintos tipos de plasmas.

The Human 343delT HSPB5 Chaperone Associated with Early-onset Skeletal Myopathy Causes Defects in Protein Solubility*

PubMed Central

Mitzelfelt, Katie A.; Limphong, Pattraranee; Choi, Melinda J.; Kondrat, Frances D. L.; Lai, Shuping; Kolander, Kurt D.; Kwok, Wai-Meng; Dai, Qiang; Grzybowski, Michael N.; Zhang, Huali; Taylor, Graydon M.; Lui, Qiang; Thao, Mai T.; Hudson, Judith A.; Barresi, Rita; Bushby, Kate; Jungbluth, Heinz; Wraige, Elizabeth; Geurts, Aron M.; Benesch, Justin L. P.; Riedel, Michael; Christians, Elisabeth S.; Minella, Alex C.; Benjamin, Ivor J.

2016-01-01

Mutations of HSPB5 (also known as CRYAB or αB-crystallin), a bona fide heat shock protein and molecular chaperone encoded by the HSPB5 (crystallin, alpha B) gene, are linked to multisystem disorders featuring variable combinations of cataracts, cardiomyopathy, and skeletal myopathy. This study aimed to investigate the pathological mechanisms involved in an early-onset myofibrillar myopathy manifesting in a child harboring a homozygous recessive mutation in HSPB5, 343delT. To study HSPB5 343delT protein dynamics, we utilize model cell culture systems including induced pluripotent stem cells derived from the 343delT patient (343delT/343delT) along with isogenic, heterozygous, gene-corrected control cells (WT KI/343delT) and BHK21 cells, a cell line lacking endogenous HSPB5 expression. 343delT/343delT and WT KI/343delT-induced pluripotent stem cell-derived skeletal myotubes and cardiomyocytes did not express detectable levels of 343delT protein, contributable to the extreme insolubility of the mutant protein. Overexpression of HSPB5 343delT resulted in insoluble mutant protein aggregates and induction of a cellular stress response. Co-expression of 343delT with WT prevented visible aggregation of 343delT and improved its solubility. Additionally, in vitro refolding of 343delT in the presence of WT rescued its solubility. We demonstrate an interaction between WT and 343delT both in vitro and within cells. These data support a loss-of-function model for the myopathy observed in the patient because the insoluble mutant would be unavailable to perform normal functions of HSPB5, although additional gain-of-function effects of the mutant protein cannot be excluded. Additionally, our data highlight the solubilization of 343delT by WT, concordant with the recessive inheritance of the disease and absence of symptoms in carrier individuals. PMID:27226619

[The Argentina State railroad and its contribution to science].

PubMed

Salerno, Elena

2008-01-01

In Argentina, the State financed, built, and ran government-own railroads based on recourse to subsidies until the first Yrigoyen administration (1916-1922), which introduced changes and shifted the direction of rail policy somewhat. The Ferrocarriles del Estado contributed to the development of science, created a demand for professionals which helped form the professional engineering field, and, by linking the capitals of central and northern provinces, facilitated both communications and scientific tasks themselves, especially research into diseases endemic to the country.

Silicon Nanoclusters Embedded in SiO2 Studies by Raman Scattering

DTIC Science & Technology

2001-06-01

was partially supported by a CON- CYTEQ (Consejo de Ciencia y Tecnologia del Estado de Quer~taro) and CONACyT from Mexico. References [1] L. Rebohle, J...scattering F J. Espinoza-Beltrdnt, L. L. Diaz-FloresT, J. Morales-Herndndezl, J. M. Ydfiez-Lim6nt, F Rodriguez-Melgarejot, Y . V. VorobievT and J. Gonzflez...F. PNrez-Robles, R. Ramirez- Bon, Y . V. Vorobiev and J. Gonzdilez-Hern~indez, Microelectronic Engineering, 51-52, 659- 666 (2000). [6] K. Kim, Phys

Juarez and the Mexican Republic during the French Intervention: Government Under Crisis.

DTIC Science & Technology

1984-05-02

Constituci6n Federal de los Estados -Unidos Mexicano, sancionada y~ lurada port c Coin-reso General Constituyente el dia Sfebrero de 1857. M~xico... disposiciones j gl’!lativas exv’edidas desde la independencla de l1a reulia 34 vols. M~xico: Imprenta del Comrcio, a carga de Dublin y Lozano, hijos, 1876-1904...Also useful are the biographical histories of Ralph Roeder on Julrez and Frank A. Knapp on Sebastian Lerdo de Tejada. Roeder’s work unfortunately

Silvics of Native and Exotic Trees of Puerto Rico and the Caribbean Islands (Spanish version)

Treesearch

John K. Francis; Carol A. Lowe

2000-01-01

Se consideró por primera vez incluir las especies de árboles tropicales en Silvics of North America en el 1980, cuando el Servicio Forestal del Departamento de Agricultura de los Estados Unidos de Norteamérica decidió poner al día el Manual de Agricultura 271, Silvics of forest trees of the United States. Diez años más tarde el Manual de Agricultura 654 se publicó con...

Building the genomic nation: ‘Homo Brasilis’ and the ‘Genoma Mexicano’ in comparative cultural perspective

PubMed Central

Kent, Michael; García-Deister, Vivette; López-Beltrán, Carlos; Santos, Ricardo Ventura; Schwartz-Marín, Ernesto; Wade, Peter

2015-01-01

This article explores the relationship between genetic research, nationalism and the construction of collective social identities in Latin America. It makes a comparative analysis of two research projects – the ‘Genoma Mexicano’ and the ‘Homo Brasilis’ – both of which sought to establish national and genetic profiles. Both have reproduced and strengthened the idea of their respective nations of focus, incorporating biological elements into debates on social identities. Also, both have placed the unifying figure of the mestizo/mestiço at the heart of national identity constructions, and in so doing have displaced alternative identity categories, such as those based on race. However, having been developed in different national contexts, these projects have had distinct scientific and social trajectories: in Mexico, the genomic mestizo is mobilized mainly in relation to health, while in Brazil the key arena is that of race. We show the importance of the nation as a frame for mobilizing genetic data in public policy debates, and demonstrate how race comes in and out of focus in different Latin American national contexts of genomic research, while never completely disappearing. PMID:27479999

63. G.F.H., photographer July 30, 1932 DEL NORTE COUNTY, SECTION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

63. G.F.H., photographer July 30, 1932 DEL NORTE COUNTY, SECTION A, HIGHWAY 1. 1-DN A #124, STA. 164=00 SHOWING DRAINAGE CONDITIONS, G.F.H., 7-30-32. - Redwood National & State Parks Roads, California coast from Crescent City to Trinidad, Crescent City, Del Norte County, CA

Del(20q) in patients with chronic lymphocytic leukemia: A therapy-related abnormality involving lymphoid or myeloid cells

PubMed Central

Yin, C. Cameron; Tang, Guilin; Lu, Gary; Feng, Xiaoli; Keating, Michael J.; Medeiros, L. Jeffrey; Abruzzo, Lynne V.

2015-01-01

Del(20q), a common cytogenetic abnormality in myeloid neoplasms, is rare in chronic lymphocytic leukemia. We report 64 patients with chronic lymphocytic leukemia and del(20q), as the sole abnormality in 40, a stemline abnormality in 21, and a secondary abnormality in 3 cases. FISH analysis revealed an additional high-risk abnormality, del(11q) or del(17p), in 27/64 (42%) cases. In most cases, the leukemic cells showed atypical cytologic features, unmutated IGHV genes and ZAP70 positivity. The del(20q) was detected only after chemotherapy in all 27 cases with initial karyotypes available. With a median follow-up of 90 months, 30 patients (47%) died, most as a direct consequence of chronic lymphocytic leukemia. Eight patients developed a therapy-related myeloid neoplasm, seven with a complex karyotype. Combined morphologic and FISH analysis for del(20q) performed in 12 cases without morphologic evidence of a myeloid neoplasm localized the del(20q) to the chronic lymphocytic leukemia cells in 5 (42%) cases, and to myeloid/erythroid cells in 7 (58)% cases. The del(20q) was detected in myeloid cells in all 4 cases of myelodysplastic syndrome. In aggregate, these data indicate that chronic lymphocytic leukemia with del(20q) acquired after therapy is heterogeneous. In cases with morphologic evidence of dysplasia, the del(20q) likely resides in the myeloid lineage. However, in cases without morphologic evidence of dysplasia, the del(20q) may represent clonal evolution and disease progression. Combining morphologic analysis with FISH for del(20q) or performing FISH on immunomagnetically-selected subpopulations to localize the cell population with this abnormality may help guide patient management. PMID:25953391

Gene expression profiling assigns CHEK2 1100delC breast cancers to the luminal intrinsic subtypes.

PubMed

Nagel, Jord H A; Peeters, Justine K; Smid, Marcel; Sieuwerts, Anieta M; Wasielewski, Marijke; de Weerd, Vanja; Trapman-Jansen, Anita M A C; van den Ouweland, Ans; Brüggenwirth, Hennie; van I Jcken, Wilfred F J; Klijn, Jan G M; van der Spek, Peter J; Foekens, John A; Martens, John W M; Schutte, Mieke; Meijers-Heijboer, Hanne

2012-04-01

CHEK2 1100delC is a moderate-risk cancer susceptibility allele that confers a high breast cancer risk in a polygenic setting. Gene expression profiling of CHEK2 1100delC breast cancers may reveal clues to the nature of the polygenic CHEK2 model and its genes involved. Here, we report global gene expression profiles of a cohort of 155 familial breast cancers, including 26 CHEK2 1100delC mutant tumors. In line with previous work, all CHEK2 1100delC mutant tumors clustered among the hormone receptor-positive breast cancers. In the hormone receptor-positive subset, a 40-gene CHEK2 signature was subsequently defined that significantly associated with CHEK2 1100delC breast cancers. The identification of a CHEK2 gene signature implies an unexpected biological homogeneity among the CHEK2 1100delC breast cancers. In addition, all 26 CHEK2 1100delC tumors classified as luminal intrinsic subtype breast cancers, with 8 luminal A and 18 luminal B tumors. This biological make-up of CHEK2 1100delC breast cancers suggests that a relatively limited number of additional susceptibility alleles are involved in the polygenic CHEK2 model. Identification of these as-yet-unknown susceptibility alleles should be aided by clues from the 40-gene CHEK2 signature.

Neurobiología de la impulsividad y los trastornos de la conducta alimentaria*

PubMed Central

Orozco-Cabal, Luis Felipe; Herin, David

2009-01-01

Resumen Introducción La impulsividad es un rasgo de personalidad multidimensional relacionado con el control del comportamiento y las emociones. Está presente de manera diversa en los trastornos de la conducta alimentaria, particularmente, en la bulimia nerviosa (BN). Aunque la relación entre la impulsividad y BN ha sido objeto de numerosas investigaciones, en la actualidad se desconocen los sustratos neurobiológicos de esta relación. Objetivos Discutir críticamente la evidencia que sugiere que las alteraciones en los sistemas neuronales relacio-nados con las funciones ejecutivas, con la formación de preferencias y con la regulación de los estados emocionales sirven como base para el rasgo de personalidad impulsiva, así como su estado en subgrupos de pacientes con BN. Métodos Búsqueda selectiva de la literatura relevante. Resultados y conclusiones Esta discusión ilustra la complejidad de la relación entre la impulsividad y BN, donde la impulsividad actúa como un factor de vulnerabilidad que puede sensibilizar al sujeto con BN a estados emocionales negativos, durante los cuales modifica el impacto de estímulos internos y externos sobre el comportamiento y su regulación, favoreciendo así patrones de comportamiento maladaptativos e inflexibles. PMID:19838321

Eruptive Massive Vector Particles of 5-Dimensional Kerr-Gödel Spacetime

NASA Astrophysics Data System (ADS)

Övgün, A.; Sakalli, I.

2018-02-01

In this paper, we investigate Hawking radiation of massive spin-1 particles from 5-dimensional Kerr-Gödel spacetime. By applying the WKB approximation and the Hamilton-Jacobi ansatz to the relativistic Proca equation, we obtain the quantum tunneling rate of the massive vector particles. Using the obtained tunneling rate, we show how one impeccably computes the Hawking temperature of the 5-dimensional Kerr-Gödel spacetime.

Del(20q) in patients with chronic lymphocytic leukemia: a therapy-related abnormality involving lymphoid or myeloid cells.

PubMed

Yin, C Cameron; Tang, Guilin; Lu, Gary; Feng, Xiaoli; Keating, Michael J; Medeiros, L Jeffrey; Abruzzo, Lynne V

2015-08-01

Deletion 20q (Del(20q)), a common cytogenetic abnormality in myeloid neoplasms, is rare in chronic lymphocytic leukemia. We report 64 patients with chronic lymphocytic leukemia and del(20q), as the sole abnormality in 40, a stemline abnormality in 21, and a secondary abnormality in 3 cases. Fluorescence in situ hybridization (FISH) analysis revealed an additional high-risk abnormality, del(11q) or del(17p), in 25/64 (39%) cases. In most cases, the leukemic cells showed atypical cytologic features, unmutated IGHV (immunoglobulin heavy-chain variable region) genes, and ZAP70 positivity. The del(20q) was detected only after chemotherapy in all 27 cases with initial karyotypes available. With a median follow-up of 90 months, 30 patients (47%) died, most as a direct consequence of chronic lymphocytic leukemia. Eight patients developed a therapy-related myeloid neoplasm, seven with a complex karyotype. Combined morphologic and FISH analysis for del(20q) performed in 12 cases without morphologic evidence of a myeloid neoplasm localized the del(20q) to the chronic lymphocytic leukemia cells in 5 (42%) cases, and to myeloid/erythroid cells in 7 (58)% cases. The del(20q) was detected in myeloid cells in all 4 cases of myelodysplastic syndrome. In aggregate, these data indicate that chronic lymphocytic leukemia with del(20q) acquired after therapy is heterogeneous. In cases with morphologic evidence of dysplasia, the del(20q) likely resides in the myeloid lineage. However, in cases without morphologic evidence of dysplasia, the del(20q) may represent clonal evolution and disease progression. Combining morphologic analysis with FISH for del(20q) or performing FISH on immunomagnetically selected sub-populations to localize the cell population with this abnormality may help guide patient management.

Aldehyde dehydrogenase polymorphism in North American, South American, and Mexican Indian populations.

PubMed Central

Goedde, H W; Agarwal, D P; Harada, S; Rothhammer, F; Whittaker, J O; Lisker, R

1986-01-01

While about 40% of the South American Indian populations (Atacameños, Mapuche, Shuara) were found to be deficient in aldehyde dehydrogenase isozyme I (ALDH2 or E2), preliminary investigations showed very low incidence of isozyme deficiency among North American natives (Sioux, Navajo) and Mexican Indians (mestizo). Possible implications of such trait differences on cross-cultural behavioral response to alcohol drinking are discussed. PMID:3953578

62. R.L.T., photographer November 1, 1934 DEL NORTE COUNTY, SECTION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

62. R.L.T., photographer November 1, 1934 DEL NORTE COUNTY, SECTION D, HIGHWAY 1. REDWOOD CLEARING ON EXISTING LINE, 1-DN-71-A #26, R.L.T. 11-1-34. Stamped office copy. - Redwood National & State Parks Roads, California coast from Crescent City to Trinidad, Crescent City, Del Norte County, CA

60. C.J.T., photographer December 23, 1955 KLAMATH RIVER BRIDGE, DEL ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

60. C.J.T., photographer December 23, 1955 KLAMATH RIVER BRIDGE, DEL NORTE COUNTY, SECTION A, HIGHWAY 1. DN-1-A #538, KLAMATH RIVER BR. FROM SO. END, 12/23/55, C.J.T. - Redwood National & State Parks Roads, California coast from Crescent City to Trinidad, Crescent City, Del Norte County, CA

Digitalización de diapositivas del Sol en H α

NASA Astrophysics Data System (ADS)

Missio, H.; Montenegro, C.; Montenegro, R.

El objetivo de este trabajo ha sido el de obtener imágenes digitalizadas de las diapositivas tomadas del Sol en luz de hidrógeno de la línea correspondiente a Hα, y de esta manera llegar a convertir las mismas a un archivo digital para poder ser tratadas luego por computadora y poder contabilizar con exactitud, mediante un programa adecuado para tal fin, las zonas activas del Sol en la imagen digitalizada. En principio, para llegar a esto se pensó en la utilización de medios accesibles, y como detector se utilizó un fototransistor ubicado dentro de un soporte rectangular sobre dos ejes de desplazamiento X e Y. Se han obtenido con este procedimiento imágenes de buena calidad, construídas a partir de tres datos digitalizados en cada barrido que aportan la posición X e Y y la intensidad del pixel en ese punto indicada en 255 tonos de grises.

CHEK2 (∗) 1100delC Mutation and Risk of Prostate Cancer.

PubMed

Hale, Victoria; Weischer, Maren; Park, Jong Y

2014-01-01

Although the causes of prostate cancer are largely unknown, previous studies support the role of genetic factors in the development of prostate cancer. CHEK2 plays a critical role in DNA replication by responding to double-stranded breaks. In this review, we provide an overview of the current knowledge of the role of a genetic variant, 1100delC, of CHEK2 on prostate cancer risk and discuss the implication for potential translation of this knowledge into clinical practice. Currently, twelve articles that discussed CHEK2 (∗)1100delC and its association with prostate cancer were identified. Of the twelve prostate cancer studies, five studies had independent data to draw conclusive evidence from. The pooled results of OR and 95% CI were 1.98 (1.23-3.18) for unselected cases and 3.39 (1.78-6.47) for familial cases, indicating that CHEK2 (∗)1100delC mutation is associated with increased risk of prostate cancer. Screening for CHEK2(∗)1100delC should be considered in men with a familial history of prostate cancer.

CHEK2 ∗1100delC Mutation and Risk of Prostate Cancer

PubMed Central

Park, Jong Y.

2014-01-01

Although the causes of prostate cancer are largely unknown, previous studies support the role of genetic factors in the development of prostate cancer. CHEK2 plays a critical role in DNA replication by responding to double-stranded breaks. In this review, we provide an overview of the current knowledge of the role of a genetic variant, 1100delC, of CHEK2 on prostate cancer risk and discuss the implication for potential translation of this knowledge into clinical practice. Currently, twelve articles that discussed CHEK2 ∗1100delC and its association with prostate cancer were identified. Of the twelve prostate cancer studies, five studies had independent data to draw conclusive evidence from. The pooled results of OR and 95% CI were 1.98 (1.23–3.18) for unselected cases and 3.39 (1.78–6.47) for familial cases, indicating that CHEK2 ∗1100delC mutation is associated with increased risk of prostate cancer. Screening for CHEK2∗1100delC should be considered in men with a familial history of prostate cancer. PMID:25431674

The Cuernos del Paine mountains in Torres del Paine National Park in Chile, photographed during NASA's AirSAR 2004 campaign

NASA Image and Video Library

2004-03-11

The Cuernos del Paine mountains in Torres del Paine National Park in Chile, photographed during NASA's AirSAR 2004 campaign. AirSAR 2004 is a three-week expedition in Central and South America by an international team of scientists that is using an all-weather imaging tool, called the Airborne Synthetic Aperture Radar (AirSAR), located onboard NASA's DC-8 airborne laboratory. Scientists from many parts of the world are combining ground research with NASA's AirSAR technology to improve and expand on the quality of research they are able to conduct. Founded in 1959, Torres del Paine National Park encompasses 450,000 acres in the Patagonia region of Chile. This region is being studied by NASA using a DC-8 equipped with an Airborne Synthetic Aperture Radar (AirSAR) developed by scientists from NASA’s Jet Propulsion Laboratory. This is a very sensitive region that is important to scientists because the temperature has been consistently rising causing a subsequent melting of the region’s glaciers. AirSAR will provide a baseline model and unprecedented mapping of the region. This data will make it possible to determine whether the warming trend is slowing, continuing or accelerating. AirSAR will also provide reliable information on ice shelf thickness to measure the contribution of the glaciers to sea level.

La Observación Sistemática de Vecindarios: El caso de Chile y sus perspectivas para Trabajo Social

PubMed Central

Sanhueza, Guillermo E.; Delva, Jorge; Andrade, Fernando H.; Grogan-Kaylor, Andrew; Bares, Cristina; Castillo, Marcela

2012-01-01

El estudio acerca de las características de los vecindarios y sus efectos sobre las personas ha llegado a ser un área de creciente atención por parte de investigadores de diversas disciplinas en países desarrollados. Aunque actualmente existen diversas metodologías para estudiar efectos del vecindario, una de las más utilizadas es la Observación Sistemática de Vecindarios –Systematic Social Observation SSO, en inglés—porque permite recolectar información acerca de diversas características del entorno físico, social, ambiental y económico de los vecindarios donde se aplica. El objetivo de este artículo es (i) dar a conocer sumariamente algunas investigaciones influyentes sobre efectos del vecindario en Estados Unidos, ii) describir cómo se diseñó e implementó la Observación Sistemática de Vecindarios en la ciudad de Santiago de Chile, iii) señalar algunos facilitadores y obstaculizadores de la implementación del proyecto y, finalmente iv) enunciar posibles contribuciones y limitaciones que esta metodología ofrecería al trabajo social en Chile. PMID:24791060

El ``Aula del Cel'': astronomy approaching high school

NASA Astrophysics Data System (ADS)

Ortiz-Gil, A.; Gómez Collado, M.; Gallego Calvente, A. T.

The “Aula del Cel” is a project carried out by the Astronomical Obsevatory of the University of Valencia, Spain. It offers high-school teachers a tool for teaching Astronomy to 10 to 17 year-old students. Different programs, experiments, and audiovisual presentations have been prepared by a team formed both by professional astronomers and teachers, and are offered in a format chosen to suit each particular age and curriculum group. Special sessions have been designed for students with special needs (for example blind or autistic children) in close contact with the pedagogical teams responsible for their education. Nearly three thousand students have already visited the “Aula del Cel” over the first six months that it has been offered to the school community.

CHEK2*1100delC homozygosity in the Netherlands—prevalence and risk of breast and lung cancer

PubMed Central

Huijts, Petra EA; Hollestelle, Antoinette; Balliu, Brunilda; Houwing-Duistermaat, Jeanine J; Meijers, Caro M; Blom, Jannet C; Ozturk, Bahar; Krol-Warmerdam, Elly MM; Wijnen, Juul; Berns, Els MJJ; Martens, John WM; Seynaeve, Caroline; Kiemeney, Lambertus A; van der Heijden, Henricus F; Tollenaar, Rob AEM; Devilee, Peter; van Asperen, Christi J

2014-01-01

The 1100delC mutation in the CHEK2 gene has a carrier frequency of up to 1.5% in individuals from North-West Europe. Women heterozygous for 1100delC have an increased breast cancer risk (odds ratio 2.7). To explore the prevalence and clinical consequences of 1100delC homozygosity in the Netherlands, we genotyped a sporadic breast cancer hospital-based cohort, a group of non-BRCA1/2 breast cancer families, and breast tumors from a tumor tissue bank. Three 1100delC homozygous patients were found in the cohort of 1434 sporadic breast cancer patients, suggesting an increased breast cancer risk for 1100delC homozygotes (odds ratio 3.4, 95% confidence interval 0.4–32.6, P=0.3). Another 1100delC homozygote was found in 592 individuals from 108 non-BRCA1/2 breast cancer families, and two more were found after testing 1706 breast tumors and confirming homozygosity on their wild-type DNA. Follow-up data was available for five homozygous patients, and remarkably, three of them had developed contralateral breast cancer. A possible relationship between 1100delC and lung cancer risk was investigated in 457 unrelated lung cancer patients but could not be confirmed. Due to the small number of 1100delC homozygotes identified, the breast cancer risk estimate associated with this genotype had limited accuracy but is probably higher than the risk in heterozygous females. Screening for CHEK2 1100delC could be beneficial in countries with a relatively high allele frequency. PMID:23652375

Primer registro para Peru del genero Nielsonia Young, 1977 (Hemiptera: Cicadellidae: Cicadellinae: Cicadellini)

USDA-ARS?s Scientific Manuscript database

En este articulo se reporta por primera vez para el Peru una especies del genero Nielsonia Young, 1977, de material procedente del Departamento de Tumbes. El genero ha sido reportada anteriormente de Ecuador, como unico registro para Sudamerica, y America Central. El unico especimen hembra encontra...

Ectopsocidae (Psocodea: 'Psocoptera') from Valle del Cauca and NNP Gorgona, Colombia.

PubMed

Manchola, Oscar Fernando Saenz; Obando, Ranulfo González; Aldrete, Alfonso N García

2014-04-14

The results of a survey of the psocid family Ectopsocidae in Valle del Cauca and NNP Gorgona, are here presented. Fifteen species were identified, in the genera Ectopsocus (14 species), and Ectopsocopsis (one species); four of the Ectopsocus species are new to science and are here described and illustrated. The male of E. thorntoni García Aldrete is here described. Records of Ectopsocopsis cryptomeriae (Enderlein), Ectopsocus briggsi McLachlan, E. californicus Banks, E. columbianus Badonnel, E. maindroni Badonnel, E. meridionalis Ribaga, E. pilosus Badonnel, E. richardsi Pearman, E. titschacki Jentsch, and E. vilhenai Badonnel, are provided. Ten species were found only in Valle del Cauca, two species were found only in the NNP Gorgona, and three species were found at both sites. The specimens studied are deposited in the Entomological Museum, Universidad del Valle, Santiago de Cali, Colombia (MUSENUV).

Desgarros del epitelio pigmentario de la retina: factores de riesgo, mecanismo y control terapéutico.

PubMed

Clemens, Christoph R; Eter, Nicole

2017-07-11

Los desgarros del epitelio pigmentario de la retina (EPR) se asocian en la mayoría de los casos con los desprendimientos vascularizados del EPR debido a una degeneración macular asociada a la edad (DMAE), y normalmente implican una pérdida adversa de la agudeza visual. Estudios recientes indican que ha habido un aumento en la incidencia de desgarros del EPR desde la introducción de fármacos anti-factor de crecimiento del endotelio vascular (anti-VEGF) así como una asociación temporal entre el desgarro y la inyección intravítrea. Dado que el número de pacientes con DMAE y el número de inyecciones anti-VEGF va en aumento, tanto la dificultad de prevenir desgarros del EPR como el tratamiento tras la formación de los desgarros han adquirido una mayor relevancia. De forma paralela, la evolución de la imagenología de la retina ha contribuido de manera significativa a comprender mejor el desarrollo de los desgarros del EPR en los últimos años. Esta revisión resume los conocimientos que se poseen actualmente sobre el desarrollo, los factores pronósticos y las estrategias terapéuticas de los desgarros del EPR antes y después de que estos se formen. © 2017 S. Karger AG, Basel.

Allele frequencies of the 15 AmpF/Str Identifiler loci in the population of Metztitlán (Estado de Hidalgo), México.

PubMed

Gorostiza, A; González-Martín, A; Ramírez, C López; Sánchez, C; Barrot, C; Ortega, M; Huguet, E; Corbella, J; Gené, M

2007-03-02

The 15 AmpF/STR Identifiler loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818 and FGA) were analyzed in the sample of 180 unrelated autochthonous healthy adults born in Meztitlán City from the valley of Metztitlán (Estado de Hidalgo, México). The agreement with Hardy-Weinberg equilibrium was confirmed for all loci. From the forensic point of view, the heterozygosity value, power of discrimination and the a priori chance of exclusion were calculated.

33 CFR 334.110 - Delaware Bay off Cape Henlopen, Del.; naval restricted area.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., Del.; naval restricted area. 334.110 Section 334.110 Navigation and Navigable Waters CORPS OF....110 Delaware Bay off Cape Henlopen, Del.; naval restricted area. (a) The area. Beginning at a point on... regulations in this section shall be enforced by the Commandant, Fourth Naval District, and such agencies as...

Modeling landscapes and past vegetation patterns of New Mexico's Rio Del Oso Valley

Treesearch

Richard D. Periman

2005-01-01

Humans have interacted with the landscape and ecosystem of New Mexico's Rio del Oso Valley for thousands of years. Throughout the Holocene, various cultures have dramatically affected and altered the Rio del Oso. An interdisciplinary research approach, incorporating geomorphology, paleobotany, archaeology, and history, provides a broad range of methodologies and...

El bosque estatal del nuevo milenio antes y después del huracán Georges

Treesearch

A.E. Lugo; E. Román Nunci; M. Quinones; H. Marcano Vega; I. Vicéns

2005-01-01

We studied changes that occurred between 1997 and 2005 on a secondary wet subtropical urban forest in the University of Puerto Rico’s Botanical Garden (Bosque Estatal del Nuevo Milenio). Hurricane Georges passed south of the forest on November 21, 1998 with 127 km/h winds. The study consisted of identifying species in 40 plots of 254 m2 each, measuring the diameter at...

Antagonistic effects of IL-17 and D-resolvins on endothelial Del-1 expression through a GSK-3β-C/EBPβ pathway.

PubMed

Maekawa, Tomoki; Hosur, Kavita; Abe, Toshiharu; Kantarci, Alpdogan; Ziogas, Athanasios; Wang, Baomei; Van Dyke, Thomas E; Chavakis, Triantafyllos; Hajishengallis, George

2015-09-16

Del-1 is an endothelial cell-secreted anti-inflammatory protein. In humans and mice, Del-1 expression is inversely related to that of IL-17, which inhibits Del-1 through hitherto unidentified mechanism(s). Here we show that IL-17 downregulates human endothelial cell expression of Del-1 by targeting a critical transcription factor, C/EBPβ. Specifically, IL-17 causes GSK-3β-dependent phosphorylation of C/EBPβ, which is associated with diminished C/EBPβ binding to the Del-1 promoter and suppressed Del-1 expression. This inhibitory action of IL-17 can be reversed at the GSK-3β level by PI3K/Akt signalling induced by D-resolvins. The biological relevance of this regulatory network is confirmed in a mouse model of inflammatory periodontitis. Intriguingly, resolvin-D1 (RvD1) confers protection against IL-17-driven periodontal bone loss in a Del-1-dependent manner, indicating an RvD1-Del-1 axis against IL-17-induced pathological inflammation. The dissection of signalling pathways regulating Del-1 expression provides potential targets to treat inflammatory diseases associated with diminished Del-1 expression, such as periodontitis and multiple sclerosis.

An unexpected effect of TNF-α on F508del-CFTR maturation and function

PubMed Central

Bitam, Sara; Urbach, Valérie; Sermet-Gaudelus, Isabelle; Hinzpeter, Alexandre; Edelman, Aleksander

2015-01-01

Cystic fibrosis (CF) is a multifactorial disease caused by mutations in the cystic fibrosis transmembrane conductance regulator gene ( CFTR), which encodes a cAMP-dependent Cl - channel. The most frequent mutation, F508del, leads to the synthesis of a prematurely degraded, otherwise partially functional protein. CFTR is expressed in many epithelia, with major consequences in the airways of patients with CF, characterized by both fluid transport abnormalities and persistent inflammatory responses. The relationship between the acute phase of inflammation and the expression of wild type (WT) CFTR or F508del-CFTR is poorly understood. The aim of the present study was to investigate this effect. The results show that 10 min exposure to TNF-alpha (0.5-50ng/ml) of F508del-CFTR-transfected HeLa cells and human bronchial cells expressing F508del-CFTR in primary culture (HBE) leads to the maturation of F508del-CFTR and induces CFTR chloride currents. The enhanced CFTR expression and function upon TNFα is sustained, in HBE cells, for at least 24 h. The underlying mechanism of action involves a protein kinase C (PKC) signaling pathway, and occurs through insertion of vesicles containing F508del-CFTR to the plasma membrane, with TNFα behaving as a corrector molecule. In conclusion, a novel and unexpected action of TNFα has been discovered and points to the importance of systematic studies on the roles of inflammatory mediators in the maturation of abnormally folded proteins in general and in the context of CF in particular. PMID:26594334

Weyl fermions in a family of Gödel-type geometries with a topological defect

NASA Astrophysics Data System (ADS)

Garcia, G. Q.; Oliveira, J. R. De S.; Furtado, C.

In this paper, we study Weyl fermions in a family of Gödel-type geometries in Einstein general relativity. We also consider that these solutions are embedded in a topological defect background. We solve the Weyl equation and find the energy eigenvalues and eigenspinors for all three cases of Gödel-type geometries where a topological defect is passing through them. We show that the presence of a topological defect in these geometries contributes to the modification of the spectrum of energy. The energy zero modes for all three cases of the Gödel geometries are discussed.

General nonextremal rotating charged Gödel black holes in minimal five-dimensional gauged supergravity.

PubMed

Wu, Shuang-Qing

2008-03-28

I present the general exact solutions for nonextremal rotating charged black holes in the Gödel universe of five-dimensional minimal supergravity theory. They are uniquely characterized by four nontrivial parameters: namely, the mass m, the charge q, the Kerr equal rotation parameter a, and the Gödel parameter j. I calculate the conserved energy, angular momenta, and charge for the solutions and show that they completely satisfy the first law of black hole thermodynamics. I also study the symmetry and separability of the Hamilton-Jacobi and the massive Klein-Gordon equations in these Einstein-Maxwell-Chern-Simons-Gödel black hole backgrounds.

La implantacion del enfoque constructivista en el aula de ciencia: Estudio de caso multiple

NASA Astrophysics Data System (ADS)

Arroyo Betancourt, Luz I.

Esta investigacion estudia la implantacion del enfoque constructivista en tres aulas de ciencia del contexto puertorriqueno. Se auscultaron las practicas educativas que utilizan maestras consideradas constructivistas y la correspondencia de sus practicas educativas con los elementos esenciales de la didactica que proponen los teoricos de los planteamientos constructivistas. Se ausculto, ademas, a que vision del enfoque constructivista responden las expresiones de las maestras acerca de su practica educativa y como compara con su quehacer, a la luz de los elementos esenciales de las visiones constructivistas piagetiana, social y radical. Se utilizo el diseno de estudio descriptivo de caso multiple. El estudio se baso en entrevistas a profundidad, revision de documentos y observacion no participativa a la sala de clases. El contexto fueron tres escuelas publicas de la Region Educativa de San Juan, una elemental, una intermedia y una superior. Los resultados confirmaron que la transicion hacia el enfoque constructivista es un proceso que toma tiempo, dedicacion y la participacion en adiestramientos y readiestramientos acerca del nuevo enfoque. Las maestras coinciden en la mayoria de las practicas educativas que utilizan para implantar el enfoque constructivista de ensenanza y difieren en algunas debido, probablemente, a que han tenido que adaptarlas a los correspondientes niveles de ensenanza: elemental, intermedio y superior. Dos de las maestras planifican por conceptos generadores, mientras que una de ellas planifica siguiendo la guia que recibe del Departamento de Educacion. Difieren ademas, en el enfasis que confieren al inquirir cientifico. Con relacion a la correspondencia entre la vision manifestada por las maestras a la luz de las visiones piagetiana, social y radical, aparentemente, las preguntas del protocolo de entrevistas no lograron evocar la informacion con suficiente profundidad, por lo que la investigadora tuvo que inferir las visiones de las

Estimaciones de Prevalencia del VIH por Género y Grupo de Riesgo en Tijuana, México: 2006

PubMed Central

Iñiguez-Stevens, Esmeralda; Brouwer, Kimberly C.; Hogg, Robert S.; Patterson, Thomas L.; Lozada, Remedios; Magis-Rodriguez, Carlos; Elder, John P.; Viani, Rolando M.; Strathdee, Steffanie A.

2010-01-01

OBJETIVO Estimar la prevalencia del VIH en adultos de 15-49 años de edad en Tijuana, México - en la población general y en subgrupos de riesgo en el 2006. METODOS Se obtuvieron datos demográficos del censo Mexicano del 2005, y la prevalencia del VIH se obtuvo de la literatura. Se construyó un modelo de prevalencia del VIH para la población general y de acuerdo al género. El análisis de sensibilidad consistió en estimar errores estándar del promedio-ponderado de la prevalencia del VIH y tomar derivados parciales con respecto a cada parámetro. RESULTADOS La prevalencia del VIH es 0.54%(N = 4,347) (Rango: 0.22%–0.86%, (N = 1,750–6,944)). Esto sugiere que 0.85%(Rango: 0.39%–1.31%) de los hombres y 0.22%(Rango: 0.04%–0.40%) de las mujeres podrían ser VIH-positivos. Los hombres que tienen sexo con hombres (HSH), las trabajadoras sexuales usuarias de drogas inyectables (MTS-UDI), MTS-noUDI, mujeres UDI, y los hombres UDI contribuyeron las proporciones más elevadas de personas infectadas por el VIH. CONCLUSIONES El número de adultos VIH-positivos entre subgrupos de riesgo en la población de Tijuana es considerable, marcando la necesidad de enforcar las intervenciones de prevención en sus necesidades específicas. El presente modelo estima que hasta 1 en cada 116 adultos podrían ser VIH-positivos. PMID:19685824

An evening at "La Clinica del Pueblo".

PubMed

Shefsky, M L

1986-01-01

This article describes a typical evening at the Clinica del Pueblo in the Hispanic neighborhood of Adams-Morgan in Washington, D.c. The Clinical del Pueblo began operating in 1983 in response to the urgen medical needs of Central American refugees arriving in the Washington D.c. area. The refugees bring with them severe trauma, fear, and health problems caused by the civil was and exacerbated by inadequate or non-existant health services. Approximately 80,000 Salvadoran refugees live in the area. They do not receive adequate health care for 3 reasons. 1) Because the US goverment is unwilling to recognize them as true refugees, they live with the constant threat of deportatin back to the violence from which they have fled. 2) Refugees lack the ability to pay for private care. 3) Langauage and culture create frightening barriers to health care for the refugees. For those who do seek care, these barriers can lead to the inadequate or incomplete diagnoses and poor compliance and follow-up. Plenty International and the Central American Refugee Center responded to these problems by organizing a free clinic to provide not only medical care but also a training course for volunteers. The director of the clinic organizes the course, the classes are taught by a variety of people including the clinic's volunteer physicians, nurses, and public health educators as well as graduates of previus training courses and people from the wider community. The services of the clinic reach only a small portion of the population in need. However, the fact that free medical services are now available to some Central American refugees make the Clinica del Pueblo an important program.

The novel complex allele [A238V;F508del] of the CFTR gene: clinical phenotype and possible implications for cystic fibrosis etiological therapies.

PubMed

Diana, Anna; Polizzi, Angela Maria; Santostasi, Teresa; Ratclif, Luigi; Pantaleo, Maria Giuseppina; Leonetti, Giuseppina; Iusco, Danila Rosa; Gallo, Crescenzio; Conese, Massimo; Manca, Antonio

2016-06-01

Few mutations in cis have been annotated for F508del homozygous patients. Southern Italy patients who at a first analysis appeared homozygous for the F508del mutation (n=63) or compound heterozygous for the F508del and another mutation in the cystic fibrosis transmembrane conductance regulator gene (n=155) were searched for the A238V mutation in exon 6. The allelic frequency of the complex allele [A238V;F508del] was 0.04. When the whole data set was used (comprised also of 56 F508del/F508del and 34 F508del/other mutation controls), no differences reached the statistical significance in the clinical parameters, except chloride concentrations which were lower in [A238V;F508del]/other mutation compared with F508del/other mutation (P=0.03). The two study groups presented less complications than the control groups. Within the minimal data set (34 F508del/F508del, 27 F508del/other mutation, 4 [A238V;F508del]/F508del cases and 5 [A238V;F508del]/other mutation cases); that is, presenting all the variables in each patient, forced expiratory volume in 1 s and forced vital capacity presented a trend to lower levels in the study groups in comparison with the F508del/F508del group, and C-reactive protein approximated statistically significant higher levels in the [A238V;F508del]/other mutation as compared with F508del/F508del patients (P=0.09). The analysis of statistical dependence among the variables showed a significant anticorrelation between chloride and body mass index in the [A238V;F508del]/other mutation group. In conclusion, the complex allele [A238V;F508del] seems to be associated with less general complications than in the control groups, on the other hand possibly giving a worse pulmonary phenotype and higher systemic/local inflammatory response. These findings have implications for the correct recruitment and clinical response of F508del patients in the clinical trials testing the new etiological drugs for cystic fibrosis.

Foreword: special issue on the geology of Northwestern Mexico and adjacent areas

NASA Astrophysics Data System (ADS)

González-León, Carlos M.; Barajas, Arturo Martin

2001-10-01

The eight papers presented in this special issue are contributions that were received following the Fourth Meeting on the Geology of Northwestern Mexico and Adjacent Areas that took place from March 6- 8, 2000, in Hermosillo, México. The meeting was organized by the Estación Regional del Noroeste, Instituto de Geología, Universidad Nacional Autónoma de México; Departamento de Geología, Universidad de Sonora; Departamento de Geología, Centro de Investigación Científica y Estudios Superiores de Ensenada; Departamento de Geociencias, Centro de Estudios Superiores del Estado de Sonora; Distrito Sonora, Asociación de Ingenieros de Minas, Metalurgistas y Geólogos de México and Sociedad Geológica Mexicana. The manuscripts present new result that constitute recent advances to our understanding of the geology of southwestern North America.

Design and Implementation of A DICOM PACS With Secure Access Via Internet

DTIC Science & Technology

2001-10-25

which we have called SINFIM ( Sistema de INFormación de Imágenes Médicas). This system permits the automatic acquisition of DICOM images [2] [3...1] MA. Martínez, AJR. Jiménez, BV. Medina, LJ. Azpiroz. “Los Sistemas PACS”. [Last access 08/12/2000]. Available URL http://itzamna.uam.mx...junio, por el que se aprueba el Reglamento de medidas de seguridad de los ficheros automatizados que contengan datos de carácter personal” (Boletín Oficial del Estado, número 151, de 25 de junio de 1999)

NOAA Weather Radio

Science.gov Websites

Programación Español Listado de estación Explicacion de SAME Coverage Station Listing County Listing interés abajo de dentro de la lista entera del archivo nacional Transmisores de NWR en los Estados ±ol Condado de cobertura Listado de estación Lista de Emisora y Cobertura Acerca de NWR ESTACIONES

Comportamiento del Helio en estrellas químicamente peculiares

NASA Astrophysics Data System (ADS)

Malaroda, S. M.; López García, Z.; Leone, F.; Catalano, F.

Las estrellas químicamente peculiares (CP) se caracterizan por tener deficiencias y sobreabundancias de algunos elementos químicos de hasta 106 veces la abundancia solar. Además presentan variaciones en las líneas espectrales. Se piensa que ello se debe a que los campos magnéticos presentes en este tipo de estrellas son principalmente dipolares, con un eje de simetría diferente del eje de rotación. La distribución de los elementos sobreabundantes y deficientes no es homogénea sobre la superficie estelar y las variaciones observadas serían una consecuencia directa de la rotación estelar. Entre los elementos con abundancia anómala se encuentra el Helio, cuyas líneas tienen intensidades que no son consistentes con una abundancia normal, que no puede ser determinada del modo usual, o sea, considerando una atmósfera con composición solar. Con el fin de determinar la abundancia de este elemento, se inició un estudio de estrellas anómalas de Helio, Hew y He strong. Además se determinarán las abundancias de otros elementos anómalos como ser el Si, Cr, Mg, Mn y Fe. Las mismas se determinan del modo tradicional, o sea: a) medida de los anchos equivalentes de las líneas de los distintos elementos analizados; b) adopción de la temperatura efectiva, gravedad y abundancia del Helio; c) cálculo del modelo de atmósfera d) comparación con las observaciones y reinicio de un proceso iterativo hasta lograr un acuerdo entre todos los parámetros analizados. Las observaciones se llevaron a cabo en el Complejo Astronómico El Leoncito. Se observaron setenta y ocho estrellas anómalas de Helio. En este momento se está procediendo a calcular las abundancias correspondientes a los distintos elementos químicos. Para ello se hace uso de los modelos de Kurucz, ATLAS9. Los cálculos NLTE de las líneas de Helio se llevan a cabo con el programa MULTI y se compararán con los realizados con el programa WIDTH9 de Kurucz (LTE), con el objeto de resaltar la importancia de

Misura de Massa e Larghezza degli Stati $$x_1$$ e $$x_2$$ del Charmonio Formati in Interazioni $$p - \\bar{p}$$

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pallavicini, Marco

1995-01-01

Oggetto di questa tesi è la misura di alcune caratteristiche fisiche ( massa, larghezza, e larghezza parziale in p - p) degli stati 3 Pi e 3 A del charmonio, - overo del sistema legato di un quark "charm" e del suo antiquark-, nell'ambito dell'esperimento E-760, installato nell'accumulatore di antiprotoni del Fermilab (U.S.A).

Gonadal dysgenesis, Turner syndrome with 46,XX,del(18p)3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Telvi, L.; Ion, R.; Bernheim, A.

1994-09-01

The authors report a case of a female infant with gonadal dysgenesis, clinical features of Turner syndrome and a de novo del(18p). The factors controlling gonadal dysgenesis and Turner syndrome are unknown to date. The genes involved could be located not only on X chromosome but also on autosomes. The present case suggests that one of these genes is situated on the short arm of chromosome 18. We conclude that patients with del(18p) syndrome should be evaluated for gonadal dysgenesis.

Mejoras en el apuntado del telescopio de 2,15 mts de CASLEO

NASA Astrophysics Data System (ADS)

Aballay, J. L.; Casagrande, A. R.; Pereyra, P. F.; Marún, A. H.

Con el objeto de optimizar el funcionamiento del telescopio de 2,15 mts. de CASLEO, se están eliminando los motores de calar, de guía y mecánica asociada. Para ésto, se están diseñando dos electrónicas que gobernarán, solamente, el motor de slew y el de tracking. Con el control del motor de slew se realizarán las funciones de slew y calar, controlando desde una PC la placa que maneja las rampas de velocidad. De este modo, el movimiento será programado y por lo tanto, más suave y preciso. Con el control del motor de tracking, a través de un generador de frecuencias programable desde una PC, se proveerá los movimientos necesarios para el tracking y guía.

[Recommendations to improve the scientific communication process in the Revista Médica del IMSS].

PubMed

Álvarez, Ivón

2016-01-01

In order to improve the position of the Revista Médica del Instituto Mexicano del Seguro Social among the different journals, in this editorial we enumerate a series of recommendations to ameliorate the practices of the different actors who participate in the scientific communication process of this journal.

Electromagnetically Inferred Structure of the Caja del Rio Plateau, New Mexico

NASA Astrophysics Data System (ADS)

Layton, M. E.; Speed, C.; Shukla, M.; Vila, A.; Chon, E.; Kitamikado, C.; Feucht, D. W.; Bedrosian, P.; Pellerin, L.

2016-12-01

Magnetotelluric (MT) and transient electromagnetic (TEM) data were acquired by students from the Summer of Applied Geophysical Experience (SAGE) to construct structural models in and around the Caja del Rio Plateau, New Mexico. The Caja del Rio is located on the La Bajada-Jemez constriction that separates the Española and Santa Domingo basins in the Rio Grande Rift. The Rio Grande Rift, the result of tectonic extensional forces, extends approximately north-south across northern New Mexico. MT data collected in 2016 were merged with that from previous years to make up an 11 km north line and a 16 km south line extending from the west side of the Caja Del Rio to the east off the plateau in the Old Buckman Road area. The resistivity distributions revealed in one-dimensional (1-D) and two-dimensional (2-D) inverse models show some robust features. Models of the north are interpreted as a top resistive layer (<500m) of Tertiary volcanoclastic rock, to a central conductive layer (600-200m) of Mesozoic and Paleozoic sediments of the Santa Fe group to crystalline basement rock. Models for the south line show low resistivity for the first 3 to 5 km and then transitions into higher resistivity values consistent with the models for the north line. At a period of 100 seconds induction arrows (Parkinson's convention) point in the northwest direction towards the conductive Valles Caldera. The MT models are consistent with geologic interpretations of the stratigraphic units. In addition, models disclose an additional conductive layer below the basement that we interpret as the mid-crustal conductor. Transient electromagnetic (TEM) data were collected in seven locations atop the Caja del Rio plateau in an attempt to identify the basal contact of the Cerros del Rio volcanic field, which, in turn, allow for the thickness of these basaltic and andesitic deposits to be mapped across the plateau. One-dimensional inverse models produced from the TEM data were aligned and interpreted

Field Measurements of Respiratory Del13CO2 and Photodegradation

NASA Astrophysics Data System (ADS)

van Asperen, H.; Sabbatini, S.; Nicolini, G.; Warneke, T.; Papale, D.; Notholt, J.

2014-12-01

Carbon decomposition dynamics have been studied in a variety of ecosystems and its variation can mostly be explained in terms of environmental variables (e.g. temperature and precipitation). However, carbon dynamics in arid, water limited regions have shown to be very different and are still largely unknown. Several studies have indicated the importance of photodegradation, the direct breakdown of organic matter by sunlight, in these arid regions. A FTIR (Fourier Transform Infrared Spectrometer) was set up to continuously measure concentrations of CO2, CH4, N2O, CO as well as del13C in CO2. The FTIR was connected to 2 different flux measurement systems: a Flux Gradient system and 2 flux chambers, providing a continuous data set of gas concentrations and biosphere-atmosphere gas fluxes at different heights and scales. Field measurements showed photodegradation induced carbon fluxes. Also, respiratory del13CO2 was determined by use of Keeling plots, and was determined to vary between -25‰ and -21‰. A clear diurnal pattern in respiratory del13CO2 was found, suggesting either different (dominant) respiratory processes between day and night or the effect of diffusive fractionation.

Nebraska State Report Card, 1999-2000 = Tarjeta informativa del Estado de Nebraska, 1999-2000.

ERIC Educational Resources Information Center

Nebraska State Dept. of Education, Lincoln.

This report, printed in English and Spanish versions, is the first Nebraska State Report Card. It provides a snapshot of Nebraska schools using statewide averages. Nebraska students scored better than students nationwide in reading, with 60% of Nebraska students in grades 3-4, 7-8, and 10-12 scoring above the median on a standardized reading test.…

Ecos del Cosmos: A radio astroexperience at the Universitat de Valencia

NASA Astrophysics Data System (ADS)

Marco, E.; Ballesteros, F. J.; Ortiz-Gil, A.

2017-03-01

During the last three years Ecos del Cosmos has been a radio program dedicated to spreading astronomical hot news to the Universitat de València community and beyond, and also topics of general astronomical interest. To do this, this program by Ràdio Universitat has conducted live interviews with researchers, explored relationships of astronomy with humanities and society, performed contests and explained in a simple way the main monthly ephemerides. A version of Ecos del Cosmos was broadcasted in the Onda Cero’s summer program ''Jelo en verano''conducted by Arturo Tellez.

Pier Diego Siccardi (1880-1917) and the "Clinica del Lavoro" in the trench warfare.

PubMed

Riva, Michele Augusto; Caramella, Michela; Turato, Massimo; Cesana, Giancarlo

2017-12-14

The year 2017 marks the centenary of the death of the Italian scientist Pier Diego Siccardi (1880-1917), one of Luigi Devoto's assistants at the "Clinica del Lavoro" in Milan. To commemorate Siccardi and to describe the activities of the physicians of the "Clinica del Lavoro" during World War I. A comprehensive analysis was conducted on scientific papers written by Pier Diego Siccardi and by other physicians belonging to the Clinica del Lavoro, in the period 1915-1918. During the Great War, the Clinica del Lavoro became a military hospital, even though it indirectly maintained a role in Occupational Health, assisting women who had started to work to replace the men sent to the front. Devoto and his assistants were drafted as Army doctors, but continued their research activities while at the front; focusing on the diseases that affected the soldiers, mainly infections. Bleeding fevers and jaundice were endemic among Italian troops, but their etiology was unknown. Pier Diego Siccardi identified this syndrome as an infection caused by a spirochete, and was the first one to isolate the infectious agent. Siccardi prematurely died of the same disease as a consequence of a laboratory accident, which provided further confirmation for his research. The heroic life of Siccardi and his tragic death testify the important activities of the scientists of the "Clinica del Lavoro" in the years of the Great War.

Venezuela, A Country Study.

DTIC Science & Technology

1982-04-16

NUMBERS US Army War College Carlisle Barracks, PA 17013 11. CONTROLLING OFFICE NAME AND ADDRESS 12. REPORT DATE Same16 Aril 1982Same13. NUMBER OF...to grips with expectations for more and better social welfare programs, education, health facilities and jobs. The pressures are the 2 greatest in the...the mestizos or mulattos - and freed blacks. This group was spreading through the country. They became a significant ethnic culture in Venezuela

DelPhiPKa web server: predicting pKa of proteins, RNAs and DNAs.

PubMed

Wang, Lin; Zhang, Min; Alexov, Emil

2016-02-15

A new pKa prediction web server is released, which implements DelPhi Gaussian dielectric function to calculate electrostatic potentials generated by charges of biomolecules. Topology parameters are extended to include atomic information of nucleotides of RNA and DNA, which extends the capability of pKa calculations beyond proteins. The web server allows the end-user to protonate the biomolecule at particular pH based on calculated pKa values and provides the downloadable file in PQR format. Several tests are performed to benchmark the accuracy and speed of the protocol. The web server follows a client-server architecture built on PHP and HTML and utilizes DelPhiPKa program. The computation is performed on the Palmetto supercomputer cluster and results/download links are given back to the end-user via http protocol. The web server takes advantage of MPI parallel implementation in DelPhiPKa and can run a single job on up to 24 CPUs. The DelPhiPKa web server is available at http://compbio.clemson.edu/pka_webserver. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Meta-analysis of CHEK2 1100delC variant and colorectal cancer susceptibility.

PubMed

Xiang, He-ping; Geng, Xiao-ping; Ge, Wei-wei; Li, He

2011-11-01

Cell cycle checkpoint kinase 2 (CHEK2) gene has been inconsistently associated with colorectal cancer (CRC), particularly the 1100delC variant. To generate large-scale evidence on whether the CHEK2 1100delC variant is associated with CRC susceptibility we have conducted a meta-analysis. Data were collected from the following electronic databases: PubMed, Excerpta Medica Database and Chinese Biomedical Literature Database, with the last report up to November 2010. The odds ratio (OR) and its 95% confidence interval (95% CI) were used to assess the strength of association. We evaluated the contrast of carriers versus non-carriers. Meta-analysis was performed in a fixed/random effect model by using the software Review Manager 4.2. A total of six studies including 4194 cases and 10,010 controls based on the search criteria were involved in this meta-analysis. A significant association of the CHEK2 1100delC variant with unselected CRC was found (OR=2.11, 95% CI=1.41-3.16, P=0.0003). We also found an association of the CHEK2 1100delC variant with familial CRC (OR=2.80, 95% CI=1.74-4.51, P<0.0001). However, the association was not established for sporadic CRC (OR=1.45, 95% CI=0.49-4.30, P=0.50). This meta-analysis demonstrates that the CHEK2 1100delC variant may be an important CRC-predisposing gene, which increases CRC risk. Copyright © 2011. Published by Elsevier Ltd.

DelPhiForce web server: electrostatic forces and energy calculations and visualization.

PubMed

Li, Lin; Jia, Zhe; Peng, Yunhui; Chakravorty, Arghya; Sun, Lexuan; Alexov, Emil

2017-11-15

Electrostatic force is an essential component of the total force acting between atoms and macromolecules. Therefore, accurate calculations of electrostatic forces are crucial for revealing the mechanisms of many biological processes. We developed a DelPhiForce web server to calculate and visualize the electrostatic forces at molecular level. DelPhiForce web server enables modeling of electrostatic forces on individual atoms, residues, domains and molecules, and generates an output that can be visualized by VMD software. Here we demonstrate the usage of the server for various biological problems including protein-cofactor, domain-domain, protein-protein, protein-DNA and protein-RNA interactions. The DelPhiForce web server is available at: http://compbio.clemson.edu/delphi-force. delphi@clemson.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

DelPhi web server v2: incorporating atomic-style geometrical figures into the computational protocol.

PubMed

Smith, Nicholas; Witham, Shawn; Sarkar, Subhra; Zhang, Jie; Li, Lin; Li, Chuan; Alexov, Emil

2012-06-15

A new edition of the DelPhi web server, DelPhi web server v2, is released to include atomic presentation of geometrical figures. These geometrical objects can be used to model nano-size objects together with real biological macromolecules. The position and size of the object can be manipulated by the user in real time until desired results are achieved. The server fixes structural defects, adds hydrogen atoms and calculates electrostatic energies and the corresponding electrostatic potential and ionic distributions. The web server follows a client-server architecture built on PHP and HTML and utilizes DelPhi software. The computation is carried out on supercomputer cluster and results are given back to the user via http protocol, including the ability to visualize the structure and corresponding electrostatic potential via Jmol implementation. The DelPhi web server is available from http://compbio.clemson.edu/delphi_webserver.

Los plaguicidas y la contaminacion del medio ambiente Venezolano

USGS Publications Warehouse

Stickel, L.F.; Stickel, W.H.

1972-01-01

RESUMEN DE RECOMENDACIONES Recomendaciones para el Programa de Investigacion: 1. Establecer un sistema de muestreo biologico para detectar los niveles tendencias de los productos quimicos toxicos en un peque?o numero de si tios representativos. 2. Mantener continua vigilancia de la contaminacion ambiental, mediante la seleccion acertadamente dirigida de las zonas afectadas y de las fuentes de contaminacion. 3. Realizar estudios acerca de las poblaciones de animales silvestres, y del exito de los procesos reproductivos de las especies o grupos clayes de animales que se consideran mas gravemente afectados. 4. Preparar recomendaciones para una accion gubernamental de proteccion al hombre, a la fauna silvestre y al medio ambiente. Recomendaciones para la Accion Administrativa: 1. Establecer limites a la tolerancia de los residuos de plaguicidas en los alimentos. Constituye una medida clave para disminuir la contaminacion ambiental. 2. Establecer normas de calidad del agua para las corrientes, represas, la gos y otros cuerpos. Es la segunda medida clave para reducir la contaminacion del ambiente 3. Exigir un tratamiento adecuado de los efluentes industriales, especialmente antes de que se construyan las nuevas plantas. 4. Exigir a los agricultores que en el uso de plaguicidas sigan los consejos tecnicos autorizados y negar a los vendedores el derecho a recomendar productos por su cuenta. 5. Tomar medidas para recoger y eliminar los recipientes y sobrantes de los plaguicidas.

CHEK2 c.1100delC allele is rarely identified in Greek breast cancer cases.

PubMed

Apostolou, Paraskevi; Fostira, Florentia; Papamentzelopoulou, Myrto; Michelli, Maria; Panopoulos, Christos; Fountzilas, George; Konstantopoulou, Irene; Voutsinas, Gerassimos E; Yannoukakos, Drakoulis

2015-04-01

The CHEK2 gene encodes a protein kinase that plays a crucial role in maintenance of genomic integrity and the DNA repair mechanism. CHEK2 germline mutations are associated with increased risk of breast cancer and other malignancies. From a clinical perspective, the most significant mutation identified is the c.1100delC mutation, which is associated with an approximately 25% lifetime breast cancer risk. The distribution of this mutation shows wide geographical variation; it is more prevalent in the Northern European countries and less common, or even absent, in Southern Europe. In order to estimate the frequency of the CHEK2 c.1100delC mutation in Greek breast cancer patients, we genotyped 2,449 patients (2,408 females and 41 males), which was the largest series ever tested for c.1100delC. The mean age of female and male breast cancer diagnosis was 49 and 59 years, respectively. All patients had previously tested negative for the Greek BRCA1 founder and recurrent mutations. The CHEK2 c.1100delC mutation was detected in 0.16% (4 of 2,408) of females, all of whom were diagnosed with breast cancer before the age of 50 years. Only one c.1100delC carrier was reported with breast cancer family history. The present study indicates that the CHEK2 c.1100delC mutation does not contribute substantially to hereditary breast cancer in patients of Greek descent. Copyright © 2015 Elsevier Inc. All rights reserved.

Haplotype analysis of the 185delAG BRCA1 mutation in ethnically diverse populations

PubMed Central

Laitman, Yael; Feng, Bing-Jian; Zamir, Itay M; Weitzel, Jeffrey N; Duncan, Paul; Port, Danielle; Thirthagiri, Eswary; Teo, Soo-Hwang; Evans, Gareth; Latif, Ayse; Newman, William G; Gershoni-Baruch, Ruth; Zidan, Jamal; Shimon-Paluch, Shani; Goldgar, David; Friedman, Eitan

2013-01-01

The 185delAG* BRCA1 mutation is encountered primarily in Jewish Ashkenazi and Iraqi individuals, and sporadically in non-Jews. Previous studies estimated that this is a founder mutation in Jewish mutation carriers that arose before the dispersion of Jews in the Diaspora ∼2500 years ago. The aim of this study was to assess the haplotype in ethnically diverse 185delAG* BRCA1 mutation carriers, and to estimate the age at which the mutation arose. Ethnically diverse Jewish and non-Jewish 185delAG*BRCA1 mutation carriers and their relatives were genotyped using 15 microsatellite markers and three SNPs spanning 12.5 MB, encompassing the BRCA1 gene locus. Estimation of mutation age was based on a subset of 11 markers spanning a region of ∼5 MB, using a previously developed algorithm applying the maximum likelihood method. Overall, 188 participants (154 carriers and 34 noncarriers) from 115 families were included: Ashkenazi, Iraq, Kuchin-Indians, Syria, Turkey, Iran, Tunisia, Bulgaria, non-Jewish English, non-Jewish Malaysian, and Hispanics. Haplotype analysis indicated that the 185delAG mutation arose 750–1500 years ago. In Ashkenazim, it is a founder mutation that arose 61 generations ago, and with a small group of founder mutations was introduced into the Hispanic population (conversos) ∼650 years ago, and into the Iraqi–Jewish community ∼450 years ago. The 185delAG mutation in the non-Jewish populations in Malaysia and the UK arose at least twice independently. We conclude that the 185delAG* BRCA1 mutation resides on a common haplotype among Ashkenazi Jews, and arose about 61 generations ago and arose independently at least twice in non-Jews. PMID:22763381

Detecting a hierarchical genetic population structure via Multi-InDel markers on the X chromosome

PubMed Central

Fan, Guang Yao; Ye, Yi; Hou, Yi Ping

2016-01-01

Detecting population structure and estimating individual biogeographical ancestry are very important in population genetics studies, biomedical research and forensics. Single-nucleotide polymorphism (SNP) has long been considered to be a primary ancestry-informative marker (AIM), but it is constrained by complex and time-consuming genotyping protocols. Following up on our previous study, we propose that a multi-insertion-deletion polymorphism (Multi-InDel) with multiple haplotypes can be useful in ancestry inference and hierarchical genetic population structures. A validation study for the X chromosome Multi-InDel marker (X-Multi-InDel) as a novel AIM was conducted. Genetic polymorphisms and genetic distances among three Chinese populations and 14 worldwide populations obtained from the 1000 Genomes database were analyzed. A Bayesian clustering method (STRUCTURE) was used to discern the continental origins of Europe, East Asia, and Africa. A minimal panel of ten X-Multi-InDels was verified to be sufficient to distinguish human ancestries from three major continental regions with nearly the same efficiency of the earlier panel with 21 insertion-deletion AIMs. Along with the development of more X-Multi-InDels, an approach using this novel marker has the potential for broad applicability as a cost-effective tool toward more accurate determinations of individual biogeographical ancestry and population stratification. PMID:27535707

[The Revista Médica del IMSS in the 2017 Healthcare Book Fair].

PubMed

Ramiro-H, Manuel; Acosta-Pérez, L; Cruz-Aranda, J E; García-Damián, J J; Miguel-Reyes, R; González-Martínez, R

2017-01-01

On August, the second edition of the Healthcare Book Fair took place, sponsored by the Facultad de Medicina of UNAM. Again, the Revista Médica del Instituto Mexicano del Seguro Social participated with a stand where we promoted it, talked about the different indexes where our journal is included, explained its objective and scope, and finally talked about its nature as an open access journal, which is aimed to the clinical staff of the different health institutions of our country.

Resultados del relevamiento de HI en el Cielo Austral: 3. Relevamiento de Nubes de Alta Velocidad

NASA Astrophysics Data System (ADS)

Morras, R.; Bajaja, E.; Arnal, E. M.; Pöppel, W. G. L.

Los resultados del relevamiento de HI del Hemisferio Austral fueron reprocesados con el fin de incrementar su sensibilidad. Así, se utilizó esta nueva base de datos con el fin de obtener un nuevo relevamiento de Nubes de Alta Velocidad en el cielo austral. El ruido r.m.s. alcanzado es de 0.015-0.020 K, con una resolución espectral de 8 km/seg. El cubrimiento espacial del relevamiento mejora en un factor 16 al realizado por Bajaja et al (1985).

[La Medicina del Lavoro: 100 volumes].

PubMed

Zocchetti, C

2009-01-01

With these pages La Medicina del Lavoro starts its 100th volume, so we have yet another historical occasion to celebrate the oldest occupational health journal in the world that is still publishing. Over the last few years we have had many occasions to celebrate, for example several anniversaries of the Journal (the 80th volume in 1989, 90 years in 1992, 100 years in 2001); the centenary of the foundation of the Clinica del Lavoro "Luigi Devoto" of Milan in 2001; the celebration of the 300 years' anniversary of the publication of De Morbis Artificum Diatriba by Bernardino Ramazzini, and we obviously hope to continue for many years to come in this positive outlook. One hundred volumes makes for a very large collection, with the highs and lows ofthe Journal's history (here we mean the variations in number of pages and physical size of the Journal). It is thanks to the Editors-in-chief(there have been very few so we can cite them all: Luigi Devoto, 1901-1936; Luigi Preti, 1936-1941; Enrico Vigliani, 1943-1992; e Vito Foà, 1992 to the present); the contributors who in various ways and with varying degrees of commitment but always with an exceptional personal participation, that it has been possible to reach 100 volumes, starting with C. Moreschi who, along with Luigi Devoto, was the first and sole editor at the Journal's foundation; up to the present extended and impressive editorial board; the printers (from the first. Tipografia Cooperativa, Via dei Molini in Pavia, to the latest: Casa Editrice Mattioli in Fidenza); the sponsors, including the most evident who, via advertising (rather limited as a matter offact), directly gave information about themselves, but also those who have often been or are behind the scenes, ensuring fundamental support which is not visible; content. articles, news, events, reports, ideas, opinions, photographs, tables, numbers... etc, which are really impossible to sum up. But the true collection which, for obvious reasons, cannot be

Relevamiento total del hemisferio sur celeste en la frecuencia de 1420 MHz

NASA Astrophysics Data System (ADS)

Bava, J. A.; Colomb, F. R.; Hurrel, E.; Larrarte, J. J.; Sanz, A. J.; Testori, J. C.; Reich, P.; Reich, W.; Wielebinski, R.

En el presente artículo se describe el relevamiento del cielo en el Hemisferio Sur Celeste en la frecuencia de 1420 MHz para declinaciones δ<= -19o realizado con la Antena II de 30 metros de diámetro del IAR. Este relevamiento posee igual sensibilidad (3xr.m.s=50 mK) que el realizado en el Hemisferio Norte con el radiotelescopio de 25 metros de Stockert de la Universidad de Bonn, operado por el Max-Planck Institute für Radioastronomie ( Reich W., 1982, A&ASS 48, 219; Reich P. and Reich W., 1986, A&ASS 63, 205). Con los datos obtenidos por ambos radiotelescopios se posee una base de datos de todo el cielo en esta frecuencia. En esta publicación presentamos los detalles del sistema receptor, técnicas de observación y reducción de datos, calibración y discusión de los errores en los resultados.

Restoration of CFTR function in patients with cystic fibrosis carrying the F508del-CFTR mutation

PubMed Central

Stefano, Daniela De; Villella, Valeria R; Esposito, Speranza; Tosco, Antonella; Sepe, Angela; Gregorio, Fabiola De; Salvadori, Laura; Grassia, Rosa; Leone, Carlo A; Rosa, Giuseppe De; Maiuri, Maria C; Pettoello-Mantovani, Massimo; Guido, Stefano; Bossi, Anna; Zolin, Anna; Venerando, Andrea; Pinna, Lorenzo A; Mehta, Anil; Bona, Gianni; Kroemer, Guido; Maiuri, Luigi; Raia, Valeria

2014-01-01

Restoration of BECN1/Beclin 1-dependent autophagy and depletion of SQSTM1/p62 by genetic manipulation or autophagy-stimulatory proteostasis regulators, such as cystamine, have positive effects on mouse models of human cystic fibrosis (CF). These measures rescue the functional expression of the most frequent pathogenic CFTR mutant, F508del, at the respiratory epithelial surface and reduce lung inflammation in CftrF508del homozygous mice. Cysteamine, the reduced form of cystamine, is an FDA-approved drug. Here, we report that oral treatment with cysteamine greatly reduces the mortality rate and improves the phenotype of newborn mice bearing the F508del-CFTR mutation. Cysteamine was also able to increase the plasma membrane expression of the F508del-CFTR protein in nasal epithelial cells from F508del homozygous CF patients, and these effects persisted for 24 h after cysteamine withdrawal. Importantly, this cysteamine effect after washout was further sustained by the sequential administration of epigallocatechin gallate (EGCG), a green tea flavonoid, both in vivo, in mice, and in vitro, in primary epithelial cells from CF patients. In a pilot clinical trial involving 10 F508del-CFTR homozygous CF patients, the combination of cysteamine and EGCG restored BECN1, reduced SQSTM1 levels and improved CFTR function from nasal epithelial cells in vivo, correlating with a decrease of chloride concentrations in sweat, as well as with a reduction of the abundance of TNF/TNF-alpha (tumor necrosis factor) and CXCL8 (chemokine [C-X-C motif] ligand 8) transcripts in nasal brushing and TNF and CXCL8 protein levels in the sputum. Altogether, these results suggest that optimal schedules of cysteamine plus EGCG might be used for the treatment of CF caused by the F508del-CFTR mutation. PMID:25350163

Restoration of CFTR function in patients with cystic fibrosis carrying the F508del-CFTR mutation.

PubMed

De Stefano, Daniela; Villella, Valeria R; Esposito, Speranza; Tosco, Antonella; Sepe, Angela; De Gregorio, Fabiola; Salvadori, Laura; Grassia, Rosa; Leone, Carlo A; De Rosa, Giuseppe; Maiuri, Maria C; Pettoello-Mantovani, Massimo; Guido, Stefano; Bossi, Anna; Zolin, Anna; Venerando, Andrea; Pinna, Lorenzo A; Mehta, Anil; Bona, Gianni; Kroemer, Guido; Maiuri, Luigi; Raia, Valeria

2014-01-01

Restoration of BECN1/Beclin 1-dependent autophagy and depletion of SQSTM1/p62 by genetic manipulation or autophagy-stimulatory proteostasis regulators, such as cystamine, have positive effects on mouse models of human cystic fibrosis (CF). These measures rescue the functional expression of the most frequent pathogenic CFTR mutant, F508del, at the respiratory epithelial surface and reduce lung inflammation in Cftr(F508del) homozygous mice. Cysteamine, the reduced form of cystamine, is an FDA-approved drug. Here, we report that oral treatment with cysteamine greatly reduces the mortality rate and improves the phenotype of newborn mice bearing the F508del-CFTR mutation. Cysteamine was also able to increase the plasma membrane expression of the F508del-CFTR protein in nasal epithelial cells from F508del homozygous CF patients, and these effects persisted for 24 h after cysteamine withdrawal. Importantly, this cysteamine effect after washout was further sustained by the sequential administration of epigallocatechin gallate (EGCG), a green tea flavonoid, both in vivo, in mice, and in vitro, in primary epithelial cells from CF patients. In a pilot clinical trial involving 10 F508del-CFTR homozygous CF patients, the combination of cysteamine and EGCG restored BECN1, reduced SQSTM1 levels and improved CFTR function from nasal epithelial cells in vivo, correlating with a decrease of chloride concentrations in sweat, as well as with a reduction of the abundance of TNF/TNF-alpha (tumor necrosis factor) and CXCL8 (chemokine [C-X-C motif] ligand 8) transcripts in nasal brushing and TNF and CXCL8 protein levels in the sputum. Altogether, these results suggest that optimal schedules of cysteamine plus EGCG might be used for the treatment of CF caused by the F508del-CFTR mutation.

Screening for F508del as a first step in the molecular diagnosis of cystic fibrosis.

PubMed

Marson, Fernando Augusto de Lima; Bertuzzo, Carmen Silvia; Ribeiro, Maria Ângela Gonçalves de Oliveira; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu

2013-01-01

To determine the relevance of screening for the F508del mutation of the cystic fibrosis transmembrane conductance regulator gene as a first step in the genetic diagnosis of cystic fibrosis (CF) by associating the genotype with various clinical variables. We evaluated 180 CF patients regarding the F508del mutation. The clinical data were obtained from the medical records of the patients and from interviews with their parents or legal guardians. Of the 180 patients studied, 65 (36.1%) did not carry the F508del mutation (group 0 [G0]), 67 (37.2%) were F508del heterozygous (G1), and 48 (26.7%) were F508del homozygous (G2). All three groups showed associations with the clinical variables. Homozygosis was associated with younger patients, younger age at CF diagnosis, and younger age at the first isolation of Pseudomonas aeruginosa (PA), as well as with higher prevalence of pancreatic insufficiency (PI) and non-mucoid PA (NMPA) colonization. In comparison with G1+G2 patients, G0 patients were older; first experienced clinical symptoms, digestive disease, and pulmonary disease at an older age; were older at CF diagnosis and at first PA isolation; and had a lower prevalence of PI and meconium ileus, as well as of colonization by NMPA, mucoid PA, and Burkholderia cepacia. In G1 patients, values were intermediate for age at CF diagnosis; age at first PA isolation, first pulmonary symptoms, and first clinical manifestations; MPA colonization; and OR for PI. The identification of F508del in 63.9% of the patients studied showed that this can be a useful tool as a first step in the genetic diagnosis of CF. The F508del genotype was associated with clinical severity of the disease, especially with the variables related to CF onset.

Identificación de los miembros del cúmulo NGC 2516

NASA Astrophysics Data System (ADS)

de Elía, G. C.; Orellana, R. B.

El cúmulo abierto NGC 2516 (α = 7h 58m y δ = -60o 45') tiene una edad de, aproximadamente, 150 Myr. El análisis de este sistema es particularmente importante en el Hemisferio Sur debido a su abundancia de estrellas peculiares y muy estudiado aplicando técnicas fotométricas, pero muy poco analizado desde el punto de vista astrométrico. A partir de una placa obtenida en el Observatorio Astronómico de La Plata y observaciones más actuales, nos hemos abocado al estudio de los movimientos propios de este cúmulo con el fin de determinar la pertenencia al mismo de las estrellas del campo de dicho cúmulo. Luego de llevar a cabo la determinación de los movimientos propios de todas las estrellas a partir de las posiciones obtenidas de la placa existente en el Observatorio de La Plata de 1914 y leídas con la MAMA en París, las observaciones realizadas con el círculo meridiano de San Fernando que se encuentra en el Observatorio Félix Aguilar de San Juan y las posiciones existentes en los catálogos AC 2000, Tycho, USNO y UCAC, programamos el método de Vasilevsky y Sanders para determinar la pertenencia de las estrellas de la región al cúmulo en cuestión. En un paso posterior, se realizó una modificación al método anterior para la determinación de los miembros. En esta modificación se consideró la densidad de las estrellas del cúmulo y la densidad de estrellas de campo. Esto permitió evaluar la pertenencia, no sólo a partir del movimiento propio de las estrellas, sino también a partir de la posición de las mismas con respecto al centro del cúmulo. También se consideró la dependencia de los parámetros con la magnitud. Los resultados así obtenidos fueron comparados con otras investigaciones de movimientos propios de la región del cúmulo. El movimiento propio absoluto del cúmulo fue comparado con el obtenido a partir de los catálogos estelares. Se encontró que los resultados coincidían para estrellas brillantes (magnitud más brillante que

A participatory approach to integrated aquifer management: The case of Guanajuato State, Mexico

NASA Astrophysics Data System (ADS)

Sandoval, Ricardo

de l'État s'est appliqué à développer une stratégie sur deux plans. Tout d'abord, des études hydrogéologiques de base et des modèles mathématiques d'écoulement et de transport de nappe ont été réalisés à partir d'un suivi d'ensemble des puits existants et d'une révision générale du contexte géologique de l'État. Ensuite, on a soutenu une structure de participation des usagers de l'eau aux actions de gestion de l'eau, à partir de la dissémination de l'information pour la mise en place de projets pilotes efficaces d'utilisation de l'eau, avec des aides financières, techniques et politiques de l'État. Simultanément, un effort coordonné en vue de l'achèvement de l'enregistrement des usagers de l'eau a été fait avec l'autorité fédérale, en même temps que d'autres mesures de soutien, telles que des programmes de formation et des campagnes de surveillance. Cet article présente une vue d'ensemble des réalisations de projets et des défis. Resumen El Estado de Guanajuato, situado en el centro de México, ocupa menos del 2% de la superficie del país. Tiene casi 17.000 pozos profundos, de los cuales se extrae cerca de 4.000 hm3/a, lo que supone un exceso de 1.000 hm3/a respecto a la recarga anual. Puesto que el agua es administrada a nivel federal en México, el gobierno del Estado afronta el reto de asegurar el desarrollo de la población sin disponer de medios formales de intervención. Dadas las limitaciones para aplicar políticas y medidas reguladoras, el programa del agua en el Estado tiene como objetivo principal la implantación de una doble estrategia. Por un lado, desarrollar estudios hidrogeológicos básicos y modelos matemáticos de flujo y transporte de los acuíferos, basándose en una campaña exhaustiva de pozos existentes y en una revisión del marco geológico del Estado. Por otro lado, promover-con soporte financiero, técnico y político-una estructura de participación de los usuarios en las acciones de gesti

Modeling visibility in the Paso del Norte (PDN) Region

NASA Astrophysics Data System (ADS)

Medina Calderon, Richard

Poor visibility is a subject of growing public concern throughout the U.S, and an active area of research. Its societal impacts on air quality, aviation transport and traffic are significant. Aerosols play a fundamental role in the attenuation of solar radiation, and also affect visibility. The scattering and extinction coefficients of aerosol particles in the Paso del Norte Region have been calculated using the T- matrix model in conjunction with a laser particle counter. Inter-comparison of the model's results of the scattering and absorption coefficients against the corresponding data from a Photoacustic extinctiometer instrument (which measures in-situ absorption and scattering coefficients of aerosol particles) shows excellent agreement. In addition, the volume-weighted method is used to determine the composite index of refraction which is representative of the aerosols for the Paso del Norte Region to obtain information of the type of aerosol particles present in the Region. The Single Scattering Albedo has also been retrieved using this methodology to obtain further insight into the type of aerosols present on a given day. Finally, the Koschmieder equation has been used to calculate the visual range or visibility, and was correlated with the PM2.5 and PM10 particle concentration present in the Region. Our methodology will allow a better understanding of the size and type of aerosol particles that are most detrimental to the visibility for the Paso Del Norte Region.

Highly preferential association of NonF508del CF mutations with the M470 allele.

PubMed

Ciminelli, B M; Bonizzato, A; Bombieri, C; Pompei, F; Gabaldo, M; Ciccacci, C; Begnini, A; Holubova, A; Zorzi, P; Piskackova, T; Macek, M; Castellani, C; Modiano, G; Pignatti, P F

2007-01-01

On the basis of previous findings on random individuals, we hypothesized a preferential association of CF causing mutations with the M allele of the M470V polymorphic site of the CFTR gene. We have determined the M/V-CF mutation haplotype in a series of 201 North East Italian and 73 Czech CF patients who were not F508del homozygotes, as F508del was already known to be fully associated with the M allele. Out of 358 not F508del CF genes, 84 carried the V allele and 274 the less common M allele. In the N-E Italian population, MM subjects have a risk of carrying a CF causing mutation 6.9x greater than VV subjects when F508del is excluded and 15.4x when F508del is included. In the Czech population a similar, although less pronounced, association is observed. Besides the possible biological significance of this association, the possibility of exploiting it for a pilot screening program has been explored in a local North East Italian population for which CF patients were characterized for their CF mutation. General M470V genotyping followed by common CF mutation screening limited to couples in which each partner carries at least one M allele would need testing only 39% of the couples, which contribute 89% of the total risk, with a cost benefit.

Age- and Tumor Subtype–Specific Breast Cancer Risk Estimates for CHEK2*1100delC Carriers

PubMed Central

Hogervorst, Frans; van Hien, Richard; Cornelissen, Sten; Broeks, Annegien; Adank, Muriel A.; Meijers, Hanne; Waisfisz, Quinten; Hollestelle, Antoinette; Schutte, Mieke; van den Ouweland, Ans; Hooning, Maartje; Andrulis, Irene L.; Anton-Culver, Hoda; Antonenkova, Natalia N.; Antoniou, Antonis C.; Arndt, Volker; Bermisheva, Marina; Bogdanova, Natalia V.; Bolla, Manjeet K.; Brauch, Hiltrud; Brenner, Hermann; Brüning, Thomas; Burwinkel, Barbara; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Couch, Fergus J.; Cox, Angela; Cross, Simon S.; Czene, Kamila; Dunning, Alison M.; Fasching, Peter A.; Figueroa, Jonine; Fletcher, Olivia; Flyger, Henrik; Galle, Eva; García-Closas, Montserrat; Giles, Graham G.; Haeberle, Lothar; Hall, Per; Hillemanns, Peter; Hopper, John L.; Jakubowska, Anna; John, Esther M.; Jones, Michael; Khusnutdinova, Elza; Knight, Julia A.; Kosma, Veli-Matti; Kristensen, Vessela; Lee, Andrew; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Margolin, Sara; Meindl, Alfons; Milne, Roger L.; Muranen, Taru A.; Newcomb, Polly A.; Offit, Kenneth; Park-Simon, Tjoung-Won; Peto, Julian; Pharoah, Paul D.P.; Robson, Mark; Rudolph, Anja; Sawyer, Elinor J.; Schmutzler, Rita K.; Seynaeve, Caroline; Soens, Julie; Southey, Melissa C.; Spurdle, Amanda B.; Surowy, Harald; Swerdlow, Anthony; Tollenaar, Rob A.E.M.; Tomlinson, Ian; Trentham-Dietz, Amy; Vachon, Celine; Wang, Qin; Whittemore, Alice S.; Ziogas, Argyrios; van der Kolk, Lizet; Nevanlinna, Heli; Dörk, Thilo; Bojesen, Stig; Easton, Douglas F.

2016-01-01

Purpose CHEK2*1100delC is a well-established breast cancer risk variant that is most prevalent in European populations; however, there are limited data on risk of breast cancer by age and tumor subtype, which limits its usefulness in breast cancer risk prediction. We aimed to generate tumor subtype- and age-specific risk estimates by using data from the Breast Cancer Association Consortium, including 44,777 patients with breast cancer and 42,997 controls from 33 studies genotyped for CHEK2*1100delC. Patients and Methods CHEK2*1100delC genotyping was mostly done by a custom Taqman assay. Breast cancer odds ratios (ORs) for CHEK2*1100delC carriers versus noncarriers were estimated by using logistic regression and adjusted for study (categorical) and age. Main analyses included patients with invasive breast cancer from population- and hospital-based studies. Results Proportions of heterozygous CHEK2*1100delC carriers in controls, in patients with breast cancer from population- and hospital-based studies, and in patients with breast cancer from familial- and clinical genetics center–based studies were 0.5%, 1.3%, and 3.0%, respectively. The estimated OR for invasive breast cancer was 2.26 (95%CI, 1.90 to 2.69; P = 2.3 × 10−20). The OR was higher for estrogen receptor (ER)–positive disease (2.55 [95%CI, 2.10 to 3.10; P = 4.9 × 10−21]) than it was for ER-negative disease (1.32 [95%CI, 0.93 to 1.88; P = .12]; P interaction = 9.9 × 10−4). The OR significantly declined with attained age for breast cancer overall (P = .001) and for ER-positive tumors (P = .001). Estimated cumulative risks for development of ER-positive and ER-negative tumors by age 80 in CHEK2*1100delC carriers were 20% and 3%, respectively, compared with 9% and 2%, respectively, in the general population of the United Kingdom. Conclusion These CHEK2*1100delC breast cancer risk estimates provide a basis for incorporating CHEK2*1100delC into breast cancer risk prediction models and into

Estudio fenomenologico del conocimiento curricular y conocimiento de contenido en maestros de matematica a nivel secundario

NASA Astrophysics Data System (ADS)

Cardona Tomassini, Ivan Javier

En esta investigacion se estudio el fenomeno del conocimiento de contenido y el conocimiento curricular de maestros de matermaticas y como estos dos componentes se reflejan en su conocimiento pedagogico del contenido. El conocimiento de contenido es el conocimiento que tienen los maestros de los contenidos de una disciplina y sobre la estructura de su organizacion (Shulman, 1986). El conocimiento curricular es el conocimiento que los maestros poseen sobre los componentes de un curriculo disenado para ensenar un topico de una materia especifica a un nivel particular, la variedad de instrumentos instruccionales disponibles para implementar el mismo y como utilizar los instrumentos curriculares disponibles (Ball & Bass, 2003; Choppin, 2009; Hill, Rowan, & Ball, 2005). Este estudio se enmarca en el paradigma cualitativo, teniendo como diseno el estudio fenomenologico (Lucca y Berrios, 2009; McMillan, 2004). Los participantes fueron seis maestros de matermaticas del nivel superior (10mo a 12mo grado). Al momento de la investigacion los participantes ensenaban en escuelas publicas o privadas de Puerto Rico. Para recolectar la informacion se utilizo un grupo focal en donde los maestros resolvieron seis ejercicios matematicos y posteriormente reflexionaron en forma grupal sobre las soluciones. Tambien se realizo un analisis de documentos de planificacion y se llevaron a cabo entrevistas semiestructuradas. Se exploraron los contenidos relacionados a la ecuacion de una recta, rectas verticales y horizontales, suma y multiplicacion de polinomios, resolucion de ecuaciones cuadraticas y distancia entre dos puntos del plano cartesiano. Los resultados muestran que los participantes tienen dominio procesal de los contenidos correspondientes a las rectas verticales y horizontales, la suma y multiplicacion de polinomios, el calculo distancia entre dos puntos del plano cartesiano. Sin embargo, se noto cierta dificultad en la explicacion conceptual de los contenidos relacionados a la

Age- and Tumor Subtype-Specific Breast Cancer Risk Estimates for CHEK2*1100delC Carriers.

PubMed

Schmidt, Marjanka K; Hogervorst, Frans; van Hien, Richard; Cornelissen, Sten; Broeks, Annegien; Adank, Muriel A; Meijers, Hanne; Waisfisz, Quinten; Hollestelle, Antoinette; Schutte, Mieke; van den Ouweland, Ans; Hooning, Maartje; Andrulis, Irene L; Anton-Culver, Hoda; Antonenkova, Natalia N; Antoniou, Antonis C; Arndt, Volker; Bermisheva, Marina; Bogdanova, Natalia V; Bolla, Manjeet K; Brauch, Hiltrud; Brenner, Hermann; Brüning, Thomas; Burwinkel, Barbara; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Dunning, Alison M; Fasching, Peter A; Figueroa, Jonine; Fletcher, Olivia; Flyger, Henrik; Galle, Eva; García-Closas, Montserrat; Giles, Graham G; Haeberle, Lothar; Hall, Per; Hillemanns, Peter; Hopper, John L; Jakubowska, Anna; John, Esther M; Jones, Michael; Khusnutdinova, Elza; Knight, Julia A; Kosma, Veli-Matti; Kristensen, Vessela; Lee, Andrew; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Margolin, Sara; Meindl, Alfons; Milne, Roger L; Muranen, Taru A; Newcomb, Polly A; Offit, Kenneth; Park-Simon, Tjoung-Won; Peto, Julian; Pharoah, Paul D P; Robson, Mark; Rudolph, Anja; Sawyer, Elinor J; Schmutzler, Rita K; Seynaeve, Caroline; Soens, Julie; Southey, Melissa C; Spurdle, Amanda B; Surowy, Harald; Swerdlow, Anthony; Tollenaar, Rob A E M; Tomlinson, Ian; Trentham-Dietz, Amy; Vachon, Celine; Wang, Qin; Whittemore, Alice S; Ziogas, Argyrios; van der Kolk, Lizet; Nevanlinna, Heli; Dörk, Thilo; Bojesen, Stig; Easton, Douglas F

2016-08-10

CHEK2*1100delC is a well-established breast cancer risk variant that is most prevalent in European populations; however, there are limited data on risk of breast cancer by age and tumor subtype, which limits its usefulness in breast cancer risk prediction. We aimed to generate tumor subtype- and age-specific risk estimates by using data from the Breast Cancer Association Consortium, including 44,777 patients with breast cancer and 42,997 controls from 33 studies genotyped for CHEK2*1100delC. CHEK2*1100delC genotyping was mostly done by a custom Taqman assay. Breast cancer odds ratios (ORs) for CHEK2*1100delC carriers versus noncarriers were estimated by using logistic regression and adjusted for study (categorical) and age. Main analyses included patients with invasive breast cancer from population- and hospital-based studies. Proportions of heterozygous CHEK2*1100delC carriers in controls, in patients with breast cancer from population- and hospital-based studies, and in patients with breast cancer from familial- and clinical genetics center-based studies were 0.5%, 1.3%, and 3.0%, respectively. The estimated OR for invasive breast cancer was 2.26 (95%CI, 1.90 to 2.69; P = 2.3 × 10(-20)). The OR was higher for estrogen receptor (ER)-positive disease (2.55 [95%CI, 2.10 to 3.10; P = 4.9 × 10(-21)]) than it was for ER-negative disease (1.32 [95%CI, 0.93 to 1.88; P = .12]; P interaction = 9.9 × 10(-4)). The OR significantly declined with attained age for breast cancer overall (P = .001) and for ER-positive tumors (P = .001). Estimated cumulative risks for development of ER-positive and ER-negative tumors by age 80 in CHEK2*1100delC carriers were 20% and 3%, respectively, compared with 9% and 2%, respectively, in the general population of the United Kingdom. These CHEK2*1100delC breast cancer risk estimates provide a basis for incorporating CHEK2*1100delC into breast cancer risk prediction models and into guidelines for intensified screening and follow-up. © 2016

Effect of the F508del genotype on outcomes of endoscopic sinus surgery in children with cystic fibrosis.

PubMed

Do, Bao Anh Julie; Lands, Larry C; Saint-Martin, Christine; Mascarella, Marco A; Manoukian, John J; Daniel, Sam J; Nguyen, Lily H P

2014-07-01

Numerous authors have sought to describe genotype-phenotype correlations in cystic fibrosis (CF), notably to pancreatic insufficiency and lung disease. However, few studies have focused on the association between the F508del genotype and response to sinus surgery. The objective of this study is to assess the effect of the F508del genotype on sinonasal disease severity and outcomes following functional endoscopic sinus surgery (FESS) in a pediatric population. A retrospective chart review of 153 children with CF seen at a tertiary care pediatric hospital from 1995 to 2008 was performed. Patients were classified into one of three groups according to F508del genotype, either as homozygous, heterozygous or not carrying a F508del mutation. The sinonasal disease phenotype of the three groups was compared based on clinical and radiological findings, extent of endoscopic sinus surgery and rate of revision surgery. The relationship between the F508del genotype and pancreatic insufficiency was confirmed (p<0.05). There was no association between the F508del genotype and increased need for FESS (p=0.75). Moreover, no association was established between F508del homozygosity and presence of nasal polyps, Lund-Mackay score, extent of surgery or length of postoperative hospitalization. The rates of revision surgery did not differ significantly among the three genotypes analyzed (p=0.59). There is no clear association between the F508del genotype and an increased need for FESS, extent of surgery, or revision surgery. Given the phenotypic variability of sinonasal disease in patients with CF, a prospective study is needed to better understand outcomes following FESS and the contribution of gene modifiers to this effect. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

[Seventy years of medicine in the Instituto Mexicano del Seguro Social].

PubMed

Fajardo-Ortiz, Guillermo

2014-01-01

The purpose of these lines is to remember and refer some of the historical landmarks in the evolution of the medical services of the Instituto Mexicano del Seguro Social (IMSS, according to its initials in Spanish) since it was founded, in 1943. We also want to bring to the reader's attention that the dimensions and impacts on health that IMSS has achieved, throughout its history, have strengthened the citizenship, as well as social sustainability. Also, those impacts have determined the creation and the reinforcement of human capital in México. Throughout this concise balance, all the controversy surrounding the foundation of the Institute is being recalled (the protest in the Mexico City Zócalo, or the attack to an hospital in San Ángel -a neighborhood located in the Southwest of Mexico City-), as well as the way the IMSS incorporated several words into the vocabulary of Mexicans. We also remember the previous antecedent of the Revista Médica del Instituto Mexicano del Seguro Social, as well as the Revista de Enfermería, and the emblematic Archives of Medical Research. The IMSS has 70 years of achievements, seven decades covered.

Medición de densidades medias de meteoritos: test del método de inmersión

NASA Astrophysics Data System (ADS)

Steren, G.

Se evaluó una técnica simple para medir las densidades medias de meteoritos, basada en el Método de Arquímedes y que utiliza cuentas de vidrio de 40μ en lugar de un fluído esto presenta la ventaja de no ser intrusivo ni químicamente reactivo (D.Britt and G.Consolmagno, 1996, B.A.A.S.28,1106). El estudio, realizado en junio de este año por participantes de la VI Escuela de Verano del Observatorio del Vaticano, empleó 37 muestras de la colección del Observatorio del Vaticano, de las cuales 26 eran Condritas, 1 Pallasita y 1 Howardita; algunas de ellas ya habian sido estudiadas por otras técnicas aunque también se incluyeron muestras no estudiadas anteriormente.

A chemical corrector modifies the channel function of F508del-CFTR.

PubMed

Kim Chiaw, Patrick; Wellhauser, Leigh; Huan, Ling Jun; Ramjeesingh, Mohabir; Bear, Christine E

2010-09-01

The deletion of Phe-508 (F508del) constitutes the most prevalent cystic fibrosis-causing mutation. This mutation leads to cystic fibrosis transmembrane conductance regulator (CFTR) misfolding and retention in the endoplasmic reticulum and altered channel activity in mammalian cells. This folding defect can however be partially overcome by growing cells expressing this mutant protein at low (27 degrees C) temperature. Chemical "correctors" have been identified that are also effective in rescuing the biosynthetic defect in F508del-CFTR, thereby permitting its functional expression at the cell surface. The mechanism of action of chemical correctors remains unclear, but it has been suggested that certain correctors [including 4-cyclohexyloxy-2-(1-[4-(4-methoxy-benzenesulfonyl)-piperazin-1-yl]-ethyl)-quinazoline (VRT-325)] may act to promote trafficking by interacting directly with the mutant protein. To test this hypothesis, we assessed the effect of VRT-325 addition on the channel activity of F508del-CFTR after its surface expression had been "rescued" by low temperature. It is noteworthy that short-term pretreatment with VRT-325 [but not with an inactive analog, 4-hydroxy-2-(1-[4-(4-methoxy-benzenesulfonyl)-piperazin-1-yl]-ethyl)-quinazoline (VRT-186)], caused a modest but significant inhibition of cAMP-mediated halide flux. Furthermore, VRT-325 decreased the apparent ATP affinity of purified and reconstituted F508del-CFTR in our ATPase activity assay, an effect that may account for the decrease in channel activity by temperature-rescued F508del-CFTR. These findings suggest that biosynthetic rescue mediated by VRT-325 may be conferred (at least in part) by direct modification of the structure of the mutant protein, leading to a decrease in its ATP-dependent conformational dynamics. Therefore, the challenge for therapy discovery will be the design of small molecules that bind to promote biosynthetic maturation of the major mutant without compromising its activity in

DK phocomelia phenotype (von Voss-Cherstvoy syndrome) caused by somatic mosaicism for del(13q).

PubMed

Bamforth, J S; Lin, C C

1997-12-31

DK phocomelia (von Voss-Cherstvoy syndrome) is a rare condition characterized by radial ray defects, occipital encephalocoele, and urogenital abnormalities. Lubinsky et al. [1994: Am J Med Genet 52:272-278] pointed out similarities between this and the del(13q) syndrome. To date, all reported cases of DK phocomelia have been apparently normal chromosomally. We report on a case of DK phocomelia in which the proposita had normal lymphocyte chromosomes, but was mosaic in fibroblasts for del(13)(q12). Fibroblast chromosomes studies on other cases of DK phocomelia have not been reported: this raises the possibility that some cases of DK phocomelia may be somatic mosaics for del(13)(q12).

With simple gasoline stripping devices, a problem of gas transportation by pipeline is resolved (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Couto, J.A.

1975-06-01

Liquid hydrocarbons contained in Argentina's Pico Truncade natural gas caused a number of serious pipeline transmission and gas processing problems. Gas del Estado has installed a series of efficient liquid removal devices at the producing fields. A flow chart of the gasoline stripping process is illustrated, as are 2 types of heat exchangers. This process of gasoline stripping (gas condensate recovery) integrates various operations which normally are performed independently: separation of the poor condensate in the gas, stabilization of the same, and incorporation of the light components (products of the stabilization) in the main gas flow.

Excess breast cancer risk in first degree relatives of CHEK2∗1100delC positive familial breast cancer cases.

PubMed

Adank, Muriel A; Verhoef, Senno; Oldenburg, Rogier A; Schmidt, Marjanka K; Hooning, Maartje J; Martens, John W M; Broeks, Annegien; Rookus, Matti; Waisfisz, Quinten; Witte, Birgit I; Jonker, Marianne A; Meijers-Heijboer, Hanne

2013-05-01

The CHEK2∗1100delC mutation confers a relative risk of two for breast cancer (BC) in the general population. This study aims to explore the excess cancer risk due to the CHEK2∗1100delC mutation within a familial non-BRCA1/2 breast cancer setting. Cancer incidences were compared between first degree relatives of 107 familial breast cancer patients positive for the CHEK2∗1100delC mutation (CHEK2 positive families) and first degree relatives of 314 familial breast cancer patients without the CHEK2∗1100delC mutation (CHEK2 negative families). All families were derived from the same pool of familial non-BRCA1/2 breast cancer families (n=2554). Medical information of 2188 first degree relatives of these families was analysed for cancer risk. CHEK2∗1100delC status of relatives was unknown. Increased breast cancer risk (hazard ratio (HR) 2.0 (95% confidence interval (CI): 1.4-2.7), p<0.001) was observed in sisters of CHEK2∗1100delC positive index cases compared to sisters of CHEK2∗1100delC negative index cases. HR was 1.6 (95% CI: 1.0-2.4) for mothers of CHEK2 positive versus negative index cases (p=0.041). For second primary breast cancers HR was increased in CHEK2∗1100delC positive index cases (HR 2.1, 95% CI: 1.3-3.3, p=0.003) and their sisters (HR 2.6, 95% CI: 1.1-6.1, p=0.025). There is an excess breast cancer risk in first degree relatives of CHEK2∗1100delC positive non-BRCA1/2 familial breast cancer patients compared to non-CHEK2∗1100delC familial breast cancer relatives. Genotyping for the CHEK2∗1100delC mutation in a familial breast cancer setting contributes to optimal clinical surveillance in countries in which this mutation is prevalent. Carriers and female relatives are eligible for stringent breast surveillance programs. Copyright © 2013 Elsevier Ltd. All rights reserved.

Autoimmune vitiligo in rheumatic disease in the mestizo Mexican population.

PubMed

Avalos-Díaz, Esperanza; Pérez-Pérez, Elena; Rodríguez-Rodríguez, Mayra; Pacheco-Tovar, María-Guadalupe; Herrera-Esparza, Rafael

2016-08-01

Vitiligo is a chronic disease characterized by the dysfunction or destruction of melanocytes with secondary depigmentation. The aim of the present study was to determine the prevalence of vitiligo associated with autoimmune rheumatic diseases. The clinical records from a 10-year database of patients with rheumatic diseases and associated vitiligo was analysed, with one group of patients having autoimmune rheumatic disease and another non-autoimmune rheumatic disease. Available serum samples were used to assess the anti-melanocyte antibodies. A total of 5,251 individual clinical files were archived in the last 10 years, and these patients underwent multiple rheumatology consultations, with 0.3% of the group presenting with vitiligo. The prevalence of vitiligo in the autoimmune rheumatic disease group was 0.672%, which was mainly associated with lupus and arthritis. However, patients with more than one autoimmune disease had an increased relative risk to develop vitiligo, and anti-melanocyte antibodies were positive in 92% of these patients. By contrast, the prevalence was 0.082% in the group that lacked autoimmune rheumatic disease and had negative autoantibodies. In conclusion, the association between vitiligo and autoimmune rheumatic diseases was relatively low. However, the relative risk increased when there were other autoimmune comorbidities, such as thyroiditis or celiac disease. Therefore, the presence of multiple autoimmune syndromes should be suspected.

Species identification in forensic samples using the SPInDel approach: A GHEP-ISFG inter-laboratory collaborative exercise.

PubMed

Alves, Cíntia; Pereira, Rui; Prieto, Lourdes; Aler, Mercedes; Amaral, Cesar R L; Arévalo, Cristina; Berardi, Gabriela; Di Rocco, Florencia; Caputo, Mariela; Carmona, Cristian Hernandez; Catelli, Laura; Costa, Heloísa Afonso; Coufalova, Pavla; Furfuro, Sandra; García, Óscar; Gaviria, Anibal; Goios, Ana; Gómez, Juan José Builes; Hernández, Alexis; Hernández, Eva Del Carmen Betancor; Miranda, Luís; Parra, David; Pedrosa, Susana; Porto, Maria João Anjos; Rebelo, Maria de Lurdes; Spirito, Matteo; Torres, María Del Carmen Villalobos; Amorim, António; Pereira, Filipe

2017-05-01

DNA is a powerful tool available for forensic investigations requiring identification of species. However, it is necessary to develop and validate methods able to produce results in degraded and or low quality DNA samples with the high standards obligatory in forensic research. Here, we describe a voluntary collaborative exercise to test the recently developed Species Identification by Insertions/Deletions (SPInDel) method. The SPInDel kit allows the identification of species by the generation of numeric profiles combining the lengths of six mitochondrial ribosomal RNA (rRNA) gene regions amplified in a single reaction followed by capillary electrophoresis. The exercise was organized during 2014 by a Working Commission of the Spanish and Portuguese-Speaking Working Group of the International Society for Forensic Genetics (GHEP-ISFG), created in 2013. The 24 participating laboratories from 10 countries were asked to identify the species in 11 DNA samples from previous GHEP-ISFG proficiency tests using a SPInDel primer mix and control samples of the 10 target species. A computer software was also provided to the participants to assist the analyses of the results. All samples were correctly identified by 22 of the 24 laboratories, including samples with low amounts of DNA (hair shafts) and mixtures of saliva and blood. Correct species identifications were obtained in 238 of the 241 (98.8%) reported SPInDel profiles. Two laboratories were responsible for the three cases of misclassifications. The SPInDel was efficient in the identification of species in mixtures considering that only a single laboratory failed to detect a mixture in one sample. This result suggests that SPInDel is a valid method for mixture analyses without the need for DNA sequencing, with the advantage of identifying more than one species in a single reaction. The low frequency of wrong (5.0%) and missing (2.1%) alleles did not interfere with the correct species identification, which demonstrated the

Rescue of murine F508del CFTR activity in native intestine by low temperature and proteasome inhibitors.

PubMed

Wilke, Martina; Bot, Alice; Jorna, Huub; Scholte, Bob J; de Jonge, Hugo R

2012-01-01

Most patients with Cystic Fibrosis (CF) carry at least one allele with the F508del mutation, resulting in a CFTR chloride channel protein with a processing, gating and stability defect, but with substantial residual activity when correctly sorted to the apical membranes of epithelial cells. New therapies are therefore aimed at improving the folding and trafficking of F508del CFTR, (CFTR correctors) or at enhancing the open probability of the CFTR chloride channel (CFTR potentiators). Preventing premature breakdown of F508del CFTR is an alternative or additional strategy, which is investigated in this study. We established an ex vivo assay for murine F508del CFTR rescue in native intestinal epithelium that can be used as a pre-clinical test for candidate therapeutics. Overnight incubation of muscle stripped ileum in modified William's E medium at low temperature (26°C), and 4 h or 6 h incubation at 37°C with different proteasome inhibitors (PI: ALLN, MG-132, epoxomicin, PS341/bortezomib) resulted in fifty to hundred percent respectively of the wild type CFTR mediated chloride secretion (forskolin induced short-circuit current). The functional rescue was accompanied by enhanced expression of the murine F508del CFTR protein at the apical surface of intestinal crypts and a gain in the amount of complex-glycosylated CFTR (band C) up to 20% of WT levels. Sustained rescue in the presence of brefeldin A shows the involvement of a post-Golgi compartment in murine F508del CFTR degradation, as was shown earlier for its human counterpart. Our data show that proteasome inhibitors are promising candidate compounds for improving rescue of human F508del CFTR function, in combination with available correctors and potentiators.

CHEK2*1100delC and risk of malignant melanoma: Danish and German studies and meta-analysis.

PubMed

Weischer, Maren; Heerfordt, Ida M; Bojesen, Stig E; Eigentler, Thomas; Garbe, Claus; Röcken, Martin; Hölmich, Lisbet Rosenkrantz; Schmidt, Henrik; Klyver, Helle; Bastholt, Lars; Nordestgaard, Børge G

2012-02-01

It is possible that reduced function of DNA repair and cell-cycle control genes increases the individual susceptibility to malignant melanoma. As CHEK2 is a cell-cycle master controller, we tested the hypothesis that heterozygosity for the frameshift alteration CHEK2*1100delC is associated with increased risk of malignant melanoma. First, we performed case-control studies of 1,152 Danish and 752 German individuals with malignant melanoma compared with 9,142 Danish and 3,718 German controls. Second, we performed a meta-analysis of CHEK2*1100delC and malignant melanoma, involving 2,619 cases and 17,481 controls. Third, we examined the risk of malignant melanoma associated with CHEK2*1100delC heterozygosity in an analysis stratified for sun exposure, as well as for subtype and location on the body. The odds ratios for malignant melanoma for CHEK2(*)1100del heterozygotes compared with those for noncarriers were 2.01 (95% confidence interval (CI), 1.03-3.91) in Danes, 1.42 (95% CI, 0.46-4.31) in Germans, and 1.79 (95% CI, 1.02-3.17) in Danes and Germans combined. In a meta-analysis, the odds ratio of malignant melanoma for CHEK2*1100delC heterozygotes compared with that for noncarriers was 1.81 (95% CI, 1.07-3.05). Stratifications did not alter these results. CHEK2*1100delC heterozygotes have a twofold risk of malignant melanoma compared with noncarriers.

Absence of CHEK2*1100delC mutation in families with hereditary breast cancer in North America.

PubMed

Iniesta, Maria D; Gorin, Michael A; Chien, Ling-Chen; Thomas, Samantha M; Milliron, Kara J; Douglas, Julie A; Merajver, Sofia D

2010-10-15

The CHEK2*1100delC mutation has been reported to confer a twofold increased risk of breast cancer among carriers. The frequency of the mutation varies among populations. The highest frequency has been described in Northern and Eastern European countries; the frequency may be much lower in North America. In this study, our aim was to determine the frequency of CHEK2*1100delC in members of breast cancer families who tested negative for a deleterious mutation in BRCA1/2 at the University of Michigan Comprehensive Cancer Center. We genotyped 102 members from 90 families for CHEK2*1100delC. Most of these families had several cases of breast cancer or ovarian cancer (or both), as well as multiple members with other cancer types in a single lineage. No CHEK2*1100delC mutations were detected in any of the 102 individuals, including 51 women diagnosed with breast cancer at an early age (<45 years), 8 women with bilateral breast cancer, 3 men with breast cancer, and 8 women with ovarian cancer. Our data are consistent with the reported very low frequency of CHEK2*1100delC mutations in North American populations (compared with Northern Europe), rendering CHEK2*1100delC such an unlikely culprit in BRCA1/2 negative families that routine testing of these families appears unwarranted. Copyright © 2010 Elsevier Inc. All rights reserved.

Nesting biology, morphological remarks, and description of the mature larva of Mellinus arvensis obscurus (Hymenoptera: Crabronidae) in Nepal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boesi, R.; Polidori, C.; Andrietti, F.

Recently re-named as a sub-species of Mellinus arvensis, Mellinus arvensis obscurus Handlirsch 1888 was investigated ecologically and morphologically in Nepal, in order to underline the most important differences with the well known M. arvensis arvensis. Mellinus arvensis obscurus females nested in clumped aggregations on inclined plains at high altitudes, both on sunny bare soil and on a shaded grassy one. Beginning of monsoon season probably interfered with wasp activity, and females performed few provisioning flights during the day. Prey consisted of a broad range of Diptera, except for one case of a spider. Many females were observed not provisioning amore » nest but floating on the nesting site, and many intraspecific interactions suggested a high degree of usurpation attempts. At least one species of flies and two of ants probably acted as natural enemies of the wasp. Morphological observations on females showed that the Nepal population shares more similarities (shape of tergite I, body punctation) with the European populations than with the closer Japanese population; melanization is strong, according to west-east and altitudinal cline. The mature larva of M. arvensis obscurus Handlirsch is described, illustrated, and compared with the other mature larva of the genus. The differences between both larvae mainly lie in the presence/absence, and number or differentiation of integumental structures. We conclude that morphological traits are more important than ecological and behavioral ones in distinguishing M. arvensis obscurus from M. arvensis arvensis. (author) [Spanish] En el presente articulo se aportan los resultados y conclusiones de un estudio, llevado a cabo en Nepal, en el que se abordaron aspectos ecologicos, comportamentales y morfologicos (tanto del ultimo estado de la fase larvaria como del adulto) de Mellinus arvensis obscurus Handlirsch 1888. El principal objetivo del estudio radicaba en mostrar las principales diferencias que separan a esta

[Polymorphism g.37190613 G>A of the ELMO1 gene in the Mexican population: potential marker for clinical-surgical pathology].

PubMed

Topete-González, Luz Rosalba; Ramirez-Garcia, Sergio Alberto; Charles-Niño, Claudia; Villa-Ruano, Nemesio; Mosso-González, Clemente; Dávalos-Rodríguez, Nory Omayra

2014-01-01

ELMO1 is a gene located at locus 7p14.2-14.1 that codifies a regulatory protein involved in fibrogenesis, cell migration, phagocytosis and apoptosis. This gene presents a single nucleotide polymorphism, which appears to be linked with the development of diabetic nephropathy. Currently, there are no studies in regard to the presence of such polymorphism in the Mexican population. Therefore, the aim of this work was to estimate the frequency rate of alleles and genotypes of polymorphism rs1345365 from ELMO1 in Mexican mestizos who inhabit the west and the southeast regions of Mexico in order to generate reliable data for further association studies. There were 322 individuals who were screened for the identification of polymorphism rs1345365 using genomic DNA from leucocytes as a template for PCR-PASA reactions. Amplicons were separated in 7% PAGE and visualized after staining with silver nitrate. The reference allele (A) was the most frequent in both western and southeastern populations of Mexico. In addition, a different genotype distribution was found with respect to other populations. The results of this study indicate that both populations are in Hardy-Weinberg equilibrium. This study also reveals a low frequency rate of the ancestral genotype for the polymorphism rs1345365 in mestizos from the western and southeastern regions of Mexico.

Helicobacter pylori Infection in Rural and Urban Dyspeptic Patients from Venezuela

PubMed Central

Contreras, Monica; Fernández-Delgado, Milagro; Reyes, Nelson; García-Amado, María Alexandra; Rojas, Héctor; Michelangeli, Fabian

2015-01-01

The goal of this work was to assess the Helicobacter pylori prevalence in a rural mestizo population and compare it to an urban population from Venezuela. The study was performed in gastric juice samples of 71 dyspeptic patients from Caracas (urban) and 39 from Tucupita (rural), in the Orinoco Delta region. Helicobacter pylori was detected by amplification of 16S rRNA, glmM, and ureA genes in 55.0% patients from urban and 87.2% from rural populations. cagA was found positive in 51% and 62% urban and rural patients, respectively. Non-H. pylori Helicobacter species were not detected in the urban population, but was found in 7.7% of patients in the rural study site. Frequency values of the 16S rRNA, glmM, and ureA genes were higher in the rural population. The odds ratio for each gene was 15.18 for 16S rRNA, 2.34 for glmM, 2.89 for ureA, and 1.53 cagA, showing significant differences except for cagA when gene frequency was compared in both populations. These results demonstrate a higher frequency of H. pylori and gastric non-H. pylori Helicobacter infection in a rural mestizo population with low hygienic standards as compared with city dwellers, representing a potential risk for the development of gastroduodenal diseases. PMID:26195456

Mast cells in the human lung at high altitude

NASA Astrophysics Data System (ADS)

Heath, Donald

1992-12-01

Mast cell densities in the lung were measured in five native highlanders of La Paz (3600 m) and in one lowlander dying from high-altitude pulmonary oedema (HAPO) at 3440 m. Two of the highlanders were mestizos with normal pulmonary arteries and the others were Aymara Indians with muscular remodelling of their pulmonary vasculature. The aim of the investigation was to determine if accumulation of mast cells in the lung at high altitude (HA) is related to alveolar hypoxia alone, to a combination of hypoxia and muscularization of the pulmonary arterial tree, or to oedema of the lung. The lungs of four lowlanders were used as normoxic controls. The results showed that the mast cell density of the two Mestizos was in the normal range of lowlanders (0.6-8.8 cells/mm2). In the Aymara Indians the mast cell counts were raised (25.6-26.0 cells/mm2). In the lowlander dying from HAPO the mast cell count was greatly raised to 70.1 cells/mm2 lung tissue. The results show that in native highlanders an accumulation of mast cells in the lung is not related to hypoxia alone but to a combination of hypoxia and muscular remodelling of the pulmonary arteries. However, the most potent cause of increased mast cell density in the lung at high altitude appears to be high-altitude pulmonary oedema.

CHOQUES AGREGADOS E INVERSIÓN EN CAPITAL HUMANO: EL LOGRO EDUCATIVO SUPERIOR DURANTE LA DÉCADA PERDIDA EN MÉXICO

PubMed Central

Peña, Pablo A.

2014-01-01

Este artículo documenta una respuesta agregada negativa del logro educativo superior (más de 12 años de escolaridad) en México a la recesión de 1982–83 y el estancamiento que le siguió. La respuesta no fue homogénea entre géneros, regiones y entornos familiares. Los hombres experimentaron una caída en el logro mientras que las mujeres experimentaron un crecimiento más lento. En promedio, los estados con un mayor logro antes del choque experimentaron mayores caídas. La respuesta entre distintos entornos familiares no presenta un patrón claro. Sin embargo, el efecto negativo en el logro se observa incluso entre hermanos. La evidencia sugiere una historia por el lado de la demanda: la caída en el ingreso de los hogares parece ser el determinante de la caída/desaceleración del logro educativo superior. La conclusión es que la recesión y la falta de crecimiento que le siguió tuvieron un efecto negativo importante y duradero en la formación de capacidades en México. PMID:25328251

Violencia de Pareja en Mujeres Hispanas: Implicaciones para la Investigación y la Práctica

PubMed Central

Gonzalez-Guarda, Rosa Maria; Becerra, Maria Mercedes

2012-01-01

Las investigaciones sobre la violencia entre parejas sugieren que las mujeres hispanas están siendo afectadas desproporcionadamente por la ocurrencia y consecuencias de este problema de salud pública. El objetivo del presente artículo es dar a conocer el estado del arte en relación a la epidemiologia, consecuencias y factores de riesgo para VP entre mujeres Hispanas, discutiendo las implicaciones para la investigación y la práctica. Investigaciones han demostrado una fuerte asociación del status socioeconómico, abuso de droga y el alcohol, la salud mental, aculturación, inmigración, comportamientos sexuales riesgosos e historia de abuso con la violencia entre parejas. Sin embargo, más estudios se deben llevar a cabo para identificar otros factores de riesgos y de protección a poblaciones hispanas no clínicas. Mientras que el conocimiento sobre la etiología de la VP entre mujeres Hispanas se expanda, enfermeras y otros profesionales de la salud deben desarrollar, implementar y evaluar estrategias culturalmente adecuadas para la prevención primaria y secundaria de la violencia entre pareja. PMID:26166938

Mini-mastoidectomía para anastomosis hipogloso-facial con sección parcial del nervio hipogloso

PubMed Central

Campero, Álvaro; Ajler, Pablo; Socolovsky, Mariano; Martins, Carolina; Rhoton, Albert

2012-01-01

Introducción: La anastomosis hipogloso-facial es la técnica de elección para la reparación de la parálisis facial cuando no se dispone de un cabo proximal sano del nervio facial. La técnica de anastomosis mediante fresado mastoideo y sección parcial del hipogloso minimiza la atrofia lingual sin sacrificar resultados a nivel facial. Método: La porción mastoidea del nervio facial transcurre por la pared anterior de la AM, a un promedio de 18+/-3 mm de profundidad respecto de la pared lateral. Se debe reconocer la cresta supramastoidea, desde la cual se marca una línea vertical paralela al eje mayor de la AM, 1 cm por detrás de la pared posterior del CAE El fresado se comienza desde la línea medio mastoidea hasta la pared posterior del CAE. Una vez encontrado el nervio facial en el tercio medio del canal mastoideo, el mismo es seguido hacia proximal y distal. Resultados: El abordaje descripto permite acceder al nervio facial intratemporal en su porción mastoidea, y efectuar un fresado óseo sin poner en riesgo al nervio o a estructuras vasculares cercanas. Se trata de un procedimiento técnicamente más sencillo que los abordajes amplios habitualmente utilizados al hueso temporal; no obstante su uso debe ser restringido mayormente a la anastomosis hipogloso-facial. Conclusión: Esta es una técnica relativamente sencilla, que puede ser reproducida por cirujanos sin mayor experiencia en el tema, luego de su paso por el laboratorio de anatomía. PMID:23596555

Reproductive biology of the Del Norte salamander (Plethodon elongatus).

Treesearch

Clara A. Wheeler; Hartwell H. Welsh Jr.; Lisa M. Ollivier

2013-01-01

We examined seasonal reproductive patterns of the Del Norte Salamander, Plethodon elongatus, in mixed conifer and hardwood forests of northwestern California and southwestern Oregon. Seasonal size differences in reproductive structures suggested that maximum spermatogenic activity occurred during the late summer, with spermatozoa transfer to the...

New records of fishes at Isla del Coco, Costa Rica

USGS Publications Warehouse

Garrison, V.H.

1996-01-01

Isla del Coco lies at 5 degrees 32'N latitude, 87 degrees 04'W longitude and is the sole peak of the Cocos Ridge exposed above sea level. This isolated island formed approximately 2 million years ago. It rises 575 m above the surface of the sea and covers 46 km2 (Castillo et aI., 1988). Five hundred km to the NNE is Costa Rica; 630 km SSW are the Galapagos Islands; 650 km to the E is Isla Malpelo, Colombia; and approximately 8,000 km W lie the Line Islands. Costa Rica claimed Isla del Coco in 1832 and declared it a National Park in 1978. The area of the park was increased to include the adjacent waters 5 km offshore in 1984 and 25 km offshore in 1991.

The CHEK2 del5395 is a founder mutation without direct effects for cancer risk in the latvian population.

PubMed

Plonis, J; Kalniete, D; Nakazawa-Miklasevica, M; Irmejs, A; Vjaters, E; Gardovskis, J; Miklasevics, E

2015-12-01

Our objective was to determine: 1) whether the checkpoint kinase 2 ( CHEK2 ) del5395 (g.27417113-27422508 del, NC_000022.11) is a founder mutation in the Latvian population, 2) if there is an association between CHEK2 del5395 mutation and cancer risk, and 3) and whether the CHEK2 del5395 mutation impacts cancer predisposition in Chernobyl disaster liquidators (the civil and military personnel who were called upon to deal with consequences of the 1986 nuclear disaster) as well as geriatric populations. We recruited 438 breast cancer patients, 568 colorectal cancer patients, 399 ovarian cancer patients, 419 prostate cancer patients, 526 healthy blood donors, 480 Chernobyl disaster liquidators and 444 geriatric cancer-free participants. DNA samples were isolated from blood samples and subjected to multiplex polymerase chain reaction (PCR). The truncation of del5395 was estimated by fragment size of the multiplex PCR.All groups were compared to the healthy blood donors using Fisher's exact test. All p values were two-sided and the odds ratios (OR) calculated by two-by-two table. In cancer groups, the del5395 mutation was most frequently observed in the ovarian cancer group (1.00%, OR = 1.32). In control groups, the del5395 mutation was most frequent (0.76%) in the healthy donors, which exceeded its frequency in the Chernobyl liquidators group and the geriatric group by 0.01 and 0.08%, respectively. For all groups, the OR appeared to be >1 only in ovarian cancer patients. However, OR rates showed no statistical significance in either cancer or control groups, with the p value fluctuating within the range of 0.39-1.00. The CHEK2 gene del5395 is a founder mutation in the Latvian population, which, however, does not have a direct impact on genetic predisposition toward colorectal, breast, ovarian and prostate cancer.

Association Between CHEK2*1100delC and Breast Cancer: A Systematic Review and Meta-Analysis.

PubMed

Liang, Mingming; Zhang, Yun; Sun, Chenyu; Rizeq, Feras Kamel; Min, Min; Shi, Tingting; Sun, Yehuan

2018-06-16

The association between the checkpoint kinase 2*1100delC (CHEK2*1100delC) and breast cancer has been extensively explored. In light of the recent publication of studies on these specific findings, particularly regarding male patients with breast cancer, we performed an updated meta-analysis to investigate a more reliable estimate. This meta-analysis included 26 published studies selected in a search of electronic databases up to January 2018, including 118,735 breast cancer cases and 195,807 controls. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the association between 1100delC and breast cancer. Meta-analysis results suggested that 1100delC contributed to an increased breast cancer risk in overall populations (OR 2.89; 95% CI 2.63-3.16). Subgroup analysis found ORs of 3.13 (95% CI 1.94-5.07) for male breast cancer, 2.88 (95% CI 2.63-3.16) for female breast cancer, 2.87 (95% CI 1.85-4.47) for early-onset breast cancer, 2.92 (95% CI 2.65-3.22) for invasive breast cancer, and 3.21 (95% CI 2.41-4.29) for familial breast cancer. The sensitivity analysis suggested that results of this meta-analysis were generally robust. CHEK2*1100delC is associated with an increased risk of both female and male breast cancer.

[Genetic polymorphism and forensic application of 30 InDel loci of Han population in Beijing].

PubMed

Bai, Ru-Feng; Jiang, Li-Zhe; Zhang, Zhong; Shi, Mei-Sen

2013-12-01

To study the genetic diversities of 30 insertion-deletion (InDel) polymorphisms loci of Han population in Beijing, and to evaluate their forensic application, 210 unrelated healthy individuals of Han population in Beijing were investigated to determine the distributions of allele frequencies by using Investigator DIP system. The PCR products were detected with ABI 3130 XL Genetic Analyzer. Forensic parameters were calculated with relevant statistical analysis software. As a result, after the Bonferroni correction at a 95% significance level, there were no significant departures from Hardy-Weinberg equilibrium or significant linkage disequilibrium between the loci. The power of discrimination (DP) varies between 0.2690 (HLD118) and 0.6330 (HLD45), and the combined discrimination power (TDP) for the 30 InDel loci is 0.999999999985. The combined power of exclusion was 0.98771049 in trio cases (CPE(trio)) and 0.94579456 in duo cases (CPE(duo)). The parentage testing of 32 cases revealed no mutations happened to 30 InDel loci. Multiplex detection of the 30 InDel loci revealed a highly polymorphic genetic distribution in Beijing Han population, which represents a complementary tool in human identification studies, especially in challenging DNA cases.

El círculo meridiano automático de San Fernando - San Juan. Sus primeros pasos en el hemisferio sur

NASA Astrophysics Data System (ADS)

Mallamaci, C. C.; Muiños, J. L.; Gallego, M.; Pérez, J. A.; Marmolejo, L.; Navarro, J. L.; Sedeño, J.; Vallejos, M.; Belizón, F.

Se informa sobre el estado actual del Círculo Meridiano Automático de San Fernando-San Juan. El instrumento (Grubb-Parson, de 178mm de abertura y 2665 mm de distancia focal) es gemelo del que se encuentra en las Islas Canarias, y fue instalado durante los meses de julio y agosto de 1996 en la estación astronómica ``Dr. C.U.Cesco" (El Leoncito, Barreal), a unos 200 km de distancia de la ciudad de San Juan, merced a un Convenio de Cooperación Científica, firmado en 1994 entre el ROA (España) y el OAFA (Argentina). En la actualidad se está llevando a cabo un programa de prueba cuyos resultados preliminares muestran que el telescopio está en buenas condiciones para observar estrellas de hasta magnitud aproximada 14.5, con buenos errores de observación (<0.12" en ascensión recta y declinación).

Haptoglobin genotyping of Vietnamese: global distribution of HP del, complete deletion allele of the HP gene.

PubMed

Soejima, Mikiko; Agusa, Tetsuro; Iwata, Hisato; Fujihara, Junko; Kunito, Takashi; Takeshita, Haruo; Lan, Vi Thi Mai; Minh, Tu Binh; Takahashi, Shin; Trang, Pham Thi Kim; Viet, Pham Hung; Tanabe, Shinsuke; Koda, Yoshiro

2015-01-01

The haptoglobin (HP) gene deletion allele (HP(del)) is responsible for anhaptoglobinemia and a genetic risk factor for anaphylaxis reaction after transfusion due to production of the anti-HP antibody. The distribution of this allele has been explored by several groups including ours. Here, we studied the frequency of HP(del) in addition to the distribution of common HP genotypes in 293 Vietnamese. The HP(del) was encountered with the frequency of 0.020. The present result suggested that this deletion allele is restricted to East and Southeast Asians. Thus, this allele seems to be a potential ancestry informative marker for these populations. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

CDC25AQ110del: A Novel Cell Division Cycle 25A Isoform Aberrantly Expressed in Non-Small Cell Lung Cancer

PubMed Central

Younis, Rania H.; Cao, Wei; Lin, Ruxian; Xia, Ronghui; Liu, Zhenqiu; Edelman, Martin J.; Mei, Yuping; Mao, Li; Ren, Hening

2012-01-01

Objective Lung cancer remains number one cause of cancer related deaths worldwide. Cell cycle deregulation plays a major role in the pathogenesis of Non-Small Cell Lung Cancer (NSCLC). CDC25A represents a critical cell cycle regulator that enhances cell cycle progression. In this study we aimed to investigate the role of a novel CDC25A transcriptional variant, CDC25AQ110del, on the regulation of the CDC25A protein, and its impact on prognosis of NSCLC patients. Methodology/Principal Findings Here we report a novel CDC25A transcript variant with codon 110 (Glutamine) deletion, that we termed CDC25AQ110del in NSCLC cells. In 9 (75%) of the 12 NSCLC cell lines, CDC25AQ110del expression accounted for more than 20% of the CDC25A transcripts. Biological effects of CDC25AQ110del were investigated in H1299 and HEK-293F cells using UV radiation, flowcytometry, cyclohexamide treatment, and confocal microscopy. Compared to CDC25Awt, CDC25AQ110del protein had longer half-life; cells expressing CDC25AQ110del were more resistant to UV irradiation and showed more mitotic activity. Taqman-PCR was used to quantify CDC25AQ110del expression levels in 88 primary NSCLC tumor/normal tissue pairs. In patients with NSCLC, Kaplan Meier curves showed tumors expressing higher levels of CDC25AQ110del relative to the adjacent lung tissues to have significantly inferior overall survival (P = .0018). Significance Here we identified CDC25AQ110del as a novel transcriptional variant of CDC25A in NSCLC. The sequence-specific nature of the abnormality could be a prognostic indicator in NSCLC patients as well as a candidate target for future therapeutic strategies. PMID:23071577

Correction of the F508del-CFTR protein processing defect in vitro by the investigational drug VX-809

PubMed Central

Van Goor, Fredrick; Hadida, Sabine; Grootenhuis, Peter D. J.; Burton, Bill; Stack, Jeffrey H.; Straley, Kimberly S.; Decker, Caroline J.; Miller, Mark; McCartney, Jason; Olson, Eric R.; Wine, Jeffrey J.; Frizzell, Ray A.; Ashlock, Melissa; Negulescu, Paul A.

2011-01-01

Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene that impair the function of CFTR, an epithelial chloride channel required for proper function of the lung, pancreas, and other organs. Most patients with CF carry the F508del CFTR mutation, which causes defective CFTR protein folding and processing in the endoplasmic reticulum, resulting in minimal amounts of CFTR at the cell surface. One strategy to treat these patients is to correct the processing of F508del-CFTR with small molecules. Here we describe the in vitro pharmacology of VX-809, a CFTR corrector that was advanced into clinical development for the treatment of CF. In cultured human bronchial epithelial cells isolated from patients with CF homozygous for F508del, VX-809 improved F508del-CFTR processing in the endoplasmic reticulum and enhanced chloride secretion to approximately 14% of non-CF human bronchial epithelial cells (EC50, 81 ± 19 nM), a level associated with mild CF in patients with less disruptive CFTR mutations. F508del-CFTR corrected by VX-809 exhibited biochemical and functional characteristics similar to normal CFTR, including biochemical susceptibility to proteolysis, residence time in the plasma membrane, and single-channel open probability. VX-809 was more efficacious and selective for CFTR than previously reported CFTR correctors. VX-809 represents a class of CFTR corrector that specifically addresses the underlying processing defect in F508del-CFTR. PMID:21976485

DelPhi Web Server: A comprehensive online suite for electrostatic calculations of biological macromolecules and their complexes

PubMed Central

Sarkar, Subhra; Witham, Shawn; Zhang, Jie; Zhenirovskyy, Maxim; Rocchia, Walter; Alexov, Emil

2011-01-01

Here we report a web server, the DelPhi web server, which utilizes DelPhi program to calculate electrostatic energies and the corresponding electrostatic potential and ionic distributions, and dielectric map. The server provides extra services to fix structural defects, as missing atoms in the structural file and allows for generation of missing hydrogen atoms. The hydrogen placement and the corresponding DelPhi calculations can be done with user selected force field parameters being either Charmm22, Amber98 or OPLS. Upon completion of the calculations, the user is given option to download fixed and protonated structural file, together with the parameter and Delphi output files for further analysis. Utilizing Jmol viewer, the user can see the corresponding structural file, to manipulate it and to change the presentation. In addition, if the potential map is requested to be calculated, the potential can be mapped onto the molecule surface. The DelPhi web server is available from http://compbio.clemson.edu/delphi_webserver. PMID:24683424

Combined effects of VX-770 and VX-809 on several functional abnormalities of F508del-CFTR channels.

PubMed

Kopeikin, Z; Yuksek, Z; Yang, H-Y; Bompadre, S G

2014-09-01

The most common cystic fibrosis-associated mutation, the deletion of phenylalanine 508 (F508del), results in channels with poor membrane expression and impaired function. VX-770, a clinically approved drug for treatment of CF patients carrying the G551D mutation, and VX-809, a corrector shown in vitro to increase membrane expression of mutant channels, are currently undergoing clinical trials, but functional data at the molecular level is still lacking. The effect of VX-770 and VX-809 on the multiple functional defects of F508del-CFTR was assessed via excised inside-out patch-clamp experiments. VX-770 completely restores the low opening-rate of F508del-CFTR, with smaller open-time increase, in temperature-corrected and VX-809-treated channels. The shorter locked-open time of hydrolysis-deficient F508del-CFTR is also prolonged by VX-770. VX-809 does not improve channel function by itself as previously reported. The results from these studies can be interpreted as an equilibrium shift toward the open-channel conformation of F508del-CFTR channels. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

[Bibliometric analysis of Revista Médica del IMSS in the Scopus database for the period between 2005-2013].

PubMed

García-Gómez, Francisco; Ramírez-Méndez, Fernando

2015-01-01

To analyze the number of articles of Revista Médica del Instituto Mexicano del Seguro Social (Rev Med Inst Mex Seguro Soc) in the Scopus database and describe principal quantitative bibliometric indicators of scientific publications during the period between 2005 to 2013. Scopus database was used limited to the period between 2005 to 2013. The analysis cover mainly title of articles with the title of Revista Médica del Instituto Mexicano del Seguro Social and its possible modifications. For the analysis, Scopus, Excel and Access were used. 864 articles were published during the period between 2005 to 2013 in the Scopus database. We identified authors with the highest number of contributions including articles with the highest citation rate and forms of documents cited. We also divided articles by subjects, types of documents and other bibliometric indicators which characterize the publications. The use of Scopus brings the possibility of analyze with an external tool the visibility of the scientific production published in the Revista Médica del IMSS. The use of this database also contributes to identify the state of science in México, as well as in the developing countries.

Characterization of nasal potential difference in cftr knockout and F508del-CFTR mice.

PubMed

Saussereau, Emilie Lyne; Roussel, Delphine; Diallo, Siradiou; Debarbieux, Laurent; Edelman, Aleksander; Sermet-Gaudelus, Isabelle

2013-01-01

Treatments designed to correct cystic fibrosis transmembrane conductance regulator (CFTR) defects must first be evaluated in preclinical experiments in the mouse model of cystic fibrosis (CF). Mice nasal mucosa mimics the bioelectric defect seen in humans. The use of nasal potential difference (V(TE)) to assess ionic transport is a powerful test evaluating the restoration of CFTR function. Nasal V(TE) in CF mice must be well characterized for correct interpretation. We performed V(TE) measurements in large-scale studies of two mouse models of CF--B6;129 cftr knockout and FVB F508del-CFTR--and their respective wild-type (WT) littermates. We assessed the repeatability of the test for cftr knockout mice and defined cutoff points distinguishing between WT and F508del-CFTR mice. We determined the typical V(TE) values for CF and WT mice and demonstrated the existence of residual CFTR activity in F508del-CFTR mice. We characterized intra-animal variability in B6;129 mice and defined the cutoff points for F508del-CFTR chloride secretion rescue. Hyperpolarization of more than -2.15 mV after perfusion with a low-concentration Cl(-) solution was considered to indicate a normal response. These data will make it possible to interpret changes in nasal V(TE) in mouse models of CF, in future preclinical studies.

Forensic efficiency and genetic variation of 30 InDels in Vietnamese and Nigerian populations.

PubMed

Du, Weian; Peng, Zhiyong; Feng, Chunlei; Zhu, Bofeng; Wang, Bangchao; Wang, Yue; Liu, Chao; Chen, Ling

2017-10-24

Insertion/deletion polymorphisms (InDels) are ubiquitous diallelic genetic markers that have drawn increasing attention from forensic researchers. Here, we investigated 30 InDel loci in Vietnamese and Nigerian populations and evaluated their usefulness in forensic genetics. The polymorphic information content of these populations ranged, respectively, from 0.164 to 0.375 and from 0.090 to 0.375 across loci. After Bonferroni correction, no significant deviation from Hardy-Weinberg equilibrium was found, except for HLD97 in the Nigerian population. The cumulative power of exclusion for all 30 loci in the Vietnamese and Nigerian populations was 0.9870 and 0.9676, respectively, indicating that this InDel set is not suitable for paternity testing in these populations, but could be included as a supplement. For the Vietnamese and the Nigerian populations, the mean observed heterozygosity was 0.5917 and 0.6268, and the combined discrimination power of the 30 loci was 0.9999999999767 and 0.9999999999603, respectively. These findings indicated that these InDels may be suitable for personal forensic identification in the studied populations. The results of D A distance, phylogenetic tree, principal component, and cluster analyses were consistent and indicated a clear pattern of regional distribution. Moreover, the Vietnamese population was shown to have close genetic relationships with the Guangdong Han and Shanghai Han populations.

Forensic efficiency and genetic variation of 30 InDels in Vietnamese and Nigerian populations

PubMed Central

Du, Weian; Peng, Zhiyong; Feng, Chunlei; Zhu, Bofeng; Wang, Bangchao; Wang, Yue; Liu, Chao; Chen, Ling

2017-01-01

Insertion/deletion polymorphisms (InDels) are ubiquitous diallelic genetic markers that have drawn increasing attention from forensic researchers. Here, we investigated 30 InDel loci in Vietnamese and Nigerian populations and evaluated their usefulness in forensic genetics. The polymorphic information content of these populations ranged, respectively, from 0.164 to 0.375 and from 0.090 to 0.375 across loci. After Bonferroni correction, no significant deviation from Hardy-Weinberg equilibrium was found, except for HLD97 in the Nigerian population. The cumulative power of exclusion for all 30 loci in the Vietnamese and Nigerian populations was 0.9870 and 0.9676, respectively, indicating that this InDel set is not suitable for paternity testing in these populations, but could be included as a supplement. For the Vietnamese and the Nigerian populations, the mean observed heterozygosity was 0.5917 and 0.6268, and the combined discrimination power of the 30 loci was 0.9999999999767 and 0.9999999999603, respectively. These findings indicated that these InDels may be suitable for personal forensic identification in the studied populations. The results of DA distance, phylogenetic tree, principal component, and cluster analyses were consistent and indicated a clear pattern of regional distribution. Moreover, the Vietnamese population was shown to have close genetic relationships with the Guangdong Han and Shanghai Han populations. PMID:29179488

Extracorporeal membrane oxygenation in children with heart disease and del22q11 syndrome: a review of the Extracorporeal Life Support Organization Registry.

PubMed

Prodhan, P; Gossett, J M; Rycus, P T; Gupta, P

2015-11-01

The study objective was to evaluate outcomes among children with del22q11 (DiGeorge) syndrome supported on ECMO for heart disease. The ELSO registry database was queried to include all children <18 years undergoing heart surgery for either common atrio-ventricular canal, tetralogy of Fallot, truncus arteriosus or transposition of the great vessels and interrupted aortic arch and requiring ECMO, from 1998-2011. The outcomes evaluated included mortality, ECMO duration and length of hospital stay in patients with del22q11 syndrome and with no del22q11 syndrome. Eighty-eight ECMO runs occurred in children with del22q11 syndrome while 2694 ECMO runs occurred in children without del22q11 syndrome. For patients with heart defects receiving ECMO, del22q11 syndrome did not confer a significant mortality risk or an increased risk of infectious complications before or while on ECMO support. Neither the duration of ECMO nor mechanical ventilation prior to ECMO deployment were prolonged in patients with del22q11 syndrome compared to the controls. © The Author(s) 2015.

Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

PubMed

Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M; McClean, Phillip E

2014-01-01

Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate.

Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

PubMed Central

Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M.; McClean, Phillip E.

2013-01-01

Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate. PMID:24860578

Medicina integrativa en América: De qué forma se está practicando la medicina integrativa en los centros clínicos en los Estados Unidos

PubMed Central

Horrigan, Bonnie; Lewis, Sheldon; Abrams, Donald I.; Pechura, Constance

2012-01-01

RESUMEN EJECUTIVO El impulso para desarrollar e implementar estrategias de medicina integrativa está enraizado en el deseo de mejorar la atención al paciente. The Bravewell Collaborative, una organización sin ánimo de lucro dedicada a la mejora de la atención sanitaria, define la medicina integrativa como “un enfoque de la medicina que coloca al paciente en el centro y se dirige al conjunto completo de influencias físicas, emocionales, mentales, sociales, espirituales y ambientales que afectan a la salud de la persona. Con una estrategia personalizada que considera las condiciones, necesidades y circunstancias únicas del paciente, utiliza las intervenciones más apropiadas de una variedad de disciplinas científicas para curar la afección y la enfermedad y ayudar a las personas a recobrar y mantener una salud óptima”. En las pasadas dos décadas, se ha documentado un número creciente de centros clínicos que proporcionan medicina integrativa, el número de facultades y escuelas médicas que enseñan estrategias integrativas, el número de investigadores que estudian intervenciones integrativas, y el número de pacientes que solicitan cuidados integrativos. Pero se desconocía si la medicina integrativa se estaba ofreciendo de manera igual, similar, o dispar. Además, mientras que los estudios anteriores se centraban en la prevalencia y el uso de la medicina complementaria o alternativa (MCA) por parte de los pacientes1,2 o de los médicos en hospitales3, enumerando la utilización de terapias MCA individuales, se había recogido muy poca información con respecto a la práctica real de la medicina integrativa que, por definición, trata a la persona en su conjunto. En 2011, The Bravewell Collaborative encargó una encuesta para determinar la forma en que la medicina integrativa se estaba practicando en los Estados Unidos: (1) describiendo las poblaciones de pacientes y las afecciones sanitarias tratadas más habitualmente; (2) definiendo las pr

78 FR 30268 - Del Norte County Resource Advisory Committee

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-22

... Schools and Community Self-Determination Act (Pub. L. 112-141) (the Act) and operates in compliance with... to review prior year project's progress. Should the Secure Rural Schools Act be reauthorized, the.... ADDRESSES: The meetings will be held at the Del Norte County Unified School District, Redwood Room, 301 West...

Casimir force in the Gödel space-time and its possible induced cosmological inhomogeneity

NASA Astrophysics Data System (ADS)

Khodabakhshi, Sh.; Shojai, A.

2017-07-01

The Casimir force between two parallel plates in the Gödel universe is computed for a scalar field at finite temperature. It is observed that when the plates' separation is comparable with the scale given by the rotation of the space-time, the force becomes repulsive and then approaches zero. Since it has been shown previously that the universe may experience a Gödel phase for a small period of time, the induced inhomogeneities from the Casimir force are also studied.

Combination of t(4;14), del(17p13), del(1p32) and 1q21 gain FISH probes identifies clonal heterogeneity and enhances the detection of adverse cytogenetic profiles in 233 newly diagnosed multiple myeloma.

PubMed

Smol, Thomas; Dufour, Annika; Tricot, Sabine; Wemeau, Mathieu; Stalnikiewicz, Laure; Bernardi, Franck; Terré, Christine; Ducourneau, Benoît; Bisiau, Hervé; Daudignon, Agnès

2017-01-01

Our aim was to set the FISH combination of del(17p13), t(4;14), 1q21 gain and del(1p32), four adverse cytogenetic factors rarely evaluated together, and compare our technical thresholds with those defined in the literature. Two hundred thirty-three patients with MM at diagnosis were studied using FISH to target 4 unfavorable cytogenetic abnormalities: 17p13 deletion, t(4;14) translocation, 1p32 deletion and 1q21 gain. Technical thresholds were determined for each probe using isolated CD138-expressing PC from patients without MM. The FISH analysis identified abnormalities in 79.0% of patients. Del(17p13) was detected in 15.0% of cases, t(4;14) in 11.5%, 1q21 gain in 37.8% and del(1p32) in 8.7%. Adding 1p32/1q21 FISH probes has enabled us to identify adverse cytogenetic profiles in 39.0% of patients without del(17p13) or t(4;14). Clonal heterogeneity was observed in 51.1% of patients as well as an increase in the number of adverse abnormalities when related clones were greater than or equal to 2 (85.1% against 45.6%). FISH allowed detecting accumulation of adverse abnormalities and clonal heterogeneity in MM with a combination of 4 probes. The impacts of these two parameters need to be evaluated, and could be included in future cytogenetic classifications.

El diseño final del espectrógrafo de banco (EBASIM) para CASLEO

NASA Astrophysics Data System (ADS)

Simmons, J.; Levato, H.

Utilizando el código de óptica ACCOS V se ha finalizado el diseño del espectrógrafo de banco para CASLEO. En una comunicación anterior habíamos indicado que utilizaríamos un colimador de 150 mm de diámetro con un radio de curvatura de 1540 mm. Para el espejo cámara, que tiene un diámetro de 200 mm, el radio de curvatura es de 1200 mm, ambos radios con una tolerancia no mayor a los 3 mm. En la presente, se informa sobre los detalles finales del cálculo del espectrógrafo que incluye el cómputo para 5 longitudes de onda diferentes y alrededor de 100 rayos. En todos los casos el 75 % de energía está dentro de un diámetro de 13 micrones. El diseño ha sido probado entre 3500 Å hasta 9000 Å con resultados satisfactorios.

[Effectiveness of azacitidine in chronic myelomonocytic leukemia harboring del(20q) - a case report].

PubMed

Manabe, Masahiro; Okita, Junya; Takakuwa, Teruhito; Harada, Naonori; Aoyama, Yasutaka; Kumura, Takeo; Ohta, Tadanobu; Furukawa, Yoshio; Mugitani, Atsuko

2014-06-01

A 7 1-year-old man was admitted to our hospital with leukocytosis and anemia. Chronic myelomonocytic leukemia (CMML)harboring del(20q)was diagnosed by peripheral blood examination and bone marrow aspiration. The patient was subsequently treated with azacitidine, which resulted in rapid disappearance of monocytosis and resolved his dependency on red cell transfusion. With regard to the chromosomal abnormality, although del(20q)is estimated to be encountered in approximately 0.7-1.0% of all CMML cases, its significance in prognosis has not been fully analyzed. Hence, more such cases need to be evaluated to elucidate the therapeutic outcome of CMML involving del(20q). In addition, the Wilms tumor-1(WT 1)level in the patient gradually decreased after the initiation of azacitidine therapy. This phenomenon of WT1 decrease synchronizing with the patient's clinical improvement might reflect therapeutic efficacy with regard to the clinical course, as had been observed in acute myeloid leukemia and myelodysplastic syndrome.

DELIVERING TIMELY AIR QUALITY, TRAFFIC, AND WEATHER INFORMATION TO YOUR COMMUNITY/THE PASO DEL NORTE ENVIRONMENTAL MONITORING PROJECT

EPA Science Inventory

EPA has developed a technology transfer handbook for the EMPACT Paso del Norte Project. The EMPACT Paso del Norte Environmental Monitoring Project is a mobile vehicle emissions project that involves the international community of El Paso, TX; Sundland Park, NM; and Juarez, Mexico...

Lack of effect of the alpha2C-adrenoceptor Del322-325 polymorphism on inhibition of cyclic AMP production in HEK293 cells.

PubMed

Montgomery, M D; Bylund, D B

2010-02-01

The alpha(2C)-adrenoceptor has multiple functions, including inhibiting release of noradrenaline from presynaptic nerve terminals. A human alpha(2C) polymorphism, Del322-325, a potential risk factor for heart failure, has been reported to exhibit reduced signalling in CHO cells. To further understand the role of the Del322-325 polymorphism on receptor signalling, we attempted to replicate and further study the reduced signalling in HEK293 cells. Human alpha(2C) wild-type (WT) and Del322-325 adrenoceptors were stably transfected into HEK293 cells. Radioligand binding was performed to determine affinities for both receptors. In intact cells, inhibition of forskolin-stimulated cyclic AMP production by WT and Del322-325 clones with a range of receptor densities (200-2320 fmol.mg(-1) protein) was measured following agonist treatment. Noradrenaline, brimonidine and clonidine exhibited similar binding affinities for WT and Del322-325. Brimonidine and clonidine also had similar efficacies and potencies for both receptors for the inhibition of cyclic AMP production at all receptor densities tested. A linear regression analysis comparing efficacy and potency with receptor expression levels showed no differences in slopes between WT and Del322-325. The alpha(2C) WT and Del322-325 adrenoceptors exhibited similar binding properties. Additionally, inhibition of cyclic AMP production by Del322-325 was similar to that of WT over a range of receptor densities. Therefore, in intact HEK293 cells, the alpha(2C)-Del322-325 polymorphism does not exhibit reduced signalling to adenylyl cyclase and may not represent a clinically important phenotype.

[Not Available].

PubMed

Chivu, Elena Cristina; Artero-Fullana, Ana; Alfonso García, Antonio; Sánchez Juan, Carlos

2016-07-19

Introducción: conociendo la elevada prevalencia de la desnutrición hospitalaria, se hace necesaria su detección precoz. Cuando, por diversos motivos, no es posible realizar una valoración completa del estado nutricional, se recomienda el empleo de herramientas validadas de cribado nutricional. Estas ayudarían a detectar de forma rápida a aquellos pacientes que necesiten de un tratamiento nutricional.Objetivos: determinar la prevalencia del riesgo de desnutrición, en el Hospital General Universitario de Valencia, empleando para ello la herramienta de cribado nutricional HEMAN y comprobar si la implementación de esta herramienta en la práctica clínica, sería lo más adecuado.Métodos: estudio transversal, realizado sobre una muestra de 1.099 pacientes ingresados en un hospital terciario. A todos ellos se les realizó el cribado nutricional HEMAN a las 24-48 horas del ingreso. Las variables cualitativas se compararon mediante Chi-cuadrado, y las cuantitativas mediante el test t de Student.Resultados: la prevalencia del riesgo de desnutrición fue del 33,5%. Los pacientes que resultaron positivos en el cribado (HEMAN ≥ 3), tenían mayor edad que los pacientes normonutridos, referían pérdidas de peso entre el 5-10%, el 55,2% disminuyó su ingesta a menos del 50% de la habitual. Además, ingresaron con patologías consideradas de leves a moderadas. La utilización del método HEMAN como herramienta de cribado, resultó ser práctica y efectiva, y ayudó a disminuir el tiempo empleado con cada paciente encuestado evaluado.Conclusiones: se detectó una elevada prevalencia de riesgo de desnutrición entre los pacientes evaluados, por lo tanto se hace imprescindible la utilización de métodos de cribado nutricional en la rutina diaria del hospital, para ello recomendamos especialmente la utilización del método HEMAN.

[Trattamento farmacologico del disturbo da uso di alcol. Evidenze scientifiche].

PubMed

Attilia, Fabio; Perciballi, Roberta; Rotondo, Claudia; Capriglione, Ida; Iannuzzi, Silvia; Attilia, Maria Luisa; Vitali, Mario; Alessandrini, Giovanni; Scamporrino, Maria Concetta Marcella; Fiore, Marco; Ceccanti, Mauro

2018-01-01

RIASSUNTO. La terapia farmacologica nei pazienti con disturbo da uso di alcol riveste un ruolo centrale nel progetto terapeutico, altamente contestualizzato in un approccio multidisciplinare. Sebbene i trattamenti non farmacologici per la dipendenza da alcol risultino ben strutturati e in continua evoluzione, dal punto di vista medico le possibilità di intervento sono realmente ristrette, con poche molecole a disposizione approvate per il disturbo da uso di alcol: nello specifico, l'acamprostato, il naltrexone e, più recentemente, il nalmefene tra gli anticraving; il disulfiram tra gli avversivanti. Nuovi approcci sperimentali stanno cercando di ampliare tale gamma attraverso l'utilizzo di farmaci off-label. Evidenze scientifiche devono supportare l'indicazione terapeutica, quest'ultima deve dimostrarsi "cucita" sulle esigenze del paziente e sulle comorbilità presenti tenendo conto del profilo bio-psico-sociale individuale. Fondamentale risulta il follow-up per valutare la ritenzione in trattamento e il monitoraggio degli outcome alcologici.

Pío del Río Hortega and the discovery of the oligodendrocytes

PubMed Central

Pérez-Cerdá, Fernando; Sánchez-Gómez, María Victoria; Matute, Carlos

2015-01-01

Pío del Río Hortega (1882–1945) discovered microglia and oligodendrocytes (OLGs), and after Ramón y Cajal, was the most prominent figure of the Spanish school of neurology. He began his scientific career with Nicolás Achúcarro from whom he learned the use of metallic impregnation techniques suitable to study non-neuronal cells. Later on, he joined Cajal’s laboratory. and Subsequently, he created his own group, where he continued to develop other innovative modifications of silver staining methods that revolutionized the study of glial cells a century ago. He was also interested in neuropathology and became a leading authority on Central Nervous System (CNS) tumors. In parallel to this clinical activity, del Río Hortega rendered the first systematic description of a major polymorphism present in a subtype of macroglial cells that he named as oligodendroglia and later OLGs. He established their ectodermal origin and suggested that they built the myelin sheath of CNS axons, just as Schwann cells did in the periphery. Notably, he also suggested the trophic role of OLGs for neuronal functionality, an idea that has been substantiated in the last few years. Del Río Hortega became internationally recognized and established an important neurohistological school with outstanding pupils from Spain and abroad, which nearly disappeared after his exile due to the Spanish civil war. Yet, the difficulty of metal impregnation methods and their variability in results, delayed for some decades the confirmation of his great insights into oligodendrocyte biology until the development of electron microscopy and immunohistochemistry. This review aims at summarizing the pioneer and essential contributions of del Río Hortega to the current knowledge of oligodendrocyte structure and function, and to provide a hint of the scientific personality of this extraordinary and insufficiently recognized man. PMID:26217196

CHEK2*1100delC Variant and BRCA1/2-Negative Familial Breast Cancer - A Family-Based Genetic Association Study

DTIC Science & Technology

2007-10-01

AD_________________ Award Number: DAMD17-03-1-0774 TITLE: CHEK2 *1100delC Variant and BRCA1/2...NUMBER CHEK2 *1100delC Variant and BRCA1/2-Negative Familial Breast Cancer - A Family- Based Genetic Association Study 5b. GRANT NUMBER DAMD17...association between the CHEK2 *1100delC gene variant and breast cancer among BRCA1/2-negative families. Vital to DNA replication and normal growth of breast

The Cuernos del Paine mountains in Torres del Paine National Park in Chile provide a backdrop to a herd of guanacos during NASA's AirSAR 2004 campaign

NASA Image and Video Library

2004-03-11

The Cuernos del Paine mountains in Torres del Paine National Park in Chile provide a backdrop to a herd of guanacos during NASA's AirSAR 2004 campaign. AirSAR 2004 is a three-week expedition in Central and South America by an international team of scientists that is using an all-weather imaging tool, called the Airborne Synthetic Aperture Radar (AirSAR), located onboard NASA's DC-8 airborne laboratory. Scientists from many parts of the world are combining ground research with NASA's AirSAR technology to improve and expand on the quality of research they are able to conduct. Founded in 1959, Torres del Paine National Park encompasses 450,000 acres in the Patagonia region of Chile. This region is being studied by NASA using a DC-8 equipped with an Airborne Synthetic Aperture Radar (AirSAR) developed by scientists from NASA’s Jet Propulsion Laboratory. This is a very sensitive region that is important to scientists because the temperature has been consistently rising causing a subsequent melting of the region’s glaciers. AirSAR will provide a baseline model and unprecedented mapping of the region. This data will make it possible to determine whether the warming trend is slowing, continuing or accelerating. AirSAR will also provide reliable information on ice shelf thickness to measure the contribution of the glaciers to sea level.

PFI-ZEKE (Pulsed Field Ionization-Zero Electron Kinetic Energy) para el estudio de iones

NASA Astrophysics Data System (ADS)

Castaño, F.; Fernández, J. A.; Basterretxea, A. Longarte. F.; Sánchez Rayo, M. N.; Martínez, R.

descubierta, que va en contra de lo esperado en otros sistemas físicos y que consiste en que los altos estados Rydberg de átomos, moléculas y sus complejos de van der Waals (o de los iones) tienen tiempos de vida de centenas de μ s. En resumen, el experimento y la espectroscopía ZEKE consiste en excitar un átomo, molécula o cluster sucesivamente a dos estados excitados selectivos de manera que el final sea un estado Rydberg. A continuación se aplica un campo eléctrico variable que lo ioniza y después de un cierto retraso se aplica un campo eléctrico de extracción, tanto para el electrón como para el ión. El espectro de los iones, es un espectro ZEKE. Hay varias alternativas para hacer este último proceso. El estudio de la espectroscopía y propiedades de iones y sus clusters requiere el conocimiento detallado de la espectroscopía de la molécula neutra, los estados Rydberg, de los confórmeros y sus complejos. Todo ello implica el haber estudiado los sistemas por LIF, REMPI y doble resonancia (hole burning IR-UV, UV-UV). Además solo es posible interpretar los resultados y obtener la información contenida en los espectros con ayuda de cálculos cuánticos ab initio. Hasta el momento hemos aplicado tanto el ZEKE como el conjunto de técnicas mencionadas anteriormente, a varias molécula de interés químico general como anilina y sus derivados, así como sus complejos con agua y amoniaco. Sin embargo, el método es muy versátil y puede aplicarse a iones de átomos, iones múltiples, moléculas sencillas y sus clusters así como a sus semi-reacciones. Como ejemplo de uno de estos espectros PFI-ZEKE se presenta aquí el caso del amonibenzonitrilo, ABN y solamente en su estado fundamental. En la conferencia se presentarán espectros ZEKE del ABN y moléculas similares en estados vibracionales intermedios (islas de estabilidad), así como la determinación de potenciales de ionización precisos, energías de enlace de compuestos del ión con varios disolventes y

Generalized Gödel universes in higher dimensions and pure Lovelock gravity

NASA Astrophysics Data System (ADS)

Dadhich, Naresh; Molina, Alfred; Pons, Josep M.

2017-10-01

The Gödel universe is a homogeneous rotating dust with negative Λ which is a direct product of a three-dimensional pure rotation metric with a line. We would generalize it to higher dimensions for Einstein and pure Lovelock gravity with only one N th-order term. For higher-dimensional generalization, we have to include more rotations in the metric, and hence we shall begin with the corresponding pure rotation odd (d =2 n +1 )-dimensional metric involving n rotations, which eventually can be extended by a direct product with a line or a space of constant curvature for yielding a higher-dimensional Gödel universe. The considerations of n rotations and also of constant curvature spaces is a new line of generalization and is being considered for the first time.

The effect of the common c.2299delG mutation in USH2A on RNA splicing.

PubMed

Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

2014-05-01

Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

Cosmogenic Radionuclides in the Campo Del Cielo Iron Meteorite

NASA Technical Reports Server (NTRS)

Liberman, R. G.; FernandezNiello, J. O.; Reedy, R. C.; Fifield, L. K.; diTada, M. L.

2001-01-01

Cosmogenic Be-10, Al-26, Cl-36, Ca-41, and Ni-59 were measured in the Campo del Cielo iron meteorite. Our results led us to conclude that the pre-atmospheric radius might have been approximately 2 m. Comparisons with other big bodies are also presented. Additional information is contained in the original extended abstract.

Determinacion de periodos fundamentales del suelo mediante vibraciones ambientales en el municipio de Humacao, Puerto Rico

NASA Astrophysics Data System (ADS)

Cintron Aponte, Rommel

La tecnica de Nakamura ha sido utilizada a nivel mundial para determinar periodos fundamentales del suelo. La tecnica consiste en calcular y graficar cocientes espectrales H/V de vibraciones ambientales registradas sobre el suelo. Mediciones de vibraciones ambientales fueron tomadas en 151 lugares dentro del municipio de Humacao, localizado al este de Puerto Rico. Los datos se procesaron utilizando espectros de Fourier y espectros de potencia. La tecnica fue validada al compararla con los resultados de cocientes espectrales H/V de registros de sismos debiles y tambien con una modelacion numerica realizada con datos de un ensayo "downhole". Las graficas de los cocientes espectrales H/V fueron divididas en casos y grupos, los cuales dependen de la facilidad para identificar el periodo fundamental pico y amplitudes en frecuencias menores de 1 Hz, respectivamente. Los resultados obtenidos con ambos espectros fueron comparados y se concluye que los mismos se complementan para proveer resultados mas confiables. Se crearon mapas de periodos fundamentales, factores de amplitud, isoperiodos y clasificacion sismica de sitio. Los mapas de isoperiodos fueron realizados en las zonas mas pobladas sobre depositos de suelo. El mapa de periodos fundamentales del suelo mostro buena correlacion con la geologia local. El mapa de clasificacion sismica derivado de periodos de sitio fue comparado con el mapa de clasificacion sismica derivado de barrenos geotecnicos. El mapa de clasificacion obtenido de periodos puede sobreestimar un poco algunas clasificaciones del suelo. Sin embargo, este mapa puede proveer un estimado aproximado de la velocidad de onda de corte promedio del suelo hasta una profundidad de 100 pies (30 metros).

Prevalence of 2314delG mutation in Spanish patients with Usher syndrome type II (USH2).

PubMed

Beneyto, M M; Cuevas, J M; Millán, J M; Espinós, C; Mateu, E; González-Cabo, P; Baiget, M; Doménech, M; Bernal, S; Ayuso, C; García-Sandoval, B; Trujillo, M J; Borrego, S; Antiñolo, G; Carballo, M; Nájera, C

2000-06-01

The Usher syndrome (USH) is a group of autosomal recessive diseases characterized by congenital sensorineural hearing loss and retinitis pigmentosa. Three clinically distinct forms of Usher syndrome have so far been recognized and can be distinguished from one another by assessing auditory and vestibular function. Usher syndrome type II (USH2) patients have congenital moderate-to-severe nonprogressive hearing loss, retinitis pigmentosa, and normal vestibular function. Genetic linkage studies have revealed genetic heterogeneity among the three types of USH, with the majority of USH2 families showing linkage to the USH2A locus in 1q41. The USH2A gene (MIM 276901) has been identified: three mutations, 2314delG, 2913delG, and 4353-54delC, were initially reported in USH2A patients, the most frequent of which is the 2314delG mutation. It has been reported that this mutation can give rise to typical and atypical USH2 phenotypes. USH2 cases represent 62% of all USH cases in the Spanish population, and 95% of these cases have provided evidence of linkage to the USH2A locus. In the present study, the three reported mutations were analyzed in 59 Spanish families with a diagnosis of USH type II. The 2314delG was the only mutation identified in our population: it was detected in 25% of families and 16% of USH2 chromosomes analyzed. This study attempts to estimate the prevalence of this common mutation in a homogeneous Spanish population.

An experiment of formation of charmoni states in annihilation P-Pbarra. Un esperimento di formazione di stati del charmonio in annichilazione P-Pbarra (in Italian)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pallavicini, Marco

1995-01-01

Oggetto di questa tesi e la misura di alcune caratteristiche fisiche (massa, larghezza, e larghezza parziale in p -more » $$\\bar{p}$$) degli stati 3P 1 e 3P 2 del charmonio, -ovvero del sistema legato di un quark "charm" e del suo antiquark-, nell'amito dell'esperimento E-760, installato nell'accumulatore di antiprotoni del Fermilab.« less

Segundo Catálogo Estelar del Hemisferio Sur con Astrolabio Fotoeléctrico PAII

NASA Astrophysics Data System (ADS)

Manrique, W. T.; Podestá, R. C.; Alonso, E.; Actis, E. V.; Pacheco, A. M.; Bustos, G.; Lizhi, L.; Zezhi, W.; Fanmiao, Z.; Hongqi, W.; Perdomo, R.

Recordamos que entre el Observatorio Astronómico ``Félix Aguilar'', el Observatorio Astronómico de Beijing y el Observatorio Astronómico de La Plata, se ha convenido en desarrollar un Proyecto de Investigación conjunto, para la observación sistemática de estrellas en el Hemisferio Sur, con el objeto de la elaboración de un Catálogo Estelar Global utilizando un Astrolabio Fotoeléctrico PAII del Observatorio de Beijing, que ha sido usado con éxito en la República de China. En este trabajo se presenta el Segundo Catálogo Estelar del Hemisferio Sur, derivado de las observaciones realizadas con el PAII instalado en el OAFA, durante el períiodo Febrero de 1992 a Marzo de 1997. En este lapso se han observado mas de 400000 pasajes estelares, obteniéndose las correcciones Δ α y Δ δ de 5241 estrellas del FK4, FK5, FK5 Ext., SRS, CAMC y GC. Las precisiones medias son del orden de ± 3,2 ms en ascensión recta y ±0."057 en declinación. Rango de magnitudes : 2,0 a 11,5 Rango de declinaciones : -3o a -60o Epoca Media : 1994.9 Se analizan los residuos en función de la magnitud y tipo espectral, correcciones de grupo y frecuencia de distribución Δ α y Δ δ.

Global Vulnerability Assessment in Santa María Tixmadeje, Estado de México, México

NASA Astrophysics Data System (ADS)

Monroy Salazar, S.; Novelo-Casanova, D. A.

2010-12-01

Santa María Tixmadejé (SMT), Estado de México, Mexico is a town located very close to the Acambay-Tixmadejé fault. This fault is located in the middle of the Trans Volcanic Belt in the center of the Mexican territory and generated a large seismic event in 1912 with magnitude 6.9 which combined with the local vulnerability, caused a disaster. In this work we measure the different vulnerabilities of the SMT community: structural, economical, social and educational. In addition, we determinate the total vulnerability, by summing all estimated vulnerabilities, for the critical facilities identified in this town. Vulnerability was determined using the methodology proposed by National Oceanic Atmospheric Administration (NOAA) and by Disaster Prevention National Center (CENAPRED). Besides, we considered a minimum sample statistically significant of the total houses with a random sampling for our survey. Our results indicate that 50% of the critical facilities have high and very high and the other 50% between low and moderate level of total vulnerability. The results for independent vulnerabilities are as follows: (1) Near to 75% of the community has high and very high level of social vulnerability and the range for the another 25% is between low and moderate; (2) About 43% of the community has high and very high economical vulnerability and 57% low and moderate; (3) Approximately 38% of the population has high and very high educational vulnerability. The 62% present low and moderate vulnerability; and (4) About 42% of the community has very high structural vulnerability and 58% between low and moderate.

La enumeración de la soltería femenina en los censos de población: sesgo y propuesta de corrección

PubMed Central

McCaa, Robert; Esteve, Albert; Garcia, Joan

2013-01-01

Esta investigación tiene como objetivo investigar el efecto que la disolución de las uniones consensuales tiene en los niveles de soltería que proporciona el Censo de Población, niveles derivados de la variable estado civil. Para ello comparamos los datos censales con los de la Encuestas de Demografía y Salud (de ahora en adelante DHS) en aquellos países y años para los que disponemos de ambas fuentes en el mismo año o años adyacentes (Bolivia, Brasil, Colombia y Perú). Los resultados muestran claramente que las proporciones de nunca unidas derivadas de la variable censal ’Estado civil’ son sistemáticamente más elevadas que las estimadas a partir de las DHS. La razón de esta sobreestimación obedece al hecho de que personas que estuvieron en unión libre en el pasado se declaran solteras en el momento del Censo. La elevada proporción de mujeres solteras que tienen hijos según el Censo es una prueba de ello y a su vez una solución efectiva para corregir el sesgo. PMID:25593515

Interdisciplinary Unit: La Isla del Encanto (The Enchanted Island).

ERIC Educational Resources Information Center

Ford-Guerrera, Rebecca

This document presents a series of 14 lesson plans in an interdisciplinary Spanish unit on "La isla del encanto/The Enchanted Island." The materials were prepared for students in grades 5 or 6 who have had basic Spanish instruction in previous grades. The students should also be familiar with basic concepts in English such as math…

Association of methylenetetrahydrofolate reductase (MTHFR 677C>T) and thymidylate synthase (TSER and TS 1494del6) polymorphisms with premature ovarian failure in Korean women.

PubMed

Rah, HyungChul; Jeon, Young Joo; Choi, Youngsok; Shim, Sung Han; Yoon, Tae Ki; Choi, Dong Hee; Cha, Sun Hee; Kim, Nam Keun

2012-11-01

The aim of our study was to investigate whether methylenetetrahydrofolate reductase (MTHFR) gene variant (MTHFR 677C>T) and thymidylate synthase (TS) gene variants (TS enhancer region [TSER] and TS 1494del6) confer a risk for premature ovarian failure (POF). We genotyped 136 POF patients and 236 controls among Korean women for the three single nucleotide polymorphism sites using polymerase chain reaction restriction fragment length polymorphism analysis. Differences in the MTHFR 677C>T, TSER, and TS 1494del6 genotype frequencies between POF patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as a measure of the strength of the association between genotypes and POF. The MTHFR 677CT and CT + TT variant genotypes were more frequent in POF patients than in controls (OR, 2.249; 95% CI, 1.317-3.843; and OR, 2.132; 95% CI, 1.268-3.585, respectively). The combined genotype frequencies of MTHFR 677CT + TT/TSER 3R3R and 677CT + TT/TS 1494del6 del6/del6 were higher in patients than in controls (OR, 2.300; 95% CI, 1.219-4.337; and OR, 3.314; 95% CI, 1.623-6.767, respectively). The T-3R-del6 and T-2R-del6 (MTHFR 677C>T/TSER/TS 1494del6) haplotypes were more frequent in patients (OR, 1.450; 95% CI, 1.050-2.002; and OR, 2.911; 95% CI, 1.191-7.117, respectively), whereas the C-2R-del6 haplotype was less frequent in patients (OR, 0.372; 95% CI, 0.152-0.912). The T-del6 (MTHFR 677/TS 1494del6) haplotype frequency was higher among patients (OR, 1.653; 95% CI, 1.206-2.266), whereas the C-del6 haplotype frequency was lower among patients (OR, 0.700; 95% CI, 0.516-0.950). We did not find an association between TSER or TS 1494del6 polymorphisms and POF. Our data suggest that the MTHFR 677T allele may increase the risk for POF, which could lead to the development of novel genetic markers for predicting the risk of POF in patients.

Prevalencia y tamizaje del Trastorno por Déficit de Atención con Hiperactividad en Costa Rica

PubMed Central

Weiss, Nicholas T.; Schuler, Jovita; Monge, Silvia; McGough, James J.; Chavira, Denise; Bagnarello, Monica; Herrera, Luis Diego; Mathews, Carol A.

2015-01-01

Resumen La investigación tuvo como propósito estimar la prevalencia del Trastorno por Déficit de Atención con Hiperactividad (TDAH) en Costa Rica y determinar si la versión en español del cuestionario Swanson Nolan and Pelham Scale IV (SNAP-IV) es un instrumento de tamizaje útil en una población de niños y niñas escolares costarricenses. El instrumento fue entregado a padres y maestros de 425 niños entre 5 y 13 años de edad (promedio = 8.8). Todos fueron evaluados con el instrumento Swanson, Kotkin, Agler, M-Flynn and Pelham Scale (SKAMP). Su diagnóstico fue confirmado con una entrevista clínica. La sensibilidad y la especificidad del SNAP-IV fueron evaluadas como predictores de criterios de diagnóstico según el DSM-IV. La prevalencia puntual en la muestra del TDAH fue del 5%. El tamizaje más preciso lo hizo el SNAP-IV completado por el maestro en un corte de 20%, con una sensibilidad de 96% y una especificidad de un 82%. La sensibilidad de los instrumentos completados por los padres fue más baja que aquella de los maestros. El SNAP-IV completado por las maestras con un corte aislando el 20% de los mayores puntajes categorizó correctamente a un 87% de los sujetos. PMID:22432094

Aplicación de la metodología Molecular de Orbitales de Defecto Cuántico (MQDO) al cálculo de intensidades vibrónicas y vidas medias de niveles vibracionales

NASA Astrophysics Data System (ADS)

María Velasco Sanz, Ana

Desde que se formuló, en 1996, la metodología Molecular de Orbitales de Defecto Cuántico (MQDO) [1], se han obtenido datos de calidad relativos a intensidades de bandas electrónicas que implican estados Rydberg para una gran variedad de sistemas moleculares [2]. Animados por los buenos resultados obtenidos, recientemente hemos abordado el estudio de transiciones vibrónicas, es decir aquellas que ocurren entre estados vibracionales que pertenecen a distintos estados Rydberg electrónicos. Como prototipo adecuado para nuestros propósitos hemos elegido la molécula de NO, importante en la química de la atmósfera, y para la cual existen en la bibliografía datos experimentales de calidad suficiente para contrastar la validez de nuestros resultados. En concreto, hemos calculado las fuerzas de oscilador y coeficientes de Einstein para transiciones electrónicas y vibrónicas de las principales bandas del NO, al igual que vidas medias radiativas de niveles vibracionales de dicha molécula. Las propiedades estudiadas son esenciales para la comprensión de los aspectos teóricos de los procesos físicos básicos relativos a la dispersión electrónica en moléculas heteronucleares con capas abiertas. Además, valores fiables de probabilidades de transición moleculares tienen importantes aplicaciones en Astrofísica, en la modelización de procesos fotodinámicos moleculares, etc., al igual que para evaluar más profundamente la validez de nuestra metodología teórica.

Systematically frameshifting by deletion of every 4th or 4th and 5th nucleotides during mitochondrial transcription: RNA self-hybridization regulates delRNA expression.

PubMed

Seligmann, Hervé

2016-01-01

In mitochondria, secondary structures punctuate post-transcriptional RNA processing. Recently described transcripts match the human mitogenome after systematic deletions of every 4th, respectively every 4th and 5th nucleotides, called delRNAs. Here I explore predicted stem-loop hairpin formation by delRNAs, and their associations with delRNA transcription and detected peptides matching their translation. Despite missing 25, respectively 40% of the nucleotides in the original sequence, del-transformed sequences form significantly more secondary structures than corresponding randomly shuffled sequences, indicating biological function, independently of, and in combination with, previously detected delRNA and thereof translated peptides. Self-hybridization decreases delRNA abundances, indicating downregulation. Systematic deletions of the human mitogenome reveal new, unsuspected coding and structural informations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

PREFACE: Third Congress on Materials Science and Engineering (CNCIM-Mexico 2012)

NASA Astrophysics Data System (ADS)

de Coss, Romeo; Murrieta-Hernández, Gabriel; Aguayo-González, Aarón; Rubio-Rosas, Efraín; Chigo-Anota, Ernesto; Vigueras-Santiago, Enrique

2013-06-01

ónoma de Puebla Ciudad Universitaria, Col. San Manuel, C.P. 72570, Puebla, Puebla, México efrain.rubio@cuv.buap.mx Ernesto Chigo-Anota Benemérita Universidad Autónoma de Puebla Ciudad Universitaria, Col. San Manuel, C.P. 72570, Puebla, Puebla, México ernesto.chigo@correo.buap.mx Enrique Vigueras-Santiago Universidad Autónoma del Estado de México Instituto Literario No. 100, Col. Centro 50000, Toluca, Edo. de México, México vigueras@uaemex.mx Session Chairs Gabriel Canto Santana, Universidad Autónoma de Campeche. Enrique Vigueras Santiago, Universidad Autónoma del Estado de México. César Cab, Universidad Autónoma de Yucatán. Alejandro ávila Ortega, Universidad Autónoma de Yucatán. Jesús Barrón Zambrano, Universidad Autónoma de Yucatán. Maritza de Coss, Universidad Autónoma de Yucatán. Jorge A. Tapia González, Universidad Autónoma de Yucatán. David Muñoz Rodríguez, Universidad Autónoma de Yucatán. Mario Pérez Cortes, Universidad Autónoma de Yucatán. Jesús García Serrano, Universidad Autónoma del Estado de Hidalgo. Rubén Arturo Medina Esquivel, Universidad Autónoma de Yucatán. César R. Acosta, Universidad Autónoma de Yucatán. Organizing Committee Aarón Aguayo González, Universidad Autónoma de Yucatán. Gabriel Murrieta Hernández, Universidad Autónoma de Yucatán. Alejandro Tapia González, Universidad Autónoma de Yucatán. Cristian Carrera Figueiras, Universidad Autónoma de Yucatán. Heriberto Hernández Cocoletzi, Benemérita Universidad Autónoma de Puebla. Ernesto Chigo Anota, Benemérita Universidad Autónoma de Puebla. Efraín Rubio Rosas, Benemérita Universidad Autónoma de Puebla. Enrique Vigueras Santiago, Universidad Autónoma del Estado de México. Romeo de Coss, Centro de Investigación y de Estudios Avanzados (Cinvestav-Mérida). Organizers: Organizers Sponsors: Sponsors

Differential Item Functioning of the Psychological Domain of the Menopause Rating Scale.

PubMed

Monterrosa-Castro, Alvaro; Portela-Buelvas, Katherin; Oviedo, Heidi C; Herazo, Edwin; Campo-Arias, Adalberto

2016-01-01

Introduction. Quality of life could be quantified with the Menopause Rating Scale (MRS), which evaluates the severity of somatic, psychological, and urogenital symptoms in menopause. However, differential item functioning (DIF) analysis has not been applied previously. Objective . To establish the DIF of the psychological domain of the MRS in Colombian women. Methods . 4,009 women aged between 40 and 59 years, who participated in the CAVIMEC (Calidad de Vida en la Menopausia y Etnias Colombianas) project, were included. Average age was 49.0 ± 5.9 years. Women were classified in mestizo, Afro-Colombian, and indigenous. The results were presented as averages and standard deviation ( X ± SD). A p value <0.001 was considered statistically significant. Results . In mestizo women, the highest X ± SD were obtained in physical and mental exhaustion (PME) (0.86 ± 0.93) and the lowest ones in anxiety (0.44 ± 0.79). In Afro-Colombian women, an average score of 0.99 ± 1.07 for PME and 0.63 ± 0.88 for anxiety was gotten. Indigenous women obtained an increased average score for PME (1.33 ± 0.93). The lowest score was evidenced in depressive mood (0.50 ± 0.81), which is different from other Colombian women ( p < 0.001). Conclusions . The psychological items of the MRS show differential functioning according to the ethnic group, which may induce systematic error in the measurement of the construct.

The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

PubMed Central

Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

2013-01-01

Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

CCL2 Serum Levels and Adiposity Are Associated with the Polymorphic Phenotypes -2518A on CCL2 and 64ILE on CCR2 in a Mexican Population with Insulin Resistance.

PubMed

Guzmán-Ornelas, Milton-Omar; Petri, Marcelo Heron; Vázquez-Del Mercado, Mónica; Chavarría-Ávila, Efraín; Corona-Meraz, Fernanda-Isadora; Ruíz-Quezada, Sandra-Luz; Madrigal-Ruíz, Perla-Monserrat; Castro-Albarrán, Jorge; Sandoval-García, Flavio; Navarro-Hernández, Rosa-Elena

2016-01-01

Genetic susceptibility has been described in insulin resistance (IR). Chemokine (C-C motif) ligand-2 (CCL2) is overexpressed in white adipose tissue and is the ligand of C-C motif receptor-2 (CCR2). The CCL2 G-2518A polymorphism is known to regulate gene expression, whereas the physiological effects of the CCR2Val64Ile polymorphism are unknown. The aim of the study is to investigate the relationship between these polymorphisms with soluble CCL2 levels (sCCL2), metabolic markers, and adiposity. In a cross-sectional study we included 380 Mexican-Mestizo individuals, classified with IR according to Stern criteria. Polymorphism was identified using PCR-RFLP/sequence-specific primers. Anthropometrics and metabolic markers were measured by routine methods and adipokines and sCCL2 by ELISA. The CCL2 polymorphism was associated with IR (polymorphic A+ phenotype frequencies were 70.9%, 82.6%, in individuals with and without IR, resp.). Phenotype carriers CCL2 (A+) displayed lower body mass and fat indexes, insulin and HOMA-IR, and higher adiponectin levels. Individuals with IR presented higher sCCL2 compared to individuals without IR and was associated with CCR2 (Ile+) phenotype. The double-polymorphic phenotype carriers (A+/Ile+) exhibited higher sCCL2 than double-wild-type phenotype carriers (A-/Ile-). The present findings suggest that sCCL2 production possibly will be associated with the adiposity and polymorphic phenotypes of CCL2 and CCR2, in Mexican-Mestizos with IR.

Differential Item Functioning of the Psychological Domain of the Menopause Rating Scale

PubMed Central

Portela-Buelvas, Katherin; Oviedo, Heidi C.; Herazo, Edwin; Campo-Arias, Adalberto

2016-01-01

Introduction. Quality of life could be quantified with the Menopause Rating Scale (MRS), which evaluates the severity of somatic, psychological, and urogenital symptoms in menopause. However, differential item functioning (DIF) analysis has not been applied previously. Objective. To establish the DIF of the psychological domain of the MRS in Colombian women. Methods. 4,009 women aged between 40 and 59 years, who participated in the CAVIMEC (Calidad de Vida en la Menopausia y Etnias Colombianas) project, were included. Average age was 49.0 ± 5.9 years. Women were classified in mestizo, Afro-Colombian, and indigenous. The results were presented as averages and standard deviation (X ± SD). A p value <0.001 was considered statistically significant. Results. In mestizo women, the highest X ± SD were obtained in physical and mental exhaustion (PME) (0.86 ± 0.93) and the lowest ones in anxiety (0.44 ± 0.79). In Afro-Colombian women, an average score of 0.99 ± 1.07 for PME and 0.63 ± 0.88 for anxiety was gotten. Indigenous women obtained an increased average score for PME (1.33 ± 0.93). The lowest score was evidenced in depressive mood (0.50 ± 0.81), which is different from other Colombian women (p < 0.001). Conclusions. The psychological items of the MRS show differential functioning according to the ethnic group, which may induce systematic error in the measurement of the construct. PMID:27847825

A slow life history is related to a negative attitude towards cousin marriages: a study in three ethnic groups in Mexico.

PubMed

Buunk, Abraham P; Hoben, Ashley D

2013-06-24

Little is known about current attitudes towards cousin marriages. Using data from a rural population in the Mexican state of Oaxaca, the present research examined how life history was related to attitudes towards cousin marriages in various ethnic groups. Participants were 205 parents from three ethnic groups. i.e., Mestizos (people of mixed descent, n = 103), indigenous Mixtecs (n = 65), and Blacks (n = 35). Nearly all men in this study were farm workers or fishermen. Participants reported more negative than positive attitudes towards cousin marriage, and women reported more negative attitudes than did men. The main objection against marrying a cousin was that it is wrong for religious reasons, whereas the risk of genetic defects was considered relatively unimportant. Cousin marriage was not considered to contribute to the quality and unity of marriage and the family. The three ethnic groups did not differ in their attitude towards cousin marriages. However, a slower life history was related to a more negative attitude towards cousin marriages, especially among Blacks, less so among Mixtecs, and not at all among Mestizos. In addition, and independent of the effect of life history, with increasing levels of parental control over mate choice, the attitude towards cousin marriage was more positive, but among men the attitude was more negative the more religious they were. The results are discussed in the context of theorizing on life history theory and the benefits and costs of cousin marriages.

Null geodesics and wave front singularities in the Gödel space-time

NASA Astrophysics Data System (ADS)

Kling, Thomas P.; Roebuck, Kevin; Grotzke, Eric

2018-01-01

We explore wave fronts of null geodesics in the Gödel metric emitted from point sources both at, and away from, the origin. For constant time wave fronts emitted by sources away from the origin, we find cusp ridges as well as blue sky metamorphoses where spatially disconnected portions of the wave front appear, connect to the main wave front, and then later break free and vanish. These blue sky metamorphoses in the constant time wave fronts highlight the non-causal features of the Gödel metric. We introduce a concept of physical distance along the null geodesics, and show that for wave fronts of constant physical distance, the reorganization of the points making up the wave front leads to the removal of cusp ridges.

Functional characterization of a basic helix-loop-helix (bHLH) transcription factor GhDEL65 from cotton (Gossypium hirsutum).

PubMed

Shangguan, Xiao-Xia; Yang, Chang-Qing; Zhang, Xiu-Fang; Wang, Ling-Jian

2016-10-01

Cotton fiber is proposed to share some similarity with the Arabidopsis thaliana leaf trichome, which is regulated by the MYB-bHLH-WD40 transcription complex. Although several MYB transcription factors and WD40 family proteins in cotton have been characterized, little is known about the role of bHLH family proteins in cotton. Here, we report that GhDEL65, a bHLH protein from cotton (Gossypium hirsutum), is a functional homologue of Arabidopsis GLABRA3 (GL3) and ENHANCER OF GLABRA3 (EGL3) in regulating trichome development. Transcripts of GhDEL65 were detected in 0 ∼ 1 days post-anthesis (DPA) ovules and abundant in 3-DPA fibers, implying that GhDEL65 may act in early fiber development. Ectopic expression of GhDEL65 in Arabidopsis gl3 egl3 double mutant partly rescued the trichome development, and constitutive expression of GhDEL65 in wild-type plants led to increased trichome density on rosette leaves and stems, mainly by activating the transcription of two key positive regulators of trichome development, GLABRA1 (GL1) and GLABRA2 (GL2), and suppressed the expression of a R3 single-repeat MYB factor TRIPTYCHON (TRY). GhDEL65 could interact with cotton R2R3 MYB transcription factors GhMYB2 and GhMYB3, as well as the WD40 protein GhTTG3, suggesting that the MYB-bHLH-WD40 protein complex also exists in cotton fiber cell, though its function in cotton fiber development awaits further investigation. © 2016 Scandinavian Plant Physiology Society.

CONTAMINACIÓN AMBIENTAL, VARIABILIDAD CLIMÁTICA Y CAMBIO CLIMÁTICO: UNA REVISIÓN DEL IMPACTO EN LA SALUD DE LA POBLACIÓN PERUANA

PubMed Central

Gonzales, Gustavo F.; Zevallos, Alisson; Gonzales-Castañeda, Cynthia; Nuñez, Denisse; Gastañaga, Carmen; Cabezas, César; Naeher, Luke; Levy, Karen; Steenland, Kyle

2015-01-01

RESUMEN El presente artículo es una revisión sobre la contaminación del agua, el aire y el efecto del cambio climático en la salud de la población peruana. Uno de los principales contaminantes del aire es el material particulado menor de 2,5 μ (PM 2,5), en la ciudad de Lima, anualmente 2300 muertes prematuras son atribuibles a este contaminante. Otro problema es la contaminación del aire domiciliario por el uso de cocinas con combustible de biomasa, donde la exposición excesiva a PM 2,5 dentro de las casas es responsable de aproximadamente 3000 muertes prematuras anuales entre adultos, con otro número desconocido de muertes entre niños debido a infecciones respiratorias. La contaminación del agua tiene como principales causas los desagües vertidos directamente a los ríos, minerales (arsénico) de varias fuentes, y fallas de las plantas de tratamiento. En el Perú, el cambio climático puede impactar en la frecuencia y severidad del fenómeno de El Niño oscilación del sur (ENSO) que se ha asociado con un incremento en los casos de enfermedades como cólera, malaria y dengue. El cambio climático incrementa la temperatura y puede extender las áreas afectadas por enfermedades transmitidas por vectores, además de tener efecto en la disponibilidad del agua y en la contaminación del aire. En conclusión, el Perú, pasa por una transición de factores de riesgo ambientales, donde coexisten riesgos tradicionales y modernos, y persisten los problemas infecciosos y crónicos, algunos de los cuales se asocian con problemas de contaminación de agua y de aire. PMID:25418656

Impacto del Seguro Popular en el gasto catastrófico y de bolsillo en el México rural y urbano, 2005–2008

PubMed Central

Sosa-Rubí, Sandra G; Salinas-Rodríguez, Aarón; Galárraga, Omar

2016-01-01

Objetivo Estimar el efecto del Seguro Popular (SP) sobre la incidencia del gasto catastrófico en salud (GCS) y sobre el gasto de bolsillo en salud (GBS) en el mediano plazo. Material y métodos Con base en la Encuesta de Evaluación del Seguro Popular (2005–2008), se analizaron los resultados del efecto del SP en la cohorte rural para dos años de seguimiento (2006 y 2008) y en la cohorte urbana para un año (2008). Resultados A nivel conglomerado no se detectaron efectos del SP. A nivel hogar se encontró que el SP tiene un efecto protector en el GCS y en el GBS en consulta externa y hospitalización en zonas rurales; y efectos significativos en la reducción de GBS en consulta externa en zonas urbanas. Conclusiones El SP se muestra como un programa efectivo para proteger a los hogares contra gastos de bolsillo por motivos de salud en el mediano plazo. PMID:22282205

Wave maps from Gödel's universe

NASA Astrophysics Data System (ADS)

Barletta, Elisabetta; Dragomir, Sorin; Magliaro, Marco

2014-10-01

Using a result by Koch (1988 Trans. Am. Math. Soc. 307 827-41) we realize Gödel's universe G_{α }^{4}=({{{R}}^{4}},{{g}_{α}}) as the total space of a principal {R}-bundle over a strictly pseudo-convex CR manifold M3 and exploit the analogy between {{g}_{Yalpha;}} and Fefferman's metric {{F}_{θ}} (Fefferman 1976 Ann. Math. 103 395-416 104 393-4) to show that for any {R}-invariant wave map Φ of G_{α}^{4} into a Riemannian manifold N, the corresponding base map φ :{{M}^{3}}\\to N is subelliptic harmonic, with respect to a canonical choice of contact form θ on M3. We show that the subelliptic Jacobi operator J_{b}^{φ} of ϕ has a discrete Dirichlet spectrum on any bounded domain D\\subset {{M}^{3}} supporting the Poincaré inequality on \\mathop{W}\\limits^{\\circ }{}_{H}^{1,2}(D,{{φ}^{-1}}TN) and Kondrakov compactness, i.e. compactness of the embedding \\mathop{W}\\limits^{\\circ }{}_{H}^{1,2}(D,{{φ }^{-1}}TN)\\hookrightarrow {{L}^{2}}(D,{{φ}^{-1}}TN). We exhibit an explicit solution π :G_{α}^{4}\\to {{M}^{3}} to the wave map system on G_{α}^{4}, of index in{{d}^{Ω}}(π)\\geqslant 1 for any bounded domain Ω \\subset G_{α}^{4}. Mounoud's distance (Mounoud 2001 Differ. Geom. Appl. 15 47-57) d_{{{G}_{0}}, Ω }^{∞}({{g}_{α }}, {{F}_{θ}}) is bounded below by a constant depending only on the rotation frequency of Gödel's universe, thus giving a measure of the bias of {{g}_{α}} from being Fefferman like in the region Ω \\subset {{{R}}^{4}}.

Biotic association and palaeoenvironmental reconstruction of the "Loma del Pterodaustro" fossil site (Early Cretaceous, Argentina)

USGS Publications Warehouse

Chiappe, L.; Rivarola, D.; Cione, A.; Fregenal-Martinez, M.; Sozzi, H.; Buatois, L.; Gallego, O.; Laza, J.; Romero, E.; Lopez-Arbarello, A.; Buscalioni, A.; Marsicano, C.; Adamonis, S.; Ortega, F.; McGehee, S.; Di, Iorio O.

1998-01-01

A sedimentological analysis of the basal section of the Early Cretaceous, lacustrine Lagarcito Formation at "Loma del Pterodaustro" (San Luis, Argentina) and a summary of its biological components are presented. Three sedimentological facies can be recognized in the basal sequence of the Lagarcito Formation. Fossil remains are particularly abundant in laminated claystones of a facies interpreted as deposits formed in offshore areas of the lake. The preservation of delicate structures allows recognition of these deposits as a Konservat Lagersta??tte. Up to now, rocks at "Loma del Pterodaustro" have yielded plants, conchostracans, semionotid and pleuropholid fishes, pterodactyloid pterosaurs, and a variety of invertebrate traces. The chronology of the Lagarcito Formation is discussed and it is concluded that this unit is of Albian age. The palaeoenvironment of deposition of the basal sequence of the Lagarcito Formation at "Loma del Pterodaustro" is interpreted as a perennial, shallow lake developed within an alluvial plain, under semiarid climatic conditions.

Integrated global background monitoring network. Preliminary results from Torres del Paine and Olympic National Parks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiersma, G.B.; Kohler, A.; Boelcke, C.

1985-10-01

During 1984, a pilot project was initiated for monitoring pollution at Torres del Paine National Park in southern Chile and Olympic National Park in the United States. These are two of three initial sites that are to be established as part of an integrated global backgound monitoring network. Eventually, the plan is to establish a world-wide system of such sites. We collected and analyzed samples of the soil, water, air, and two species of plants (moss and lichen). We also collected and analyzed samples of the forest litter. We compared the samples of soil and vegetation against reference samples. Wemore » also compared samples of soil, vegetation, and of organic material from Torres del Paine against similar samples from Olympic and Sequoia-Kings Canyon National Parks in the United States. Although the data is preliminary, it is in agreement with out initial hypothesis that Torres del Paine and Olympic National Parks are not a polluted sites.« less

Monitoring Sea Level by Tide Gauges and GPS at Barcelona and Estartit Harbours

NASA Astrophysics Data System (ADS)

Martinez Benjamin, J. J.; Gili, J.; Lopez, R.; Tapia, A.; Bosch, E.; Perez, B.; Pros, F.

2012-04-01

Sea level is an environmental variable which is widely recognised as being important in many scientific disciplines as a control parameter for coastal dynamical processes or climate processes in the coupled atmosphere-ocean systems, as well as engineering applications. A major source of sea-level data are the national networks of coastal tide gauges, in Spain belonging to different institutions as the Instituto Geográfico Nacional (IGN), Puertos del Estado (PE), Instituto Hidrográfico de la Marina (IHM), etc. The tide gauge of l'Estartit is a traditional floating gauge placed 21 years ago and has an accuracy of ± 2 mm. Since 1996, l'Estartit tide gauge has been co-located with geodetic techniques (GPS measurements of XU, Utilitary Network, and XdA, Levelling Network,) and it is tied to the SPGIC (Integrated Geodetic Positioning System of Catalonia) project of the Cartographic Institute of Catalunya (ICC). In 2006, due to the work for the expansion of the harbour, the tide gauge had to be moved. Before the work started, appropiate GPS measurements were carried out in order to ensure the connection of the tide gauge data. During October 2006 and May 2008, the tide gauge was inactive and it has been moved on to a new location inside the harbour. In June 2008, new GPS and levelling measures have been done in order to tie the new location into SPGIC project and to co-locate old data respect the new one. Although l'Estartit does not have a GPS permanent station, it is possible to build a virtual one from the service "CATNET web" of the ICC. "CATNET web" is a data distribution system of a virtual GPS permanent station via web. From the coordinates where you want to place the virtual station, the time interval and the measurement rate, the system generates a RINEX file under the requested conditions. At Barcelona harbour there is one MIROS radar tide gauge belonging to Puertos del Estado (Spanish Harbours). It is placed at the dock 140 of the ENAGAS Building.The radar

Development and validation of an automated delirium risk assessment system (Auto-DelRAS) implemented in the electronic health record system.

PubMed

Moon, Kyoung-Ja; Jin, Yinji; Jin, Taixian; Lee, Sun-Mi

2018-01-01

A key component of the delirium management is prevention and early detection. To develop an automated delirium risk assessment system (Auto-DelRAS) that automatically alerts health care providers of an intensive care unit (ICU) patient's delirium risk based only on data collected in an electronic health record (EHR) system, and to evaluate the clinical validity of this system. Cohort and system development designs were used. Medical and surgical ICUs in two university hospitals in Seoul, Korea. A total of 3284 patients for the development of Auto-DelRAS, 325 for external validation, 694 for validation after clinical applications. The 4211 data items were extracted from the EHR system and delirium was measured using CAM-ICU (Confusion Assessment Method for Intensive Care Unit). The potential predictors were selected and a logistic regression model was established to create a delirium risk scoring algorithm to construct the Auto-DelRAS. The Auto-DelRAS was evaluated at three months and one year after its application to clinical practice to establish the predictive validity of the system. Eleven predictors were finally included in the logistic regression model. The results of the Auto-DelRAS risk assessment were shown as high/moderate/low risk on a Kardex screen. The predictive validity, analyzed after the clinical application of Auto-DelRAS after one year, showed a sensitivity of 0.88, specificity of 0.72, positive predictive value of 0.53, negative predictive value of 0.94, and a Youden index of 0.59. A relatively high level of predictive validity was maintained with the Auto-DelRAS system, even one year after it was applied to clinical practice. Copyright © 2017. Published by Elsevier Ltd.

La utilizacion de los mapas conceptuales en la ensenanza de biologia y su efecto sobre el dominio del proceso de fotosintesis en los estudiantes universitarios

NASA Astrophysics Data System (ADS)

Gonzalez Rivera, Maria M.

Se investigo el efecto de los mapas conceptuales sobre el dominio del proceso de fotosintesis en estudiantes universitarios. La investigacion utilizo dos estrategias: mapas conceptuales individuales y mapas conceptuales colaborativos, con el fin de investigar si existen diferencias significativas en el dominio del proceso de fotosintesis. El analisis de los datos incluyo aspectos cualitativos y cuantitativos. Se desprende del estudio que el 80% de los estudiantes describen la utilizacion de los mapas conceptuales como una experiencia beneficiosa. El 70% de los estudiantes expreso que los mapas conceptuales son utiles en el aprendizaje del proceso de fotosintesis y el 61% indico que facilitan la comprension de los conceptos. Los hallazgos mas importantes del analisis cuantitativo indican que los estudiantes que utilizaron los mapas conceptuales mejoraron significativamente su desempeno en la posprueba global. Se utilizo la prueba Mann-Whitney para investigar si existian diferencias significativas en la posprueba y preprueba global, el valor de W = 1945.0, para un valor p de 0.00, lo cual establece diferencias significativas. Para determinar si existian diferencias significativas entre la posprueba y preprueba del grupo individual, se realizo la prueba nuevamente. El valor de W correspondio a 490.5, que es significativo, con un valor p de 0.00. Se concluye que existen diferencias significativas entre la ejecucion de la posprueba y preprueba del grupo individual. Los datos proveen suficiente evidencia para sostener que los estudiantes que utilizaron la estrategia de mapas conceptuales individuales mejoraron el dominio del proceso de fotosintesis significativamente. Se realizo nuevamente la prueba para los resultados de posprueba y preprueba del grupo colaborativo. El valor de W correspondio a 446 con un valor p de 0.00. Se concluyo que existen diferencias significativas entre la ejecucion de la posprueba y preprueba del grupo colaborativo. Finalmente, se efectuo una

Violación del Principio de Equivalencia en Teorías con Dilatón de Cuerdas

NASA Astrophysics Data System (ADS)

Landau, S. J.; Sisterna, P. D.; Vucetich, H.

Se estudian las violaciones al Principio de Equivalencia en Teorías con Dilatón de Cuerdas. En estos modelos, algunas de las constantes fundamentales dependen del espacio y del tiempo. Se muestra que los experimentos de caída libre no tienen aún precisión como para poner límites a los parámetros de la teoría.

[Barriers and Facilitators in the Recruitment and Retention of Heterosexual Couples for Preventive Interventions.

PubMed

Hernández-Hernández, Alberto L; Perez-Jimenez, David

2010-01-01

El Reclutamiento y la Retención (R&R) de participantes es fundamental para el éxito de estudios y para el desarrollo de intervenciones preventivas. El R&R de participantes determina la validez y efectividad de estos programas. En este trabajo examinamos algunos de los factores que facilitan y dificultan el R&R en los proyectos preventivos y ofrecemos algunas alternativas para mejorar los índices de R&R. Realizamos dos estudios, en el primero administramos el Instrumento de Informatión, Motivatión y Conductas-Español (IIMC-E) a un grupo de 26 parejas heterosexuales (52 participantes). En el segundo, entrevistamos a 5 parejas VIH discordantes (10 participantes). Encontramos que el 75% de los/las participantes indicó que su trabajo era una de las principales barreras que dificultan la asistencia a las actividades. Otras barreras son las responsabilidades laborales y familiares. Encontramos que la principal barrera fue el miedo a la revelación del estado serlógico. Los principales facilitadores del R&R son la coordinación adecuada y el seguimiento telefónico ofrecido por parte del personal del proyecto. Concluimos que en el desarrollo e implantación de programas de prevención el investigador/a debe tomar en cuenta la adaptación de aspectos logísticos como la disponibilidad y las necesidades particulares de los/las participantes.

Barreras y Facilitadores en el Reclutamiento y la Retención de Parejas Heterosexuales en Intervenciones Preventivas en VIH/SIDA

PubMed Central

Hernández-Hernández, Alberto L.; Perez-Jimenez, David

2012-01-01

Compendio El Reclutamiento y la Retención (R&R) de participantes es fundamental para el éxito de estudios y para el desarrollo de intervenciones preventivas. El R&R de participantes determina la validez y efectividad de estos programas. En este trabajo examinamos algunos de los factores que facilitan y dificultan el R&R en los proyectos preventivos y ofrecemos algunas alternativas para mejorar los índices de R&R. Realizamos dos estudios, en el primero administramos el Instrumento de Informatión, Motivatión y Conductas-Español (IIMC-E) a un grupo de 26 parejas heterosexuales (52 participantes). En el segundo, entrevistamos a 5 parejas VIH discordantes (10 participantes). Encontramos que el 75% de los/las participantes indicó que su trabajo era una de las principales barreras que dificultan la asistencia a las actividades. Otras barreras son las responsabilidades laborales y familiares. Encontramos que la principal barrera fue el miedo a la revelación del estado serlógico. Los principales facilitadores del R&R son la coordinación adecuada y el seguimiento telefónico ofrecido por parte del personal del proyecto. Concluimos que en el desarrollo e implantación de programas de prevención el investigador/a debe tomar en cuenta la adaptación de aspectos logísticos como la disponibilidad y las necesidades particulares de los/las participantes. PMID:23264700

Arsenic exposure and risk of preeclampsia in a Mexican mestizo population.

PubMed

Sandoval-Carrillo, Ada; Méndez-Hernández, Edna M; Antuna-Salcido, Elizabeth I; Salas-Pacheco, Sergio M; Vázquez-Alaniz, Fernando; Téllez-Valencia, Alfredo; Aguilar-Durán, Marisela; Barraza-Salas, Marcelo; Castellanos-Juárez, Francisco X; La Llave-León, Osmel; Salas-Pacheco, José M

2016-07-11

Exposure to arsenic in drinking water has been associated with various complications of pregnancy including fetal loss, low birth weight, anemia, gestational diabetes and spontaneous abortion. However, to date, there are no studies evaluating its possible association with preeclampsia. This case-control study involved 104 preeclamptic and 202 healthy pregnant women. The concentrations of arsenic in drinking water and urine were measured using a Microwave Plasma-Atomic Emission Spectrometer. We found relatively low levels of arsenic in household tap water (range of 2.48-76.02 μg/L) and in the urine of the participants (7.1 μg/L vs 6.78 μg/L in cases and controls, respectively). The analysis between groups showed for the first time that at these lower levels of exposure there is no association with preeclampsia.

Esquizofrenia y trastorno en el consumo de sustancias: prevalencia y characterísticas sociodemográficas en la población Latina

PubMed Central

Jiménez-Castro, Lorena; Raventós-Vorst, Henriette; Escamilla, Michael

2012-01-01

El interés por comprender la co-morbilidad de la esquizofrenia y el trastorno en el uso de sustancias, ha aumentado debido al incremento de este diagnóstico, a los efectos negativos observados en el sujeto y a los costos en los servicios de salud. Este trastorno dual puede tener efectos dramáticos en el curso clínico del trastorno psicótico tales como: mayores recaídas, re-hospitalizaciones, síntomas más severos, no adherencia al tratamiento antipsicótico, cambios marcados del humor, aumento en el grado de hostilidad e ideación suicida, así como alteraciones en otras áreas del funcionamiento incluyendo violencia, victimización, indigencia y problemas legales. La literatura proveniente en particular de Estados Unidos y Europa sugiere que el rango de prevalencia para este diagnóstico puede oscilar entre el 10% hasta el 70%. En este estudio, revisamos la prevalencia del diagnóstico dual de esquizofrenia y trastorno en el uso sustancias, así como sus características sociodemográficas, con base en la literatura disponible alrededor del mundo dando énfasis en la poblacion latina. A pesar de que este diagnóstico es ampliamente aceptado, se conoce poco sobre su prevalencia en la población latina, sobre los factores ambientales, demográficos, clínicos y otras características de estos individuos. Un mejor conocimiento sobre este diagnóstico permitiría mejorar los métodos para la detección y adecuada valoración del trastorno en el uso de sustancias en personas con trastornos metales severos como la esquizofrenia. PMID:21404151

History and use of del Nido cardioplegia solution at Boston Children's Hospital.

PubMed

Matte, Gregory S; del Nido, Pedro J

2012-09-01

Cardioplegia is an integral and essential method of myocardial protection for patients of all ages requiring cardiac surgery in which the heart must be stopped. Numerous cardioplegia solutions and delivery methods have been developed. The del Nido cardioplegia solution has been in use for 18 years at Boston Children's Hospital. This is a unique four parts crystalloid to one part whole blood formulation that is generally used in a single-dose fashion. Although the formulation was originally developed for use in pediatric and infant patients, its use for adult cardiac surgery has been expanding. National and international inquiries to our institution regarding this cardioplegia have been increasing over the last 2 years. We present the developmental history, supporting theory, and current protocol for use of what is now referred to as del Nido cardioplegia.

Implementación de un modelo de capacitación multimedial para brindar orientación alimentaria a los beneficiarios de un programa de ayuda social en México.

PubMed

Amaya-Castellanos, Maritza Alejandra; Morales-Ruan, María Del Carmen; Uribe-Carvajal, Rebeca; Jiménez-Aguilar, Alejandra; Salazar-Coronel, Araceli Apolonia; Martínez-Tapia, Brenda; Shamah-Levy, Teresa

2018-03-01

Introducción: Se implementó un modelo de capacitación en orientación alimentaria para la población beneficiaria y el personal operativo del Programa de Abasto Rural (PAR) de Diconsa, el cual es una iniciativa social de ayuda alimentaria que abastece productos básicos y complementarios, además de brindar capacitación en localidades de alta marginación en México. Objetivo: Documentar la utilización de la Metodología de Capacitación Multimedial (MCM) en el desarrollo de un esquema de capacitación sobre orientación alimentaria y su implementación en la población beneficiaria del PAR, a través de la propia estructura operativa del PAR. Metodología: El modelo se fundamenta en la MCM, integrada por cuatro elementos didácticos e indivisibles que conforman el paquete pedagógico multimedial (PPM), compuesto a su vez por tres videos y rotafolios, material impreso, prácticas y las relaciones interpersonales. Los ejes temáticos fueron: alimentación correcta para una vida saludable, alimentación materno-infantil, elecciones saludables y gasto familiar. El modelo fue replicado en cascada en los tres niveles operativos del PAR (responsables de capacitación, supervisores operativos y beneficiarios del PAR), con un componente de multiplicación horizontal, e implementado como piloto en cuatro estados de México. Resultados: Se observó un cambio positivo sobre los conocimientos en alimentación correcta en todos los niveles de capacitación, principalmente en los beneficiarios del PAR. La evaluación del proceso mostró conocimientos previos de los responsables de capacitación en los temas, buen desempeño como facilitadores, y habilidades de presentación y manejo del grupo de los supervisores operativos. A partir de las evaluaciones y del acompañamiento en la prueba piloto, fueron modificados las actividades, las estrategias y los materiales educativos del PPM. Conclusiones: La capacitación multimedial y la educación nutricional promueven procesos de

F508del-CFTR rescue: a matter of cell stress response.

PubMed

Nieddu, Erika; Pollarolo, Benedetta; Merello, Luisa; Schenone, Silvia; Mazzei, Mauro

2013-01-01

Cystic fibrosis (CF) is a common inherited fatal disease affecting 70,000 people worldwide, with a median predicted age of survival of approximately 38 years. The deletion of Phenylalanine in position 508 of the Cystic Fibrosis Transmembrane conductance Regulator (F508del-CFTR) is the most common mutation in CF patients: the deleted protein, not properly folded, is degraded. To date no commercial drugs are available. Low temperature, some osmolytes and conditions able to induce heat shock protein 70 (Hsp70) expression and heat shock cognate 70 (Hsc70) inhibition result in F508del-CFTR rescue, hence restoring its physiological function: this review sheds light on the correlation between these several evidences. Interestingly, all these approaches have a role in the cell stress response (CSR), a set of cell reactions to stress. In addition, unpredictably, F508del-CFTR rescue has to be considered in the frame of CSR: entities that induce - or are induced during - the CSR are, in general, also able to correct trafficking defect of CFTR. Specifically, the low temperature induces, by definition, a CSR; osmolytes, such as glycerol and trimethylamine N-oxide (TMAO), are products of the CSR; pharmacological correctors, such as Matrine and 4-phenylbutirric acid (4PBA), down-regulate the constitutive Hsc70 in favor of an up-regulation of the inducible chaperone Hsp70, another component of the CSR. The identification of a common mechanism of action for different types of correctors could drive the discovery of new active molecules in CF, overcoming methods clinically inapplicable, such as the low temperature.

Impacto metabólico e inflamatorio de una comida rica en grasas saturadas y su relación con la obesidad abdominal.

PubMed

Alayón, Alicia Norma; Rivadeneira, Ana Patricia; Herrera, Carlos; Guzmán, Heidy; Arellano, Dioneris; Echeverri, Isabella

2018-05-01

Introducción. La etapa posprandial se asocia con el incremento de marcadores relacionados con el riesgo cardiovascular, cuya intensidad depende del estado metabólico.Objetivo. Determinar el impacto de la ingestión de una comida rica en grasas saturadas sobre el perfil metabólico e inflamatorio y su relación con la obesidad abdominal.Materiales y métodos. Se hizo un ensayo clínico en 42 individuos (21 con obesidad abdominal). Se midieron, en sangre, la glucosa, la insulina, el perfil lipídico, la proteína C reactiva, los lipopolisacáridos y la interleucina 6, en ayunas y después de la ingestión.Resultados. Además de la obesidad, se registró la presencia de resistencia a la insulina y de niveles elevados de triacilglicéridos y proteína C reactiva en ayunas. Asimismo, se detectaron niveles posprandiales más elevados de glucosa, insulina y triacilglicéridos. La interleucina 6 disminuyó en el grupo de personas sin obesidad y los lipopolisacáridos aumentaron en ambos grupos.Conclusión. La ingestión de una comida rica en grasas saturadas produjo un mayor impacto en las variables glucémicas en el grupo con obesidad y, aunque afectó de forma similar los lípidos en ambos grupos, el incremento de triacilglicéridos fue mayor en presencia de una concentración basal elevada y promovió el aumento de lipopolisacáridos. El estado inflamatorio basal y posprandial afectó en mayor medida al grupo con obesidad. El momento posprandial reflejó el estado más frecuente de los individuos en un día normal y permitió evidenciar la capacidad de respuesta metabólica frente a la ingestión de alimentos, así como los estados tempranos de riesgo metabólico.

A review on Balanites aegyptiaca Del (desert date): phytochemical constituents, traditional uses, and pharmacological activity

PubMed Central

Chothani, Daya L.; Vaghasiya, H. U.

2011-01-01

Balanites aegyptiaca Del. (Zygophyllaceae), known as ‘desert date,’ is spiny shrub or tree up to l0 m tall, widely distributed in dry land areas of Africa and South Asia. It is traditionally used in treatment of various ailments i.e. jaundice, intestinal worm infection, wounds, malaria, syphilis, epilepsy, dysentery, constipation, diarrhea, hemorrhoid, stomach aches, asthma, and fever. It contains protein, lipid, carbohydrate, alkaloid, saponin, flavonoid, and organic acid. Present review summarizes the traditional claims, phytochemistry, and pharmacology of B. aegyptiaca Del reported in scientific literature. PMID:22096319

Meningiomas del foramen magno: Reporte de 12 casos y revisión de la literatura

PubMed Central

Campero, Álvaro; Ajler, Pablo; Roman, Guillermo; Rivadeneira, Conrado

2017-01-01

Resumen Objetivo: El propósito del presente trabajo es presentar los resultados de 12 pacientes con diagnóstico de meningiomas del foramen magno (MFM), de localización anterior o lateral, operados con técnicas microquirúrgicas. Método: Desde Junio de 2005 a Diciembre de 2016, 12 pacientes con diagnóstico de MFM fueron intervenidos quirúrgicamente. Se evaluó: edad, sexo, localización de la lesión (anterior o lateral), sintomatología, tipo de abordaje utilizado y resultados postoperatorios. Resultados: De los pacientes intervenidos, 8 fueron mujeres y 4 varones. La edad promedio fue de 47 años. La localización fue anterior en 8 casos y lateral en 4 casos. La sintomatología más frecuente fue dolor occipito-cervical (8 casos), seguido de tetraparesia (3 casos). En los pacientes con MFM de localización anterior se realizó un abordaje extremo-lateral transcondilar (ELTC), mientras que en los tumores laterales el abordaje fue extremo-lateral retrocondilar (ELRC). En 10 casos la resección fue completa. En dos pacientes fue necesario dejar una pequeña lámina de meningioma sobre la arteria vertebral y a nivel del foramen yugular. Como complicaciones postoperatorias, 3 pacientes presentaron una paresia del XII nervio craneano y 2 pacientes paresia del XI nervio craneano; además, 1 paciente presentó una fístula de LCR. Conclusión: La cirugía de los MFM de localización anterior y lateral puede ser realizada de forma segura y efectiva. Es necesario: a) buen conocimiento anatómico de la región; b) disecar los músculos de la nuca en 2 planos, exponiendo el triángulo suboccipital y la arteria vertebral (AV); 3) realizar un abordaje ELRC en los tumores laterales, y ELTC en los tumores anteriores; y 4) buena técnica microquirúrgica. PMID:29142778

Contribución al flujo infrarrojo de las estrellas Be de la recombinación dielectrónica del MgII

NASA Astrophysics Data System (ADS)

Cruzado, A.; di Rocco, H.; Ringuelet, A.

Para evaluar la contribución del proceso de recombinación dielectrónica del átomo de MgII al exceso de flujo infrarrojo observado en las estrellas Be, calculamos la energía emitida en las líneas originadas por este proceso. Se evaluaron los efectos de las condiciones físicas del medio, como la temperatura electrónica y la densidad electrónica, sobre el flujo emitido. Se consideró también la influencia de una posible opacidad.

Synthetic Spectral Analysis of the Far Ultraviolet Spectra of the Old Nova HR Del

NASA Astrophysics Data System (ADS)

Robertson, Jordan; Sion, E.

2012-05-01

We present a synthetic spectral analysis of the archival IUE far ultraviolet spectra of the post-nova, HR Del (Nova Del 1967). The system has an estimated white dwarf mass of 0.55 Msun (Ritter and Kolb 2003), orbital period P_orb = 0.214165 days, estimated orbital inclination of 40 degrees (Keurster 1988) and distance determinations in the literature ranging from 970 pc to 285 pc. The spectra reveal P Cygni profiles indicative of wind outflow from the disk and closely resemble the IUE spectra of UX UMa nova-likes, which have never had recorded outbursts. We de-reddened the archival IUE spectra using E(B-V) = 0.16. Our synthetic spectral analysis utilized optically thick, steady state accretion disk models and white dwarf model atmospheres that we constructed using TLUSTY and SYNSPEC (Hubeny 1988, Hubeny and Lanz (1995). Our input parameters were the white dwarf mass, inclination and a range of accretion rates for which we found the best-fitting model. We report the results of our model fitting and compare HR Del with other post-novae at comparable times past their nova outburst. This work was supported by NSF grant 0807892 to Villanova University

La meridiana di Egnazio Danti nella Torre dei Venti in Vaticano: un'icona della riforma Gregoriana del calendario

NASA Astrophysics Data System (ADS)

Sigismondi, Costantino

2014-05-01

La Torre dei Venti domina l’angolo Sud Ovest del cortile della Pigna (nell'area dei Musei Vaticani), ed è inclusa negli ambienti dell'Archivio Segreto Vaticano. Non è aperta al pubblico, ma è universalmente nota per la fama che da oltre quattrocento anni la circonda, legata alle vicende della riforma Gregoriana del calendario. La meridiana tracciata da padre Egnazio Danti (1536-1586) nella torre dei Venti, fu visitata anche da Gregorio XIII, probabilmente il 21 marzo 1581 come suppone il padre Stein, per convincersi dell'anticipo ormai arrivato a dieci giorni dell'equinozio di primavera sulla data che il concilio di Nicea aveva fissato al 21 marzo per il computo pasquale. La ricognizione astrometrica del febbraio-marzo 2009 fatta dall'autore viene qui presentata.

Increasing the Endoplasmic Reticulum Pool of the F508del Allele of the Cystic Fibrosis Transmembrane Conductance Regulator Leads to Greater Folding Correction by Small Molecule Therapeutics.

PubMed

Chung, W Joon; Goeckeler-Fried, Jennifer L; Havasi, Viktoria; Chiang, Annette; Rowe, Steven M; Plyler, Zackery E; Hong, Jeong S; Mazur, Marina; Piazza, Gary A; Keeton, Adam B; White, E Lucile; Rasmussen, Lynn; Weissman, Allan M; Denny, R Aldrin; Brodsky, Jeffrey L; Sorscher, Eric J

2016-01-01

Small molecules that correct the folding defects and enhance surface localization of the F508del mutation in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) comprise an important therapeutic strategy for cystic fibrosis lung disease. However, compounds that rescue the F508del mutant protein to wild type (WT) levels have not been identified. In this report, we consider obstacles to obtaining robust and therapeutically relevant levels of F508del CFTR. For example, markedly diminished steady state amounts of F508del CFTR compared to WT CFTR are present in recombinant bronchial epithelial cell lines, even when much higher levels of mutant transcript are present. In human primary airway cells, the paucity of Band B F508del is even more pronounced, although F508del and WT mRNA concentrations are comparable. Therefore, to augment levels of "repairable" F508del CFTR and identify small molecules that then correct this pool, we developed compound library screening protocols based on automated protein detection. First, cell-based imaging measurements were used to semi-quantitatively estimate distribution of F508del CFTR by high content analysis of two-dimensional images. We evaluated ~2,000 known bioactive compounds from the NIH Roadmap Molecular Libraries Small Molecule Repository in a pilot screen and identified agents that increase the F508del protein pool. Second, we analyzed ~10,000 compounds representing diverse chemical scaffolds for effects on total CFTR expression using a multi-plate fluorescence protocol and describe compounds that promote F508del maturation. Together, our findings demonstrate proof of principle that agents identified in this fashion can augment the level of endoplasmic reticulum (ER) resident "Band B" F508del CFTR suitable for pharmacologic correction. As further evidence in support of this strategy, PYR-41-a compound that inhibits the E1 ubiquitin activating enzyme-was shown to synergistically enhance F508del rescue by C18, a small

Cayler cardiofacial syndrome and del 22q11: Part of the CATCH22 phenotype

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giannotti, A.; Digilio, M.C.; Marino, B.

1994-11-15

The authors report evidence supporting the hypothesis that del(22)(q11) can be a pathogenetic mechanism for the association between hypoplasia of the depressor anguli oris muscle (DAOM) and conotruncal cardiac malformations. A series of over 180 patients was investigated with deletions of 22q11 with conotruncal defects. About 2/3 of these patients had isolated, nonfamilial cardiac defects. Hemizygosity was searched using the HD7k probe and densitometric analysis. In the patients with molecular evidence of del(22)(q11), hemizygosity was confirmed also using fluorescence in situ hybridization (FISH) with SC11.1 probe. No deletion was found in the parents of hemizygous patients. 16 refs.

[Tierra del Fuego: the scientific-political construction of exclusion and counter-image of the ideal city dweller].

PubMed

Nacach, Gabriela

2012-01-01

Due to its late incorporation into the national State, the social, economic and political setting of the Argentine province Tierra del Fuego differed from that of the rest of the national territory. In the construction of dependent otherness, objectifications and representations were imposed by state-related and non-state-related institutions, among other agencies. In this context, the Salesian mission of La Candelaria and Ushuaia's Jail for recidivists stand out as spaces in which biopolitics was concretised. The native population and criminals in Tierra del Fuego were those to be subjugated. The thesis of the extinction of the Indian and the simultaneous exaltation of the criminal as the subject of progress identified the scientific and political mechanisms by which the exclusion of certain social groups (Tierra del Fuego's indigenous population) and the inclusion of others (criminals) were regulated.

Geospatial tools for the identification of a malaria corridor in Estado Sucre, a Venezuelan north-eastern state.

PubMed

Delgado-Petrocelli, Laura; Camardiel, Alberto; Aguilar, Víctor Hugo; Martinez, Néstor; Córdova, Karenia; Ramos, Santiago

2011-05-01

Landscape ecology research relies on frameworks based on geographical information systems (GIS), geostatistics and spatial-feature relationships. With regard to health, the approach consists of systems analysis using a set of powerful tools aimed at the reduction of community vulnerability through improved public policies. The north-oriental malaria focus, one of five such foci in Venezuela, situated in the north-eastern part of the Estado Sucre state, unites several social and environmental features and functions as an epidemiological corridor, i.e. an endemic zone characterised by permanent interaction between the mosquito vector and the human host allowing a continuous persistence of the malaria lifecycle. A GIS was developed based on official cartography with thematic overlays depicting malaria distribution, socio-economic conditions, basic environmental information and specific features associated with the natural wetlands present in the area. Generally, malaria foci are continuously active but when the malaria situation was modelled in the north-oriental focus, a differential, spatio-temporal distribution pattern situation was found, i.e. a situation oscillating between very active and dormant transmission. This pattern was displayed by spatial and statistical analysis based on the model generated in this study and the results were confirmed by municipal and county malaria records. Control of malaria, keeping the incidence at a permanently low level within the regional population, should be possible if these results are taken into account when designing and implementing epidemiological surveillance policies.

Atypical E2F transcriptional repressor DEL1 acts at the intersection of plant growth and immunity by controlling the hormone salicylic acid.

PubMed

Chandran, Divya; Rickert, Joshua; Huang, Yingxiang; Steinwand, Michael A; Marr, Sharon K; Wildermuth, Mary C

2014-04-09

In plants, the activation of immunity is often inversely correlated with growth. Mechanisms that control plant growth in the context of pathogen challenge and immunity are unclear. Investigating Arabidopsis infection with the powdery mildew fungus, we find that the Arabidopsis atypical E2F DEL1, a transcriptional repressor known to promote cell proliferation, represses accumulation of the hormone salicylic acid (SA), an established regulator of plant immunity. DEL1-deficient plants are more resistant to pathogens and slightly smaller than wild-type. The resistance and size phenotypes of DEL1-deficient plants are due to the induction of SA and activation of immunity in the absence of pathogen challenge. Moreover, Enhanced Disease Susceptibility 5 (EDS5), a SA transporter required for elevated SA and immunity, is a direct repressed target of DEL1. Together, these findings indicate that DEL1 control of SA levels contributes to regulating the balance between growth and immunity in developing leaves. Copyright © 2014 Elsevier Inc. All rights reserved.

Taos Smart Growth Implementation Assistance: Concepts for the Paseo del Pueblo Sur Corridor

EPA Pesticide Factsheets

This report describes a technical assistance project with Taos, NM, to help make development along State Highway 68, the Paseo del Pueblo Sur commercial corridor, economically stronger and more attractive.

Analysis of density and epitopes of D antigen on the surface of erythrocytes from DEL phenotypic individuals carrying the RHD1227A allele.

PubMed

Gu, Juan; Sun, An-Yuan; Wang, Xue-Dong; Shao, Chao-Peng; Li, Zheng; Huang, Li-Hua; Pan, Zhao-Lin; Wang, Qing-Ping; Sun, Guang-Ming

2014-04-01

The characteristics of the D antigen are important as they influence the immunogenicity of D variant cells. Several studies on antigenic sites have been reported in normal D positive, weak D and partial D cases, including a comprehensive analysis of DEL types in Caucasians. The aim of this study was to assess D antigen density and epitopes on the erythrocyte surface of Asian type DEL phenotypic individuals carrying the RHD1227A allele in the Chinese population. A total of 154 DEL phenotypic individuals carrying the RHD1227A allele were identified through adsorption and elution tests and polymerase chain reaction analysis with sequence-specific primers in the Chinese population. D antigen density on the erythrocyte surface of these individuals was detected using a flow cytometric method. An erythrocyte sample with known D antigen density was used as a standard. Blood samples from D-negative and D-positive individuals were used as controls. In addition, D antigen epitopes on the erythrocyte surface of DEL individuals carrying the RHD1227A allele were investigated with 18 monoclonal anti-D antibodies specific for different D antigen epitopes. The means of the median fluorescence intensity of D antigen on the erythrocyte membrane surface of D-negative, D-positive and DEL individuals were 2.14±0.25, 193.61±11.43 and 2.45±0.82, respectively. The DEL samples were estimated to have approximately 22 D antigens per cell. The samples from all 154 DEL individuals reacted positively with 18 monoclonal anti-D antibodies specific for different D antigen epitopes. In this study, D antigen density on the erythrocyte surface of DEL individuals carrying the RHD1227A allele was extremely low, there being only very few antigenic molecules per cell, but the D antigen epitopes were grossly complete.

Tratamiento Quirúrgico de los Meningiomas del Foramen Óptico, Técnicay Resultados de una Serie de 18 Pacientes

PubMed Central

Goldschmidt, Ezequiel; Ajler, Pablo; Campero, Álvaro; Landriel, Federico; Sposito, Maximiliano; Carrizo, Antonio

2014-01-01

Introducción: los meningiomas del foramen óptico producen un rápido deterioro de la función visual aún cuando su tamaño es pequeño, por eso su diagnóstico y manejo difiere del resto de los meningiomas clinoideos. El propósito de este estudio es presentar la técnica y los resultados de nuestro manejo quirúrgico de meningiomas foraminales (MF). Pacientes y Métodos: se llevó a cabo una revisión de las historias clínicas de 47 pacientes con meningiomas primarios intraorbitarios. Se realizaron 52 cirugías en los pacientes con MF. Se empleó una craneotomía fronto-orbitaria, seguida de una descompresión extradural del canal óptico, resección del componente intraorbitario y exploración intradural del nervio óptico. Resultados: de los 12 pacientes con MF que presentaban la visión conservada, la agudeza visual fue preservada en 7 casos, mejoró en 2, y empeoró en 3. En 18 pacientes, el principal síntoma fue exoftalmos y en 35 pacientes ceguera unilateral. Ocurrieron 6 recurrencias, 2 a 10 años después de la resección quirúrgica. Cinco de ellos fueron reoperados. Se indicó radioterapia después de la recurrencia en 3 pacientes. Conclusión: el manejo de los MF continúa siendo controvertido y frecuentemente se propone un tratamiento conservador. Basados en nuestros hallazgos de frecuente extensión intracraneal, proponemos realizar una resección total o subtotal del tumor, preservando el nervio óptico en pacientes con visión prequirúrgica conservada. PMID:25165616

Heat flow and thermal processes in the Jornada delMuerto, New Mexico

NASA Technical Reports Server (NTRS)

Reiter, M.

1985-01-01

Most heat flow data in rifts are uncertain largely because of hydrologic disturbances in regions of extensive fracturing. Estimates of heat flow in deep petroleum tests within a large basin of the Rio Grande rift, which has suffered little syn-rift fracturing, may begin to provide clearer insight into the relationships between high heat flow and crustal thinning processes. The Jornada del Muerto is a large basin located in the Rio Grande rift of south central New Mexico. The region of interest within the Jornada del Muerto is centered about 30 km east of the town of Truth or Consequences, and is approximately 60 km north-south by 30 km east-west. High heat flows are estimated for the region. Values increase from about 90 mWm(-2) in the northern part of the study area to about 125 mWm(-2) in the southern part. These high heat flows are rather enigmatic because in the immediate vicinities of the sites there is little evidence of Cenozoic volcanism or syn-rift extensional tectonics. It is suggested that the geothermal anomaly in the southern Jornada del Muerto (approx. 125 to approx. 95 mWm(-2) results from some type of mass movement-heat transfer mechanism operating in the crust just below the elastic layer. This conclusion is consistent with the geologic and geophysical data which describe a thin crust, apparently devoid of features indicative of extensional-tectonics in the upper part of the lastic crust.

Current status and future trends of medical physics in Mexico

NASA Astrophysics Data System (ADS)

Azorin Nieto, J.

2015-01-01

Medical Physics is an area that applies the principles of physics to medicine, particularly in the prevention, diagnosis and treatment of diseases using ionizing and nonionizing radiation. The main attractive of medical physics is that it has a direct impact on the quality and safety of medical care in humans; this social component with direct implications for the population is of high value for Mexico. This paper describes the concepts of medical physics, trends and the current status of this discipline as a profession, which is directly related to the efforts of clinical research. It is also described what is, in my opinion, the future of medical physics in Mexico, emphasizing the fact that this field requires a substantial boost from universities and hospitals to recruit highly qualified young medical physicists and the support from government agencies such as Secretaria de Salud, Instituto Mexicano del Seguro Social and Instituto de Seguridad y Servicios Sociales para los Trabajadores del Estado through clinical research projects that allow the necessary evolution of medical physics into the hospital setting.

Cambios históricos en el aporte terrígeno de la cuenca del Río de la Plata sobre la plataforma interna Uruguaya

NASA Astrophysics Data System (ADS)

Marrero, Analía; Tudurí, Adriana; Pérez, Laura; Cuña, Caroline; Muniz, Pablo; Lopes Figueira, Rubens; Michaelovitch de Mahiques, Michel; Alves de Lima Ferreira, Paulo; Pittauerová, Daniela; Hanebuth, Till; García Rodríguez, Felipe

2014-12-01

El Río de la Plata (RdlP) presenta significativas variaciones naturales (hidrodinámicas y oceanográficas) asociadas a diferentes condiciones climáticas. El propósito de este trabajo es inferir los cambios de aportes continentales de sedimentos y su relación con las variaciones hidrológicas del Río de la Plata, a través del análisis de proxies sedimentológicos y geoquímicos en testigos de sedimentos de la plataforma interna uruguaya que registran los últimos 100 años, aproximadamente. A partir de la datación por 210Pb de dos testigos de sedimentos (GeoB 13813-4 y BAR1) se reconstruyó la geocronología del ambiente, y se relacionó con datos de las forzantes climáticas Pacific Decadal Oscillation, El Niño/La Niña Southern Oscillation, Atlantic Multidecadal Oscillation, y las anomalías hidrológicas de los ríos Paraná y Uruguay. Los valores más positivos y estables del Southern Oscillation Index, los cuales corresponden a fases La Niña, se observan en el periodo correspondiente entre 1910-1970, respecto al resto de la serie, donde se aprecia una mayor variabilidad y una tendencia hacia valores más negativos (eventos El Niño). Se hicieron dendrogramas (clustering) jerárquicos para ambos testigos. Para el testigo GeoB 13813-4, se utilizó la relación Ca/Ti y la granulometría, mientras que para BAR1 se recurrió a variables granulométricas y la tasa de sedimentación. El mayor aporte continental hacia la región de la plataforma adyacente al Río de la Plata registrado a partir del año 1970, podría ser el factor principal de los agrupamientos observados en los clusters para ambos testigos. Las agrupaciones mostraron una diferenciación en la década de 1970, lo que estaría asociado al aumento de los caudales de los ríos Paraná y Uruguay, durante las últimas tres décadas del siglo XX. Por otra parte se observa que la granulometría del testigo BAR1 presentó un mayor tamaño de grano y más variabilidad que en el caso del testigo Geo

Prevalence of 185delAG and 5382insC mutations in BRCA1, and 6174delT in BRCA2 in women of Ashkenazi Jewish origin in southern Brazil

PubMed Central

Dillenburg, Crisle Vignol; Bandeira, Isabel Cristina; Tubino, Taiana Valente; Rossato, Luciana Grazziotin; Dias, Eleonora Souza; Bittelbrunn, Ana Cristina; Leistner-Segal, Sandra

2012-01-01

Certain mutations in BRCA1 and BRCA2 genes are frequent in the Ashkenazi Jewish population. Several factors contribute to this increased frequency, including consanguineous marriages and an event known as a “bottleneck”, which occurred in the past and caused a drastic reduction in the genetic variability of this population. Several studies were performed over the years in an attempt to elucidate the role of BRCA1 and BRCA2 genes in susceptibility to breast cancer. The aim of this study was to estimate the carrier frequency of certain common mutations in the BRCA1 (185delAG and 5382insC) and BRCA2 (6174delT) genes in an Ashkenazi Jewish population from Porto Alegre, Brazil. Molecular analyses were done by PCR followed by RFLP (ACRS). The carrier frequencies for BRCA1 185delAG and 5382insC were 0.78 and 0 respectively, and 0.4 for the BRCA2 6174deT mutation. These findings are similar to those of some prior studies but differ from others, possibly due to excluding individuals with a personal or family history of cancer. Our sample was drawn from the community group and included individuals with or without a family or personal history of cancer. Furthermore, increased dispersion among Ashkenazi subpopulations may be the result of strong genetic drift and/or admixture. It is therefore necessary to consider the effects of local admixture on the mismatch distributions of various Jewish populations. PMID:23055798

Prevalence of 185delAG and 5382insC mutations in BRCA1, and 6174delT in BRCA2 in women of Ashkenazi Jewish origin in southern Brazil.

PubMed

Dillenburg, Crisle Vignol; Bandeira, Isabel Cristina; Tubino, Taiana Valente; Rossato, Luciana Grazziotin; Dias, Eleonora Souza; Bittelbrunn, Ana Cristina; Leistner-Segal, Sandra

2012-07-01

Certain mutations in BRCA1 and BRCA2 genes are frequent in the Ashkenazi Jewish population. Several factors contribute to this increased frequency, including consanguineous marriages and an event known as a "bottleneck", which occurred in the past and caused a drastic reduction in the genetic variability of this population. Several studies were performed over the years in an attempt to elucidate the role of BRCA1 and BRCA2 genes in susceptibility to breast cancer. The aim of this study was to estimate the carrier frequency of certain common mutations in the BRCA1 (185delAG and 5382insC) and BRCA2 (6174delT) genes in an Ashkenazi Jewish population from Porto Alegre, Brazil. Molecular analyses were done by PCR followed by RFLP (ACRS). The carrier frequencies for BRCA1 185delAG and 5382insC were 0.78 and 0 respectively, and 0.4 for the BRCA2 6174deT mutation. These findings are similar to those of some prior studies but differ from others, possibly due to excluding individuals with a personal or family history of cancer. Our sample was drawn from the community group and included individuals with or without a family or personal history of cancer. Furthermore, increased dispersion among Ashkenazi subpopulations may be the result of strong genetic drift and/or admixture. It is therefore necessary to consider the effects of local admixture on the mismatch distributions of various Jewish populations.

High precision ages from the Torres del Paine Intrusion, Chile

NASA Astrophysics Data System (ADS)

Michel, J.; Baumgartner, L.; Cosca, M.; Ovtcharova, M.; Putlitz, B.; Schaltegger, U.

2006-12-01

The upper crustal bimodal Torres del Paine Intrusion, southern Chile, consists of the lower Paine-Mafic- Complex and the upper Paine-Granite. Geochronologically this bimodal complex is not well studied except for a few existing data from Halpern (1973) and Sanchez (2006). The aim of this study is to supplement the existing data and to constrain the age relations between the major magmatic pulses by applying high precision U-Pb dating on accessory zircons and 40Ar/39Ar-laser-step-heating-ages on biotites from the Torres del Paine Intrusion. The magmatic rocks from mafic complex are fine to medium-grained and vary in composition from quartz- monzonites to granodiorites and gabbros. Coarse-grained olivine gabbros have intruded these rocks in the west. The granitic body is represented by a peraluminous, biotite-orthoclase-granite and a more evolved leucocratic granite in the outer parts towards the host-rock. Field observations suggest a feeder-zone for the granite in the west and that the granite postdates the mafic complex. Two granite samples of the outermost margins in the Northeast and South were analyzed. The zircons were dated by precise isotope-dilution U-Pb techniques of chemically abraded single grains. The data are concordant within the analytical error and define weighted mean 206/238U ages of 12.59 ± 0.03 Ma and 12.58 ± 0.01 Ma for the two samples respectively. A 40Ar/39Ar-age for the second sample yield a date of 12.37 ± 0.11 Ma. Three 40Ar/39Ar -ages of biotites were obtained for rocks belonging to the mafic complex. A hbl-bio- granodiorite from the central part, approximately 150 m below the subhorizontal contact with the granite, gives an age of 12.81 ± 0.11 Ma. A hbl-bio-granodiorite and an olivine-gabbro west of the feeder-zone date at 12.42 ± 0.14 Ma and 12.49 ± 0.11 Ma, respectively. The obtained older age of 12.81 Ma for the granodiorite in the central part is consistent with structural relationships of brittle fracturing of the mafic

New Argentine Central-West line taps rich Neuquen gas field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watts, J.

1982-02-01

Argentina's new Central-West gas pipeline consists of 697 miles of 30-in. line and 451 miles of smaller gathering and distribution lines that link the rich Neuquen gas field with cities to the north. A financing package drawn up by 21 banks in the US and Europe allowed Cogasco S.A. to build the line for Gas del Estado across the roadless pampas east of the Andes. Primarily an agricultural country, Argentina had to import all the equipment and materials for the project. Site work began in July, 1980 with 800 workers employed on three spreads; the line was commissioned in November,more » 1981, 15 months ahead of the contract schedule.« less

"Chiriguano" Astronomy - Venus and a Guarani New Year

NASA Astrophysics Data System (ADS)

Pereira, Gonzalo

A Supreme Decree emitted by the government of Bolivia instituted the celebration of the June solstices in view of the fact that the indigenous people, both the Andean highlands and the Amazon and Chaco, "have commemorated this event for thousands of years" (Gobierno del Estado Plurinacional de Bolivia, Decreto Supremo N° 0173, June16, 2009, La Paz). In the case of the lowlands' indigenous, particularly the Guarani people, the decree mentions the planet Venus as the argument for this celebration. In this case of study and in light of astronomical and ethnographic evidence, we analyze the relevance of this decree in the case of the Guarani people of the Bolivian Chaco region, known as "Chiriguanos".

Conceptos Basicos Sobre el Gas Natural (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

El gas natural abastece cerca de 150.000 vehiculos en los Estados Unidos y aproximadamente 22 millones de vehiculos en todo el mundo. Los vehiculos de gas natural (NGV, por sus siglas en ingles) son una buena opcion para las flotas de vehiculos de alto kilometraje, tales como autobuses, taxis, vehiculos de recoleccion de basura, los cuales son alimentados centralmente u operan dentro de un area limitada o a lo largo de una ruta con estaciones de servicio de gas natural. Las ventajas del gas natural como combustible alternativo incluyen su disponibilidad interna, la red de distribucion establecida, un costo relativamentemore » bajo, y los beneficios de las emisiones.« less

Argentina's YPF hones in on privatization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This paper reports on Argentina's push to privatize and attract more foreign investment to its petroleum sector which continues to gather momentum. The Argentine government plans by year end 1992 to sell unprofitable assets of Yacimientos Petroliferos Fiscales, then sell as much as 50% of the state oil company through an international stock offering. If privatization proceeds as expected, YPF Pres. Jose Estenssoro the, the company's stock will be offered to private investors early in 1993. The company was founded in 1922. By March 1992, Argentina also will begin selling all assets of state owned Gas del Estado (GDE) throughmore » an international bidding process expected to take about 18 months.« less

Variation in mangrove forest structure and sediment characteristics in Bocas del Toro, Panama

USGS Publications Warehouse

Lovelock, C.E.; Feller, Ilka C.; McKee, K.L.; Thompson, R.

2005-01-01

Mangrove forest structure and sediment characteristics were examined in the extensive mangroves of Bocas del Toro, Republic of Panama. Forest structure was characterized to determine if spatial vegetation patterns were repeated over the Bocas del Toro landscape. Using a series of permanent plots and transects we found that the forests of Bocas del Toro were dominated by Rhizophora mangle with very few individuals of Avicennia germinans and Laguncularia racemosa. Despite this low species diversity, there was large variation in forest structure and in edaphic conditions (salinity, concentration of available phosphorus, Eh and sulphide concentration). Aboveground biomass varied 20-fold, from 6.8 Mg ha-1 in dwarf forests to 194.3 Mg ha-1 in the forests fringing the land. But variation in forest structure was predictable across the intertidal zone. There was a strong tree height gradient from seaward fringe (mean tree height 3.9 m), decreasing in stature in the interior dwarf forests (mean tree height 0.7 m), and increasing in stature in forests adjacent to the terrestrial forest (mean tree height 4.1 m). The predictable variation in forest structure emerges due to the complex interactions among edaphic and plant factors. Identifying predictable patterns in forest structure will aid in scaling up the ecosystem services provided by mangrove forests in coastal landscapes. Copyright 2005 College of Arts and Sciences.

CHEK2*1100delC homozygosity is associated with a high breast cancer risk in women.

PubMed

Adank, Muriel A; Jonker, Marianne A; Kluijt, Irma; van Mil, Saskia E; Oldenburg, Rogier A; Mooi, Wolter J; Hogervorst, Frans B L; van den Ouweland, Ans M W; Gille, Johan J P; Schmidt, Marjanka K; van der Vaart, Aad W; Meijers-Heijboer, Hanne; Waisfisz, Quinten

2011-12-01

Mutations in the CHEK2 gene confer a moderately increased breast cancer risk. The risk for female carriers of the CHEK2*1100delC mutation is twofold increased. Breast cancer risk for carrier women is higher in a familial breast cancer setting which is due to coinheritance of additional genetic risk factors. This study investigated the occurrence of homozygosity for the CHEK2*1100delC allele among familial breast cancer cases and the associated breast cancer risk. Homozygosity for the CHEK2*1100delC allele was identified in 8/2554 Dutch independent familial non-BRCA1/2 breast cancer cases. The genotype relative risk for breast cancer of homozygous and heterozygous familial breast cancer cases was 101.34 (95% CI 4.47 to 121 000) and 4.04 (95% CI 0.88 to 21.0), respectively. Female homozygotes appeared to have a greater than twofold increased breast cancer risk compared to familial CHEK2*1100delC heterozygotes (p=0.044). These results and the occurrence of multiple primary tumours in 7/10 homozygotes indicate a high cancer risk in homozygous women from non-BRCA1/2 families. Intensive breast surveillance is therefore justified in these homozygous women. It is concluded that diagnostic testing for biallelic mutations in CHEK2 is indicated in non-BRCA1/2 breast cancer families, especially in populations with a relatively high prevalence of deleterious mutations in CHEK2.

Optimal time travel in the Gödel universe

NASA Astrophysics Data System (ADS)

Natário, José

2012-04-01

Using the theory of optimal rocket trajectories in general relativity, recently developed in Henriques and Natário (2011), we present a candidate for the minimum total integrated acceleration closed timelike curve in the Gödel universe, and give evidence for its minimality. The total integrated acceleration of this curve is lower than Malament's conjectured value (Malament 1984), as was already implicit in the work of Manchak (Gen. Relativ. Gravit. 51-60, 2011); however, Malament's conjecture does seem to hold for periodic closed timelike curves.

78 FR 74008 - Amendment of Class E Airspace; Del Rio, TX

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-10

... Laughlin Air Force Base (AFB). The FAA is taking this action to enhance the safety and management of... at Laughlin AFB, Del Rio, TX. An additional segment to the north is needed to contain approach category E military aircraft conducting circling approaches to the airport, to retain the safety and...

From badge of pride to cause of stigma: combatting mal del pinto in Mexico.

PubMed

Carrillo, Ana María

2013-03-01

Mal del pinto is a dermatological disease characterized by discoloured patches of skin on the face and body. It has been present in what is now the territory of Mexico from before the Spanish conquest up to recent times. Though early concerns for mal del pinto as a public health problem can be traced back to the late 19th century, no campaign to combat the disease was undertaken until the second half of the 20th. Thanks to the effectiveness of treatment with penicillin, the fight against this illness--which was once assumed as a symbol of pride--enjoyed a broader acceptance among the population that other health campaigns. Copyright © 2013 Elsevier Ltd. All rights reserved.

Analysis of the El Niño/La Niña-Southern Oscillation variability and malaria in the Estado Sucre, Venezuela.

PubMed

Delgado-Petrocelli, Laura; Córdova, Karenia; Camardiel, Alberto; Aguilar, Víctor H; Hernández, Denise; Ramos, Santiago

2012-09-01

The last decade has seen an unprecedented, worldwide acceleration of environmental and climate changes. These processes impact the dynamics of natural systems, which include components associated with human communities such as vector-borne diseases. The dynamics of environmental and climate variables, altered by global change as reported by the Intergovernmental Panel on Climate Change, affect the distribution of many tropical diseases. Complex systems, e.g. the El Niño/La Niña-Southern Oscillation (ENSO), in which environmental variables operate synergistically, can provoke the reemergence and emergence of vector-borne diseases at new sites. This research investigated the influence of ENSO events on malaria incidence by determining the relationship between climate variations, expressed as warm, cold and neutral phases, and their relation to the number of malaria cases in some north-eastern municipalities of Venezuela (Estado Sucre) during the period 1990-2000. Significant differences in malaria incidence were found, particularly in the La Niña ENSO phases (cold) of moderate intensity. These findings should be taken into account for surveillance and control in the future as they shed light on important indicators that can lead to reduced vulnerability to malaria.

Descripción del coronógrafo a ser instalado en Argentina (MICA)

NASA Astrophysics Data System (ADS)

Stenborg, G.; Francile, C.; Schwenn, R.; Epple, A.; Rovira, M.

El ``Coronógrafo de espejo para Argentina'' es un telescopio solar terrestre a ser colocado en el Observatorio Astronómico Félix Aguilar (El Leoncito), antes de finalizar 1996, como parte de un programa de ciencia bilateral entre Alemania y Argentina. Eclipses fotográficos de alta resolución han revelado que la corona solar es altamente estructurada y variable. De hecho, está contínuamente deformada y moldeada por los movimientos convectivos de los extremos de los arcos magnéticos en la fotosfera, estando, en muchas oportunidades, afectada por explosivas liberaciones de energía. MICA, en conjunción con otros telescopios solares espaciales y terrestres, tratará de contribuir al entendimiento de cuestiones fundamentales de la física solar. Entre ellas: cómo la corona está siendo calentada, dónde y cómo el viento solar es acelerado, qué causa los transitorios coronales, etc. Para ello investigará la distribución de los parámetros del plasma y su evolución con el tiempo, la estructura espacial de la corona en fina y gran escala, procesos que ocurren en los transitorios coronales y factores que los disparan, etc. Para responder a estas cuestiones MICA observará la atmósfera solar por sobre el limbo entre 1.1 y 2 radios solares aproximadamente, usando un nuevo tipo de sistema coronográfico que permite suprimir el brillo del disco solar suficientemente bien, tomando las imágenes con una cámara CCD de 1024x1024 pixels, codificada en 12 bits, pudiendo el mismo ser operado en forma remota. En la presente exposición describiremos las características del instrumento, cómo será controlado y qué esperamos observar basados en las imágenes obtenidas por los telescopios de similares características LASCO C1 a bordo del SOHO y PICO (ubicado en el Observatorio de Pic du Midi, Francia).

77 FR 4897 - Safety Zone; M/V Del Monte Live-Fire Gun Exercise, James River, Isle of Wight, VA

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-01

...-AA00 Safety Zone; M/V Del Monte Live-Fire Gun Exercise, James River, Isle of Wight, VA AGENCY: Coast... provide for the safety of life on navigable waters during the live-fire gun exercises on the M/V Del Monte... associated with the live-fire gun exercise. DATES: This rule is effective in the CFR on February 1, 2012...

76 FR 31848 - Safety Zone; M/V Del Monte Live-Fire Gun Exercise, James River, Isle of Wight, Virginia

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-02

...-AA00 Safety Zone; M/V Del Monte Live-Fire Gun Exercise, James River, Isle of Wight, Virginia AGENCY... provide for the safety of life on navigable waters during the live-fire gun exercises on the M/V Del Monte... associated with the live-fire gun exercise. DATES: This rule will be effective from 11 a.m. June 6, 2011...

The CFTR trafficking mutation F508del inhibits the constitutive activity of SLC26A9.

PubMed

Bertrand, Carol A; Mitra, Shalini; Mishra, Sanjay K; Wang, Xiaohui; Zhao, Yu; Pilewski, Joseph M; Madden, Dean R; Frizzell, Raymond A

2017-06-01

Several members of the SLC26A family of anion transporters associate with CFTR, forming complexes in which CFTR and SLC26A functions are reciprocally regulated. These associations are thought to be facilitated by PDZ scaffolding interactions. CFTR has been shown to be positively regulated by NHERF-1, and negatively regulated by CAL in airway epithelia. However, it is unclear which PDZ-domain protein(s) interact with SLC26A9, a SLC26A family member found in airway epithelia. We have previously shown that primary, human bronchial epithelia (HBE) from non-CF donors exhibit constitutive anion secretion attributable to SLC26A9. However, constitutive anion secretion is absent in HBE from CF donors. We examined whether changes in SLC26A9 constitutive activity could be attributed to a loss of CFTR trafficking, and what role PDZ interactions played. HEK293 coexpressing SLC26A9 with the trafficking mutant F508del CFTR exhibited a significant reduction in constitutive current compared with cells coexpressing SLC26A9 and wt CFTR. We found that SLC26A9 exhibits complex glycosylation when coexpressed with F508del CFTR, but its expression at the plasma membrane is decreased. SLC26A9 interacted with both NHERF-1 and CAL, and its interaction with both significantly increased with coexpression of wt CFTR. However, coexpression with F508del CFTR only increased SLC26A9's interaction with CAL. Mutation of SLC26A9's PDZ motif decreased this association with CAL, and restored its constitutive activity. Correcting aberrant F508del CFTR trafficking in CF HBE with corrector VX-809 also restored SLC26A9 activity. We conclude that when SLC26A9 is coexpressed with F508del CFTR, its trafficking defect leads to a PDZ motif-sensitive intracellular retention of SLC26A9. Copyright © 2017 the American Physiological Society.

High-resolution HLA allele and haplotype frequencies in majority and minority populations of Costa Rica and Nicaragua: Differential admixture proportions in neighboring countries.

PubMed

Arrieta-Bolaños, E; Madrigal-Sánchez, J J; Stein, J E; Órlich-Pérez, P; Moreira-Espinoza, M J; Paredes-Carias, E; Vanegas-Padilla, Y; Salazar-Sánchez, L; Madrigal, J A; Marsh, S G E; Shaw, B E

2018-06-01

The HLA system shows the most extensive polymorphism in the human genome. Allelic and haplotypic frequencies of HLA genes vary dramatically across human populations. Due to a complex history of migration, populations in Latin America show a broad variety of admixture proportions, usually varying not only between countries, but also within countries. Knowledge of HLA allele and haplotype frequencies is essential for medical fields such as transplantation, but also serves as a means to assess genetic diversity and ancestry in human populations. Here, we have determined high-resolution HLA-A, -B, -C, and -DRB1 allele and haplotype frequencies in a sample of 713 healthy subjects from three Mestizo populations, one population of African descent, and Amerindians of five different groups from Costa Rica and Nicaragua and compared their profiles to a large set of indigenous populations from Iberia, Sub-Saharan Africa, and the Americas. Our results show a great degree of allelic and haplotypic diversity within and across these populations, with most extended haplotypes being private. Mestizo populations show alleles and haplotypes of putative European, Amerindian, and Sub-Saharan African origin, albeit with differential proportions. Despite some degree of gene flow, Amerindians and Afro-descendants show great similarity to other Amerindian and West African populations, respectively. This is the first comprehensive study reporting high-resolution HLA diversity in Central America, and its results will shed light into the genetic history of this region while also supporting the development of medical programs for organ and stem cell transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

PubMed Central

Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

2017-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

MÉXICO Y ESTADO DE GUANAJUATO: TRANSFERENCIAS INTERGENERACIONALES HACIA LOS ADULTOS MAYORES*

PubMed Central

Montes de Oca, Verónica; Hebrero, Mirna

2017-01-01

RESUMEN En México, las transferencias formales e informales destinadas al apoyo de las personas adultas mayores son diversificadas. En este documento se analizan la tendencia nacional y los resultados de un estudio centrado en la entidad federativa de Guanajuato. La distribución de los apoyos confirma que las transferencias hechas por el sistema de seguridad social tienen un sesgo urbano y que las transferencias formales del gobierno federal se orientan a las áreas menos urbanizadas, particularmente las zonas rurales. A pesar de las transferencias formales (esporádicas e insuficientes), las necesidades económicas y de salud de las personas mayores persisten y ello lleva a que sus familiares realicen transferencias informales de naturaleza ascendente. En México —y más concretamente en Guanajuato— el apoyo de quienes residen con la persona mayor tiene un significativo peso, y lo contrario sucede con el de quienes han migrado. A partir de este material, se analiza el rol que, de acuerdo a su cohorte y su condición migratoria, desempeñan los descendientes. En todo caso, queda de manifiesto que, en cada entidad nacional, las dinámicas de transferencias intergeneracionales son de diversos tipos. PMID:29375179

Evaluation of HLA-G 14-bp ins/del and +3142G>C polymorphisms with susceptibility to recurrent spontaneous abortion.

PubMed

Hashemi, Mohammad; Mokhtari, Mojgan; Khazaeian, Safura; Bahari, Gholamreza; Rezaei, Maryam; Nakhaee, Alireza; Taheri, Mohsen

2017-06-01

HLA-G is critically important for successful implantation during pregnancy. Increasing evidence supposed that HLA-G plays a key role in tolerance of the semi-allogeneic graft in pregnancy by inhibiting the cytotoxic functions of T and NK cells. The present study aimed to evaluate the impact of HLA-G rs1063320 (+3142G>C) and 14-bp insertion (ins)/deletion (del) polymorphisms on recurrent spontaneous abortion (RSA). Genomic DNA from 93 RSA patients and 93 normal fertile women was isolated using the salting out method. Genotyping of HLA-G +3142G>C and 14-bp ins/del variants was done by polymerase chain reaction restriction fragment length polymorphism (PCR-RFP) and PCR method, respectively. The HLA-G +3142G>C polymorphism increased the risk of RSA in codominant (OR = 2.39, 95%CI = 1.27-4.49, p = 0.010, GC vs GG; OR = 3.28, 95%CI = 1.16-9.72, p = 0.040, CC vs GG) and dominant (OR = 2.52, 95%CI = 1.37-4.64, p = 0.004, GC + CC vs GG) tested inheritance models. HLA-G rs1063320 C allele was associated with increased risk of RSA (OR = 1.84, 95%CI = 1.20-2.83, p = 0.007). The del/del genotype as well as del allele of 14-bp ins/del variant increased that risk of RSA (OR = 3.02, 95%CI = 1.23-7.41, p = 0.025 and OR = 1.65, 95%CI = 1.09-2.50, p = 0.022, respectively). In summary, our results showed that HLA-G gene polymorphisms significantly increased the risk of RSA in a sample of the Iranian population. Copyright © 2017. Published by Elsevier B.V.

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

PubMed

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

Experience the magic of light and color: outreach activity by Universidad del Valle student chapter

NASA Astrophysics Data System (ADS)

Valdes, Claudia; Reyes, Camilo; Osorio, Alberto; Solarte, Efrain

2010-08-01

During 2007, the Universidad del Valle Student Chapter presented a proposal for developing an educational outreach activity for children from an underprivileged zone to the Optical Society of America Foundation (OSAF) and to SPIE. The activity was carried out jointly by OSA and SPIE Universidad del Valle Student Chapters in the hillsides of Santiago de Cali, in a zone known as "Pueblo Joven" during 2008. It was aimed to boys and girls with ages between 8 and 13 years and was called "Experience the magic of light and color". The main purpose was to bring the children some basic concepts on optics and to encourage them to explore science through optics. The Universidad del Valle Student Chapters designed a series of talks and practical workshops where children participated in hands-on experiments that easily explain the fundamental concepts of light phenomena. Afterwards the children presented their achievements in a small science fair offered to the community and tried to explain in their own words what they learned and built. In this work, we present the most successful experimental designs and the educational standards we tried to develop with this activity.

Rethinking stratigraphy and site formation of the Pleistocene deposit at Cueva Negra del Estrecho del Río Quípar (Caravaca de la Cruz, Spain)

NASA Astrophysics Data System (ADS)

Angelucci, Diego E.; Anesin, Daniela; López Martínez, Mariano; Haber Uriarte, María; Rodríguez Estrella, Tomás; Walker, Michael J.

2013-11-01

Cueva Negra del Estrecho del Río Quípar (Caravaca de la Cruz, Murcia, Spain), hereinafter Cueva Negra, is a key-site for understanding the early peopling of Europe. Since 1990, systematic excavation has revealed an intriguing assemblage of lithic and faunal remains, and hominin teeth. It was deposited 0.99-0.78 Ma according to palaeomagnetic and biostratigraphical data; pollen data indicate warm moist conditions. Recently, possible evidence of thermal alteration was detected in a deep part of the deposit. We report here on our revision of the Cueva Negra stratigraphy, and offer information on site formation processes, based on new field observations and preliminary data from soil micromorphology. The Cueva Negra succession comprises three main stratigraphical complexes. Complex 1 is late Holocene. Complexes 2 and 3 are Pleistocene and are formed mainly of alluvial sediment, with subordinate inputs from the cave walls. Complexes 2 and 3 were accumulated almost without interruption, being separated by an erosive surface truncating a thin alluvial soil developed at the top of Complex 3. Our initial micromorphological findings indicate that anthropic inputs are mostly in derived positions, very likely having undergone inward displacement from the mouth of the rock-shelter.

The CHEK2 1100delC allelic variant is not present in familial and sporadic breast cancer cases from Moroccan population.

PubMed

Marouf, Chaymaa; Hajji, Omar; Diakité, Brehima; Tazzite, Amal; Jouhadi, Hassan; Benider, Abdellatif; Nadifi, Sellama

2015-01-01

The cell-cycle checkpoint kinase 2 (CHEK2) is an important signal transducer of cellular responses to DNA damage, whose defects has been associated with increased risk for breast cancer. The CHEK2 1100delC mutation has been reported to confer a twofold increased risk of breast cancer among carriers. The frequency of the mutation varies among populations. The highest frequency has been described in Northern and Eastern European countries. However, the 1100delC mutation has been investigated in different case-control studies and none in Moroccan population. The aim of this study was to evaluate the prevalence of this variant and determine its contribution to the development of breast cancer in sporadic cases and also in members of breast cancer families who tested negative or positive for a deleterious mutation in BRCA1/BRCA2. In this case-control study we performed the CHEK2 1100delC mutation analysis by ASO-PCR in 134 breast cancer patients and 114 unaffected control individuals. Most of these families had several cases of breast cancer or ovarian cancer (or both). No CHEK2 1100delC mutations were detected in any of 134 individuals, including 59 women diagnosed with breast cancer at an early age (<40 years), 10 women with bilateral breast cancer, and 6 women with ovarian cancer. Our preliminary genetic analysis are consistent with the reported very low frequency of CHEK2 1100delC mutation in North American populations (compared with Northern Europe), rendering CHEK2 1100delC such as an unlikely to be major breast cancer susceptibility genes.

Plan Multinacional de Educacion del Adulto (Multinational Plan for Adult Education).

ERIC Educational Resources Information Center

Eduplan Informa, 1971

1971-01-01

This document contains part of the final report from the first meeting of the Inter-American Council on Education, Science, and Culture, held in Vina del Mar, Chile, in 1970. The report presents general policy and guidelines which should be followed in the establishment of adult elementary education programs. The general discussion covers literacy…

Antimicrobial properties of Honduran medicinal plants.

PubMed

Lentz, D L; Clark, A M; Hufford, C D; Meurer-Grimes, B; Passreiter, C M; Cordero, J; Ibrahimi, O; Okunade, A L

1998-12-01

Ninety-two plants used in the traditional pharmacopoeia of the Pech and neighboring Mestizo peoples of central Honduras are reported. The results of in vitro antimicrobial screens showed that 19 of the extracts from medicinal plants revealed signs of antifungal activity while 22 demonstrated a measurable inhibitory effect on one or more bacterial cultures. Bioassay-guided fractionation of extracts from Mikania micrantha, Neurolaena lobata and Piper aduncum produced weak to moderately active isolates. The broad spectrum of activity of the extracts helps to explain the widespread use of these plants for wound healing and other applications.

Mujeres Latinas--Santas y Marquesas.

PubMed

Arredondo, Patricia

2002-11-01

This presidential address is a conceptualization and application of psychohistorical and mestizo psychology frameworks to address gender and ethnic identity conflicts for contemporary Latinas. Connections are made between historical and cultural icons and Latina literature of the 21st century with protagonists who give voice to the struggles of acculturated and self-empowered women. Spanish terms are used to communicate and give emphasis to the Latino landscape. The article comes to conclusion with personal reflections about María Morales de Zaldívar, or Mamá, the author's grandmother, who embodies the santa y marquesa life script.

Ceratopetalum (Cunoniaceae) fruits of Australasian affinity from the early Eocene Laguna del Hunco flora, Patagonia, Argentina

PubMed Central

Hermsen, Elizabeth J

2017-01-01

Abstract Background and Aims Radially symmetrical, five-winged fossil fruits from the highly diverse early Eocene Laguna del Hunco flora of Chubut Province, Patagonia, Argentina, are named, described and illustrated. The main goals are to assess the affinities of the fossils and to place them in an evolutionary, palaeoecological and biogeographic context. Methods Specimens of fossil fruits were collected from the Tufolitas Laguna del Hunco. They were prepared, photographed and compared with similar extant and fossil fruits using published literature. Their structure was also evaluated by comparing them with that of modern Ceratopetalum (Cunoniaceae) fruits through examination of herbarium specimens. Key Results The Laguna del Hunco fossil fruits share the diagnostic features that characterize modern and fossil Ceratopetalum (symmetry, number of fruit wings, presence of a conspicuous floral nectary and overall venation pattern). The pattern of the minor wing (sepal) veins observed in the Patagonian fossil fruits is different from that of modern and previously described fossil Ceratopetalum fruits; therefore, a new fossil species is recognized. An apomorphy (absence of petals) suggests that the fossils belong within crown-group Ceratopetalum. Conclusions The Patagonian fossil fruits are the oldest known record for Ceratopetalum. Because the affinities, provenance and age of the fossils are so well established, this new Ceratopetalum fossil species is an excellent candidate for use as a calibration point in divergence dating studies of the family Cunoniaceae. It represents the only record of Ceratopetalum outside Australasia, and further corroborates the biogeographic connection between the Laguna del Hunco flora and ancient and modern floras of the Australasian region. PMID:28110267

"Gioco del Mondo" an Alpine Hopscotch Game and Prehistoric Cosmology. (Italian Title: Il "Gioco del Mondo" e il cosmo preistorico)

NASA Astrophysics Data System (ADS)

Ragazzi, G.

2015-04-01

"Gioco del Mondo" ("Hopscotch game" in Anglo-Saxon countries), is a children's game in which the memory of a knowledge belonging to the prehistory of western thought is preserved. The path of the game is an image of the cosmos. The jumps allow the player to move from one region to another in the cosmos, in order to retrieve the pebble, wich is interpreted as a symbol of the human soul. The game is the imitation of a healing ritual in which a shaman brings back the soul kidnapped by a spirit from in his headquarters in a region of the cosmos.