2'-Deoxy-3,7-dideazaguanosine and related compounds. Synthesis of 6-amino-1-(2-deoxy-beta-D-erythro-pentofuranosyl) and 1-beta-D-arabinofuranosyl-1H-pyrrolo[3,2-c]pyridin-4(5H)-one via direct glycosylation of a pyrrole precursor.

PubMed Central

Girgis, N S; Cottam, H B; Larson, S B; Robins, R K

1987-01-01

The synthesis of two new analogs of 2'-deoxyguanosine, 6-amino-1-(2-deoxy-beta-D-erythro-pentofuranosyl)-1H-pyrrolo[3,2-c] pyridin-4(5H)-one (8) and 6-amino-1-beta-D-arabinofuranosyl-1H-pyrrolo[3,2-c]-pyridin-4(5H)-one (13) has been accomplished by glycosylation of the sodium salt of ethyl 2-cyanomethyl-1H-pyrrole-3-carboxylate (4c) using 1-chloro-2-deoxy-3,5-di-O-p-toluoyl-alpha-D-erythro-pentofuranose( 5) and 1-chloro-2,3,5-tri-O-benzyl-alpha-D-arabinofuranose (9), respectively. The resulting blocked nucleosides, ethyl 2-cyanomethyl-1-(2-deoxy-3,5-di-O-p-toluoyl-beta-D-erythro- pentofuranosyl)-1H-pyrrole-3-carboxylate (6) and ethyl 2-cyanomethyl-1-(2,3,5-tri-O-benzyl-beta-D-arabinofuranosyl)- 1H-pyrrole-3-carboxylate, were ring closed with hydrazine to form 5-amino-6-hydrazino-1-(2-deoxy-beta-D-erythro-pentofuranosyl)-1H- pyrrolo[3,2-c]-pyridin-4(5H)-one (7) and 5,6-diamino-1-(2,3,5-tri-O-benzyl-beta-D-arabinofuranosyl)-1H- pyrrolo[3,2-c]pyridin-4(5H)-one (11), respectively. Treatment of 7 with Raney nickel provided the 2'-deoxyguanosine analog 8 while reaction of 11 with Raney nickel followed by palladium hydroxide/cyclohexene treatment gave the 2'-deoxyguanosine analog 13. The anomeric configuration of 8 was assigned as beta by proton NMR, while that of 13 was confirmed as beta by single-crystal X-ray analysis of the deblocked precursor ethyl 2-cyanomethyl-1-beta-D-arabinofuranosyl-1H-pyrrole-3-carboxylate (10a). PMID:3593477

Bioinformatics approaches for structural and functional analysis of proteins in secondary metabolism in Withania somnifera.

PubMed

Sanchita; Singh, Swati; Sharma, Ashok

2014-11-01

Withania somnifera (Ashwagandha) is an affluent storehouse of large number of pharmacologically active secondary metabolites known as withanolides. These secondary metabolites are produced by withanolide biosynthetic pathway. Very less information is available on structural and functional aspects of enzymes involved in withanolides biosynthetic pathways of Withiana somnifera. We therefore performed a bioinformatics analysis to look at functional and structural properties of these important enzymes. The pathway enzymes taken for this study were 3-Hydroxy-3-methylglutaryl coenzyme A reductase, 1-Deoxy-D-xylulose-5-phosphate synthase, 1-Deoxy-D-xylulose-5-phosphate reductase, farnesyl pyrophosphate synthase, squalene synthase, squalene epoxidase, and cycloartenol synthase. The prediction of secondary structure was performed for basic structural information. Three-dimensional structures for these enzymes were predicted. The physico-chemical properties such as pI, AI, GRAVY and instability index were also studied. The current information will provide a platform to know the structural attributes responsible for the function of these protein until experimental structures become available.

Rigid 2',4'-difluororibonucleosides: synthesis, conformational analysis, and incorporation into nascent RNA by HCV polymerase.

PubMed

Martínez-Montero, Saúl; Deleavey, Glen F; Kulkarni, Anupriya; Martín-Pintado, Nerea; Lindovska, Petra; Thomson, Michael; González, Carlos; Götte, Matthias; Damha, Masad J

2014-06-20

We report on the synthesis and conformational properties of 2'-deoxy-2',4'-difluorouridine (2',4'-diF-rU) and cytidine (2',4'-diF-rC) nucleosides. NMR analysis and quantum mechanical calculations show that the strong stereoelectronic effects induced by the two fluorines essentially "lock" the conformation of the sugar in the North region of the pseudorotational cycle. Our studies also demonstrate that NS5B HCV RNA polymerase was able to accommodate 2',4'-diF-rU 5'-triphosphate (2',4'-diF-rUTP) and to link the monophosphate to the RNA primer strand. 2',4'-diF-rUTP inhibited RNA synthesis in dinucleotide-primed reactions, although with relatively high half-maximal inhibitory concentrations (IC50 > 50 μM). 2',4'-diF-rU/C represents rare examples of "locked" ribonucleoside mimics that lack a bicyclic ring structure.

Mechanism of ribonucleotide reductase from Herpes simplex virus type 1. Evidence for 3' carbon-hydrogen bond cleavage and inactivation by nucleotide analogs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ator, M.A.; Stubbe, J.; Spector, T.

1986-03-15

Isotope effects of 2.5, 2.1, and 1.0 were measured on the conversion of (3'-3H)ADP, (3'-H)UDP, and (5-3H) UDP to the corresponding 2'-deoxynucleotides by herpes simplex virus type 1 ribonucleotide reductase. These results indicate that the reduction of either purine or pyrimidine nucleotides requires cleavage of the 3' carbon-hydrogen bond of the substrate. The substrate analogs 2'-chloro-2'-deoxyuridine 5'-diphosphate (ClUDP), 2'-deoxy-2'-fluorouridine 5'-diphosphate, and 2'-azido-2'-deoxyuridine 5'-diphosphate were time-dependent inactivators of the herpes simplex virus type 1 ribonucleotide reductase. Incubation of (3'-3H)ClUDP with the enzyme was accompanied by time-dependent release of 3H to the solvent. Reaction of (beta-32P)ClUDP with the reductase resulted in themore » production of inorganic pyrophosphate. These results are consistent with the enzyme-mediated cleavage of the 3' carbon-hydrogen bond of ClUDP and the subsequent conversion of the nucleotide to 2-methylene-3(2H)furanone, as previously reported with the Escherichia coli ribonucleotide reductase.« less

Antioxidant and free radical-scavenging activity of constituents from two Scorzonera species.

PubMed

Milella, Luigi; Bader, Ammar; De Tommasi, Nunziatina; Russo, Daniela; Braca, Alessandra

2014-10-01

The aim of this study was to investigate the secondary metabolites content of Scorzonera papposa DC., an edible plant eaten in the desert region of Jordan and to assess its antioxidant and free radical-scavenging activity. By using this bioassay-oriented approach nine compounds, including the new natural compounds (6-trans-p-coumaroyl)-3-O-β-D-glucopyranosyl-2-deoxy-D-riburonic acid (1), (6-cis-p-coumaroyl)-3-O-β-D-glucopyranosyl-2-deoxy-D-riburonic acid (2a), (6-trans-p-coumaroyl)-3-O-β-D-glucopyranosyl-2-deoxy-D-riburonic acid methyl ester (3), and (6-trans-p-coumaroyl)-3-O-β-D-glucopyranosyl-(5-acetyl)-2-deoxy-D-riburonic acid (4), having the rare deoxy-D-riburonic acid moiety, were isolated. Their structures were elucidated by UV, MS, (1)H and (13)C NMR and 2D NMR. The antioxidant activity of the S. papposa pure compounds and of related derivatives isolated from another Scorzonera species (S. judaica Eig.) was also tested. The Relative Antioxidant Capacity Index (RACI) was applied as an integrated method to compare the antioxidant activities obtained using different chemical methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Synthesis of novel 3'-azido-3'-deoxy-α-L-ribo configured nucleosides: A comparative study between chemical and chemo-enzymatic methodologies.

PubMed

Rana, Neha; Kumar, Manish; Singh, Ankita; Maity, Jyotirmoy; Shukla, Poonam; Prasad, Ashok K

2018-05-03

Syntheses of novel 3'-azido-3'-deoxy-2'-O,4'-C-methylene-α-L-ribofuranosyl nucleosides have been carried out from 3'-azido-3'-deoxy-4'-C-hydroxymethyl-β-D-xylofuranosyl nucleosides following both chemical and chemo-enzymatic methodologies. The precursor nucleoside in turn was synthesized from a common glycosyl donor 4-C-acetoxymethyl-1,2,5-tri-O-acetyl-3-azido-3-deoxy-α,β-D-xylofuranose, which was obtained by the acetolysis of 4-C-acetoxymethyl-5-O-acetyl-3-azido-3-deoxy-1,2-O-isopropylidene-α-D-xylofuranose in 96% yield. It has been observed that a chemo-enzymatic pathway for the synthesis of targeted nucleosides is much more efficient than a chemical pathway, leading to the improvement in yield for the synthesis of 3'-azido-3'-deoxy-α-L-ribofuranosyl thymine and uracil from 49 to 89% and 55 to 93%, respectively.

A new synthesis of certain 7-(beta-D-ribofuranosyl) and 7-(2-deoxy-beta-D-ribofuranosyl) derivatives of 3-deazaguanine via the sodium salt glycosylation procedure.

PubMed Central

Gupta, P K; Robins, R K; Revankar, G R

1985-01-01

A facile synthesis of 7-beta-D-ribofuranosyl-3-deazaguanine (1) and certain 8-substituted derivatives of 1 via the sodium salt glycosylation method has been developed. Glycosylation of the sodium salt of methyl 2-chloro(or methylthio)-4(5)-cyanomethylimidazole-5(4)-carboxylate (5 and 13b) with 2,3,5-tri-O-benzoyl-D-ribofuranosyl bromide (6) gave exclusively methyl 2-chloro(or methylthio)-4-cyanomethyl-1-(2,3, 5-tri-O-benzoyl-beta-D-ribofuranosyl)imidazole-5-carboxylate (7 and 14a), respectively. Ammonolysis of 7 and 14a provided 6-amino-2-chloro(or methylthio)-3-beta-D-ribofuranosylimidazo-[4,5-c]pyridin-4(5H)-one (11 and 17), which on subsequent dehalogenation (or dethiation) gave 1. Similarly, reaction of the sodium salt of 5 and 13b with 1-chloro-2-deoxy-3,5-di-O-p-toluoyl-alpha-D-erythro-pentofuranose (8), and ammonolysis of the glycosylated imidazole precursors (9 and 16) gave 6-amino-2-chloro(or methylthio)-3-(2-deoxy-beta-D-erythro-pentofuranosyl) imidazo[4,5-c]-pyridin-4(5H)-one (10a and 15), respectively. Dehalogenation of 10a or dethiation of 15 gave 2'-deoxy-7-beta-D-ribofuranosyl-3-deazaguanine (10b). This procedure provided a direct method of obtaining 10b without the contaminating 9-glycosyl isomer 4. PMID:4022783

Synthesis of 5'-deoxy-5'-nucleosideacetic acid derivatives

NASA Technical Reports Server (NTRS)

Harada, Kazuo; Orgel, Leslie E.

1990-01-01

Several new 5'-deoxy-5'-nucleosideacetic acid derivatives have been synthesized by the reactions of alkoxycarbonylmethylene triphenylphosphoranes with nucleoside 5'-aldehydes. The oligomerization of adenine derivatives IIa, IIIa, IV, V and guanine derivatives IIc and IIIc in aqueous solution was studied using a water-soluble carbodiimide as a condensing agent. It is found that the saturated acid (IV) tends to cyclize to the lactone, while IIa and unsaturated acids (IIIa and V) oligomerized efficiently, especially in the presence of poly (U) as a template.

4'- C -Methoxy-2-deoxy-2'-fluoro Modified Ribonucleotides Improve Metabolic Stability and Elicit Efficient RNAi-Mediated Gene Silencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malek-Adamian, Elise; Guenther, Dale C.; Matsuda, Shigeo

We designed novel 4'-modified 2'-deoxy-2'-fluorouridine (2'-F U) analogues with the aim to improve nuclease resistance and potency of therapeutic siRNAs by introducing 4'-C-methoxy (4'-OMe) as the alpha (C4'α) or beta (C4'β) epimers. The C4'α epimer was synthesized by a stereoselective route in six steps; however, both α and β epimers could be obtained by a nonstereoselective approach starting from 2'-F U. 1H NMR analysis and computational investigation of the α-epimer revealed that the 4'-OMe imparts a conformational bias toward the North-East sugar pucker, due to intramolecular hydrogen bonding and hyperconjugation effects. The α-epimer generally conceded similar thermal stability as unmodifiedmore » nucleotides, whereas the β-epimer led to significant destabilization. Both 4'-OMe epimers conferred increased nuclease resistance, which can be explained by the close proximity between 4'-OMe substituent and the vicinal 5'- and 3'-phosphate group, as seen in the X-ray crystal structure of modified RNA. siRNAs containing several C4'α-epimer monomers in the sense or antisense strands triggered RNAi-mediated gene silencing with efficiencies comparable to that of 2'-F U.« less

Biosynthesis of 2-deoxysugars using whole-cell catalyst expressing 2-deoxy-D-ribose 5-phosphate aldolase.

PubMed

Li, Jitao; Yang, Jiangang; Men, Yan; Zeng, Yan; Zhu, Yueming; Dong, Caixia; Sun, Yuanxia; Ma, Yanhe

2015-10-01

2-Deoxy-D-ribose 5-phosphate aldolase (DERA) accepts a wide variety of aldehydes and is used in de novo synthesis of 2-deoxysugars, which have important applications in drug manufacturing. However, DERA has low preference for non-phosphorylated substrates. In this study, DERA from Klebsiella pneumoniae (KDERA) was mutated to increase its enzyme activity and substrate tolerance towards non-phosphorylated polyhydroxy aldehyde. Mutant KDERA(K12) (S238D/F200I/ΔY259) showed a 3.15-fold improvement in enzyme activity and a 1.54-fold increase in substrate tolerance towards D-glyceraldehyde compared with the wild type. Furthermore, a whole-cell transformation strategy using resting cells of the BL21(pKDERA12) strain, containing the expressed plasmid pKDERA12, resulted in increase in 2-deoxy-D-ribose yield from 0.41 mol/mol D-glyceraldehyde to 0.81 mol/mol D-glyceraldehyde and higher substrate tolerance from 0.5 to 3 M compared to in vitro assays. With further optimization of the transformation process, the BL21(pKDERA12) strain produced 2.14 M (287.06 g/L) 2-deoxy-D-robose (DR), with a yield of 0.71 mol/mol D-glyceraldehyde and average productivity of 0.13 mol/L·h (17.94 g/L·h). These results demonstrate the potential for large-scale production of 2-deoxy-D-ribose using the BL21(pKDERA12) strain. Furthermore, the BL21(pKDERA12) strain also exhibited the ability to efficiently produce 2-deoxy-D-altrose from D-erythrose, as well as 2-deoxy-L-xylose and 2-deoxy-L-ribose from L-glyceraldehyde.

LC/MS Analysis of Tetrodotoxin and Its Deoxy Analogs in the Marine Puffer Fish Fugu niphobles from the Southern Coast of Korea, and in the Brackishwater Puffer Fishes Tetraodon nigroviridis and Tetraodon biocellatus from Southeast Asia

PubMed Central

Jang, Jun-Ho; Lee, Jong-Soo; Yotsu-Yamashita, Mari

2010-01-01

Tetrodotoxin (TTX) and its deoxy analogs, 5-deoxyTTX, 11-deoxyTTX, 6,11-dideoxyTTX, and 5,6,11-trideoxyTTX, were quantified in the tissues of three female and three male specimens of the marine puffer fish, Fugu niphobles, from the southern coast of Korea, and in the whole body of the brackishwater puffer fishes, Tetraodon nigroviridis (12 specimens) and Tetrodon biocellatus (three specimens) from Southeast Asia using LC/MS in single ion mode (SIM). Identification of these four deoxy analogs in the ovarian tissue of F. niphobles were further confirmed by LC/MS/MS. TTX and 5,6,11-trideoxyTTX were detected in all three puffer fish species as the major TTX analogs, similar to Japanese Fugu pardalis. While 6,11-dideoxyTTX was also found to be a major analog in almost all tissues of Korean F. niphobles, this analog was minor in the two Tetraodon species and Japanese F. pardalis. Among the tissues of F. niphobles, the concentrations of TTXs were highest in the ovaries (female) and skin (female and male). PMID:20479966

Molecular modeling of methyl-α-Neu5Ac analogues docked against cholera toxin--a molecular dynamics study.

PubMed

Blessy, J Jino; Sharmila, D Jeya Sundara

2015-02-01

Molecular modeling of synthetic methyl-α-Neu5Ac analogues modified in C-9 position was investigated by molecular docking and molecular dynamics (MD) simulation methods. Methyl-α-Neu5Ac analogues were docked against cholera toxin (CT) B subunit protein and MD simulations were carried out for three Methyl-α-Neu5Ac analogue-CT complexes (30, 10 and 10 ns) to estimate the binding activity of cholera toxin-Methyl-α-Neu5Ac analogues using OPLS_2005 force field. In this study, direct and water mediated hydrogen bonds play a vital role that exist between the methyl-α-9-N-benzoyl-amino-9-deoxy-Neu5Ac (BENZ)-cholera toxin active site residues. The Energy plot, RMSD and RMSF explain that the simulation was stable throughout the simulation run. Transition of phi, psi and omega angle for the complex was calculated. Molecular docking studies could be able to identify the binding mode of methyl-α-Neu5Ac analogues in the binding site of cholera toxin B subunit protein. MD simulation for Methyl-α-9-N-benzoyl-amino-9-deoxy-Neu5Ac (BENZ), Methyl-α-9-N-acetyl-9-deoxy-9-amino-Neu5Ac and Methyl-α-9-N-biphenyl-4-acetyl-deoxy-amino-Neu5Ac complex with CT B subunit protein was carried out, which explains the stable nature of interaction. These methyl-α-Neu5Ac analogues that have computationally acceptable pharmacological properties may be used as novel candidates for drug design for cholera disease.

Studies toward the oxidative and reductive activation of C-S bonds in 2'-S-aryl-2'-thiouridine derivatives.

PubMed

Rayala, Ramanjaneyulu; Giuglio-Tonolo, Alain; Broggi, Julie; Terme, Thierry; Vanelle, Patrice; Theard, Patricia; Médebielle, Maurice; Wnuk, Stanislaw F

2016-04-21

Studies directed toward the oxidative and reductive desulfurization of readily available 2'- S -aryl-2'-thiouridine derivatives were investigated with the prospect to functionalize the C2'-position of nucleosides. The oxidative desulfurization-difluorination strategy was successful on 2-(arylthio)alkanoate surrogates, while extension of the combination of oxidants and fluoride sources was not an efficient fluorination protocol when applied to 2'- S -aryl-2'-thiouridine derivatives, resulting mainly in C5-halogenation of the pyrimidine ring and C2'-monofluorination without desulfurization. Cyclic voltammetry of 2'-arylsulfonyl-2'-deoxyuridines and their 2'-fluorinated analogues showed that cleavage of the arylsulfone moiety could occur, although at relatively high cathodic potentials. While reductive-desulfonylation of 2'-arylsulfonyl-2'-deoxyuridines with organic electron donors (OEDs) gave predominantly base-induced furan type products, chemical (OED) and electrochemical reductive-desulfonylation of the α-fluorosulfone derivatives yielded the 2'-deoxy-2'-fluorouridine and 2',3'-didehydro-2',3'-dideoxy-2'-fluorouridine derivatives. These results provided good evidence of the generation of a C2'-anion through carbon-sulfur bond cleavage, opening new horizons for the reductive-functionalization approaches in nucleosides.

Studies toward the oxidative and reductive activation of C-S bonds in 2'-S-aryl-2'-thiouridine derivatives

PubMed Central

Rayala, Ramanjaneyulu; Giuglio-Tonolo, Alain; Broggi, Julie; Terme, Thierry; Vanelle, Patrice; Theard, Patricia; Médebielle, Maurice; Wnuk, Stanislaw F.

2016-01-01

Studies directed toward the oxidative and reductive desulfurization of readily available 2'-S-aryl-2'-thiouridine derivatives were investigated with the prospect to functionalize the C2'-position of nucleosides. The oxidative desulfurization-difluorination strategy was successful on 2-(arylthio)alkanoate surrogates, while extension of the combination of oxidants and fluoride sources was not an efficient fluorination protocol when applied to 2'-S-aryl-2'-thiouridine derivatives, resulting mainly in C5-halogenation of the pyrimidine ring and C2'-monofluorination without desulfurization. Cyclic voltammetry of 2'-arylsulfonyl-2'-deoxyuridines and their 2'-fluorinated analogues showed that cleavage of the arylsulfone moiety could occur, although at relatively high cathodic potentials. While reductive-desulfonylation of 2'-arylsulfonyl-2'-deoxyuridines with organic electron donors (OEDs) gave predominantly base-induced furan type products, chemical (OED) and electrochemical reductive-desulfonylation of the α-fluorosulfone derivatives yielded the 2'-deoxy-2'-fluorouridine and 2',3'-didehydro-2',3'-dideoxy-2'-fluorouridine derivatives. These results provided good evidence of the generation of a C2'-anion through carbon-sulfur bond cleavage, opening new horizons for the reductive-functionalization approaches in nucleosides. PMID:27019535

[Monolayer culture of pancreatic islet cells of the adult rat: effect of 2-deoxy-2-fluoroglucose].

PubMed

Aoki, M; Kagawa, S; Yamamura, T; Matsuoka, A; Utsunomiya, J

1988-02-20

In the present study, the culture system for preparing monolayer islet cells of the neonatal rat was applied and modified for use with the pancreas of the adult rat. In this procedure, whole pancreatic tissues were enzymatically dispersed and then cultured for 30 days in TCM 199 medium with either 5.5 mM glucose or 5.5 mM glucose plus 1 mM 2-deoxy-2-fluoroglucose. Under culture conditions without 2-deoxy-2-fluoroglucose, the responsiveness of B cells was totally abolished by day 20 of culture. The addition of 2-deoxy-2-fluoroglucose destroyed fibroblasts selectively in a period of 20 days, yielding the monolayers mostly consisting of islet cells, and the morphological characteristics were well preserved at the end of the culture study period. After culture for 20 days in medium with 2-deoxy-2-fluoroglucose, insulin secretion was raised in a dose-dependent fashion due to the increasing concentrations of glucose, leucine and 2-ketoisocaproate. The dose-response curve for insulin secretion evoked by glucose was sigmoid with a Km of 7 mM glucose, and the secretion threshold was observed at a concentration of between 2.8 and 5.5 mM glucose. The ratios of the maximum level to the basal were 6, 5 and 3 respectively for glucose, leucine and 2-ketoisocaproate. The secretory competence was preserved in the B cells on day 30 as well. Addition of epinephrine or clonidine inhibited the glucose-induced insulin secretion dose-dependently. At a concentration of 10(-7) M, both drugs produced an 80% drop in insulin secretion evoked by glucose. The inhibitory effect of epinephrine or clonidine was reversed by 3 X 10(-5) M yohimbine or 10(-5) M phentolamine, whereas 10(-5) M propranolol had little or no effect and alpha adrenergic blockade of prazosin (5 X 10(-5) M) was weak as compared to that of yohimbine. At a high concentration (10(-5) M) of phenylephrine, a marked drop of insulin secretion was observed. In summary, the present culture system facilitates the establishment of monolayers of adult rat pancreas that consist mostly of islet cells. In addition, it is certain that the response of the B cells in 2-deoxy-2-fluoroglucose to nutrient secretagogues and the adrenergic modulation of insulin secretion are well preserved for a long-term culture period of 30 days. These preparations may provide a useful tool not only for the in vitro study of the B-cell function, but also for use in implantation resource.

1-/sup 11/C-2-deoxy-D-glucose and process for the preparation thereof

DOEpatents

MacGregor, R.R.; Wolf, A.P.; Shiue, C.Y.; Wan, C.N.

1980-02-08

The novel labelled compound 1-/sup 11/C-2-deoxy-D-glucose, and a process for its preparation from 2,3:4,5-di-O-isopropylidene-D-arabinitol derivatives of relatively high reactivity are disclosed. 1-/sup 11/C-2-deoxy-D-glucose is useful for measuring regional brain glucose metabolism in vivo.

Synthetic mucin fragments: synthesis of O-sulfo and O-methyl derivatives of allyl O-(beta-D-galactopyranosyl)-(1-->3)-2-acetamido-2-deoxy-alpha-D- galactopyranoside as potential compounds for sulfotransferases.

PubMed

Jain, R K; Piskorz, C F; Matta, K L

1995-10-02

Allyl 2-acetamido-4,6-O-(4-methoxybenzylidene)-2-deoxy-alpha-D-galact opy ranoside (1) was condensed with either 2,3,4,6-tetra-O-acetyl-alpha-D-galactopyranosyl bromide (2) or 2,3,4-tri-O-benzoyl-6-O-bromoacetyl-alpha-D-galactopyranosyl bromide (14) in the presence of mercuric cyanide. Selective substitution with methyl, sulfo or both at desired positions, followed by the removal of protecting groups, afforded allyl O-(beta-D-galactopyranosyl)-(1-->3)-2-acetamido-2-deoxy-6-O-methyl-alpha -D- galactopyranoside (5), allyl O-(6-O-sulfo-beta-D-galactopyranosyl sodium salt)-(1-->3)-2-acetamido-2-deoxy-6- O-methyl-alpha-D-galactopyranoside (10), allyl O-(beta-D-galactopyranosyl)-(1-->3)-2-acetamido-2-deoxy-6-O-sulfo-alpha- D- galactopyranoside sodium salt (13), allyl O-(6-O-sulfo-beta-D-galactopyranosyl sodium salt)-(1-->3)-2-acetamido-2-deoxy- alpha-D-galactopyranoside (17) and allyl O-(3-O-sulfo-beta-D-galactopyranosyl sodium salt)-(1-->3)-2-acetamido-2-deoxy- alpha-D-galactopyranoside (22). The structures of compounds 5, 10, 13, 17 and 22 were established by 13C NMR and FAB mass spectroscopy.

Nucleic acid component analogues: synthesis of 2'-deoxynucleosides from 5-substituted-4-hydroxy-6(1H)-pyrimidinones.

PubMed

Khattab, Ahmed F; Abdel Megied, Ahmed E S; Pedersen, Erik B

2003-01-01

Condensation of the silylated pyrimidines 5a-c with methyl 2-deoxy-3,5-di-O-toluoyl-D-pentofuranoside 6, using trimethylsilyltriflate as catalyst gave anomeric mixtures of 2'-deoxynucleosides 7a-c, the pure alpha- and beta-anomers were separated and deprotected with sodium methoxide in methanol to give 1-(2'-deoxy-alpha-D-pentafuranosyl)-4-hydroxy-5-substituted-6(1H)-pyrimidinones 10a,b and 13a and their corresponding beta-anomers 11a,b and 13b.

Building blocks for the synthesis of glycosyl-myo-inositols involved in the insulin intracellular signalling process.

PubMed

Zapata, A; Martín-Lomas, M

1992-10-09

Glycosylation of (+/- )-1-O-benzyl-2,3:5,6-di-O-isopropylidene-myo-inositol (4) with 6-O-acetyl-4-O-allyl-2-azido-3-O-benzyl-2-deoxy-beta-D-glucopyranosyl trichloroacetimidate (6) gave the 4-O-(2-amino-2-deoxy-alpha-D-glucopyranosyl)- myo-inositol derivative (9) as a mixture of diastereoisomers which could be resolved by chromatography. Likewise alpha-glycosylation of 4 with 6-O-acetyl-2-azido-3-O-benzoyl-2-deoxy-4-O-(2,3,4,6-tetra-O-acetyl-beta- D- galactopyranosyl)-D-glucopyranosyl trichloroacetimidate (10) gave the corresponding pseudotrisaccharide derivative 16 as a mixture of diastereomers which could be resolved partially by chromatography. alpha-Glycosylation of enantiomerically pure 2,3:5,6- (18) and 2,3:4,5-di-O-isopropylidene-1-O-menthoxycarbonyl-myo-inositol (19) with 3,4,6-tri-O-acetyl-2-azido-2-deoxy-D-glucopyranosyl trichloroacetimidate (20) gave the pseudodisaccharide derivatives 21 and 22, respectively. Likewise, alpha-glycosylation of 18 with 10 afforded a pseudotrisaccharide derivative (23).

2'-Deoxy-2'-methylenecytidine and 2'-deoxy-2',2'-difluorocytidine 5'-diphosphates: potent mechanism-based inhibitors of ribonucleotide reductase.

PubMed

Baker, C H; Banzon, J; Bollinger, J M; Stubbe, J; Samano, V; Robins, M J; Lippert, B; Jarvi, E; Resvick, R

1991-06-01

It has been found that 2'-deoxy-2'-methyleneuridine (MdUrd), 2'-deoxy-2'-methylenecytidine (MdCyd), and 2'-deoxy-2',2'-difluorocytidine (dFdCyd) 5'-diphosphates (MdUDP (1) MdCDP (2) and dFdCDP (3), respectively) function as irreversible inactivators of the Escherichia coli ribonucleoside diphosphate reductase (RDPR). 2 is a much more potent inhibitor than its uridine analogue 1. It is proposed that 2 undergoes abstraction of H3' to give an allylic radical that captures a hydrogen atom and decomposes to an active alkylating furanone species. RDPR also accepts 3 as an alternative substrate analogue and presumably executes an initial abstraction of H3' to initiate formation of a suicide species. Both 2 and 3 give inactivation results that differ from those of previously studied inhibitors. The potent anticancer activities of MdCyd and dFdCyd indicate a significant chemotherapeutic potential. The analogous RDPR of mammalian cells should be regarded as a likely target and/or activating enzyme for these novel mechanism-based inactivators.

Interactions of tea tannins and condensed tannins with proteins.

PubMed

Frazier, Richard A; Deaville, Eddie R; Green, Rebecca J; Stringano, Elisabetta; Willoughby, Ian; Plant, John; Mueller-Harvey, Irene

2010-01-20

Binding parameters for the interactions of four types of tannins: tea catechins, grape seed proanthocyanidins, mimosa 5-deoxy proanthocyanidins, and sorghum procyanidins (mDP=17), with gelatin and bovine serum albumin (BSA) have been determined from isothermal titration calorimetry data. Equilibrium binding constants determined for the interaction with gelatin were in the range 10(4) to 10(6) M(-1) and in the order: sorghum procyanidins > grape seed proanthocyanidins > mimosa 5-deoxy proanthocyanidins > tea catechins. Interaction with BSA was generally weaker, with equilibrium binding constants of < or =10(3)M(-1) for grape seed proanthocyanidins, mimosa 5-deoxy proanthocyanidins and tea catechins, and 10(4)M(-1) for the sorghum procyanidins. In all cases the interactions with proteins were exothermic and involved multiple binding sites on the protein. The data are discussed in relation to the structures and the known nutritional effects of the condensed tannins.

Anticancer and antiviral effects and inactivation of S-adenosyl-L-homocysteine hydrolase with 5'-carboxaldehydes and oximes synthesized from adenosine and sugar-modified analogues.

PubMed

Wnuk, S F; Yuan, C S; Borchardt, R T; Balzarini, J; De Clercq, E; Robins, M J

1997-05-23

Selectively protected adenine nucleosides were converted into 5'-carboxaldehyde analogues by Moffatt oxidation (dimethyl sulfoxide/dicyclohexylcarbodiimide/dichloroacetic acid) or with the Dess-Martin periodinane reagent. Hydrolysis of a 5'-fluoro-5'-S-methyl-5'-thio (alpha-fluoro thioether) arabinosyl derivative also gave the 5'-carboxaldehyde. Treatment of 5'-carboxaldehydes with hydroxylamine [or O-(methyl, ethyl, and benzyl)hydroxylamine] hydrochloride gave E/Z oximes. Treatment of purified oximes with aqueous trifluoroacetic acid and acetone effected trans-oximation to provide clean samples of 5'-carboxaldehydes. Adenosine (Ado)-5'-carboxaldehyde and its 4'-epimer are potent inhibitors of S-adenosyl-L-homocysteine (AdoHcy) hydrolase. They bind efficiently to the enzyme and undergo oxidation at C3' to give 3'-keto analogues with concomitant reduction of the NAD+ cofactor to give an inactive, tightly bound NADH-enzyme complex (type I cofactor-depletion inhibition). Potent type I inhibition was observed with 5'-carboxaldehydes that contain a ribo cis-2',3'-glycol. Their oxime derivatives are "proinhibitors" that undergo enzyme-catalyzed hydrolysis to release the inhibitors at the active site. The 2'-deoxy and 2'-epimeric (arabinosyl) analogues were much weaker inhibitors, and the 3'-deoxy compounds bind very weakly. Ado-5'-carboxaldehyde oxime had potent cytotoxicity in tumor cell lines and was toxic to normal human cells. Analogues had weaker cytotoxic and antiviral potencies, and the 3'-deoxy compounds were essentially devoid of cytotoxic and antiviral activity.

Enhancing Isoprene Production by Genetic Modification of the 1-Deoxy-d-Xylulose-5-Phosphate Pathway in Bacillus subtilis▿ †

PubMed Central

Xue, Junfeng; Ahring, Birgitte K.

2011-01-01

To enhance the production of isoprene, a volatile 5-carbon hydrocarbon, in the Gram-positive spore-forming rod-shaped bacterium Bacillus subtilis, 1-deoxy-d-xylulose-5-phosphate synthase (Dxs) and 1-deoxy-d-xylulose-5-phosphate reductoisomerase (Dxr) were overexpressed in B. subtilis DSM 10. For the strain that overexpresses Dxs, the yield of isoprene was increased 40% over that by the wild-type strain. In the Dxr overexpression strain, the level of isoprene production was unchanged. Overexpression of Dxr together with Dxs showed an isoprene production level similar to that of the Dxs overproduction strain. The effects of external factors, such as stress factors including heat (48°C), salt (0.3 M NaCl), ethanol (1%), and oxidative (0.005% H2O2) stress, on isoprene production were further examined. Heat, salt, and H2O2 induced isoprene production; ethanol inhibited isoprene production. In addition, induction and repression effects are independent of SigB, which is the general stress-responsive alternative sigma factor of Gram-positive bacteria. PMID:21296950

Isolation of a Mutant of Salmonella typhimurium Dependent on D-Arabinose-5-phosphate for Growth and Synthesis of 3-Deoxy-D-mannoctulosonate (Ketodeoxyoctonate)

PubMed Central

Rick, P. D.; Osborn, M. J.

1972-01-01

A new type of auxotrophic mutant of Salmonella typhimurium has been isolated that is defective in the synthesis of the 3-deoxy-D-mannooctulosonate (ketodeoxyoctonate) region of the lipopolysaccharide and requires D-arabinose-5-phosphate for growth. Genetic and biochemical evidence indicated that the mutant defect was due to an altered ketodeoxyoctonate-8-phosphate synthetase with an apparent Km for D-arabinose-5-phosphate 35-fold higher than that of the parental enzyme. As a result of this enzymatic lesion, the mutant strain was dependent on exogenous D-arabinose-5-phosphate both for growth and for synthesis of a complete lipopolysaccharide. PMID:4566459

Cytotoxic 1-deoxysphingolipids are metabolized by a cytochrome P450-dependent pathway[S

PubMed Central

Alecu, Irina; Othman, Alaa; Penno, Anke; Saied, Essa M.; Arenz, Christoph; von Eckardstein, Arnold; Hornemann, Thorsten

2017-01-01

The 1-deoxysphingolipids (1-deoxySLs) are atypical sphingolipids (SLs) that are formed when serine palmitoyltransferase condenses palmitoyl-CoA with alanine instead of serine during SL synthesis. The 1-deoxySLs are toxic to neurons and pancreatic β-cells. Pathologically elevated 1-deoxySLs cause the inherited neuropathy, hereditary sensory autonomic neuropathy type 1 (HSAN1), and are also found in T2D. Diabetic sensory polyneuropathy (DSN) and HSAN1 are clinically very similar, suggesting that 1-deoxySLs may be implicated in both pathologies. The 1-deoxySLs are considered to be dead-end metabolites, as they lack the C1-hydroxyl group, which is essential for the canonical degradation of SLs. Here, we report a previously unknown metabolic pathway, which is capable of degrading 1-deoxySLs. Using a variety of metabolic labeling approaches and high-resolution high-accuracy MS, we identified eight 1-deoxySL downstream metabolites, which appear to be formed by cytochrome P450 (CYP)4F enzymes. Comprehensive inhibition and induction of CYP4F enzymes blocked and stimulated, respectively, the formation of the downstream metabolites. Consequently, CYP4F enzymes might be novel therapeutic targets for the treatment of HSAN1 and DSN, as well as for the prevention of T2D. PMID:27872144

The degradation of the antitumor agent gemcitabine hydrochloride in an acidic aqueous solution at pH 3.2 and identification of degradation products.

PubMed

Jansen, P J; Akers, M J; Amos, R M; Baertschi, S W; Cooke, G G; Dorman, D E; Kemp, C A; Maple, S R; McCune, K A

2000-07-01

A study of the degradation kinetics of gemcitabine hydrochloride (2'-deoxy-2',2'-difluorocytidine) in aqueous solution at pH 3.2 was conducted. The degradation of gemcitabine followed pseudo first-order kinetics, and rate constants were determined at four different temperatures. These rates were used to construct an Arrhenius plot from which degradation rates at lower temperatures were extrapolated and activation energy calculated. Four major degradation products were identified. Only one of these degradation products, the uridine analogue of gemcitabine, was a known degradation product of gemcitabine and was identified by comparison with synthesized material. The other three degradation products were isolated and characterized by spectroscopic techniques. Two of these products were determined to be the diastereomeric 6-hydroxy-5, 6-dihydro-2'-deoxy-2',2'-difluorouridines, and the other product was determined to be O(6),5'-cyclo-5,6-dihydro-2'-deoxy-2', 2'-difluorouridine. The mechanisms of formation of these degradation products are discussed.

Oligomerization of deoxynucleoside-biphosphate dimers - Template and linkage specificity

NASA Technical Reports Server (NTRS)

Visscher, J.; Van Der Woerd, R.; Bakker, C. G.; Schwartz, Alan W.

1989-01-01

The oligomerization of the activated 3-prime-5-prime pyrophosphate-linked dimer, pdAppdAp, is presently noted to be selectively favored by a poly(U) template over the 3-prime-3-prime and 5-prime-5-prime linked dimers. Both overall yields and the production of the longest oligomers were markedly stimulated by poly(U)'s presence; in its absence, the 5-prime-5-prime linked dimer became the most reactive, yielding chains of the order of 60 monomer-unit lengths. Remarkable self-organization properties are noted for the 5-prime-5-prime dimer of pdAp.

Oligomerizations of deoxyadenosine bis-phosphates and of their 3-prime-5-prime, 3-prime-3-prime, and 5-prime-5-prime dimers - Effects of a pyrophosphate-linked, poly(T) analog

NASA Technical Reports Server (NTRS)

Visscher, J.; Bakker, C. G.; Schwartz, Alan W.

1990-01-01

The effect of a 3-prime-5-prime pyrophosphate-linked oligomer of pTp on oligomerizations of pdAp and of its 3-prime-5-prime, 3-prime-3-prime, and 5-prime-5-prime dimers was investigated, using HPLC to separate the reaction mixtures; peak detection was by absorbance monitoring at 254 nm. It was expected that the dimers would form stable complexes with the template, with the degree of stability depending upon the internal linkage of each dimer. It was found that, although the isomers differ substantially in their oligomerization behavior in the absence of template, the analog-template catalyzes the oligomerization to about the same extent in all three cases.

The position of a key tyrosine in dTDP-4-Keto-6-deoxy-D-glucose-5-epimerase (EvaD) alters the substrate profile for this RmlC-like enzyme.

PubMed

Merkel, Alexandra B; Major, Louise L; Errey, James C; Burkart, Michael D; Field, Robert A; Walsh, Christopher T; Naismith, James H

2004-07-30

Vancomycin, the last line of defense antibiotic, depends upon the attachment of the carbohydrate vancosamine to an aglycone skeleton for antibacterial activity. Vancomycin is a naturally occurring secondary metabolite that can be produced by bacterial fermentation. To combat emerging resistance, it has been proposed to genetically engineer bacteria to produce analogues of vancomycin. This requires a detailed understanding of the biochemical steps in the synthesis of vancomycin. Here we report the 1.4 A structure and biochemical characterization of EvaD, an RmlC-like protein that is required for the C-5' epimerization during synthesis of dTDP-epivancosamine. EvaD, although clearly belonging to the RmlC class of enzymes, displays very low activity in the archetypal RmlC reaction (double epimerization of dTDP-6-deoxy-4-keto-D-glucose at C-3' and C-5'). The high resolution structure of EvaD compared with the structures of authentic RmlC enzymes indicates that a subtle change in the enzyme active site repositions a key catalytic Tyr residue. A mutant designed to re-establish the normal position of the Tyr increases the RmlC-like activity of EvaD.

Cytotoxic 1-deoxysphingolipids are metabolized by a cytochrome P450-dependent pathway.

PubMed

Alecu, Irina; Othman, Alaa; Penno, Anke; Saied, Essa M; Arenz, Christoph; von Eckardstein, Arnold; Hornemann, Thorsten

2017-01-01

The 1-deoxysphingolipids (1-deoxySLs) are atypical sphingolipids (SLs) that are formed when serine palmitoyltransferase condenses palmitoyl-CoA with alanine instead of serine during SL synthesis. The 1-deoxySLs are toxic to neurons and pancreatic β-cells. Pathologically elevated 1-deoxySLs cause the inherited neuropathy, hereditary sensory autonomic neuropathy type 1 (HSAN1), and are also found in T2D. Diabetic sensory polyneuropathy (DSN) and HSAN1 are clinically very similar, suggesting that 1-deoxySLs may be implicated in both pathologies. The 1-deoxySLs are considered to be dead-end metabolites, as they lack the C1-hydroxyl group, which is essential for the canonical degradation of SLs. Here, we report a previously unknown metabolic pathway, which is capable of degrading 1-deoxySLs. Using a variety of metabolic labeling approaches and high-resolution high-accuracy MS, we identified eight 1-deoxySL downstream metabolites, which appear to be formed by cytochrome P450 (CYP)4F enzymes. Comprehensive inhibition and induction of CYP4F enzymes blocked and stimulated, respectively, the formation of the downstream metabolites. Consequently, CYP4F enzymes might be novel therapeutic targets for the treatment of HSAN1 and DSN, as well as for the prevention of T2D. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

Estrogen receptors regulate the estrous behavior induced by progestins, peptides, and prostaglandin E2.

PubMed

Lima-Hernández, F J; Gómora-Arrati, P; García-Juárez, M; Blaustein, J D; Etgen, A M; Beyer, C; González-Flores, O

2014-07-01

The role of classical estrogen receptors (ERs) in priming female reproductive behavior has been studied previously; however, the participation of this receptor during activation of estrous behavior has not been extensively studied. The purpose of this work was to test the possibility that the facilitation of lordosis behavior in estrogen-primed rats by progesterone (P) and its 5α- and 5β-reduced metabolites, gonadotropin-releasing hormone (GnRH), leptin, prostaglandin E2 (PGE2) and vagino-cervical stimulation (VCS) involves interactions with classical ERs by using the selective ER modulator, tamoxifen. To further assess the role of ERs, we also explored the effects of the pure ER antagonist, ICI182780 (ICI), on estrous behavior induced by P and GnRH. Ovariectomized, estrogen-primed rats (5μg estradiol benzoate 40h earlier) were injected intraventricularly with the above-mentioned compounds, or they received VCS. All compounds and VCS effectively facilitated estrous behavior when tested at 60, 120 or 240min after infusion or application of VCS. Intraventricular infusion of tamoxifen (5μg), 30min before, significantly attenuated estrous behaviors induced in estradiol-primed rats by P, most of its 5α- and 5β-reduced metabolites, GnRH, and PGE2, but not by VCS. Although there was a trend for reduction, tamoxifen did not significantly decrease lordosis in females treated with 5β-pregnan-3,20-dione. ICI also inhibited lordosis behavior induced by P and GnRH at some testing intervals. These results suggest that activation of classical ERs participates in the triggering effects on estrous behavior induced by agents with different chemical structures that do not bind directly to ERs. Copyright © 2014 Elsevier Inc. All rights reserved.

15-deoxy prostaglandin J2, the nonenzymatic metabolite of prostaglandin D2, induces apoptosis in keratinocytes of human hair follicles: a possible explanation for prostaglandin D2-mediated inhibition of hair growth.

PubMed

Joo, Hyun Woo; Kang, Yoo Ri; Kwack, Mi Hee; Sung, Young Kwan

2016-07-01

Recent studies have shown that prostaglandin D2 (PGD2) and its nonenzymatic metabolite, 15-deoxy-Δ(12,14)-prostaglandin J2 (15-dPGJ2), inhibit in vitro growth of explanted human hair follicles and inhibit hair growth in mice through the GPR44 (DP2). However, the underlying mechanism is still unclear. In this study, we first investigated the expression of DP2 in human hair follicles and in cultured follicular cells. We found that DP2 is strongly expressed in the outer root sheath (ORS) cells and weakly expressed in the dermal papilla (DP) cells. We observed slight growth stimulation when ORS and DP cells were treated with PGD2. We also observed slight growth stimulation when DP and ORS cells were treated with low concentrations (0.5 and 1 μM) of 15-dPGJ2. However, 5 μM 15-dPGJ2 inhibited the viability and caused apoptosis of both cell types. Exposure of cultured human hair follicles to 15-dPGJ2 resulted in significant apoptosis in follicular keratinocytes. Altogether, our data provide an evidence that 15-dPGJ2 promotes apoptosis in follicular keratinocytes and provide rationale for developing remedies for the prevention and treatment of hair loss based on DP2 antagonism.

The energy structure and decay channels of the 4p6-shell excited states in Sr

NASA Astrophysics Data System (ADS)

Kupliauskienė, A.; Kerevičius, G.; Borovik, V.; Shafranyosh, I.; Borovik, A.

2017-11-01

The ejected-electron spectra arising from the decay of the 4p{}5{{nln}}{\\prime }{l}{\\prime }{n}{\\prime\\prime }{l}{\\prime\\prime } autoionizing states in Sr atoms have been studied precisely at the incident-electron energies close to excitation and ionization thresholds of the 4{{{p}}}6 subshell. The excitation behaviors for 58 lines observed between 12 and 21 eV ejected-electron kinetic energy have been investigated. Also, the ab initio calculations of excitation energies, autoionization probabilities and electron-impact excitation cross sections of the states 4p{}5{{nln}}{\\prime }{l}{\\prime }{n}{\\prime\\prime }{l}{\\prime\\prime } (nl = 4d, 5s, 5p; {n}{\\prime }{l}{\\prime } = 4d, 5s, 5p; {n}{\\prime\\prime }{l}{\\prime\\prime } = 5s, 6s, 7s, 8s, 9s, 5p, 6p, 5d, 6d, 7d, 8d, 4f, 5g) have been performed by employing the large-scale configuration-interaction method in the basis of the solutions of Dirac-Fock-Slater equations. The obtained experimental and theoretical data have been used for the accurate identification of the 60 lines in ejected-electron spectra and the 68 lines observed earlier in photoabsorption spectra. The excitation and decay processes for 105 classified states in the 4p55s{}2{nl}, 4p54d{}2{nl} and 4p55s{{nln}}{\\prime }{l}{\\prime } configurations have been considered in detail. In particular, most of the states lying below the ionization threshold of the 4p6 subshell at 26.92 eV possess up to four decay channels with formation of Sr+ in 5s{}1/2, 4d{}3/{2,5/2} and 5p{}1/{2,3/2} states. Two-step autoionization and two-electron Auger transitions with formation of Sr2+ in the 4p6 {}1{{{S}}}0 ground state are the main decay paths for high-lying autoionizing states. The excitation threshold of the 4{{{p}}}6 subshell in Sr has been established at 20.98 ± 0.05 eV.

First Identification of 5,11-Dideoxytetrodotoxin in Marine Animals, and Characterization of Major Fragment Ions of Tetrodotoxin and Its Analogs by High Resolution ESI-MS/MS

PubMed Central

Yotsu-Yamashita, Mari; Abe, Yuka; Kudo, Yuta; Ritson-Williams, Raphael; Paul, Valerie J.; Konoki, Keiichi; Cho, Yuko; Adachi, Masaatsu; Imazu, Takuya; Nishikawa, Toshio; Isobe, Minoru

2013-01-01

Even though tetrodotoxin (TTX) is a widespread toxin in marine and terrestrial organisms, very little is known about the biosynthetic pathway used to produce it. By describing chemical structures of natural analogs of TTX, we can start to identify some of the precursors that might be important for TTX biosynthesis. In the present study, an analog of TTX, 5,11-dideoxyTTX, was identified for the first time in natural sources, the ovary of the pufferfish and the pharynx of a flatworm (planocerid sp. 1), by comparison with totally synthesized (−)-5,11-dideoxyTTX, using high resolution ESI-LC-MS. Based on the presence of 5,11-dideoxyTTX together with a series of known deoxy analogs, 5,6,11-trideoxyTTX, 6,11-dideoxyTTX, 11-deoxyTTX, and 5-deoxyTTX, in these animals, we predicted two routes of stepwise oxidation pathways in the late stages of biosynthesis of TTX. Furthermore, high resolution masses of the major fragment ions of TTX, 6,11-dideoxyTTX, and 5,6,11-trideoxyTTX were also measured, and their molecular formulas and structures were predicted to compare them with each other. Although both TTX and 5,6,11-trideoxyTTX give major fragment ions that are very close, m/z 162.0660 and 162.1020, respectively, they are distinguishable and predicted to be different molecular formulas. These data will be useful for identification of TTXs using high resolution LC-MS/MS. PMID:23924959

Studies on the metabolism and bioactivation of (S)-nicotine and beta-nicotyrine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shigenaga, M.K.

1989-01-01

(S)-Nicotine has long been suspected of contributing to the chronic toxicities associated with the use of cigarettes and other tobacco products. The possibility that (S)-nicotine could contribute to these chronic toxicities by causing irreversible damage to cellular macromolecules has prompted studies aimed at characterizing the metabolic pathways of (S)-nicotine that form reactive metabolites which bind covalently. In order to study these processes, (S)-5-{sup 3}H-nicotine was synthesized by catalytic tritiolysis of (S)-5-bromonicotine with carrier-free tritium gas, purified by HPLC and characterized by tritium NMR, diode array VV and HPLC chromatographic analysis. The metabolism of (S)-5-{sup 3}H-nicotine by rabbit liver and lungmore » microsomal enzymes produced reactive intermediates which bound covalently to microsomal macromolecules in a time, NADPH and cytochrome P-450 dependent manner. The results of studies employing rabbit lung microsomes and agents which inhibit or alter the expression of the cytochrome P-450 isozyme composition in this tissue indicated that the covalent binding of (S)-nicotine requires (S)-nicotine {Delta}{sup 1{prime},5{prime}}-iminium ion as an obligate intermediate and the catalytic activity of lung cytochrome P-450 isozyme-2. Investigations of the effects of (S)-nicotine and related tobacco alkaloids on the oxidation of the Parkinson's disease inducing agent MPTP by the mitochondrial enzyme MAO-B were prompted by the inverse correlation between cigarette smoking and Parkinson's disease. In the author studies (S)-nicotine A{sup 1{prime},5{prime}}-iminium bisperchlorate inhibited the MAOB catalyzed oxidation of MPTP by a linear-mixed type mechanism. Subsequent studies identified {beta}-nicotyrine as a MAO-B catalyzed oxidation product of (S)-nicotine A{sup 1{prime},5{prime}}-iminium ion.« less

Toxic effects of 2-deoxy-D-galactose on Coptotermes formosanus (Isoptera: Rhinotermitidae) and symbionts.

PubMed

Veillon, Lucas; Muniruzzaman, Syed; Henderson, Gregg; Laine, Roger A

2010-10-01

In the interest of developing interventions to infestations by Formosan subterranean termites, Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae), several rare sugars were tested for effects on the termites and symbionts. Among these, the D-galactose analog, 2-deoxy-D-galactose (2deoxyGal) showed promise as a potential control chemical. At a test concentration of 2deoxyGal (320.4 microg/mm3) in water applied to 5-cm filter paper, in bioassays with 20 termite workers, we found that worker termite mortality was significantly affected over a 2-wk period. Subsequent dose-mortality feeding studies confirmed these findings. In addition, consumption of the sugar-treated filter paper by termites caused a significant decrease in hindgut protozoan populations. 2deoxyGal caused dose-dependent termite mortality, taking on average 1 wk to begin killing workers, indicating that it may have promise as a delayed action toxin, which, if added to baits, could allow time after bait discovery for an entire colony to be affected.

Oligomerization reactions of deoxyribonucleotides on montmorillonite clay - The effect of mononucleotide structure, phosphate activation and montmorillonite composition on phosphodiester bond formation

NASA Technical Reports Server (NTRS)

Ferris, James P.; KAMALUDDIN; Ertem, Gozen

1990-01-01

The 2(prime)-d-5(prime)-GMP and 2(prime)-d-5(prime)-AMP bind 2 times more strongly to montmorillonite 22A than do 2(prime)-d-5(prime)-CMP and 5(prime)-TMP. The dinucleotide d(pG)2 forms in 9.2 percent yield and the cyclic dinucleotide c(dpG)2 in 5.4 percent yield in the reaction of 2(prime)-d-5(prime)-GMP with EDAC in the presence of montmorillonite 22A. The yield of dimers which contain the phosphodiester bond decreases as the reaction medium is changed from 0.2 M NaCl to a mixture of 0.2 M NaCl and 0.075 M MgCl2. A low yield of d(pA)2 was observed in the condensation reaction of 5(prime)-ImdpA on montmorillonite 22A. The yield of d(pA)2 obtained when EDAC is used as the condensing agent increases with increasing iron content of the Na(+)-montmorillonite used as catalyst. Evidence is presented which shows that the acidity of the Na(+)-montmorillonite is a necessary but not sufficient factor for the montmorillonite catalysis of phosphodiester bond formation.

Synthesis and biosynthesis of {sup 13}C-, {sup 15}N-labeled deoxynucleosides useful for biomolecular structural determinations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashburn, D.A.; Garcia, K.; Hanners, J.L.

Currently, there is a great emphasis on elucidating the structure, function, and dynamics of DNA. Much of the research involved in this study uses nuclear magnetic resonance (NMR) spectroscopy. Effective use of NMR spectroscopy for DNA molecules with mw > 10,000 requires stable isotope enrichment. We present strategies for site-specific isotopic labeling of the purine bases adenosine and guanosine and the biosynthesis of (U-{sup 13}C, {sup 15}N) DNA from methylotropic bacteria. With commercially available 6-chloropurine, an effective two-step route leads to 2{prime}-deoxy-(amino-{sup 15}N)adenosine (dA). The resulting d(amino-{sup 15}N)A is used in a series of reactions to synthesize 2{prime}-deoxy-(2-{sup 13}C,1,amino-{sup 15}N{submore » 2})guanosine or any combination thereof. An improved biosynthesis of labeled DNA has been accomplished using Methylobacterium extorquens AS1. Each liter of growth medium contains 4 g of methanol to yield 1 g of lyophilized cells. As much as 200 mg of RNA per liter of culture has been obtained. We are currently developing large-scale isolation protocols. General synthetic pathways to oligomeric DNA will be presented.« less

Cardiovascular Activity of Labdane Diterpenes from Andrographis paniculata in Isolated Rat Hearts

PubMed Central

Awang, Khalijah; Abdullah, Nor Hayati; Hadi, A. Hamid A.; Su Fong, Yew

2012-01-01

The dichloromethane (DCM) extract of Andrographis paniculata Nees was tested for cardiovascular activity. The extract significantly reduced coronary perfusion pressure by up to 24.5 ± 3.0 mm Hg at a 3 mg dose and also reduced heart rate by up to 49.5 ± 11.4 beats/minute at this dose. Five labdane diterpenes, 14-deoxy-12-hydroxyandrographolide (1), 14-deoxy-11,12-didehydroandrographolide (2), 14-deoxyandrographolide (3), andrographolide (4), and neoandrographolide (5), were isolated from the aerial parts of this medicinal plant. Bioassay-guided studies using animal model showed that compounds, (2) and (3) were responsible for the coronary vasodilatation. This study also showed that andrographolide (4), the major labdane diterpene in this plant, has minimal effects on the heart. PMID:22536026

Syn- and anti-conformations of 5'-deoxy- and 5'-O-methyl-uridine 2',3'-cyclic monophosphate.

PubMed

Grabarkiewicz, Tomasz; Hoffmann, Marcin

2006-01-01

Two uridine 2',3'-cyclic monophosphate (cUMP) derivatives, 5'-deoxy (DcUMP) and 5'-O-methyl (McUMP), were studied by means of quantum chemical methods. Aqueous solvent effects were estimated based on the isodensity-surface polarized-continuum model (IPCM). Gas phase calculations revealed only slight energy differences between the syn- and anti-conformers of both compounds: the relative energies of the syn-structure are -0.9 and 0.2 kcal mol(-1) for DcUMP and McUMP, respectively. According to the results from the IPCM calculations, however, both syn-conformers become about 14 kcal mol(-1) more stable in aqueous solution than their corresponding anti-structures. Additionally, the effects of a countercation and protonation on DcUMP were studied, revealing that the syn-structure is also favored over the anti-one for these systems.

Omega-3 Long-Chain Fatty Acids in the Heart, Kidney, Liver and Plasma Metabolite Profiles of Australian Prime Lambs Supplemented with Pelleted Canola and Flaxseed Oils.

PubMed

Nguyen, Don V; Le, Van H; Nguyen, Quang V; Malau-Aduli, Bunmi S; Nichols, Peter D; Malau-Aduli, Aduli E O

2017-08-17

The objective of the study was to ascertain whether human health beneficial omega-3 long-chain (≥C 20 ) polyunsaturated fatty acid ( n -3 LC-PUFA) content in heart, kidney and liver can be enhanced by supplementing prime lambs with graded levels of canola and flaxseed oil. Health status of the lambs, as a consequence of the supplementation, was also investigated by examining their plasma metabolites. Sixty purebred and first-cross lambs were allocated to one of five treatments of lucerne hay basal diet supplemented with isocaloric and isonitrogenous wheat-based pellets without oil inclusion (Control) or graded levels of canola oil at 2.5% (2.5C), 5% (5C), flaxseed oil at 2.5% (2.5F) and 5% (5F) in a completely randomised design. Pre-slaughter blood, post-slaughter kidney, liver and heart samples were analysed for plasma metabolite and fatty acid profiles. Summations of docosapentaenoic acid and docosahexaenoic acid, and total n -3 LC-PUFA were enhanced in the liver and kidney of 5F supplemented lambs with a marked decrease in n -6/ n -3 ratio and significant breed differences detected. There were generally no deleterious impacts on animal health status. A combination of 5% oil supplementation and lamb genetics is an effective and strategic management tool for enhancing n -3 LC-PUFA contents of heart, kidney and liver without compromising lamb health.

Omega–3 Long-Chain Fatty Acids in the Heart, Kidney, Liver and Plasma Metabolite Profiles of Australian Prime Lambs Supplemented with Pelleted Canola and Flaxseed Oils

PubMed Central

Nguyen, Don V.; Le, Van H.; Nguyen, Quang V.; Malau-Aduli, Bunmi S.; Nichols, Peter D.

2017-01-01

The objective of the study was to ascertain whether human health beneficial omega–3 long-chain (≥C20) polyunsaturated fatty acid (n-3 LC-PUFA) content in heart, kidney and liver can be enhanced by supplementing prime lambs with graded levels of canola and flaxseed oil. Health status of the lambs, as a consequence of the supplementation, was also investigated by examining their plasma metabolites. Sixty purebred and first-cross lambs were allocated to one of five treatments of lucerne hay basal diet supplemented with isocaloric and isonitrogenous wheat-based pellets without oil inclusion (Control) or graded levels of canola oil at 2.5% (2.5C), 5% (5C), flaxseed oil at 2.5% (2.5F) and 5% (5F) in a completely randomised design. Pre-slaughter blood, post-slaughter kidney, liver and heart samples were analysed for plasma metabolite and fatty acid profiles. Summations of docosapentaenoic acid and docosahexaenoic acid, and total n-3 LC-PUFA were enhanced in the liver and kidney of 5F supplemented lambs with a marked decrease in n-6/n-3 ratio and significant breed differences detected. There were generally no deleterious impacts on animal health status. A combination of 5% oil supplementation and lamb genetics is an effective and strategic management tool for enhancing n-3 LC-PUFA contents of heart, kidney and liver without compromising lamb health. PMID:28817082

Protein-bound polysaccharide-K augments the anticancer effect of fluoropyrimidine derivatives possibly by lowering dihydropyrimidine dehydrogenase expression in gastrointestinal cancers.

PubMed

Mekata, Eiji; Murata, Satoshi; Sonoda, Hiromichi; Shimizu, Tomoharu; Umeda, Tomoko; Shiomi, Hisanori; Naka, Shigeyuki; Yamamoto, Hiroshi; Abe, Hajime; Edamatsu, Takeo; Fujieda, Ayako; Fujioka, Masaki; Wada, Tsutomu; Tani, Tohru

2013-12-01

Protein-bound polysaccharide-K (PSK) enhances the antitumor effect of anticancer drug when used clinically in combination with such drugs. PSK is known to act by immune-mediated mechanisms; however, the relationship between PSK and metabolic enzymes of anticancer drugs is unknown. We used the collagen gel droplet-embedded culture drug sensitivity test (CD-DST) clinically to evaluate the sensitivity of anticancer drugs. In the present study, we modified the CD-DST by adding peripheral blood mononuclear cells (PBMCs) (immuno-CD-DST) and examined the antitumor effect of PSK in combination with anticancer drugs. First, HCT116 human colon cancer cells were cultured with PSK and 5-fluorouracil (5-FU) or 5'-deoxy-5-fluorouridine (5'-DFUR) in the presence or absence of PBMCs, and the antiproliferative effects were compared. In the presence of PBMCs, PSK augmented the inhibitory effects of 5-FU and 5'-DFUR on HCT116 cell proliferation. Next, using human gastric cancer and colon cancer cell lines, the effects of PSK on mRNA expression of various metabolic enzymes of fluoropyrimidines: dihydropyrimidine dehydrogenase (DPD), thymidylate synthase, thymidine phosphorylase and orotate phosphoribosyl transferase, were examined by real-time PCR. PSK significantly enhanced DPD mRNA expression in all of the cancer cell lines tested, but not those of the other enzymes. Addition of IFN-α and TRAIL, cytokines known to inhibit DPD expression, to the cultures reduced DPD mRNA expression in the cancer cells. When PBMC samples collected from healthy volunteers were cultured with PSK, IFN-α mRNA expression increased in 3 of the 5 PBMC samples, while TRAIL mRNA expression was unchanged. The present results propose the possibility that PSK induces PBMCs to express IFN-α which inhibits DPD expression, and consequently augments the antitumor effect of 5-FU or 5'-DFUR. Immuno-CD-DST is useful for evaluating drugs with immunological mechanisms of action.

PCB and DDE methyl sulfones in mammals from Canada and Sweden

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bergman, A.; Kuroki, Hiroaki; Norstrom, R.J.

1994-01-01

Levels of PCB methyl sulfones (MeSO[sub 2]-CBs) and DDE methyl sulfones (MeSO[sub 2]-DDEs) have been determined in tissues from polar bear (Ursus martimus), beluga whale (Delphinapterus leucas), and false killer whale (Pseudorca crassidens) from the Canadian environment, and grey seal (Halichoerus grypus), otter (Lutra lutra), and wild mink (Mustela vison) from the Swedish environment. Up to 30 MeSO[sub 2]-CB congeners and three MeSO[sub 2]-DdE isomers were shown to be present in the analyzed tissues. The concentration of total MeSO[sub 2]-CBs ranged from 0.1 to 21 [mu]g/g extracted lipids. 3-MeSO[sub 2]-2,5,2[prime],4[prime],5[prime]-penta-CB is the dominating MeSO[sub 2]-CB congener in all the analyzedmore » samples, but the corresponding 4-MeSO[sub 2]-CB also is present in high concentrations. A smaller number of MeSO[sub 2]-CBs, always dominated by the meta-substituted MeSO[sub 2]-CBs, were present in livers of grey seal, otter, and mink than in adipose tissue or muscle. In all studied mammals the concentration of MeSO[sub 2]-CBs were higher in liver than in blubber or muscle. Seven PCB congeners were identified as precursors of the PCB methyl sulfones: 2,4,2[prime],5[prime]-tetra-CB (CB-49),2,5,3[prime],4[prime]-tetra-CB (CB-70), 2,4,5,2[prime],5[prime]-penta-CB (CB-101),2,3,4,5,2[prime],5[prime]-penta-CB (CB-87),2,3,6,2[prime],4[prime],5[prime]-hexa-CB (CB-149),2,3,4,2[prime],3[prime],6[prime]-hexa-CB (CB-132), and 2,3,4,2[prime],5[prime]-hexa-CB (CB-141). All species except beluga whale contained 3-MeSO[sub 2]-4,4[prime]-DDE, but at a much lower concentration in mink and otter than in the other mammals. Polar bear and grey seal liver also contained 2-MeSO[sub 2]-4,4[prime]-DDE. The concentration of 2- and 3-MeSo[sub 2]-DDE ranged from 0.01 to 1.3 [mu]g/g extracted lipids.« less

Fenofibrate lowers atypical sphingolipids in plasma of dyslipidemic patients: A novel approach for treating diabetic neuropathy?

PubMed

Othman, Alaa; Benghozi, Renee; Alecu, Irina; Wei, Yu; Niesor, Eric; von Eckardstein, Arnold; Hornemann, Thorsten

2015-01-01

The condensation of palmitoyl-CoA and L-Serine is the first step in the de novo formation of sphingolipids and catalyzed by the serine-palmitoyltransferase (SPT). Besides other acyl-CoAs the SPT can also metabolize L-alanine and glycine, which forms an atypical category of neurotoxic 1-deoxy-sphingolipids (1-deoxySL). Several mutations in SPT are associated with pathologically increased 1-deoxySL levels, which cause the inherited sensory neuropathy HSAN1. 1-DeoxySL levels are also elevated in individuals with the metabolic syndrome and diabetes mellitus type II and seem to be involved in the pathology of the diabetic neuropathy. In previous studies, we observed a strong correlation between plasma 1-deoxySLs and triglycerides (TGs). We were therefore interested whether lowering plasma TG levels also affects plasma sphingolipid and in particular, 1-deoxySL levels. Sixty-six patients with dyslipidemia were treated for 6 wk with the TG-lowering drug fenofibrate (160 mg/d) or extended-release niacin (0.5 g/d for 3 wk, then 1 g/d) with 4 wk of washout between treatments. The sphingoid base profile was analyzed by liquid chromatography-mass spectrometry (LC-MS) before and after each treatment block. Fenofibrate significantly lowered 1-deoxySLs and other atypical sphingoid bases (P < .001) but had no effect on the typical sphingolipids. In contrast, extended-release niacin had no effect on 1-deoxySL levels although both treatments lowered plasma TG levels. The lowering of plasma 1-deoxySL levels by fenofibrate in dyslipidemic patients might be a novel therapeutic approach in the prevention and treatment of diabetic neuropathy. Copyright © 2015 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Biosynthesis of sesquiterpenes in grape berry exocarp of Vitis vinifera L.: evidence for a transport of farnesyl diphosphate precursors from plastids to the cytosol

PubMed Central

May, Bianca; Lange, B. Markus; Wüst, Matthias

2013-01-01

The participation of the mevalonic acid (MVA) and 1-deoxy-D-xylulose 5-phosphate/2-C-methyl-D-erythritol-4-phosphate (DOXP/MEP) pathways in sesquiterpene biosynthesis of grape berries was investigated. There is an increasing interest in this class of terpenoids, since the oxygenated sesquiterpene rotundone was identified as the peppery aroma impact compound in Australian Shiraz wines. To investigate precursor supply pathway utilization, in vivo feeding experiments were performed with the deuterium labeled, pathway specific, precursors [5,5-2H2]-1-deoxy-D-xylulose and [5,5-2H2]-mevalonic acid lactone. Head Space-Solid Phase Micro Extraction-Gas Chromatography-Mass Spectrometry (HS-SPME-GC-MS) analysis of the generated volatile metabolites demonstrated that de novo sesquiterpene biosynthesis is mainly located in the grape berry exocarp (skin), with no detectable activity in the mesocarp (flesh) of the Lemberger variety. Interestingly, precursors from both the (primarily) cytosolic MVA and plastidial DOXP/MEP pathways were incorporated into grape sesquiterpenes in the varieties Lemberger, Gewürztraminer and Syrah. Our labeling data provide evidence for a homogenous, cytosolic pool of precursors for sesquiterpene biosynthesis, indicating that a transport of precursors occurs mostly from plastids to the cytosol. The labeling patterns of the sesquiterpene germacrene D were in agreement with a cyclization mechanism analogous to that of a previously cloned enantioselective (R)-germacrene D synthase from Solidago canadensis. This observation was subsequently confirmed by enantioselective GC-MS analysis demonstrating the exclusive presence of (R)-germacrene D, and not the (S)-enantiomer, in grape berries. PMID:23954075

Biosynthesis of sesquiterpenes in grape berry exocarp of Vitis vinifera L.: evidence for a transport of farnesyl diphosphate precursors from plastids to the cytosol.

PubMed

May, Bianca; Lange, B Markus; Wüst, Matthias

2013-11-01

The participation of the mevalonic acid (MVA) and 1-deoxy-d-xylulose 5-phosphate/2-C-methyl-d-erythritol-4-phosphate (DOXP/MEP) pathways in sesquiterpene biosynthesis of grape berries was investigated. There is an increasing interest in this class of terpenoids, since the oxygenated sesquiterpene rotundone was identified as the peppery aroma impact compound in Australian Shiraz wines. To investigate precursor supply pathway utilization, in vivo feeding experiments were performed with the deuterium labeled, pathway specific, precursors [5,5-(2)H2]-1-deoxy-d-xylulose and [5,5-(2)H2]-mevalonic acid lactone. Head Space-Solid Phase Micro Extraction-Gas Chromatography-Mass Spectrometry (HS-SPME-GC-MS) analysis of the generated volatile metabolites demonstrated that de novo sesquiterpene biosynthesis is mainly located in the grape berry exocarp (skin), with no detectable activity in the mesocarp (flesh) of the Lemberger variety. Interestingly, precursors from both the (primarily) cytosolic MVA and plastidial DOXP/MEP pathways were incorporated into grape sesquiterpenes in the varieties Lemberger, Gewürztraminer and Syrah. Our labeling data provide evidence for a homogenous, cytosolic pool of precursors for sesquiterpene biosynthesis, indicating that a transport of precursors occurs mostly from plastids to the cytosol. The labeling patterns of the sesquiterpene germacrene D were in agreement with a cyclization mechanism analogous to that of a previously cloned enantioselective (R)-germacrene D synthase from Solidago canadensis. This observation was subsequently confirmed by enantioselective GC-MS analysis demonstrating the exclusive presence of (R)-germacrene D, and not the (S)-enantiomer, in grape berries. Copyright © 2013 Elsevier Ltd. All rights reserved.

Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirby, James; Dietzel, Kevin L.; Wichmann, Gale

2016-10-27

Isoprenoids are made by all free-living organisms and range from essential metabolites like sterols and quinones to more complex compounds like pinene and rubber. They are used in many commercial applications and much work has gone into engineering microbial hosts for their production. Isoprenoids are produced either from acetyl-CoA via the mevalonate pathway or from pyruvate and glyceraldehyde 3-phosphate via the 1-deoxy-D-xylulose 5-phosphate (DXP) pathway. Saccharomyces cerevisiae exclusively utilizes the mevalonate pathway to synthesize native isoprenoids and in fact the alternative DXP pathway has never been found or successfully reconstructed in the eukaryotic cytosol. There are, however, several advantages tomore » isoprenoid synthesis via the DXP pathway, such as a higher theoretical yield, and it has long been a goal to transplant the pathway into yeast. In this work, we investigate and address barriers to DXP pathway functionality in S. cerevisiae using a combination of synthetic biology, biochemistry and metabolomics. We report, for the first time, functional expression of the DXP pathway in S. cerevisiae. Under low aeration conditions, an engineered strain relying solely on the DXP pathway for isoprenoid biosynthesis achieved an endpoint biomass 80% of that of the same strain using the mevalonate pathway.« less

Lowering plasma 1-deoxysphingolipids improves neuropathy in diabetic rats.

PubMed

Othman, Alaa; Bianchi, Roberto; Alecu, Irina; Wei, Yu; Porretta-Serapiglia, Carla; Lombardi, Raffaella; Chiorazzi, Alessia; Meregalli, Cristina; Oggioni, Norberto; Cavaletti, Guido; Lauria, Giuseppe; von Eckardstein, Arnold; Hornemann, Thorsten

2015-03-01

1-Deoxysphingolipids (1-deoxySLs) are atypical neurotoxic sphingolipids that are formed by the serine-palmitoyltransferase (SPT). Pathologically elevated 1-deoxySL concentrations cause hereditary sensory and autonomic neuropathy type 1 (HSAN1), an axonal neuropathy associated with several missense mutations in SPT. Oral L-serine supplementation suppressed the formation of 1-deoxySLs in patients with HSAN1 and preserved nerve function in an HSAN1 mouse model. Because 1-deoxySLs also are elevated in patients with type 2 diabetes mellitus, L-serine supplementation could also be a therapeutic option for diabetic neuropathy (DN). This was tested in diabetic STZ rats in a preventive and therapeutic treatment scheme. Diabetic rats showed significantly increased plasma 1-deoxySL concentrations, and L-serine supplementation lowered 1-deoxySL concentrations in both treatment schemes (P < 0.0001). L-serine had no significant effect on hyperglycemia, body weight, or food intake. Mechanical sensitivity was significantly improved in the preventive (P < 0.01) and therapeutic schemes (P < 0.001). Nerve conduction velocity (NCV) significantly improved in only the preventive group (P < 0.05). Overall NCV showed a highly significant (P = 5.2E-12) inverse correlation with plasma 1-deoxySL concentrations. In summary, our data support the hypothesis that 1-deoxySLs are involved in the pathology of DN and that an oral L-serine supplementation could be a novel therapeutic option for treating DN. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

High glucose-induced resistance to 5-fluorouracil in pancreatic cancer cells alleviated by 2-deoxy-D-glucose.

PubMed

Cheng, Yao; Diao, Dongmei; Zhang, Hao; Guo, Qi; Wu, Xuandi; Song, Yongchun; Dang, Chengxue

2014-03-01

Abnormal glucose metabolism from hyperglycemia or diabetes aggravates the progression of pancreatic cancer. It is unknown whether high glucose has an impact on the antitumor effect of 5-fluorouracil (5-Fu) and whether targeting aberrant glucose metabolism using 2-deoxy-D-glucose (2-DG) may reverse this effect in high-glucose microenvironments. The cell viability of AsPC-1 and Panc-1 was analyzed by MTT assay following 5-Fu treatment at different glucose concentrations. Altered sensitivity to 5-Fu by 2-DG was also analyzed. LY294002 was used to inhibit PI3K-Akt signaling to determine the mechanism involved. In response to glucose, 5-Fu-induced cell growth inhibition was attenuated in a dose-dependent manner, accompanied with activated p-Akt, while 2-DG enhanced 5-Fu-induced cell growth inhibition. Moreover, blocking the PI3K/Akt pathway by LY294002 effectively eliminated 2-DG-induced apoptosis. In conclusion, high glucose weakens the antitumor effect of 5-Fu via PI3K / Akt signaling. Using 2-DG in combination with 5-Fu significantly increased their therapeutic effectiveness in high-glucose microenvironments.

Virtual Screening of compounds to 1-deoxy-Dxylulose 5-phosphate reductoisomerase (DXR) from Plasmodium falciparum.

PubMed

Chaudhary, Kamal Kumar; Prasad, C V S Siva

2014-01-01

The 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) protein (Gen Bank ID AAN37254.1) from Plasmodium falciparum is a potential drug target. Therefore, it is of interest to screen DXR against a virtual library of compounds (at the ZINC database) for potential binders as possible inhibitors. This exercise helped to choose 10 top ranking molecules with ZINC00200163 [N-(2,2di methoxy ethyl)-6-methyl-2, 3, 4, 9-tetrahydro-1H-carbazol-1-amine] a having good fit (-6.43 KJ/mol binding energy) with the target protein. Thus, ZINC00200163 is identified as a potential molecule for further comprehensive characterization and in-depth analysis.

Diastereocontrolled Electrophilic Fluorinations of 2-Deoxyribonolactone: Syntheses of All Corresponding 2-Deoxy-2-fluoro-lactones and 2’-Deoxy-2’-fluoro-NAD+s

PubMed Central

Cen, Yana; Sauve, Anthony A.

2009-01-01

Methods to construct 2’-deoxy-2’-fluoro-nucleosides have undergone limited improvement in the last twenty years in spite of substantially increased value of these compounds as pharmaceuticals and as tools for studying biological processes. We herein describe a consolidated approach to synthesize precursors to these commercially and scientifically valuable compounds via diastereocontrolled fluorination of the readily available precursor 2-deoxy-d-ribonolactone. With employment of appropriate sterically bulky silyl protecting groups at 3 and 5 positions, controlled electrophilic fluorination of the Li-ribonolactone enolate by N-fluorodibenezenesulfonamide yielded the corresponding 2-deoxy-2-fluoro-arabino-lactone in high isolated yield (72 %). The protected 2-deoxy-2, 2-difluoro-ribonolactone was obtained similarly in high yield from a second round of electrophilic fluorination (2 steps, 51% from protected ribonolactone starting material). Accomplishment of the difficult ribo-fluorination of the lactone was achieved by the directive effects of a diastereoselectively installed α-trimethylsilyl group. Electrophilic fluorination of a protected 2-deoxy-2-trimethylsilyl-arabino-lactone via enolate generation provided the protected 2-deoxy-2-fluoro-ribo-lactone as the exclusive fluorinated product. The reaction also yielded the starting material, the desilylated protected 2-deoxy-ribonolactone, which was recycled to provide a 38% chemical yield of the fluorinated product (versus initial protected ribonolactone) after consecutive silylation and fluorination cycles. Using our fluorinated sugar precursors we prepared the 2’-fluoro-arabino-, 2’-fluoro-ribo- and 2’,2’-difluoro-nicotinamide adenine dinucleotides (NAD+) of potential biological interest. These syntheses provide the most consolidated and efficient methods for production of sugar precursors of 2’-deoxy-2’-fluoronucleosides and have the advantage of utilizing an air-stable electrophilic fluorinating agent. The fluorinated NAD+s are anticipated to be useful for studying a variety of cellular metabolic and signaling processes. PMID:19958035

A Novel Aldo-Keto Reductase, HdRed, from the Pacific Abalone Haliotis discus hannai, Which Reduces Alginate-derived 4-Deoxy-l-erythro-5-hexoseulose Uronic Acid to 2-Keto-3-deoxy-d-gluconate*

PubMed Central

Mochizuki, Shogo; Nishiyama, Ryuji; Inoue, Akira; Ojima, Takao

2015-01-01

Abalone feeds on brown seaweeds and digests seaweeds' alginate with alginate lyases (EC 4.2.2.3). However, it has been unclear whether the end product of alginate lyases (i.e. unsaturated monouronate-derived 4-deoxy-l-erythro-5-hexoseulose uronic acid (DEH)) is assimilated by abalone itself, because DEH cannot be metabolized via the Embden-Meyerhof pathway of animals. Under these circumstances, we recently noticed the occurrence of an NADPH-dependent reductase, which reduced DEH to 2-keto-3-deoxy-d-gluconate, in hepatopancreas extract of the pacific abalone Haliotis discus hannai. In the present study, we characterized this enzyme to some extent. The DEH reductase, named HdRed in the present study, could be purified from the acetone-dried powder of hepatopancreas by ammonium sulfate fractionation followed by conventional column chromatographies. HdRed showed a single band of ∼40 kDa on SDS-PAGE and reduced DEH to 2-keto-3-deoxy-d-gluconate with an optimal temperature and pH at around 50 °C and 7.0, respectively. HdRed exhibited no appreciable activity toward 28 authentic compounds, including aldehyde, aldose, ketose, α-keto-acid, uronic acid, deoxy sugar, sugar alcohol, carboxylic acid, ketone, and ester. The amino acid sequence of 371 residues of HdRed deduced from the cDNA showed 18–60% identities to those of aldo-keto reductase (AKR) superfamily enzymes, such as human aldose reductase, halophilic bacterium reductase, and sea hare norsolorinic acid (a polyketide derivative) reductase-like protein. Catalytic residues and cofactor binding residues known in AKR superfamily enzymes were fairly well conserved in HdRed. Phylogenetic analysis for HdRed and AKR superfamily enzymes indicated that HdRed is an AKR belonging to a novel family. PMID:26555267

A Novel Aldo-Keto Reductase, HdRed, from the Pacific Abalone Haliotis discus hannai, Which Reduces Alginate-derived 4-Deoxy-L-erythro-5-hexoseulose Uronic Acid to 2-Keto-3-deoxy-D-gluconate.

PubMed

Mochizuki, Shogo; Nishiyama, Ryuji; Inoue, Akira; Ojima, Takao

2015-12-25

Abalone feeds on brown seaweeds and digests seaweeds' alginate with alginate lyases (EC 4.2.2.3). However, it has been unclear whether the end product of alginate lyases (i.e. unsaturated monouronate-derived 4-deoxy-L-erythro-5-hexoseulose uronic acid (DEH)) is assimilated by abalone itself, because DEH cannot be metabolized via the Embden-Meyerhof pathway of animals. Under these circumstances, we recently noticed the occurrence of an NADPH-dependent reductase, which reduced DEH to 2-keto-3-deoxy-D-gluconate, in hepatopancreas extract of the pacific abalone Haliotis discus hannai. In the present study, we characterized this enzyme to some extent. The DEH reductase, named HdRed in the present study, could be purified from the acetone-dried powder of hepatopancreas by ammonium sulfate fractionation followed by conventional column chromatographies. HdRed showed a single band of ∼ 40 kDa on SDS-PAGE and reduced DEH to 2-keto-3-deoxy-D-gluconate with an optimal temperature and pH at around 50 °C and 7.0, respectively. HdRed exhibited no appreciable activity toward 28 authentic compounds, including aldehyde, aldose, ketose, α-keto-acid, uronic acid, deoxy sugar, sugar alcohol, carboxylic acid, ketone, and ester. The amino acid sequence of 371 residues of HdRed deduced from the cDNA showed 18-60% identities to those of aldo-keto reductase (AKR) superfamily enzymes, such as human aldose reductase, halophilic bacterium reductase, and sea hare norsolorinic acid (a polyketide derivative) reductase-like protein. Catalytic residues and cofactor binding residues known in AKR superfamily enzymes were fairly well conserved in HdRed. Phylogenetic analysis for HdRed and AKR superfamily enzymes indicated that HdRed is an AKR belonging to a novel family. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Theoretical study of the A prime 5Sigma(+)g and C double prime 5Pi u states of N2 - Implications for the N2 afterglow

NASA Technical Reports Server (NTRS)

Partridge, Harry; Langhoff, Stephen R.; Bauschlicher, Charles W., Jr.; Schwenke, David W.

1988-01-01

Theoretical spectroscopic constants are reported for the A prime 5Sigma(+)g and C double prime 5Pi u states of N2 based on CASSCF/MRCI calculations using large ANO Gaussian basis sets. The calculated A prime Sigma(+)g potential differs qualitatively from previous calculations in that the inner well is significantly deeper (De = 3450/cm). This deeper well provides considerable support for the suggestion of Berkowitz et al. (1956) that A prime 5Sigma(+)g is the primary precursor state involved in the yellow Lewis-Rayleigh afterglow of N2.

[Development of arbekacin and synthesis of new derivatives stable to enzymatic modifications by methicillin-resistant Staphylococcus aureus].

PubMed

Kondo, S

1994-06-01

Our studies on the resistance mechanisms and chemical modifications of aminoglycoside antibiotics led to the synthesis of arbekacin (ABK), which was refractory to most aminoglycoside-modifying enzymes in resistant bacteria. In 1990, ABK was launched into clinical uses in Japan as a chemotherapeutic agent for the treatment of infections caused by methicillin-resistant Staphylococcus aureus (MRSA). By 1993 only a few MRSA strains moderately resistant to ABK (MIC, 6.25-12.5 micrograms/ml) had clinically been isolated. ABK was modified by the reaction with an excess of an enzyme preparation extracted from an ABK-resistant strain (12.5 micrograms/ml) and three inactivated products were produced, consisting mainly of ABK 2''-phosphate along with small amounts of 6'-N-acetyl-ABK and the doubly modified ABK. Based on these results, replacement of the 2''-hydroxyl by amino group in dibekacin (DKB) or in ABK was designed to obtain potent active derivatives against MRSA. Conversion of the 2''-hydroxyl group by DMSO-DCC oxidation followed by reductive amination with NH4OAc-NaBH3CN gave 2''-amino-2''-deoxy-DKB (D1) and -ABK (A1). Their 5-deoxy (D2 and A2), 5-epifluoro (D3 and A3) and 5-epiamino (D4 and A4) derivatives were also synthesized. All 2''-amino-2''-deoxy-ABK derivatives (A1, A2, A3 and A4) showed excellent activities against MRSA and Gram-negative bacteria, as expected. Among them, A4 having low acute toxicity and nephrotoxicity was selected as a new candidate for anti-MRSA agent.

Biological Evaluation of Uridine Derivatives of 2-Deoxy Sugars as Potential Antiviral Compounds against Influenza A Virus

PubMed Central

Krol, Ewelina; Wandzik, Ilona; Szewczyk, Boguslaw

2017-01-01

Influenza virus infection is a major cause of morbidity and mortality worldwide. Due to the limited ability of currently available treatments, there is an urgent need for new anti-influenza drugs with broad spectrum protection. We have previously shown that two 2-deoxy sugar derivatives of uridine (designated IW3 and IW7) targeting the glycan processing steps during maturation of viral glycoproteins show good anti-influenza virus activity and may be a promising alternative approach for the development of new anti-influenza therapy. In this study, a number of IW3 and IW7 analogues with different structural modifications in 2-deoxy sugar or uridine parts were synthesized and evaluated for their ability to inhibit influenza A virus infection in vitro. Using the cytopathic effect (CPE) inhibition assay and viral plaque reduction assay in vitro, we showed that compounds 2, 3, and 4 exerted the most inhibitory effect on influenza virus A/ostrich/Denmark/725/96 (H5N2) infection in Madin-Darby canine kidney (MDCK) cells, with 50% inhibitory concentrations (IC50) for virus growth ranging from 82 to 100 (μM) without significant toxicity for the cells. The most active compound (2) showed activity of 82 μM with a selectivity index value of 5.27 against type A (H5N2) virus. Additionally, compound 2 reduced the formation of HA glycoprotein in a dose-dependent manner. Moreover, an analysis of physicochemical properties of studied compounds demonstrated a significant linear correlation between lipophilicity and antiviral activity. Therefore, inhibition of influenza A virus infection by conjugates of uridine and 2-deoxy sugars is a new promising approach for the development of new derivatives with anti-influenza activities. PMID:28777309

Identification of 2-keto-3-deoxy-d-Gluconate Kinase and 2-keto-3-deoxy-d-Phosphogluconate Aldolase in an Alginate-Assimilating Bacterium, Flavobacterium sp. Strain UMI-01

PubMed Central

Nishiyama, Ryuji; Inoue, Akira; Ojima, Takao

2017-01-01

Recently, we identified an alginate-assimilating gene cluster in the genome of Flavobacterium sp. strain UMI-01, a member of Bacteroidetes. Alginate lyase genes and a 4-deoxy-l-erythro-5-hexoseulose uronic acid (DEH) reductase gene in the cluster have already been characterized; however, 2-keto-3-deoxy-d-gluconate (KDG) kinase and 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase genes, i.e., flkin and flald, still remained uncharacterized. The amino acid sequences deduced from flkin and flald showed low identities with those of corresponding enzymes of Saccharophagus degradans 2-40T, a member of Proteobacteria (Kim et al., Process Biochem., 2016). This led us to consider that the DEH-assimilating enzymes of Bacteroidetes species are somewhat deviated from those of Proteobacteria species. Thus, in the present study, we first assessed the characteristics in the primary structures of KDG kinase and KDG aldolase of the strain UMI-01, and then investigated the enzymatic properties of recombinant enzymes, recFlKin and recFlAld, expressed by an Escherichia coli expression system. Multiple-sequence alignment among KDG kinases and KDG aldolases from several Proteobacteria and Bacteroidetes species indicated that the strain UMI-01 enzymes showed considerably low sequence identities (15%–25%) with the Proteobacteria enzymes, while they showed relatively high identities (47%–68%) with the Bacteroidetes enzymes. Phylogenetic analyses for these enzymes indicated the distant relationship between the Proteobacteria enzymes and the Bacteroidetes enzymes, i.e., they formed distinct clusters in the phylogenetic tree. recFlKin and recFlAld produced with the genes flkin and flald, respectively, were confirmed to show KDG kinase and KDPG aldolase activities. Namely, recFlKin produced 1.7 mM KDPG in a reaction mixture containing 2.5 mM KDG and 2.5 mM ATP in a 90-min reaction, while recFlAld produced 1.2 mM pyruvate in the reaction mixture containing 5 mM KDPG at the equilibrium state. An in vitro alginate-metabolizing system constructed from recFlKin, recFlAld, and previously reported alginate lyases and DEH reductase of the strain UMI-01 could convert alginate to pyruvate and glyceraldehyde-3-phosphate with an efficiency of 38%. PMID:28216576

Molecular and crystal structure and the Hirshfeld surface analysis of 1-amino-1-deoxy-α-D-sorbopyranose and 1-amino-1-deoxy-α-D-psicopyranose ("D-sorbosamine" and "D-psicosamine") derivatives

NASA Astrophysics Data System (ADS)

Mossine, Valeri V.; Barnes, Charles L.; Mawhinney, Thomas P.

2018-05-01

Sorbosamine and psicosamine are the last two 1-amino-1-deoxy-hexuloses for which no structural data were available. We report on a13C NMR and a single crystal X-ray diffraction study of 1-deoxy-1-(N-methylphenylamino)-D-sorbose (1) and 1-deoxy-1-(N-methylphenylamino)-D-psicose (2). In solutions, both aminosugars are conformationally unstable and establish equilibria, with 90.7% α-pyranose, 3.8% α-furanose, 1.0% β-pyranose, 0.5% β-furanose, and 4.0% acyclic keto form for 1 and 32.4% α-furanose, 27.2% α-pyranose, 21.0% β-pyranose, 9.1% β-furanose, and 11.0% acyclic keto form for 2. X-ray diffraction data provided detailed structural information on 1 and 2 in the α-pyranose form. Both molecules adopt the 5C2 ring conformations, the bond distances and valence angles compare well with respective pyranose structures. All hydroxyl groups in crystal structures of both 1 and 2 participate in two-dimensional hydrogen bonding networks, the H-bonding pattern in 1 is dominated by co-crystallized water molecules. The Hirshfeld surface analysis revealed a significant contribution of non- or weakly polar interactions to the packing forces for both molecules, with crystal structure of 2 featuring short H⋯H contacts. Other structural features found in 2 are a significant planarity of the tertiary amino group (the pyramid heights are 0.127 Å in 2 vs 0.231 Å in 1), a concomitant non-involvement of the amine nitrogen in heteroatom contacts, and a unique anti-periplanar conformation around the C1sbnd C2 bond.

Effects of 5-Fluorodeoxyuridine and Related Halogenated Pyrimidines on the Sand-Dollar Embryo

PubMed Central

Karnofsky, David A.; Basch, Ross S.

1960-01-01

The embryo of the sand-dollar (Echinarachnius parma) was exposed to various concentrations of fluorinated pyrimidines immediately after fertilization. FUDR (5-fluorodeoxyuridine) was most active, and a concentration of 2 to 4 mγ/10 cc. (0.8 to 1.6 x 10-6 m.eq./liter) blocked development at the early blastula stage. Larger doses interrupted development at the same stage. This effect was prevented by thymidine (TDR) and thymine (T); and these pyrimidines protected against many times the minimal lethal concentration of FUDR. TDR was active as a protective agent if added just before early blastula formation. The other fluorinated pyrimidines, 5-fluorouracil (FU), 5-fluorouridine (FUR), 5-fluorocytidine (FCR), 5-fluorodeoxycytidine (FCDR), and 5-fluoroorotic acid (FO), were also studied. These drugs produced effects on embryonic development similar to those seen with FUDR. The effective concentrations, however, varied greatly. T and TDR provided protection against these drugs, but in most cases they were not so effective as against FUDR. 5-Bromodeoxyurdine (BrUDR), beginning at the early blastula stage, caused a random pattern of embryonic death up to the pluteus stage. This drug has been shown to be incorporated into bacterial DNA. BrUDR protected embryos against the early lethal effects of FUDR presumably acting as a thymidine substitute, but the embryos died subsequently in a pattern similar to that seen with BrUDR alone. FUDR and BrUDR appear to inhibit the formation and alter the structure of DNA, respectively, distinctive effects whch may provide a means for studying the role of DNA in embryonic development. PMID:14404541

Effects of 5-fluorodeoxyuridine and related halogenated pyrimidines on the sand-dollar embryo.

PubMed

KARNOFSKY, D A; BASCH, R S

1960-02-01

The embryo of the sand-dollar (Echinarachnius parma) was exposed to various concentrations of fluorinated pyrimidines immediately after fertilization. FUDR (5-fluorodeoxyuridine) was most active, and a concentration of 2 to 4 mgamma/10 cc. (0.8 to 1.6 x 10(-6) m.eq./liter) blocked development at the early blastula stage. Larger doses interrupted development at the same stage. This effect was prevented by thymidine (TDR) and thymine (T); and these pyrimidines protected against many times the minimal lethal concentration of FUDR. TDR was active as a protective agent if added just before early blastula formation. The other fluorinated pyrimidines, 5-fluorouracil (FU), 5-fluorouridine (FUR), 5-fluorocytidine (FCR), 5-fluorodeoxycytidine (FCDR), and 5-fluoroorotic acid (FO), were also studied. These drugs produced effects on embryonic development similar to those seen with FUDR. The effective concentrations, however, varied greatly. T and TDR provided protection against these drugs, but in most cases they were not so effective as against FUDR. 5-Bromodeoxyurdine (BrUDR), beginning at the early blastula stage, caused a random pattern of embryonic death up to the pluteus stage. This drug has been shown to be incorporated into bacterial DNA. BrUDR protected embryos against the early lethal effects of FUDR presumably acting as a thymidine substitute, but the embryos died subsequently in a pattern similar to that seen with BrUDR alone. FUDR and BrUDR appear to inhibit the formation and alter the structure of DNA, respectively, distinctive effects whch may provide a means for studying the role of DNA in embryonic development.

Tn5Prime, a Tn5 based 5' capture method for single cell RNA-seq.

PubMed

Cole, Charles; Byrne, Ashley; Beaudin, Anna E; Forsberg, E Camilla; Vollmers, Christopher

2018-06-01

RNA-sequencing (RNA-seq) is a powerful technique to investigate and quantify entire transcriptomes. Recent advances in the field have made it possible to explore the transcriptomes of single cells. However, most widely used RNA-seq protocols fail to provide crucial information regarding transcription start sites. Here we present a protocol, Tn5Prime, that takes advantage of the Tn5 transposase-based Smart-seq2 protocol to create RNA-seq libraries that capture the 5' end of transcripts. The Tn5Prime method dramatically streamlines the 5' capture process and is both cost effective and reliable. By applying Tn5Prime to bulk RNA and single cell samples, we were able to define transcription start sites as well as quantify transcriptomes at high accuracy and reproducibility. Additionally, similar to 3' end-based high-throughput methods like Drop-seq and 10× Genomics Chromium, the 5' capture Tn5Prime method allows the introduction of cellular identifiers during reverse transcription, simplifying the analysis of large numbers of single cells. In contrast to 3' end-based methods, Tn5Prime also enables the assembly of the variable 5' ends of the antibody sequences present in single B-cell data. Therefore, Tn5Prime presents a robust tool for both basic and applied research into the adaptive immune system and beyond.

CaLecRK-S.5, a pepper L-type lectin receptor kinase gene, confers broad-spectrum resistance by activating priming

PubMed Central

Woo, Joo Yong; Jeong, Kwang Ju; Kim, Young Jin; Paek, Kyung-Hee

2016-01-01

In Arabidopsis, several L-type lectin receptor kinases (LecRKs) have been identified as putative immune receptors. However, to date, there have been few analyses of LecRKs in crop plants. Virus-induced gene silencing of CaLecRK-S.5 verified the role of CaLecRK-S.5 in broad-spectrum resistance. Compared with control plants, CaLecRK-S.5-silenced plants showed reduced hypersensitive response, reactive oxygen species burst, secondary metabolite production, mitogen-activated protein kinase activation, and defense-related gene expression in response to Tobacco mosaic virus pathotype P0 (TMV-P0) infection. Suppression of CaLecRK-S.5 expression significantly enhanced the susceptibility to Pepper mild mottle virus pathotype P1,2,3, Xanthomonas campestris pv. vesicatoria, Phytophthora capsici, as well as TMV-P0. Additionally, β-aminobutyric acid treatment and a systemic acquired resistance assay revealed that CaLecRK-S.5 is involved in priming of plant immunity. Pre-treatment with β-aminobutyric acid before viral infection restored the reduced disease resistance phenotypes shown in CaLecRK-S.5-silenced plants. Systemic acquired resistance was also abolished in CaLecRK-S.5-silenced plants. Finally, RNA sequencing analysis indicated that CaLecRK-S.5 positively regulates plant immunity at the transcriptional level. Altogether, these results suggest that CaLecRK-S.5-mediated broad-spectrum resistance is associated with the regulation of priming. PMID:27647723

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chenna, A.; Singer, B.

Benzene is a carcinogen in rodents and a cause of bone marrow toxicity and leukemia in humans. p-Benzoquinone (p-BQ) is one of the stable metabolites of benzene, as well as of a number of drugs and other chemicals. 2{prime}-Deoxycytidine (dC) and 2{prime}-deoxyadenosine (dA) were allowed to react with p-BQ in aqueous solution at pH 7.4 and 4.5. The yields were considerably higher at pH 4.5 than at pH 7.4 and 4.5. The yields were considerably higher at pH 4.5 than at pH 7.4, as indicated by HPLC analysis. The desired products were isolated by column chromatography on silica gel ormore » cellulose. Identification was done by FAB-MS, {sup 1}H NMR, and UV spectroscopy. The reaction of p-BQ with dC and dA at pH 4.5 produced the exocyclic compounds 3-hydroxy-1,N{sup 4}-benzetheno-2{prime}-deoxycytidine (p-BA-dC), and 9-hydroxy-1,N{sup 6}-benzetheno-2{prime}-deoxyadenosine (p-BQ-dA), respectively, in a large scale and high yield. These adducts have been previously made in a microgram scale as the 3{prime}-phosphate for {sup 32}P-postlabeling studies of their incidence in DNA. The p-BQ-dC and p-BQ-dA adducts have, in addition to the two hydroxyl groups of deoxyribose, one newly formed hydroxyl group a the C-3 or C-9 of the exocyclic base of each product respectively. Incorporation of these adducts into oligonucleotides as the phosphoramidite requires the protection of ll three hydroxyl groups in these compounds. The mass spectroscopic analysis of the DNA oligomers was confirmed by electrospray MS. These oligomers are now under investigation for their biochemical properties. 41 refs., 4 figs.« less

Ceramide synthase inhibition by fumonisin B1 causes accumulation of 1-deoxy-sphinganine: a novel category of bioactive 1-deoxy-sphingoid bases and 1-deoxy-dihydroceramides biosynthesized by mammalian cell lines and animals

USDA-ARS?s Scientific Manuscript database

Fumonisin B1 (FB1) is a mycotoxin that inhibits ceramide synthases (CerS) and causes kidney and liver toxicity and other disease. Inhibition of CerS by FB1 increases sphinganine (Sa), Sa 1-phosphate and a previously unidentified metabolite. Analysis of the latter by quadrupole-time-of-flight mass ...

5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

DOEpatents

Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

1999-06-01

The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

A 2'-deoxy-2'-fluoro-2'-C-methyl uridine cyclopentyl carbocyclic analog and its phosphoramidate prodrug as inhibitors of HCV NS5B polymerase.

PubMed

Liu, Jian; Du, Jinfa; Wang, Peiyuan; Nagarathnam, Dhanapalan; Espiritu, Christine L; Bao, Haiying; Murakami, Eisuke; Furman, Phillip A; Sofia, Michael J

2012-04-01

The 2 '-deoxy-2 '-fluoro-2 '-C-methyluridine nucleotide prodrug, PSI-7851 and its single diastereomer PSI-7977 have displayed potent antiviral activity against hepatitis C virus in clinical trials, and PSI-7977 is currently in Phase III studies. As part of our SAR study of the 2 '-deoxy-2 '-fluoro-2 '- C-methyl class of nucleosides, we prepared the cyclopentyl carbocyclic uridine analog 11 and its phosphoramidate prodrug 15. Both 11 and 15 were shown not to inhibit HCV replication. This lack of activity might be attributed to the inability of the monophosphate to be converted to the corresponding diphosphate or triphosphate or the inactivity of triphosphate of 11 as an inhibitor of the polymerase.

Discovery of 1-((2R,4aR,6R,7R,7aR)-2-Isopropoxy-2-oxidodihydro-4H,6H-spiro[furo[3,2-d][1,3,2]dioxaphosphinine-7,2'-oxetan]-6-yl)pyrimidine-2,4(1H,3H)-dione (JNJ-54257099), a 3'-5'-Cyclic Phosphate Ester Prodrug of 2'-Deoxy-2'-Spirooxetane Uridine Triphosphate Useful for HCV Inhibition.

PubMed

Jonckers, Tim H M; Tahri, Abdellah; Vijgen, Leen; Berke, Jan Martin; Lachau-Durand, Sophie; Stoops, Bart; Snoeys, Jan; Leclercq, Laurent; Tambuyzer, Lotke; Lin, Tse-I; Simmen, Kenny; Raboisson, Pierre

2016-06-23

JNJ-54257099 (9) is a novel cyclic phosphate ester derivative that belongs to the class of 2'-deoxy-2'-spirooxetane uridine nucleotide prodrugs which are known as inhibitors of the HCV NS5B RNA-dependent RNA polymerase (RdRp). In the Huh-7 HCV genotype (GT) 1b replicon-containing cell line 9 is devoid of any anti-HCV activity, an observation attributable to inefficient prodrug metabolism which was found to be CYP3A4-dependent. In contrast, in vitro incubation of 9 in primary human hepatocytes as well as pharmacokinetic evaluation thereof in different preclinical species reveals the formation of substantial levels of 2'-deoxy-2'-spirooxetane uridine triphosphate (8), a potent inhibitor of the HCV NS5B polymerase. Overall, it was found that 9 displays a superior profile compared to its phosphoramidate prodrug analogues (e.g., 4) described previously. Of particular interest is the in vivo dose dependent reduction of HCV RNA observed in HCV infected (GT1a and GT3a) human hepatocyte chimeric mice after 7 days of oral administration of 9.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Safronova, U. I.; Safronova, A. S.; Beiersdorfer, P.

Energy levels, radiative transition probabilities, and autoionization rates for [Ni]more » $$4{s}^{2}4{p}^{6}{nl}$$, [Ni]$$4{s}^{2}4{p}^{5}4l^{\\prime} {nl}$$ ($$l^{\\prime} =d,f,n$$ = 4–7), [Ni]$$4s4{p}^{6}4l^{\\prime} {nl}$$, ($$l^{\\prime} =d,f,n$$ = 4–7), [Ni]$$4{s}^{2}4{p}^{5}5l^{\\prime} {nl}$$ (n = 5–7), and [Ni]$$4s4{p}^{6}6l^{\\prime} {nl}$$ (n = 6–7) states in Rb-like tungsten (W37+) are calculated using the relativistic many-body perturbation theory method (RMBPT code) and the Hartree–Fock-relativistic method (COWAN code). Autoionizing levels above the [Ni]$$4{s}^{2}4{p}^{6}$$ threshold are considered. It is found that configuration mixing among [Ni]$$4{s}^{2}4{p}^{5}4l^{\\prime} {nl}$$ and [Ni]$$4s4{p}^{6}4l^{\\prime} {nl}$$ plays an important role for all atomic characteristics. Branching ratios relative to the first threshold and intensity factors are calculated for satellite lines, and dielectronic recombination (DR) rate coefficients are determined for the [Ni]$$4{s}^{2}4{p}^{6}{nl}$$ (n = 4–7) singly excited states, as well as the [Ni]$$4{s}^{2}4{p}^{5}4{dnl}$$, [Ni]$$4{s}^{2}4{p}^{5}4{fnl}$$, [Ni]$$4s4{p}^{6}4{dnl}$$, [Ni]$$4{s}^{2}4{p}^{6}4{fnl}$$, (n = 4–6), and [Ni]$$4{s}^{2}4{p}^{5}5l^{\\prime} 5l$$ doubly excited nonautoionizing states in Rb-like W37+ ion. Contributions from the [Ni]$$4s24{p}^{6}4{fnl}$$ (n = 6–7), [Ni]$$4{s}^{2}4{p}^{5}5l^{\\prime} {nl}$$ (n = 5–6), and [Ni]$$4{s}^{2}4{p}^{5}6l^{\\prime} {nl}$$ (n = 6–7) doubly excited autoionizing states are evaluated numerically. The high-n state (with n up to 500) contributions are very important for high temperatures. These contributions are determined by using a scaling procedure. Synthetic dielectronic satellite spectra from Rb-like W are simulated in a broad spectral range from 8 to 70 Å. Here, these calculations provide highly accurate values for a number of W 37+ properties useful for a variety of applications including for fusion applications.« less

Inactivation of the ribonucleoside triphosphate reductase from Lactobacillus leichmannii by 2 prime -chloro-2 prime -deoxyuridine 5 prime -triphosphate: A 3 prime -2 prime hydrogen transfer during the formation of 3 prime -keto-2 prime -deoxyuridine 5 prime -triphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashley, G.W.; Harris, G.; Stubbe, J.

1988-10-04

The ribonucleoside triphosphate reductase of Lactobacillus leichmannii converts the substrate analogue 2{prime}-chloro-2{prime}-deoxyuridine 5{prime}-triphosphate (C1UTP) into a mixture of 2{prime}-deoxyuridine triphosphate (dUTP) and the unstable product 3{prime}-keto-2{prime}-deoxyuridine triphosphate (3{prime}-keto-dUTP). This ketone can be trapped by reduction with NaBH{sub 4}, producing a 4:1 mixture of xylo-dUTP and dUTP. When (3{prime}-{sup 3}H)C1UTP is treated with enzyme in the presence of NaBH{sub 4}, the isomeric deoxyuridines isolated after alkaline phosphatase treatment retained 15% of the {sup 3}H in C1UTP. Degradation of these isomeric nucleosides has established the location of the {sup 3}H in 3{prime}-keto-dUTP as predominantly 2{prime}(S). The xylo-dU had 98.6% of its labelmore » at the 2{prime}(S) position and 1.5% at 2{prime}(R). The isolated dU had 89.6% of its label at 2{prime}(S) and 1.4% at 2{prime}(R), with the remaining 9% label inferred to be at the 3{prime}-carbon, this resulting from the direct enzymic production of dUTP. These results are consistent with enzymic production of a 1:1,000 mixture of dUTP and 3{prime}-keto-dUTP, where the 3{prime}-hydrogen of C1UTP is retained at 3{prime} during production of dUTP and is transferred to 2{prime}(S) during production of 3{prime}-keto-dUTP. The implications of these results and the unique role of the cofactor adenosylcobalamin are discussed in terms of reductase being a model for the B{sub 12}-dependent rearrangement reactions.« less

Number Theoretic Background

NASA Astrophysics Data System (ADS)

Rudnick, Z.

Contents: 1. Introduction 2. Divisibility 2.1. Basics on Divisibility 2.2. The Greatest Common Divisor 2.3. The Euclidean Algorithm 2.4. The Diophantine Equation ax+by=c 3. Prime Numbers 3.1. The Fundamental Theorem of Arithmetic 3.2. There Are Infinitely Many Primes 3.3. The Density of Primes 3.4. Primes in Arithmetic Progressions 4. Continued Fractions 5. Modular Arithmetic 5.1. Congruences 5.2. Modular Inverses 5.3. The Chinese Remainder Theorem 5.4. The Structure of the Multiplicative Group (Z/NZ)^* 5.5. Primitive Roots 6. Quadratic Congruences 6.1. Euler's Criterion 6.2. The Legendre Symbol and Quadratic Reciprocity 7. Pell's Equation 7.1. The Group Law 7.2. Integer Solutions 7.3. Finding the Fundamental Solution 8. The Riemann Zeta Function 8.1 Analytic Continuation and Functinal Equation of ζ(s) 8.2 Connecting the Primes and the Zeros of ζ(s) 8.3 The Riemann Hypothesis References

X-ray structures of the Pseudomonas cichorii D-tagatose 3-epimerase mutant form C66S recognizing deoxy sugars as substrates.

PubMed

Yoshida, Hiromi; Yoshihara, Akihide; Ishii, Tomohiko; Izumori, Ken; Kamitori, Shigehiro

2016-12-01

Pseudomonas cichorii D-tagatose 3-epimerase (PcDTE), which has a broad substrate specificity, efficiently catalyzes the epimerization of not only D-tagatose to D-sorbose but also D-fructose to D-psicose (D-allulose) and also recognizes the deoxy sugars as substrates. In an attempt to elucidate the substrate recognition and catalytic reaction mechanisms of PcDTE for deoxy sugars, the X-ray structures of the PcDTE mutant form with the replacement of Cys66 by Ser (PcDTE_C66S) in complexes with deoxy sugars were determined. These X-ray structures showed that substrate recognition by the enzyme at the 1-, 2-, and 3-positions is responsible for enzymatic activity and that substrate-enzyme interactions at the 4-, 5-, and 6-positions are not essential for the catalytic reaction of the enzyme leading to the broad substrate specificity of PcDTE. They also showed that the epimerization site of 1-deoxy 3-keto D-galactitol is shifted from C3 to C4 and that 1-deoxy sugars may bind to the catalytic site in the inhibitor-binding mode. The hydrophobic groove that acts as an accessible surface for substrate binding is formed through the dimerization of PcDTE. In PcDTE_C66S/deoxy sugar complex structures, bound ligand molecules in both the linear and ring forms were detected in the hydrophobic groove, while bound ligand molecules in the catalytic site were in the linear form. This result suggests that the sugar-ring opening of a substrate may occur in the hydrophobic groove and also that the narrow channel of the passageway to the catalytic site allows a substrate in the linear form to pass through.

Genetic and physical mapping of the Treacher Collins syndrome locus with respect to loci in the chromosome 5q3 region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jabs, E.W.; Li, Xiang; Coss, C.

Treacher Collins syndrome is an autosomal dominant, craniofacial developmental disorder, and its locus (TCOF1) has been mapped to chromosome 5q3. To refine the location of the gene within this region, linkage analysis was performed among the TCOF1 locus and 12 loci (IL9, FGFA, GRL, D5S207, D5S210, D5S376, CSF1R, SPARC, D5S119, D5S209, D5S527, FGFR4) in 13 Treacher Collins syndrome families. The highest maximum lod score was obtained between loci TCOF1 and D5S210 (Z = 10.52; [theta] = 0.02 [+-] 0.07). The best order, IL9-GRL-D5S207/D5S210-CSF1R-SPARC-D5S119, and genetic distances among these loci were determined in the 40 CEPH families by multipoint linkage analysis.more » YAC clones were used to establish the order of loci, centromere-5[prime]GRL3[prime]-D5S207-D5S210-D5S376-CSF1R-SPARC-D5S119-telomere. By combining known physical mapping data with ours, the order of chromosome 5q3 markers is centomere-IL9-FGFA-5[prime]GRL3[prime]-D5s207-D5S210-D5S376-CSF1R-SPARC-D5S119-D5S209-FGFR4-telomere. Based on this order, haplotype analysis suggests that the TCOF1 locus resides distal CSF1R and proximal to SPARC within a region less than 1 Mb in size. 29 refs., 2 figs., 2 tabs.« less

Hydrothermal syntheses, crystal structures and luminescence properties of zinc(II) and cadmium(II) coordination polymers based on bifunctional 3,2 Prime :6 Prime ,3 Prime Prime -terpyridine-4 Prime -carboxylic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Na; Guo, Hui-Lin; Hu, Huai-Ming, E-mail: ChemHu1@NWU.EDU.CN

2013-02-15

Five new coordination polymers, [Zn{sub 2}(ctpy){sub 2}Cl{sub 2}]{sub n} (1), [Zn{sub 2}(ctpy){sub 2}(ox)(H{sub 2}O){sub 2}]{sub n} (2), [Zn{sub 2}(ctpy)(3-btc)(H{sub 2}O)]{sub n}{center_dot}0.5nH{sub 2}O (3), [Cd(ctpy){sub 2}(H{sub 2}O)]{sub n} (4), [Cd{sub 4}(ctpy){sub 2}(2-btc){sub 2}(H{sub 2}O){sub 2}]{sub n}{center_dot}2nH{sub 2}O (5), (Hctpy=3,2 Prime :6 Prime ,3 Prime Prime -terpyridine-4 Prime -carboxylic acid, H{sub 2}ox=oxalic acid, H{sub 3}(3-btc)=1,3,5-benzenetricarboxylic acid, H{sub 3}(2-btc)=1,2,4-benzenetricarboxylic acid) have been synthesized under hydrothermal conditions and characterized by elemental analysis, IR spectroscopy, and single-crystal X-ray diffraction. Compounds 1-2 are a one-dimensional chain with weak interactions to form 3D supramolecular structures. Compound 3 is a 4-nodal 3D topology framework comprised of binuclear zincmore » units and (ctpy){sup -} anions. Compound 4 shows two dimensional net. Compound 5 is a (4,5,6)-connected framework with {l_brace}4{sup 4}{center_dot}6{sup 2}{r_brace}{l_brace}4{sup 6}{center_dot}6{sup 4}{r_brace}{sub 2}{l_brace}4{sup 9}{center_dot}6{sup 6}{r_brace} topology. In addition, the thermal stabilities and photoluminescence properties of 1-5 were also studied in the solid state. - Graphical abstract: Five new Zn/Cd compounds with 3,2 Prime :6 Prime ,3 Prime Prime -terpyridine-4 Prime -carboxylic acid were prepared. The photoluminescence and thermal stabilities properties of 1-5 were investigated in the solid state. Highlights: Black-Right-Pointing-Pointer Five new zinc/cadmium metal-organic frameworks have been hydrothermal synthesized. Black-Right-Pointing-Pointer The structural variation is attributed to the diverse metal ions and auxiliary ligand. Black-Right-Pointing-Pointer Compounds 1-5 exhibit 1D ring chain, 2D layer and 3D open-framework, respectively. Black-Right-Pointing-Pointer These compounds exhibit strong solid state luminescence emission at room temperature.« less

Redesigning Aldolase Stereoselectivity by Homologous Grafting.

PubMed

Bisterfeld, Carolin; Classen, Thomas; Küberl, Irene; Henßen, Birgit; Metz, Alexander; Gohlke, Holger; Pietruszka, Jörg

2016-01-01

The 2-deoxy-d-ribose-5-phosphate aldolase (DERA) offers access to highly desirable building blocks for organic synthesis by catalyzing a stereoselective C-C bond formation between acetaldehyde and certain electrophilic aldehydes. DERA´s potential is particularly highlighted by the ability to catalyze sequential, highly enantioselective aldol reactions. However, its synthetic use is limited by the absence of an enantiocomplementary enzyme. Here, we introduce the concept of homologous grafting to identify stereoselectivity-determining amino acid positions in DERA. We identified such positions by structural analysis of the homologous aldolases 2-keto-3-deoxy-6-phosphogluconate aldolase (KDPG) and the enantiocomplementary enzyme 2-keto-3-deoxy-6-phosphogalactonate aldolase (KDPGal). Mutation of these positions led to a slightly inversed enantiopreference of both aldolases to the same extent. By transferring these sequence motifs onto DERA we achieved the intended change in enantioselectivity.

Synthesis and biological evaluation of 6-substituted-5-fluorouridine ProTides.

PubMed

Slusarczyk, Magdalena; Ferla, Salvatore; Brancale, Andrea; McGuigan, Christopher

2018-02-01

A new family of thirteen phosphoramidate prodrugs (ProTides) of different 6-substituted-5-fluorouridine nucleoside analogues were synthesized and evaluated as potential anticancer agents. In addition, antiviral activity against Chikungunya (CHIKV) virus was evaluated using a cytopathic effect inhibition assay. Although a carboxypeptidase Y assay supported a putative mechanism of activation of ProTides built on 5-fluorouridine with such C6-modifications, the Hint docking studies revealed a compromised substrate-activity for the Hint phosphoramidase-type enzyme that is likely responsible for phosphoramidate bioactivation through P-N bond cleavage and free nucleoside 5'-monophosphate delivery. Our observations may support and explain to some extent the poor in vitro biological activity generally demonstrated by the series of 6-substituted-5-fluorouridine phosphoramidates (ProTides) and will be of guidance for the design of novel phosphoramidate prodrugs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Excitation energies, radiative and autoionization rates, dielectronic satellite lines, and dielectronic recombination rates for excited states of Rb-like W from Kr-like W [Relativistic atomic data for Rb-like tungsten

DOE PAGES

Safronova, U. I.; Safronova, A. S.; Beiersdorfer, P.

2016-11-02

Energy levels, radiative transition probabilities, and autoionization rates for [Ni]more » $$4{s}^{2}4{p}^{6}{nl}$$, [Ni]$$4{s}^{2}4{p}^{5}4l^{\\prime} {nl}$$ ($$l^{\\prime} =d,f,n$$ = 4–7), [Ni]$$4s4{p}^{6}4l^{\\prime} {nl}$$, ($$l^{\\prime} =d,f,n$$ = 4–7), [Ni]$$4{s}^{2}4{p}^{5}5l^{\\prime} {nl}$$ (n = 5–7), and [Ni]$$4s4{p}^{6}6l^{\\prime} {nl}$$ (n = 6–7) states in Rb-like tungsten (W37+) are calculated using the relativistic many-body perturbation theory method (RMBPT code) and the Hartree–Fock-relativistic method (COWAN code). Autoionizing levels above the [Ni]$$4{s}^{2}4{p}^{6}$$ threshold are considered. It is found that configuration mixing among [Ni]$$4{s}^{2}4{p}^{5}4l^{\\prime} {nl}$$ and [Ni]$$4s4{p}^{6}4l^{\\prime} {nl}$$ plays an important role for all atomic characteristics. Branching ratios relative to the first threshold and intensity factors are calculated for satellite lines, and dielectronic recombination (DR) rate coefficients are determined for the [Ni]$$4{s}^{2}4{p}^{6}{nl}$$ (n = 4–7) singly excited states, as well as the [Ni]$$4{s}^{2}4{p}^{5}4{dnl}$$, [Ni]$$4{s}^{2}4{p}^{5}4{fnl}$$, [Ni]$$4s4{p}^{6}4{dnl}$$, [Ni]$$4{s}^{2}4{p}^{6}4{fnl}$$, (n = 4–6), and [Ni]$$4{s}^{2}4{p}^{5}5l^{\\prime} 5l$$ doubly excited nonautoionizing states in Rb-like W37+ ion. Contributions from the [Ni]$$4s24{p}^{6}4{fnl}$$ (n = 6–7), [Ni]$$4{s}^{2}4{p}^{5}5l^{\\prime} {nl}$$ (n = 5–6), and [Ni]$$4{s}^{2}4{p}^{5}6l^{\\prime} {nl}$$ (n = 6–7) doubly excited autoionizing states are evaluated numerically. The high-n state (with n up to 500) contributions are very important for high temperatures. These contributions are determined by using a scaling procedure. Synthetic dielectronic satellite spectra from Rb-like W are simulated in a broad spectral range from 8 to 70 Å. Here, these calculations provide highly accurate values for a number of W 37+ properties useful for a variety of applications including for fusion applications.« less

Host cells and methods for producing 1-deoxyxylulose 5-phosphate (DXP) and/or a DXP derived compound

DOEpatents

Kirby, James; Fortman, Jeffrey L.; Nishimoto, Minobu; Keasling, Jay D.

2017-05-02

The present invention provides for a genetically modified host cell capable of producing 1-deoxyxylulose 5-phosphate or 1-deoxy-D-xylulose 5-phosphate (DXP) (12), and optionally one or more DXP derived compounds, comprising: (a) a mutant RibB, or functional variant thereof, capable of catalyzing xylulose 5-phoshpate and/or ribulose 5-phospate to DXP, or (b) a YajO, or functional variant thereof, and a XylB, or functional variant thereof.

Host cells and methods for producing 1-deoxyxylulose 5-phosphate (DXP) and/or a DXP derived compound

DOEpatents

Kirby, James; Fortman, Jeffrey L.; Nishimoto, Minobu; Keasling, Jay D.

2016-07-05

The present invention provides for a genetically modified host cell capable of producing 1-deoxyxylulose 5-phosphate or 1-deoxy-D-xylulose 5-phosphate (DXP) (12), and optionally one or more DXP derived compounds, comprising: (a) a mutant RibB, or functional variant thereof, capable of catalyzing xylulose 5-phosphate and/or ribulose 5-phosphate to DXP, or (b) a YajO, or functional variant thereof, and a XylB, or functional variant thereof.

Sodium metabisulfite–induced polymerization of sickle cell hemoglobin incubated in the extracts of three medicinal plants (Anacardium occidentale, Psidium guajava, and Terminalia catappa)

PubMed Central

Chikezie, Paul Chidoka

2011-01-01

Background: The exploitation and utilization of vast varieties of herbal extracts may serve as alternative measures to deter aggregation of deoxygenated sickle cell hemoglobin (deoxyHbS) molecules. Objective: The present in vitro study ascertained the capacity of three medicinal plants, namely, Anacardium occidentale, Psidium guajava, and Terminalia catappa, to alter polymerization of HbS. Materials and Methods: Spectrophotometric method was used to monitor the level of polymerization of hemolysate HbS molecules treated with sodium metabisulfite (Na2 S2 O5) at a regular interval of 30 s for a period of 180 s in the presence of separate aqueous extracts of A. occidentale, P. guajava, and T. catappa. At time intervals of 30 s, the level of polymerization was expressed as percentage of absorbance relative to the control sample at the 180th s. Results: Although extracts of the three medicinal plants caused significant (P < 0.05) reduction in polymerization of deoxyHbS molecules, the corresponding capacity in this regard diminished with increase in incubation time. Aqueous extract of P. guajava exhibited the highest capacity to reduced polymerization of deoxyHbS molecules. Whereas at t > 60 s, extract concentration of 400 mg% of A. occidentale activated polymerization of deoxyHbS molecules by 6.23±1.34, 14.53±1.67, 21.15±1.89, and 24.42±1.09%, 800 mg% of T. catappa at t > 30 s gave values of 2.50±1.93, 5.09±1.96, 10.00±0.99, 15.38±1.33, and 17.31±0.97%. Conclusion: The capacity of the three medicinal plants to interfere with polymerization of deoxyHbS molecules depended on the duration of incubation and concentration of the extracts. PMID:21716622

Soluble minerals in chemical evolution. II - Characterization of the adsorption of 5-prime-AMP and 5-prime-CMP on a variety of soluble mineral salts

NASA Technical Reports Server (NTRS)

Chan, Stephen; Orenberg, James; Lahav, Noam

1987-01-01

The adsorption of 5-prime-AMP and 5-prime-CMP is studied in the saturated solutions of several mineral salts as a function of pH, ionic strength, and surface area of the solid salt. It is suggested that the adsorption which results from the binding between the nucleotide molecule and the salt surface is due to electrostatic forces. The adsorption is reversible in nature and decreases with increasing ionic strength.

Increasing anthraquinone production by overexpression of 1-deoxy-D: -xylulose-5-phosphate synthase in transgenic cell suspension cultures of Morinda citrifolia.

PubMed

Quevedo, Carla; Perassolo, María; Alechine, Eugenia; Corach, Daniel; Giulietti, Ana María; Talou, Julián Rodriguez

2010-07-01

A Morinda citrifolia cell line was obtained by overexpresion of 1-deoxy-D: -xylulose 5-phosphate synthase (DXS) from Catharanthus roseus, a key enzyme of the metabolic pathway of anthraquinones (AQs). This cell line increased AQs production by about 24% compared to the control cell line. This transgenic cell line which carries dxs cDNA isolated from Catharanthus roseus, was achieved by direct transformation of cell suspension cultures of M. citrifolia using a hypervirulent Agrobacterium tumefaciens strain. The effects of the overexpression of the dxs gene also resulted in increased levels of dxs mRNA transcripts and DXS activity compared to the control cell line. In addition, total phenolics and phenylalanine ammonia-lyase activity were evaluated and were significantly higher in the transgenic line than in controls.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

Prebiotic condensation reactions using cyanamide

NASA Technical Reports Server (NTRS)

Sherwood, E.; Nooner, D. W.; Eichberg, J.; Epps, D. E.; Oro, J.

1978-01-01

Condensation reactions in cyanamide, 4-amino-5-imidazole-carboxamide and cyanamide, imidazole systems under dehydrating conditions at moderate temperatures (60 to 100 deg C) were investigated. The cyanamide, imidazole system was used for synthesis of palmitoylglycerols from ammonium palmitate and glycerol. With the addition of deoxythymidine to the former system, P1, P2-dideoxythymidine 5 prime-phosphate was obtained; the same cyanamide, 4-amino-5-imidazole-carboxamide system was used to synthesize deoxythymidine oligonucleotides using deoxythymidine 5 prime-phosphate and deoxythymidine 5 prime-triphosphate, and peptides using glycine, phenylalanine or isoleucine with adenosine 5 prime-triphosphate. The pH requirements for these reactions make their prebiotic significance questionable; however, it is conceivable that they could occur in stable pockets of low interlayer acidity in a clay such as montmorillonite.

Mineral catalysis of the formation of the phosphodiester bond in aqueous solution: The possible role of montmorillonite clays

NASA Astrophysics Data System (ADS)

Ferris, James P.; Ertem, Gözen; Kamaluddin; Agarwal, Vipin; Hua, Lu Lin

The binding of adenosine to Na+-montmorillonite 22A is greater than 5'-AMP, at neutral pH. Adenine derivatives bind more strongly to the clay than the corresponding uracil derivatives. These data are consistent with the protonation of the adenine by the acidic clay surface and a cationic binding of the protonated ring to the anionic clay surface. Other forces must be operative in the binding of uracil derivatives to the clay since the uracil ring system is not basic. The reaction of the 5'-AMP with water soluble carbodiimide in the presence of Na+-montmorillonite results in the formation of 2',5'-pApA (18.9%), 3',5'-pApA (11%), and AppA (4.8%). When poly(U) is used in place of the clay the product yields are 2',5',-pApA (15.5%), 3',5'-pApA (3.7%) and AppA (14.9%). The cyclic nucleotide, c(pA)2 is also formed when poly(U) is used. AppA is the principal reaction product when neither clay nor poly(U) is present in the reaction mixture. When 2'-deoxy-5'-AMP reacts with carbodiimide in the presence of Na+-montmorillonite 22A the products are dpApA (4.8%), dAppApA (4.5%) and dAppA (17.4%). Cyclic 3',5'-dAMP is the main product (14%) of the reaction of 2'-deoxy-3'-AMP.

Crystallization and X-ray analysis of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nango, Eriko; Kumasaka, Takashi, E-mail: tkumasak@bio.titech.ac.jp; Sato, Takao

2005-07-01

The crystallization of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics, is reported. A recombinant 2-deoxy-scyllo-inosose synthase from Bacillus circulans has been crystallized at 277 K using PEG 4000 as precipitant. The diffraction pattern of the crystal extends to 2.30 Å resolution at 100 K using synchrotron radiation at the Photon Factory. The crystals are monoclinic and belong to space group P2{sub 1}, with unit-cell parameters a = 80.5, b = 70.4, c = 83.0 Å, β = 117.8°. The presence of two molecules per asymmetric unit gives a crystal volume per protein weight (V{sub M})more » of 2.89 Å{sup 3} Da{sup −1} and a solvent constant of 57.4% by volume.« less

Contribution of the priming paradigm to the understanding of the conceptual developmental shift from 5 to 9 years of age.

PubMed

Perraudin, Sandrine; Mounoud, Pierre

2009-11-01

We conducted three experiments to study the role of instrumental (e.g. knife-bread) and categorical (e.g. cake-bread) relations in the development of conceptual organization with a priming paradigm, by varying the nature of the task (naming--Experiment 1--or categorical decision--Experiments 2 and 3). The participants were 5-, 7- and 9-year-old children and adults. The results showed that on both types of task, adults and 9-year-old children presented instrumental and categorical priming effects, whereas 5-year-old children presented mainly instrumental priming effects, with categorical effects remaining marginal. Moreover, the magnitude of the instrumental priming effects decreased with age. Finally, the priming effects observed for 7-year-old children depended on the task, especially for the categorical effects. The theoretical implications of these results for our understanding of conceptual reorganization from 5 to 9 years of age are discussed.

Patterns of fecal gonadal hormone metabolites in the maned wolf (Chrysocyon brachyurus).

PubMed

Songsasen, N; Rodden, M; Brown, J L; Wildt, D E

2006-10-01

Ex situ populations of maned wolves are not viable due to low reproductive efficiency. The objective of this study was to increase knowledge regarding the reproductive physiology of maned wolves to improve captive management. Fecal samples were collected 3-5 d/wk from 12 females of various reproductive age classes (young, prime breeding and aged) and reproductive histories (conceived and raised pups, conceived but lost pups, pseudo-pregnant and unpaired). Ovarian steroids were extracted from feces and assessed by enzyme immunoassay. Concentrations of estrogen metabolites gradually increased, beginning 2-5 d before breeding, and declined to baseline on the day of lordosis and copulation. Fecal progestin metabolite concentrations increased steadily during the periovulatory period, when sexual receptivity was observed, and remained elevated during pregnancy and pseudo-pregnancy. During the luteal phase, young and prime breeding-age females excreted larger amounts of progestins than those of older age classes. Furthermore, progestin concentrations were higher during the luteal phase of pregnant versus pseudo-pregnant bitches. Profiles of fecal progestin metabolites for three singleton females were unchanged throughout the breeding season, suggesting ovulation is induced in this species. However, this finding could be confounded by age, as these females were either young or aged.

Crystal Structure, Conformational Analysis, and Charge Density Distribution for Eng-Epifisetinidol: An Explanation for Regiospecific Aromatic Substitution of 5-Deoxyflavan

Treesearch

Fred L. Tobiason; Frank R. Fronczek; Jan P. Steynberg; Elizabeth C. Steynberg; Richard W. Hemingway; Wayne L. Mattice

1993-01-01

Molecular modeling and molecular orbital analyses of ent-epifisetinidol gave &ood predictions of the approximate "reverse half-chair" conformation found for the crystal structure. MNDO and AM1 analyses of HOMO electron densities provided an explanation for the stereospecific electrophilic aromatic substitution at C(6) in 5-deoxy-flavans...

Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wartchow, C.A.; Wang, Peng; Bednarski, M.D.

1995-12-31

The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonylmore » amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.« less

Individual variability in the human metabolism of an arsenic-containing carbohydrate, 2',3'-dihydroxypropyl 5-deoxy-5-dimethylarsinoyl-beta-D-riboside, a naturally occurring arsenical in seafood.

PubMed

Raml, Reingard; Raber, Georg; Rumpler, Alice; Bauernhofer, Thomas; Goessler, Walter; Francesconi, Kevin A

2009-09-01

We report studies on the variability in human metabolism of an oxo-arsenosugar involving the ingestion of a chemically synthesized arsenosugar and quantitative determination of the arsenic metabolites in urine and serum by HPLC coupled with arsenic-selective mass spectrometric detection (ICPMS, inductively coupled plasma mass spectrometry). The total, four-day, urinary excretion of arsenic for six volunteers ranged widely from ca. 4-95%. The arsenic metabolites present in the urine also showed great variability: high arsenic excretion was accompanied by almost complete biotransformation of the ingested oxo-arsenosugar into a multitude of metabolites (>10), whereas the subjects that excreted low amounts of arsenic produced low quantities of metabolites relative to unchanged oxo-arsenosugar and its thio-analogue. Major arsenic urinary metabolites were dimethylarsinate (DMA) and possible intermediates in the degradation of arsenosugar to DMA, namely, dimethylarsinoylethanol (DMAE) and dimethylarsinoylacetate (DMAA) present both as their oxo- and thio-analogues. Thio-DMAE and thio-DMAA were also found in blood serum indicating that these species were formed in the liver rather than on storage of the urine in the bladder. The large variability in the way individuals metabolize arsenosugars has implications for risk assessment of arsenic intake from seafood.

Formation of Fused-Ring 2′-Deoxycytidine Adducts from 1-Chloro-3-buten-2-one, an in Vitro 1,3-Butadiene Metabolite, under in Vitro Physiological Conditions

PubMed Central

Sun, Liang; Pelah, Avishay; Zhang, Dong-Ping; Zhong, Yu-Fang; An, Jing; Yu, Ying-Xin; Zhang, Xin-Yu; Elfarra, Adnan A.

2013-01-01

1-Chloro-3-buten-2-one (CBO) is a potential metabolite of 1,3-butadiene (BD), a carcinogenic air pollutant. CBO is a bifunctional alkylating agent that readily reacts with glutathione (GSH) to form mono-GSH and di-GSH adducts. Recently, CBO and its precursor 1-chloro-2-hydroxy-3-butene (CHB) were found to be cytotoxic and genotoxic in human liver cells in culture with CBO being approximately 100-fold more potent than CHB. In the present study, CBO was shown to react readily with 2′-deoxycytidine (dC) under in vitro physiological conditions (pH 7.4, 37 °C) to form four dC adducts with the CBO moieties forming fused rings with the N3 and N4 atoms of dC. The four products were structurally characterized as 2-hydroxy-2-hydroxymethyl-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahy dro-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-1 and dC-2, a pair of diastereomers), 4-chloromethyl-4-hydroxy-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahydr o-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-3), and 2-chloromethyl-2-hydroxy-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahydr o-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-4). Interestingly, dC-1 and dC-2 were stable under our experimental conditions (pH 7.4, 37 °C, 6 h) and existed in equilibrium as indicated by HPLC analysis, whereas dC-3 and dC-4 were labile with the half-lives being 3.0 ± 0.36 and 1.7 ± 0.06 h, respectively. Decomposition of dC-4 produced both dC-1 and dC-2, whereas acid hydrolysis of dC-1/dC-2 and dC-4 in 1 M HCl at 100 °C for 30 min yielded the deribosylated adducts dC-1H/dC-2H and dC-4H, respectively. Because fused-ring dC adducts of other chemicals are mutagenic, the characterized CBO-dC adducts could be mutagenic and play a role in the cytotoxicity and genotoxicity of CBO and its precursors, CHB and BD. The CBO-dC adducts may also be used as standards to characterize CBO-DNA adducts and to develop potential biomarkers for CBO formation in vivo. PMID:24020501

Antimicrobial steroidal saponin and oleanane-type triterpenoid saponins from Paullinia pinnata.

PubMed

Lunga, Paul K; Qin, Xu-Jie; Yang, Xing W; Kuiate, Jules-Roger; Du, Zhi Z; Gatsing, Donatien

2014-10-02

Paullinia pinnata L. (Sapindaceae) is an African woody vine, which is widely used in traditional medicine for the treatment of human malaria, erectile dysfunction and bacterial infections. A phytochemical investigation of its methanol leaf and stem extracts led to the isolation of seven compounds which were evaluated for their antimicrobial properties. The extracts were fractionated and compounds were isolated by chromatographic methods. Their structures were elucidated from their spectroscopic data in conjunction with those reported in literature. The antimicrobial activities of the crude extracts, fractions and compounds were evaluated against bacteria, yeasts and dermatophytes using the broth micro-dilution technique. Seven compounds: 2-O-methyl-L-chiro-inositol (1), β-sitosterol (2), friedelin (3), 3β-(β-D-Glucopyranosyloxy) stigmast-5-ene (4), (3β)-3-O-(2'-Acetamido-2'-deoxy-β-D-glucopyranosyl) oleanolic acid (5), (3β,16α-hydroxy)-3-O-(2'-Acetamido-2'-deoxy-β-D-glucopyranosyl) echinocystic acid (6) and (3β)-3-O-[β-D-glucopyranosyl-(1″-3')-2'-acetamido-2'-deoxy-β-D-galactopyranosyl]oleanolic acid (7) were isolated. Compounds 5 and 7 showed the best antibacterial and anti-yeast activities respectively (MIC value range of 0.78-6.25 and 1.56-6.25 μg/ml), while 6 exhibited the best anti-dermatophytic activity (MIC value range of 6.25-25 μg/ml). The results of the present findings could be considered interesting, taking into account the global disease burden of these susceptible microorganisms, in conjunction with the search for alternative and complementary medicines.

Mechanism and Stereochemistry of 5-Dehydroquinate Synthetase*

PubMed Central

Rotenberg, S. L.; Sprinson, D. B.

1970-01-01

3-Deoxy-D-arabino-heptulosonic acid 7-phosphate (DAHP) labeled at C-7 randomly or stereospecifically with tritium and at C-1 with 14C was converted enzymically to 5-dehydroquinate. Tritium of all three substrates was completely retained in 5-dehydroquinate, in accord with formation of a non-ketonizing 6,7-enol intermediate. The 5-dehydroquinates were dehydrated to 5-dehydroshikimate by 5-dehydroquinate dehydratase, which is known to catalyze a cis-elimination. Only 5-dehydroquinate derived from [7-3H](7R)-DAHP lost its tritium in this dehydration, indicating that the configuration at C-7 was inverted in the conversion of DAHP to 5-dehydroquinate. PMID:5275368

Synthesis of 18-hydroxy-19-norcorticosterone and 18-deoxy-19-noraldosterone. Structure determination of related 19-nor steroids by means of 2-D 1H nmr.

PubMed

Harnik, M; Kashman, Y; Carmely, S; Cojocaru, M; Dale, S L; Holbrook, M M; Melby, J C

1986-01-01

The compounds named in the title have been synthesized from the di-(ethylene ketal) of 21-hydroxy-3,20-dioxo-19-norpregn-5-ene-18, 11 beta-lactone and its 5(10)-ene isomer. Reduction of this mixture 1 with sodium aluminum bis-(methoxyethoxy)hydride furnished the 11 beta, 18, 21-triol 2a. Conversion to the 18,21-diacetate 2b, followed by deketalization to the free dione 3 and hydrolysis, afforded 18-hydroxy-19-norcorticosterone 4a which, in the solid state and probably in solution, has the 18,20-hemiacetal structure. Periodate oxidation of 4a gave 11 beta-hydroxy-3-oxo-19-norandrost-4-ene-17 beta, 18-carbolactone 5a, and acid treatment of 4a or its precursor 2a yielded 18-deoxy-19-noraldosterone 6a. The structure of 5a was confirmed by mass spectrometry and 1H nmr, and compared with that of its C-19 methyl homolog 5b and 19-noraldosterone-gamma-etiolactone 8. In particular, 2-D nmr COSY 45 experiments, affording full 1H line assignments, have rigorously established the "natural" beta (axial) configuration of the C-10 hydrogen in the 19-nor lactones 5a and 8, and therefore also in the related 4a, 6a and 19-noraldosterone 7.

Progesterone's 5 alpha-reduced metabolite, 3 alpha,5 alpha-THP, mediates lateral displacement of hamsters.

PubMed

Frye, Cheryl A; Rhodes, Madeline E

2005-03-15

5 alpha-Pregnan-3 alpha-ol-20-one (3 alpha,5 alpha-THP), progesterone (P4)'s 5 alpha-reduced, 3 alpha-hydroxysteroid oxidoreduced product, facilitates lordosis of rodents in part via agonist-like actions at GABA(A)/benzodiazepine receptor complexes in the ventral tegmental area (VTA). Whether 3 alpha,5 alpha-THP influences another reproductively-relevant behavior, lateral displacement, of hamsters was investigated. Lateral displacement is the movement that female hamsters make with their perineum towards male-like tactile stimulation. This behavior facilitates, and is essential for, successful mating. Hamsters in behavioral estrus had greater lateral displacement responses when endogenous progestin levels were elevated compared to when progestin levels were lower. Administration of P4, a prohormone for 3 alpha,5 alpha-THP, dose-dependently (500 > 200 > 100, 50, or 0 microg) enhanced lateral displacement of ovariectomized hamsters that had been primed with SC estradiol benzoate (5 or 10 microg). Inhibiting P4's metabolism to 3 alpha,5 alpha-THP by co-administering finasteride, a 5 alpha-reductase inhibitor, or indomethacin, a 3 alpha-hydroxysteroid oxidoreductase inhibitor, either systemically or to the VTA, significantly decreased lateral displacement and midbrain progestin levels of naturally receptive or hormone-primed hamsters compared to controls. These data suggest that lateral displacement is progestin-sensitive and requires the formation of 3 alpha,5 alpha-THP in the midbrain VTA.

pH profile of the adsorption of nucleotides onto montmorillonite. II - Adsorption and desorption of 5-prime-AMP in iron-calcium montmorillonite systems

NASA Technical Reports Server (NTRS)

Banin, A.; Lawless, J. G.; Mazzurco, J.; Church, F. M.; Margulies, L.; Orenberg, J. B.

1985-01-01

The interaction of 5-prime-AMP with montmorillonite saturated with various ratios of two metals found ubiquitously on the surface of earth, that is, iron and calcium, is investigated. Adsorption and desorption of the nucleotide were studied in the pH range of 2-12 at three levels of addition: 0.080, 0.268 and 0.803 mmole 5-prime-AMP per gram of clay. Two desorption stages were employed - H2O wash and NaOH extraction (pH = 12.0). 5-prime-AMP was preferentially adsorbed on the Fe-containing clays relative to the Ca clay. The nucleotide was fully recovered by the two desorption stages, mostly by the NaOH extraction. The evidence at hand indicates that 5-prime-AMP reaction with clay is affected by electrostatic interactions involving both attraction and repulsion forces. Some specific adsorption, possibly the result of covalent bonding and complex formation with the adsorbed ion, cannot be ruled out for iron but does not appear to operate for calcium. Changes in pH cause varying degrees of attaction and repulsion of 5-prime-AMP and may have been operating on the primitive earth, leading to sequences of adsorption and release of this biomolecule.

Characterization of the functional near-infrared spectroscopy response to nociception in a pediatric population.

PubMed

Olbrecht, Vanessa A; Jiang, Yifei; Viola, Luigi; Walter, Charlotte M; Liu, Hanli; Kurth, Charles D

2018-02-01

Near-infrared spectroscopy can interrogate functional optical signal changes in regional brain oxygenation and blood volume to nociception analogous to functional magnetic resonance imaging. This exploratory study aimed to characterize the near-infrared spectroscopy signals for oxy-, deoxy-, and total hemoglobin from the brain in response to nociceptive stimulation of varying intensity and duration, and after analgesic and neuromuscular paralytic in a pediatric population. We enrolled children 6 months-21 years during propofol sedation before surgery. The near-infrared spectroscopy sensor was placed on the forehead and nociception was produced from an electrical current applied to the wrist. We determined the near-infrared spectroscopy signal response to increasing current intensity and duration, and after fentanyl, sevoflurane, and neuromuscular paralytic. Heart rate and arm movement during electrical stimulation was also recorded. The near-infrared spectroscopy signals for oxy-, deoxy-, and total hemoglobin were calculated as optical density*time (area under curve). During electrical stimulation, nociception was evident: tachycardia and arm withdrawal was observed that disappeared after fentanyl and sevoflurane, whereas after paralytic, tachycardia persisted while arm withdrawal disappeared. The near-infrared spectroscopy signals for oxy-, deoxy-, and total hemoglobin increased during stimulation and decreased after stimulation; the areas under the curves were greater for stimulations 30 mA vs 15 mA (13.9 [5.6-22.2], P = .0021; 5.6 [0.8-10.5], P = .0254, and 19.8 [10.5-29.1], P = .0002 for HbO 2 , Hb, and Hb T , respectively), 50 Hz vs 1 Hz (17.2 [5.8-28.6], P = .0046; 7.5 [0.7-14.3], P = .0314, and 21.9 [4.2-39.6], P = .0177 for HbO 2 , Hb, and Hb T , respectively) and 45 seconds vs 15 seconds (16.3 [3.4-29.2], P = .0188 and 22.0 [7.5-36.5], P = .0075 for HbO 2 and Hb T , respectively); the areas under the curves were attenuated by analgesics but not by paralytic. Near-infrared spectroscopy detected functional activation to nociception in a broad pediatric population. The near-infrared spectroscopy response appears to represent nociceptive processing because the signals increased with noxious stimulus intensity and duration, and were blocked by analgesics but not paralytics. © 2017 John Wiley & Sons Ltd.

5,6-de-epoxy-5-en-7-one-17-hydroxy withaferin A, a new cytotoxic steroid from Withania somnifera L. Dunal leaves.

PubMed

Siddique, Amreen A; Joshi, Pallavi; Misra, Laxminarain; Sangwan, Neelam S; Darokar, Mahendra P

2014-01-01

From the leaves of Withania somnifera L. Dunal, a new withasteroid named as 5,6-de-epoxy-5-en-7-one-17-hydroxy withaferin A (6) was isolated along with several known compounds, namely 16β-acetoxy-6α,7α-epoxy-5α-hydroxy-1-oxowitha-2,17(20),24-trienolide (1), withanone (2), 16-en-27-deoxy withaferin A (3), 27-deoxy withaferin A (4), withaferin A (5), withanolide D (7) and 27-hydroxy withanone (8). Its structure was determined using spectroscopic methods, namely IR, (1)H NMR, (13)C NMR, COSY, HMBC and HRMS. Among the known compounds, 16β-acetoxy-6α,7α-epoxy-5α-hydroxy-1-oxowitha-2,17(20),24-trienolide (1) was previously reported from the roots of W. somnifera. Now, it has been isolated from the leaves, as well. The cytotoxic activity of the new steroid was carried out using the MTT assay against a panel of cancer cell lines, namely MCF-7 (breast), WRL-68 (liver), PC-3 (prostate) and CACO-2 (colon). The results showed that the new compound possesses strong cytotoxic activity against liver and breast cancer with an IC50 of 1.0 μg/mL and a moderate activity against colon (IC50 3.4 μg/mL) and prostate (IC50 7.4 μg/mL) cancer cells.

Solution treatment-delayed zirconium-strengthening behavior in Ti-7.5Mo-xZr alloy system

NASA Astrophysics Data System (ADS)

Chern Lin, Jiin-Huey; Fu, Yen-Han; Chen, Yen-Chun; Peng, Yu-Po; Ju, Chien-Ping

2018-01-01

The present study was devoted to investigate and compare the Zr-strengthening behavior in as-cast (AC) and solution-treated (ST) Ti-7.5Mo-xZr alloys. The experimental results indicated that AC Ti-7.5Mo and AC Ti-7.5Mo-1Zr alloys substantially had an orthorhombic {α }\\prime\\prime phase with a fine, acicular morphology. The content of equi-axed β phase continued to increase with increased Zr content at the expense of {α }\\prime\\prime phase. The threshold Zr content for the formation of β phase in the ST Ti-7.5Mo-xZr alloys was apparently higher than that in the AC Ti-7.5Mo-xZr alloys. The β granular structure was revealed in ST Ti-7.5Mo-5Zr alloy, which increased with increased Zr content. Unlike AC Ti-7.5Mo-9Zr alloy, within each grain of ST Ti-7.5Mo-9Zr alloy were still observed a significant portion of {α }\\prime\\prime morphology. AC Ti-7.5Mo alloy had the lowest YS, lowest tensile modulus and highest elongation among all AC Ti-7.5Mo-xZr alloys. When Zr content increased, both YS and modulus significantly increased while the elongation significantly decreased. Compared to AC Ti-7.5Mo alloy, AC Ti-7.5Mo-9Zr alloy had almost double YS, indicating the effectiveness of Zr-induced strengthening in the AC Ti-7.5Mo-xZr alloys. Compared to AC Ti-7.5Mo, ST Ti-7.5Mo alloys had lower YS, UTS and tensile modulus with almost the same elongation. All the XRD, metallography and tensile test results consistently indicated that the presence of Zr could accelerate the formation of β phase and effectively strengthen the AC Ti-7.5Mo-xZr alloys. A phenomenon of delayed β formation and delayed strengthening was noted in the ST Ti-7.5Mo-xZr alloys, compared to the AC Ti-7.5Mo-xZr alloys.

Organometallic oxides: Preparation, structure, and chemical and physical properties of paramagnetic ((. eta. -C sub 5 H sub 5 )NbCl(. mu. -A)) sup 3 (. mu. sub 3 -OH)(. mu. sub 3 -O) (A = Cl, OH) and other oxo-hydroxo clusters of niobium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bottomley, F.; Keizer, P.N.; White, P.S.

Hydrolysis of Cp{prime}NbCl{sub 4} (Cp{prime} = {eta}{sup 5}-C{sub 5}H{sub 5} (Cp), {eta}-C{sub 5}H{sub 4}Me (Cp{sup 1})) in tetrahydrofuran (THF) gave a mixture of products of general formula (Cp{prime}NbL{sub 4}){sub 2}({mu}-O), where L{sub 4} is a combination of H{sub 2}O and terminal or bridging Cl that gives eight-coordinate, pentavalent, niobium. For Cp{prime} = Cp, a major constituent of the mixture is (CpNb(H{sub 2}O)Cl{sub 3}){sub 2}({mu}-O) {times} 2THF {times} 0.05Et{sub 2}O (1), the structure of which was determined by X-ray diffraction. Reduction of (Cp{prime}NbL{sub 4}){sub 2}({mu}-O) with aluminum powder gave the cluster (Cp{prime}NbCl({mu}-Cl)){sub 3}({mu}{sub 3}-OH)({mu}{sub 3}-O) (2). The structure of 2 (Cp{prime}more » = Cp) as the THF adduct was determined by X-ray diffraction. Crystal data: monoclinic; P2{sub 1}/c; a = 9.966 (1) {angstrom}, b = 12.471 (2) {angstrom}, c = 20.321 (2) {angstrom}, {beta} = 93.86 (1){degree}.« less

Interaction of prostanoid EP3 and TP receptors in guinea-pig isolated aorta: contractile self-synergism of 11-deoxy-16,16-dimethyl PGE2

PubMed Central

Jones, RL; Woodward, DF

2011-01-01

BACKGROUND AND PURPOSE Surprisingly high contractile activity was reported for 11-deoxy-16,16-dimethyl prostaglandin E2 (DX-DM PGE2) on pig cerebral artery when used as a selective EP3 receptor agonist. This study investigated the selectivity profile of DX-DM PGE2, focusing on the interaction between its EP3 and TP (thromboxane A2-like) agonist activities. EXPERIMENTAL APPROACH Contraction of guinea-pig trachea (EP1 system) and aorta (EP3 and TP systems) was measured in conventional organ baths. KEY RESULTS Strong contraction of guinea-pig aorta to sulprostone and 17-phenyl PGE2 (EP3 agonists) was only seen under priming with a second contractile agent such as phenylephrine, histamine or U-46619 (TP agonist). In contrast, DX-DM PGE2 induced strong contraction, which on the basis of treatment with (DG)-3ap (EP3 antagonist) and/or BMS-180291 (TP antagonist) was attributed to self-synergism arising from co-activation of EP3 and TP receptors. EP3/TP self-synergism also accounted for contraction induced by PGF2α and its analogues (+)-cloprostenol and latanoprost-FA. DX-DM PGE2 also showed significant EP1 agonism on guinea-pig trachea as defined by the EP1 antagonists SC-51322, (ONO)-5-methyl-1 and AH-6809, although AH-6809 exhibited poor specificity at concentrations ≥3 µM. CONCLUSIONS AND IMPLICATIONS EP3/TP self-synergism, as seen with PGE/PGF analogues in this study, may confound EP3 agonist potency comparisons and the characterization of prostanoid receptor systems. The competitive profile of a TP antagonist may be distorted by variation in the silent/overt contraction profile of the EP3 system in different studies. The relevance of self-synergism to in vivo actions of natural prostanoid receptor agonists is discussed. PMID:20955363

Deoxy-liquefaction of three different species of macroalgae to high-quality liquid oil.

PubMed

Li, Jinhua; Wang, Guoming; Chen, Ming; Li, Jiedong; Yang, Yaoyao; Zhu, Qiuyan; Jiang, Xiaohuan; Wang, Zonghua; Liu, Haichao

2014-10-01

Three species of macroalgae (Ulva lactuca, Laminaria japonica and Gelidium amansii) were converted into liquid oils via deoxy-liquefaction. The elemental analysis, FTIR and GC-MS results showed that the three liquid oils were all mainly composed of aromatics, phenols, alkanes and alkenes, other oxygen-containing compounds, and some nitrogen-containing compounds though there were some differences in terms of their types or contents due to the different constituents in the macroalgae feedstocks. The oxygen content was only 5.15-7.30% and the H/C molar ratio was up to 1.57-1.73. Accordingly, the HHV of the three oils were 42.50, 41.76 and 40.00 MJ/kg, respectively. The results suggested that U. lactuca, L. japonica and G. amansii have potential as biomass feedstock for fuel and chemicals and that deoxy-liquefaction technique may be an effective way to convert macroalgae into high-quality liquid oil. Copyright © 2014 Elsevier Ltd. All rights reserved.

[Effect of preoperative oral 5'-DFUR on PyNPase level in gastrointestinal malignant tumor tissues].

PubMed

Wang, Wen-Jian; Shi, De; Wang, Shen-Ming

2003-06-01

Pyrimidine nucleoside phosphorylase (PyNPase) exists mainly in tumor tissues.5'-deoxy-5-fluorouridine(5'-DFUR) can decrease its level in tumor tissues. However, the effect of preoperative oral 5'-DFUR on PyNPase level in the different time after administration has not been reported. This study was designed to investigate the suitable duration of preoperative chemotherapy through observing the changes of PyNPase levels in gastrointestinal malignant tumors after preoperative oral administration of 5'- DFUR in different duration. Seventy-three patients with gastrointestinal malignant tumors were divided into four groups by the duration of preoperative oral 5'-DFUR (600-1,200 mg x d(-1)): group A, three days, 27 cases; group B, one week, 22 cases; group C, two weeks, 15 cases; group D, two months, 9 cases. Meanwhile, group E, control group, had 24 inpatients with gastrointestinal malignant tumors at the same term. All the above-mentioned patients did not receive the other chemotherapy or radiotherapy. The changes of PyNPase levels in tumor tissues of different groups were tested using reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry (IHC), etc. (1)Under electron microscope, there were many irrecoverable, lethal changes in tumor cells of group C. The outlines of the tumor cells were normal under light microscope, and more fibroconnective tissues were seen only in the stroma of group D. (2)The expressing levels of PyNPase mRNA and protein production in tumor tissues reduced obviously in group A (0.79+/-0.08, 19.26+/-1.65), and decreased most obviously in group C (0.43+/-0.07,5.91+/-1.45) comparing with group E (0.95+/-0.09, 29.34+/-1.82). However, there was no significant difference between group C and group D (0.42+/-0.04, 5.36+/-1.19) for the levels of PyNPase mRNA and protein production. The correlation coefficient between the levels of PyNPase mRNA and protein in tumor tissues of different group was r=0.92(P< 0.0001). 5'-DFUR by oral administration before operation might destroy gastrointestinal malignant tumor cells. As the duration prolonged, the content of PyNPase in tumor tissues decreased progressively, being lowest level in two weeks after chemotherapy. So two-week duration might be suitable for the treatment.

Enzymatic and antisense effects of a specific anti-Ki-ras ribozyme in vitro and in cell culture.

PubMed Central

Giannini, C D; Roth, W K; Piiper, A; Zeuzem, S

1999-01-01

Due to their mode of action, ribozymes show antisense effects in addition to their specific cleavage activity. In the present study we investigated whether a hammerhead ribozyme is capable of cleaving mutated Ki-ras mRNA in a pancreatic carcinoma cell line and whether antisense effects contribute to the activity of the ribozyme. A 2[prime]-O-allyl modified hammerhead ribozyme was designed to cleave specifically the mutated form of the Ki- ras mRNA (GUU motif in codon 12). The activity was monitored by RT-PCR on Ki- ras RNA expression by determination of the relative amount of wild type to mutant Ki-ras mRNA, by 5-bromo-2[prime]-deoxy-uridine incorporation on cell proliferation and by colony formation in soft agar on malignancy in the human pancreatic adenocarcinoma cell line CFPAC-1, which is heterozygous for the Ki-ras mutation. A catalytically inactive ribozyme was used as control to differentiate between antisense and cleavage activity and a ribozyme with random guide sequences as negative control. The catalytically active anti-Ki-ras ribozyme was at least 2-fold more potent in decreasing cellular Ki-ras mRNA levels, inhibiting cell proliferation and colony formation in soft agar than the catalytically inactive ribozyme. The catalytically active anti-Ki-ras ribozyme, but not the catalytically inactive or random ribozyme, increased the ratio of wild type to mutated Ki-ras mRNA in CFPAC-1 cells. In conclusion, both cleavage activity and antisense effects contribute to the activity of the catalytically active anti-Ki-ras hammerhead ribozyme. Specific ribozymes might be useful in the treatment of pancreatic carcinomas containing an oncogenic GTT mutation in codon 12 of the Ki-ras gene. PMID:10373591

Insertion of part of an intron into the 5[prime] untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conrad, R.; Thomas, J.; Spieth, J.

In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of amore » vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.« less

[Cloning and identification of the priming glycosyltransferase gene involved in exopolysaccharide 139A biosynthesis in Streptomyces].

PubMed

Wang, Ling-Yan; Li, Shi-Tao; Guo, Lian-Hong; Jiang, Rong; Li, Yuan

2003-08-01

Recently in our laboratory, Streptomyces sp. 139 has been identified to produce a new exopolysaccharide designated EPS 139A that shows anti-rheumatic arthritis activity. The strategy of studying EPS 139A biosynthesis is to clone the key gene in the EPS biosynthesis pathway, i.e. the priming glycosyltransferase gene catalyzing the first step of nucleotide sugar transfer. Degenerate primers-based PCR approach was adopted to isolate the putative priming glycosyltransferase gene in Streptomyces sp. 139. According to the genes encoding the priming glycosyltransferases that have been identified in several microorganisms, a multiple alignment of the amino acid sequences of these genes was used to identify regions conserved between all genes. To clone the priming glycosyltransferase gene in Streptomyces sp. 139, degenerate primers were designed from these conserved regions taking into account information on Streptomyces codon usage to amplify an internal DNA fragment of this gene. A distinctive PCR product with the expected size of 0.3 kb was amplified from Streptomyces sp. 139 total genomic DNA. Sequence analysis showed that it is part of a putative priming glycosyltransferase gene and contains the predicted conserved domain B. To isolate the complete priming glycosyltransferase gene, a Streptomyces sp. 139 genomic library was constructed in the E. coli--Streptomyces shuttle vector pOJ446. Using the 0.3 kb PCR product of priming glycosyltransferase gene as a probe, 17 positive colonies were isolated by colony hybridization. A 4.0 kb BamHI fragment from all positive cosmids that hybridized to this probe was sequenced, which revealed the complete priming glycosyltransferase gene. The priming glycosyltransferase gene ste5 (GenBank under accession number AY131229) most likely begins with GTG, preceded by a probable ribosome binding site (RBS), GGGGA. It encodes a 492-amino-acid protein with molecular weight of 54 kDa and isoelectric point of 10.6. The G + C content of ste5 is 73%, close to the average of G + C content (74%) for Streptomyces. Moreover, the preference usage of G or C as third base of codons are found in the ste5, which is in accordance with the Streptomyces codon usage. A BlastP search showed that the C-terminal region of Ste5 shows highly homology with a number of priming glycosyltransferases from many different organisms. Ste5 contains two putative catalytic residues, Glu and Asp (residues 423 and 474) with a spacing of approximately 50 amino acids that conserved in various beta-glycosyltransferases. Moreover, the C-terminal one third of Ste5 contains three domains, A, B and C that is reported to be common to glycosyltransferases. By hydrophilicity plot prediction, the N-terminal two thirds of Ste5 exhibits 5 putative transmembrane domains. To investigate the involvement of the identified polysaccharide gene cluster in EPS 139A biosynthesis, the gene ste5 encoding priming glycosyltransferase was insertionally disrupted by a single-crossover homologous recombination event. A 0.85 kb internal fragment of ste5 was cloned into vector pKC1139 to yield pLY5015 that was transduced into Streptomyces sp. 139. Correct integration in Streptomyces LY1001 ste5- mutant strain was confirmed by Southern hybridization. After fermentation, no EPS 139A could be detected in the cultures of ste5- mutant strain Streptomyces LY1001. Therefore, the gene ste5 identified in this work is involved in the synthesis of the Streptomyces sp. 139 EPS.

Homogeneous catalysts for stereoregular olefin polymerization

DOEpatents

Marks, T.J.; Eisen, M.S.; Giardello, M.A.

1995-10-03

The synthesis, and use as precatalysts of chiral organozirconium complexes for olefin polymerization are disclosed, having the structure (C{sub 5}R{prime}{sub 4{minus}x}R*{sub x})A(C{sub 5}R{double_prime}{sub 4{minus}y}R{double_prime}{prime}{sub y})MQ{sub p}, where x and y represent the number of unsubstituted locations on the cyclopentadienyl ring; R{prime}, R{double_prime}, R{double_prime}{prime}, and R* represent substituted and unsubstituted alkyl groups having 1--30 carbon atoms and R* is a chiral ligand; A is a fragment containing a Group 13, 14, 15, or 16 element of the Periodic Table; M is a Group 3, 4, or 5 metal of the Periodic Table; and Q is a hydrocarbyl radical, or halogen radical, with 3{>=}p{>=}0. Related complexes may be prepared by alkylation of the corresponding dichlorides. In the presence of methylalumoxane or triarylborane cocatalysts, these complexes form ``cation-like`` species which are highly active for olefin polymerization. In combination with a Lewis acid cocatalyst, propylene or other {alpha}-olefin polymerization can be effected with very high efficiency and isospecificity. 1 fig.

Homogeneous catalysts for stereoregular olefin polymerization

DOEpatents

Marks, T.J.; Eisen, M.S.; Giardello, M.A.

1994-07-19

The synthesis, and use as precatalysts of chiral organozirconium complexes for olefin polymerization are disclosed, having the structure (C[sub 5]R[prime][sub 4[minus]x]R*[sub x])-A-(C[sub 5]R[double prime][sub 4[minus]y]R[prime][double prime][sub y])-M-Q[sub p], where x and y represent the number of unsubstituted locations on the cyclopentadienyl ring; R[prime], R[double prime], R[prime][double prime], and R* represent substituted and unsubstituted alkyl groups having 1--30 carbon atoms and R* is a chiral ligand; A is a fragment containing a Group 13, 14, 15, or 16 element of the Periodic Table; M is a Group 3, 4, or 5 metal of the Periodic Table; and Q is a hydrocarbyl radical, or halogen radical, with 3 [<=] p [<=] 0. Related complexes may be prepared by alkylation of the corresponding dichlorides. In the presence of methylalumoxane or triarylborane cocatalysts, these complexes form cation-like'' species which are highly active for olefin polymerization. In combination with a Lewis acid cocatalyst, propylene or other [alpha]-olefin polymerization can be effected with very high efficiency and isospecificity. 1 fig.

Intranasal Live Influenza Vaccine Priming Elicits Localized B Cell Responses in Mediastinal Lymph Nodes.

PubMed

Jegaskanda, Sinthujan; Mason, Rosemarie D; Andrews, Sarah F; Wheatley, Adam K; Zhang, Ruijun; Reynoso, Glennys V; Ambrozak, David R; Santos, Celia P; Luke, Catherine J; Matsuoka, Yumiko; Brenchley, Jason M; Hickman, Heather D; Talaat, Kawsar R; Permar, Sallie R; Liao, Hua-Xin; Yewdell, Jonathan W; Koup, Richard A; Roederer, Mario; McDermott, Adrian B; Subbarao, Kanta

2018-05-01

Pandemic live attenuated influenza vaccines (pLAIV) prime subjects for a robust neutralizing antibody response upon subsequent administration of a pandemic inactivated subunit vaccine (pISV). However, a difference was not detected in H5-specific memory B cells in the peripheral blood between pLAIV-primed and unprimed subjects prior to pISV boost. To investigate the mechanism underlying pLAIV priming, we vaccinated groups of 12 African green monkeys (AGMs) with H5N1 pISV or pLAIV alone or H5N1 pLAIV followed by pISV and examined immunity systemically and in local draining lymph nodes (LN). The AGM model recapitulated the serologic observations from clinical studies. Interestingly, H5N1 pLAIV induced robust germinal center B cell responses in the mediastinal LN (MLN). Subsequent boosting with H5N1 pISV drove increases in H5-specific B cells in the axillary LN, spleen, and circulation in H5N1 pLAIV-primed animals. Thus, H5N1 pLAIV primes localized B cell responses in the MLN that are recalled systemically following pISV boost. These data provide mechanistic insights for the generation of robust humoral responses via prime-boost vaccination. IMPORTANCE We have previously shown that pandemic live attenuated influenza vaccines (pLAIV) prime for a rapid and robust antibody response on subsequent administration of inactivated subunit vaccine (pISV). This is observed even in individuals who had undetectable antibody (Ab) responses following the initial vaccination. To define the mechanistic basis of pLAIV priming, we turned to a nonhuman primate model and performed a detailed analysis of B cell responses in systemic and local lymphoid tissues following prime-boost vaccination with pLAIV and pISV. We show that the nonhuman primate model recapitulates the serologic observations from clinical studies. Further, we found that pLAIVs induced robust germinal center B cell responses in the mediastinal lymph node. Subsequent boosting with pISV in pLAIV-primed animals resulted in detection of B cells in the axillary lymph nodes, spleen, and peripheral blood. We demonstrate that intranasally administered pLAIV elicits a highly localized germinal center B cell response in the mediastinal lymph node that is rapidly recalled following pISV boost into germinal center reactions at numerous distant immune sites. Copyright © 2018 American Society for Microbiology.

Structural Priming as Learning: Evidence from Mandarin-Learning 5-Year-Olds

ERIC Educational Resources Information Center

Hsu, Dong-Bo

2014-01-01

Three experiments on structural priming in Mandarin-speaking 5-year-olds were conducted to test the priming as implicit learning hypothesis. It describes a learning mechanism that acts on a shared abstract syntactic representation in response to linguistic input using an equi-biased Mandarin SVO-"ba" alternation. The first two…

HIV-DNA priming alters T-cell responses to HIV-adenovirus vaccine even when responses to DNA are undetectable1

PubMed Central

De Rosa, Stephen C.; Thomas, Evan P.; Bui, John; Huang, Yunda; deCamp, Allan; Morgan, Cecilia; Kalams, Spyros; Tomaras, Georgia D.; Akondy, Rama; Ahmed, Rafi; Lau, Chuen-Yen; Graham, Barney S.; Nabel, Gary J.; McElrath, M. Juliana

2011-01-01

Many candidate HIV vaccines are designed to primarily elicit T-cell responses. Although repeated immunization with the same vaccine boosts antibody responses, the benefit for T-cell responses is ill-defined. We compared two immunization regimens that include the same recombinant adenoviral serotype 5 (rAd5) boost. Repeated homologous rAd5 immunization fails to increase T-cell responses, but increases gp140 antibody responses ten-fold. DNA prime, as compared with rAd5 prime, directs long-term memory CD8+ T cells toward a terminally differentiated effector memory phenotype with cytotoxic potential. Based on the kinetics of activated cells measured directly ex vivo, the DNA vaccination primes for both CD4+ and CD8+ T cells, despite the lack of detection of the latter until after the boost. These results suggest that heterologous prime-boost combinations have distinct immunological advantages over homologous prime-boosts, and suggest that the effect of DNA on subsequent boosting may not be easily detectable directly after the DNA vaccination. PMID:21844392

Quantification of 5'-deoxy-5'-methylthioadenosine in heat-treated natural rubber latex serum.

PubMed

Pitakpornpreecha, Thanawat; Plubrukarn, Anuchit; Wititsuwannakul, Rapepun

2012-01-01

5'-Deoxy-5'-methylthioadenosine (MTA) is one of the biologically active components found in natural rubber latex (NRL) serum, a common waste product from rubber plantations. In this study the contents of MTA in heat-treated NRL serum were measured in order to assess the potential of the serum as an alternative source of MTA. To devise an HPLC/UV-based quantitative analytical protocol for the determination of MTA, and to determine the effect of heat treatment on the content of MTA in NRL serum from various sources. An HPLC/UV-based determination of MTA using an acidic eluant was devised and validated. In the heat treatment, the effect of refluxing times on MTA liberation was evaluated. The quantification protocol was validated with satisfying linearity, limits of detection and quantitation, precisions for peak areas and recovery percentages from intra- and inter-day operations. The amounts of MTA in the NRL sera from various sources increased with heat treatment to yield 5-12 μg MTA/mL of serum. The devised protocol was found to be satisfyingly applicable to the routine determination of MTA in NRL serum. The effect of heat treatment on the content of MTA also indicated another possible use for NRL serum, normally discarded in vast amounts by the rubber industry, as an alternative source of MTA. Copyright © 2011 John Wiley & Sons, Ltd.

DETECTION AND QUANTIFICATION OF THIO-ARSENOSUGAR IN MARINE MOLLUSKS BY IC-ICP-MS WITH AN EMPHASIS ON THE INTERACTION OF ARSENOSUGARS WITH SULFIDE AS A FUNCTION OF PH

EPA Science Inventory

The sulfar analog of As(328)(2,3-dihydroxypropyl-5-deoxy-5-dimethylarsinoyl-ß-D-riboside), abbreviated (As(328-S), was detected and quantified in five species of marine shellfish using IC-ICP-MS with structural verification via IC-ESI-MS/MS. The CAD spectra produced from the par...

The structural basis of the inhibition of human alpha-mannosidases by azafuranose analogues of mannose.

PubMed Central

Winchester, B; al Daher, S; Carpenter, N C; Cenci di Bello, I; Choi, S S; Fairbanks, A J; Fleet, G W

1993-01-01

Eight pyrrolidine, five pyrrolizidine and one indolizidine analogue(s) of the known alpha-mannosidase inhibitor, the azafuranose, 1,4-dideoxy-1,4-imino-D-mannitol (DIM), have been tested for inhibition of the multiple forms of alpha-mannosidase in human liver in vitro. Substitution of the ring nitrogen markedly decreased or abolished inhibition, but loss of the C-6 hydroxy group, as in 6-deoxy-DIM and 6-deoxy-6-fluoro-DIM, enhanced inhibition, particularly of the lysosomal alpha-mannosidase. Addition of the anomeric substituent-CH2OH decreased inhibition. To be a potent inhibitor of the lysosomal, Golgi II and neutral alpha-mannosidases, a polyhydroxylated pyrrolidine must have the same substituents and chirality as mannofuranose at C-2, C-3, C-4 and C-5. These four chiral centres can also be part of a polyhydroxylated indolizidine, e.g. swainsonine, but not of a pyrrolizidine, e.g. cyclized DIM, ring-contracted swainsonine or 1,7-diepi-australine. DIM did not inhibit lysosomal alpha-mannosidase intracellularly, but both 6-deoxy-DIM and 6-deoxy-6-fluoro-DIM caused accumulation of partially catabolized glycans in normal human fibroblasts. Analysis of these induced storage products by h.p.l.c. showed that both compounds also inhibited Golgi alpha-mannosidase II and that 6-deoxy-6-fluoro-DIM was also a good inhibitor of the endoplasmic reticulum alpha-mannosidase and specific lysosomal alpha (1-6)-mannosidase. None of the mannofuranose analogues appeared to inhibit Golgi alpha-mannosidase I. Images Figure 2 Figure 3 PMID:8457203

Recognition of Nucleoside Monophosphate Substrates by Haemophilus influenzae Class C Acid Phosphatase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Harkewal; Schuermann, Jonathan P.; Reilly, Thomas J.

2010-12-08

The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD{sup +} utilization pathway by dephosphorylating nicotinamide mononucleotide to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases (CCAPs), which are nonspecific 5{prime},3{prime}-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with nicotinamide mononucleotide, 5{prime}-AMP, 3{prime}-AMP, and 2{prime}-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pocketsmore » that contact the ribose and the hydrogen-bonding edge of the base. The span between the hydrophobic box and the phosphoryl site is optimal for recognizing nucleoside monophosphates, explaining the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, consistent with an observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5{prime}-nucleotides and 3{prime}-nucleotides. These pockets minimize the enzyme's direct interactions with the ribose and provide sufficient space to accommodate 5{prime} substrates in an anti conformation and 3{prime} substrates in a syn conformation. Finally, the structures suggest that class B acid phosphatases and CCAPs share a common strategy for nucleotide recognition.« less

Priming and attentional control of lexical and sublexical pathways during naming.

PubMed

Zevin, J D; Balota, D A

2000-01-01

A modified priming task was used to investigate whether skilled readers are able to adjust the degree to which lexical and sublexical information contribute to naming. On each trial, participants named 5 low-frequency exception word primes or 5 nonword primes before a target. The low-frequency exception word primes should have produced a greater dependence on lexical information, whereas the nonword primes should have produced a greater dependence on sublexical information. Across 4 experiments, the effects of lexicality, regularity, frequency, and imageability were all modulated in predictable ways on the basis of the notion that the primes directed attention to specific processing pathways. It is argued that these results are consistent with an attentional control hypothesis.

Redirection of metabolite biosynthesis from hydroxybenzoates to volatile terpenoids in green hairy roots of Daucus carota.

PubMed

Mukherjee, Chiranjit; Samanta, Tanmoy; Mitra, Adinpunya

2016-02-01

A metabolic shift in green hairy root cultures of carrot from phenylpropanoid/benzenoid biosynthesis toward volatile isoprenoids was observed when compared with the metabolite profile of normal hairy root cultures. Hairy roots cultures of Daucus carota turned green under continuous illumination, while the content of the major phenolic compound p-hydroxybenzoic acid (p-HBA) was reduced to half as compared to normal hairy roots cultured in darkness. p-Hydroxybenzaldehyde dehydrogenase (HBD) activity was suppressed in the green hairy roots. However, comparative volatile analysis of 14-day-old green hairy roots revealed higher monoterpene and sesquiterpene contents than found in normal hairy roots. Methyl salicylate content was higher in normal hairy roots than in green ones. Application of clomazone, an inhibitor of 1-deoxy-D-xylulose 5-phosphate synthase (DXS), reduced the amount of total monoterpenes and sesquiterpenes in green hairy roots compared to normal hairy roots. However, methyl salicylate content was enhanced in both green and normal hairy roots treated with clomazone as compared to their respective controls. Because methyl-erythritol 4-phosphate (MEP) and phenylpropanoid pathways, respectively, contribute to the formation of monoterpenes and phenolic acids biosynthesis, the activities of enzymes regulating those pathways were measured in terms of their in vitro activities, in both green and normal hairy root cultures. These key enzymes were 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR), an early regulatory enzyme of the MEP pathway, pyruvate kinase (PK), an enzyme of primary metabolism related to the MEP pathway, shikimate dehydrogenase (SKDH) which is involved in biosynthesis of aromatic amino acids, and phenylalanine ammonia-lyase (PAL) that catalyzes the first step of phenylpropanoid biosynthesis. Activities of DXR and PK were higher in green hairy roots as compared to normal ones, whereas the opposite trend was observed for SKDH and PAL activities. Gene expression analysis of DXR and PAL showed trends similar to those for the respective enzyme activities. Based on these observations, we suggest a possible redirection of metabolites from the primary metabolism toward isoprenoid biosynthesis, limiting the phenolic biosynthetic pathway in green hairy roots grown under continuous light.

Mineral catalysis of the formation of the phosphodiester bond in aqueous solution - The possible role of montmorillonite clays

NASA Technical Reports Server (NTRS)

Ferris, James P.; Ertem, Gozen; KAMALUDDIN; Agarwal, Vipin; Hua, Lu Lin

1989-01-01

The possible role of montmorillonite clays in the spontaneous formation on the primitive earth of the phosphodiester bond in the presence of water was investigated in experiments measuring the binding of various nucleosides and nucleotides with Na(+)-montmorillonite 22A and the reactions of these compounds with a water-soluble carbodiimide. It was found that, at neutral pH, adenine derivatives bind stronger than the corresponding uracil derivatives, consistent with the protonation of the adenine by the acidic clay surface and a cationic binding of the protonated ring to the anionic clay surface. The reaction of the 5-prime-AMP with carbodiimide resulted in the formation of 2-prime,5-prime-pApA (18.9 percent), 3-prime,5-prime-pApA (11 percent), and AppA (4.8 percent). The yields of these oligomers obtained when poly(U) was used in place of the clay were 15.5 percent, 3.7 percent, and 14.9 percent AppA, respectively.

Solanesol Biosynthesis in Plants.

PubMed

Yan, Ning; Liu, Yanhua; Zhang, Hongbo; Du, Yongmei; Liu, Xinmin; Zhang, Zhongfeng

2017-03-23

Solanesol is a non-cyclic terpene alcohol composed of nine isoprene units that mainly accumulates in solanaceous plants. Solanesol plays an important role in the interactions between plants and environmental factors such as pathogen infections and moderate-to-high temperatures. Additionally, it is a key intermediate for the pharmaceutical synthesis of ubiquinone-based drugs such as coenzyme Q10 and vitamin K2, and anti-cancer agent synergizers such as N-solanesyl-N,N'-bis(3,4-dimethoxybenzyl) ethylenediamine (SDB). In plants, solanesol is formed by the 2- C -methyl-d-erythritol 4-phosphate (MEP) pathway within plastids. Solanesol's biosynthetic pathway involves the generation of C5 precursors, followed by the generation of direct precursors, and then the biosynthesis and modification of terpenoids; the first two stages of this pathway are well understood. Based on the current understanding of solanesol biosynthesis, we here review the key enzymes involved, including 1-deoxy-d-xylulose 5-phosphate synthase (DXS), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (DXR), isopentenyl diphosphate isomerase (IPI), geranyl geranyl diphosphate synthase (GGPPS), and solanesyl diphosphate synthase (SPS), as well as their biological functions. Notably, studies on microbial heterologous expression and overexpression of key enzymatic genes in tobacco solanesol biosynthesis are of significant importance for medical uses of tobacco.

Metabolism of pentose sugars in the hyperthermophilic archaea Sulfolobus solfataricus and Sulfolobus acidocaldarius.

PubMed

Nunn, Charlotte E M; Johnsen, Ulrike; Schönheit, Peter; Fuhrer, Tobias; Sauer, Uwe; Hough, David W; Danson, Michael J

2010-10-29

We have previously shown that the hyperthermophilic archaeon, Sulfolobus solfataricus, catabolizes d-glucose and d-galactose to pyruvate and glyceraldehyde via a non-phosphorylative version of the Entner-Doudoroff pathway. At each step, one enzyme is active with both C6 epimers, leading to a metabolically promiscuous pathway. On further investigation, the catalytic promiscuity of the first enzyme in this pathway, glucose dehydrogenase, has been shown to extend to the C5 sugars, D-xylose and L-arabinose. In the current paper we establish that this promiscuity for C6 and C5 metabolites is also exhibited by the third enzyme in the pathway, 2-keto-3-deoxygluconate aldolase, but that the second step requires a specific C5-dehydratase, the gluconate dehydratase being active only with C6 metabolites. The products of this pathway for the catabolism of D-xylose and L-arabinose are pyruvate and glycolaldehyde, pyruvate entering the citric acid cycle after oxidative decarboxylation to acetyl-coenzyme A. We have identified and characterized the enzymes, both native and recombinant, that catalyze the conversion of glycolaldehyde to glycolate and then to glyoxylate, which can enter the citric acid cycle via the action of malate synthase. Evidence is also presented that similar enzymes for this pentose sugar pathway are present in Sulfolobus acidocaldarius, and metabolic tracer studies in this archaeon demonstrate its in vivo operation in parallel with a route involving no aldol cleavage of the 2-keto-3-deoxy-pentanoates but direct conversion to the citric acid cycle C5-metabolite, 2-oxoglutarate.

Mid-aged and aged wild-type and progestin receptor knockout (PRKO) mice demonstrate rapid progesterone and 3alpha,5alpha-THP-facilitated lordosis.

PubMed

Frye, C A; Sumida, K; Lydon, J P; O'Malley, B W; Pfaff, D W

2006-05-01

Progesterone (P) and its 5alpha-reduced metabolite, 3alpha-hydroxy-5alpha-pregnan-20-one (3alpha,5alpha-THP), facilitate sexual behavior of rodents via agonist-like actions at intracellular progestin receptors (PRs) and membrane GABA(A)/benzodiazepine receptor complexes (GBRs), respectively. Given that ovarian secretion of progestins declines with aging, whether or not senescent mice are responsive to progestins was of interest. Homozygous PR knockout (PRKO) or wild-type mice that were between 10-12 (mid-aged) or 20-24 (aged) months of age were administered P or 3alpha,5alpha-THP, and the effect on lordosis were examined. Effects of a progestin-priming regimen that enhances PR-mediated (experiment 1) or more rapid, PR-independent effects of progestins (experiments 2 and 3) on sexual behavior were examined. Levels of P, 3alpha,5alpha-THP, and muscimol binding were examined in tissues from aged mice (experiment 4). Wild-type, but not PRKO, mice were responsive when primed with 17beta-estradiol (E(2); 0.5 microg) and administered P (500 microg, subcutaneously). Mid-aged wild-type mice demonstrated greater increases in lordosis 6 h later compared to their pre-P, baseline test than did aged wild-type mice (experiment 1). Lordosis of younger and older wild-type, but not PRKO, mice was significantly increased within 5 min of intravenous (IV) administration of P (100 ng), compared with E(2)-priming alone (experiment 2). However, wild-type and PRKO mice demonstrated significant increases in lordosis 5 min after IV administration of 3alpha,5alpha-THP, an effect which was more pronounced in mid-aged than in aged animals (100 ng-experiment 3). In tissues from aged wild-type and PRKO mice, levels of P, 3alpha,5alpha-THP, and muscimol binding were increased by P administration (experiment 4). PR binding was lower in the cortex of PRKO than that of wild-type mice. Mid-aged and aged PRKO and wild-type mice demonstrated rapid P or 3alpha,5alpha-THP-facilitated lordosis that may be, in part, independent of activity at PRs.

Experimental Determination of the Electric Dipole Moment Function of the X Pi-2 Hydroxyl Radical

NASA Technical Reports Server (NTRS)

Chackerian, C., Jr.; Goorvitch, D.; Abrams, M. C.; Davis, S. P.; Benidar, A.; Farrenq, R.; Guelachvili, G.; Strawa, Anthony W. (Technical Monitor)

1995-01-01

Laboratory infrared emission spectra of X 2piOH obtained with the Solar McMath FTS and the U. Paris (Orsay) FTS are used in an inversion procedure to experimentally determine the electric dipole moment function (EDMF) of the hydroxyl radical. The spectra produced at Kitt Peak show vibrational levels up to v = 10 and rotational lines in the range, -25.5 less than or equal to m less than or equal to 12.5. The following vibrational quantum number ranges were observed: for DELTA v = -1, v prime = 1 - 9, for DELTA v = -2, v prime = 2 - 10, and for DELTA v = - 3, v prime = 6 - 10. The spectra produced at Orsay show DELTA v = -1, with v prime = 1 - 4 and -22.5 less than or equal to m less than or equal to 9.5 as well as DELTA v = 0, with v prime= 1 - 3, and 9.5 less than or equal to m less than or equal to 25.5. The OH rovibrational wavefunctions used in the inversion procedure were calculated using a procedure which reproduces observed rotational constants with a high level of accuracy. Comparisons of our EDMF are made with previous experimental and theoretical work.

Potent inhibition of HhaI DNA methylase by the aglycon of 2-(1H)-pyrimidinone riboside (zebularine) at the GCGC recognition domain.

PubMed

Marquez, Victor E; Eritja, Ramon; Kelley, James A; Vanbemmel, Dana; Christman, Judith K

2003-12-01

A short oligodeoxynucleotide (ODN) with 2-(1H)-pyrimidinone at the HhaI DNA methyltransferase target site (GCGC) is shown to induce a level of inhibition of methyl transfer and thermal stability of the complex with the enzyme identical to that achieved with a similar ODN substituted with 5-azacytosine. The drugs responsible for these effects-zebularine and 5-azacytidine/2'-deoxy-5-azacytidine-are contrasted in terms of chemical stability and possible metabolic activation by a brief structure-activity analysis.

40 CFR 180.505 - Emamectin; tolerances for residues.

Code of Federal Regulations, 2011 CFR

2011-07-01

... residues of emamectin (a mixture of a minimum of 90% 4′-epi-methylamino-4′-deoxyavermectin B1a and maximum of 10% 4′-epi-methylamino-4′-deoxyavermectin B1b) and its metabolites 8,9-isomer of the B1a and B1b component of the parent (8,9-ZMA), or 4′-deoxy-4′-epi-amino-avermectin B1a and 4′-deoxy-4′-epi-amino...

Acoustic imprinting leads to differential 2-deoxy-D-glucose uptake in the chick forebrain.

PubMed Central

Maier, V; Scheich, H

1983-01-01

This report describes experiments in which successful acoustic imprinting correlates with differential uptake of D-2-deoxy[14C]glucose in particular forebrain areas that are not considered primarily auditory. Newly hatched guinea chicks (Numida meleagris meleagris) were imprinted by playing 1.8-kHz or 2.5-kHz tone bursts for prolonged periods. Those chicks were considered to be imprinted who approached the imprinting stimulus (emitted from a loudspeaker) and preferred it over a new stimulus in a simultaneous discrimination test. In the 2-deoxy-D-glucose experiment all chicks, imprinted and naive, were exposed to 1.8-kHz tone bursts for 1 hr. As shown by the autoradiographic analysis of the brains, neurons in the 1.8-kHz isofrequency plane of the auditory "cortex" (field L) were activated in all chicks, whether imprinted or not. However, in the most rostral forebrain striking differences were found. Imprinted chicks showed an increased 2-deoxy-D-glucose uptake in three areas, as compared to naive chicks: (i) the lateral neostriatum and hyperstriatum ventrale, (ii) a medial magnocellular field (medial neostriatum/hyperstriatum ventrale), and (iii) the most dorsal layers of the hyperstriatum. Based on these findings we conclude that these areas are involved in the processing of auditory stimuli once they have become meaningful by experience. Images PMID:6574519

Localization of 1-deoxysphingolipids to mitochondria induces mitochondrial dysfunction[S

PubMed Central

Alecu, Irina; Tedeschi, Andrea; Behler, Natascha; Wunderling, Klaus; Lamberz, Christian; Lauterbach, Mario A. R.; Gaebler, Anne; Ernst, Daniela; Van Veldhoven, Paul P.; Al-Amoudi, Ashraf; Latz, Eicke; Othman, Alaa; Kuerschner, Lars; Hornemann, Thorsten; Bradke, Frank; Thiele, Christoph; Penno, Anke

2017-01-01

1-Deoxysphingolipids (deoxySLs) are atypical sphingolipids that are elevated in the plasma of patients with type 2 diabetes and hereditary sensory and autonomic neuropathy type 1 (HSAN1). Clinically, diabetic neuropathy and HSAN1 are very similar, suggesting the involvement of deoxySLs in the pathology of both diseases. However, very little is known about the biology of these lipids and the underlying pathomechanism. We synthesized an alkyne analog of 1-deoxysphinganine (doxSA), the metabolic precursor of all deoxySLs, to trace the metabolism and localization of deoxySLs. Our results indicate that the metabolism of these lipids is restricted to only some lipid species and that they are not converted to canonical sphingolipids or fatty acids. Furthermore, exogenously added alkyne-doxSA [(2S,3R)-2-aminooctadec-17-yn-3-ol] localized to mitochondria, causing mitochondrial fragmentation and dysfunction. The induced mitochondrial toxicity was also shown for natural doxSA, but not for sphinganine, and was rescued by inhibition of ceramide synthase activity. Our findings therefore indicate that mitochondrial enrichment of an N-acylated doxSA metabolite may contribute to the neurotoxicity seen in diabetic neuropathy and HSAN1. Hence, we provide a potential explanation for the characteristic vulnerability of peripheral nerves to elevated levels of deoxySLs. PMID:27881717

Targeted deletion of Atg5 in chondrocytes promotes age-related osteoarthritis.

PubMed

Bouderlique, Thibault; Vuppalapati, Karuna K; Newton, Phillip T; Li, Lei; Barenius, Björn; Chagin, Andrei S

2016-03-01

It has been suggested that the lysosomal recycling process called macro-autophagy plays a role in osteoarthritis development. We thus decided to genetically ablate the autophagy-indispensable Atg5 gene specifically in chondrocytes and analyse the development of osteoarthritis upon aging and in a post-traumatic model. Mice lacking the Atg5 gene in their chondrocytes (Atg5cKO) were generated by crossing Atg5-floxed mice with transgenic mice that expressed cre recombinase driven by the collagen type 2 promoter. Animals were analysed at the age of 2, 6 and 12 months for age-related osteoarthritis or underwent mini-open partial medial meniscectomy at 2 months of age and were analysed 1 or 2 months after surgery. We evaluated osteoarthritis using the Osteoarthritis Research Society International (OARSI) scoring on safranin-O-stained samples. Cell death was evaluated by terminal deoxy-nucleotidyl-transferase-mediated deoxy-UTP nick end labelling (TUNEL) and by immunostaining of cleaved caspases. We observed the development of osteoarthritis in Atg5cKO mice with aging including fibrillation and loss of proteoglycans, which was particularly severe in males. The ablation of Atg5 was associated with an increased cell death as assessed by TUNEL, cleaved caspase 3 and cleaved caspase 9. Surprisingly, no difference in the development of post-traumatic osteoarthritis was observed between Atg5cKO and control mice. Autophagy protects from age-related osteoarthritis by facilitating chondrocyte survival. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Lamellar crystalline self-assembly behaviour and solid lipid nanoparticles of a palmityl prodrug analogue of Capecitabine—A chemotherapy agent

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gong, Xiaojuan; Moghaddam, Minoo J.; Sagnella, Sharon M.

2014-09-24

An amphiphile prodrug, 5'-deoxy-5-fluoro-N 4-(palmityloxycarbonyl) cytidine or 5'-deoxy-5-fluoro-N 4-(hexadecanaloxycarbonyl) cytidine (5-FCPal), consisting of the same head group as the commercially available chemotherapeutic agent Capecitabine, linked to a palmityl hydrocarbon chain via a carbamate bond is reported. Thermal analysis of this prodrug indicates that it melts at ~115 °C followed quickly by degradation beginning at ~120 °C. The neat solid 5-FCPal amphiphile acquires a lamellar crystalline arrangement with a d-spacing of 28.6 ± 0.3 Å, indicating interdigitation of the hydrocarbon chains. Under aqueous conditions, solid 5-FCPal is non-swelling and no lyotropic liquid crystalline phase formation is observed. In order to assessmore » the in vitro toxicity and in vivo efficacy in colloidal form, solid lipid nanoparticles (SLNs) with an average size of ~700 nm were produced via high pressure homogenization. The in vitro toxicity of the 5-FCPal SLNs against several different cancer and normal cell types was assessed over a 48 h period, and IC 50 values were comparable to those observed for Capecitabine. The in vivo efficacy of the 5-FCPal SLNs was then assessed against the highly aggressive mouse 4T1 breast cancer model. To do so, the prodrug SLNs were administered orally at 3 different dosages (0.1, 0.25, 0.5 mmol/mouse/day) and compared to Capecitabine delivered at the same dosages. After 21 days of receiving the treatments, the 0.5 mmol dose of 5-FCPal exhibited the smallest average tumour volume. Since 5-FCPal is activated in a similar manner to Capecitabine via a 3 step enzymatic pathway with the final step occurring preferentially at the tumour site, formulation of the prodrug into SLNs combines the advantage of selective, localized activation with the sustained release properties of nanostructured amphiphile self-assembly and multiple payload materials thereby potentially creating a more effective anticancer agent.« less

Quantitative autoradiographic mapping of focal herpes simplex virus encephalitis using a radiolabeled antiviral drug

DOE Office of Scientific and Technical Information (OSTI.GOV)

Price, R.

1984-12-18

A method of mapping herpes simplex viral infection comprising administering a radiolabeled antiviral active 5-substituted 1-(2'-deoxy-2'-substituted-D-arabinofuranosyl) pyrimidine nucleoside to the infected subject, and scanning the area in which the infection is to be mapped for the radiolabel.

Improved Properties of Baker's Yeast Mutants Resistant to 2-Deoxy-d-Glucose

PubMed Central

Rincón, Ana M.; Codón, Antonio C.; Castrejón, Francisco; Benítez, Tahía

2001-01-01

We isolated spontaneous mutants from Saccharomyces cerevisiae (baker's yeast V1) that were resistant to 2-deoxy-d-glucose and had improved fermentative capacity on sweet doughs. Three mutants could grow at the same rate as the wild type in minimal SD medium (0.17% Difco yeast nitrogen base without amino acids and ammonium sulfate, 0.5% ammonium sulfate, 2% glucose) and had stable elevated levels of maltase and/or invertase under repression conditions but lower levels in maltose-supplemented media. Two of the mutants also had high levels of phosphatase active on 2-deoxy-d-glucose-6-phosphate. Dough fermentation (CO2 liberation) by two of the mutants was faster and/or produced higher final volumes than that by the wild type, both under laboratory and industrial conditions, when the doughs were supplemented with glucose or sucrose. However, the three mutants were slower when fermenting plain doughs. Fermented sweet bakery products obtained with these mutants were of better quality than those produced by the wild type, with regard to their texture and their organoleptic properties. PMID:11526034

In situ formation of the amino sugars 1-amino-1-deoxy-fructose and 2-amino-2-deoxy-glucose under Maillard reaction conditions in the absence of ammonia.

PubMed

Nashalian, Ossanna; Yaylayan, Varoujan A

2016-04-15

Replacing amino acids with their binary metal complexes during the Maillard reaction can initiate various processes, including the oxidative degradation of their glucose conjugates, generating 1-amino-1-deoxy-fructose and its derivatives. These reactive amino sugars are not easily accessible under Maillard reaction conditions and are only formed in the presence of ammonia. To explore the generality of this observation and to study in particular the ability of fructose to generate glucosamine, the amino acid-metal complexes were heated in aqueous solutions with three aldohexoses and two ketohexoses at 110°C for 2 h and the dry residues were analysed by ESI/qTOF/MS/MS. All the sugars generated relatively intense ions at [M+H](+) 180 (C6H14NO5); those ions originating from ketohexoses exhibited MS/MS fragmentations identical to glucosamine and those originating form aldohexoses showed ions identical to fructosamine. Furthermore, the amino sugars were found to form fructosazine, react with other sugars and undergo dehydration reactions. Copyright © 2015 Elsevier Ltd. All rights reserved.

Novel insights into structure–function mechanism and tissue-specific expression profiling of full-length dxr gene from Cymbopogon winterianus

PubMed Central

Devi, Kamalakshi; Dehury, Budheswar; Phukon, Munmi; Modi, Mahendra Kumar; Sen, Priyabrata

2015-01-01

The 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR; EC1.1.1.267), an NADPH-dependent reductase, plays a pivotal role in the methylerythritol 4-phosphate pathway (MEP), in the conversion of 1-deoxy-d-xylulose-5-phosphate (DXP) into MEP. The sheath and leaf of citronella (Cymbopogon winterianus) accumulates large amount of terpenes and sesquiterpenes with proven medicinal value and economic uses. Thus, sequencing of full length dxr gene and its characterization seems to be a valuable resource in metabolic engineering to alter the flux of isoprenoid active ingredients in plants. In this study, full length DXR from citronella was characterized through in silico and tissue-specific expression studies to explain its structure–function mechanism, mode of cofactor recognition and differential expression. The modelled DXR has a three-domain architecture and its active site comprised of a cofactor (NADPH) binding pocket and the substrate-binding pocket. Molecular dynamics simulation studies indicated that DXR model retained most of its secondary structure during 10 ns simulation in aqueous solution. The modelled DXR superimposes well with its closest structural homolog but subtle variations in the charge distribution over the cofactor recognition site were noticed. Molecular docking study revealed critical residues aiding tight anchoring NADPH within the active pocket of DXR. Tissue-specific differential expression analysis using semi-quantitative RT-PCR and qRT-PCR in various tissues of citronella plant revealed distinct differential expression of DXR. To our knowledge, this is the first ever report on DXR from the important medicinal plant citronella and further characterization of this gene will open up better avenues for metabolic engineering of secondary metabolite pathway genes from medicinal plants in the near future. PMID:25941629

Pyrimidine homoribonucleosides: synthesis, solution conformation, and some biological properties.

PubMed

Lassota, P; Kuśmierek, J T; Stolarski, R; Shugar, D

1987-05-01

Conversion of uridine and cytidine to their 5'-O-tosyl derivatives, followed by cyanation with tetraethylammonium cyanide, reduction and deamination, led to isolation of the hitherto unknown homouridine (1-(5'-deoxy-beta-D-allofuranosyl)uracil) and homocytidine (1-(5'-deoxy-beta-D-allofuranosyl)cytosine), analogues of uridine and cytidine in which the exocyclic 5'-CH2OH chain is extended by one carbon to CH2CH2OH. Homocytidine was also phosphorylated to its 6'-phosphate and 6'-pyrophosphate analogues. In addition, it was converted, via its 2,2'-anhydro derivative, to arahomocytidine, an analogue of the chemotherapeutically active araC. The structures of all the foregoing were established by various criteria, including 1H and 13C NMR spectroscopy, both of which were also applied to analyses of the solution conformations of the various compounds, particularly as regards the conformations of the exocyclic chains. The behaviour of the homo analogues was examined in several enzymatic systems. Homocytidine was a feeble substrate, without inhibitory properties, of E. coli cytidine deaminase. Homocytidine was an excellent substrate for wheat shoot nucleoside phosphotransferase; while homouridine was a good substrate for E. coli uridine phosphorylase. Although homoCMP was neither a substrate, nor an inhibitor, of snake venom 5'-nucleotidase, homoCDP was a potent inhibitor of this enzyme (Ki approximately 6 microM). HomoCDP was not a substrate for M. luteus polynucleotide phosphorylase. None of the compounds exhibited significant activity vs herpes simplex virus type 1, or cytotoxic activity in several mammalian cell lines.

Synthesis of [18F]-labelled Maltose Derivatives as PET Tracers for Imaging Bacterial Infection

PubMed Central

Namavari, Mohammad; Gowrishankar, Gayatri; Hoehne, Aileen; Jouannot, Erwan; Gambhir, Sanjiv S

2015-01-01

Purpose To develop novel positron emission tomography (PET) agents for visualization and therapy monitoring of bacterial infections. Procedures It is known that maltose and maltodextrins are energy sources for bacteria. Hence, 18F-labelled maltose derivatives could be a valuable tool for imaging bacterial infections. We have developed methods to synthesize 4-O-(α-D-glucopyranosyl)-6-deoxy-6-[18F]fluoro-D-glucopyranoside (6-[18F]fluoromaltose) and 4-O-(α-D-glucopyranosyl)-1-deoxy-1-[18F]fluoro-D-glucopyranoside (1-[18F]fluoromaltose) as bacterial infection PET imaging agents. 6-[18F]fluoromaltose was prepared from precursor 1,2,3-tri-O-acetyl-4-O-(2′,3′,-di-O-acetyl-4′,6′-benzylidene-α-D-glucopyranosyl)-6-deoxy-6-nosyl-D-glucopranoside (5). The synthesis involved the radio-fluorination of 5 followed by acidic and basic hydrolysis to give 6-[18F]fluoromaltose. In an analogous procedure, 1-[18F]fluoromaltose was synthesized from 2,3, 6-tri-O-acetyl-4-O-(2′,3′,4′,6-tetra-O-acetyl-α-D-glucopyranosyl)-1-deoxy-1-O-triflyl-D-glucopranoside (9). Stability of 6-[18F]fluoromaltose in phosphate-buffered saline (PBS) and human and mouse serum at 37 °C was determined. Escherichia coli uptake of 6-[18F]fluoromaltose was examined. Results A reliable synthesis of 1- and 6-[18F]fluoromaltose has been accomplished with 4–6 and 5–8 % radiochemical yields, respectively (decay-corrected with 95 % radiochemical purity). 6-[18F]fluoromaltose was sufficiently stable over the time span needed for PET studies (~96 % intact compound after 1-h and ~65 % after 2-h incubation in serum). Bacterial uptake experiments indicated that E. coli transports 6-[18F]fluoromaltose. Competition assays showed that the uptake of 6-[18F]fluoromaltose was completely blocked by co-incubation with 1 mM of the natural substrate maltose. Conclusion We have successfully synthesized 1- and 6-[18F]fluoromaltose via direct fluorination of appropriate protected maltose precursors. Bacterial uptake experiments in E. coli and stability studies suggest a possible application of 6-[18F]fluoromaltose as a new PET imaging agent for visualization and monitoring of bacterial infections. PMID:25277604

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

Extraction of cesium and strontium from nuclear waste

DOEpatents

Davis, M.W. Jr.; Bowers, C.B. Jr.

1988-06-07

Cesium is extracted from acidified nuclear waste by contacting the waste with a bis 4,4[prime](5) [1-hydroxy-2-ethylhexyl]benzo 18-crown-6 compound and a cation exchanger in a matrix solution. Strontium is extracted from acidified nuclear waste by contacting the waste with a bis 4,4[prime](5[prime]) [1-hydroxyheptyl]cyclohexo 18-crown-6 compound, and a cation exchanger in a matrix solution. 3 figs.

Whole body protein metabolism in children with cancer.

PubMed Central

Daley, S E; Pearson, A D; Craft, A W; Kernahan, J; Wyllie, R A; Price, L; Brock, C; Hetherington, C; Halliday, D; Bartlett, K

1996-01-01

Whole body protein synthesis and catabolism were measured using the [ring-2H5]phenylalanine and [1-13C]leucine primed constant infusion technique in 32 paediatric patients with cancer at different stages of treatment. Rates of synthesis (S) and catabolism (C) derived from the [ring-2H5]phenylalanine and [1-13C]leucine models were 4.7 (SD 1.3) (S) and 6.0 (1.5) (C) g/d/kg, and 5.5 (0.8) (S) and 6.8 (1.2) (C) g/d/kg, respectively. These results show that these two tracer techniques give similar results in this study population. Comparison of these values with results previously reported for groups of control children using the [ring-2H5]phenylalanine model (S = 3.69 and 3.93; C = 4.09 and 4.28 g/d/kg) and the [1-13C]leucine model (S = 4.32; C = 4.85 g/d/kg) show that rates of synthesis and catabolism were higher in cancer patients than in controls. Thus whole body protein turnover is increased in children under treatment for cancer. Other indices of metabolism such as plasma amino acids and intermediary metabolites were also measured and showed that, although subjects were in isotopic steady state, there were significant metabolic changes during the course of the primed constant infusions used to measure protein turnover. PMID:8984910

Phasic affective modulation of semantic priming.

PubMed

Topolinski, Sascha; Deutsch, Roland

2013-03-01

The present research demonstrates that very brief variations in affect, being around 1 s in length and changing from trial to trial independently from semantic relatedness of primes and targets, modulate the amount of semantic priming. Implementing consonant and dissonant chords (Experiments 1 and 5), naturalistic sounds (Experiment 2), and visual facial primes (Experiment 3) in an (in)direct semantic priming paradigm, as well as brief facial feedback in a summative priming paradigm (Experiment 4), yielded increased priming effects under brief positive compared to negative affect. Furthermore, this modulation took place on the level of semantic spreading rather than on strategic mechanisms (Experiment 5). Alternative explanations such as distraction, motivation, arousal, and cognitive tuning could be ruled out. This phasic affective modulation constitutes a mechanism overlooked thus far that may contaminate priming effects in all priming paradigms that involve affective stimuli. Furthermore, this mechanism provides a novel explanation for the observation that priming effects are usually larger for positive than for negative stimuli. Finally, it has important implications for linguistic research, by suggesting that association norms may be biased for affective words. (c) 2013 APA, all rights reserved.

Secreted Respiratory Syncytial Virus G Glycoprotein Induces Interleukin-5 (IL-5), IL-13, and Eosinophilia by an IL-4-Independent Mechanism

PubMed Central

Johnson, Teresa R.; Graham, Barney S.

1999-01-01

The attachment glycoprotein G of respiratory syncytial virus (RSV) is produced as both membrane-anchored and secreted forms by infected cells. Immunization with secreted RSV G (Gs) or formalin-inactivated alumprecipitated RSV (FI-RSV) predisposes mice to immune responses involving a Th2 cell phenotype which results in more severe illness and pathology, decreased viral clearance, and increased pulmonary eosinophilia upon subsequent RSV challenge. These responses are associated with increased interleukin-4 (IL-4) production in FI-RSV-primed mice, and the responses are IL-4 dependent. RNase protection assays demonstrated that similar levels of IL-4 mRNA were induced after RSV challenge in mice primed with vaccinia virus expressing Gs (vvGs) or a construct expressing only membrane-anchored G (vvGr). However, upon RSV challenge, vvGs-primed mice produced significantly greater levels of IL-5 and IL-13 mRNA and protein than vvGr-primed mice. Administration of neutralizing anti-IL-4 antibody 11.B11 during vaccinia virus priming did not alter the levels of vvGs-induced IL-5, IL-13, pulmonary eosinophilia, illness, or RSV titers upon RSV challenge, although immunoglobulin G (IgG) isotype profiles revealed that more IgG2a was produced. vvGs-priming of IL-4-deficient mice demonstrated that G-induced airway eosinophilia was not dependent on IL-4. In contrast, airway eosinophilia induced by FI-RSV priming was significantly reduced in IL-4-deficient mice. Thus we conclude that, in contrast to FI-RSV, the secreted form of RSV G can directly induce IL-5 and IL-13, producing pulmonary eosinophilia and enhanced illness in RSV-challenged mice by an IL-4-independent mechanism. PMID:10482601

Pilot study assessment of dynamic vascular changes in breast cancer with near-infrared tomography from prospectively targeted manipulations of inspired end-tidal partial pressure of oxygen and carbon dioxide.

PubMed

Jiang, Shudong; Pogue, Brian W; Michaelsen, Kelly E; Jermyn, Michael; Mastanduno, Michael A; Frazee, Tracy E; Kaufman, Peter A; Paulsen, Keith D

2013-07-01

The dynamic vascular changes in the breast resulting from manipulation of both inspired end-tidal partial pressure of oxygen and carbon dioxide were imaged using a 30 s per frame frequency-domain near-infrared spectral (NIRS) tomography system. By analyzing the images from five subjects with asymptomatic mammography under different inspired gas stimulation sequences, the mixture that maximized tissue vascular and oxygenation changes was established. These results indicate maximum changes in deoxy-hemoglobin, oxygen saturation, and total hemoglobin of 21, 9, and 3%, respectively. Using this inspired gas manipulation sequence, an individual case study of a subject with locally advanced breast cancer undergoing neoadjuvant chemotherapy (NAC) was analyzed. Dynamic NIRS imaging was performed at different time points during treatment. The maximum tumor dynamic changes in deoxy-hemoglobin increased from less than 7% at cycle 1, day 5 (C1, D5) to 17% at (C1, D28), which indicated a complete response to NAC early during treatment and was subsequently confirmed pathologically at the time of surgery.

Hypoxia increases expression of selective facilitative glucose transporters (GLUT) and 2-deoxy-d-glucose uptake in human adipocytes

PubMed Central

Stuart Wood, I.; Wang, Bohan; Lorente-Cebrián, Silvia; Trayhurn, Paul

2007-01-01

Hypoxia modulates the production of key inflammation-related adipokines and may underlie adipose tissue dysfunction in obesity. Here we have examined the effects of hypoxia on glucose transport by human adipocytes. Exposure of adipocytes to hypoxia (1% O2) for up to 24 h resulted in increases in GLUT-1 (9.2-fold), GLUT-3 (9.6-fold peak at 8 h), and GLUT-5 (8.9-fold) mRNA level compared to adipocytes in normoxia (21% O2). In contrast, there was no change in GLUT-4, GLUT-10 or GLUT-12 expression. The rise in GLUT-1 mRNA was accompanied by a substantial increase in GLUT-1 protein (10-fold), but there was no change in GLUT-5; GLUT-3 protein was not detected. Functional studies with [3H]2-deoxy-d-glucose showed that hypoxia led to a stimulation of glucose transport (4.4-fold) which was blocked by cytochalasin B. These results indicate that hypoxia increases monosaccharide uptake capacity in human adipocytes; this may contribute to adipose tissue dysregulation in obesity. PMID:17658463

Hypoxia increases expression of selective facilitative glucose transporters (GLUT) and 2-deoxy-D-glucose uptake in human adipocytes.

PubMed

Wood, I Stuart; Wang, Bohan; Lorente-Cebrián, Silvia; Trayhurn, Paul

2007-09-21

Hypoxia modulates the production of key inflammation-related adipokines and may underlie adipose tissue dysfunction in obesity. Here we have examined the effects of hypoxia on glucose transport by human adipocytes. Exposure of adipocytes to hypoxia (1% O(2)) for up to 24 h resulted in increases in GLUT-1 (9.2-fold), GLUT-3 (9.6-fold peak at 8 h), and GLUT-5 (8.9-fold) mRNA level compared to adipocytes in normoxia (21% O(2)). In contrast, there was no change in GLUT-4, GLUT-10 or GLUT-12 expression. The rise in GLUT-1 mRNA was accompanied by a substantial increase in GLUT-1 protein (10-fold), but there was no change in GLUT-5; GLUT-3 protein was not detected. Functional studies with [(3)H]2-deoxy-D-glucose showed that hypoxia led to a stimulation of glucose transport (4.4-fold) which was blocked by cytochalasin B. These results indicate that hypoxia increases monosaccharide uptake capacity in human adipocytes; this may contribute to adipose tissue dysregulation in obesity.

Synthesis and structure-activity relationships of novel lincomycin derivatives part 3: discovery of the 4-(pyrimidin-5-yl)phenyl group in synthesis of 7(S)-thiolincomycin analogs.

PubMed

Wakiyama, Yoshinari; Kumura, Ko; Umemura, Eijiro; Masaki, Satomi; Ueda, Kazutaka; Sato, Yasuo; Watanabe, Takashi; Hirai, Yoko; Ajito, Keiichi

2017-01-01

Novel lincomycin derivatives possessing an aryl phenyl group or a heteroaryl phenyl group at the C-7 position via sulfur atom were synthesized by Pd-catalyzed cross-coupling reactions of 7(S)-7-deoxy-7-thiolincomycin (5) with various aryl halides. This reaction is the most useful method to synthesize a variety of 7(S)-7-deoxy-7-thiolincomycin derivatives. On the basis of analysis of structure-activity relationships of these novel lincomycin derivatives, we found that (a) the location of basicity in the C-7 side chain was an important factor to enhance antibacterial activities, and (b) compounds 22, 36, 42, 43 and 44 had potent antibacterial activities against a variety of Streptococcus pneumoniae with erm gene, which cause severe respiratory infections, even compared with our C-7-modified lincomycin analogs (1-4) reported previously. Furthermore, 7(S)-configuration was found to be necessary for enhancing antibacterial activities from comparison of configurations at the 7-position of 36 (S-configuration) and 41 (R-configuration).

Onset and effectiveness of rocuronium for rapid onset of paralysis in patients with major burns: priming or large bolus

PubMed Central

Han, T.-H.; Martyn, J. A. J.

2009-01-01

Background Burn injury leads to resistance to the effects of non-depolarizing muscle relaxants. We tested the hypothesis that a larger bolus dose is as effective as priming for rapid onset of paralysis after burns. Methods Ninety adults, aged 18–59 yr with 40 (2)% [mean (se)] burn and 30 (2) days after injury, received rocuronium as a priming dose followed by bolus (0.06+0.94 mg kg−1), or single bolus of either 1.0 or 1.5 mg kg−1. Sixty-one non-burned, receiving 1.0 mg kg−1 as a primed (0.06+0.94 mg kg−1) or full bolus dose, served as controls. Acceleromyography measured the onset times. Results Priming when compared with 1.0 mg kg−1 bolus in burned patients shortened the time to first appearance of twitch depression (30 vs 45 s, P<0.05) and time to maximum twitch inhibition (135 vs 210 s, P<0.05). The onset times between priming and higher bolus dose (1.5 mg kg−1) were not different (30 vs 30 s for first twitch depression and 135 vs 135 s for maximal depression, respectively). The onset times in controls, however, were significantly (P<0.05) faster than burns both for priming and for full bolus (15 and 15 s, respectively, for first twitch depression and 75 and 75 s for maximal depression). Priming caused respiratory distress in 10% of patients in both groups. Intubating conditions in burns were significantly better with 1.5 mg kg−1 than with priming or full 1.0 mg kg−1 bolus. Conclusions A dose of 1.5 mg kg−1 not only produces an initial onset of paralysis as early as 30 s, which we speculate could be a reasonable onset time for relief of laryngospasm, but also has an onset as fast as priming with superior intubating conditions and no respiratory side-effects. PMID:19029093

Multiple bonds between transition metals and main-group elements. 73. Synthetic routes to rhenium(V) alkyl and rhenium(VII) alkylidyne complexes. X-ray crystal structures of (. eta. sup 5 -C sub 5 Me sub 5 )Re( double bond O)(CH sub 3 )(CH sub 2 C(CH sub 3 ) sub 3 ) and (. eta. sup 5 -C sub 5 Me sub 5 )(Br) sub 3 Re triple bond CC(CH sub 3 ) sub 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herrmann, W.A.; Felixberger, J.K.; Anwander, R.

1990-05-01

Dialkyloxo({eta}{sup 5}pentamethylcyclopentadienyl)rhenium(V) complexes ({eta}{sup 5}-C{sub 5}Me{sub 5})Re({double bond}O)(CH{sub 3})R{prime}(R{prime} = C{sub 2}H{sub 5}, CH{sub 2}Si(CH{sub 3}){sub 3}, CH{sub 2}C(CH{sub 3}){sub 3}), 1c-e, have become accessible through alkylation of ({eta}{sup 5}-C{sub 5}Me{sub 5})Re({double bond}O)(Cl)(CH{sub 3}) (7) with R{prime}MgCl. 1c-e are the first rhenium complexes containing different alkyl ligands. The neopentyl derivative 1e (R{prime} = CH{sub 2}C(CH{sub 3}){sub 3}) crystallizes in the orthorhombic space group Pbca with a = 960.7 (2), b = 2.844.5 (4), c = 1,260.7 (2) pm, and Z = 8. The X-ray crystal structure was refined to R{sub W} = 3.9%. The chiral molecule shows a distorted tetrahedralmore » geometry around the rhenium center. The tribromide 3b has been structurally characterized. Brown crystals of 3b belong to space group P2{sub 1}/c with unit cell dimensions a = 1,311.5 (2), b = 723.0 (1), c = 1,901.6 (2) pm, {beta} = 92.68 (1){degree}, and Z = 4. The structure exhibits a four-legged piano stool geometry with no trans influence of the neopentylidyne ligand to the bromine atom.« less

Localization of 1-deoxysphingolipids to mitochondria induces mitochondrial dysfunction.

PubMed

Alecu, Irina; Tedeschi, Andrea; Behler, Natascha; Wunderling, Klaus; Lamberz, Christian; Lauterbach, Mario A R; Gaebler, Anne; Ernst, Daniela; Van Veldhoven, Paul P; Al-Amoudi, Ashraf; Latz, Eicke; Othman, Alaa; Kuerschner, Lars; Hornemann, Thorsten; Bradke, Frank; Thiele, Christoph; Penno, Anke

2017-01-01

1-Deoxysphingolipids (deoxySLs) are atypical sphingolipids that are elevated in the plasma of patients with type 2 diabetes and hereditary sensory and autonomic neuropathy type 1 (HSAN1). Clinically, diabetic neuropathy and HSAN1 are very similar, suggesting the involvement of deoxySLs in the pathology of both diseases. However, very little is known about the biology of these lipids and the underlying pathomechanism. We synthesized an alkyne analog of 1-deoxysphinganine (doxSA), the metabolic precursor of all deoxySLs, to trace the metabolism and localization of deoxySLs. Our results indicate that the metabolism of these lipids is restricted to only some lipid species and that they are not converted to canonical sphingolipids or fatty acids. Furthermore, exogenously added alkyne-doxSA [(2S,3R)-2-aminooctadec-17-yn-3-ol] localized to mitochondria, causing mitochondrial fragmentation and dysfunction. The induced mitochondrial toxicity was also shown for natural doxSA, but not for sphinganine, and was rescued by inhibition of ceramide synthase activity. Our findings therefore indicate that mitochondrial enrichment of an N-acylated doxSA metabolite may contribute to the neurotoxicity seen in diabetic neuropathy and HSAN1. Hence, we provide a potential explanation for the characteristic vulnerability of peripheral nerves to elevated levels of deoxySLs. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

Coexpression of Human α- and Circularly Permuted β-Globins Yields a Hemoglobin with Normal R State but Modified T State Properties†

PubMed Central

Asmundson, Anna L.; Taber, Alexandria M.; van der Walde, Adella; Lin, Danielle H.; Olson, John S.; Anthony-Cahill, Spencer J.

2009-01-01

For the first time, a circularly permuted human β-globin (cpβ) has been coexpressed with human α-globin in bacterial cells and shown to associate to form α-cpβ hemoglobin in solution. Flash photolysis studies of α-cpβ show markedly biphasic CO and O2 kinetics with the amplitudes for the fast association phases being dominant due the presence of large amounts of high-affinity liganded hemoglobin dimers. Extensive dimerization of liganded but not deoxygenated α-cpβ was observed by gel chromatography. The rate constants for O2 and CO binding to the R state forms of α-cpβ are almost identical to those of native HbA (k′R(CO) ≈ 5.0 μM−1 s−1; k′R(O2) ≈ 50 μM−1 s−1), and the rate of O2 dissociation from fully oxygenated α-cpβ is also very similar to that observed for HbA (kR(O2) ≈ 21–28 s−1). When the equilibrium deoxyHb form of α-cpβ is reacted with CO in rapid mixing experiments, the observed time courses are monophasic and the observed bimolecular association rate constant is ∼1.0 μM−1 s−1, which is intermediate between the R state rate measured in partial photolysis experiments (∼5 μM−1 s−1) and that observed for T state deoxyHbA (k′T(CO) ≈ 0.1 to 0.2 μM−1 s−1). Thus the deoxygenated permutated β subunits generate an intermediate, higher affinity, deoxyHb quaternary state. This conclusion is supported by equilibrium oxygen binding measurements in which α-cpβ exhibits a P50 of ∼1.5 mmHg and a low n-value (∼1.3) at pH 7, 20 °C, compared to 8.5 mmHg and n ≈ 2.8 for native HbA under identical, dilute conditions. PMID:19397368

MRS evidence of adequate O2 supply in human skeletal muscle at the onset of exercise

PubMed Central

Richardson, Russell S.; Wary, Claire; Wray, D. Walter; Hoff, Jan; Rossiter, Harry; Layec, Gwenael; Carlier, Pierre G.

2015-01-01

Purpose At exercise onset, intramuscular oxidative energy production responds relatively slowly in comparison to the change in ATP demand. To determine if the slow kinetics of oxidative ATP production is due to inadequate O2 supply or metabolic inertia we studied the kinetics of intramyocellular deoxygenation (deoxy-myoglobin, Mb) and metabolism (phosphocreatine, PCr), using proton (1H) and phosphorus (31P) magnetic resonance spectroscopy (MRS) in 6 healthy subjects (33 ± 5 yrs). Methods Specifically, utilizing dynamic plantar flexion exercise, rest to exercise and recovery was assessed at both 60% of maximum work rate (WRmax) (moderate intensity) and 80% of WRmax (heavy intensity). Results At exercise onset [PCr] fell without delay and with a similar time constant (τ) at both exercise intensities (~33 s). In contrast, the increase in deoxy-Mb was delayed at exercise onset by 5–7 s, after which it increased with kinetics (moderate τ = 37 ± 9 s, and heavy τ = 29 ± 6 s) that were not different from τPCr (p > 0.05). At cessation, deoxy-Mb recovered without a time delay and more rapidly (τ ~20 s) than PCr (τ ~33 s) (p < 0.05). Conclusion using a unique combination of in vivo MRS techniques with high time-resolution, this study revealed a delay in intramuscular de-oxygenation at the onset of exercise, and rapid re-oxygenation kinetics upon cessation. Together these data imply that intramuscular substrate-enzyme interactions, and not O2 availability, determine the exercise onset kinetics of oxidative metabolism in healthy human skeletal muscle. PMID:25830362

Regulation of expression of hyperalgesic priming by estrogen receptor alpha in the rat

PubMed Central

Ferrari, Luiz F.; Araldi, Dionéia; Levine, Jon D.

2017-01-01

Hyperalgesic priming, a sexually dimorphic model of transition to chronic pain, is expressed as prolongation of prostaglandin E2 (PGE2)-induced hyperalgesia by the activation of an additional pathway including an autocrine mechanism at the plasma membrane. The autocrine mechanism involves the transport of cAMP to the extracellular space, and its conversion to AMP and adenosine, by ecto-5′phosphodiesterase and ecto-5′nucleotidase, respectively. The end product, adenosine, activates A1 receptors, producing delayed onset prolongation of PGE2 hyperalgesia. We tested the hypothesis that the previously reported, estrogen-dependent, sexual dimorphism observed in the induction of priming is present in the mechanisms involved in its expression, as a regulatory effect on ecto-5′nucleotidase by estrogen receptor alpha (EsRα), in female rats. In the primed paw AMP hyperalgesia was dependent on conversion to adenosine, being prevented by ecto-5′nucleotidase inhibitor AMPCP and A1 receptor antagonist DPCPX. To investigate an interaction between EsRα and ecto-5′nucleotidase, we treated primed female rats with ODN antisense or mismatch against EsRα mRNA. While in rats treated with antisense AMP-induced hyperalgesia was abolished, the A1 receptor agonist N6-cyclopentiladenosine (CPA) still produced hyperalgesia. Thus, EsRα interacts with this autocrine pathway at the level of ecto-5′nucleotidase. These results demonstrate a sexually dimorphic mechanism for the expression of priming. Perspective This study presents evidence of an estrogen-dependent mechanism of expression of chronic pain in females, supporting the suggestion that differential targets must be considered when establishing protocols for the treatment of painful conditions in males and females. PMID:28089711

Priming dose of phenylhydrazine protects against hemolytic and lethal effects of 2-butoxyethanol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palkar, Prajakta S.; Philip, Binu K.; Reddy, Ramesh N.

2007-11-15

Protection against a high dose of a toxicant by prior exposure to another toxicant is called heteroprotection. Our objective was to establish a heteroprotection model in RBCs. Female Sprague Dawley rats treated with an LD90 dose of 2-butoxyethanol (BE, 1500 mg/kg in water, 5 ml/kg po) 14 days after priming with 0.9% NaCl suffered 90% mortality by 15 days, whereas all rats receiving the LD90 dose of BE 14 days after priming with phenylhydrazine (PHZ, 125 mg/kg in 0.9% NaCl, 3 ml/kg po) survived. Hematocrit decreased from normal 45% to 24% by day 3 after PHZ priming and improved thereafter.more » Increasing the time interval between the priming and LD90 dose to 21 days abolished the heteroprotection. RBCs obtained on days 7 and 14 after PHZ priming unlike those on day 21 were resilient to the hemotoxic metabolite of BE, butoxyacetic acid (BAA). Unaltered hepatic alcohol and aldehyde dehydrogenase activities upon PHZ priming suggested that bioactivation of BE to BAA was unaffected. Lower renal (6 and 12 h) and hepatic (12 h) BAA levels and 3 fold higher excretion of BAA in PHZ-primed rat urine suggested a protective role of toxicokinetics. Higher erythropoietin, reticulocytes, and resiliency of PHZ-primed rat RBCs indicated that newly formed RBCs are resilient to hemolytic BAA. The antioxidant levels in the PHZ-primed rat RBCs did not indicate a protective role in heteroprotection. In conclusion, the resistance of PHZ-primed rats against BE-induced hemotoxicity and lethality is mediated by a combination of altered toxicokinetics, robust erythropoiesis, and resiliency of new RBCs.« less

Chemistry of anti-AIDS and anticancer compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, S.

1992-01-01

Several types of prodrugs of 2[prime], 3[prime]-dideoxynucleosides were designed and synthesized for evaluation as anti-AIDS drugs. These prodrugs include 5[prime]-O-acyl-2[prime], 3[prime]-dideoxynucleosides, in which the acyl groups are derived from both aromatic and aliphatic acids, [alpha]-amino acids, diacylglycerol carbonic acids, and diacylglycerol carbamic acids. By applying the pyridium-dihydropyridine redox delivery system to deliver 2[prime], 3[prime]-dideoxynucleosides to the central nervous system, 1,4-dihydropyridine-2[prime], 3[prime]-dideoxy-inosine and -adenosine compounds were synthesized. 5[prime]-Esters of 2[prime], 3[prime]-dideoxyinosine and 2[prime], 3[prime]-dideoxyadenosine were evaluated for their activity against the HIV-1 virus and for delivery to the central nervous system (CNS). The isomerization, hydrolysis, and oxidation of alkyl 1,4-dihydro-N-methylpyridine-3-carboxylates weremore » studied by [sup 1]H and [sup 13]C NMR spectroscopy. Three intermediates, 1,4-dihydro-N-methylpyridine-3-carboxylic acid, alkyl (methyl or isopropyl) 1,6-dihydro-N-methylpyridine-3-carboxylate, and 1,6-dihydro-N-methylpyridine-3-carboxylic acid, were observed by [sup 1]H and [sup 13]C NMR spectroscopy, and their percentages in solution were determined. The structures of the 1,6-dihydropyridine intermediates were confirmed by comparison of the NMR spectra with those of an authentic model compound, methyl N-(4-chlorobenzyl)-1,6-dihydropyridine-3-carboxylate. The rate of hydrolysis of alkyl 1,4-dihydro-N-methylpyridine-3-carboxylates depends on the steric bulk of the O-alkyl group. A new type of 1,4-dihydropyridine drug delivery system with a three-carbon spacer group, 9-[2,3-di-O-acetyl-5-O-[3-(1,4-dihydro-N-methylpyridine-3-carboxamido)propionyl]-[beta]-D-arabinofuranosyl]adenine was designed, synthesized, and evaluated to deliver ara-ADA to the CNS for treatment of herpes encephalitis.« less

Crystallization and X-ray analysis of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics

PubMed Central

Nango, Eriko; Kumasaka, Takashi; Sato, Takao; Tanaka, Nobuo; Kakinuma, Katsumi; Eguchi, Tadashi

2005-01-01

A recombinant 2-deoxy-scyllo-inosose synthase from Bacillus circulans has been crystallized at 277 K using PEG 4000 as precipitant. The diffraction pattern of the crystal extends to 2.30 Å resolution at 100 K using synchrotron radiation at the Photon Factory. The crystals are monoclinic and belong to space group P21, with unit-cell parameters a = 80.5, b = 70.4, c = 83.0 Å, β = 117.8°. The presence of two molecules per asymmetric unit gives a crystal volume per protein weight (V M) of 2.89 Å3 Da−1 and a solvent constant of 57.4% by volume. PMID:16511136

Metabolism of hydroxydibenzofurans, methoxydibenzofurans, acetoxydibenzofurans, and nitrodibenzofurans by Sphingomonas sp. strain HH69

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harms, H.; Wittich, R.M.; Fortnagel, P.

The metabolism of 11 substituted dibenzofurans by the dibenzofuran-degrading Sphingomonas sp. strain HH69 was investigated. Strain HH69 utilizes 2-, 3-, and 4-acetoxydibenzofuran as well as 2-, 3-, and 4-hydroxydibenzofuran as sole sources of carbon and energy. The degradation of acetoxydibenzofurans is initiated by hydrolysis of the ester bonds, yielding the corresponding hydroxydibenzofurans and acetate. Strain HH69 grew on 2-methoxydibenzofuran only after it was adapted to the utilization of 5-methoxysalicylic acid, whereas 3- and 4-methoxydibenzofuran as well as 2- and 3-nitrodibenzofuran were only cooxidized. During the breakdown of all eight hydroxy-, methoxy-, and nitrodibenzofurans studied here, the corresponding substituted salicylic acidsmore » accumulated in the culture broth. In the cases of 2- and 3-hydroxydibenzofuran as well as 2- and 3-nitrodibenzofuran, salicylic acid was also formed. Those four dibenzofurans which did not serve as carbon sources for strain HH69 were converted to a nonutilizable salicylic acid derivative. From turnover experiments with the mutant HH69/II, which is deficient in meta-cleavage, 2,2{prime}, 3,4{prime}-tetrahydroxybiphenyl, 2,2{prime},3-trihydroxy-5{prime}-methoxybiphenyl, 2,2{prime},3-trihydroxy-5{prime}-nitrobiphenyl, and 2,2{prime},3-trihydroxy-4{prime}-nitrobiphenyl were isolated as the main products formed from 3-hydroxydibenzofuran, 2-methoxydibenzofuran, and 2- and 3-nitrodibenzo-furan, respectively. These results indicate significant regioselectivity for the dioxygenolytic cleavage of the ether bond of these monosubstituted dibenzofurans, with a preference for the nonsubstituted aromatic nucleus. Substituted trihydroxybiphenyls are converted further by meta-cleavage followed by the removal of the side chain of the resulting product. A stepwise degradation of this side chain was found to be involved in the metabolism of 2-hydroxydibenzofuran. 34 refs., 5 figs., 2 tabs.« less

Salicylic acid seed priming instigates defense mechanism by inducing PR-Proteins in Solanum melongena L. upon infection with Verticillium dahliae Kleb.

PubMed

Mahesh, H M; Murali, M; Anup Chandra Pal, M; Melvin, Prasad; Sharada, M S

2017-08-01

Salicylic acid (SA) is a hormone connected with various cellular functions including the fight against invading pathogens. Priming of seeds pre-sowing is a very simple method to the farmers' to produce better growth, yield and manage the pathogens. The present study was aimed to determine the growth and disease resistance ability in brinjal seeds primed with different concentrations (0.25, 0.5, 0.75 and 1.0 mM) of SA under greenhouse conditions. Priming of seeds with SA significantly increased seed germination and seedling vigor with a maximum of 84% and 859.18, respectively at 0.5 mM concentration. Seed priming with SA also reduced Verticillium wilt incidence to 39.25% (at 0.5 mM) under greenhouse conditions and also enhanced the vegetative growth parameters of the plant compared to control. The induced resistance obtained with SA was in line with higher expression of PR-protein (β-1,3-glucanase and chitinase) related defense enzymes. Further, an increase of 1.7, 2.9, 2.1, 2.5 and 2-fold increase in gene expression of IAA27, MPK1, GPX, chitinase and β-1,3-glucanase, respectively were observed in SA primed challenge inoculated seedlings than non-primed susceptible inoculated controls. The higher expression of IAA27, MPK1, GPX, chitinase and β-1,3-glucanase correlates with the plant growth promoting and disease protection studies as these genes are vital for increasing plant growth and inducing resistance during host-pathogen interaction. Enhanced activation of defense-related activities in plants upon priming with SA suggests that it alters plant physiology which in turn is useful for production and protection of brinjal. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

cAMP and forskolin decrease. gamma. -aminobutyric acid-gated chloride flux in rat brain synaptoneurosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heuschneider, G.; Schwartz, R.D.

1989-04-01

The effects of the cyclic nucleotide cAMP on {gamma}-aminobutyric acid-gated chloride channel function were investigated. The membrane-permeant cAMP analog N{sup 6}, O{sup 2{prime}}-dibutyryladenosine 3{prime},5{prime}-cyclic monophosphate inhibited muscimol-induced {sup 36}Cl{sup {minus}} uptake into rat cerebral cortical synaptoneurosomes in a concentration-dependent manner. The inhibition was due to a decrease in the maximal effect of muscimol, with no change in potency. Similar effects were observed with 8-(4-chlorophenylthio)adenosine 3{prime},5{prime}-cyclic monophosphate, 8-bromoadenosine 3{prime},5{prime}-cyclic monophosphate, and the phosphodiesterase inhibitor isobutylmethylxanthine. The effect of endogenous cAMP accumulation on the {gamma}-aminobutyric acid-gated Cl{sup {minus}} channel was studied with forskolin, an activator of adenylate cyclase. Under identical conditions, inmore » the intact synaptoneurosomes, forskolin inhibited muscimol-induced {sup 36}Cl{sup {minus}} uptake and generated cAMP with similar potencies. Surprisingly, 1,9-dideoxyforskolin, which does not activate adenylate cyclase, also inhibited the muscimol response, suggesting that forskolin and its lipophilic derivatives may interact with the Cl{sup {minus}} channel directly. The data suggest that {gamma}-aminobutyric acid (GABA{sub A}) receptor function in brain can be regulated by cAMP-dependent phosphorylation.« less

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

A precursor to the beta-pyranosides of 3-amino-3,6-dideoxy-D-mannose (mycosamine).

PubMed

Alais, J; David, S

1992-06-04

SN2-type reaction of 3-O-(1-imidazyl)sulfonyl-1,2:5,6-di-O-isopropylidene-alpha-D-gluco furanose with benzoate gave the 3-O-benzoyl-alpha-D-allo derivative 2, which was hydrolysed to give the 5,6-diol 3. Compound 3 was converted into the 6-deoxy-6-iodo derivative 4 which was reduced with tributylstannane, and then position 5 was protected by benzyloxymethylation, to give 3-O-benzoyl-5-O-benzyloxymethyl-6-deoxy-1,2-O-isopropylidene-alpha -D- allofuranose (6). Debenzoylation of 6 gave 7, (1-imidazyl)sulfonylation gave 8, and azide displacement gave 3-azido-5-O-benzyloxymethyl-3,6-dideoxy- 1,2-O-isopropylidene-alpha-D-glucofuranose (9, 85%). Acetolysis of 9 gave 1,2,4-tri-O-acetyl-3-azido-3,6-dideoxy-alpha,beta-D-glucopyranose (10 and 11). Selective hydrolysis of AcO-1 in the mixture of 10 and 11 with hydrazine acetate (----12), followed by conversion into the pyranosyl chloride 13, treatment with N,N-dimethylformamide dimethyl acetal in the presence of tetrabutylammonium bromide, and benzylation gave 3-azido-4-O-benzyl-3,6-dideoxy-1,2-O-(1-methoxyethylidene)-alpha-D -glucopyranose (15). Treatment of 15 with dry acetic acid gave 1,2-di-O-acetyl-3-azido-4-O-benzyl-3,6-dideoxy-beta-D-glucopyranose (16, 86% yield) that was an excellent glycosyl donor in the presence of trimethylsilyl triflate, allowing the synthesis of cyclohexyl 2-O-acetyl-3-azido-4-O-benzyl-3,6-dideoxy-beta-D-glucopyranoside (17, 90%).(ABSTRACT TRUNCATED AT 250 WORDS)

Phenolics from Ageratina adenophora roots and their phytotoxic effects on Arabidopsis thaliana seed germination and seedling growth.

PubMed

Zhou, Zhong-Yu; Liu, Wan-Xue; Pei, Gang; Ren, Hui; Wang, Jing; Xu, Qiao-Lin; Xie, Hai-Hui; Wan, Fang-Hao; Tan, Jian-Wen

2013-12-04

A bioassay-directed phytochemical study was conducted to investigate potential allelochemicals in the roots of the invasive plant Ageratina adenophora. Eleven phenolic compounds, including seven new ones, 7-hydroxy-8,9-dehydrothymol 9-O-trans-ferulate (1), 7-hydroxythymol 9-O-trans-ferulate (2), 7,8-dihydroxythymol 9-O-trans-ferulate (3), 7,8-dihydroxythymol 9-O-cis-ferulate (4), methyl (7R)-3-deoxy-4,5-epoxy-D-manno-2-octulosonate 8-O-trans-p-coumarate (5), methyl (7R)-3-deoxy-4,5-epoxy-D-manno-2-octulosonate 8-O-cis-p-coumarate (6), and 3-(2-hydroxyphenyl)propyl methyl malonate (7), were isolated from a bioactive subfraction of the ethanol extract of the roots of A. adenophora. The new structures were established on the basis of detailed spectroscopic analysis. The potential phytotoxic effects of these compounds on the germination of Arabidopsis thaliana seeds were tested by a filter paper assay. Compound 7 and known compounds 3-(2-hydroxyphenyl)-1-propanol (8) and o-coumaric acid (9) remarkably showed inhibition activity against Arabidopsis seed germination at a concentration of 1.0 mM. Compounds 1, 2, 5, 6, and 10 showed slight inhibitory activity at the test concentration after treatment for 3 days, while the other compounds showed no obvious inhibitory effects. Moreover, 7-9 were further found to show obvious inhibitory activity on retarding the seedling growth of Ar. thaliana cultured in soil medium.

Effects of Natural Rubber on Microwave Absorption Characteristics of Some Li-Ni-Zn Ferrite-Thermoplastic Natural Rubber Composites

NASA Astrophysics Data System (ADS)

Abdul Hamid, Siti Atkah; Abdullah, Mustaffa Hj.; Ahmad, Sahrim Hj.; Mansor, Abdul Aziz; Yusoff, Ahmad Nazlim

2002-09-01

A microwave (Li0.5Fe0.5)0.4Ni0.3Zn0.3Fe2O4 (LNZ) ferrite was prepared by a conventional sintering method in air. Thermoplastic natural rubber (TPNR) was prepared from polypropylene (PP) and natural rubber (NR) in the ratios of 80:20, 70:30, 60:40, 50:50 and 40:60 with liquid natural rubber as a compatibilizer by a melt blending technique. LNZ ferrite-TPNR composites with 20 wt% ferrite filler were prepared using a Brabender plasticorder internal mixer. The microwave electromagnetic properties of the composites were studied in the frequency range of 0.3-13.5 GHz using a microwave vector network analyzer (MVNA). The real and imaginary components of the relative complex dielectric permittivity (\\varepsilonr*=\\varepsilonr\\prime-j\\varepsilonr\\prime\\prime) and magnetic permeability (μr*=μr\\prime-jμr\\prime\\prime) were calculated from the measured complex scattering parameters (S11* and S12*) using the Nicolson-Ross model. The dielectric and magnetic properties were found to depend on the NR and PP content in the composites. The minimum reflection loss (RL) under the matching conditions increases with increasing NR content.

Src kinase signaling mediates estrous behavior induced by 5β-reduced progestins, GnRH, prostaglandin E2 and vaginocervical stimulation in estrogen-primed rats.

PubMed

Lima-Hernández, Francisco J; Beyer, Carlos; Gómora-Arrati, Porfirio; García-Juárez, Marcos; Encarnación-Sánchez, José L; Etgen, Anne M; González-Flores, Oscar

2012-11-01

The progesterone receptor (PR) is a dual function protein that acts in the nucleus as a transcriptional factor and at the cytoplasm as a scaffold for the Src-MAPK signaling pathway. Several agents lacking affinity for the PR, such as 5β-reduced progestins, GnRH or prostaglandin E(2) (PGE(2)) facilitate estrous behavior in ovariectomized (ovx), estrogen-primed rats yet their action is blocked by the antiprogestin RU486. We hypothesize that these agents act by using the PR-Src-mitogen activated protein kinase alternative pathway. To test this hypothesis we used PP2, a specific inhibitor of the Src kinase family. Intraventricular infusion of 30 μg of PP2, 30 min before behavioral testing, significantly attenuated estrous behaviors induced in estradiol benzoate (E(2)B)-primed rats by 5β-dihydroprogesterone (5β-DHP), 5β-pregnan-3β-ol-20-one (5β,3β-Pgl), GnRH, PGE(2) and by manual flank/vaginocervical stimulation. These results suggest that the Src signaling system, by activating mitogen-activated protein kinases, participates in the facilitation of estrous behavior in E(2)B-primed rats induced by agents lacking affinity for the PR. Copyright © 2012 Elsevier Inc. All rights reserved.

RF Priming Experiments and Simulations of Magnetic Priming in Relativistic Magnetrons

NASA Astrophysics Data System (ADS)

White, W. M.; Gilgenbach, R. M.; Jones, M. C.; Neculaes, V. B.; Lau, Y. Y.; Jordan, N.; Pengvanich, P.; Edgar, R.; Hoff, B.; Spencer, T. A.; Price, D.

2004-11-01

We investigate 2 priming techniques in relativistic magnetrons for rapid startup and mode-locking: RF priming experiments with 0.1-1 MW from a 2nd magnetron; Magnetic-priming simulations by azimuthally-varying-axial magnetic field. Experiments utilize MELBA-C with a Titan 6-vane magnetron: V = -300kV, I = 1-10kA, e-beam T = 0.5 μs, microwave power = 100-500 MW, f= 1-1.3 GHz, base vacuum= 8.5 x 10-10 Torr. The AFRL RF priming magnetron is at 0.1-2 MW, 3 μsec, 1.27-1.32 GHz. About 0.2-0.3 MW is injected into 1 of 3 open coupling slots in the relativistic magnetron. Analysis of the relativistic magnetron's microwave output shows a clear effect of RF priming. Simulations of magnetic priming in the pi-mode are run in MAGIC code by imposing N/2 azimuthal-variations in the axial magnetic field of an N-vane magnetron. Faster startup and mode-locking are simulated by rapid-electron spoke formation and excitation of RF fields.

Cytoplasmic Acidification and Secondary Metabolite Production in Different Plant Cell Suspensions (A Comparative Study).

PubMed Central

Hagendoorn, MJM.; Wagner, A. M.; Segers, G.; Van Der Plas, LHW.; Oostdam, A.; Van Walraven, H. S.

1994-01-01

In this study, a correlation is described between low cytoplasmic pH, measured with the fluorescent probes 2[prime],7[prime]-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (acetoxymethyl ester) and bis- [3-propyl-5-oxoisoxazol-4-yl]pentamethine oxonol, and the production of secondary metabolites for several plant cell-suspension systems. Anthraquinone production in Morinda citrifolia suspensions is negligible in the presence of 2,4-dichlorophenoxyacetic acid (2,4-D), whereas with naphthalene acetic acid (NAA) a significant accumulation is realized. NAA-grown cells showed a lower cytoplasmic pH than did 2,4-D-grown cells. Addition of 2,4-D or parachlorophenoxy acetic acid to NAA-grown cells resulted in an inhibition of anthraquinone production and an increase of the cytoplasmic pH, whereas addition of parachlorophenyl acetic acid had no effect on either parameter. Lignin production in Petunia hybrida cells could be induced by subculturing them in a medium without iron. These cells showed a lower cytoplasmic pH than control cells. Addition of Fe3+ led to a decreased lignin content and an increased cytoplasmic pH. Two cell lines of Linum flavum showed a different level of coniferin and lignin concentration in their cells. Cells that accumulated coniferin and lignin had a lower cytoplasmic pH than cells that did not accumulate these secondary metabolites. Apparently, in different species and after different kinds of treatment there is a correlation between acidification of the cytoplasm and the production of different secondary metabolites. The possible role of this acidification in secondary metabolite production is discussed. PMID:12232364

Cytoplasmic Acidification and Secondary Metabolite Production in Different Plant Cell Suspensions (A Comparative Study).

PubMed

Hagendoorn, MJM.; Wagner, A. M.; Segers, G.; Van Der Plas, LHW.; Oostdam, A.; Van Walraven, H. S.

1994-10-01

In this study, a correlation is described between low cytoplasmic pH, measured with the fluorescent probes 2[prime],7[prime]-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (acetoxymethyl ester) and bis- [3-propyl-5-oxoisoxazol-4-yl]pentamethine oxonol, and the production of secondary metabolites for several plant cell-suspension systems. Anthraquinone production in Morinda citrifolia suspensions is negligible in the presence of 2,4-dichlorophenoxyacetic acid (2,4-D), whereas with naphthalene acetic acid (NAA) a significant accumulation is realized. NAA-grown cells showed a lower cytoplasmic pH than did 2,4-D-grown cells. Addition of 2,4-D or parachlorophenoxy acetic acid to NAA-grown cells resulted in an inhibition of anthraquinone production and an increase of the cytoplasmic pH, whereas addition of parachlorophenyl acetic acid had no effect on either parameter. Lignin production in Petunia hybrida cells could be induced by subculturing them in a medium without iron. These cells showed a lower cytoplasmic pH than control cells. Addition of Fe3+ led to a decreased lignin content and an increased cytoplasmic pH. Two cell lines of Linum flavum showed a different level of coniferin and lignin concentration in their cells. Cells that accumulated coniferin and lignin had a lower cytoplasmic pH than cells that did not accumulate these secondary metabolites. Apparently, in different species and after different kinds of treatment there is a correlation between acidification of the cytoplasm and the production of different secondary metabolites. The possible role of this acidification in secondary metabolite production is discussed.

Mitsunobu alkylation of cancerostatic 5-fluorouridine with (2E)-10-hydroxydec-2-enoic acid, a fatty acid from royal jelly with multiple biological activities.

PubMed

Ottenhaus, Vanessa; Rosemeyer, Helmut

2015-09-01

5-Fluorouridine (1) - a nucleoside antimetabolite with strong cancerostatic properties - was protected i) at the 2'- and 3'-OH groups with a heptan-4-ylidene residue and ii) at the 5'-OH group with a (4-methoxyphenyl)(diphenyl)methyl residue. This fully protected compound, 3, was submitted to a Mitsunobu reaction with the N-hydroxysuccinimide (NHS) ester, 5, of (2E)-10-hydroxydec-2-enoic acid (4) which gave nucleolipid 6. The latter was detritylated with Cl2 CHCOOH to yield the co-drug 7 as NHS ester. Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

Intermediates detected by visible spectroscopy during the reaction of nitrite with deoxyhemoglobin: the effect of nitrite concentration and diphosphoglycerate.

PubMed

Nagababu, Enika; Ramasamy, Somasundaram; Rifkind, Joseph M

2007-10-16

The reaction of nitrite with deoxyhemoglobin (deoxyHb) results in the reduction of nitrite to NO, which binds unreacted deoxyHb forming Fe(II)-nitrosylhemoglobin (Hb(II)NO). The tight binding of NO to deoxyHb is, however, inconsistent with reports implicating this reaction with hypoxic vasodilation. This dilemma is resolved by the demonstration that metastable intermediates are formed in the course of the reaction of nitrite with deoxyHb. The level of intermediates is quantitated by the excess deoxyHb consumed over the concentrations of the final products formed. The dominant intermediate has a spectrum that does not correspond to that of Hb(III)NO formed when NO reacts with methemoglobin (MetHb), but is similar to metHb resulting in the spectroscopic determinations of elevated levels of metHb. It is a delocalized species involving the heme iron, the NO, and perhaps the beta-93 thiol. The putative role for red cell reacted nitrite on vasodilation is associated with reactions involving the intermediate. (1) The intermediate is less stable with a 10-fold excess of nitrite and is not detected with a 100-fold excess of nitrite. This observation is attributed to the reaction of nitrite with the intermediate producing N2O3. (2) The release of NO quantitated by the formation of Hb(II)NO is regulated by changes in the distal heme pocket as shown by the 4.5-fold decrease in the rate constant in the presence of 2,3-diphosphoglycerate. The regulated release of NO or N2O3 as well as the formation of the S-nitroso derivative of hemoglobin, which has also been reported to be formed from the intermediates generated during nitrite reduction, should be associated with any hypoxic vasodilation attributed to the RBC.

Identification of rare 6-deoxy-D-altrose from an edible mushroom (Lactarius lividatus).

PubMed

Tako, Masakuni; Dobashi, Yahiko; Tamaki, Yukihiro; Konishi, Teruko; Yamada, Masashi; Ishida, Hideharu; Kiso, Makoto

2012-03-01

6-Deoxy-L-altrose is well known as a constituent sugar moiety of lipopolysaccharides in Gram-negative bacteria. However, its isomer, 6-deoxy-D-altrose, is little known. Identification of 6-deoxy-D-altrose isolated from a polysaccharide extracted from an edible mushroom (Lactarius lividatus), its comparison with chemically synthesized 6-deoxy-D-altrose using (1)H and (13)C NMR including COSY, HMQC spectroscopy, and investigation of its specific optical rotation were all conducted in this study. The 6-deoxy-hexose isolated from acid hydrolysate of the polysaccharide extracted from L. lividatus was involved in four anomeric isomers (α-pyranose and β-pyranose, and α-furanose and β-furanose), as was chemically synthesized 6-deoxy-d-altrose in an aqueous solution because of mutarotation. Almost all signals of 1D ((1)H NMR and (13)C NMR) and 2D (COSY and HMQC)-NMR spectra agreed with those of the authentic 6-deoxy-D-altrose. The specific optical rotation [α](589) of 6-deoxy-sugar showed a value of +18.2°, which was in agreement with that of authentic 6-deoxy-D-altrose. Consequently, 6-deoxy-hexose was identified as the 6-deoxy-D-altrose. This work is the first complete identification of 6-deoxy-D-altrose in a natural environment. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effects on H(-) production in a multicusp ion source by mixture of H2 with H2O, NH3, CH4, N2H4, and SF6

NASA Technical Reports Server (NTRS)

Orient, O. J.; Chutjian, A.; Leung, K. N.

1987-01-01

Effects of H(-) production in a multicusp ion source are measured by separately mixing with hydrogen small amounts (0.33-10 percent) of water, ammonia, methane, and hydrazine these are molecules which produce large amounts of H(-) via dissociative attachment (DA) resonances at higher electron energies. The mixing was done in a separate reservoir, with careful measurement of individual pressures. Experimental enhancements of 1.4 and less were observed, whereas calculated enhancements, using accurate DA cross sections for ground-state H2, should have produced factors of 1.5, 3.0, 1.3, and 2.4 enhancements for water, ammonia methane, and hydrazine, respectively, at a mean electron energy of 1.0 eV in the extraction region. The difference is accounted for by including, in the enhancement calculation, vibrationally and rotationally excited H2 molecules, with v-double prime = 5-11, and J-double prime = 0-5, and the large DA cross sections for the excited H2 (v-double prime, J-double prime). The relative populations of H2 (v-double prime, J-double prime) thus obtained are found to be substantially smaller than those predicted by theoretical calculations. The effect on H(-) current was also studied by mixing small amounts of SF6 with H2. A 1.5 percent mixture was found to reduce the H(-) output by one half.

Nucleotide and Nucleotide Sugar Analysis by Liquid Chromatography-Electrospray Ionization-Mass Spectrometry on Surface-Conditioned Porous Graphitic Carbon

PubMed Central

2010-01-01

We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458

Role of dopamine D1-like receptor within the nucleus accumbens in acute food deprivation- and drug priming-induced reinstatement of morphine seeking in rats.

PubMed

Sadeghzadeh, Fatemeh; Babapour, Vahab; Haghparast, Abbas

2015-01-01

Dopamine is a predominant neurotransmitter in the nervous system, which plays an important role in both drug priming- and cue-induced reinstatement of cocaine and heroin seeking. Therefore, in the present study, the conditioned place preference (CPP) paradigm was used to evaluate the effects of intra-accumbal administration of SCH23390 as a dopamine D1-like receptor antagonist on food deprivation (FD) and drug priming-induced reinstatement. Sixty-eight adult male albino Wistar rats weighing 200-280 g were bilaterally implanted by cannulae into the nucleus accumbens (NAc). For induction of the CPP, subcutaneous (sc) administration of morphine (5mg/kg) was used daily during a three-day conditioning phase. The conditioning score and locomotor activity were recorded by using the Ethovision software. Under extinction conditions, rats were given an 'off' period and were tested for FD-induced reinstatement following the 24-h or 48-h FD condition, and for drug priming-induced reinstatement under the sated condition following an injection of 0.5 and 1mg/kg (sc) morphine. In the next experiments, animals received different doses of intra-accumbal SCH23390 (0.25, 1 and 4 μg/0.5 μl saline) bilaterally and were subsequently tested for FD- and morphine priming-induced reinstatement. Our findings indicated that only a dose of 1mg/kg and not 0.5mg/kg of morphine induced the reinstatement of morphine. 24-h FD similar to 48-h FD induced the reinstatement of seeking behaviors facilitated by an ineffective dose of morphine (0.5mg/kg). Furthermore, the D1-like receptor antagonist attenuated FD- and drug priming-induced reinstatement dose-dependently. It is concluded that FD- and drug priming-induced reinstatement may be mediated, at least in some way, by activation of dopamine D1-like receptors in the NAc. Copyright © 2015 Elsevier B.V. All rights reserved.

Soluble minerals in chemical evolution. I - Adsorption of 5-prime-AMP on CaSO4 - A model system

NASA Technical Reports Server (NTRS)

Orenberg, J. B.; Chan, S.; Calderon, J.; Lahav, N.

1985-01-01

The adsorption of 5-prime-AMP onto solid CaSO4-2H2O was studied in a saturated suspension as a function of pH and electrolyte concentration. The adsorption is pH-dependent and is directly correlated with the charge on the 5-prime-AMP molecule which is determined by the state of protonation of the N-1 nitrogen of the purine ring and the phosphate oxygens. It is proposed that the binding that occurs between the nucleotide and the salt is electrostatic in nature. The adsorption decreases with increasing ionic strength of the solution which means that in a fluctuating environment of wetting and drying cycles, a biomolecule similar to 5-prime-AMP could be expected to desorb during the drying phase. The results indicate that CaSO4-2H2O can serve as a concentrating surface for biomolecules. The significance of this is discussed with regard to the possible role of soluble minerals and their surfaces in a geochemical model consistent with the evolution of the earth and the origin of life.

Binding of nickel /II/ to 5-prime-nucleoside monophosphates and related compounds. [role in origin of life

NASA Technical Reports Server (NTRS)

Orenberg, J. B.; Kjos, K. M.; Winkler, R.; Link, J.; Lawless, J. G.

1982-01-01

The interactions of Ni(II) cation with a representative suite of purine bases and the respective nucleosides and nucleotides have been studied by ultraviolet difference spectroscopy. Apparent association constants were determined for each system at pH 7.0, using computer linear regression coupled with an iteration technique. The specificity of binding of Ni(2+) for the purine nucleotides studied at pH 7.0 was 5-prime-GMP greater than 5-prime-AMP; a similar ordering was also found for the respective nucleosides and bases. In this study binding was not observed for the suite of pyramidines used, although an Ni(2+) -cytidine complex has been observed (Fiskin and Beer, 1965). It was also found that Ni(2+) bound more strongly to the purine 5-prime-nucleotides than to the respective nucleosides and bases. These trends are explained in terms of metal-ligand bonds and available bonding positions on the ligands. A role for metal-ion-nucleotide types of complexes is suggested in the processes that might have given rise to the origin of life.

A new C-Glycosylflavone from Encyclia michuacana

NASA Astrophysics Data System (ADS)

Tovar-Gijón, Claudia E.; Hernández-Carlos, Beatriz; Burgueño-Tapia, Eleuterio; Cedillo-Portugal, Ernestina; Joseph-Nathan, Pedro

2006-02-01

The methanol extracts from Encyclia michuacana tubercles yielded the new 8- C-(6-deoxy-β- D-glucopyranosyl)apigenin ( 1) together with known 1-(3'-hydroxy-5'-methoxyphenyl)-2-(4″-hydroxy-5″-methoxyphenyl)ethane ( 2) and 2-(4-hydroxybenzyl)malic acid ( 3). The new structure was elucidated using spectroscopic methods, mainly 1D and 2D NMR. The β-anomer for 1 was supported by comparison of the experimental 1H- 1H coupling constant values with those generated employing a generalized Karplus-type relationship using dihedral angles extracted from DFT calculations.

Novel genomic island modifies DNA with 7-deazaguanine derivatives

PubMed Central

Thiaville, Jennifer J.; Kellner, Stefanie M.; Yuan, Yifeng; Hutinet, Geoffrey; Thiaville, Patrick C.; Jumpathong, Watthanachai; Mohapatra, Susovan; Brochier-Armanet, Celine; Letarov, Andrey V.; Hillebrand, Roman; Malik, Chanchal K.; Rizzo, Carmelo J.; Dedon, Peter C.; de Crécy-Lagard, Valérie

2016-01-01

The discovery of ∼20-kb gene clusters containing a family of paralogs of tRNA guanosine transglycosylase genes, called tgtA5, alongside 7-cyano-7-deazaguanine (preQ0) synthesis and DNA metabolism genes, led to the hypothesis that 7-deazaguanine derivatives are inserted in DNA. This was established by detecting 2’-deoxy-preQ0 and 2’-deoxy-7-amido-7-deazaguanosine in enzymatic hydrolysates of DNA extracted from the pathogenic, Gram-negative bacteria Salmonella enterica serovar Montevideo. These modifications were absent in the closely related S. enterica serovar Typhimurium LT2 and from a mutant of S. Montevideo, each lacking the gene cluster. This led us to rename the genes of the S. Montevideo cluster as dpdA-K for 7-deazapurine in DNA. Similar gene clusters were analyzed in ∼150 phylogenetically diverse bacteria, and the modifications were detected in DNA from other organisms containing these clusters, including Kineococcus radiotolerans, Comamonas testosteroni, and Sphingopyxis alaskensis. Comparative genomic analysis shows that, in Enterobacteriaceae, the cluster is a genomic island integrated at the leuX locus, and the phylogenetic analysis of the TgtA5 family is consistent with widespread horizontal gene transfer. Comparison of transformation efficiencies of modified or unmodified plasmids into isogenic S. Montevideo strains containing or lacking the cluster strongly suggests a restriction–modification role for the cluster in Enterobacteriaceae. Another preQ0 derivative, 2’-deoxy-7-formamidino-7-deazaguanosine, was found in the Escherichia coli bacteriophage 9g, as predicted from the presence of homologs of genes involved in the synthesis of the archaeosine tRNA modification. These results illustrate a deep and unexpected evolutionary connection between DNA and tRNA metabolism. PMID:26929322

Nuclear magnetic resonance studies of phenylalanine analog interactions with normal and sicklen hemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Y.H.

Several phenylalanine derivatives have been found to inhibit the gelation of deoxygenated sickle hemoglobin (deoxy HbS). Proton and /sup 19/F-NMR techniques were used to monitor the interaction of selected phenylalanine derivatives with the Hb molecule by using fluorine containing phenylalanine derivatives, Hb labeled at the ..beta..93 position with N-(2,2,2-trifluoroethyl) iodoacetamide (IA-F/sub 3/), and by monitoring the relaxation rates of the C2 and C4 histidine protons. The results show that the /sup 19/F spin-spin relaxation times of L-phenylalanin-4-fluorobenzylamide (PheNBz1-F), which has a deoxy HbS antigelling activity comparable to that of the amino acid, tryptophan, are affected much more strongly by interactionmore » with Hb than are those of glycin-4-fluorobenzylamide (GlyNBz1-F). In contrast, it is shown that N-(2,2,5,5-tetramethylpyrrolidin-1-oxy-3-carboxyl)-L-phenylalanine t-butyl ester (SL-Phe) exhibits specific binding to Hb, and an antigelling activity more than two orders of magnitude greater than that of phenylalanine. These results indicate that the fluorine nuclei strongly influenced by the presence of spin label nitroxide are located in a conformation within a few angstroms of the SL-Phe binding site. Proton NMR relaxation measurements of the C2 and C4 proton resonances from the ..beta..2, 4b143 and ..beta..146 histidine residues show significant and selective effects from the binding of SL-Phe to Hb, indicating that the SL-Phe binding site must be close to the side chains of these three residues. The strong antigelation activity of SL-Phe suggests that this binding site may be one of the intermolecular contact sites of importance to the deoxy HbS aggregation process.« less

Cloning and expression of 3-deoxy-d-manno-oct-2-ulosonic acid α-ketoside hydrolase from oyster hepatopancreas†

PubMed Central

Nakagawa, Tetsuto; Shimada, Yoshimi; Pavlova, Nadejda V; Li, Su-Chen; Li, Yu-Teh

2015-01-01

We have previously reported that oyster hepatopancreas contained three unusual α-ketoside hydrolases: (i) a 3-deoxy-d-manno-oct-2-ulosonic acid α-ketoside hydrolase (α-Kdo-ase), (ii) a 3-deoxy-d-glycero-d-galacto-non-2-ulosonic acid α-ketoside hydrolase and (iii) a bifunctional ketoside hydrolase capable of cleaving both the α-ketosides of Kdn and Neu5Ac (Kdn-sialidase). After completing the purification of Kdn-sialidase, we proceeded to clone the gene encoding this enzyme. Unexpectedly, we found that instead of expressing Kdn-sialidase, our cloned gene expressed α-Kdo-ase activity. The full-length gene, consisting of 1176-bp (392 amino acids, Mr 44,604), expressed an active recombinant α-Kdo-ase (R-α-Kdo-ase) in yeast and CHO-S cells, but not in various Escherichia coli strains. The deduced amino acid sequence contains two Asp boxes (S277PDDGKTW and S328TDQGKTW) commonly found in sialidases, but is devoid of the signature FRIP-motif of sialidase. The R-α-Kdo-ase effectively hydrolyzed the Kdo in the core-oligosaccharide of the structurally defined lipopolysaccharide (LPS), Re-LPS (Kdo2-Lipid A) from Salmonella minnesota R595 and E. coli D31m4. However, Rd-LPS from S. minnesota R7 that contained an extra outer core phosphorylated heptose was only slowly hydrolyzed. The complex type LPS from Neisseria meningitides A1 and M992 that contained extra 5–6 sugar units at the outer core were refractory to R-α-Kdo-ase. This R-α-Kdo-ase should become useful for studying the structure and function of Kdo-containing glycans. PMID:26362869

Molecular Cloning and Characterization of DXS and DXR Genes in the Terpenoid Biosynthetic Pathway of Tripterygium wilfordii

PubMed Central

Tong, Yuru; Su, Ping; Zhao, Yujun; Zhang, Meng; Wang, Xiujuan; Liu, Yujia; Zhang, Xianan; Gao, Wei; Huang, Luqi

2015-01-01

1-Deoxy-d-xylulose-5-phosphate synthase (DXS) and 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR) genes are the key enzyme genes of terpenoid biosynthesis but still unknown in Tripterygium wilfordii Hook. f. Here, three full-length cDNA encoding DXS1, DXS2 and DXR were cloned from suspension cells of T. wilfordii with ORF sizes of 2154 bp (TwDXS1, GenBank accession no.KM879187), 2148 bp (TwDXS2, GenBank accession no.KM879186), 1410 bp (TwDXR, GenBank accession no.KM879185). And, the TwDXS1, TwDXS2 and TwDXR were characterized by color complementation in lycopene accumulating strains of Escherichia coli, which indicated that they encoded functional proteins and promoted lycopene pathway flux. TwDXS1 and TwDXS2 are constitutively expressed in the roots, stems and leaves and the expression level showed an order of roots > stems > leaves. After the suspension cells were induced by methyl jasmonate, the mRNA expression level of TwDXS1, TwDXS2, and TwDXR increased, and triptophenolide was rapidly accumulated to 149.52 µg·g−1, a 5.88-fold increase compared with the control. So the TwDXS1, TwDXS2, and TwDXR could be important genes involved in terpenoid biosynthesis in Tripterygium wilfordii Hook. f. PMID:26512659

First characterization of extremely halophilic 2-deoxy-D-ribose-5-phosphate aldolase.

PubMed

Ohshida, Tatsuya; Hayashi, Junji; Satomura, Takenori; Kawakami, Ryushi; Ohshima, Toshihisa; Sakuraba, Haruhiko

2016-10-01

2-Deoxy-d-ribose-5-phosphate aldolase (DERA) catalyzes the aldol reaction between two aldehydes and is thought to be a potential biocatalyst for the production of a variety of stereo-specific materials. A gene encoding DERA from the extreme halophilic archaeon, Haloarcula japonica, was overexpressed in Escherichia coli. The gene product was successfully purified, using procedures based on the protein's halophilicity, and characterized. The expressed enzyme was stable in a buffer containing 2 M NaCl and exhibited high thermostability, retaining more than 90% of its activity after heating at 70 °C for 10 min. The enzyme was also tolerant to high concentrations of organic solvents, such as acetonitrile and dimethylsulfoxide. Moreover, H. japonica DERA was highly resistant to a high concentration of acetaldehyde and retained about 35% of its initial activity after 5-h' exposure to 300 mM acetaldehyde at 25 °C, the conditions under which E. coli DERA is completely inactivated. The enzyme exhibited much higher activity at 25 °C than the previously characterized hyperthermophilic DERAs (Sakuraba et al., 2007). Our results suggest that the extremely halophilic DERA has high potential to serve as a biocatalyst in organic syntheses. This is the first description of the biochemical characterization of a halophilic DERA. Copyright © 2016 Elsevier Inc. All rights reserved.

Changes in functional properties of the caffeine-sensitive Ca2+ store during differentiation of human SH-SY5Y neuroblastoma cells.

PubMed

Riddoch, Fiona C; Brown, Anna M; Rowbotham, Sophie E; Redfern, Christopher P F; Cheek, Timothy R

2007-03-01

We have used single cell fluorescence imaging techniques to examine how functional properties of the caffeine-sensitive Ca(2+) store change during differentiation of a sub-population of caffeine-sensitive SH-SY5Y cells. Application of caffeine (30 mM) 1-10.5 min after a 'priming' depolarisation pulse of 55 mM K(+) revealed that the caffeine-sensitive store in undifferentiated cells remained replete, whereas that in 9-cis retinoic acid (9cRA)-differentiated cells spontaneously dissipated with a t(1/2) of 2.8 min, and was essentially completely depleted approximately 10 min after priming. In 9cRA-differentiated cells that were stimulated with methacholine (10 microM) 1 min after priming, the amplitude, rate of rise and propagation velocity of the Ca(2+) wave in the neurites were all constant, whereas these kinetic parameters all progressively decreased as the wave travelled along the neurites in cells that were stimulated 10 min after priming. Use-dependent block with ryanodine inhibited the global Ca(2+) signal in 9cRA-differentiated cells stimulated with methacholine 1 min after priming (71+/-8%) but not 10 min after priming. Depolarisation was more effective at priming the caffeine-sensitive Ca(2+) store in 9cRA-differentiated cells, which lack a functional store-operated Ca(2+) entry pathway. We conclude that differentiation of caffeine-sensitive SH-SY5Y cells is accompanied by an increase in lability of the caffeine-sensitive Ca(2+) store, and that spontaneous dissipation of Ca(2+) from the store limits the time course of its molecular 'memory' during which it can amplify the hormone-induced Ca(2+) signal by Ca(2+)-induced Ca(2+) release.

Molecular analysis of the glucocerebrosidase gene locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winfield, S.L.; Martin, B.M.; Fandino, A.

1994-09-01

Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less

[Event-related potentials in character semantic priming of attention deficit hyperactivity disorder children and normal children: a comparative study].

PubMed

Xie, Na; Wang, Su-Hong; Ren, Yan-Ling; Ma, Ling; Dong, Xuan

2009-02-17

To investigate the cognitive event related potentials in Chinese character priming effect of children with attention deficit hyperactivity disorder (ADHD) and to analyze the neural mechanism of the priming effect. Fifty-two ADHD children aged (9.5 +/- 1.7) and 45 age-matched children without ADHD were asked to perform a Chinese character semantic priming task while electroencephalogram was recorded. During the Chinese character semantic priming task the subjects were instructed to judge whether the presented target word was a related word, unrelated word, or a pseudoword and event-related potentials (ERPs) were elicited and analyzed with the brain electricity source analysis (BESA) software. (1) The behavioral results showed that the reaction time to the unrelated character stimuli in the ADHD children was (1252 +/- 256) ms, significantly longer than that in the normal control [(1131 +/- 194) ms, P < 0.05]. (2) The amplitude of the character related N2 at the Cz lead in the ADHD children was -7.7 (-12.8, -5.0) microV, significantly larger than that of the normal controls [-5.6 (-9.4, -3.2) microV, P < 0.05]. (3) The amplitude of character unrelated stimuli P3 at the Cz lead of the ADHD children was 5.4 (2.0, 9.5) microV, significantly lower than that of the normal control [9.5 (4.2, 16.9) microV, P < 0.01]. There is a positive correlation between the amplitude of N2 and the difficulty in character semantic priming. It is more difficult for the ADHD children than normal controls to accomplish the same semantic task. ADHD children need more attention resources than normal controls. The amplitudes of character related-N2 and unrelated-P3 may become markers to measure the development of recognition in the ADHD children, thus being helpful in the ADHD diagnosis.

BIOCHEMICAL AND GENETIC CHARACTERIZATION OF AN EARLY STEP IN A NOVEL PATHWAY FOR THE BIOSYNTHESIS OF AROMATIC AMINO ACIDS AND P-AMINOBENZOIC ACID IN THE ARCHAEON METHANOCOCCUS MARIPALUDIS

EPA Science Inventory

Methanococcus maripaludis is a strictly anaerobic, methane-producing archaeon and facultative autotroph capable of biosynthesizing all the amino acids and vitamins required for growth. In this work, the novel 6-deoxy-5-ketofructose-1-phosphate (DKFP) pathway for the biosynthesis ...

Synthesis and molecular structure of the 5-methoxycarbonylpentyl a-Glycoside of the upstream, terminal moiety of the O-specific polysaccharide of vibrio cholerae O1, serotype inaba

USDA-ARS?s Scientific Manuscript database

Trimethylsilyl trifluoromethanesulfonate (TMSOTf) catalyzed reaction of methyl 6-hydroxyhexanoate with 3-O-benzyl-4-(2,4-di-O-acetyl-3-deoxy-L-glycero-tetronamido)-4,6-dideoxy-2-O-levulinoyl-'-D-mannopyranosyl trichloroacetimidate followed by two-step deprotection (hydrogenolysis over Pd/C catalyst ...

In vitro radiolabel uptake viability assay for Onchocerca microfilariae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Callahan, H.L.; Wakeman, J.M.; Crouch, R.K.

1989-02-01

A radiolabel uptake viability assay for Onchocerca cervicalis using (/sup 3/H)2-deoxy-D-glucose in Hanks' balanced salt solution, pH 7.5, at 30 C is described and compared to the traditional visual motility assay. A correlation of r = 0.92 between the assays was found, with the radiolabel uptake method apparently a more sensitive indicator of microfilarial viability.

Priming T-cell responses with recombinant measles vaccine vector in a heterologous prime-boost setting in non-human primates.

PubMed

Bolton, Diane L; Santra, Sampa; Swett-Tapia, Cindy; Custers, Jerome; Song, Kaimei; Balachandran, Harikrishnan; Mach, Linh; Naim, Hussein; Kozlowski, Pamela A; Lifton, Michelle; Goudsmit, Jaap; Letvin, Norman; Roederer, Mario; Radošević, Katarina

2012-09-07

Licensed live attenuated virus vaccines capable of expressing transgenes from other pathogens have the potential to reduce the number of childhood immunizations by eliciting robust immunity to multiple pathogens simultaneously. Recombinant attenuated measles virus (rMV) derived from the Edmonston Zagreb vaccine strain was engineered to express simian immunodeficiency virus (SIV) Gag protein for the purpose of evaluating the immunogenicity of rMV as a vaccine vector in rhesus macaques. rMV-Gag immunization alone elicited robust measles-specific humoral and cellular responses, but failed to elicit transgene (Gag)-specific immune responses, following aerosol or intratracheal/intramuscular delivery. However, when administered as a priming vaccine to a heterologous boost with recombinant adenovirus serotype 5 expressing the same transgene, rMV-Gag significantly enhanced Gag-specific T lymphocyte responses following rAd5 immunization. Gag-specific humoral responses were not enhanced, however, which may be due to either the transgene or the vector. Cellular response priming by rMV against the transgene was highly effective even when using a suboptimal dose of rAd5 for the boost. These data demonstrate feasibility of using rMV as a priming component of heterologous prime-boost vaccine regimens for pathogens requiring strong cellular responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

Modified bases enable high-efficiency oligonucleotide-mediated allelic replacement via mismatch repair evasion

PubMed Central

Wang, Harris H.; Xu, George; Vonner, Ashley J.; Church, George

2011-01-01

Genome engineering using single-stranded oligonucleotides is an efficient method for generating small chromosomal and episomal modifications in a variety of host organisms. The efficiency of this allelic replacement strategy is highly dependent on avoidance of the endogenous mismatch repair (MMR) machinery. However, global MMR inactivation generally results in significant accumulation of undesired background mutations. Here, we present a novel strategy using oligos containing chemically modified bases (2′-Fluoro-Uridine, 5-Methyl-deoxyCytidine, 2,6-Diaminopurine or Iso-deoxyGuanosine) in place of the standard T, C, A or G to avoid mismatch detection and repair, which we tested in Escherichia coli. This strategy increases transient allelic-replacement efficiencies by up to 20-fold, while maintaining a 100-fold lower background mutation level. We further show that the mismatched bases between the full length oligo and the chromosome are often not incorporated at the target site, probably due to nuclease activity at the 5′ and 3′ termini of the oligo. These results further elucidate the mechanism of oligo-mediated allelic replacement (OMAR) and enable improved methodologies for efficient, large-scale engineering of genomes. PMID:21609953

Immunogenicity of heterologous H5N1 influenza booster vaccination 6 or 18 months after primary vaccination in adults: a randomized controlled clinical trial.

PubMed

Langley, Joanne M; Frenette, Louise; Jeanfreau, Robert; Halperin, Scott A; Kyle, Michael; Chu, Laurence; McNeil, Shelly; Dramé, Mamadou; Moris, Philippe; Fries, Louis; Vaughn, David W

2015-01-15

Highly pathogenic avian influenza A/H5N1 viruses continue to circulate in birds and infect humans causing serious illness and death. In this randomized, observer-blinded study, adults ≥18 years of age (n=841) received 3.75 or 7.5 μg hemagglutinin antigen (HA) of an AS03-adjuvanted (AS03A or AS03B) A/Indonesia/5/2005 H5N1 (subclade 2.1) vaccine (priming), followed by the same HA dose of AS03-adjuvanted A/turkey/Turkey/1/05 H5N1 (clade 2.2) influenza vaccine as a booster 6 or 18 months after priming; an unprimed group received placebo at Day 0, and 3.75 μg HA of AS03A-adjuvanted booster vaccine at 6 and 18 months. Antibody responses were assessed by hemagglutination-inhibition assay (HI). Microneutralization (MN) antibody and cellular immunoassays were assessed in a subset of participants. Geometric mean titers (GMTs) and seroconversion rates (SCRs) were higher in primed vs. unprimed subjects against the booster strain 10 days following booster vaccination at month 6 and month 18. After the booster at 18 months, the lower limit of the 97.5% confidence interval for the difference in SCR and GMT ratios between primed and unprimed subjects was >15% and >2.0, respectively, fulfilling the primary endpoint criteria for superiority against the booster strain. MN and cellular immune responses corresponded with the immunogenicity seen in HI measures. Adults primed with a dose-sparing oil-in-water adjuvanted H5N1 subclade vaccine had rapid and durable antibody responses to a heterologous subclade boosting vaccine given 6 or 18 months later. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

48 CFR 1019.202-70-5 - Incentives for prime contractor participation.

Code of Federal Regulations, 2010 CFR

2010-10-01

... for prime contractor participation. (a) Under the Small Business Act, 15 U.S.C. 637(d)(4)(E), Treasury.../management factors. (b) A mentor's performance will be evaluated against the criteria described in DTAR 1052... contracts as a factor in determining contractor responsibility under FAR 19.705-5(a)(1). (d) Mentor-protégé...

Orthographic and Phonological Contributions to Reading Development: Tracking Developmental Trajectories Using Masked Priming

ERIC Educational Resources Information Center

Ziegler, Johannes C.; Bertrand, Daisy; Lété, Bernard; Grainger, Jonathan

2014-01-01

The present study used a variant of masked priming to track the development of 2 marker effects of orthographic and phonological processing from Grade 1 through Grade 5 in a cross-sectional study. Pseudohomophone (PsH) priming served as a marker for phonological processing, whereas transposed-letter (TL) priming was a marker for coarse-grained…

A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko

1994-01-01

The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophinmore » lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.« less

Prime-boost immunization using a DNA vaccine delivered by attenuated Salmonella enterica serovar typhimurium and a killed vaccine completely protects chickens from H5N1 highly pathogenic avian influenza virus.

PubMed

Pan, Zhiming; Zhang, Xiaoming; Geng, Shizhong; Fang, Qiang; You, Meng; Zhang, Lei; Jiao, Xinan; Liu, Xiufan

2010-04-01

H5N1 highly pathogenic avian influenza virus (HPAIV) has posed a great threat not only for the poultry industry but also for human health. However, an effective vaccine to provide a full spectrum of protection is lacking in the poultry field. In the current study, a novel prime-boost vaccination strategy against H5N1 HPAIV was developed: chickens were first orally immunized with a hemagglutinin (HA) DNA vaccine delivered by attenuated Salmonella enterica serovar Typhimurium, and boosting with a killed vaccine followed. Chickens in the combined vaccination group but not in single vaccination and control groups were completely protected against disease following H5N1 HPAIV intranasal challenge, with no clinical signs and virus shedding. Chickens in the prime-boost group also generated significantly higher serum hemagglutination inhibition (HI) titers and intestinal mucosal IgA titers against avian influenza virus (AIV) and higher host immune cellular responses than those from other groups before challenge. These results demonstrated that the prime-boost vaccination strategy provides an effective way to prevent and control H5N1 highly pathogenic avian influenza virus.

Sterile Protection against Plasmodium knowlesi in Rhesus Monkeys from a Malaria Vaccine: Comparison of Heterologous Prime Boost Strategies

PubMed Central

Jiang, George; Shi, Meng; Conteh, Solomon; Richie, Nancy; Banania, Glenna; Geneshan, Harini; Valencia, Anais; Singh, Priti; Aguiar, Joao; Limbach, Keith; Kamrud, Kurt I.; Rayner, Jonathan; Smith, Jonathan; Bruder, Joseph T.; King, C. Richter; Tsuboi, Takafumi; Takeo, Satoru; Endo, Yaeta; Doolan, Denise L.; Richie, Thomas L.; Weiss, Walter R.

2009-01-01

Using newer vaccine platforms which have been effective against malaria in rodent models, we tested five immunization regimens against Plasmodium knowlesi in rhesus monkeys. All vaccines included the same four P. knowlesi antigens: the pre-erythrocytic antigens CSP, SSP2, and erythrocytic antigens AMA1, MSP1. We used four vaccine platforms for prime or boost vaccinations: plasmids (DNA), alphavirus replicons (VRP), attenuated adenovirus serotype 5 (Ad), or attenuated poxvirus (Pox). These four platforms combined to produce five different prime/boost vaccine regimens: Pox alone, VRP/Pox, VRP/Ad, Ad/Pox, and DNA/Pox. Five rhesus monkeys were immunized with each regimen, and five Control monkeys received a mock vaccination. The time to complete vaccinations was 420 days. All monkeys were challenged twice with 100 P. knowlesi sporozoites given IV. The first challenge was given 12 days after the last vaccination, and the monkeys receiving the DNA/Pox vaccine were the best protected, with 3/5 monkeys sterilely protected and 1/5 monkeys that self-cured its parasitemia. There was no protection in monkeys that received Pox malaria vaccine alone without previous priming. The second sporozoite challenge was given 4 months after the first. All 4 monkeys that were protected in the first challenge developed malaria in the second challenge. DNA, VRP and Ad5 vaccines all primed monkeys for strong immune responses after the Pox boost. We discuss the high level but short duration of protection in this experiment and the possible benefits of the long interval between prime and boost. PMID:19668343

Stereoselective formation of a 2 prime (3 prime)- aminoacyl ester of a nucleotide

NASA Technical Reports Server (NTRS)

Weber, A. L.

1986-01-01

Reaction of DL-series and adenosine-5-phosphorimidazolide in the presence of adenosine-5'-(0-methylphosphate) and imidazole resulted in the stereoselective synthesis of the aminoacyl nucleotide ester, 2'(3')-0-seryl-adenosine-5'-(0-methylphosphate). The enantiomeric excess of D-serine incorporated into 2'(3')-0-seryl-adenosine-5'-(0-methylphosphate) was about 9%. Adenylyl-(5->N)-serine and an unknown product also incorporated an excess of D-serine, however, seryl-serine showed an excess of L-serine. The relationship of these results to the origin of the biological pairing of L-amino acids and nucleotides containing D-ribose is discussed.

Lysozyme revisited: crystallographic evidence for distortion of an N-acetylmuramic acid residue bound in site D.

PubMed

Strynadka, N C; James, M N

1991-07-20

A structure of the trisaccharide 2-acetamido-2-deoxy-D-muramic acid-beta (1----4)-2-acetamido-2-deoxy-D-glucose-beta (1----4)-2-acetamido-2-deoxy-D-muramic acid (NAM-NAG-NAM), bound to subsites B, C and D in the active-site cleft of hen egg-white lysozyme has been determined and refined at 1.5 A resolution. The resulting atomic co-ordinates indicate that the NAM residue in site D is distorted from the full 4C1 chair conformation to one in which the ring atoms C-1, C-2, O-5 and C-5 are approximately coplanar, and the hydroxymethyl group is positioned axially (a conformation best described as a sofa). This finding supports the original proposals that suggested the ground-state conformation of the sugar bound in site D is strained to one that more closely resembles the geometry required for the oxocarbonium-ion transition state, the next step along the reaction pathway. Additionally, detailed analysis at 1.5 A resolution of the environments of the catalytic residues Glu35 and Asp52 provides new information on the properties that may allow lysozyme to promote the stabilization of an unusually long-lived oxocarbonium-ion transition state. Intermolecular interactions between the N-acetylmuramic acid residue in site D and the lysozyme molecule that contribute to the saccharide ring distortion include: close packing of the O-3' lactyl group with a hydrogen-bonded "platform" of enzyme residues (Asp52, Asn46, Asn59, Ser50 and Asp48), a close contact between the hydroxymethyl group of ring D and the 2'-acetamido group of ring C and a strong hydrogen-bonded interaction between the NH group of Val109 and O-6 of ring D that stabilizes the observed quasi-axial orientation of the -CH2OH group. Additionally, the structure of this complex shows a strong hydrogen bond between the carboxyl group of Glu35 and the beta-anomeric hydroxyl group of the NAM residue in site D. The hydrogen-bonded environment of Asp52 in the native enzyme and in the complex coupled with the very unfavorable direction of approach of the potential carboxylate nucleophile makes it most unlikely that there is a covalent glycosylenzyme intermediate on the hydrolysis pathway of hen egg-white lysozyme.

Can Achievement Goals be Primed in Competitive Tasks?

PubMed Central

Greenlees, Iain; Figgins, Sean; Kearney, Philip

2014-01-01

This study examined whether achievement goal priming effects would be observed within an overtly competitive setting. Male soccer players (N = 66) volunteered to participate in a soccer penalty-kick taking competition during which they took 20 penalty-kicks on 2 occasions. Following a pretest, participants were allocated to 1 of 5 priming conditions. Immediately prior to the posttest, participants in the priming conditions were asked to complete what was presented as an ostensibly unrelated task that took the form of either a computer task (subliminal priming) or wordsearch task (supraliminal priming). Results revealed that priming had no significant influence on performance. PMID:25031692

On the stereoselective aminoacylation of RNA

NASA Technical Reports Server (NTRS)

Usher, D. A.; Needels, M. C.

1984-01-01

Gabbay and Kleinman (1970) have found that stereospecific complex formation (noncovalent) occurs between nucleic acids and a number of derivatives of amino acids. However, until recently, chiral selection in any nonenzymatic RNA-aminoacylation reaction was unknown. Profy and Usher (1984) reported that aminoacylation of the 'internal' 2-prime-ester occurred with a significant amount of stereoselection. Profy and Usher (1984) have also observed that aminoacylation of the 'internal' 2-prime-hydroxyl groups of polyribonucleotides by the imidazolide of N-3,5-dinitrobenzoylalanine occurs with chiral selection. In order to obtain further information regarding the considered phenomena, a systematic investigation was initiated of the factors which contribute to the observed stereoselectivity of the aminoacylation reaction. In the present paper, the effect of a change in the amino acid from alanine to leucine is considered along with an investigation of the D- and L-alanyl internal' 2-prime esters of the dinucleoside monophosphate of 3-prime,5-prime-ApA.

Phonological priming in young children who stutter: holistic versus incremental processing.

PubMed

Byrd, Courtney T; Conture, Edward G; Ohde, Ralph N

2007-02-01

To investigate the holistic versus incremental phonological encoding processes of young children who stutter (CWS; N = 26) and age- and gender-matched children who do not stutter (CWNS; N = 26) via a picture-naming auditory priming paradigm. Children named pictures during 3 auditory priming conditions: neutral, holistic, and incremental. Speech reaction time (SRT) was measured from the onset of picture presentation to the onset of participant response. CWNS shifted from being significantly faster in the holistic priming condition to being significantly faster in the incremental priming condition from 3 to 5 years of age. In contrast, the majority of 3- and 5-year-old CWS continued to exhibit faster SRT in the holistic than the incremental condition. CWS are delayed in making the developmental shift in phonological encoding from holistic to incremental processing, a delay that may contribute to their difficulties establishing fluent speech.

Seven novel mutations at the 5,10-methylenetetrahydrofolate reductase locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goyette, P.; Frosst, P.; Rosenblatt, D.S.

1994-09-01

5,10-methylenetetrahydrofolate reductase (MTHFR), a flavoprotein, catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a cofactor for methionine synthase in the methylation of homocysteine to methionine. Severe MTHFR deficiency, which causes homocysteinemia, is an autosomal recessive disorder with variable clinical features; developmental delay, perinatal death, mental retardation and asymptomatic individuals have been observed. A milder deficiency has been reported in patients with cardiovascular disease. We have recently described the isolation of a cDNA for MTHFR and the identification of 2 mutations in patients with severe MTHFR deficiency. We report here the characterization of 7 additional mutations at this locus: 5 missense mutationsmore » and 2 splicing mutations. Mutation analysis was performed by SSCP on PCR products generated either from reverse transcription-PCR of patients` total fibroblast RNA or from PCR of patients` genomic DNA. The 5 missense mutations are as follows: 1 Arg to Cys substitution in a hydrophilic segment proposed to be the hinge region that connects the catalytic and regulatory domains, 2 different Arg to Cys substitutions in 2 patients whose enzymatic thermolability is responsive to FAD, 1 Thr to Met substitution affecting an evolutionarily-conserved residue and a Pro to Leu substitution. The 2 splicing mutations affect the 5{prime} splice site and the 3{prime} splice site of 2 introns, respectively. The 5{prime} splice site mutation generates a 57 bp in-frame deletion of the RNA through the utilization of a cryptic 5{prime} splice site within the coding sequence. The identification of 9 mutations at this locus has allowed us to make preliminary correlations between genotype and phenotype and to contribute to a structure:function analysis of the enzyme.« less

A between-subjects test of the lower-identification/ higher-priming paradox.

PubMed

Rubino, I Alex; Rociola, Giuseppe; Di Lorenzo, Giorgio; Magni, Valentina; Ribolsi, Michele; Mancini, Valentina; Saya, Anna; Pezzarossa, Bianca; Siracusano, Alberto; Suslow, Thomas

2013-01-01

An under-recognised U-shaped model states that unconscious and conscious perceptual effects are functionally exclusive and that unconscious perceptual effects manifest themselves only at the objective detection threshold, when conscious perception is completely absent. We tested the U-shaped line model with a between-subjects paradigm. Angry, happy, neutral faces, or blank slides were flashed for 5.5 ms and 19.5 ms before Chinese ideographs in a darkened room. A group of volunteers (n = 84) were asked to rate how much they liked each ideograph and performed an identification task. According to the median identification score two subgroups were composed; one with 50% or < 50% identification scores (n = 31), and one with above 50% identification scores (n = 53). The hypothesised U-shaped line was confirmed by the findings. Affective priming was found only at the two extreme points: the 5.5 ms condition of the low-identification group (subliminal perception) and the 19.5 ms condition of the > 50% high-identification group (supraliminal perception). The two intermediate points (19.5 ms of the low-identification group and 5.5 ms of the high-identification group) did not correspond to significant priming effects. These results confirm that a complete absence of conscious perception is the condition for the deployment of unconscious perceptual effects.

19F and 13C NMR studies of polyol metabolism in freeze-tolerant pupae of Hyalophora cecropia.

PubMed

Podlasek, C A; Serianni, A S

1994-01-28

Sorbitol biosynthesis and regulation in freeze tolerant pupae of Hyalophora cecropia have been investigated as a function of temperature by 19F and 13C nuclear magnetic resonance (NMR) spectroscopy using several 13C-labeled and/or fluorine-substituted carbohydrates. 3-Deoxy-3-fluoro-D-glucose (3DFG) was metabolized to 3-deoxy-3-fluoro-D-sorbitol (3DFS), 3-deoxy-3-fluoro-D-fructose (3DFF), and 3-deoxy-3-fluoro-D-gluconic acid (3DFGA), indicating that the enzymes required for sorbitol biosynthesis and metabolism are active in H. cecropia at warm (22 degrees C) and cold (4 and -10 degrees C) temperatures. Two additional metabolites were produced when pupae were injected with either 3DFG, 3DFS, 3DFF, or 3-deoxy-3-fluoro-D-mannose (3DFM). One of these was identified as 3-deoxy-3-fluoro-D-mannitol (3DFML) by 13C NMR using [1-13C]3DFM and [1-13C]3DFG as metabolic probes. H. cecropia pupae injected with D-glucose labeled with 13C at C-1, C-2, or C-3 and subsequently analyzed by 13C NMR clearly demonstrated the ability to generate sorbitol and fructose. In contrast, gas chromatography/mass spectrometric analysis of hemolymph failed to detect sorbitol in pupae reared under natural conditions (i.e. in the absence of injected enriched sugars). Thus, although H. cecropia pupae have the enzymic machinery to biosynthesize sorbitol, they do not appear to accumulate high steady-state concentrations of this polyol over the temperature range studied. The specificity of the enzymes involved in alditol biosynthesis in H. cecropia was examined by 13C NMR with a wide range of aldoses enriched with 13C at C-1. Pupae were capable of converting these sugars to their corresponding [1-13C]alditols, indicating that nonspecific dehydrogenase(s), in addition to aldose reductase, is(are) involved in polyol biosynthesis in H. cecropia pupae.

Callose deposition during gravitropism of Zea mays and Pisum sativum and its inhibition by 2-deoxy-D-glucose

NASA Technical Reports Server (NTRS)

Jaffe, M. J.; Leopold, A. C.

1984-01-01

In etiolated corn (Zea mays L.) and etiolated pea (Pisum sativum L.) seedlings, a gravitropic stimulation induces the deposition of callose. In the corn coleoptiles this occurs within 5 min of gravity stimulation, and prior to the beginning of curvature. Both gravitropic curvature and callose deposition reach their maxima by 12 h. Within the first 2 h more callose is deposited on the upper (concave) side, but after 2-3 h, this deposition pattern is reversed. An inhibitor of protein glycosylation, 2-deoxy-D-glucose (DDG), inhibits callose production and considerably retards gravitropic bending in both species of plants. Mannose can relieve the inhibition of gravitropic bending by DDG. The pea mutant "Ageotropum", which does not respond to gravity when etiolated, also fails to produce callose in response to a gravitic stimulus. These correlations indicate that callose deposition may be a biochemical component of gravitropism in plant shoots.

Biosynthesis of 2-methyl-3-buten-2-ol emitted from needles of Pinus ponderosa via the non-mevalonate DOXP/MEP pathway of isoprenoid formation.

PubMed

Zeidler, J; Lichtenthaler, H K

2001-06-01

The volatile hemiterpene 2-methyl-3-buten-2-ol (MBO) is emitted from the needles of several pine species from the Western United States and contributes to ozone formation in the atmosphere. It is synthesised enzymatically from dimethylallyl diphosphate (DMAPP). We show here that needles of Pinus ponderosa Laws. incorporated [1-2H1]-1-deoxy-D-xylulose (d-DOX) into the emitted MBO, but not D,L-[2-13C]mevalonic acid lactone. Furthermore, MBO emission was inhibited by fosmidomycin, a specific inhibitor of the second enzyme of the mevalonate-independent pathway of isopentenyl diphosphate and DMAPP formation, i.e. the 1-deoxy-D-xylulose 5-phosphate/2-C-methyl-D-erythritol 4-phosphate (DOXP/MEP) pathway. We thus prove that MBO emitted from needles of P. ponderosa is primarily formed via the DOXP/MEP pathway.

Sensomics-Based Molecularization of the Taste of Pot-au-Feu, a Traditional Meat/Vegetable Broth.

PubMed

Kranz, Maximilian; Viton, Florian; Smarrito-Menozzi, Candice; Hofmann, Thomas

2018-01-10

Targeted quantification of 49 basic taste-active molecules, followed by the calculation of dose-over-threshold (DoT) factors, and taste re-engineering experiments revealed minerals, nucleotides/nucleosides, amino acids, organic acids, and carbohydrates as the key compounds of Pot-au-Feu, a traditional broth preparation from beef cuts and vegetables. Moreover, the dipeptide carnosine was identified to be the key inducer for the white-meaty and thick-sour orosensation of the broth, next to anserine and 1-deoxy-d-fructosyl-N-β-alanyl-l-histidine, the latter of which has been identified for the first time by means of a sensory-guided fractionation. Sensory studies revealed the threshold concentration of carnosine in model broth to decrease by a factor of 5 upon nonenzymatic glycosylation to reach 4.4 mmol/L for its Amadori product 1-deoxy-d-fructosyl-N-β-alanyl-l-histidine.

75 FR 22847 - Prohibited Transaction Exemptions and Grant of Individual Exemptions Involving: 2010-13, Putnam...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-30

...'' means the Putnam Money Market Liquidity Fund and any other money market fund that is a diversified open... section III(d) to reflect the fact that the Putnam Prime Money Market Fund is no longer in existence. In..., the word ``2006'' should be deleted; (5) Paragraph 5 of the Summary refers to the Putnam Prime Money...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Young, M.E.; Keegstra, K.; Froehlich, J.E.

Protein import into chloroplasts is an energy-requiring process mediated by a pertinacious import apparatus. Although previous work has shown that low levels of ATP or GTP can support precursor binding, the role of GTP during the import process remains unclear. Specifically, it is unknown whether GTP plays a separate role from ATP during the early stages of protein import and whether GTP has any role in the later stages of transport. The authors investigated the role of GTP during the various stages of protein import into chloroplasts by using purified GTP analogs and an in vitro import assay. GTP, GDP,more » the nonhydrolyzable analog GMP-PNP, and the slowly hydrolyzable analogs guanosine 5{prime}-O-(2-thiodiphosphate) and guanosine 5{prime}-O-(3-thiotriphosphate) were used in this study. Chromatographically purified 5{prime}-guanylyl-imido-diphosphate and guanosine 5{prime}-O-(3-thiotriphosphate) were found to inhibit the formation of early-import intermediates, even in the presence of ATP. The authors also observed that GTP does not play a role during the translocation of precursors from the intermediate state. They conclude that GTP hydrolysis influences events leading to the formation of early-import intermediates, but not subsequent steps such as precursor translocation.« less

Priming Addition Facts with Semantic Relations

ERIC Educational Resources Information Center

Bassok, Miriam; Pedigo, Samuel F.; Oskarsson, An T.

2008-01-01

Results from 2 relational-priming experiments suggest the existence of an automatic analogical coordination between semantic and arithmetic relations. Word pairs denoting object sets served as primes in a task that elicits "obligatory" activation of addition facts (5 + 3 activates 8; J. LeFevre, J. Bisanz, & L. Mrkonjic, 1988). Semantic relations…

Phasic Affective Modulation of Semantic Priming

ERIC Educational Resources Information Center

Topolinski, Sascha; Deutsch, Roland

2013-01-01

The present research demonstrates that very brief variations in affect, being around 1 s in length and changing from trial to trial independently from semantic relatedness of primes and targets, modulate the amount of semantic priming. Implementing consonant and dissonant chords (Experiments 1 and 5), naturalistic sounds (Experiment 2), and visual…

"Replicable effects of primes on human behavior": Correction to Payne et al. (2016).

PubMed

2016-12-01

Reports an error in "Replicable effects of primes on human behavior" by B. Keith Payne, Jazmin L. Brown-Iannuzzi and Chris Loersch ( Journal of Experimental Psychology: General , 2016[Oct], Vol 145[10], 1269-1279). In the article, the graph in Figure 5 did not contain the asterisk mentioned in the figure caption, which was intended to indicate a statistically significant difference between bet and pass prime. The online version of this article has been corrected. (The following abstract of the original article appeared in record 2016-46925-002.) The effect of primes (i.e., incidental cues) on human behavior has become controversial. Early studies reported counterintuitive findings, suggesting that primes can shape a wide range of human behaviors. Recently, several studies failed to replicate some earlier priming results, raising doubts about the reliability of those effects. We present a within-subjects procedure for priming behavior, in which participants decide whether to bet or pass on each trial of a gambling game. We report 6 replications (N = 988) showing that primes consistently affected gambling decisions when the decision was uncertain. Decisions were influenced by primes presented visibly, with a warning to ignore the primes (Experiments 1 through 3) and with subliminally presented masked primes (Experiment 4). Using a process dissociation procedure, we found evidence that primes influenced responses through both automatic and controlled processes (Experiments 5 and 6). Results provide evidence that primes can reliably affect behavior, under at least some conditions, without intention. The findings suggest that the psychological question of whether behavior priming effects are real should be separated from methodological issues affecting how easily particular experimental designs will replicate. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

Structures of nitrato-(2-hydroxybenzaldehydo) (2,2 Prime -bipyridyl)copper and nitrato-(2-hydroxy-5-nitrobenzaldehydo)(2,2 Prime -bipyridyl)copper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chumakov, Yu. M.; Paladi, L. G.; Antosyak, B. Ya.

2011-03-15

Nitrato-(2-hydroxy-5-nitrobenzaldehydo)(2,2 Prime -bipyridyl)copper (I) and nitrato-(2-hydroxybenzaldehydo)(2,2 Prime -bipyridyl)copper (II) were synthesized and characterized by X-ray diffraction. The coordination polyhedron of the central copper atom in complex I can be described as a distorted tetragonal pyramid whose base is formed by the phenol and carbonyl oxygen atoms of the monodeprotonated 2-hydroxy-5nitrobenzaldehyde molecule and the nitrogen atoms of the 2,2 Prime -bipyridyl ligand and whose apex is occupied by the oxygen atom of the nitrato group. In the crystal structure, complexes I are linked by the acido ligands and the NO{sub 2} groups of the aldehyde molecule into infinite chains. In complexmore » II, the central copper atom is coordinated by 2-hydroxybenzaldehyde, 2,2 Prime -bipyridyl, and the nitrato group, resulting in the formation of centrosymmetric dimers. The coordination polyhedron of the central copper atom can be described as a bipyramid (4 + 1 + 1) with the same base as in complex I. The axial vertices of the bipyramid are occupied by the oxygen atom of the nitrato group and the bridging phenol oxygen atom of the adjacent complex related to the initial complex by a center of symmetry. In the crystal structure, complexes II are hydrogen bonded into infinite chains.« less

Pseudo-random number generator for the Sigma 5 computer

NASA Technical Reports Server (NTRS)

Carroll, S. N.

1983-01-01

A technique is presented for developing a pseudo-random number generator based on the linear congruential form. The two numbers used for the generator are a prime number and a corresponding primitive root, where the prime is the largest prime number that can be accurately represented on a particular computer. The primitive root is selected by applying Marsaglia's lattice test. The technique presented was applied to write a random number program for the Sigma 5 computer. The new program, named S:RANDOM1, is judged to be superior to the older program named S:RANDOM. For applications requiring several independent random number generators, a table is included showing several acceptable primitive roots. The technique and programs described can be applied to any computer having word length different from that of the Sigma 5.

KSC-2009-1473

NASA Image and Video Library

2009-02-04

VANDENBERG AIR FORCE BASE, Calif. -- The mobile service tower moves away from the Delta II rocket with NASA's NOAA-N Prime satellite aboard on the Space Launch Complex 2 at Vandenberg Air Force Base in California. The launch of the NOAA-N Prime weather satellite was scrubbed at 5 a.m. EST Feb. 3 when a launch pad gaseous nitrogen pressurization system failed. This system maintains pressurization and purges to various systems of the Delta II rocket prior to launch. Immediate repair to this system was being taken. The next launch attempt will be no earlier than 5:22 a.m. EST Feb. 5, weather permitting. NOAA-N Prime is the latest polar-orbiting operational environmental weather satellite developed by NASA for the National Oceanic and Atmospheric Administration. Photo credit: NASA/Carleton Bailie, VAFB-ULA

Metabolomic Markers of Altered Nucleotide Metabolism in Early Stage Adenocarcinoma

PubMed Central

Wikoff, William R.; Grapov, Dmitry; Fahrmann, Johannes F.; DeFelice, Brian; Rom, William; Pass, Harvey; Kim, Kyoungmi; Nguyen, UyenThao; Taylor, Sandra L.; Kelly, Karen; Fiehn, Oliver; Miyamoto, Suzanne

2015-01-01

Adenocarcinoma, a type of non-small-cell lung cancer (NSCLC), is the most frequently diagnosed lung cancer and the leading cause of lung cancer mortality in the United States. It is well documented that biochemical changes occur early in the transition from normal to cancer cells, but the extent to which these alterations affect tumorigenesis in adenocarcinoma remains largely unknown. Herein we describe the application of mass spectrometry and multivariate statistical analysis in one of the largest biomarker research studies to date aimed at distinguishing metabolic differences between malignant and non-malignant lung tissue. Gas chromatography time-of-flight mass spectrometry was used to measure 462 metabolites in 39 malignant and non-malignant lung tissue pairs from current or former smokers with early stage (Stage IA–IB) adenocarcinoma. Statistical mixed effects models, orthogonal partial least squares discriminant analysis and network integration, were used to identify key cancer-associated metabolic perturbations in adenocarcinoma compared to non-malignant tissue. Cancer-associated biochemical alterations were characterized by: 1) decreased glucose levels, consistent with the Warburg effect, 2) changes in cellular redox status highlighted by elevations in cysteine and antioxidants, alpha- and gamma-tocopherol, 3) elevations in nucleotide metabolites 5,6-dihydrouracil and xanthine suggestive of increased dihydropyrimidine dehydrogenase and xanthine oxidoreductase activity, 4) increased 5'-deoxy-5'-methylthioadenosine levels indicative of reduced purine salvage and increased de novo purine synthesis and 5) coordinated elevations in glutamate and UDP-N-acetylglucosamine suggesting increased protein glycosylation. The present study revealed distinct metabolic perturbations associated with early stage lung adenocarcinoma which may provide candidate molecular targets for personalizing therapeutic interventions and treatment efficacy monitoring. PMID:25657018

Viral replication. Structural basis for RNA replication by the hepatitis C virus polymerase.

PubMed

Appleby, Todd C; Perry, Jason K; Murakami, Eisuke; Barauskas, Ona; Feng, Joy; Cho, Aesop; Fox, David; Wetmore, Diana R; McGrath, Mary E; Ray, Adrian S; Sofia, Michael J; Swaminathan, S; Edwards, Thomas E

2015-02-13

Nucleotide analog inhibitors have shown clinical success in the treatment of hepatitis C virus (HCV) infection, despite an incomplete mechanistic understanding of NS5B, the viral RNA-dependent RNA polymerase. Here we study the details of HCV RNA replication by determining crystal structures of stalled polymerase ternary complexes with enzymes, RNA templates, RNA primers, incoming nucleotides, and catalytic metal ions during both primed initiation and elongation of RNA synthesis. Our analysis revealed that highly conserved active-site residues in NS5B position the primer for in-line attack on the incoming nucleotide. A β loop and a C-terminal membrane-anchoring linker occlude the active-site cavity in the apo state, retract in the primed initiation assembly to enforce replication of the HCV genome from the 3' terminus, and vacate the active-site cavity during elongation. We investigated the incorporation of nucleotide analog inhibitors, including the clinically active metabolite formed by sofosbuvir, to elucidate key molecular interactions in the active site. Copyright © 2015, American Association for the Advancement of Science.

Immunization with herpes simplex virus 2 (HSV-2) genes plus inactivated HSV-2 is highly protective against acute and recurrent HSV-2 disease.

PubMed

Morello, Christopher S; Levinson, Michael S; Kraynyak, Kimberly A; Spector, Deborah H

2011-04-01

To date, no vaccine that is safe and effective against herpes simplex virus 2 (HSV-2) disease has been licensed. In this study, we evaluated a DNA prime-formalin-inactivated-HSV-2 (FI-HSV2) boost vaccine approach in the guinea pig model of acute and recurrent HSV-2 genital disease. Five groups of guinea pigs were immunized and intravaginally challenged with HSV-2. Two groups were primed with plasmid DNAs encoding the secreted form of glycoprotein D2 (gD2t) together with two genes required for viral replication, either the helicase (UL5) and DNA polymerase (UL30) genes or the single-stranded DNA binding protein (UL29) and primase (UL52) genes. Both DNA-primed groups were boosted with FI-HSV2 formulated with monophosphoryl lipid A (MPL) and alum adjuvants. Two additional groups were primed with the empty backbone plasmid DNA (pVAX). These two groups were boosted with MPL and alum (MPL-alum) together with either formalin-inactivated mock HSV-2 (FI-Mock) or with FI-HSV2. The final group was immunized with gD2t protein in MPL-alum. After challenge, 0/9 animals in the group primed with UL5, UL30, and gD2t DNAs and all 10 animals in the mock-immunized control group (pVAX-FI-Mock) developed primary lesions. All mock controls developed recurrent lesions through day 100 postchallenge. Only 1 guinea pig in the group primed with pVAX DNA and boosted with FI-HSV2 (pVAX-FI-HSV2 group) and 2 guinea pigs in the group primed with UL5, UL30, and gD2t DNAs and boosted with FI-HSV2 (UL5, UL30, gD2t DNA-FI-HSV2 group) developed recurrent lesions. Strikingly, the UL5, UL30, gD2t DNA-FI-HSV2 group showed a 97% reduction in recurrent lesion days compared with the mock controls, had the highest reduction in days with recurrent disease, and contained the lowest mean HSV-2 DNA load in the dorsal root ganglia.

The myotonic dystrophy kinase 3{prime}-untranslated region and its effect on gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ang, C.W.Y.; Sabourin, L.A.; Narang, M.A.

1994-09-01

Myotonic dystrophy (DM) is an autosomal dominant neuromuscular disease involving the expansion of an unstable CTG repeat in the 3{prime}-untranslated (3{prime}-UTR) region of the DM kinase (DMK) gene. Increased levels of mRNA in congenital compared to normal tissue have been shown, suggesting elevated DMK levels may be responsible for the disease phenotype. To study the effect of the DMK 3{prime}UTR on gene expression, a reporter gene system was constructed using the constitutive CMV promoter with the chloramphenicol acetyl transferase (CAT) open reading frame and the DMK 3{prime}UTR containing from 5 repeats up to 90 repeats. Transient transfection into a rhabdomyosarcomamore » cell line shows a three-fold increase in CAT activity from constructs containing a wildtype 3{prime}UTR (5 and 20 repeats) compared to a control construct containing only a poly(A) signal. Reporter constructs with repeats in the protomutation (50 repeats) and mutation (90 repeats) range show a greater than 10-fold increase over control CAT activity. These results suggest the presence of elements in the DMK 3{prime}UTR capable of conferring increased gene expression. We are currently investigating cell-specific activity of the constructs and conducting deletion mapping to identify regulatory elements in the 3{prime}-UTR.« less

Screening and Identification for Immunological Active Components from Andrographis Herba Using Macrophage Biospecific Extraction Coupled with UPLC/Q-TOF-MS.

PubMed

Wang, Yaqi; Jiao, Jiaojiao; Yang, Yuanzhen; Yang, Ming; Zheng, Qin

2018-04-30

The method of cell biospecific extraction coupled with UPLC/Q-TOF-MS has been developed as a tool for the screening and identification of potential immunological active components from Andrographis Herba (AH). In our study, a macrophage cell line (RAW264.7) was used to extract cell-combining compounds from the ethanol extract of AH. The cell binding system was then analyzed and identified by UPLC/Q-TOF-MS analysis. Finally, nine compounds, which could combine with macrophages, in an ethanol extract of AH were detected by comparing basic peak intensity (BPI) profiles of macrophages before and after treatment with AH. Then they were identified as Andrographidine E ( 1 ), Andrographidine D ( 2 ), Neoandrographolide ( 3 ), Dehydroandrographolide ( 4 ), 5, 7, 2′, 3′-tetramethoxyflavone ( 5 ), β-sitosterol ( 7 ), 5-hydroxy-7, 2′, 3′-trimethoxyflavone ( 8 ) and 5-hydroxy-7, 8, 2′, 3′-tetramethoxyflavone ( 9 ), which could classified into five flavonoids, three diterpene lactones, and one sterol. Their structures were recognized by their characteristic fragment ions and fragmentations pattern of diterpene lactones and flavonoids. Additionally, the activity of compounds 3 , 4 , and 7 was tested in vitro. Results showed that these three compounds could decrease the release of NO ( p < 0.01) in macrophages remarkably. Moreover, 3 , 4 , and 7 showed satisfactory dose-effect relationships and their IC 50 values were 9.03, 18.18, and 13.76 μg/mL, respectively. This study is the first reported work on the screening of immunological active components from AH. The potential immunological activity of flavonoids from AH has not been reported previously.

Metabolic Flux Analysis of Plastidic Isoprenoid Biosynthesis in Poplar Leaves Emitting and Nonemitting Isoprene1[W

PubMed Central

Ghirardo, Andrea; Wright, Louwrance Peter; Bi, Zhen; Rosenkranz, Maaria; Pulido, Pablo; Rodríguez-Concepción, Manuel; Niinemets, Ülo; Brüggemann, Nicolas; Gershenzon, Jonathan; Schnitzler, Jörg-Peter

2014-01-01

The plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway is one of the most important pathways in plants and produces a large variety of essential isoprenoids. Its regulation, however, is still not well understood. Using the stable isotope 13C-labeling technique, we analyzed the carbon fluxes through the MEP pathway and into the major plastidic isoprenoid products in isoprene-emitting and transgenic isoprene-nonemitting (NE) gray poplar (Populus × canescens). We assessed the dependence on temperature, light intensity, and atmospheric [CO2]. Isoprene biosynthesis was by far (99%) the main carbon sink of MEP pathway intermediates in mature gray poplar leaves, and its production required severalfold higher carbon fluxes compared with NE leaves with almost zero isoprene emission. To compensate for the much lower demand for carbon, NE leaves drastically reduced the overall carbon flux within the MEP pathway. Feedback inhibition of 1-deoxy-d-xylulose-5-phosphate synthase activity by accumulated plastidic dimethylallyl diphosphate almost completely explained this reduction in carbon flux. Our data demonstrate that short-term biochemical feedback regulation of 1-deoxy-d-xylulose-5-phosphate synthase activity by plastidic dimethylallyl diphosphate is an important regulatory mechanism of the MEP pathway. Despite being relieved from the large carbon demand of isoprene biosynthesis, NE plants redirected only approximately 0.5% of this saved carbon toward essential nonvolatile isoprenoids, i.e. β-carotene and lutein, most probably to compensate for the absence of isoprene and its antioxidant properties. PMID:24590857

Metabolic flux analysis of plastidic isoprenoid biosynthesis in poplar leaves emitting and nonemitting isoprene.

PubMed

Ghirardo, Andrea; Wright, Louwrance Peter; Bi, Zhen; Rosenkranz, Maaria; Pulido, Pablo; Rodríguez-Concepción, Manuel; Niinemets, Ülo; Brüggemann, Nicolas; Gershenzon, Jonathan; Schnitzler, Jörg-Peter

2014-05-01

The plastidic 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway is one of the most important pathways in plants and produces a large variety of essential isoprenoids. Its regulation, however, is still not well understood. Using the stable isotope 13C-labeling technique, we analyzed the carbon fluxes through the MEP pathway and into the major plastidic isoprenoid products in isoprene-emitting and transgenic isoprene-nonemitting (NE) gray poplar (Populus×canescens). We assessed the dependence on temperature, light intensity, and atmospheric [CO2]. Isoprene biosynthesis was by far (99%) the main carbon sink of MEP pathway intermediates in mature gray poplar leaves, and its production required severalfold higher carbon fluxes compared with NE leaves with almost zero isoprene emission. To compensate for the much lower demand for carbon, NE leaves drastically reduced the overall carbon flux within the MEP pathway. Feedback inhibition of 1-deoxy-D-xylulose-5-phosphate synthase activity by accumulated plastidic dimethylallyl diphosphate almost completely explained this reduction in carbon flux. Our data demonstrate that short-term biochemical feedback regulation of 1-deoxy-d-xylulose-5-phosphate synthase activity by plastidic dimethylallyl diphosphate is an important regulatory mechanism of the MEP pathway. Despite being relieved from the large carbon demand of isoprene biosynthesis, NE plants redirected only approximately 0.5% of this saved carbon toward essential nonvolatile isoprenoids, i.e. β-carotene and lutein, most probably to compensate for the absence of isoprene and its antioxidant properties.

Production of mono- and sesquiterpenes in Camelina sativa oilseed.

PubMed

Augustin, Jörg M; Higashi, Yasuhiro; Feng, Xiaohong; Kutchan, Toni M

2015-09-01

Camelina was bioengineered to accumulate (4 S )-limonene and (+)-δ-cadinene in seed. Plastidic localization of the recombinant enzymes resulted in higher yields than cytosolic localization. Overexpressing 1-deoxy- d -xylulose-5-phosphate synthase ( DXS ) further increased terpene accumulation. Many plant-derived compounds of high value for industrial or pharmaceutical applications originate from plant species that are not amenable to cultivation. Biotechnological production in low-input organisms is an attractive alternative. Several microbes are well established as biotechnological production platforms; however, their growth requires fermentation units, energy input, and nutrients. Plant-based production systems potentially allow the generation of high-value compounds on arable land with minimal input. Here we explore whether Camelina sativa (camelina), an emerging low-input non-foodstuff Brassicaceae oilseed crop grown on marginal lands or as a rotation crop on fallow land, can successfully be refactored to produce and store novel compounds in seed. As proof-of-concept, we use the cyclic monoterpene hydrocarbon (4S)-limonene and the bicyclic sesquiterpene hydrocarbon (+)-δ-cadinene, which have potential biofuel and industrial solvent applications. Post-translational translocation of the recombinant enzymes to the plastid with concurrent overexpression of 1-deoxy-D-xylulose-5-phosphate synthase (DXS) resulted in the accumulation of (4S)-limonene and (+)-δ-cadinene up to 7 mg g(-1) seed and 5 mg g(-1) seed, respectively. This study presents the framework for rapid engineering of camelina oilseed production platforms for terpene-based high-value compounds.

Comparison of Fixed-Stabilizer, Adjustable-Stabilizer and All-Moveable Horizontal Tails

DTIC Science & Technology

1945-10-01

the thrust axis and wind direction at Infinity, degrees; primed to indicate that a is corrected for ground interference effects 5 angular ...deflection of control surface, degrees i+- maximum angular deflection of stabilizer measured with reference to thrust axis, degrees hnax...5e maximum negative angular deflection of elevator, degrees E downwash angle at teil, degrees; primed to indicate that e Is

Contribution of the Priming Paradigm to the Understanding of the Conceptual Developmental Shift from 5 to 9 Years of Age

ERIC Educational Resources Information Center

Perraudin, Sandrine; Mounoud, Pierre

2009-01-01

We conducted three experiments to study the role of instrumental (e.g. "knife-bread") and categorical (e.g. "cake-bread") relations in the development of conceptual organization with a priming paradigm, by varying the nature of the task (naming--Experiment 1--or categorical decision--Experiments 2 and 3). The participants were 5-, 7- and…

Efficient triple helix formation by oligodeoxyribonucleotides containing alpha- or beta-2-amino-5-(2-deoxy-D-ribofuranosyl) pyridine residues.

PubMed

Bates, P J; Laughton, C A; Jenkins, T C; Capaldi, D C; Roselt, P D; Reese, C B; Neidle, S

1996-11-01

Triple helices containing C+xGxC triplets are destabilised at physiological pH due to the requirement for base protonation of 2'-deoxycytidine (dC), which has a pKa of 4.3. The C nucleoside 2-amino-5-(2'-deoxy-beta-D-ribofuranosyl)pyridine (beta-AP) is structurally analogous to dC but is considerably more basic, with a pKa of 5.93. We have synthesised 5'-psoralen linked oligodeoxyribonucleotides (ODNs) containing thymidine (dT) and either beta-AP or its alpha-anomer (alpha-AP) and have assessed their ability to form triplexes with a double-stranded target derived from standard deoxynucleotides (i.e. beta-anomers). Third strand ODNs derived from dT and beta-AP were found to have considerably higher binding affinities for the target than the corresponding ODNs derived from dT and either dC or 5-methyl-2'-deoxycytidine (5-Me-dC). ODNs containing dT and alpha-AP also showed enhanced triplex formation with the duplex target and, in addition are more stable in serum-containing medium than standard oligopyrimidine-derived ODNs or ODNs derived from dT and beta-AP. Molecular modelling studies showed that an alpha-anomeric AP nucleotide can be accommodated within an otherwise beta-anomeric triplex with only minor perturbation of the triplex structure. Molecular dynamics (MD) simulations on triplexes containing either the alpha- or beta-anomer of (N1-protonated) AP showed that in both cases the base retained two standard hydrogen bonds to its associated guanine when the 'A-type' model of the triplex was used as the start-point for the simulation, but that bifurcated hydrogen bonds resulted when the alternative 'B-type' triplex model was used. The lack of a differential stability between alpha-AP- and beta-AP-containing triplexes at pH >7, predicted from the behaviour of the B-type models, suggests that the A-type models are more appropriate.

Clinical significance of 2-[18F]fluoro-2-deoxy-D-glucose positron emission tomography for the assessment of 131I-metaiodobenzylguanidine therapy in malignant phaeochromocytoma.

PubMed

Nakazawa, Azusa; Higuchi, Tetsuya; Oriuchi, Noboru; Arisaka, Yukiko; Endo, Keigo

2011-10-01

The aim of this study was to evaluate the significance of 2-[18F]fluoro-2-deoxy-D-glucose (FDG) positron emission tomography (PET) in the assessment of the therapeutic response to 131I-metaiodobenzylguanidine (MIBG) in malignant phaeochromocytoma. We reviewed the records of 11 patients (7 men and 4 women) with malignant phaeochromocytoma who underwent 131I-MIBG therapy (100-200 mCi). 18F-FDG PET and serum catecholamine assays were performed 3 months before and after the first dose of 131I-MIBG. FDG uptake was evaluated in the observed lesions using the maximum standardised uptake value (SUVmax). The average SUVmax of all lesions (ASUV) was calculated. If more than five lesions were identified, the average SUVmax of the five highest SUVmax (ASUV5) was calculated. The ratio of pre- and post-therapy values was calculated for the highest SUVmax (rMSUV), ASUV (rASUV), ASUV5 (rASUV5), CT diameter (rCT) and serum catecholamine (rCA). Responder (R) and non-responder (NR) groups were defined after a clinical follow-up of at least 6 months according to changes in symptoms, CT, magnetic resonance imaging (MRI) and 123I-MIBG scan. Post-therapy evaluation revealed five R and six NR patients. The size of the target lesions was not significantly different before and after therapy (p>0.05). However, ASUV and ASUV5 were significantly lower in the R group (rASUV 0.64±0.18, rASUV5 0.68±0.17) compared to the NR group (rASUV 1.40±0.54, rASUV5 1.37±0.61) (p<0.05). 18F-FDG PET can be potentially used to evaluate the response of malignant phaeochromocytoma to 131I-MIBG therapy.

The Next Generation Fornax Survey (NGFS). II. The Central Dwarf Galaxy Population

NASA Astrophysics Data System (ADS)

Eigenthaler, Paul; Puzia, Thomas H.; Taylor, Matthew A.; Ordenes-Briceño, Yasna; Muñoz, Roberto P.; Ribbeck, Karen X.; Alamo-Martínez, Karla A.; Zhang, Hongxin; Ángel, Simón; Capaccioli, Massimo; Côté, Patrick; Ferrarese, Laura; Galaz, Gaspar; Grebel, Eva K.; Hempel, Maren; Hilker, Michael; Lançon, Ariane; Mieske, Steffen; Miller, Bryan; Paolillo, Maurizio; Powalka, Mathieu; Richtler, Tom; Roediger, Joel; Rong, Yu; Sánchez-Janssen, Ruben; Spengler, Chelsea

2018-03-01

We present a photometric study of the dwarf galaxy population in the core region (≲r vir/4) of the Fornax galaxy cluster based on deep u‧g‧i‧ photometry from the Next Generation Fornax Cluster Survey. All imaging data were obtained with the Dark Energy Camera mounted on the 4 m Blanco telescope at the Cerro Tololo Interamerican Observatory. We identify 258 dwarf galaxy candidates with luminosities ‑17 ≲ M g‧ ≲ ‑8 mag, corresponding to typical stellar masses of 9.5≳ {log}{{ \\mathcal M }}\\star /{M}ȯ ≳ 5.5, reaching ∼3 mag deeper in point-source luminosity and ∼4 mag deeper in surface brightness sensitivity compared to the classic Fornax Cluster Catalog. Morphological analysis shows that the dwarf galaxy surface-brightness profiles are well represented by single-component Sérsic models with average Sérsic indices of < n{> }u\\prime ,g\\prime ,i\\prime =(0.78{--}0.83)+/- 0.02 and average effective radii of < {r}e{> }u\\prime ,g\\prime ,i\\prime =(0.67{--}0.70)+/- 0.02 {kpc}. Color–magnitude relations indicate a flattening of the galaxy red sequence at faint galaxy luminosities, similar to the one recently discovered in the Virgo cluster. A comparison with population synthesis models and the galaxy mass–metallicity relation reveals that the average faint dwarf galaxy is likely older than ∼5 Gyr. We study galaxy scaling relations between stellar mass, effective radius, and stellar mass surface density over a stellar mass range covering six orders of magnitude. We find that over the sampled stellar mass range several distinct mechanisms of galaxy mass assembly can be identified: (1) dwarf galaxies assemble mass inside the half-mass radius up to {log}{{ \\mathcal M }}\\star ≈ 8.0, (2) isometric mass assembly occurs in the range 8.0 ≲ {log}{{ \\mathcal M }}\\star /{M}ȯ ≲ 10.5, and (3) massive galaxies assemble stellar mass predominantly in their halos at {log}{{ \\mathcal M }}\\star ≈ 10.5 and above.

Investigation on microstructure characterization and property of rapidly solidified Mg-Zn-Ca-Ce-La alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Tao, E-mail: tzhou1118@163.com; Chen Zhenhua, E-mail: chenzhenhua45@hotmail.com; Yang Mingbo, E-mail: yangmingbo@cqit.edu.cn

2012-01-15

Rapidly solidified (RS) Mg-Zn-Ca-Ce-La (wt.%) alloys have been produced via atomizing the alloy melt and subsequent splat-quenching on the water-cooled copper twin-rollers in the form of flakes. Microstructure characterization, phase compositions and thermal stability of the alloys have been systematically investigated. The results showed that with addition of RE (Ce and La) to the Mg-6Zn-5Ca alloy, the stable intermetallic compounds i.e. the Mg{sub x}Zn{sub y}RE{sub z} phase with a few Ca (about 3 at.%), shortened as the T Prime phase, were formed at the expense of the binary Mg-Zn and Ca{sub 2}Mg{sub 6}Zn{sub 3} phases, which was possibly beneficial tomore » the enhanced thermal stability of the alloy. In the Mg-6Zn-5Ca-3Ce-0.5La alloy, the composition of the T Prime phase in the grain interior was different from that at the grain boundaries, in which the segregation of the La elements was found, and the atomic percentage ratio of Zn to Ce in the T Prime phase within the grains was close to 2. Moreover, the stable Mg{sub 2}Ca phases were detected around the T Prime phases at the grain boundaries in the alloy. - Research Highlights: Black-Right-Pointing-Pointer The phase constitution of RS Mg-6Zn-5Ca alloy can be improved by RE additions. Black-Right-Pointing-Pointer In the Mg-Zn-Ca-Ce-La alloys, the Mg{sub x}Zn{sub y}RE{sub z} phase with a few Ca (T Prime phase) is formed. Black-Right-Pointing-Pointer The formation of the T Prime phase leads to the loss of the Mg-Zn and Ca{sub 2}Mg{sub 6}Zn{sub 3} phases. Black-Right-Pointing-Pointer The composition of the T Prime phase differs from the grain interior to the grain boundary.« less

Priming by NUMB3R5 Does Not Involve Top-Down Feedback

ERIC Educational Resources Information Center

Kinoshita, Sachiko; Lagoutaris, Stephanie

2010-01-01

Using the same-different task, Perea, Dunabeitia, Pollatsek, and Carreiras (2009) showed that digits resembling letters ("leet digits"; e.g., 1 = "I", 4 = "A") primed pseudoword strings (e.g., "V35Z3D-VESZED"), but letters resembling digits ("leet letters") did not prime digit strings (e.g.,…

Development of Prime Cyber-Infrastructure for Combustion

DTIC Science & Technology

2009-07-14

48 6 Technologies used 6.1 PrIMe Portal The PrIMe portal is executed using the PHP language with the help of CMF Drupal -5. The standard...modules of Drupal core set are developed by third parties and obtained from the repository drupal.org. Part of the modules was modified specifically for

Anti-mitotic potential of 7-diethylamino-3(2 Prime -benzoxazolyl)-coumarin in 5-fluorouracil-resistant human gastric cancer cell line SNU620/5-FU

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Nam Hyun; Kim, Su-Nam; Oh, Joa Sub

2012-02-24

Highlights: Black-Right-Pointing-Pointer DBC exerts antiproliferative potential against 5FU-resistant human gastric cancer cells. Black-Right-Pointing-Pointer This effect is mediated by destabilization of microtubules and subsequent mitotic arrest. Black-Right-Pointing-Pointer DBC enhances apoptosis via caspase activation and downregulation of antiapoptotic genes. -- Abstract: In this study, we investigate an anti-mitotic potential of the novel synthetic coumarin-based compound, 7-diethylamino-3(2 Prime -benzoxazolyl)-coumarin, in 5-fluorouracil-resistant human gastric cancer cell line SNU-620-5FU and its parental cell SNU-620. It exerts the anti-proliferative effects with similar potencies against both cancer cells, which is mediated by destabilization of microtubules and subsequent mitotic arrest. Furthermore, this compound enhances caspase-dependent apoptotic cell deathmore » via decreased expression of anti-apoptotic genes. Taken together, our data strongly support anti-mitotic potential of 7-diethylamino-3(2 Prime -benzoxazolyl)-coumarin against drug-resistant cancer cells which will prompt us to further develop as a novel microtubule inhibitor for drug-resistant cancer chemotherapy.« less

Homochiral coordination polymers constructed from aminocarboxylate derivates: Effect of bipyridine on the amidation reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen Jianshan; Sheng Tianlu; Hu Shengmin

2012-08-15

Using aminocarboxylate derivates (S)-N-(4-cyanobenzoic)-glutamic acid (denoted as cbg, 1a) and (S)-N-(4-nitrobenzoic)-glutamic acid (denoted as nbg, 1b) as chiral ligands, five new homochiral coordination polymers formulated as [Cu(cbg)(H{sub 2}O){sub 2}]{sub n} (3), [Cu(cbop){sub 2}(4,4 Prime -bipy)(H{sub 2}O)]{sub n} (4) (cbop=(S)-N-(4-cyanobenzoic)-5-oxoproline, 4,4 Prime -bipy=4,4 Prime -bipyridine), {l_brace}[Cu(nbop){sub 2}(4,4 Prime -bipy)]{center_dot}4H{sub 2}O{r_brace}{sub n} (5) (nbop=(S)-N-(4-nitrobenzoic)-5-oxoproline), {l_brace}[Cd(nbop){sub 2}(4,4 Prime -bipy)]{center_dot}2H{sub 2}O{r_brace}{sub n} (6), and [Ni(nbop){sub 2}(4,4 Prime -bipy)(H{sub 2}O){sub 2}]{sub n} (7) have been hydrothermally synthesized and structurally characterized. Single-crystal X-ray diffraction study reveals that the original chirality of aminocarboxylate derivates is maintained in all these complexes. Complexes 3, 4, and 7 are one-dimensionalmore » infinite chain coordination polymers, while complexes 5 and 6 possess two-dimensional network structures. In situ cyclization of 1a and 1b was taken place in the formation of complexes 4-7, which may be due to the competition of 4,4 Prime -bipyridine with chiral ligands during the coordination process. Preliminary optical behavior investigation indicates that ligands 1a, 1b, and complexes 6, 7 are nonlinear optical active. - Graphical abstract: Using aminocarboxylate derivates as chiral ligands, five new homochiral coordination polymers possessing second harmonic generation activities have been hydrothermally synthesized. Highlights: Black-Right-Pointing-Pointer Two new chiral aminocarboxylate derivates were firstly synthesized. Black-Right-Pointing-Pointer Five new homochiral metal organic complexes were obtained hydrothermally based on these ligands. Black-Right-Pointing-Pointer Intramolecular amidation was taken place on the aminocarboxylate derivates during the formation of these complexes. Black-Right-Pointing-Pointer In situ amidation may be due to the impact of 4,4 Prime -bipyridine. Black-Right-Pointing-Pointer The homochiral complexes are nonlinear optical active.« less

Involvement of metabotropic glutamate receptor 5 in the inhibition of methamphetamine-associated contextual memory after prolonged extinction training.

PubMed

Huang, Chien-Hsuan; Yu, Yang-Jung; Chang, Chih-Hua; Gean, Po-Wu

2016-04-01

Addiction is thought to be a memory process between perception and environmental cues and addicted patients often relapse when they come into contact with the drug-related context once again. Here, we used a conditioned place preference protocol to seek a more effective extinction methodology of methamphetamine (METH) memory and delineate its underlying mechanism. Conditioning METH for 3 days in mice markedly increased the time spent in the METH-paired compartment. Then the mice were conditioned with saline for 6 days, from day 6 to day 11, a procedure termed extinction training. However, METH memory returned after a priming injection of METH. We prolonged extinction duration from 6 to 10 days and found that this extensive extinction (EE) training prevented priming effect. At the molecular level, we discovered that prolonged extinction training reversed the METH-conditioned place preference-induced increase in surface expression of GluA2 and alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)/NMDA ratio in the basolateral amygdala. In addition, we found that extinction with metabotropic glutamate receptor 5 (mGluR5) activation had similar results to EE: reduced relapse after extinction, decreased synaptic AMPA receptors AMPARs and the AMPA/NMDA ratio. On the contrary, EE with mGluR5 inhibition suppressed the results of EE. These data indicate that EE training-elicited inhibition of METH-primed reinstatement is mediated by the mGluR5. Conditioning mice with methamphetamine place preference (METH CPP) increases surface expression of AMPA receptors (AMPARs) in the basolateral amygdala. We found prolongation of extinction duration from 6 to 10 days prevented priming effect. At the molecular level, we discovered that extensive extinction (EE) reversed the METH CPP-induced increase in surface expression of GluA2 and AMPA/NMDA ratio. In addition, we found that extinction with the metabotropic glutamate receptor 5 (mGluR5) activation had similar results to EE: reduced relapse after extinction, decreased synaptic AMPARs and the AMPA/NMDA ratio. On the contrary, EE with mGluR5 inhibition suppressed the results of EE. These data indicate that EE training-elicited inhibition of METH-primed reinstatement is mediated by mGluR5 (PAM: positive allosteric modulator). © 2016 International Society for Neurochemistry.

Synthesis and evaluation of 3-modified 1D-myo-inositols as inhibitors and substrates of phosphatidylinositol synthase and inhibitors of myo-inositol uptake by cells.

PubMed

Johnson, S C; Dahl, J; Shih, T L; Schedler, D J; Anderson, L; Benjamin, T L; Baker, D C

1993-11-12

A number of 3-substituted 1D-myo-inositols were synthesized and evaluated as substrates for phosphatidylinositol synthase and uptake by intact cells. 1D-3-Amino-, -3-chloro-, and -3-(acetylthio)-3-deoxy-myo-inositols were all synthesized by nucleophilic displacement of the 6-O-(trifluoromethyl)sulfonyl group of 1L-1,2:3,4-di-O-cyclohexylidene-5-O-methyl-6-O-[(trifluoromethyl)-sulfon yl] - chiro-inositol (which was prepared from L-quebrachitol), respectively, by reaction with LiN3, followed by reduction of the azido function, and with LiCl and KSAc to give the O-protected compounds. O-Demethylation using BBr3 and concomitant acetal hydrolysis furnished the free-hydroxy 3-amino- and 3-chloro-3-deoxy-1D-myo-inositols. The 3-mercapto analogue was obtained by removal of the acetal groups of the acetylthio analogue, followed by acetylation and purification of the peracetate, and subsequent O-demethylation and deacetylation. The 3-deoxy derivative was synthesized from the 6-O-(imidazol-1-ylthiocarbonyl) compound via Barton-McCombie deoxygenation. The 3-azido derivative was directly synthesized from 1L-1-O-tosyl-chiro-inositol via displacement with azide. The 3-keto analogue was prepared by Pt-catalyzed air oxidation of 1L-chiro-inositol. The compounds were all evaluated as substrates for phosphatidylinositol (PtdIns) synthase from mouse brain. The 3-NH2, 3-F, 3-deoxy, and 3-keto analogues all showed activity as substrates, as measured by liberation of cytidine monophosphate. These compounds also showed inhibition of the reaction of myo-[3H]inositol with PtdIns synthase. These results taken together indicate that these compounds are likely to be incorporated into phospholipids. As a further indication that these compounds might be useful as probes for the PtdIns pathway, it was demonstrated that the 3-NH2, 3-F, and 3-deoxy compounds are taken up by intact fibroblast cells as evidenced by their competing with myo-[3H]inositol uptake.

Trifluorothymidine resistance is associated with decreased thymidine kinase and equilibrative nucleoside transporter expression or increased secretory phospholipase A2.

PubMed

Temmink, Olaf H; Bijnsdorp, Irene V; Prins, Henk-Jan; Losekoot, Nienke; Adema, Auke D; Smid, Kees; Honeywell, Richard J; Ylstra, Bauke; Eijk, Paul P; Fukushima, Masakazu; Peters, Godefridus J

2010-04-01

Trifluorothymidine (TFT) is part of the novel oral formulation TAS-102, which is currently evaluated in phase II studies. Drug resistance is an important limitation of cancer therapy. The aim of the present study was to induce resistance to TFT in H630 colon cancer cells using two different schedules and to analyze the resistance mechanism. Cells were exposed either continuously or intermittently to TFT, resulting in H630-cTFT and H630-4TFT, respectively. Cells were analyzed for cross-resistance, cell cycle, protein expression, and activity of thymidine phosphorylase (TP), thymidine kinase (TK), thymidylate synthase (TS), equilibrative nucleoside transporter (hENT), gene expression (microarray), and genomic alterations. Both cell lines were cross-resistant to 2'-deoxy-5-fluorouridine (>170-fold). Exposure to IC(75)-TFT increased the S/G(2)-M phase of H630 cells, whereas in the resistant variants, no change was observed. The two main target enzymes TS and TP remained unchanged in both TFT-resistant variants. In H630-4TFT cells, TK protein expression and activity were decreased, resulting in less activated TFT and was most likely the mechanism of TFT resistance. In H630-cTFT cells, hENT mRNA expression was decreased 2- to 3-fold, resulting in a 5- to 10-fold decreased TFT-nucleotide accumulation. Surprisingly, microarray-mRNA analysis revealed a strong increase of secretory phospholipase-A2 (sPLA2; 47-fold), which was also found by reverse transcription-PCR (RT-PCR; 211-fold). sPLA2 inhibition reversed TFT resistance partially. H630-cTFT had many chromosomal aberrations, but the exact role of sPLA2 in TFT resistance remains unclear. Altogether, resistance induction to TFT can lead to different mechanisms of resistance, including decreased TK protein expression and enzyme activity, decreased hENT expression, as well as (phospho)lipid metabolism. Mol Cancer Ther; 9(4); 1047-57. (c)2010 AACR.

Conformational Changes in Orotidine 5-Monophosphate Decarboxylase: "Remote" Residues That Stabilize the Active Conformation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wood, B.; Amyes, T; Fedorov, A

2010-01-01

The structural factors responsible for the extraordinary rate enhancement ({approx}10{sup 17}) of the reaction catalyzed by orotidine 5{prime}-monophosphate decarboxylase (OMPDC) have not been defined. Catalysis requires a conformational change that closes an active site loop and 'clamps' the orotate base proximal to hydrogen-bonded networks that destabilize the substrate and stabilize the intermediate. In the OMPDC from Methanobacter thermoautotrophicus, a 'remote' structurally conserved cluster of hydrophobic residues that includes Val 182 in the active site loop is assembled in the closed, catalytically active conformation. Substitution of these residues with Ala decreases k{sub cat}/K{sub m} with a minimal effect on k{sub cat},more » providing evidence that the cluster stabilizes the closed conformation. The intrinsic binding energies of the 5{prime}-phosphate group of orotidine 5{prime}-monophosphate for the mutant enzymes are similar to that for the wild type, supporting this conclusion.« less

Synthesis of Nucleoside Analogues with Potential Antiviral Activity against Negative Strand RNA Virus Targets

DTIC Science & Technology

1989-11-01

standing overnight. Washing the filtered crystals with ether removed triethylamine hydrochloride and triphenyl phosphine, then recrystallisation from...pyridine to from an ester, DMF and pyridinium hydrochloride . The reaction of the Vilsmeier reagent with (E)-5-(2-carboxyvinyl)uridine and quenching...include 2-deoxy-2-glucose (28), D- glucosamine (29) and tunicamycin (30). Deoxyglucose is utilized instead of glucose in the formation of guanosine

A novel radiochemical approach to 1-(2'-deoxy-2'-[(18) F]fluoro-β-d-arabinofuranosyl)cytosine ((18) F-FAC).

PubMed

Meyer, Jan-Philip; Probst, Katrin C; Trist, Iuni M L; McGuigan, Christopher; Westwell, Andrew D

2014-09-01

(18) F-FAC (1-(2'-deoxy-2'-[(18) F]fluoro-β-D-arabinofuranosyl)-cytosine) is an important 2'-fluoro-nucleoside-based positron emission tomography (PET) tracer that has been used for in vivo prediction of response to the widely used cancer chemotherapy drug gemcitabine. Previously reported synthetic routes to (18) F-FAC have relied on early introduction of the (18) F radiolabel prior to attachment to protected cytosine base. Considering the (18) F radiochemical half-life (110 min) and the technical challenges of multi-step syntheses on PET radiochemistry modular systems, late-stage radiofluorination is preferred for reproducible and reliable radiosynthesis with in vivo applications. Herein, we report the first late-stage radiosynthesis of (18) F-FAC. Cytidine derivatives with leaving groups at the 2'-position are particularly prone to undergo anhydro side-product formation upon heating because of their electron density at the 2-carbonyl pyrimidone oxygen. Our rationally developed fluorination precursor showed an improved reactivity-to-stability ratio at elevated temperatures. (18) F-FAC was obtained in radiochemical yields of 4.3-5.5% (n = 8, decay-corrected from end of bombardment), with purities ≥98% and specific activities ≥63 GBq/µmol. The synthesis time was 168 min. Copyright © 2014 John Wiley & Sons, Ltd.

A Novel Multifunctional β-N-Acetylhexosaminidase Revealed through Metagenomics of an Oil-Spilled Mangrove

PubMed Central

Soares, Fábio Lino; Marcon, Joelma; Khakhum, Nittaya; Cerdeira, Louise Teixeira; Domingos, Daniela Ferreira; Taketani, Rodrigo Gouvea; de Oliveira, Valéria Maia; Lima, André Oliveira de Souza

2017-01-01

The use of culture-independent approaches, such as metagenomics, provides complementary access to environmental microbial diversity. Mangrove environments represent a highly complex system with plenty of opportunities for finding singular functions. In this study we performed a functional screening of fosmid libraries obtained from an oil contaminated mangrove site, with the purpose of identifying clones expressing hydrolytic activities. A novel gene coding for a β-N-acetylhexosaminidase with 355 amino acids and 43KDa was retrieved and characterized. The translated sequence showed only 38% similarity to a β-N-acetylhexosaminidase gene in the genome of Veillonella sp. CAG:933, suggesting that it might constitute a novel enzyme. The enzyme was expressed, purified, and characterized for its enzymatic activity on carboxymethyl cellulose, p-Nitrophenyl-2acetamide-2deoxy-β-d-glucopyranoside, p-Nitrophenyl-2acetamide-2deoxy-β-d-galactopyranoside, and 4-Nitrophenyl β-d-glucopyranoside, presenting β-N-acetylglucosaminidase, β-glucosidase, and β-1,4-endoglucanase activities. The enzyme showed optimum activity at 30 °C and pH 5.5. The characterization of the putative novel β-N-acetylglucosaminidase enzyme reflects similarities to characteristics of the environment explored, which differs from milder conditions environments. This work exemplifies the application of cultivation-independent molecular techniques to the mangrove microbiome for obtaining a novel biotechnological product. PMID:28952541

Part I. Metabolites of Penicillium verrucosum var. cyclopium; Part II. Regioselective deuteriations of deoxyribose and incorporation into deoxynucleosides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hodge, R.P.

1988-01-01

Penicillium verrucosum var. cyclopium is the fungus responsible for several outbreaks of neurotoxicoses among cattle in Tennessee beginning in 1979. Verrucosidin isolated from samples of P. verrucosum var. cyclopium was later shown to be a powerful neurotoxin capable of paralyzing its victims and was also said to cause tremoring in some cases. Part I of this dissertation describes the re-investigation of metabolites of P. verrucosum var. cyclopium and tremorgenicity of verrucosidin. Verrucosidin has been shown in this study to be non-tremorgenic. This research also describes development of efficient synthetic methods for incorporation of deuterium into the deoxyribose moiety of deoxyribonucleosides.more » Deuteriated deoxynucleosides are presently being considered for synthesis of deuteriated sequences of DNA to be utilized in {sup 1}H NMR studies of solution conformation and dynamics, as well as interactions with proteins, drugs, metals and carcinogens. A route for synthesizing 2-deoxy-D-ribose from D-ribonic-acid-{gamma}-lactone incorporating deuterium at the C-1, C-2 or C-5 positions is presented.« less

Structural Basis of the Lactate-dependent Allosteric Regulation of Oxygen Binding in Arthropod Hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirota, S.; Tanaka, N; Micetic, I

2010-01-01

Hemocyanin (Hc) is an oxygen carrier protein in which oxygen binding is regulated by allosteric effectors such as H{sup +} and L-lactate. Isothermal titration calorimetric measurements showed that L-lactate binds to dodecameric and heterohexameric Hc and to the CaeSS3 homohexamer but not to the CaeSS2 monomer. The binding of lactate caused no change in the optical absorption and x-ray absorption spectra of either oxy- or deoxy-Hc, suggesting that no structural rearrangement of the active site occurred. At pH 6.5, the oxygen binding rate constant k{sub obs} obtained by flash photolysis showed a significant increase upon addition of L-lactate, whereas L-lactatemore » addition had little effect at pH 8.3. Lactate binding caused a concentration-dependent shift in the interhexameric distances at pH 6.5 based on small angle x-ray scattering measurements. These results show that L-lactate affects oxygen affinity at pH 6.5 by modulating the global structure of Hc without affecting its binuclear copper center (the active site). In contrast to this, the active site structure of deoxy-Hc is affected by changes in pH (Hirota, S., Kawahara, T., Beltramini, M., Di Muro, P., Magliozzo, R. S., Peisach, J., Powers, L. S., Tanaka, N., Nagao, S., and Bubacco, L. (2008) J. Biol. Chem. 283, 31941-31948). Upon addiction of lactate, the kinetic behavior of oxygen rebinding for Hc was heterogeneous under low oxygen concentrations at pH 6.5 due to changes in the T and R state populations, and the equilibrium was found to shift from the T toward the R state with addition of lactate.« less

Thermal ring closure in Mo(CO){sub 5}L (L = bpy, dmbpy, dpbpy) transients generated by pulsed laser flash photolysis. Mechanistic information from high-pressure effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, K.B.; Hoffmann, R.; Konya, G.

1992-06-01

The kinetics of the ring-closure reactions of Mo(CO){sub 5}L, produced during the laser flash photolysis of Mo(CO){sub 6} and L where L = 2,2{prime}-bipyridine (bpy), 4,4{prime}-dimethyl-2,2{prime}-bipyridine (dpbpy) and 4,4{prime}-dephenyl-2,2{prime}-bipyridine (dpbpy) were studied as a function of temperature and pressure. The values of the activation parameters and pressure. The values of the activation parameters {Delta}S and {Delta}V are small and negative for L = bpy and dmbpy supporting an associative interchange mechanism (I{sub a}) for CO extrusion. For L = dpbpy, {Delta}V is small and positive in line with a dissociative interchange mechanism (I{sub d}). The results demonstrate a changeover inmore » mechanism from I{sub a} to I{sub d} with increasing steric hindrance on the bidentate ligand L. 36 refs., 1 fig., 2 tabs.« less

Avoiding the Potential Pitfalls of Using Negative Priming Tasks in Developmental Studies: Assessing Inhibitory Control in Children, Adolescents, and Adults

ERIC Educational Resources Information Center

Pritchard, Verena E.; Neumann, Ewald

2009-01-01

Despite being ignored, visual distractors often produce traceable negative priming (NP) effects that can be used to investigate inhibitory processes. Robust NP effects are typically found with young adults, but not with children. Using 2 different NP tasks, the authors compared NP in 5 different age groups spanning 5 to 25 years of age. The 1st…

Towards a Fiscally Constrained Pacific Posture

DTIC Science & Technology

2012-03-21

joint press conference with Australian Prime Minister Julia Gillard , President Obama emphasized U.S. intent in the Asia Pacific region when he... gillard -australia-joint-press (accessed February 5, 2012). 5 Laura MacInnis and Caren Bohan, “Obama seeks to hitch U.S. economy to Asian growth,” Reuters...November 16, 2011. http://www.whitehouse.gov/the-press-office/2011/11/16/remarks-president-obama-and-prime- minister- gillard -australia-joint-press

The human serotonin 5-HT{sub 2C} receptor: Complete cDNA, genomic structure, and alternatively spliced variant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun

1996-08-01

The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less

The effect of altered 5-hydroxytryptamine levels on beta-endorphin

NASA Technical Reports Server (NTRS)

Soliman, Karam F. A.; Mash, Deborah C.; Walker, Charles A.

1986-01-01

The purpose of the present study was to examine the effect of altering the concentration of 5-hydroxytryptamine (5-HT) on beta-endorphin (beta-Ep) content in the hypothalamus, thalamus, and periaqueductal gray (PAG)-rostral pons regions of the rat brain. The selective 5-HT reuptake inhibitor, fluoxetine (10 mg/kg), significantly lowered beta-Ep content in the hypothalamus and the PAG. Parachlorophenylalanine, which inhibits 5-HT synthesis, significantly elevated beta-Ep in all brain parts studied. Intracisternal injections of the neurotoxin 5-prime, 7-prime-dihydroxytryptamine with desmethylimipramine pretreatment significantly increased beta-Ep content in the hypothalamus and the PAG. In adrenalectomized rats, fluoxetine significantly decreased beta-Ep levels in the hypothalamus and increased the levels in the PAG. The results indicate that 5-HT may modulate the levels of brain beta-Ep.

Genotype-phenotype relationships in human red/green color-vision defects: Molecular and psychophysical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deeb, S.S.; Motulsky, A.G.; Lindsey, D.T.

1992-10-01

The relationship between the molecular structure of the X-linked red and green visual pigment genes and color-vision phenotype as ascertained by anomaloscopy was studied in 64 color-defective males. The great majority of red-green defects were associated with either the deletion of the green-pigment gene or the formation of 5[prime] red-green hybrid genes or 5[prime] green-red hybrid genes. A rapid PCR-based method allowed detection of hybrid genes, including those undetectable by Southern blot analysis, as well as more precise localization of the fusion points in hybrid genes. Protan color-vision defects appeared always associated with 5[prime] red-green hybrid genes. Carriers of singlemore » red-green hybrid genes with fusion in introns 1-4 were protanopes. However, carriers of hybrid genes with red-green fusions in introns 2, 3, or 4 in the presence of additional normal green genes manifested as either protanopes or protanomalous trichromats, with the majority being protanomalous. Deutan defects were associated with green-pigment gene deletions, with 5[prime] green-red hybrid genes, or, rarely, with 5[prime] green-red-green hybrid genes. Complete green-pigment gene deletions or green-red fusions in intron 1 were usually associated with deuteranopia, although the authors unexpectedly found three carriers of a single red-pigment gene without any green-pigment genes to be deuteranomalous trichromats. All but one of the other deuteranomalous subjects had green-red hybrid genes with intron 1, 2, 3, or 4 fusions, as well as several normal green-pigment genes. The one exception had a grossly normal gene array, presumably with a more subtle mutation. Amino acid differences in exon 5 largely determine whether a hybrid gene will be more redlike or more greenlike in phenotype. Various discrepancies as to severity (dichromacy or trichromacy) remain unexplained but may arise because of variability of expression, postreceptoral variation, or both.« less

Cyclopentadienylniobium and -molybdenum phosphorodithioate complexes. X-ray crystal structures of CpNbCl sub 3 (S sub 2 P(OPr sup i ) sub 2 ), CpNbCl(. mu. -Cl) sub 2 Nb(S sub 2 P(OPr sup i ) sub 2 )Cp, and cis-Cp prime Mo(CO) sub 2 (S sub 2 P(OPr sup i ) sub 2 )

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woodward, S.; Riaz, U.; Curtis, M.D.

1990-10-01

Reaction of CpNbCl{sub 4} (Cp = {eta}-C{sub 5}H{sub 5}) with (Pr{sup i}O){sub 2}P(S)(SH) in the presence of NEt{sub 3} yields CpNbCl{sub 3}(S{sub 2}P(S{sub 2}Pr{sup i}){sub 2}) (1). Reduction of 1 with Na/Hg affords the Nb-Nb-bonded complex CpNbCl({mu}-Cl){sub 2}Nb(S{sub 2}P(OR){sub 2})Cp (2). In refluxing toluene, (Pr{sup i}O){sub 2}P(S)(SH) with (Cp{prime}Mo(CO){sub 3}){sub 2} (Cp{prime} = {eta}-C{sub 5}H{sub 4}Me) gives cis-Cp{prime}Mo(CO){sub 2}(S{sub 2}P(OPr{sup i}){sub 2}) (3). Oxidation of 3 with I{sub 2} affords Cp{prime}MoI{sub 2}(CO)(S{sub 2}P(OPr{sup i}){sub 2}) (4). The crystal structures of 1-3 are compared. For 1, triclinic, P{bar 1}, a = 7.122 (3) {angstrom}, b = 11.365 (4) {angstrom}, c =more » 12.532 (4) {angstrom}, {alpha} = 77.38 (3){degree}, {beta} = 89.08 (3){degree}, {gamma} = 72.87 (3){degree}, V = 944.5 (8) {angstrom}{sup 3}. For 2, triclinic, P{bar 1}, a = 7.251 (3) {angstrom}, b = 12.386 (5) {angstrom}, c = 13.988 (5) {angstrom}, {alpha} = 102.66 (3){degree}, {beta} = 103.56 (3){degree}, {gamma} = 94.66 (3){degree}, V = 1180.0 (8) {angstrom}{sup 3}, Z = 2. For 3, orthorhombic, Pbca, a = 12.703 (3) {angstrom}, b = 16.707 (4) {angstrom}, c = 18.398 (4) {angstrom}, V = 3904.4 (17) {angstrom}{sup 3}, Z = 8.« less

Growth kinetics of gamma-prime precipitates in a directionally solidified eutectic, gamma/gamma-prime-delta

NASA Technical Reports Server (NTRS)

Tewari, S. N.

1976-01-01

A directionally solidified eutectic alloy (DSEA), of those viewed as potential candidates for the next generation of aircraft gas turbine blade materials, is studied for the gamma-prime growth kinetics, in the system Ni-Nb-Cr-Al, specifically: Ni-20 w/o Nb-6 w/o Cr-2.5 w/o Al gamma/gamma-prime-delta DSEA. Heat treatment, polishing and etching, and preparation for electron micrography are described, and the size distribution of gamma-prime phase following various anneals is plotted, along with gamma-prime growth kinetics in this specific DSEA, and the cube of gamma-prime particle size vs anneal time. Activation energies and coarsening kinetics are studied.

Sequential Stereotype Priming: A Meta-Analysis.

PubMed

Kidder, Ciara K; White, Katherine R; Hinojos, Michelle R; Sandoval, Mayra; Crites, Stephen L

2017-08-01

Psychological interest in stereotype measurement has spanned nearly a century, with researchers adopting implicit measures in the 1980s to complement explicit measures. One of the most frequently used implicit measures of stereotypes is the sequential priming paradigm. The current meta-analysis examines stereotype priming, focusing specifically on this paradigm. To contribute to ongoing discussions regarding methodological rigor in social psychology, one primary goal was to identify methodological moderators of the stereotype priming effect-whether priming is due to a relation between the prime and target stimuli, the prime and target response, participant task, stereotype dimension, stimulus onset asynchrony (SOA), and stimuli type. Data from 39 studies yielded 87 individual effect sizes from 5,497 participants. Analyses revealed that stereotype priming is significantly moderated by the presence of prime-response relations, participant task, stereotype dimension, target stimulus type, SOA, and prime repetition. These results carry both practical and theoretical implications for future research on stereotype priming.

Phonological and Semantic Priming in Children with Reading Disability

ERIC Educational Resources Information Center

Betjemann, Rebecca S.; Keenan, Janice M.

2008-01-01

Lexical priming was assessed in children with reading disability (RD) and in age-matched controls (M= 11.5 years), in visual and auditory lexical decision tasks. In the visual task, children with RD were found to have deficits in semantic (SHIP-BOAT), phonological/graphemic (GOAT-BOAT), and combined (FLOAT-BOAT) priming. The same pattern of…

Children Draw More Affiliative Pictures Following Priming with Third-Party Ostracism

ERIC Educational Resources Information Center

Song, Ruiting; Over, Harriet; Carpenter, Malinda

2015-01-01

Humans have a strong need to belong. Thus, when signs of ostracism are detected, adults often feel motivated to affiliate with others in order to reestablish their social connections. This study investigated the importance of affiliation to young children following priming with ostracism. Four- and 5-year-old children were primed with either…

Physical Association of Saccharomyces cerevisiae Polo-like Kinase Cdc5 with Chromosomal Cohesin Facilitates DNA Damage Response.

PubMed

Pakchuen, Sujiraporn; Ishibashi, Mai; Takakusagi, Emi; Shirahige, Katsuhiko; Sutani, Takashi

2016-08-12

At the onset of anaphase, a protease called separase breaks the link between sister chromatids by cleaving the cohesin subunit Scc1. This irreversible step in the cell cycle is promoted by degradation of the separase inhibitor, securin, and polo-like kinase (Plk) 1-dependent phosphorylation of the Scc1 subunit. Plk could recognize substrates through interaction between its phosphopeptide interaction domain, the polo-box domain, and a phosphorylated priming site in the substrate, which has been generated by a priming kinase beforehand. However, the physiological relevance of this targeting mechanism remains to be addressed for many of the Plk1 substrates. Here, we show that budding yeast Plk1, Cdc5, is pre-deposited onto cohesin engaged in cohesion on chromosome arms in G2/M phase cells. The Cdc5-cohesin association is mediated by direct interaction between the polo-box domain of Cdc5 and Scc1 phosphorylated at multiple sites in its middle region. Alanine substitutions of the possible priming phosphorylation sites (scc1-15A) impair Cdc5 association with chromosomal cohesin, but they make only a moderate impact on mitotic cell growth even in securin-deleted cells (pds1Δ), where Scc1 phosphorylation by Cdc5 is indispensable. The same scc1-15A pds1Δ double mutant, however, exhibits marked sensitivity to the DNA-damaging agent phleomycin, suggesting that the priming phosphorylation of Scc1 poses an additional layer of regulation that enables yeast cells to adapt to genotoxic environments. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Antimicrobial and cytotoxic activities of 1,2,3-triazole-sucrose derivatives.

PubMed

Petrova, Krasimira T; Potewar, Taterao M; Correia-da-Silva, Paula; Barros, M Teresa; Calhelha, Ricardo C; Ćiric, Ana; Soković, Marina; Ferreira, Isabel C F R

2015-11-19

A library of 1-(1',2,3,3',4,4',6-hepta-O-acetyl-6'-deoxy-sucros-6'-yl)-1,2,3-triazoles have been investigated for their antibacterial, antifungal and cytotoxic activities. Most of the target compounds showed good inhibitory activity against a variety of clinically and food contaminant important microbial pathogens. In particular, 1-(1',2,3,3',4,4',6-hepta-O-acetyl-6'-deoxy-sucros-6'-yl)-4-(4-pentylphenyl)-1,2,3-triazole (5) was highly active against all the tested bacteria with minimal inhibitory concentrations (MICs) ranging between 1.1 and 4.4 µM and bactericidal concentrations (MBCs) from 2.2 and 8.4 µM. The compound 1-(1',2,3,3',4,4',6-hepta-O-acetyl-6'-deoxy-sucros-6'-yl)-4-(4-bromophenyl)-1,2,3-triazole (3) showed antifungal activity with MICs from 0.6 to 4.8 µM and minimal fungicidal concentrations (MFCs) ranging between 1.2 and 8.9 µM. Furthermore, some of the compounds possessed moderate cytotoxicity against human breast, lung, cervical and hepatocellular carcinoma cell lines, without showing toxicity for non-tumor liver cells. The above mentioned derivatives represent promising leads for the development of new generation of sugar-triazole antifungal agents. Copyright © 2015 Elsevier Ltd. All rights reserved.

Distal histidine conformational flexibility in dehaloperoxidase from Amphitrite ornata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Zuxu; de Serrano, Vesna; Betts, Laurie

2009-01-28

The enzyme dehaloperoxidase (DHP) from the terebellid polychaete Amphitrite ornata is a heme protein which has a globin fold but can function as both a hemoglobin and a peroxidase. As a peroxidase, DHP is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. As a hemoglobin, DHP cycles between the oxy and deoxy states as it reversibly binds oxygen for storage. Here, it is reported that the distal histidine, His55, exhibits conformational flexibility in the deoxy form and is consequently observed in two solvent-exposed conformations more than 9.5 {angstrom} away from the heme. These conformationsmore » are analogous to the open conformation of sperm whale myoglobin. The heme iron in deoxy ferrous DHP is five-coordinate and has an out-of-plane displacement of 0.25 {angstrom} from the heme plane. The observation of five-coordinate heme iron with His55 in a remote solvent-exposed conformation is consistent with the hypothesis that His55 interacts with heme iron ligands through hydrogen bonding in the closed conformation. Since His55 is also displaced by the binding of 4-iodophenol in an internal pocket, these results provide new insight into the correlation between heme iron ligation, molecular binding in the distal pocket and the conformation of the distal histidine in DHP.« less

A simple synthesis of 2-keto-3-deoxy-D-erythro-hexonic acid isopropyl ester, a key sugar for the bacterial population living under metallic stress.

PubMed

Grison, Claire M; Renard, Brice-Loïc; Grison, Claude

2014-02-01

2-Keto-3-deoxy-D-erythro-hexonic acid (KDG) is the key intermediate metabolite of the Entner Doudoroff (ED) pathway. A simple, efficient and stereoselective synthesis of KDG isopropyl ester is described in five steps from 2,3-O-isopropylidene-D-threitol with an overall yield of 47%. KDG isopropyl ester is studied as an attractive marker of a functional Entner Doudoroff pathway. KDG isopropyl ester is used to promote growth of ammonium producing bacterial strains, showing interesting features in the remediation of heavy-metal polluted soils. Copyright © 2013 Elsevier Inc. All rights reserved.

Pain intensity and duration can be enhanced by prior challenge: Initial evidence suggestive of a role of microglial priming

PubMed Central

Hains, Leah E.; Loram, Lisa C.; Weiseler, Julie L.; Frank, Matthew G.; Bloss, Erik B.; Sholar, Paige; Taylor, Frederick R; Harrison, Jacqueline A; Martin, Thomas J.; Eisenach, James C.; Maier, Steven F.; Watkins, Linda R.

2010-01-01

Activation of spinal microglia and consequent release of pro-inflammatory mediators facilitate pain. Under certain conditions, responses of activated microglia can become enhanced. Enhanced microglial production of pro-inflammatory products may result from priming (sensitization), similar to macrophage priming. We hypothesized that if spinal microglia were primed by an initial inflammatory challenge, subsequent challenges may create enhanced pain. Here, we used a "two-hit" paradigm using two successive challenges, which affect overlapping populations of spinal microglia, presented two weeks apart. Mechanical allodynia and/or activation of spinal glia were assessed. Initially, laparotomy preceded systemic lipopolysaccharide (LPS). Prior laparotomy caused prolonged microglial (not astrocyte) activation plus enhanced LPS-induced allodynia. In this “two-hit” paradigm, minocycline, a microglial activation inhibitor, significantly reduced later exaggerated pain induced by prior surgery when minocycline was administered intrathecally for 5 days starting either at the time of surgery or 5 days before LPS administration. To test generality of the priming effect, subcutaneous formalin preceded intrathecal HIV-1 gp120, which activates spinal microglia and causes robust allodynia. Prior formalin enhanced intrathecal gp120-induced allodynia, suggesting that microglial priming is not limited to laparotomy and again supporting a spinal site of action. Therefore, spinal microglial priming may increase vulnerability to pain enhancement. PMID:20434956

Plasma concentrations of 5-fluorouracil and its metabolites in colon cancer patients.

PubMed

Casale, Federico; Canaparo, Roberto; Serpe, Loredana; Muntoni, Elisabetta; Pepa, Carlo Della; Costa, Mario; Mairone, Lorenza; Zara, Gian Paolo; Fornari, Gianni; Eandi, Mario

2004-08-01

5-Fluorouracil (5-FU) is a common anticancer agent used in the treatment of solid tumours, with a reported variability in the pharmacokinetic profile and inter-patient differences in efficacy and toxicity. Since 5-FU is intracellularly metabolised to active cytotoxic fluoronucleotides, some authors suggested it would be useful to determine the plasma levels of its main metabolites 5-fluoro-5,6-dihydrouracil (5-FUH2), 5-fluorouridine (5-FUrd) and 5-fluoro-2'-deoxyuridine (5-FdUrd), in order to better characterise population pharmacokinetics-pharmacodynamics (PK-PD) of this drug. We developed and validated an HPLC method to simultaneously determine plasma concentrations of 5-FU and the three main metabolites, and we analysed the plasma concentration-time curves of the first dose of 18 colon cancer patients treated with folinic acid and 5-FU 400 mg m(-2) by intra-venous bolus injection as adjuvant chemotherapy. Non-compartmental PK analysis has been applied to 5-FU and 5-FUH2 concentrations, estimating the following parameters (median values): Cmax 55.44 and 6.23 microg ml(-1), respectively, AUC(0-2 h) 11.59 and 5.94 hx microg ml(-1), CLTB 30.64 and 51.81 lh(-1) m(-2), 5-FUH2/5-FU AUC ratio 0.47 (range 0.29-1.12). We verified the patient covariables which could influence the inter-patient variability in the area under the time-concentration curves, and we observed that age, sex, weight, body surface area, cycle of therapy, toxicity development and 5-FUrd or 5-FdUrd detectability did not have statistical influence on 5-FUH2/5-FU AUC ratio. In eight subjects, we compared the PK data of the first and the fifth day of dose administration, and we found stable 5-FU values, but the 5-FUH2 disposition decreased with lower AUC(0-2 h) (7.90 hx microg ml(-1) versus 5.99 hx microg ml(-1)) and, particularly, Cmax (8.38 microg ml(-1) versus 5.50 microg ml(-1)) at day 5. This fact, evident in almost every patient, could suggest a possible reduction in the catabolic pathway of 5-FU leading to 5-FUH2, with a possible increase of the therapeutic pathway. For this reason, we tried to detect 5-FUrd and 5-FdUrd and, in fact, in our patients these metabolites were detected only in few samples, but most of them at day 5. In conclusion, our study confirms the relevance of pharmacokinetic analysis of 5-FU main metabolites and especially 5-FUH2, to better understand the metabolism and to improve the therapeutic efficacy. Copyright 2004 Elsevier Ltd.

Structural analysis of the 5{prime} region of mouse and human Huntington disease genes reveals conservation of putative promoter region and Di- and trinucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Biaoyang; Nasir, J.; Kalchman, M.A.

1995-02-10

We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less

Bioaccumulation profiles of polychlorinated biphenyl congeners and organochlorine pesticides in Ganges River dolphins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Senthilkumar, K.; Kannan, K.; Sinha, R.K.

1999-07-01

Isomer-specific concentrations of polychlorinated biphenyls (PCBs) including non-, mono-, and di-ortho-substituted congeners, DDT and its metabolites, hexachlorocyclohexane (HCH) isomers, chlordane compounds, and hexachlorobenzene (HCB) were determined in river dolphin blubber and prey fishes collected during 1993 through 1996 from the River Ganges in India. Concentrations of organochlorines were also measured in the milk and liver of dolphins, benthic invertebrates, and sediments. The DDTs and PCBs were the predominant compounds found in dolphin tissues and fish that comprise the diet of dolphins. Concentrations of DDTs and PCBs in the blubber of dolphins were in the range of 30 to 120 andmore » 1.5 to 25 {micro}g/g, lipid weight, respectively. Penta- and hexachlorobiphenyls collectively accounted for 68 to 80% of the total PCB concentrations in river dolphins. Hexachlorobiphenyl congener 138 (2.2{prime}, 3,4,4{prime},5{prime}-) was the most abundant in dolphin blubber and prey fishes. The isomer/congener pattern of PCBs and organchlorine pesticides suggested that there is less metabolism due to cytochrome P450 enzymes in Ganges river dolphins than in marine or terrestrial mammals. The mean 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents (TEQs) estimated in river dolphin blubber was greater than those that can cause adverse effects in mink. Comparison of organochlorine concentrations in river dolphins with those of the values reported for samples analyzed during 1988 through 1992 suggested that the contamination by these compounds has increased in the River Ganges.« less

Pharmacokinetic and metabolism studies of the antiarrhythmic drug meobentine (N-(4-methoxybenzyl)-N prime , N double prime -dimethylguanidine) and its N-(4-trifluoromethyoxybenzyl)-N prime , N double prime - dimethylguanidine analogue, fluorobentine in the rat, dog and man

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warren, J.T.

1988-01-01

A radioimmunoassay (RIA) was developed that was able to detect 40 pg meobentine (M) in 0.1 ml plasma. Cross-reactivity of suspected M metabolites was very low. This RIA was later also used to assay for fluorobentine (F), a fluorine analogue of M. M exhibits three-compartment open model iv kinetics in the rat, dog, and man. Terminal drug half-life in the rat, dog, and man; total-body clearance in the rat, dog, and man; and terminal-phase volume of distribution in the rat, dog, and man were determined. (14C)-M absorption is essentially complete in the rat and dog, but this parameter could notmore » be directly ascertained in man. Relative oral drug bioavailability is linear in the rat and dog but falls off between 5-10 mg/kg in man. F was synthesized in an attempt to counteract suspected problems with M's poor absorption or extensive metabolism that might be affecting its efficacy in humans. F would likely be unavailable for O-demethylation, might well be more lipophilic than M, and yet still be active.« less

Precipitation hardenable iron-nickel-chromium alloy having good swelling resistance and low neutron absorbence

DOEpatents

Korenko, Michael K.; Merrick, Howard F.; Gibson, Robert C.

1980-01-01

An iron-nickel-chromium age-hardenable alloy suitable for use in fast breeder reactor ducts and cladding which utilizes the gamma-double prime strengthening phase and characterized in having a morphology of the gamma-double prime phase enveloping the gamma-prime phase and delta phase distributed at or near the grain boundaries. The alloy consists essentially of about 40-50% nickel, 7.5-14% chromium, 1.5-4% niobium, 0.25-0.75% silicon, 1-3% titanium, 0.1-0.5% aluminum, 0.02-0.1% carbon, 0.002-0.015% boron, and the balance iron. Up to 2% manganese and up to 0.01% magnesium may be added to inhibit trace element effects; up to 0.1% zirconium may be added to increase radiation swelling resistance; and up to 3% molybdenum may be added to increase strength.

Evaluation of In Vitro Cross-Reactivity to Avian H5N1 and Pandemic H1N1 2009 Influenza Following Prime Boost Regimens of Seasonal Influenza Vaccination in Healthy Human Subjects: A Randomised Trial

DTIC Science & Technology

2013-03-26

virus (IIV) vaccine (dose 0.5 mL intramuscularly, purchased in Thailand from Sanofi Pasteur). Both vaccines contained the three strains for the 2009/10...H1N1 2009 Influenza Following Prime Boost Regimens of Seasonal Influenza Vaccination in Healthy Human Subjects: A Randomised Trial. 5a. CONTRACT NUMBER...reported by WHO since 2003 [1]. Current seasonal trivalent influenza vaccines rely on predicted antigens based on the previous season’s circulating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adachi, Atsuo; Takahashi, Tomosaburo, E-mail: ttaka@koto.kpu-m.ac.jp; Ogata, Takehiro

Highlights: Black-Right-Pointing-Pointer NFAT5 protein expression is downregulated during cardiomyogenesis. Black-Right-Pointing-Pointer Inhibition of NFAT5 function suppresses canonical Wnt signaling. Black-Right-Pointing-Pointer Inhibition of NFAT5 function attenuates mesodermal induction. Black-Right-Pointing-Pointer NFAT5 function is required for cardiomyogenesis. -- Abstract: While nuclear factor of activated T cells 5 (NFAT5), a transcription factor implicated in osmotic stress response, is suggested to be involved in other processes such as migration and proliferation, its role in cardiomyogenesis is largely unknown. Here, we examined the role of NFAT5 in cardiac differentiation of P19CL6 cells, and observed that it was abundantly expressed in undifferentiated P19CL6 cells, and its protein expressionmore » was significantly downregulated by enhanced proteasomal degradation during DMSO-induced cardiomyogenesis. Expression of a dominant negative mutant of NFAT5 markedly attenuated cardiomyogenesis, which was associated with the inhibition of mesodermal differentiation. TOPflash reporter assay revealed that the transcriptional activity of canonical Wnt signaling was activated prior to mesodermal differentiation, and this activation was markedly attenuated by NFAT5 inhibition. Pharmacological activation of canonical Wnt signaling by [2 Prime Z, 3 Prime E]-6-bromoindirubin-3 Prime -oxime (BIO) restored Brachyury expression in NFAT5DN-expressing cells. Inhibition of NFAT5 markedly attenuated Wnt3 and Wnt3a induction. Expression of Dkk1 and Cerberus1, which are secreted Wnt antagonists, was also inhibited by NFAT5 inhibition. Thus, endogenous NFAT5 regulates the coordinated expression of Wnt ligands and antagonists, which are essential for cardiomyogenesis through the canonical Wnt pathway. These results demonstrated a novel role of NFAT5 in cardiac differentiation of stem cells.« less

Safety and Immunogenicity of a Recombinant Adenovirus Serotype 35-Vectored HIV-1 Vaccine in Adenovirus Serotype 5 Seronegative and Seropositive Individuals.

PubMed

Fuchs, Jonathan D; Bart, Pierre-Alexandre; Frahm, Nicole; Morgan, Cecilia; Gilbert, Peter B; Kochar, Nidhi; DeRosa, Stephen C; Tomaras, Georgia D; Wagner, Theresa M; Baden, Lindsey R; Koblin, Beryl A; Rouphael, Nadine G; Kalams, Spyros A; Keefer, Michael C; Goepfert, Paul A; Sobieszczyk, Magdalena E; Mayer, Kenneth H; Swann, Edith; Liao, Hua-Xin; Haynes, Barton F; Graham, Barney S; McElrath, M Juliana

2015-05-01

Recombinant adenovirus serotype 5 (rAd5)-vectored HIV-1 vaccines have not prevented HIV-1 infection or disease and pre-existing Ad5 neutralizing antibodies may limit the clinical utility of Ad5 vectors globally. Using a rare Ad serotype vector, such as Ad35, may circumvent these issues, but there are few data on the safety and immunogenicity of rAd35 directly compared to rAd5 following human vaccination. HVTN 077 randomized 192 healthy, HIV-uninfected participants into one of four HIV-1 vaccine/placebo groups: rAd35/rAd5, DNA/rAd5, and DNA/rAd35 in Ad5-seronegative persons; and DNA/rAd35 in Ad5-seropositive persons. All vaccines encoded the HIV-1 EnvA antigen. Antibody and T-cell responses were measured 4 weeks post boost immunization. All vaccines were generally well tolerated and similarly immunogenic. As compared to rAd5, rAd35 was equally potent in boosting HIV-1-specific humoral and cellular immunity and responses were not significantly attenuated in those with baseline Ad5 seropositivity. Like DNA, rAd35 efficiently primed rAd5 boosting. All vaccine regimens tested elicited cross-clade antibody responses, including Env V1/V2-specific IgG responses. Vaccine antigen delivery by rAd35 is well-tolerated and immunogenic as a prime to rAd5 immunization and as a boost to prior DNA immunization with the homologous insert. Further development of rAd35-vectored prime-boost vaccine regimens is warranted.

Automatic Activation of Phonological Code during Visual Word Recognition in Children: A Masked Priming Study in Grades 3 and 5

ERIC Educational Resources Information Center

Sauval, Karinne; Perre, Laetitia; Casalis, Séverine

2017-01-01

The present study aimed to investigate the development of automatic phonological processes involved in visual word recognition during reading acquisition in French. A visual masked priming lexical decision experiment was carried out with third, fifth graders and adult skilled readers. Three different types of partial overlap between the prime and…

Phonological Contribution during Visual Word Recognition in Child Readers. An Intermodal Priming Study in Grades 3 and 5

ERIC Educational Resources Information Center

Sauval, Karinne; Casalis, Séverine; Perre, Laetitia

2017-01-01

This study investigated the phonological contribution during visual word recognition in child readers as a function of general reading expertise (third and fifth grades) and specific word exposure (frequent and less-frequent words). An intermodal priming in lexical decision task was performed. Auditory primes (identical and unrelated) were used in…

Nucleic acids, proteins, and chirality

NASA Technical Reports Server (NTRS)

Usher, D. A.; Profy, A. T.; Walstrum, S. A.; Needels, M. C.; Bulack, S. C.; Lo, K. M.

1984-01-01

The present investigation is concerned with experimental results related, in one case, to the chirality of nucleotides, and, in another case, to the possibility of a link between the chirality of nucleic acids, and that of peptides. It has been found that aminoacylation of the 'internal' hydroxyl group of a dinucleoside monophosphate can occur stereoselectively. However, this reaction has not yet been made a part of a working peptide synthesis scheme. The formation and cleavage of oligonucleotides is considered. In the event of the formation of a helical complex between the oligonucleotide and the polymer, 1-prime,5-prime-bonds in the oligomer are found to become more resistant towards cleavage. The conditions required for peptide bond formation are examined, taking into account the known structures of RNA and possible mechanisms for prebiotic peptide bond formation. The possibility is considered that the 2-prime,5-prime-internucleotide linkage could have played an important part in the early days of biological peptide synthesis.

Prime-boost vaccination with recombinant H5-fowlpox and Newcastle disease virus vectors affords lasting protection in SPF Muscovy ducks against highly pathogenic H5N1 influenza virus.

PubMed

Niqueux, Eric; Guionie, Olivier; Amelot, Michel; Jestin, Véronique

2013-08-28

Vaccination protocols were evaluated in one-day old Muscovy ducklings, using an experimental Newcastle disease recombinant vaccine (vNDV-H5) encoding an optimized synthetic haemagglutinin gene from a clade 2.2.1 H5N1 highly pathogenic (HP) avian influenza virus (AIV), either as a single administration or as a boost following a prime inoculation with a fowlpox vectored vaccine (vFP89) encoding a different H5 HP haemagglutinin from an Irish H5N8 strain. These vaccination schemes did not induce detectable levels of serum antibodies in HI test using a clade 2.2.1 H5N1 antigen, and only induced H5 ELISA positive response in less than 10% of vaccinated ducks. However, following challenge against a clade 2.2.1 HPAIV, both protocols afforded full clinical protection at six weeks of age, and full protection against mortality at nine weeks. Only the prime-boost vaccination (vFP89+vNDV-H5) was still fully protecting Muscovy ducks against disease and mortality at 12 weeks of age. Reduction of oropharyngeal shedding levels was also constantly observed from the onset of the follow-up at 2.5 or three days post-infection in vaccinated ducks compared to unvaccinated controls, and was significantly more important for vFP89+vNDV-H5 vaccination than for vNDV-H5 alone. Although the latter vaccine is shown immunogenic in one-day old Muscovy ducks, the present work is original in demonstrating the high efficacy of the successive administration of two different vector vaccines encoding two different H5 in inducing lasting protection (at least similar to the one induced by an inactivated reassortant vaccine, Re-5). In addition, such a prime-boost schedule allows implementation of a DIVA strategy (to differentiate vaccinated from infected ducks) contrary to Re-5, involves easy practice on the field (with injection at the hatchery and mass vaccination later on), and should avoid eventual interference with NDV maternally derived antibodies. Last, the HA insert could be updated according to the epidemiological situation. Copyright © 2013 Elsevier Ltd. All rights reserved.

The Effect of Inspiratory Muscle Training on Respiratory and Limb Locomotor Muscle Deoxygenation During Exercise with Resistive Inspiratory Loading.

PubMed

Turner, L A; Tecklenburg-Lund, S L; Chapman, R; Shei, R-J; Wilhite, D P; Mickleborough, T

2016-07-01

We investigated how inspiratory muscle training impacted respiratory and locomotor muscle deoxygenation during submaximal exercise with resistive inspiratory loading. 16 male cyclists completed 6 weeks of either true (n=8) or sham (n=8) inspiratory muscle training. Pre- and post-training, subjects completed 3, 6-min experimental trials performed at ~80%  ˙VO2peak with interventions of either moderate inspiratory loading, heavy inspiratory loading, or maximal exercise imposed in the final 3 min. Locomotor and respiratory muscle oxy-, deoxy-, and total-haemoglobin and myoglobin concentration was continuously monitored using near-infrared spectroscopy. Locomotor muscle deoxygenation changes from 80%  ˙VO2peak to heavy inspiratory loading were significantly reduced pre- to post-training from 4.3±5.6 µM to 2.7±4.7 µM. Respiratory muscle deoxygenation was also significantly reduced during the heavy inspiratory loading trial (4.6±3.5 µM to 1.9±1.5 µM) post-training. There was no significant difference in oxy-, deoxy-, or total-haemoglobin and myoglobin during any of the other loading trials, from pre- to post-training, in either group. After inspiratory muscle training, highly-trained cyclists exhibited decreased locomotor and respiratory muscle deoxygenation during exercise with heavy inspiratory loading. These data suggest that inspiratory muscle training reduces oxygen extraction by the active respiratory and limb muscles, which may reflect changes in respiratory and locomotor muscle oxygen delivery. © Georg Thieme Verlag KG Stuttgart · New York.

Identification of integrin heterodimers functioning on the surface of undifferentiated porcine primed embryonic stem cells.

PubMed

Kim, Hwa-Young; Baek, Song; Han, Na Rae; Lee, Eunsong; Park, Choon-Keun; Lee, Seung Tae

2018-05-29

In vitro expansion of undifferentiated porcine primed embryonic stem (ES) cells is facilitated by use of non-cellular niches that mimic three-dimensional (3D) microenvironments enclosing an inner cell mass of porcine blastocysts. Therefore, we investigated the integrin heterodimers on the surface of undifferentiated porcine primed ES cells for the purpose of developing a non-cellular niche to support in vitro maintenance of the self-renewal ability of porcine primed ES cells. Immunocytochemistry and a fluorescence immunoassay were performed to assess integrin α and β subunit levels, and attachment and antibody inhibition assays were used to evaluate the function of integrin heterodimers. The integrin α 3 , α 5 , α 6 , α 9 , α V , and β 1 subunits, but not the α 1 , α 2 , α 4 , α 7 , and α 8 subunits, were identified on the surface of undifferentiated porcine primed ES cells. Subsequently, significant increase of their adhesion to fibronectin, tenascin C and vitronectin were observed and functional blocking of integrin heterodimer α 5 β 1 , α 9 β 1 , or α V β 1 showed significantly inhibited adhesion to fibronectin, tenascin C, or vitronectin. No integrin α 6 β 1 heterodimer?mediated adhesion to laminin was detected. These results demonstrate that active α 5 β 1 , α 9 β 1 , and α V β 1 integrin heterodimers are present on the surface of undifferentiated porcine primed ES cells, together with inactive integrin α 3 (presumed) and α 6 subunits. This article is protected by copyright. All rights reserved.

[Effect of 2-deoxy-d-glucose on enterovirus reproduction in HEp-2 cell cultures].

PubMed

Shirobokov, V P

1976-01-01

The influence of 2-deoxy-d-glucose (2DG) on reproduction of some enteroviruses was studied. When 2DG was added to carbohydrate-free medium. It exerted a marked inhibiting effect on reproduction of poliovirus type I (virulent and attenuated variants) and Coxsackie B1, B2, B3, B5 and B6 viruses. The agent was inactive for virulent and attenuated poliomyelitis type II viruses. Poliomyelitis type III and Coxsackie B4 viruses were shown to be incable of multiplication in carbohydrate-free medium when the maintenance medium in cell cultures was lactalbumin hydrolysate in Hank's solution without-glucose. The inhibiting effect of 2DG on sensitive enteroviruses was irreversible and manifest at a concentration as low as 0.1 mg/ml. The effect of the agent was directed to the active stages of intracellular enterovirus synthesis. The possible mechanism of inhibition of enterovirus reproduction in the presence of 2DG is discussed.

2-[18 F]fluoro-2-deoxy-d-glucose (FDG) positron-emission tomography (PET) findings of chronic expanding intrapericardial hematoma: a potential interpretive pitfall that mimics a malignant tumor

PubMed Central

2013-01-01

A 77-year-old man who had undergone mitral valve replacement 5 years previously presented with an intrapericardial mass. Computed tomography and magnetic resonance imaging showed that the mass lesion contained hematoma components. Positron-emission tomography (PET) with 2-[18 F] fluoro-2-deoxy-d-glucose (FDG) revealed uptake in the peripheral rim of the mass. These findings suggested the presence of hematoma associated with a malignant lesion. Surgical resection was performed, and the histological diagnosis was chronic expanding intrapericardial hematoma without neoplastic changes. Chronic expanding intrapericardial hematoma is a rare disease but should be considered when an expanding mass is found in a patient after cardiac surgery. The FDG-PET findings of chronic expanding hematomas, including FDG uptake in the peripheral rim of the mass as a result of inflammation, should be recognized as a potential interpretive pitfall that mimics a malignant tumor. PMID:23324446

A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

PubMed

Penttinen, Leena; Rutanen, Chiara; Saloheimo, Markku; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina

2018-01-01

Coupled binuclear copper (CBC) enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4) and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy) and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB) and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

Delta 12-prostaglandin J2, a plasma metabolite of prostaglandin D2, causes eosinophil mobilization from the bone marrow and primes eosinophils for chemotaxis.

PubMed

Heinemann, Akos; Schuligoi, Rufina; Sabroe, Ian; Hartnell, Adele; Peskar, Bernhard A

2003-05-01

PGD(2), a major mast cell mediator, is a potent eosinophil chemoattractant and is thought to be involved in eosinophil recruitment to sites of allergic inflammation. In plasma, PGD(2) is rapidly transformed into its major metabolite delta(12)-PGJ(2), the effect of which on eosinophil migration has not yet been characterized. In this study we found that delta(12)-PGJ(2) was a highly effective chemoattractant and inducer of respiratory burst in human eosinophils, with the same efficacy as PGD(2), PGJ(2), or 15-deoxy-delta(12,14)-PGJ(2). Moreover, pretreatment of eosinophils with delta(12)-PGJ(2) markedly enhanced the chemotactic response to eotaxin, and in this respect delta(12)-PGJ(2) was more effective than PGD(2). delta(12)-PGJ(2)-induced facilitation of eosinophil migration toward eotaxin was not altered by specific inhibitors of intracellular signaling pathways relevant to the chemotactic response, phosphatidylinositol 3-kinase (LY-294002), mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (U-0126), or p38 mitogen-activated protein kinase (SB-202190). Desensitization studies using calcium flux suggested that delta(12)-PGJ(2) signaled through the same receptor, CRTH2, as PGD(2). Finally, delta(12)-PGJ(2) was able to mobilize mature eosinophils from the bone marrow of the guinea pig isolated perfused hind limb. Given that delta(12)-PGJ(2) is present in the systemic circulation at relevant levels, a role for this PGD(2) metabolite in eosinophil release from the bone marrow and in driving eosinophil recruitment to sites of inflammation appears conceivable.

Priming with a simplified intradermal HIV-1 DNA vaccine regimen followed by boosting with recombinant HIV-1 MVA vaccine is safe and immunogenic: a phase IIa randomized clinical trial.

PubMed

Munseri, Patricia J; Kroidl, Arne; Nilsson, Charlotta; Joachim, Agricola; Geldmacher, Christof; Mann, Philipp; Moshiro, Candida; Aboud, Said; Lyamuya, Eligius; Maboko, Leonard; Missanga, Marco; Kaluwa, Bahati; Mfinanga, Sayoki; Podola, Lilly; Bauer, Asli; Godoy-Ramirez, Karina; Marovich, Mary; Moss, Bernard; Hoelscher, Michael; Gotch, Frances; Stöhr, Wolfgang; Stout, Richard; McCormack, Sheena; Wahren, Britta; Mhalu, Fred; Robb, Merlin L; Biberfeld, Gunnel; Sandström, Eric; Bakari, Muhammad

2015-01-01

Intradermal priming with HIV-1 DNA plasmids followed by HIV-1MVA boosting induces strong and broad cellular and humoral immune responses. In our previous HIVIS-03 trial, we used 5 injections with 2 pools of HIV-DNA at separate sites for each priming immunization. The present study explores whether HIV-DNA priming can be simplified by reducing the number of DNA injections and administration of combined versus separated plasmid pools. In this phase IIa, randomized trial, priming was performed using 5 injections of HIV-DNA, 1000 μg total dose, (3 Env and 2 Gag encoding plasmids) compared to two "simplified" regimens of 2 injections of HIV-DNA, 600 μg total dose, of Env- and Gag-encoding plasmid pools with each pool either administered separately or combined. HIV-DNA immunizations were given intradermally at weeks 0, 4, and 12. Boosting was performed intramuscularly with 108 pfu HIV-MVA at weeks 30 and 46. 129 healthy Tanzanian participants were enrolled. There were no differences in adverse events between the groups. The proportion of IFN-γ ELISpot responders to Gag and/or Env peptides after the second HIV-MVA boost did not differ significantly between the groups primed with 2 injections of combined HIV-DNA pools, 2 injections with separated pools, and 5 injections with separated pools (90%, 97% and 97%). There were no significant differences in the magnitude of Gag and/or Env IFN-γ ELISpot responses, in CD4+ and CD8+ T cell responses measured as IFN-γ/IL-2 production by intracellular cytokine staining (ICS) or in response rates and median titers for binding antibodies to Env gp160 between study groups. A simplified intradermal vaccination regimen with 2 injections of a total of 600 μg with combined HIV-DNA plasmids primed cellular responses as efficiently as the standard regimen of 5 injections of a total of 1000 μg with separated plasmid pools after boosting twice with HIV-MVA. World Health Organization International Clinical Trials Registry Platform PACTR2010050002122368.

Studies on the biosynthesis of vitamin B sub 2 and vitamin B sub 12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, H.C.

1988-01-01

Feeding experiments with Ashbya gossypii followed by NMR analysis of the resulting riboflavin showed incorporation of deuterium from D-(2-{sup 2}H)ribose at C-2{prime} and from D-(1-{sup 2}H)ribose in the pro-R position at C-1{prime} of the ribityl side chain. The results rule out an Amadori rearrangement mechanism for the reduction of the ribosylamino to the ribitylamino linkage and point to formation of a Schiff base that is reduced stereospecifically opposite to the face from which the oxygen has departed. As prerequisite for the analysis, the {sup 1}H NMR signals for the pro-R and pro-S hydrogens at C-1{prime} of riboflavin and its tetraacetatemore » were assigned with the aid of synthetic stereospecifically deuteriated samples. Feeding experiments with Propionibacterium shermianii followed by NMR analysis of the resulting vitamin B{sub 12} showed: (1) 5-methylbenzimidazole (5MBI) incorporated and only one regioisomer (B6-demethylcyanocobalamin)formed. (2) 8-demethylriboflavin incorporated and the same regioisomer was obtained as 5MBI experiment. (3) (1{prime}-{sup 13}C, 5-{sup 15}N)riboflavin incorporated and {sup 13}C-NMR showed that {sup 13}C at the B2 position of cyanocobalamin coupled to both adjacent nitrogen-15 atoms at about the same ratio.« less

Synthesis and reactions of nickel and palladium carbon-bound enolate complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt, E.R.; Bergman, R.G.; Heathcock, C.H.

1990-01-01

Nickel and palladium carbon-bound enolates of the general formula {eta}{sup 5}-C{sub 5}R{sub 5}(Ph{sub 3}P)MCHR{prime}COR{double prime} (R = H, CH{sub 3}; R{prime} = H, CH{sub 3}; R{double prime} = t-Bu, Ph, O-t-Bu) were prepared. Cp{sup *}(Ph{sub 3}P)NiCH{sub 2}CO{sub 2}-t-Bu (1e) was characterized by X-ray diffraction. Compound 1e crystallizes in the monoclinic space group P2{sub 1}/n with unit-cell dimensions a = 13.6110 (20) {angstrom}, b = 12.7454 (13) {angstrom}, c = 17.8571 (23) {angstrom}, {beta} = 105.544 (11){degree}, Z = 4, observed data 4,091, R = 4.53%, and R{sub w} = 4.19%. Reactions of these nickel and palladium enolates with aldehydes andmore » other electrophilic reagents were examined. The nickel ketone enolates were shown to react with 2 equiv of benzaldehyde to deliver products resulting from a Tischtschenko-type oxidation/reduction process. Cp(Ph{sub 3}P)NiCH{sub 2}CO-t-Bu reacts with phosphines (L) to yield paramagnetic nickel(I) complexes of general formula Cp(L){sub 2}Ni.« less

The Feasibility, Acceptability, and Outcomes of PRIME-D: A Novel Mobile Intervention Treatment for Depression

PubMed Central

Schlosser, Danielle A.; Campellone, Timothy R.; Truong, Brandy; Anguera, Joaquin A.; Vergani, Silvia; Vinogradov, Sophia; Arean, Patricia

2017-01-01

Background Despite decades of research and development, depression has risen from the 5th to the leading cause of disability in the U.S. Barriers to progress in the field are 1) Poor access to high quality care; 2) Limited mental health workforce; and 3) Few providers trained in the delivery of evidence-based treatments (EBTs). While mobile platforms are being developed to give consumers greater access to high quality care, too often these tools do not have empirical support for their effectiveness. In this study, we evaluated PRIME-D, a mobile app intervention that uses social networking, goal setting, and a mental health coach to deliver text-based, EBT’s to treat mood symptoms and functioning in adults with depression. Methods Thirty-six adults with depression remotely participated in PRIME-D over an 8-week period with a 4-week follow up, with 83% retained over the 12-week course of the study. Results On average, participants logged into the app 5 days/week. Depression scores (PHQ-9) significantly improved over time (over 50% reduction), with coach interactions enhancing these effects. Mood-related disability (SDS) also significantly decreased over time with participants no longer being impaired by their mood symptoms. Overall use of PRIME-D predicted greater gains in functioning. Improvements in mood and functioning were sustained over the 4-week follow-up. Conclusions Results suggest that PRIME-D is a feasible, acceptable, and effective intervention for adults with depression and that a mobile service delivery model may address the serious public health problem of poor access to high quality mental health care. PMID:28419621

Fragmented pictures revisited: long-term changes in repetition priming, relation to skill learning, and the role of cognitive resources.

PubMed

Kennedy, Kristen M; Rodrigue, Karen M; Raz, Naftali

2007-01-01

Whereas age-related declines in declarative memory have been demonstrated in multiple cross-sectional and longitudinal studies, the effect of age on non-declarative manifestations of memory, such as repetition priming and perceptual skill learning, are less clear. The common assumption, based on cross-sectional studies, is that these processes are only mildly (if at all) affected by age. To investigate long-term changes in repetition priming and age-related differences in identification of fragmented pictures in a 5-year longitudinal design. Healthy adults (age 28-82 years) viewed drawings of objects presented in descending order of fragmentation. The identification threshold (IT) was the highest fragmentation level at which the object was correctly named. After a short interval, old pictures were presented again along with a set of similar but novel pictures. Five years later the participants repeated the experiment. At baseline and 5-year follow-up alike, one repeated exposure improved IT for old (priming) and new (skill acquisition) pictures. However, long-term retention of priming gains was observed only in young adults. Working memory explained a significant proportion of variance in within-occasion priming, long-term priming, and skill learning. Contrary to cross-sectional results, this longitudinal study suggests perceptual repetition priming is not an age-invariant phenomenon and advanced age and reduced availability of cognitive resources may contribute to its decline. Copyright 2007 S. Karger AG, Basel.

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

Approaches to Preventative and Therapeutic HIV vaccines

PubMed Central

Gray, Glenda E.; Laher, Fatima; Lazarus, Erica; Ensoli, Barbara; Corey, Lawrence

2016-01-01

Novel strategies are being researched to discover vaccines to prevent and treat HIV-1. Nonefficacious preventative vaccine approaches include bivalent recombinant gp120 alone, HIV gene insertion into an Adenovirus 5 (Ad5) virus vector and the DNA prime/Ad5 boost vaccine regimen. However, the ALVAC-HIV prime/AIDSVAX® B/E gp120 boost regimen showed 31.2% efficacy at 3.5 years, and is being investigated as clade C constructs with an additional boost. Likewise, although multiple therapeutic vaccines have failed in the past, in a non-placebo controlled trial, a Tat vaccine demonstrated immune cell restoration, reduction of immune activation, and reduced HIV-1 DNA viral load. Monoclonal antibodies for passive immunization or treatment show promise, with VRC01 entering advanced clinical trials. PMID:26985884

Adaptation of the TdT assay for semi-quantitative flow cytometric detection of DNA strand breaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bromidge, T.J.; Howe, D.J.; Johnson, S.A.

The enzyme Terminal Deoxynucleotidyl Transferase (TdT) is a DNA polymerase which can be used to label DNA strand breaks by the incorporation of a labelled nucleotide followed by a fluorescent detection step. The amount of label incorporated can then be assessed by flow cytometry. The mechanism of action of TdT, however, will allow the addition of varying numbers of nucleotides to the free 3{prime} termini produced by DNA strand breaks. The substitution of Digoxigenin (DIG){trademark} labelled dideoxynucleotides for labelled deoxy-nucleotides in the TdT assay will limit the addition of label to a DNA break to a single nucleotide, thus ensuringmore » a direct relationship between an increase in DNA strand breaks and an increase in fluorescence. We have used this adaptation of the TdT assay to evaluate DNA damage incurred in lymphocytes, from patients with Chronic Lymphocytic Leukemia (CLL), on exposure to UV irradiation and apoptosis-inducing drugs, fludarabine and 2-Chloro-2{prime}-deoxyadenosine (2-CdA). This technique may give a good indication of the susceptibility of CLL patients to apoptosis inducing drugs, and hence an indication of the likely response to these therapies. 7 refs., 2 figs., 2 tabs.« less

Tetraether bolaform amphiphiles as models of archaebacterial membrane lipids: Synthesis, differential scanning calorimetry, and monolayer studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, J.M.; Thompson, D.H.

Four racemic tetraether lipids containing a single 1,[omega]-polymethylene chain ([omega] = 16, 20) bridging two glycerophosphate headgroups (bolaform amphiphiles) have been synthesized. These materials have been characterized at the air-water interface by monolayer balance methods and in buffered solution by differential scanning calorimetry (DSC) and negative stain transmission electron microscopy (TEM). Molecular areas in excess of 100 [angstrom][sup 2]/molecule at 40 mN/m[sup 2] were observed for all bolaamphiphiles studied, suggesting a U-shaped molecular conformation that places both phosphate headgroups in the water subphase. Aqueous dispersions of these lipids have thermal and morphological properties that depend on molecular structure and solutionmore » pH. Phase transition temperatures (T[sub c]) of the structural isomers, 2,2[prime]-di-O-decyl-1, 1[prime]-O-eicosamethylene-rac-diglycero-3,3[prime]-diphosphate (PS20) and 1,1[prime]-di-O-decyl-2,2[prime]-O-eicosamethylene-3,3[prime]-diphosphate (SS20), were 49 and 38 [degrees]C, respectively, at pH 2.5. A reduction in the observed T[sub c] of [approximately] 14 [degrees]C occurred when the pH was raised to 8.1. The closely related structural analogue, 1,1[prime]-O-eicosamethylene-2-O-eicosyl-rac-diglycero-3,2[prime], 3[prime]-diphosphate (PA20), has a T[sub c] 85 [degrees]C. No phase transition was observed above 5 [degrees]C for 2,2[prime]-O-dioctyl-1,1 [prime]-O-hexadecylmethylene-rac-diglycero-3, 3[prime]-disphosphoric acid (PS16). Multilamellar structures with hydrocarbon-region spacings of 24-30 [angstrom] and overall lengths approaching 0.3 [mu]m were observed by negative stain electron microscopy. The observed lamellae distance is in good agreement with the membrane thickness expected for a bolaamphiphile in its all-anti conformation. 56 refs., 8 figs., 1 tab.« less

Phosphatidylinositol 4,5-bisphosphate optical uncaging potentiates exocytosis

PubMed Central

Wierda, Keimpe DB; Pinheiro, Paulo S; Nadler, André; McCarthy, Anthony W; Ziomkiewicz, Iwona; Kruse, Martin; Reither, Gregor; Rettig, Jens; Lehmann, Martin; Haucke, Volker; Hille, Bertil

2017-01-01

Phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] is essential for exocytosis. Classical ways of manipulating PI(4,5)P2 levels are slower than its metabolism, making it difficult to distinguish effects of PI(4,5)P2 from those of its metabolites. We developed a membrane-permeant, photoactivatable PI(4,5)P2, which is loaded into cells in an inactive form and activated by light, allowing sub-second increases in PI(4,5)P2 levels. By combining this compound with electrophysiological measurements in mouse adrenal chromaffin cells, we show that PI(4,5)P2 uncaging potentiates exocytosis and identify synaptotagmin-1 (the Ca2+ sensor for exocytosis) and Munc13-2 (a vesicle priming protein) as the relevant effector proteins. PI(4,5)P2 activation of exocytosis did not depend on the PI(4,5)P2-binding CAPS-proteins, suggesting that PI(4,5)P2 uncaging may bypass CAPS-function. Finally, PI(4,5)P2 uncaging triggered the rapid fusion of a subset of readily-releasable vesicles, revealing a rapid role of PI(4,5)P2 in fusion triggering. Thus, optical uncaging of signaling lipids can uncover their rapid effects on cellular processes and identify lipid effectors. PMID:29068313

An investigation of the adsorption characteristics of 5 prime ATP and 5 prime AMP onto the surface of CaSO sub 4 x 2H sub 2 O

NASA Technical Reports Server (NTRS)

Calderon, J.; Sweeney, M. A.

1986-01-01

A model has been proposed (Lahev and Chans, 1982) in which solid surfaces can act as a site for catalytic activity of condensation reactions for certain biomolecules. From this model, the adsorption characteristics of 5'ATP and 5'AMP onto the surface of CaSO4 2H2O was chosen for study. It has been proven that 5'ATP and 5'AMP do adsorb onto the surface of CaSO4. Studies were then made to determine the dependence of adsorption versus time, concentration, ionic strength and pH. It was found that the adsorption of the nucleotides is highly pH dependent, primarily determined by the phosphate acid groups of the nucleic acid molecule. From this investigation, the data obtained are discussed in relation to the model for the prebiotic earth.

Structure-reactivity relationship of Amadori rearrangement products compared to related ketoses.

PubMed

Kaufmann, Martin; Meissner, Philipp M; Pelke, Daniel; Mügge, Clemens; Kroh, Lothar W

2016-06-16

Structure-reactivity relationships of Amadori rearrangement products compared to their related ketoses were derived from multiple NMR spectroscopic techniques. Besides structure elucidation of six Amadori rearrangement products derived from d-glucose and d-galactose with l-alanine, l-phenylalanine and l-proline, especially quantitative (13)C selective saturation transfer NMR spectroscopy was applied to deduce information on isomeric systems. It could be shown exemplarily that the Amadori compound N-(1-deoxy-d-fructos-1-yl)-l-proline exhibits much higher isomerisation rates than d-fructose, which can be explained by C-1 substituent mediated intramolecular catalysis. In combination with a reduced carbonyl activity of Amadori compounds compared to their related ketoses which results in an increased acyclic keto isomer concentration, the results on isomerisation dynamics lead to a highly significant increased reactivity of Amadori compounds. This can be clearly seen, comparing approximated carbohydrate milieu stability time constants (ACuSTiC) which is 1 s for N-(1-deoxy-d-fructos-1-yl)-l-proline and 10 s for d-fructose at pD 4.20 ± 0.05 at 350 K. In addition, first NMR spectroscopic data are provided, which prove that α-pyranose of (amino acid substituted) d-fructose adopts both, (2)C5 and (5)C2 conformation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films.

PubMed

Deng, Zongwu; Bald, Ilko; Illenberger, Eugen; Huels, Michael A

2007-10-14

Highly charged heavy ion traversal of a biological medium can produce energetic secondary fragment ions. These fragment ions can in turn cause collisional and reactive scattering damage to DNA. Here we report hyperthermal (1-100 eV) scattering of one such fragment ion (N(+)) from biologically relevant sugar molecules D-ribose and 2-deoxy-D-ribose condensed on polycrystalline Pt substrate. The results indicate that N(+) ion scattering at kinetic energies down to 10 eV induces effective decomposition of both sugar molecules and leads to the desorption of abundant cation and anion fragments. Use of isotope-labeled molecules (5-(13)C D-ribose and 1-D D-ribose) partly reveals some site specificity of the fragment origin. Several scattering reactions are also observed. Both ionic and neutral nitrogen atoms abstract carbon from the molecules to form CN(-) anion at energies down to approximately 5 eV. N(+) ions also abstract hydrogen from hydroxyl groups of the molecules to form NH(-) and NH(2) (-) anions. A fraction of OO(-) fragments abstract hydrogen to form OH(-). The formation of H(3)O(+) ions also involves hydrogen abstraction as well as intramolecular proton transfer. These findings suggest a variety of severe damaging pathways to DNA molecules which occur on the picosecond time scale following heavy ion irradiation of a cell, and prior to the late diffusion-limited homogeneous chemical processes.

Local cerebral glucose utilization during status epilepticus in newborn primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujikawa, D.G.; Dwyer, B.E.; Lake, R.R.

1989-06-01

The effect of bicuculline-induced status epilepticus (SE) on local cerebral metabolic rates for glucose (LCMRglc) was studied in 2-wk-old ketamine-anesthetized marmoset monkeys, using the 2-(/sup 14/C)-deoxy-D-glucose autoradiographical technique. To estimate LCMRglc in cerebral cortex and thalamus during SE, the lumped constant (LC) for 2-deoxy-D-glucose (2-DG) and the rate constants for 2-DG and glucose were calculated for these regions. The control LC was 0.43 in frontoparietal cortex, 0.51 in temporal cortex, and 0.50 in thalamus; it increased to 1.07 in frontoparietal cortex, 1.13 in temporal cortex, and 1.25 in thalamus after 30 min of seizures. With control LC values, LCMRglc inmore » frontoparietal cortex, temporal cortex, and dorsomedial thalamus appeared to increase four to sixfold. With seizure LC values, LCMRglc increased 1.5- to 2-fold and only in cortex. During 45-min seizures, LCMRglc in cortex and thalamus probably increases 4- to 6-fold initially and later falls to the 1.5- to 2-fold level as tissue glucose concentrations decrease. Together with our previous results demonstrating depletion of high-energy phosphates and glucose in these regions, the data suggest that energy demands exceed glucose supply. The long-term effects of these metabolic changes on the developing brain remain to be determined.« less

Clinical Usefulness of [(18)F]Fluoro-2-Deoxy-D-Glucose Uptake in 178 Head-and-Neck Cancer Patients With Nodal Metastasis Treated With Definitive Chemoradiotherapy: Consideration of Its Prognostic Value and Ability to Provide Guidance for Optimal Selection of Patients for Planned Neck Dissection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inokuchi, Haruo, E-mail: h.inokuchi@scchr.j; Kodaira, Takeshi; Tachibana, Hiroyuki

2011-03-01

Purpose: To evaluate the clinical effectiveness of pretreatment [(18)F]fluoro-2-deoxy-D-glucose-positron emission tomography for head-and-neck squamous cell carcinoma patients with nodal metastasis treated with chemoradiotherapy. Methods and Materials: Between March 2002 and December 2006, 178 patients with head-and-neck squamous cell carcinoma and nodal metastasis underwent fluoro-2-deoxy-D-glucose positron emission tomography before chemoradiotherapy. Fluoro-2-deoxy-D-glucose uptake by both the primary lesion and the neck node was measured using the standard uptake value (SUV). The overall survival, disease-free survival, local control, nodal progression-free survival, and distant metastasis-free survival rates were calculated, and several prognostic factors were evaluated. Results: The patients with a nodal SUV {>=}6.00 hadmore » a significantly lower 3-year disease-free survival rate than those with a lower SUV (44% vs. 69%, p = .004). On multivariate analysis, a high SUV of nodal disease also proved to be a significantly unfavorable factor for disease-free survival (p = .04, 95% confidence interval [CI], 1.02-3.23), nodal progression-free survival (p = .05; 95% CI, 1.00-4.15), and distant metastasis-free survival (p = .016; 95% CI, 1.25-8.92). Among the patients with a greater nodal SUV ({>=}6.00), those treated with planned neck dissection had better nodal progression-free survival than those in the observation group (p = .04, hazard ratio, 2.36; 95% CI, 1.00-5.85). Conclusion: Among head-and-neck squamous cell carcinoma patients treated with chemoradiotherapy, the pretreatment SUV of nodal disease was one of the strongest prognostic factors and also provided important information for the selection of patients suitable for planned neck dissection.« less

Hydroxyl X2Pi pure rotational transitions

NASA Astrophysics Data System (ADS)

Goorvitch, D.; Goldman, A.; Dothe, Hoang; Tipping, R. H.; Chackerian, C., Jr.

1992-12-01

We present a list of frequencies, term values, Einstein A values, and assignments for the pure rotational transitions of the X2Pi state of the OH molecule. This list includes transitions from 3 to 2015/cm for Delta-v = 0, v-double-prime = 0-4, and J-double-prime = 0.5-49.5. The A values were computed using recent advances in calculating wave functions for a coupled system and an experimentally derived electric dipole moment function (Nelson et al., 1990) which exhibits curvature.

Hypergravity signal transduction in HeLa cells with concomitant phosphorylation of proteins immunoprecipitated with anti-microtubule-associated protein antibodies

NASA Technical Reports Server (NTRS)

Kumei, Yasuhiro; Whitson, Peggy A.; Sato, Atsushige; Cintron, Nitza M.

1991-01-01

It is shown that hypergravity (35g) stimulates the production of inositol 1,4,5-trisphosphate (IP3) and decreases adenosine 3-prime,5-prime-cyclic monophosphate (cAMP) levels in HeLa cells. It is proposed that IP3 and cAMP may act as second messengers in hypergravity signal transduction. Phosphorylation of microtubule-associated proteins in both the detergent-soluble and -insoluble fractions suggests that cytoskeletal structures may be influenced by gravity.

Lexical precision in skilled readers: Individual differences in masked neighbor priming.

PubMed

Andrews, Sally; Hersch, Jolyn

2010-05-01

Two experiments investigated the relationship between masked form priming and individual differences in reading and spelling proficiency among university students. Experiment 1 assessed neighbor priming for 4-letter word targets from high- and low-density neighborhoods in 97 university students. The overall results replicated previous evidence of facilitatory neighborhood priming only for low-neighborhood words. However, analyses including measures of reading and spelling proficiency as covariates revealed that better spellers showed inhibitory priming for high-neighborhood words, while poorer spellers showed facilitatory priming. Experiment 2, with 123 participants, replicated the finding of stronger inhibitory neighbor priming in better spellers using 5-letter words and distinguished facilitatory and inhibitory components of priming by comparing neighbor primes with ambiguous and unambiguous partial-word primes (e.g., crow#, cr#wd, crown CROWD). The results indicate that spelling ability is selectively associated with inhibitory effects of lexical competition. The implications for theories of visual word recognition and the lexical quality hypothesis of reading skill are discussed.

HMG-CoA lyase (HL) gene: Cloning and characterization of the 5{prime} end of the mouse gene, gene targeting in ES cells, and demonstration of large deletions in three HL-deficient patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, S.; Robert, M.F.; Mitchell, G.A.

1994-09-01

3-hydroxy-3-methylglutaryl CoA lyase (HL) is a mitochondrial matrix enzyme which catalyzes the last step of leucine catabolism and of ketogenesis. Autosomal recessive HL deficiency in humans results in episodes of hypoglycemia and coma. We are interested in the pathophysiology of HL deficiency as a model for both amino acid and fatty acid inborn errors. We have cloned the human and mouse HL genes. In order to analyze the 5{prime} nontranslated region of mouse HL gene, we cloned and sequenced a 1.8 kb fragment containing the 5{prime} extremity including exon 1 and about 1.6 kb of 5{prime} nontranslated sequence. The regionmore » surrounding exon 1 is CpG-rich (66.4%). Using the criteria of West, the Observed/Expected ratio for CpG dinucleotides is 0.7 ({ge}0.6 is consistent with a CpG island). We are carrying out primer extension and RNase protection experiments to determine the transcription initiation site. We constructed a gene targeting vector by introducing the neomycin resistance gene into exon 2 of a 7.5 kb genomic subclone of the mouse HL gene. Targeting was performed by electroporating 10 mg linearized vector into 10{sup 7} ES cells and selecting for 12 days with G418. 5/228 colonies (2.2%) had homologous recombination as shown by PCR screening and Southern analysis. We are microinjecting the 5 targeted clones into blastocysts to create an HL-deficient mouse. To date we have obtained two chimeras with contributions of 95% and 55% from 129, by coat color estimates. Three of 27 (11%) of the HL-deficient patients studied were suggested by genomic Southern analysis to be homozygous for large intragenic deletions. We confirmed this and defined the boundaries using exonic PCR.« less

Base catalysed isomerisation of aldoses of the arabino and lyxo series in the presence of aluminate.

PubMed

Ekeberg, Dag; Morgenlie, Svein; Stenstrøm, Yngve

2002-04-30

Base-catalysed isomerisation of aldoses of the arabino and lyxo series in aluminate solution has been investigated. L-Arabinose and D-galactose give L-erythro-2-pentulose (L-ribulose) and D-lyxo-2-hexulose (D-tagatose), respectively, in good yields, whereas lower reactivity is observed for 6-deoxy-D-galactose (D-fucose). From D-lyxose, D-mannose and 6-deoxy-L-mannose (L-rhamnose) are obtained mixtures of ketoses and C-2 epimeric aldoses. Small amounts of the 3-epimers of the ketoses were also formed. 6-Deoxy-L-arabino-2-hexulose (6-deoxy-L-fructose) and 6-deoxy-L-glucose (L-quinovose) were formed in low yields from 6-deoxy-L-mannose and isolated as their O-isopropylidene derivatives. Explanations of the differences in reactivity and course of the reaction have been suggested on the basis of steric effects.

Synthesis and Crystal Structure of 2’-Se-modified guanosine Containing DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salon, J.; Sheng, J; Gan, J

Selenium modification of nucleic acids is of great importance in X-ray crystal structure determination and functional study of nucleic acids. Herein, we describe a convenient synthesis of a new building block, the 2{prime}-SeMe-modified guanosine (G{sub Se}) phosphoramidite, and report the first incorporation of the 2{prime}-Se-G moiety into DNA. The X-ray crystal structure of the 2{prime}-Se-modified octamer DNA (5{prime}-GTG{sub Se}TACAC-3{prime}) was determined at a resolution of 1.20 {angstrom}. We also found that the 2{prime}-Se modification points to the minor groove and that the modified and native structures are virtually identical. Furthermore, we observed that the 2{prime}-Se-G modification can significantly facilitate themore » crystal growth with respect to the corresponding native DNA.« less

Some further studies on the synthesis of glycopeptide derivatives: 2-acetamido-2-deoxy-β-d-glucopyranosylamine derivatives

PubMed Central

Bolton, C. H.; Hough, L.; Khan, M. Y.

1966-01-01

1. The isolation, characterization and properties of two by-products in the preparation of 2-acetamido-3,4,6-tri-O- acetyl-2-deoxy-β-d-glucopyranosylamine are described. They are bis(2-acetamido-2-deoxy-d-glucopyranosyl)amines. 2. An independent synthesis of the bis-glycopyranosylamines is reported and conditions are given for their preparation in high yield. 3. Further improvements are given for the synthesis of 2-acetamido-1-N-(β-l- aspartyl)-2-deoxy-β-d-glucopyranosylamine and the α-l-aspartyl isomer. 4. The synthesis of 2-acetamido-1-N-acetyl-2-deoxy-β-d-glucopyranosylamine is described. PMID:5971780

DEdicated MONitor of EXotransits and Transients (DEMONEXT): System Overview and Year One Results from a Low-cost Robotic Telescope for Followup of Exoplanetary Transits and Transients

NASA Astrophysics Data System (ADS)

Villanueva, Steven, Jr.; Gaudi, B. Scott; Pogge, Richard W.; Eastman, Jason D.; Stassun, Keivan G.; Trueblood, Mark; Trueblood, Patricia

2018-01-01

We report on the design and first year of operations of the DEdicated MONitor of EXotransits and Transients (DEMONEXT). DEMONEXT is a 20-inch (0.5-m) robotic telescope using a PlaneWave CDK20 telescope on a Mathis instruments MI-750/1000 fork mount. DEMONEXT is equipped with a 2048 × 2048 pixel Finger Lakes Instruments (FLI) detector; a 10-position filter wheel with an electronic focuser and B, V, R, and I, g\\prime , r\\prime , i\\prime , z\\prime ; and clear filters. DEMONEXT operates in a continuous observing mode and achieves 2-4 mmag raw, unbinned, precision on bright V< 13 targets with 20-120 second exposures, and 1 mmag precision achieved by binning on 5-6 minute timescales. DEMONEXT maintains sub-pixel (< 0.5 pixels) target position stability on the CCD over 8 hours in good observing conditions, with degraded performance in poor weather (< 1 pixel). DEMONEXT achieves 1%-10% photometry on single-epoch targets with V< 17 in 5 minute exposures, with detection thresholds of V≈ 21. The DEMONEXT automated software has produced 143 planetary candidate transit light curves for the KELT collaboration and 48 supernovae and transient light curves for the ASAS-SN supernovae group in the first year of operation. DEMONEXT has also observed for a number of ancillary science projects including Galactic microlensing, active galactic nuclei, stellar variability, and stellar rotation.

Hippocampal Metaplasticity Is Required for the Formation of Temporal Associative Memories

PubMed Central

Xu, Jian; Antion, Marcia D.; Nomura, Toshihiro; Kraniotis, Stephen; Zhu, Yongling

2014-01-01

Metaplasticity regulates the threshold for modification of synaptic strength and is an important regulator of learning rules; however, it is not known whether these cellular mechanisms for homeostatic regulation of synapses contribute to particular forms of learning. Conditional ablation of mGluR5 in CA1 pyramidal neurons resulted in the inability of low-frequency trains of afferent activation to prime synapses for subsequent theta burst potentiation. Priming-induced metaplasticity requires mGluR5-mediated mobilization of endocannabinoids during the priming train to induce long-term depression of inhibition (I-LTD). Mice lacking priming-induced plasticity had no deficit in spatial reference memory tasks, but were impaired in an associative task with a temporal component. Conversely, enhancing endocannabinoid signaling facilitated temporal associative memory acquisition and, after training animals in these tasks, ex vivo I-LTD was partially occluded and theta burst LTP was enhanced. Together, these results suggest a link between metaplasticity mechanisms in the hippocampus and the formation of temporal associative memories. PMID:25505329

Kinetics and inhibition of cyclomaltodextrinase from alkalophilic Bacillus sp. I-5.

PubMed

Kim, M J; Park, W S; Lee, H S; Kim, T J; Shin, J H; Yoo, S H; Cheong, T K; Ryu, S; Kim, J C; Kim, J W; Moon, T W; Robyt, J F; Park, K H

2000-01-01

The cyclomaltodextrinase from alkalophilic Bacillus sp. I-5 (CDase I-5) was expressed in Escherichia coli and the purified enzyme was used for characterization of the enzyme action. The hydrolysis products were monitored by both HPLC and high-performance ion chromatography analysis that enable the kinetic analysis of the cyclomaltodextrin (CD)-degrading reaction. Analysis of the kinetics of cyclomaltodextrin hydrolysis by CDase I-5 indicated that ring-opening of the cyclomaltodextrin was the major limiting step and that CDase I-5 preferentially degraded the linear maltodextrin chain by removing the maltose unit. The substrate binding affinity of the enzyme was almost same for those of cyclomaltodextrins while the rate of ring-opening was the fastest for cyclomaltoheptaose. Acarbose and methyl 6-amino-6-deoxy-alpha-d-glucopyranoside were relatively strong competitive inhibitors with K(i) values of 1.24 x 10(-3) and 8.44 x 10(-1) mM, respectively. Both inhibitors are likely to inhibit the ring-opening step of the CD degradation reaction. Copyright 2000 Academic Press.

Linkage disequilibrium between polymorphisms at the 5{prime} untranslated region and intron 5 (Dde I) of the antithrombin III (ATIII) gene in the Chinese

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tay, J.S.H.; Liu, Y.; Low, P.S.

A length polymorphism at the 5{prime} untranslated region of exon 1 and an RFLP (Dde I) in intron 5 (nt 160) of the ATIII gene were amplified by polymerase chain reaction with primers of published sequences. DNA fragments were size-fractionated by agarose gel electrophoresis (3% NuSieve and 1% Seakem GTG) and photographed over a UV transilluminator. A strong linkage disequilibrium was observed between these two polymorphisms of the ATIII gene in the Chinese ({chi}{sup 2} = 63.7; {triangle} 0.42, P < 0.001). The estimated frequencies of the three haplotypes were found to be 0.37 for SD+, 0.40 for LD+ andmore » 0.23 for LD-.« less

Wavelength-resolved emission spectroscopy of the alkoxy and alkylthio radicals in a supersonic jet

NASA Technical Reports Server (NTRS)

Misra, Prabhakar; Zhu, Xinming; Hsueh, Ching-Yu; Kamal, Mohammed M.

1993-01-01

Wavelength-resolved emission spectra of methoxy (CH3O) and methylthio (CH3S) radicals have been obtained in a supersonic jet environment with a resolution of 0.3 nm by dispersing the total laser-induced fluorescence with a 0.6 m monochromator. A detailed analysis of the single vibronic level dispersed fluorescence spectra yields the following vibrational frequencies for CH3O in the X(2)E state; nu(sub 1 double prime) = 2953/cm, nu(sub 2 double prime) = 1375/cm, nu(sub 3 double prime) = 1062/cm, nu(sub 4 double prime) = 2869/cm, nu(sub 5 double prime) = 1528/cm and nu(sub 6 double prime) = 688/cm. A similar analysis of the wavelength-resolved emission spectra of CH3S provides the following ground state vibrational frequencies: nu(sub 2 double prime) = 1329/cm, nu(sub 3 double prime) = 739/cm and nu(sub 6 double prime) = 601/cm. An experimental uncertainty of 20/cm is estimated for the assigned frequencies.

[Effect of vitamin sufficiency on adaptation syndrome in growing rats].

PubMed

Sidorova, Iu S; Beketova, N A; Vrzhesinskaia, O A; Kodentsova, V M; Kosheleva, O V; Zorin, S N; Selifanov, A V; Mazo, V K

2014-01-01

The influence of vitamin supply of growing male -Wistar rats (n=21) with an initial body weight 53,5±0,9 g on their resistance to a single distress induced by the electric shock has been investigated. Control rats within 21 days received a complete semisynthetic diet,providingadequate amounts of vitamins. Combined vitamin deficiency in experimental rats was caused by 5-fold decrease of vitamin mixture amount in the feed and the total vitamin E exclusion from the mixture. On the 21st day, one day before the end of the experiment, both groups of rats were subjected to stress impact (electrocutaneous irritation on paws, 0,4 mA for 8 sec) and then animals were placed in metabolic cages to collect urine. By the end of the experiment, the animals with the combined vitamin deficiency lag behind in growth. Vitamin B2, A, B1 and E liver content decreased in experimental rats by 1,6, 2,3, 4,4 and 15 fold accordingly. Retinol plasma concentration was significantly reduced by 18%, α-tocopherol level - by 5 fold, urinary excretionof riboflavin and 4-pyridoxic acid (vitamin B6 metabolite) was significantly reduced by 6,5 and 2,46 times accordingly. MDA blood plasma concentration and the urinary ratio of oxidized and not oxidized form of 8-hydroxy-2'-deoxy-guanosine did not differ in both groups of rats. Urinary excretion of stress biomarker corticosterone in rats with combined vitamin deficit was 2,5-fold higher than in control rats. Thus, reducing of vitamins supply resulted in an increase of urine corticosterone in stressed rats, that characterized the intensity of general adaptation syndrome. This fact shows the importance of optimal sufficiency with vitamins in nonspecific (general) resistance to stress.

l-2',3'-Didehydro-2',3'-dideoxy-3'-fluoronucleosides: synthesis, anti-HIV activity, chemical and enzymatic stability, and mechanism of resistance.

PubMed

Chong, Youhoon; Gumina, Giuseppe; Mathew, Judy S; Schinazi, Raymond F; Chu, Chung K

2003-07-17

As antiviral nucleosides containing a 2',3'-unsaturated sugar moiety with 2'-fluoro substitution are endowed with increased stabilization of the glycosyl bond, it was of interest to investigate the influence of the fluorine atom at the 3'-position. Various pyrimidine and purine L-3'-fluoro-2',3'-unsaturated nucleosides were synthesized from their precursors, L-3',3'-difluoro-2',3'-dideoxy nucleosides, by elimination of hydrogen fluoride. In the L-3',3'-difluoro-2',3'-dideoxy nucleoside series, cytidine 16 and 5-fluorocytidine 18 analogues showed modest antiviral activity (EC(50) 11.5 and 8.8 microM, respectively) when evaluated against HIV-1 in human peripheral blood mononuclear (PBM) cells. In the 2',3'-unsaturated series, L-3'-fluoro-2',3'-didehydro-2',3'-dideoxycytidine 24 and 5-fluorocytidine 26 showed highly potent antiviral activity (EC(50) 0.089 and 0.018 microM, respectively) without significant cytotoxicity. The guanosine analogue 48 showed only marginal anti-HIV activity with some cytotoxicity (EC(50) 38.5 microM, and IC(50) 17.4, 58.4, 36.5 microM in PBM, CEM, and Vero cells, respectively). The cytidine 24 and 5-fluorocytidine 26 analogues, however, showed significantly decreased antiviral activity against the clinically important lamivudine-resistant variants (HIV-1(M184V)). Molecular modeling studies demonstrated that the 3'-fluoro atom of the L-3'-fluoro-2',3'-unsaturated nucleoside is within the hydrogen bonding distance with the amide backbone of Asp185, which favors the binding of the nucleoside triphosphate to the wild-type RT. This favorable binding mode, however, cannot be maintained when the triphosphate of 3'-fluoro 2',3'-unsaturated nucleoside binds to the active site of M184V RT because the bulky side chain of Val184 occupies the space needed for the nucleotide. The biological results suggest that, in addition to the sugar conformation, the base moiety may also play a role in their interaction with the M184V RT.

Reinstatement of Morphine-Induced Conditioned Place Preference in Mice by Priming Injections

PubMed Central

Do Couto, B. Ribeiro; Aguilar, M. A.; Manzanedo, C.; Rodríguez-Arias, M.; Miñarro, J.

2003-01-01

To construct a model of relapse of drug abuse in mice, the induction, we evaluated the extinction and reinstatement of morphine-induced place preference. In Experiment 1, we examined the effects of morphine (0, 2, 3, 5, 10, 20 and 40 mg/kg) in the conditioned place preference (CPP) paradigm. Mice showed CPP with 5, 10, 20 and 40 mg/kg. In Experiment 2, we evaluated the effects of two different extinction procedures. After conditioning with 40 mg/kg of morphine, the mice underwent daily extinction sessions of 60 or 15 min of duration. CPP was extinguished after seven and nine sessions, respectively. In Experiment 3, we tested the reinstating effects of several priming doses of morphine. Mice were conditioned with 40 mg/kg of morphine and underwent the daily 15 min extinction sessions until CPP was no longer evident. Then, the effects of morphine (0, 2, 3, 5, 10, 20, 40 mg/kg, i.p.) were evaluated. CPP was reinstated by doses from 5 mg/kg upward. The results show that morphine priming injections are effective in reactivating opiateseeking behavior in mice, and thus, the CPP paradigm might be useful to investigate the mechanisms underlying relapse of drug abuse. PMID:15152982

[Study on the chemical constituents of flavones from corn silk].

PubMed

Zhang, Hui-en; Xu, De-ping

2007-02-01

The three flavones were isolated from water extracts of corn silk by chromatography on macroporous resin, polyamide, ODS and Sephadex LH-20. Three compounds were identified as formononetin (7-hydroxy-4'-methoxyisoflavone) ( I ) ,2"-O-alpha-L-rham-nosyl-6-C-( 3-deoxyglucosyl) -3 '-methoxyluteolin( II ) ,2"-O-alpha-L-rhamnosyl-6-C-( 6-deoxy-ax-5-methyl-xylo-hexos-4-ulosyl) -3'-methoxyluteolin( II ). Compounds ( I ) and ( II ) were isolated from the corn silk for the first time.

L-Aspartic and l-glutamic acid ester-based ProTides of anticancer nucleosides: Synthesis and antitumoral evaluation.

PubMed

Gao, Ling-Jie; De Jonghe, Steven; Daelemans, Dirk; Herdewijn, Piet

2016-05-01

A series of novel aryloxyphosphoramidate nucleoside prodrugs based on l-aspartic acid and l-glutamic acid as amino acid motif has been synthesized and evaluated for antitumoral activity. Depending on the cancer cell line studied and on the nature of the parent nucleoside compound (gemcitabine, 5-iodo-2'-deoxy-uridine, floxuridine or brivudin), the corresponding ProTides are endowed with an improved or decreased cytotoxic activity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Oligomerization reactions of deoxyribonucleotides on montmorillonite clay - The effect of mononucleotide structure on phosphodiester bond formation

NASA Technical Reports Server (NTRS)

Ferris, James P.; KAMALUDDIN

1989-01-01

The formation of oligomers from deoxynucleotides, catalyzed by Na(+)-montmorillonite, was investigated with special attention given to the effect of the monomer structure on the phosphodiester bond formation. It was found that adenine deoxynucleotides bind more strongly to montmorillonite than do the corresponding ribonucleotides and thymidine nucleotides. Tetramers of 2-prime-dpA were detected in the reaction of 2-prime-d-5-prime-AMP with a water-soluble carbodiimide EDAC in the presence of Na(+)-montmorillonite, illustrating the possible role of minerals in the formation of biopolymers on the primitive earth.

PSYM-WIDE: A Survey for Large-separation Planetary-mass Companions to Late Spectral Type Members of Young Moving Groups

NASA Astrophysics Data System (ADS)

Naud, Marie-Eve; Artigau, Étienne; Doyon, René; Malo, Lison; Gagné, Jonathan; Lafrenière, David; Wolf, Christian; Magnier, Eugene A.

2017-09-01

We present the results of a direct imaging survey for very large separation (>100 au), low-mass companions around 95 nearby young K5-L5 stars and brown dwarfs. They are high-likelihood candidates or confirmed members of the young (≲150 Myr) β Pictoris and AB Doradus moving groups (ABDMG) and the TW Hya, Tucana-Horologium, Columba, Carina, and Argus associations. Images in I\\prime and z\\prime filters were obtained with the Gemini Multi-Object Spectrograph (GMOS) on Gemini South to search for companions down to an apparent magnitude of z\\prime ˜ 22-24 at separations ≳20″ from the targets and in the remainder of the wide 5.‧5 × 5.‧5 GMOS field of view. This allowed us to probe the most distant region where planetary-mass companions could be gravitationally bound to the targets. This region was left largely unstudied by past high-contrast imaging surveys, which probed much closer-in separations. This survey led to the discovery of a planetary-mass (9-13 {M}{Jup}) companion at 2000 au from the M3V star GU Psc, a highly probable member of ABDMG. No other substellar companions were identified. These results allowed us to constrain the frequency of distant planetary-mass companions (5-13 {M}{Jup}) to {0.84}-0.66+6.73% (95% confidence) at semimajor axes between 500 and 5000 au around young K5-L5 stars and brown dwarfs. This is consistent with other studies suggesting that gravitationally bound planetary-mass companions at wide separations from low-mass stars are relatively rare.

Water Egress

NASA Image and Video Library

1965-07-21

S65-39907 (21 July 1965) --- Prime crew for the Gemini-Titan 5 (GT-5) spaceflight, astronauts Charles Conrad Jr. (in water) and L. Gordon Cooper Jr. (in raft) practice survival techniques following successful egress from their Gemini Static Article 5 spacecraft in the Gulf of Mexico. Cooper is command pilot and Conrad is pilot for the GT-5 mission.

Water evaporation from substrate tooth surface during dentin treatments.

PubMed

Kusunoki, Mizuho; Itoh, Kazuo; Gokan, Yuka; Nagai, Yoshitaka; Tani, Chihiro; Hisamitsu, Hisashi

2011-01-01

The purpose of this study was to evaluate changes in the quantity of water evaporation from tooth surfaces. The amount of water evaporation was measured using Multi probe adapter MPA5 and Tewameter TM300 (Courage+Khazaka Electric GmbH, Köln, Germany) after acid etching and GM priming of enamel; and after EDTA conditioning and GM priming of dentin. The results indicated that the amount of water evaporation from the enamel surface was significantly less than that from the dentin. Acid etching did not affect the water evaporation from enamel, though GM priming significantly decreased the evaporation (83.48 ± 15.14% of that before priming). The evaporation from dentin was significantly increased by EDTA conditioning (131.38 ± 42.08% of that before conditioning) and significantly reduced by GM priming (80.26 ± 7.43% of that before priming). It was concluded that dentin priming reduced water evaporation from the dentin surface.

The effect of nonenzymatic glycation on the stability and conformation of two deoxyoligonucleotide duplexes: a spectroscopic analysis by circular dichroism.

PubMed

Dutta, Udayan; Cohenford, Menashi A; Dain, Joel A

2007-01-15

Advanced glycation end products (AGEs) play a significant role in the pathophysiology of diabetes leading to such conditions as atherosclerosis, cataract formation, and renal dysfunction. While the formation of nucleoside AGEs was previously demonstrated, no extensive studies have been performed to assess the effect of AGEs on DNA structure and folding. The objective of this study was to investigate the nonenzymatic glycation of two DNA oligonucleotide duplexes with one duplex consisting of deoxy-poly(A)15 and deoxy-poly(T)15 and the other consisting of deoxy-poly(GA)15 and deoxy-poly(CT)15. With D-glucose, D-galactose, D/L-glyceraldehyde, and D-glucosamine serving as the model glycating carbohydrates, D-glucosamine was found to exhibit the greatest effect on the stability and structure of the oligonucleotide duplexes, a finding that was confirmed by circular dichroism. The nonenzymatic glycation of deoxy-poly(AT) by D-glucosamine destabilized the deoxy-poly(AT) structure and changed its conformation from A form to X form. D-glucosamine also altered the conformation of deoxy-poly(GA)15 and deoxy-poly(CT)15 from A form to B form. Capillary electrophoresis and ultraviolet and fluorescence spectroscopy revealed that, of the various purines and pyrimidines, 2'-deoxyguanosine and guanine were most reactive with D-glucosamine. The nonenzymatic modification of nucleic acids warrants further investigation because this phenomenon may occur in vivo, altering DNA structure and/or function.

48 CFR 1449.107 - Audit of prime contract settlement proposals and subcontract settlements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Audit of prime contract settlement proposals and subcontract settlements. 1449.107 Section 1449.107 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR CONTRACT MANAGEMENT TERMINATION OF CONTRACTS General Principles 1449...

Skylab 2 prime crew suit up during prelaunch training activity

NASA Image and Video Library

1973-05-08

S73-25399 (8 May 1973) --- Astronaut Paul J. Weitz, prime crew pilot of the first manned Skylab mission, is suited up in Bldg. 5 at Johnson Space Center (JSC) during prelaunch training activity. He is assisted by astronaut Charles Conrad, Jr., prime crew commander. The man in the left background is wearing a face mask to insure that Conrad, Joseph Kerwin and Weitz are not exposed to disease prior to launch. Photo credit: NASA

Sprague-Dawley and Fischer female rats differ in acute effects of fluoxetine on sexual behavior.

PubMed

Miryala, Chandra Suma J; Hiegel, Cindy; Uphouse, Lynda

2013-02-01

The selective serotonin reuptake inhibitor (SSRI), fluoxetine, leads to sexual dysfunction in a substantial proportion of women. In studies with the Fischer inbred rat, the 5-HT(1A) receptor has been implicated in this sexual dysfunction. Whether this association with 5-HT(1A) receptors holds for other rat strains is not known. The effects of acute fluoxetine on sexual behavior in two strains of rats that differ in their response to a 5-HT(1A) receptor agonist were examined. Whether the strain difference is comparable in naturally cycling and hormonally primed, ovariectomized rats was determined. Proestrous rats and ovariectomized rats, hormonally primed with estradiol benzoate and progesterone, were treated with varying doses of fluoxetine. Sexual behavior was examined before and after treatment with the SSRI. Lordosis to mount ratios, lordosis quality, and proceptive behaviors were quantified. Sprague-Dawley and Fischer females were compared on each of these measures. The IC(50) for inhibition of lordosis behavior was determined. In both the intact and the hormonally primed, ovariectomized model, Sprague-Dawley females were less sensitive to the effects of fluoxetine on sexual behavior. In both groups, fluoxetine showed dose dependency in behavioral inhibition, but a higher dose was required for Sprague-Dawley than for Fischer females. Naturally cycling, proestrous rats required a higher dose of fluoxetine than hormonally primed ovariectomized rats to produce significant inhibition of sexual behavior. Thus, the strain difference in the response to fluoxetine does not parallel strain differences in the response to a 5-HT(1A) receptor agonist. Acute treatment with fluoxetine inhibits lordosis behavior in both Fischer and Sprague-Dawley females and the strain difference cannot be explained by reported strain differences in the response to a 5-HT(1A) receptor agonist. Fluoxetine's inhibition of female rat sexual behavior may involve effects of the SSRI in addition to activation of the 5-HT(1A) receptor. © 2012 International Society for Sexual Medicine.

Sprague-Dawley and Fischer Female Rats Differ in Acute Effects of Fluoxetine on Sexual Behavior

PubMed Central

Miryala, C.S.J.; Hiegel, C.; Uphouse, L.

2012-01-01

Introduction The selective serotonin reuptake inhibitor (SSRI), fluoxetine, leads to sexual dysfunction in a substantial proportion of women. In studies with the Fischer inbred rat, the 5-HT1A receptor has been implicated in this sexual dysfunction. Whether this association with 5-HT1A receptors holds for other rat strains is not known. Aim The effects of acute fluoxetine on sexual behavior in two strains of rats that differ in their response to a 5-HT1A receptor agonist were examined. Whether the strain difference is comparable in naturally cycling and hormonally primed, ovariectomized rats was determined. Main Outcome Measures Lordosis to mount ratios, lordosis quality, and proceptive behaviors were quantified. Sprague-Dawley and Fischer females were compared on each of these measures. The IC50 for inhibition of lordosis behavior was determined. Methods Proestrous rats and ovariectomized rats, hormonally primed with estradiol benzoate and progesterone, were treated with varying doses of fluoxetine. Sexual behavior was examined before and after treatment with the SSRI. Results In both the intact and the hormonally-primed, ovariectomized model, Sprague-Dawley females were less sensitive to the effects of fluoxetine on sexual behavior. In both groups, fluoxetine showed dose-dependency in behavioral inhibition, but a higher dose was required for Sprague-Dawley than for Fischer females. Naturally cycling, proestrous rats required a higher dose of fluoxetine than hormonally-primed ovariectomized rats to produce significant inhibition of sexual behavior. Thus, the strain difference in the response to fluoxetine does not parallel strain differences in the response to a 5-HT1A receptor agonist. Conclusions Acute treatment with fluoxetine inhibits lordosis behavior in both Fischer and Sprague-Dawley females and the strain difference cannot be explained by reported strain differences in the response to a 5-HT1A receptor agonist. Fluoxetine’s inhibition of female rat sexual behavior may involve effects of the SSRI in addition to activation of the 5-HT1A receptor. PMID:23110651

Enhanced Control of Pathogenic Simian Immunodeficiency Virus SIVmac239 Replication in Macaques Immunized with an Interleukin-12 Plasmid and a DNA Prime-Viral Vector Boost Vaccine Regimen ▿ §

PubMed Central

Winstone, Nicola; Wilson, Aaron J.; Morrow, Gavin; Boggiano, Cesar; Chiuchiolo, Maria J.; Lopez, Mary; Kemelman, Marina; Ginsberg, Arielle A.; Mullen, Karl; Coleman, John W.; Wu, Chih-Da; Narpala, Sandeep; Ouellette, Ian; Dean, Hansi J.; Lin, Feng; Sardesai, Niranjan Y.; Cassamasa, Holly; McBride, Dawn; Felber, Barbara K.; Pavlakis, George N.; Schultz, Alan; Hudgens, Michael G.; King, C. Richter; Zamb, Timothy J.; Parks, Christopher L.; McDermott, Adrian B.

2011-01-01

DNA priming has previously been shown to elicit augmented immune responses when administered by electroporation (EP) or codelivered with a plasmid encoding interleukin-12 (pIL-12). We hypothesized that the efficacy of a DNA prime and recombinant adenovirus 5 boost vaccination regimen (DNA/rAd5) would be improved when incorporating these vaccination strategies into the DNA priming phase, as determined by pathogenic simian immunodeficiency virus SIVmac239 challenge outcome. The whole SIVmac239 proteome was delivered in 5 separate DNA plasmids (pDNA-SIV) by EP with or without pIL-12, followed by boosting 4 months later with corresponding rAd5-SIV vaccine vectors. Remarkably, after repeated low-dose SIVmac239 mucosal challenge, we demonstrate 2.6 and 4.4 log reductions of the median SIV peak and set point viral loads in rhesus macaques (RMs) that received pDNA-SIV by EP with pIL-12 compared to the median peak and set point viral loads in mock-immunized controls (P < 0.01). In 5 out of 6 infected RMs, strong suppression of viremia was observed, with intermittent “blips” in virus replication. In 2 RMs, we could not detect the presence of SIV RNA in tissue and lymph nodes, even after 13 viral challenges. RMs immunized without pIL-12 demonstrated a typical maximum of 1.5 log reduction in virus load. There was no significant difference in the overall magnitude of SIV-specific antibodies or CD8 T-cell responses between groups; however, pDNA delivery by EP with pIL-12 induced a greater magnitude of SIV-specific CD4 T cells that produced multiple cytokines. This vaccine strategy is relevant for existing vaccine candidates entering clinical evaluation, and this model may provide insights into control of retrovirus replication. PMID:21734035

The interrelationship between muscle oxygenation, muscle activation, and pulmonary oxygen uptake to incremental ramp exercise: influence of aerobic fitness.

PubMed

Boone, Jan; Barstow, Thomas J; Celie, Bert; Prieur, Fabrice; Bourgois, Jan

2016-01-01

We investigated whether muscle and ventilatory responses to incremental ramp exercise would be influenced by aerobic fitness status by means of a cross-sectional study with a large subject population. Sixty-four male students (age: 21.2 ± 3.2 years) with a heterogeneous peak oxygen uptake (51.9 ± 6.3 mL·min(-1)·kg(-1), range 39.7-66.2 mL·min(-1)·kg(-1)) performed an incremental ramp cycle test (20-35 W·min(-1)) to exhaustion. Breath-by-breath gas exchange was recorded, and muscle activation and oxygenation were measured with surface electromyography and near-infrared spectroscopy, respectively. The integrated electromyography (iEMG), mean power frequency (MPF), deoxygenated [hemoglobin and myoglobin] (deoxy[Hb+Mb]), and total[Hb+Mb] responses were set out as functions of work rate and fitted with a double linear function. The respiratory compensation point (RCP) was compared and correlated with the breakpoints (BPs) (as percentage of peak oxygen uptake) in muscle activation and oxygenation. The BP in total[Hb+Mb] (83.2% ± 3.0% peak oxygen uptake) preceded (P < 0.001) the BP in iEMG (86.7% ± 4.0% peak oxygen uptake) and MPF (86.3% ± 4.1% peak oxygen uptake), which in turn preceded (P < 0.01) the BP in deoxy[Hb+Mb] (88.2% ± 4.5% peak oxygen uptake) and RCP (87.4% ± 4.5% peak oxygen uptake). Furthermore, the peak oxygen uptake was significantly (P < 0.001) positively correlated to the BPs and RCP, indicating that the BPs in total[Hb+Mb] (r = 0.66; P < 0.001), deoxy[Hb+Mb] (r = 0.76; P < 0.001), iEMG (r = 0.61; P < 0.001), MPF (r = 0.63; P < 0.001), and RCP (r = 0.75; P < 0.001) occurred at a higher percentage of peak oxygen uptake in subjects with a higher peak oxygen uptake. In this study a close relationship between muscle oxygenation, activation, and pulmonary oxygen uptake was found, occurring in a cascade of events. In subjects with a higher aerobic fitness level this cascade occurred at a higher relative intensity.

The effect on quadruplex stability of North-Nucleoside derivatives in the loops of the thrombin-binding aptamer

PubMed Central

Mazzini, Stefania; Ferreira, Ruben; Gargallo, Raimundo; Marquez, Victor E.

2012-01-01

Modified thrombin-binding aptamers (TBAs) carrying uridine (U), 2′-deoxy-2′-fluorouridine (FU) and North-methanocarbathymidine (NT) residues in the loop regions were synthesized and analyzed by UV thermal denaturation experiments and CD spectroscopy. The replacement of thymidines in the TGT loop by U and FU results in an increased stability of the antiparallel quadruplex structure described for the TBA while the presence of NT residues in the same positions destabilizes the antiparallel structure. The substitution of the thymidines in the TT loops for U, FU and NT induce a destabilization of the antiparallel quadruplex, indicating the crucial role of these positions. NMR studies on TBAs modified with uridines at the TGT loop also confirm the presence of the antiparallel quadruplex structure. Nevertheless, replacement of two Ts in the TT loops by uridine gives a more complex scenario in which the antiparallel quadruplex structure is present along with other partially unfolded species or aggregates. PMID:22727781

Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase.

PubMed

Godoy, Andre S; Lima, Gustavo M A; Oliveira, Ketllyn I Z; Torres, Naiara U; Maluf, Fernando V; Guido, Rafael V C; Oliva, Glaucius

2017-03-27

The current Zika virus (ZIKV) outbreak became a global health threat of complex epidemiology and devastating neurological impacts, therefore requiring urgent efforts towards the development of novel efficacious and safe antiviral drugs. Due to its central role in RNA viral replication, the non-structural protein 5 (NS5) RNA-dependent RNA-polymerase (RdRp) is a prime target for drug discovery. Here we describe the crystal structure of the recombinant ZIKV NS5 RdRp domain at 1.9 Å resolution as a platform for structure-based drug design strategy. The overall structure is similar to other flaviviral homologues. However, the priming loop target site, which is suitable for non-nucleoside polymerase inhibitor design, shows significant differences in comparison with the dengue virus structures, including a tighter pocket and a modified local charge distribution.

Religious Priming: A Meta-Analysis With a Focus on Prosociality.

PubMed

Shariff, Azim F; Willard, Aiyana K; Andersen, Teresa; Norenzayan, Ara

2016-02-01

Priming has emerged as a valuable tool within the psychological study of religion, allowing for tests of religion's causal effect on a number of psychological outcomes, such as prosocial behavior. As the literature has grown, questions about the reliability and boundary conditions of religious priming have arisen. We use a combination of traditional effect-size analyses, p-curve analyses, and adjustments for publication bias to evaluate the robustness of four types of religious priming (Analyses 1-3), review the empirical evidence for religion's effect specifically on prosocial behavior (Analyses 4-5), and test whether religious-priming effects generalize to individuals who report little or no religiosity (Analyses 6-7). Results across 93 studies and 11,653 participants show that religious priming has robust effects across a variety of outcome measures-prosocial measures included. Religious priming does not, however, reliably affect non-religious participants-suggesting that priming depends on the cognitive activation of culturally transmitted religious beliefs. © 2015 by the Society for Personality and Social Psychology, Inc.

Combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost generate H5 hemagglutinin specific broad neutralizing antibodies

PubMed Central

Wang, Guiqin; Yin, Renfu; Zhou, Paul; Ding, Zhuang

2017-01-01

Hemagglutinin (HA) head has long been considered to be able to elicit only a narrow, strain-specific antibody response as it undergoes rapid antigenic drift. However, we previously showed that a heterologous prime-boost strategy, in which mice were primed twice with DNA encoding HA and boosted once with virus-like particles (VLP) from an H5N1 strain A/Thailand/1(KAN)-1/2004 (noted as TH DDV), induced anti-head broad cross-H5 neutralizing antibody response. To explain why TH DDV immunization could generate such breadth, we systemically compared the neutralization breadth and potency between TH DDV sera and immune sera elicited by TH DDD (three times of DNA immunizations), TH VVV (three times of VLP immunizations), TH DV (one DNA prime plus one VLP boost) and TK DDV (plasmid DNA and VLP derived from another H5N1 strain, A/Turkey/65596/2006). Then we determined the antigenic sites (AS) on TH HA head and the key residues of the main antigenic site. Through the comparison of different regiments, we found that the combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost caused that TH DDV immunization generate broad neutralizing antibodies. Antigenic analysis showed that TH DDV, TH DV, TH DDD and TH VVV sera recognize the common antigenic site AS1. Antibodies directed to AS1 contribute to the largest proportion of the neutralizing activity of these immune sera. Residues 188 and 193 in AS1 are the key residues which are responsible for neutralization breadth of the immune sera. Interestingly, residues 188 and 193 locate in classical antigen sites but are relatively conserved among the 16 tested strains and 1,663 HA sequences from NCBI database. Thus, our results strongly indicate that it is feasible to develop broad cross-H5 influenza vaccines against HA head. PMID:28542275

ALLOPREGNANOLONE’S ATTENUATION OF THE LORDOSIS-INHIBITNG EFFECTS OF RESTRAINT IS BLOCKED BY THE ANTIPROGESTIN, CDB-4124

PubMed Central

Uphouse, Lynda; Hiegel, Cindy

2014-01-01

A brief restraint experience reduces lordosis behavior in ovariectomized females that have been hormonally primed with estradiol benzoate. The addition of progesterone to the priming prevents the lordosis inhibition. Based on prior studies with an inhibitor of progesterone metabolism, we have implicated the intracellular progesterone receptor, rather than progesterone metabolites, as responsible for this protection. However, the progesterone metabolite, allopregnanolone (3α-hydroxy-5α-pregnan-20-one), also prevents lordosis inhibition after restraint. In a prior study, we reported that the progestin receptor antagonist, RU486 (11β-(4-dimethylamino)phenyl-17β-hydroxy-17-(1-propynyl)estra-4,9-dien-3-one), attenuated the effect of allopregnanolone. Because RU486 can also block the glucocorticoid receptor, in the current studies, we evaluated the effect of the progestin receptor antagonist, CDB-4124 (17 α-acetoxy-21-methoxy-11β-[4-N,N-dimethyaminopheny]-19-norpregna-4,9-dione-3,20-dione), which is relatively devoid of antiglucocorticoid activity. Ovariectomized, Fischer rats were injected with 10 μg estradiol benzoate. Two days later, rats received either 60 mg/kg CDB-4124 or the 20% DMSO/propylene glycol vehicle 1 hr before injection with 4 mg/kg allopregnanolone. After a pretest to confirm sexual receptivity, rats were restrained for 5 min and immediately tested for sexual behavior. Lordosis behavior was reduced by the restraint and attenuated by allopregnanolone. Pretreatment with CDB-4124 reduced allopregnanolone’s effect. These findings support prior suggestions that allopreganolone reduces the response to restraint by mechanisms that require activation of the intracellular progesterone receptor. PMID:24650591

Allopregnanolone's attenuation of the lordosis-inhibiting effects of restraint is blocked by the antiprogestin, CDB-4124.

PubMed

Uphouse, Lynda; Hiegel, Cindy

2014-07-01

A brief restraint experience reduces lordosis behavior in ovariectomized females that have been hormonally primed with estradiol benzoate. The addition of progesterone to the priming prevents the lordosis inhibition. Based on prior studies with an inhibitor of progesterone metabolism, we have implicated the intracellular progesterone receptor, rather than progesterone metabolites, as responsible for this protection. However, the progesterone metabolite, allopregnanolone (3α-hydroxy-5α-pregnan-20-one), also prevents lordosis inhibition after restraint. In a prior study, we reported that the progestin receptor antagonist, RU486 (11β-(4-dimethylamino)phenyl-17β-hydroxy-17-(1-propynyl)estra-4,9-dien-3-one), attenuated the effect of allopregnanolone. Because RU486 can also block the glucocorticoid receptor, in the current studies, we evaluated the effect of the progestin receptor antagonist, CDB-4124 (17α-acetoxy-21-methoxy-11β-[4-N,N-dimethyaminopheny]-19-norpregna-4,9-dione-3,20-dione), which is relatively devoid of antiglucocorticoid activity. Ovariectomized, Fischer rats were injected with 10 μg estradiol benzoate. Two days later, rats received either 60 mg/kg CDB-4124 or 20% DMSO/propylene glycol vehicle 1 h before injection with 4 mg/kg allopregnanolone. After a pretest to confirm sexual receptivity, rats were restrained for 5min and immediately tested for sexual behavior. Lordosis behavior was reduced by the restraint and attenuated by allopregnanolone. Pretreatment with CDB-4124 reduced allopregnanolone's effect. These findings support prior suggestions that allopreganolone reduces the response to restraint by mechanisms that require activation of the intracellular progesterone receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

Fluorescence and NMR investigations in the ligand binding properties of adenylate kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reinstein, J.; Vetter, I.R.; Schlichting, I.

A new system for measurement of affinities of adenylate kinases (AK) for substrates and inhibitors is presented. This system is based on the use of the fluorescent ligand {alpha},{omega}-di((3{prime} or 2{prime})-O-(N-methyl-anthraniloyl)adenosine-5{prime}) pentaphosphate (MAP5Am), which is an analogue of the bisubstrate inhibitor diadenosine pentaphosphate (AP5A). It allows the determination of dissociation constants for any ligand in the range of 1 {times} 10{sup {minus}9} to 5 {times} 10{sup {minus}2} M. Affinities for different bisubstrate inhibitors (AP4A, AP5A, AP6A) and substrates (AMP, ADP, ATP, GTP) were determined in the presence and absence of magnesium. An analysis of the binding of bisubstrate inhibitors ismore » proposed and applied to these data. Temperature denaturation experiments indicate that the mutant enzyme has the same thermal stability as the wild-type enzyme and, as NMR studies indicate, also a very similar structure. Together with the results obtained by Tian et al on the effect of replacement of the conserved His-36 in the cytosolic AK (AK1) from chicken by glutamine and asparagine, this shows that residues 28 of AK from E. coli (AKec) and 36 of AK1 are situated in a comparable environment and are not essential for catalytic activity.« less

Associating Fast Radio Bursts with Their Host Galaxies

NASA Astrophysics Data System (ADS)

Eftekhari, T.; Berger, E.

2017-11-01

The first precise localization of a fast radio burst (FRB) sheds light on the nature of these mysterious bursts and the physical mechanisms that power them. Increasing the sample of FRBs with robust host galaxy associations is the key impetus behind ongoing and upcoming searches and facilities. Here, we quantify the robustness of FRB host galaxy associations as a function of localization area and galaxy apparent magnitude. We also explore the use of FRB dispersion measures to constrain the source redshift, thereby reducing the number of candidate hosts. We use these results to demonstrate that even in the absence of a unique association, a constraint can be placed on the maximum luminosity of a host galaxy as a function of localization and dispersion measure (DM). We find that localizations of ≲ 0.5\\text{'}\\text{'} are required for a chance coincidence probability of ≲ 1 % for dwarf galaxies at z≳ 0.1; if some hosts have luminosities of ˜ {L}\\ast , then localizations of up to ≈ 5\\prime\\prime may suffice at z˜ 0.1. Constraints on the redshift from the DM only marginally improve the association probability unless the DM is low, ≲ 400 pc cm-3. This approach also relies on the determination of galaxy redshifts, which is challenging at z≳ 0.5 if the hosts are dwarf galaxies. Finally, interesting limits on the maximum host luminosity require localizations of ≲ 5\\prime\\prime at z≳ 0.1. Even a few such localizations will explain the nature of FRB progenitors, their possible diversity, and their use as cosmological tools.

WATER EGRESS

NASA Image and Video Library

1965-07-16

S65-28459 (16 July 1965) --- Astronaut Neil A. Armstrong, command pilot for the Gemini-5 backup crew, inside the Gemini Static Article 5 spacecraft prior to water egress training in the Gulf of Mexico. The training is part of the prelaunch schedule for prime and backup crew on the Gemini-5 mission.

Effects of heat treating PM Rene' 95 slightly below the gamma' solvus

NASA Technical Reports Server (NTRS)

Dreshfield, R. L.

1977-01-01

An investigation was performed on as-hot-isostatically-pressed (As-HIP) Rene' 95 to obtain additional information on the variation of the amount of gamma prime with solutioning temperatures near the gamma prime solvus temperature and the resulting effects on tensile and stress rupture strength of As-HIP Rene' 95. The amount of gamma prime phase was found to increase at a rate of about 0.5% per degree Celsius as the temperature decreased from the solvus temperature to about 50 C below the gamma prime solvus temperature. The change in the amount of gamma prime phase with decreasing solutioning temperature was observed to be primarily associated with decreasing solubilities of Al+Ti+Nb and increasing solubility of Cr in the gamma phase.

NMR studies of two spliced leader RNAs using isotope labeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapham, J.; Crothers, D.M.

1994-12-01

Spliced leader RNAs are a class of RNA molecules (<200 nts) involved in the trans splicing of messenger RNA found in trypanosomes, nematodes, and other lower eukaryotes. The spliced leader RNA from the trypanosome Leptomonas Collosoma exists in two alternate structural forms with similar thermal stabilities. The 54 nucleotides on the 5{prime} end of the SL molecule is structurally independent from the 3{prime} half of the RNA, and displays the two structural forms. Furthermore, the favored of the two structures was shown to contain anomalous nuclease sensitivity and thermal stability features, which suggests that there may be tertiary interactions betweenmore » the splice site and other nucleotides in the 5{prime} end. Multidimensional NMR studies are underway to elucidate the structural elements present in the SL RNAs that give rise to their physical properties. Two spliced leader sequences have been studied. The first, the 54 nucleotides on the 5{prime} end of the L. Collosoma sequence, was selected because of earlier studies in our laboratory. The second sequence is the 5{prime} end of the trypanosome Crithidia Fasciculata, which was chosen because of its greater sequence homology to other SL sequences. Given the complexity of the NMR spectra for RNA molecules of this size, we have incorporated {sup 15}N/{sup 13}C-labeled nucleotides into the RNA. One of the techniques we have developed to simplify the spectra of these RNA molecules is isotope labeling of specific regions of the RNA. This has been especially helpful in assigning the secondary structure of molecules that may be able to adopt multiple conformations. Using this technique one can examine a part of the molecule without spectral interference from the unlabeled portion. We hope this approach will promote an avenue for studying the structure of larger RNAs in their native surroundings.« less

FDG-PET/CT in the evaluation of anal carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cotter, Shane E.; Medical Scientist Training Program, Washington University School of Medicine, St. Louis, MO; Grigsby, Perry W.

2006-07-01

Purpose: Surgical staging and treatment of anal carcinoma has been replaced by noninvasive staging studies and combined modality therapy. In this study, we compare computed tomography (CT) and physical examination to [{sup 18}F]-fluoro-2-deoxy-D-glucose-positron emission tomography/computed tomography (FDG-PET/CT) in the staging of carcinoma of the anal canal, with special emphasis on determination of spread to inguinal lymph nodes. Methods and Materials: Between July 2003 and July 2005, 41 consecutive patients with biopsy-proved anal carcinoma underwent a complete staging evaluation including physical examination, CT, and 2-FDG-PET/CT. Patients ranged in age from 30 to 89 years. Nine men were HIV-positive. Treatment was withmore » standard Nigro regimen. Results: [{sup 18}F]-fluoro-2-deoxy-D-glucose-positron emission tomography/computed tomography (FDG-PET/CT) detected 91% of nonexcised primary tumors, whereas CT visualized 59%. FDG-PET/CT detected abnormal uptake in pelvic nodes of 5 patients with normal pelvic CT scans. FDG-PET/CT detected abnormal nodes in 20% of groins that were normal by CT, and in 23% without abnormality on physical examination. Furthermore, 17% of groins negative by both CT and physical examination showed abnormal uptake on FDG-PET/CT. HIV-positive patients had an increased frequency of PET-positive lymph nodes. Conclusion: [{sup 18}F]-fluoro-2-deoxy-D-glucose-positron emission tomography/computed tomography detects the primary tumor more often than CT. FDG-PET/CT detects substantially more abnormal inguinal lymph nodes than are identified by standard clinical staging with CT and physical examination.« less

GLUT4 Is Not Necessary for Overload-Induced Glucose Uptake or Hypertrophic Growth in Mouse Skeletal Muscle

PubMed Central

McMillin, Shawna L.; Schmidt, Denise L.; Kahn, Barbara B.

2017-01-01

GLUT4 is necessary for acute insulin- and contraction-induced skeletal muscle glucose uptake, but its role in chronic muscle loading (overload)-induced glucose uptake is unknown. Our goal was to determine whether GLUT4 is required for overload-induced glucose uptake. Overload was induced in mouse plantaris muscle by unilateral synergist ablation. After 5 days, muscle weights and ex vivo [3H]-2-deoxy-d-glucose uptake were assessed. Overload-induced muscle glucose uptake and hypertrophic growth were not impaired in muscle-specific GLUT4 knockout mice, demonstrating that GLUT4 is not necessary for these processes. To assess which transporters mediate overload-induced glucose uptake, chemical inhibitors were used. The facilitative GLUT inhibitor cytochalasin B, but not the sodium-dependent glucose cotransport inhibitor phloridzin, prevented overload-induced uptake demonstrating that GLUTs mediate this effect. To assess which GLUT, hexose competition experiments were performed. Overload-induced [3H]-2-deoxy-d-glucose uptake was not inhibited by d-fructose, demonstrating that the fructose-transporting GLUT2, GLUT5, GLUT8, and GLUT12 do not mediate this effect. To assess additional GLUTs, immunoblots were performed. Overload increased GLUT1, GLUT3, GLUT6, and GLUT10 protein levels twofold to fivefold. Collectively, these results demonstrate that GLUT4 is not necessary for overload-induced muscle glucose uptake or hypertrophic growth and suggest that GLUT1, GLUT3, GLUT6, and/or GLUT10 mediate overload-induced glucose uptake. PMID:28279980

Unraveling Massive Crocins Transport and Accumulation through Proteome and Microscopy Tools during the Development of Saffron Stigma

PubMed Central

Gómez-Gómez, Lourdes; Parra-Vega, Verónica; Rivas-Sendra, Alba; Seguí-Simarro, Jose M.; Molina, Rosa Victoria; Pallotti, Claudia; Rubio-Moraga, Ángela; Diretto, Gianfranco; Prieto, Alicia; Ahrazem, Oussama

2017-01-01

Crocins, the glucosides of crocetin, are present at high concentrations in saffron stigmas and accumulate in the vacuole. However, the biogenesis of the saffron chromoplast, the changes during the development of the stigma and the transport of crocins to the vacuole, are processes that remain poorly understood. We studied the process of chromoplast differentiation in saffron throughout stigma development by means of transmission electron microscopy. Our results provided an overview of a massive transport of crocins to the vacuole in the later developmental stages, when electron dense drops of a much greater size than plastoglobules (here defined “crocinoplast”) were observed in the chromoplast, connected to the vacuole with a subsequent transfer of these large globules inside the vacuole. A proteome analysis of chromoplasts from saffron stigma allowed the identification of several well-known plastid proteins and new candidates involved in crocetin metabolism. Furthermore, expressions throughout five developmental stages of candidate genes responsible for carotenoid and apocarotenoid biogenesis, crocins transport to the vacuole and starch metabolism were analyzed. Correlation matrices and networks were exploited to identify a series of transcripts highly associated to crocetin (such as 1-Deoxy-d-xylulose 5-phosphate synthase (DXS), 1-Deoxy-d-xylulose 5-phosphate reductoisomerase (DXR), carotenoid isomerase (CRTISO), Crocetin glucosyltransferase 2 (UGT2), etc.) and crocin (e.g., ζ-carotene desaturase (ZDS) and plastid-lipid-associated proteins (PLAP2)) accumulation; in addition, candidate aldehyde dehydrogenase (ADH) genes were highlighted. PMID:28045431

Molecular cloning and functional characterization of a glucose transporter (CsGLUT) in Clonorchis sinensis.

PubMed

Ahn, Seong Kyu; Cho, Pyo Yun; Na, Byoung-Kuk; Hong, Sung-Jong; Nam, Ho-Woo; Sohn, Woon-Mok; Ardelli, Bernadette F; Park, Yun-Kyu; Kim, Tong-Soo; Cha, Seok Ho

2016-01-01

A complementary DNA (cDNA) encoding a glucose transporter of Clonorchis sinensis (CsGLUT) was isolated from the adult C. sinensis cDNA library. The open reading frame of CsGLUT cDNA consists of 1653 base pairs that encode a 550-amino acid residue protein. Hydropathy analysis suggested that CsGLUT possess 12 putative membrane-spanning domains. The Northern blot analysis result using poly(A)(+)RNA showed a strong band at ~2.1 kb for CsGLUT. When expressed in Xenopus oocytes, CsGLUT mediated the transport of radiolabeled deoxy-D-glucose in a time-dependent but sodium-independent manner. Concentration-dependency results showed saturable kinetics and followed the Michaelis-Menten equation. Nonlinear regression analyses yielded a Km value of 588.5 ± 53.0 μM and a Vmax value of 1500.0 ± 67.5 pmol/oocyte/30 min for [1,2-(3)H]2-deoxy-D-glucose. No trans-uptakes of bile acid (taurocholic acid), amino acids (tryptophan and arginine), or p-aminohippuric acid were observed. CsGLUT-mediated transport of deoxyglucose was significantly and concentration-dependently inhibited by radio-unlabeled deoxyglucose and D-glucose. 3-O-Methylglucose at 10 and 100 μM inhibited deoxyglucose uptake by ~50 % without concentration dependence. No inhibitory effects by galactose, mannose, and fructose were observed. This work may contribute to the molecular biological study of carbohydrate metabolism and new drug development of C. sinensis.

Temperature optimum of insulin-stimulated 2-deoxy-D-glucose uptake in rat adipocytes. Correlation of cellular transport with membrane spin-label and fluorescence-label data.

PubMed Central

Hyslop, P A; Kuhn, C E; Sauerheber, R D

1984-01-01

The effects of temperature alterations between 22 degrees C and 48 degrees C on basal and insulin-stimulated 2-deoxy-D-[1-14C]glucose uptake were examined in isolated rat adipocytes. A distinct optimum was found near physiological temperature for uptake in the presence of maximally effective insulin concentrations where insulin stimulation and hexose uptake were both conducted at each given assay temperature. Basal uptake was only subtly affected. Control and maximally insulin-stimulated cells incubated at 35 degrees C subsequently exhibited minimal temperature-sensitivity of uptake measured between 30 and 43 degrees C. The data are mostly consistent with the concept that insulin-sensitive glucose transporters are, after stimulation by insulin, functionally similar to basal transporters. Adipocyte plasma membranes were labelled with various spin- and fluorescence-label probes in lipid structural studies. The temperature-dependence of the order parameter S calculated from membranes labelled with 5-nitroxide stearate indicated the presence of a lipid phase change at approx. 33 degrees C. Membranes labelled with the fluorescence label 1,6-diphenylhexa-1,3,5-triene, or the cholesterol-like spin label nitroxide cholestane, reveal sharp transitions at lower temperatures. We suggest that a thermotropic lipid phase separation occurs in the adipocyte membrane that may be correlated with the temperature-dependence of hexose transport and insulin action in the intact cells. PMID:6324752

GLUT4 Is Not Necessary for Overload-Induced Glucose Uptake or Hypertrophic Growth in Mouse Skeletal Muscle.

PubMed

McMillin, Shawna L; Schmidt, Denise L; Kahn, Barbara B; Witczak, Carol A

2017-06-01

GLUT4 is necessary for acute insulin- and contraction-induced skeletal muscle glucose uptake, but its role in chronic muscle loading (overload)-induced glucose uptake is unknown. Our goal was to determine whether GLUT4 is required for overload-induced glucose uptake. Overload was induced in mouse plantaris muscle by unilateral synergist ablation. After 5 days, muscle weights and ex vivo [ 3 H]-2-deoxy-d-glucose uptake were assessed. Overload-induced muscle glucose uptake and hypertrophic growth were not impaired in muscle-specific GLUT4 knockout mice, demonstrating that GLUT4 is not necessary for these processes. To assess which transporters mediate overload-induced glucose uptake, chemical inhibitors were used. The facilitative GLUT inhibitor cytochalasin B, but not the sodium-dependent glucose cotransport inhibitor phloridzin, prevented overload-induced uptake demonstrating that GLUTs mediate this effect. To assess which GLUT, hexose competition experiments were performed. Overload-induced [ 3 H]-2-deoxy-d-glucose uptake was not inhibited by d-fructose, demonstrating that the fructose-transporting GLUT2, GLUT5, GLUT8, and GLUT12 do not mediate this effect. To assess additional GLUTs, immunoblots were performed. Overload increased GLUT1, GLUT3, GLUT6, and GLUT10 protein levels twofold to fivefold. Collectively, these results demonstrate that GLUT4 is not necessary for overload-induced muscle glucose uptake or hypertrophic growth and suggest that GLUT1, GLUT3, GLUT6, and/or GLUT10 mediate overload-induced glucose uptake. © 2017 by the American Diabetes Association.

2-Deoxy-D-glucose, not mercaptoacetate, induces a reversible reduction of body temperature in male desert hamsters (Phodopus roborovskii).

PubMed

Chi, Qing-Sheng; Li, Xiu-Juan; Wang, De-Hua

2018-01-01

The initiation of torpor is supposed to be related to the availability of metabolic fuels. Studies on metabolic fuel inhibition of glucose by using 2-deoxy-D-glucose (2DG) or fatty acid by mercaptoacetate (MA) in heterothermic mammals produced mixed outcomes. To examine the roles of availability of glucose and fatty acid in the initiation of torpor in desert hamsters (Phodopus roborovskii), we intraperitoneally administrated 2DG and MA to summer-acclimated male hamsters while body temperature (T b ), metabolic rate (MR) and respiratory quotient (RQ) were simultaneously recorded to monitor their thermoregulatory response. 2DG induced a reversible reduction of T b in desert hamsters both at ambient temperature (T a ) of 23°C and 5°C. At T a of 23°C, T b , MR and RQ decreased in a dose-dependent manner with a large T b -T a differential (> 6.5°C) and a lowest T b of 28.0°C which were comparable to those in fasted hamsters. At T a of 5°C, 2DG-treated hamsters also decreased T b to the same level as at T a 23°C, but MR was significantly higher than that at T a of 23°C at each dose, suggesting doses of 2DG directly affected the hypothalamic T b set-point. Different from fasted hamsters which maintain normothermic at T a of 5°C, 2DG-treated hamsters showed a substantial reduction of T b at T a 5°C, indic a ting an overwhelming effect on the thermoregulatory system regardless of T a . Furthermore, the rapid decrease of T b and outstretched body posture in 2DG-treated hamsters suggest that the effects of 2DG were not simply mimicking the torpor pathways but that other mechanisms are involved. Interestingly, MA failed to induce a torpor-like state in male desert hamsters. Our results suggest that availability of glucose rather than fatty acid plays an important role for initiation of torpor in desert hamsters. Copyright © 2017 Elsevier Ltd. All rights reserved.

Determination of the In Vitro and In Vivo Activity of Compounds Tested Against Punta Toro Virus

DTIC Science & Technology

1988-12-20

2 = C CC 0 E-3 o S- EU E 0. o- coq 0 0 a)U- c 2n t 0’ E iNn~ * 00C C~J c E 0 r CE 76 .I *ý 0’E-.-..- EUE -E Z5 0 - c ~c ZN’J"- to LO U)-C E cm :- ~U...suspended in 10 mM phosphate buffer, pH 6.5. Each compound was incubated with enzyme (50:1, compound to enzyme ) at 250 C for 1 hour. Development and Detection...including adenosine, guanosine, 2,6-diaminopurne(2’-deoxy)riboside, and 6-methoxypurine. Therefore, adenosine deaminase was chosen as the likely enzyme

High-affinity cannabinoid binding site in brain: A possible marijuana receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nye, J.S.

The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

Context effects in the processing of familiar faces.

PubMed

Brennen, T; Bruce, V

1991-01-01

In this paper we report five experiments that investigate the influence of prime faces upon the speed with which familiar faces are recognized and named. Previously, priming had been reported when the prime and target faces were closely associated, e.g., Prince Charles and Princess Diana (Bruce & Valentine, 1986). In Experiment 1 we show that there is a reliable effect of relatedness on a double-familiarity decision, even when the faces are only categorically related, e.g., Kirk Douglas and Clint Eastwood. Then it was shown that such an effect emerges only on a double decision task (Experiments 2 and 3). Experiment 4 showed that on a primed naming task, faces preceded by a categorically related prime were responded to more quickly than those preceded by an unrelated prime, and the effect was due to inhibition. Experiment 5 replicated this effect and also showed that when associatively related primes were used, a facilitatory, and not an inhibitory, effect is found. It is argued that the facilitation of associative priming arises at an earlier locus than the inhibition of categorial priming.

Phosphatidylinositol 4,5-bisphosphate regulates SNARE-dependent membrane fusion.

PubMed

James, Declan J; Khodthong, Chuenchanok; Kowalchyk, Judith A; Martin, Thomas F J

2008-07-28

Phosphatidylinositol 4,5-bisphosphate (PI 4,5-P(2)) on the plasma membrane is essential for vesicle exocytosis but its role in membrane fusion has not been determined. Here, we quantify the concentration of PI 4,5-P(2) as approximately 6 mol% in the cytoplasmic leaflet of plasma membrane microdomains at sites of docked vesicles. At this concentration of PI 4,5-P(2) soluble NSF attachment protein receptor (SNARE)-dependent liposome fusion is inhibited. Inhibition by PI 4,5-P(2) likely results from its intrinsic positive curvature-promoting properties that inhibit formation of high negative curvature membrane fusion intermediates. Mutation of juxtamembrane basic residues in the plasma membrane SNARE syntaxin-1 increase inhibition by PI 4,5-P(2), suggesting that syntaxin sequesters PI 4,5-P(2) to alleviate inhibition. To define an essential rather than inhibitory role for PI 4,5-P(2), we test a PI 4,5-P(2)-binding priming factor required for vesicle exocytosis. Ca(2+)-dependent activator protein for secretion promotes increased rates of SNARE-dependent fusion that are PI 4,5-P(2) dependent. These results indicate that PI 4,5-P(2) regulates fusion both as a fusion restraint that syntaxin-1 alleviates and as an essential cofactor that recruits protein priming factors to facilitate SNARE-dependent fusion.

Trainability of hemodynamic parameters: A near-infrared spectroscopy based neurofeedback study.

PubMed

Kober, Silvia Erika; Hinterleitner, Vanessa; Bauernfeind, Günther; Neuper, Christa; Wood, Guilherme

2018-05-18

We investigated the trainability of the hemodynamic response as assessed with near-infrared spectroscopy (NIRS) during one neurofeedback (NF) session. Forty-eight participants were randomly assigned to four different groups that tried to either increase or decrease oxygenated (oxy-Hb) or deoxygenated hemoglobin (deoxy-Hb) over the inferior frontal gyrus during imagery of swallowing movements. Deoxy-Hb could be successfully up-regulated while oxy-Hb could be successfully down-regulated during NF. Participants were not able to down-regulate deoxy-Hb or to up-regulate oxy-Hb. These results show that the natural course of oxy- and deoxy-Hb during movement imagery can be reinforced by providing real-time feedback of the corresponding NIRS parameter since deoxy-Hb generally increases and oxy-Hb decreases during imagery of swallowing. Furthermore, signal-to-noise ratio of deoxy-Hb but not of oxy-Hb improved during training. Our results provide new insights into the trainability of the hemodynamic response as assessed with NIRS and have an impact on the application of NIRS-based real-time feedback. Copyright © 2018 Elsevier B.V. All rights reserved.

Method for replicating an array of nucleic acid probes

DOEpatents

Cantor, C.R.; Przetakiewicz, M.; Smith, C.L.; Sano, T.

1998-08-18

The invention relates to the replication of probe arrays and methods for replicating arrays of probes which are useful for the large scale manufacture of diagnostic aids used to screen biological samples for specific target sequences. Arrays created using PCR technology may comprise probes with 5{prime}- and/or 3{prime}-overhangs. 16 figs.

Gemini 11 prime crew during water egress training in Gulf of Mexico

NASA Technical Reports Server (NTRS)

1966-01-01

Astronauts Charles Conrad Jr. (left) and Richard F. Gordon Jr. (right), prime crew for Gemini 11 space flight, practice water egress procedures in the Gulf of Mexico. Static Article 5 was used in the training exercise. A Manned Spaceflight Center (MSC) swimmer is in the water assisting in the training.

"Prime Online": Developing Grades 3-5 Teachers' Content Knowledge for Teaching Mathematics in an Online Professional Development Program

ERIC Educational Resources Information Center

Pape, Stephen J.; Prosser, Sherri K.; Griffin, Cynthia C.; Dana, Nancy Fichtman; Algina, James; Bae, Jungah

2015-01-01

This study sought to identify components of an asynchronous online teacher professional development program, "Prime Online," that potentially affected participants' mathematical knowledge for teaching (MKT). Twenty-three third- through fifth-grade general education and special education teachers completed a yearlong online teacher…

How the CCA-Adding Enzyme Selects Adenine over Cytosine at Position 76 of tRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Baocheng; Xiong, Yong; Steitz, Thomas A.

2010-11-22

CCA-adding enzymes [ATP(CTP):tRNA nucleotidyltransferases] add CCA onto the 3{prime} end of transfer RNA (tRNA) precursors without using a nucleic acid template. Although the mechanism by which cytosine (C) is selected at position 75 of tRNA has been established, the mechanism by which adenine (A) is selected at position 76 remains elusive. Here, we report five cocrystal structures of the enzyme complexed with both a tRNA mimic and nucleoside triphosphates under catalytically active conditions. These structures suggest that adenosine 5{prime}-monophosphate is incorporated onto the A76 position of the tRNA via a carboxylate-assisted, one-metal-ion mechanism with aspartate 110 functioning as a generalmore » base. The discrimination against incorporation of cytidine 5{prime}-triphosphate (CTP) at position 76 arises from improper placement of the {alpha} phosphate of the incoming CTP, which results from the interaction of C with arginine 224 and prevents the nucleophilic attack by the 3{prime} hydroxyl group of cytidine75.« less

Hippocampal metaplasticity is required for the formation of temporal associative memories.

PubMed

Xu, Jian; Antion, Marcia D; Nomura, Toshihiro; Kraniotis, Stephen; Zhu, Yongling; Contractor, Anis

2014-12-10

Metaplasticity regulates the threshold for modification of synaptic strength and is an important regulator of learning rules; however, it is not known whether these cellular mechanisms for homeostatic regulation of synapses contribute to particular forms of learning. Conditional ablation of mGluR5 in CA1 pyramidal neurons resulted in the inability of low-frequency trains of afferent activation to prime synapses for subsequent theta burst potentiation. Priming-induced metaplasticity requires mGluR5-mediated mobilization of endocannabinoids during the priming train to induce long-term depression of inhibition (I-LTD). Mice lacking priming-induced plasticity had no deficit in spatial reference memory tasks, but were impaired in an associative task with a temporal component. Conversely, enhancing endocannabinoid signaling facilitated temporal associative memory acquisition and, after training animals in these tasks, ex vivo I-LTD was partially occluded and theta burst LTP was enhanced. Together, these results suggest a link between metaplasticity mechanisms in the hippocampus and the formation of temporal associative memories. Copyright © 2014 the authors 0270-6474/14/3416762-12$15.00/0.

Attention, awareness of contingencies, and control in spatial localization: a qualitative difference approach.

PubMed

Vaquero, Joaquín M M; Fiacconi, Chris; Milliken, Bruce

2010-12-01

The qualitative difference method for distinguishing between aware and unaware processes was applied here to a spatial priming task. Participants were asked simply to locate a target stimulus that appeared in one of four locations, and this target stimulus was preceded by a prime in one of the same four locations. The prime location predicted the location of the target with high probability (p = .75), but prime and target mismatched on a task-relevant feature (identity, color). Across 5 experiments, we observed repetition costs in the absence of awareness of the contingency, and repetition benefits in the presence of awareness of the contingency. These results were particularly clear-cut in Experiment 4, in which awareness was defined by reference to self-reported strategy use. Finally, Experiment 5 showed that frequency-based implicit learning effects were present in our experiments but that these implicit learning effects were not strong enough to override repetition costs that pushed performance in the opposite direction. The results of these experiments constitute a novel application of the qualitative difference method to the study of awareness, learning of contingencies, and strategic control.

The effect of alloying on gamma and gamma prime in nickel-base superalloys

NASA Technical Reports Server (NTRS)

Dreshfield, R. L.; Wallace, J. F.

1972-01-01

An investigation was conducted to determine the compositional limits of gamma and gamma prime phases in nickel-base superalloys. Fifty-one nickel-base alloys were melted under vacuum and heat treated for 4 hours at 1190 C followed by 1008 hours at 850 C. The alloys had the following composition ranges: A1 4.0 to 13 atomic percent, Cr 6.5 to 20.5 percent, Ti 0.25 to 4.75 percent, Mo 0.0 to 6.0 percent, and W 0.0 to 4.0 percent. The residues from the ammonium sulfate electrolytic extraction for the two-phase alloys were analyzed chemically and by X-ray diffraction. The results of the investigation were used to assemble a mathematical model of the gamma-gamma prime region of the Ni-Al-Cr-Ti-Mo-W system. A computer program was written to analyze the model of the phase diagram. Some of these results are also presented graphically. The resulting model is capable of satisfactorily predicting the compositions of conjugate gamma-gamma prime phases in the alloys investigated and twelve of fifteen commercial superalloys studied.

Near-Infrared Fluorescent Deoxyglucose Analog for Tumor Optical Imaging in Cell Culture and in Living Mice

PubMed Central

Cheng, Zhen; Levi, Jelena; Xiong, Zhengming; Gheysens, Olivier; Keren, Shay; Chen, Xiaoyuan; Gambhir, Sanjiv Sam

2011-01-01

2-deoxy-2-[18F]fluoro-d-glucose ([18F]FDG) has extensively been used for clinical diagnosis, staging and therapy monitoring of cancer and other diseases. Non-radioactive glucose analogs enabling the screening of the glucose metabolic rate of tumors are of particular interest for anticancer drug development. A non-radioactive fluorescent deoxyglucose analog may have many applications for both imaging of tumors and monitoring therapeutic efficacy of drugs in living animals and may eventually translate to clinical applications. We found that a fluorescent 2-deoxyglucose analog, 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-d-glucose (2-NBDG) can be delivered in several tumor cells via the glucose transporters (GLUTs). We therefore conjugated d-glucosamine with a near-infrared (NIR) fluorphor Cy5.5 and tested the feasibility of Cy5.5-d-glucosamine conjugate (Cy5.5-2DG) for NIR fluorescence imaging of tumors in a pre-clinical xenograft animal model. Cy5.5-2DG was prepared by conjugating Cy5.5 monofunctional N-hydroxysuccinimide ester (Cy5.5-NHS) and d-glucosamine followed by high-performance liquid chromatography purification. The accumulation of Cy5.5-2DG and Cy5.5-NHS in different tumor cell lines at 37 °C and 4 °C were imaged using a fluorescence microscope. Tumor targeting and retention of Cy5.5-2DG and Cy5.5-NHS in a subcutaneous U87MG glioma and A375M melanoma tumor model were evaluated and quantified by a Xenogen IVIS 200 optical cooled charged-coupled device system. Fluorescence microscopy imaging shows that Cy5.5-2DG and Cy5.5-NHS are taken up and trapped by a variety of tumor cell lines at 37 °C incubation, while they exhibit marginal uptake at 4 °C. The tumor cell uptake of Cy5.5-2DG can not be blocked by the 50 mM d-glucose, suggesting that Cy5.5-2DG may not be delivered in tumor cells by GLUTs. U87MG and A375M tumor localization were clearly visualized in living mice with both NIR fluorescent probes. Tumor/muscle contrast was clearly visible as early as 30 min post-injection, and the highest U87MG tumor/muscle ratio of 2.81 ± 0.10, 3.34 ± 0.23 were achieved 24 hours post-injection for Cy5.5-2DG and Cy5.5-NHS, respectively. While as a comparison, the micro-positron emission tomography imaging study shows that [18F]FDG preferentially localize to the U87MG tumor, with resulting tumor/muscle ratios ranging from 3.89 to 4.08 after 30 min to 2 h post-administration of the probe. In conclusion, the NIR fluorescent glucose analog, Cy5.5-2DG and Cy5.5-NHS both demonstrate tumor targeting abilities in cell culture and in living mice. More studies are warranted to further explore their application for optical tumor imaging. In order to develop NIR glucose analog with ability to targeting GLUTs/hexokinase, it is highly important to select NIR dyes with reasonable molecular size. PMID:16704203

Light and Fungal Elicitor Induce 3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthase mRNA in Suspension Cultured Cells of Parsley (Petroselinum crispum L.) 1

PubMed Central

Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.

1992-01-01

Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708

Replicable effects of primes on human behavior.

PubMed

Payne, B Keith; Brown-Iannuzzi, Jazmin L; Loersch, Chris

2016-10-01

[Correction Notice: An Erratum for this article was reported online in Journal of Experimental Psychology: General on Oct 31 2016 (see record 2016-52334-001). ] The effect of primes (i.e., incidental cues) on human behavior has become controversial. Early studies reported counterintuitive findings, suggesting that primes can shape a wide range of human behaviors. Recently, several studies failed to replicate some earlier priming results, raising doubts about the reliability of those effects. We present a within-subjects procedure for priming behavior, in which participants decide whether to bet or pass on each trial of a gambling game. We report 6 replications (N = 988) showing that primes consistently affected gambling decisions when the decision was uncertain. Decisions were influenced by primes presented visibly, with a warning to ignore the primes (Experiments 1 through 3) and with subliminally presented masked primes (Experiment 4). Using a process dissociation procedure, we found evidence that primes influenced responses through both automatic and controlled processes (Experiments 5 and 6). Results provide evidence that primes can reliably affect behavior, under at least some conditions, without intention. The findings suggest that the psychological question of whether behavior priming effects are real should be separated from methodological issues affecting how easily particular experimental designs will replicate. PsycINFO Database Record (c) 2016 APA, all rights reserved

Cytokinin nucleotides contents in sexual buds of Douglas-fir

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imbault, N.; Doumas, P.; Bonnet-Masimbert, N.

1989-04-01

Cytokinin nucleotides were extracted from male and female buds of Pseudotsuga menxiesii by 10 % perchloric acid. They were prepurified on cation exchanger columns (CBA, Amersham) and then separated by two HPLC systems. The first one (Partisil 10 SAX, 10{mu}m, Wathman) separates the mono-, di- and tri-phosphates groups which were collected. The second one (Ultraspher, 5 {mu}m, Beckman) separates the cytokinin nucleotides inside each group. After separation, cytokinin nucleotides were assayed by radioimmunoassay with anti ribosyl zeatin (RZ) and anti isopentenyladenosine (iPA) antibodies. The analysis showed in the monophosphate (mono-P) group one immunoreactant peak in RZ fraction which co-chromatographied withmore » RZ-5{prime}-mono-P and two peaks in the iPA fraction. One of them co-chromatographied with iPA-5{prime}-mono-P. In the diphosphate group, there were three peaks which reacted with anti RZ antibodies and one with anti iPA antibodies. The nucleotides obtained after the first HPLC system, were hydrolysed by a 5{prime}-nucleotidase showed compounds co-chromatographing with RZ and iPA. We did not observe any qualitative differences between the male and female buds. This is the first evidence of cytokinin nucleotides in tissue from woody plants.« less

Gamma prime hardened nickel-iron based superalloy

DOEpatents

Korenko, Michael K.

1978-01-01

A low swelling, gamma prime hardened nickel-iron base superalloy useful for fast reactor duct and cladding applications is described having from about 7.0 to about 10.5 weight percent (wt%) chromium, from about 24 to about 35 wt% nickel, from about 1.7 to about 2.5 wt% titanium, from about 0.3 to about 1.0 wt% aluminum, from about 2.0 to about 3.3 wt% molybdenum, from about 0.05 to about 1.0 wt% silicon, from about 0.03 to about 0.06 wt% carbon, a maximum of about 2 wt% manganese, and the balance iron.

Towards a representation of priming on soil carbon decomposition in the global land biosphere model ORCHIDEE (version 1.9.5.2)

NASA Astrophysics Data System (ADS)

Guenet, B.; Moyano, F. E.; Peylin, P.; Ciais, P.; Janssens, I. A.

2015-10-01

Priming of soil carbon decomposition encompasses different processes through which the decomposition of native (already present) soil organic matter is amplified through the addition of new organic matter, with new inputs typically being more labile than the native soil organic matter. Evidence for priming comes from laboratory and field experiments, but to date there is no estimate of its impact at global scale and under the current anthropogenic perturbation of the carbon cycle. Current soil carbon decomposition models do not include priming mechanisms, thereby introducing uncertainty when extrapolating short-term local observations to ecosystem and regional to global scale. In this study we present a simple conceptual model of decomposition priming, called PRIM, able to reproduce laboratory (incubation) and field (litter manipulation) priming experiments. Parameters for this model were first optimized against data from 20 soil incubation experiments using a Bayesian framework. The optimized parameter values were evaluated against another set of soil incubation data independent from the ones used for calibration and the PRIM model reproduced the soil incubations data better than the original, CENTURY-type soil decomposition model, whose decomposition equations are based only on first order kinetics. We then compared the PRIM model and the standard first order decay model incorporated into the global land biosphere model ORCHIDEE. A test of both models was performed at ecosystem scale using litter manipulation experiments from 5 sites. Although both versions were equally able to reproduce observed decay rates of litter, only ORCHIDEE-PRIM could simulate the observed priming (R2 = 0.54) in cases where litter was added or removed. This result suggests that a conceptually simple and numerically tractable representation of priming adapted to global models is able to capture the sign and magnitude of the priming of litter and soil organic matter.

Induction of Lipid and Oleosin Biosynthesis by (+)-Abscisic Acid and Its Metabolites in Microspore-Derived Embryos of Brassica napus L.cv Reston (Biological Responses in the Presence of 8[prime]-Hydroxyabscisic Acid).

PubMed Central

Zou, J.; Abrams, G. D.; Barton, D. L.; Taylor, D. C.; Pomeroy, M. K.; Abrams, S. R.

1995-01-01

Microspore-derived (MD) embryos of Brassica napus L. cv Reston were used to test the effects of (+)-abscisic acid ([(+)-ABA]) and its metabolites, 8[prime]-hydroxyabscisic acid (8[prime]-OH ABA) and (-)-phaseic acid (PA), on the accumulation of very long-chain monounsaturated fatty acids (VLCMFAs) and induction of genes encoding a 19-kD oleosin protein and a [delta]15 desaturase during embryogenesis. Developing early to mid-cotyledonary MD embryos at 16 to 19 d in culture were treated with 10 [mu]M hormone/metabolite for 4 d. At various times during incubation, embryos and medium were analyzed to determine levels of hormone/metabolite, VLCMFAs, and oleosin or [delta]15 desaturase transcripts. The VLCMFAs, 20:1 and 22:1, primarily in triacylglycerols, increased by 200% after 72 h in the presence of (+)-ABA and 8[prime]-OH ABA relative to the control. In contrast, treatment with PA for 72 h had little effect (20% increase) on the level of VLCMFAs. The first 24 to 72 h of (+)-ABA treatment were critical in the induction of VLCMFA biosynthesis, with 8[prime]-OH ABA lagging slightly behind (+)-ABA in promoting this response. The accumulation of VLCMFAs was positively correlated with an increase in elongase activity. (+)-ABA and its 8[prime]-OH ABA metabolite induced the accumulation of a 19-kD oleosin transcript within 2 to 4 h in culture. In addition, both (+)-ABA and 8[prime]-OH ABA induced the same level of [delta]15 desaturase transcript by 8 h. PA had no effect on the induction of either oleosin or [delta]15 desaturase transcripts. To our knowledge, this is the first report of the biological activity of 8[prime]-OH ABA and of stimulatory effects of (+)-ABA and 8[prime]-OH ABA on lipid and oleosin biosynthesis. PMID:12228493

Deep Optical Observations of Unusual Neutron Star Calvera with the GTC

NASA Astrophysics Data System (ADS)

Shibanov, Yury; Danilenko, Andrey; Zharikov, Sergey; Shternin, Peter; Zyuzin, Dima

2016-11-01

Calvera is an unusual, isolated neutron star with a pure thermal X-ray spectrum typical of central compact objects in supernova remnants. On the other hand, its rotation period and spin-down rate are typical of ordinary rotation-powered pulsars. It was discovered and studied through X-rays, and has not yet been detected in other spectral domains. We present deep optical imaging of the Calvera field, obtained with the Gran Telescopio Canarias, in the g\\prime and I\\prime bands. Within the vicinity of ≈ 1\\prime\\prime of Calvera, we detected two point-like objects that were invisible at previous shallow observations. However, accurate astrometry showed that neither of them can be identified with the pulsar. We put new upper limits of g\\prime \\gt 27.87 and I\\prime \\gt 26.84 on its optical brightness. We also reanalyzed all available archival X-ray data on Calvera. Comparison of the Calvera thermal emission parameters and upper limits on optical and non-thermal X-ray emission with respective data on rotation-powered pulsars shows that Calvera might belong to the class of ordinary middle-aged pulsars, if we assume that its distance is in the range of 1.5-5 kpc. Based on observations made with the Gran Telescopio Canarias (GTC), installed in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias, on the island of La Palma, program GTC1-14AMEX.

Positive priming of terrestrially derived dissolved organic matter in a freshwater microcosm system

NASA Astrophysics Data System (ADS)

Bianchi, Thomas S.; Thornton, Daniel C. O.; Yvon-Lewis, Shari A.; King, Gary M.; Eglinton, Timothy I.; Shields, Michael R.; Ward, Nicholas D.; Curtis, Jason

2015-07-01

The role of priming processes in the remineralization of terrestrially derived dissolved organic carbon (TDOC) in aquatic systems has been overlooked. We provide evidence for TDOC priming using a lab-based microcosm experiment in which TDOC was primed by the addition of 13C-labeled algal dissolved organic carbon (ADOC) or a 13C-labeled disaccharide (trehalose). The rate of TDOC remineralization to carbon dioxide (CO2) occurred 4.1 ± 0.9 and 1.5 ± 0.3 times more rapidly with the addition of trehalose and ADOC, respectively, relative to experiments with TDOC as the sole carbon source over the course of a 301 h incubation period. Results from these controlled experiments provide fundamental evidence for the occurrence of priming of TDOC by ADOC and a simple disaccharide. We suggest that priming effects on TDOC should be considered in carbon budgets for large-river deltas, estuaries, lakes, hydroelectric reservoirs, and continental shelves.

The efficacy of preoperative positron emission tomography-computed tomography (PET-CT) for detection of lymph node metastasis in cervical and endometrial cancer: clinical and pathological factors influencing it.

PubMed

Nogami, Yuya; Banno, Kouji; Irie, Haruko; Iida, Miho; Kisu, Iori; Masugi, Yohei; Tanaka, Kyoko; Tominaga, Eiichiro; Okuda, Shigeo; Murakami, Koji; Aoki, Daisuke

2015-01-01

We studied the diagnostic performance of (18)F-fluoro-2-deoxy-d-glucose-positron emission tomography/computed tomography in cervical and endometrial cancers with particular focus on lymph node metastases. Seventy patients with cervical cancer and 53 with endometrial cancer were imaged with (18)F-fluoro-2-deoxy-D-glucose-positron emission tomography/computed tomography before lymphadenectomy. We evaluated the diagnostic performance of (18)F-fluoro-2-deoxy-D-glucose-positron emission tomography/computed tomography using the final pathological diagnoses as the golden standard. We calculated the sensitivity, specificity, positive predictive value and negative predictive value of (18)F-fluoro-2-deoxy-D-glucose-positron emission tomography/computed tomography. In cervical cancer, the results evaluated by cases were 33.3, 92.7, 55.6 and 83.6%, respectively. When evaluated by the area of lymph nodes, the results were 30.6, 98.9, 55.0 and 97.0%, respectively. As for endometrial cancer, the results evaluated by cases were 50.0, 93.9, 40.0 and 95.8%, and by area of lymph nodes, 45.0, 99.4, 64.3 and 98.5%, respectively. The limitation of the efficacy was found out by analyzing it by the region of the lymph node, the size of metastatic node, the historical type of tumor in cervical cancer and the prevalence of lymph node metastasis. The efficacy of positron emission tomography/computed tomography regarding the detection of lymph node metastasis in cervical and endometrial cancer is not established and has limitations associated with the region of the lymph node, the size of metastasis lesion in lymph node and the pathological type of primary tumor. The indication for the imaging and the interpretation of the results requires consideration for each case by the pretest probability based on the information obtained preoperatively. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Fatigue crack propagation behaviour of unidirectionally solidified gamma/gamma-prime-delta eutectic alloys. [Ni-Nb-Al alloys

NASA Technical Reports Server (NTRS)

Bretz, P. E.; Hertzberg, R. W.

1979-01-01

Fatigue crack propagation studies were carried out on unidirectionally solidified gamma/gamma-prime-delta (Ni-Nb-Al) alloys over an aluminum content range of 1.5-2.5% by weight. The variation of Al content of as-grown alloys did not significantly affect the crack growth behavior of these eutectic composites. The results indicate that the addition of Al to the eutectic dramatically improved the FCP behavior. The gamma/gamma-prime-delta alloy exhibited crack growth rates for a given stress intensity range that are an order of magnitude lower than those for the gamma-delta alloy. It is suggested that this difference in FCP behavior can be explained on the basis of stacking fault energy considerations. Extensive delaminations at the crack tip were also revealed, which contributed to the superior fatigue response. Delamination was predominantly intergranular in nature.

Changes in cytochrome P4501A activity during development in common tern chicks fed polychlorinated biphenyls, as measured by the caffeine breath test

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyk, L.A.; Giesy, J.P.; Bosveld, A.T.C.

2000-03-01

Cytochrome P4501A (CYPIA) activity is often used as a biomarker of exposure of wildlife to polyhalogenated diaromatic hydrocarbons and is usually measured ex vivo in liver tissue. A caffeine breath test (CBT) with radiolabeled substrate ({sup 14}C-caffeine) was used to measure in vivo CYP1A activity twice during development in 14 common tern (Sterna hirundo) chicks treated with polyhalogenated diaromatic hydrocarbons. Tern hatchlings were fed fish spiked with 3,3{prime}, 4,4{prime},5-pentachlorobiphenyl (PCB 126) and 2,2{prime},4,4{prime},5,5{prime}-hexachlorobiphenyl (PCB 153) such that the diet contained an average of 23, 99, or 561 pg of 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents per gram of fish for 21 d. Sixteen additionalmore » common tern chicks were similarly dosed with polyhalogenated diaromatic hydrocarbons but were not subjected to the CBT procedure. In weeks 1 and 2, caffeine N-demethylation and ethoxyresorufin-O-deethylation activity on day 21 were elevated in birds that received the greatest PCB dose. There was less constitutive and greater induction of ethoxyresorufin-O-deethylation activity than caffeine N-demethylation. The {sup 14}C-CBT was less invasive than the ethoxyresorufin-O-deethylase assay. Only one morphological parameter differed significantly between CBT subjects and no-CBT subjects fed the same level of PCBs. Bursa weight was significantly less in control CBT subjects than in control no-CBT subjects, but bursa weights did not differ among CBT and no-CBT birds from the two PCB treatment groups. No alterations of survival or growth occurred in CBT subjects compared with no-CBT subjects.« less

An investigation of the time course of category congruence and priming distance effects in number classification tasks.

PubMed

Perry, Jason R; Lupker, Stephen J

2012-09-01

The issue investigated in the present research is the nature of the information that is responsible for producing masked priming effects (e.g., semantic information or stimulus-response [S-R] associations) when responding to number stimuli. This issue was addressed by assessing both the magnitude of the category congruence (priming) effect and the nature of the priming distance effect across trials using single-digit primes and targets. Participants made either magnitude (i.e., whether the number presented was larger or smaller than 5) or identification (i.e., press the left button if the number was either a 1, 2, 3, or 4 or the right button if the number was either a 6, 7, 8, or 9) judgments. The results indicated that, regardless of task instruction, there was a clear priming distance effect and a significantly increasing category congruence effect. These results indicated that both semantic activation and S-R associations play important roles in producing masked priming effects.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirano, Kazumi; Van Kuppevelt, Toin H.; Nishihara, Shoko, E-mail: shoko@soka.ac.jp

Highlights: ► Fas transcript increases during the transition from the naïve to the primed state. ► 3OST-5 transcript, the HS4C3 epitope synthesis gene, increases during the transition. ► Fas signaling regulates the transition from the naïve to the primed state. ► HS4C3-binding epitope regulates the transition from the naïve to the primed state. ► Fas signaling is regulated by the HS4C3 epitope during the transition. -- Abstract: The characteristics of pluripotent embryonic stem cells of human and mouse are different. The properties of human embryonic stem cells (hESCs) are similar to those of mouse epiblast stem cells (mEpiSCs), which aremore » in a later developmental pluripotency state, the so-called “primed state” compared to mouse embryonic stem cells (mESCs) which are in a naïve state. As a result of the properties of the primed state, hESCs proliferate slowly, cannot survive as single cells, and can only be transfected with genes at low efficiency. Generating hESCs in the naïve state is necessary to overcome these problems and allow their application in regenerative medicine. Therefore, clarifying the mechanism of the transition between the naïve and primed states in pluripotent stem cells is important for the establishment of stable methods of generating naïve state hESCs. However, the signaling pathways which contribute to the transition between the naïve and primed states are still unclear. In this study, we carried out induction from mESCs to mEpiSC-like cells (mEpiSCLCs), and observed an increase in the activation of Fas signaling during the induction. The expression of Fgf5, an epiblast marker, was diminished by inhibition of Fas signaling using the caspase-8 and -3 blocking peptides, IETD and DEVD, respectively. Furthermore, during the induction, we observed increased expression of 3-O sulfated heparan sulfate (HS) structures synthesized by HS 3-O-sulfotransferase (3OST), which are recognized by the HS4C3 antibody (HS4C3-binding epitope). Knockdown of 3OST-5 reduced Fas signaling and the potential for the transition to mEpiSCLCs. This indicates that the HS4C3-binding epitope is necessary for the transition to the primed state. We propose that Fas signaling through the HS4C3-binding epitope contributes to the transition from the naïve state to the primed state.« less

Hydrostatic Pressure Enhances Vital Staining with Carboxyfluorescein or Carboxydichlorofluorescein in Saccharomyces cerevisiae: Efficient Detection of Labeled Yeasts by Flow Cytometry

PubMed Central

Abe, Fumiyoshi

1998-01-01

The extent of intracellular accumulation of the fluorescent dye carboxyfluorescein or carboxydichlorofluorescein (CDCF) in Saccharomyces cerevisiae was found to be increased 5- to 10-fold under a nonlethal hydrostatic pressure of 30 to 50 MPa. This observation was confirmed by analysis of individual labeled cells by flow cytometry. The pressure-induced enhancement of staining with CDCF required d-glucose and was markedly inhibited by 2-deoxy-d-glucose, suggesting that glucose metabolism has a role in the process. PMID:9501452

The Synthesis and Study of Azole Carboxamide Nucleosides as Agents Active Against RNA Viruses.

DTIC Science & Technology

1986-09-15

solvent such as nitromethane gave a nucleoside product , identified as 1-(2,3,5-tri-O-benzoyl-o--D-ribofuranosyl)-l,2,4- triazol-3(2H)-one (20, BL-00307...at 2220 cm . Treatment of 26 with NH4OH/H 202 solution, and purification of the reaction product by chromatography on silica gel furnished 1-(2-deoxy...30) in 74% yield. Treatment of 30 with NH4OH/H202 solution, and purification of the reaction product by chroma- tography on silica gel furnished 1

Test-Induced Priming Increases False Recognition in Older but Not Younger Children

ERIC Educational Resources Information Center

Dewhurst, Stephen A.; Howe, Mark L.; Berry, Donna M.; Knott, Lauren M.

2012-01-01

The effect of test-induced priming on false recognition was investigated in children aged 5, 7, 9, and 11 years using lists of semantic associates, category exemplars, and phonological associates. In line with effects previously observed in adults, nine- and eleven-year-olds showed increased levels of false recognition when critical lures were…

Contextual Distinctiveness Produces Long-Lasting Priming of Pop-Out

ERIC Educational Resources Information Center

Thomson, David R.; Milliken, Bruce

2013-01-01

Maljkovic and Nakayama have demonstrated memory influences in singleton search from one trial to the next, an effect they termed "priming of pop-out" (PoP). This effect was described as resulting from the persistence of an implicit memory trace, the influence of which could be observed for around 5-8 subsequent trials. Thomson and…

The Use of Reported Speech in Children's Narratives: A Priming Study

ERIC Educational Resources Information Center

Serratrice, Ludovica; Hesketh, Anne; Ashworth, Rachel

2015-01-01

This study investigated the long-term effects of structural priming on children's use of indirect speech clauses in a narrative context. Forty-two monolingual English-speaking 5-year-olds in two primary classrooms took part in a story-retelling task including reported speech. Testing took place in three individual sessions (pre-test, post-test 1,…

Differential Regulation of Brain-Derived Neurotrophic Factor Transcripts during the Consolidation of Fear Learning

ERIC Educational Resources Information Center

Ressler, Kerry J.; Rattiner, Lisa M.; Davis, Michael

2004-01-01

Brain-derived neurotrophic factor (BDNF) has been implicated as a molecular mediator of learning and memory. The BDNF gene contains four differentially regulated promoters that generate four distinct mRNA transcripts, each containing a unique noncoding 5[prime]-exon and a common 3[prime]-coding exon. This study describes novel evidence for the…

Interaction between Phonemic Abilities and Syllable Congruency Effect in Young Readers

ERIC Educational Resources Information Center

Chetail, Fabienne; Mathey, Stephanie

2013-01-01

This study investigated whether and to what extent phonemic abilities of young readers (Grade 5) influence syllabic effects in reading. More precisely, the syllable congruency effect was tested in the lexical decision task combined with masked priming in eleven-year-old children. Target words were preceded by a pseudo-word prime sharing the first…

An unexplored pathway for degradation of cholate requires a 7α-hydroxysteroid dehydratase and contributes to a broad metabolic repertoire for the utilization of bile salts in Novosphingobium sp. strain Chol11.

PubMed

Yücel, Onur; Drees, Steffen; Jagmann, Nina; Patschkowski, Thomas; Philipp, Bodo

2016-12-01

Bile salts such as cholate are surface-active steroid compounds with functions for digestion and signaling in vertebrates. Upon excretion into soil and water bile salts are an electron- and carbon-rich growth substrate for environmental bacteria. Degradation of bile salts proceeds via intermediates with a 3-keto-Δ 1,4 -diene structure of the steroid skeleton as shown for e.g. Pseudomonas spp. Recently, we isolated bacteria degrading cholate via intermediates with a 3-keto-7-deoxy-Δ 4,6 -structure of the steroid skeleton suggesting the existence of a second pathway for cholate degradation. This potential new pathway was investigated with Novosphingobium sp. strain Chol11. A 7α-hydroxysteroid dehydratase encoded by hsh2 was identified, which was required for the formation of 3-keto-7-deoxy-Δ 4,6 -metabolites. A hsh2 deletion mutant could still grow with cholate but showed impaired growth. Cholate degradation of this mutant proceeded via 3-keto-Δ 1,4 -diene metabolites. Heterologous expression of Hsh2 in the bile salt-degrading Pseudomonas sp. strain Chol1 led to the formation of a dead-end steroid with a 3-keto-7-deoxy-Δ 4,6 -diene structure. Hsh2 is the first steroid dehydratase with an important function in a metabolic pathway of bacteria that use bile salts as growth substrates. This pathway contributes to a broad metabolic repertoire of Novosphingobium strain Chol11 that may be advantageous in competition with other bile salt-degrading bacteria. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

PubMed

Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

2007-01-01

Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

47 CFR Alphabetical Index - Part 76

Code of Federal Regulations, 2010 CFR

2010-10-01

...: Notification 76.94 Network programming 76.5 Network programs: nonduplication protection 76.92 Network station....209 Possession of rules 76.301 Prime time 76.5 Program carriages, STV 76.64 Programming, Network 76.5... candidates for 76.205 PURPOSE—Part 76 76.1 Q Qualified TV station, Showing 76.55 R Rate regulation standards...

Pharmacological interventions for acceleration of the onset time of rocuronium: a meta-analysis.

PubMed

Dong, Jing; Gao, Lingqi; Lu, Wenqing; Xu, Zifeng; Zheng, Jijian

2014-01-01

Rocuronium is an acceptable alternative when succinylcholine is contraindicated for facilitating the endotracheal intubation. However, the onset time of rocuronium for good intubation condition is still slower than that condition of succinylcholine. This study systematically investigated the most efficacious pharmacological interventions for accelerating the onset time of rocuronium. Medline, Embase, Cochrane Library databases, www.clinicaltrials.gov, and hand searching from the reference lists of identified papers were searched for randomized controlled trials comparing drug interventions with placebo or another drug to shorten the onset time of rocuronium. Statistical analyses were performed using RevMan5.2 and ADDIS 1.16.5 softwares. Mean differences (MDs) with their 95% confidence intervals (95% CIs) were used to analyze the effects of drug interventions on the onset time of rocuronium. 43 randomized controlled trials with 2,465 patients were analyzed. The average onset time of rocuronium was 102.4±24.9 s. Priming with rocuronium [Mean difference (MD) -21.0 s, 95% confidence interval (95% CI) (-27.6 to -14.3 s)], pretreatment with ephedrine [-22.3 s (-29.1 to -15.5 s)], pretreatment with magnesium sulphate [-28.2 s (-50.9 to -5.6 s)] were all effective in reducing the onset time of rocuronium. Statistical testing of indirect comparisons showed that rocuronium priming, pretreatment with ephedrine, and pretreatment with magnesium sulphate had the similar efficacy. Rocuronium priming, pretreatment with ephedrine, and pretreatment with magnesium sulphate were all effective in accelerating the onset time of rocuronium, and furthermore their efficacies were similar. Considering the convenience and efficacy, priming with rocuronium is recommended for accelerating the onset time of rocuronium. However, more strict clinical trials are still needed to reach a more solid conclusion due to the large heterogeneities exist among different studies.

Incorporation and translocation of 2-deoxy-2-[(18)F]fluoro-D-glucose in Sorghum bicolor (L.) Moench monitored using a planar positron imaging system.

PubMed

Hattori, Etsuko; Uchida, Hiroshi; Harada, Norihiro; Ohta, Mari; Tsukada, Hideo; Hara, Yasuhiro; Suzuki, Tetsuya

2008-04-01

[(18)F]FDG (2-deoxy-2-[(18)F]fluoro-D-glucose) was fed to a sorghum plant [Sorghum bicolor (L.) Moench] from the tip of a leaf and its movement was monitored using a planar positron imaging system (PPIS). [(18)F]FDG was uptaken from the leaf tip and it was translocated to the basal part of the shoots from where it moved to the roots, the tillers and the sheaths. Autoradiographic analysis of the distribution of (18)F, [(18)F]FDG and/or its metabolites showed translocation to the roots, tillers, and to the leaves that were younger than the supplied leaf. Strong labelling was observed in the basal part of the shoots, in the sheaths, the youngest leaf and the root tips. Our results indicate that [(18)F]FDG and/or its metabolites were absorbed from the leaf and translocated to the sites where nutrients are required. This strongly suggests that [(18)F]FDG can be utilised as a tracer to study photoassimilate translocation in the living plant. This is the first report on the use of [(18)F]FDG, which is routinely used as a probe for clinical diagnosis, to study source to sink translocation of metabolites in whole plants in real time.

40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false D-Glucuronic acid, polymer with 6...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... identified as D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.

PubMed

Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe

2018-04-19

To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.

Targeting the genital tract mucosa with a lipopeptide/recombinant adenovirus prime/boost vaccine induces potent and long-lasting CD8+ T cell immunity against herpes: importance of MyD88.

PubMed

Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; Benmohamed, Lbachir

2012-11-01

Targeting of the mucosal immune system of the genital tract with subunit vaccines has failed to induce potent and durable local CD8(+) T cell immunity, which is crucial for protection against many sexually transmitted viral pathogens, including HSV type 2 (HSV-2), which causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8(+) T cell immunity to protect the female genital tract from herpes. The lipopeptide vaccine and the rAdv5 vaccine express the immunodominant HSV-2 CD8(+) T cell epitope (gB(498-505)), and both were delivered intravaginally in the progesterone-induced B6 mouse model of genital herpes. Compared with mice immunized with the homologous lipopeptide/lipopeptide (Lipo/Lipo) vaccine, the Lipo/rAdv5 prime/boost immunized mice 1) developed potent and sustained HSV-specific CD8(+) T cells, detected in both the genital tract draining nodes and in the vaginal mucosa; 2) had significantly lower virus titers; 3) had decreased overt signs of genital herpes disease; and 4) did not succumb to lethal infection (p < 0.005) after intravaginal HSV-2 challenge. Polyfunctional CD8(+) T cells, producing IFN-γ, TNF-α, and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8(+) T cell response was significantly compromised in the absence of the adapter MyD88 (p = 0.0001). Taken together, these findings indicate that targeting of the vaginal mucosa with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8(+) T cell protective immunity against sexually transmitted herpes infection and disease.

Targeting the Genital Tract Mucosa with a Lipopeptide/Recombinant Adenovirus Prime/Boost Vaccine Induces Potent and Long-Lasting CD8+ T Cell Immunity Against Herpes: Importance of Myeloid Differentiation Factor 881

PubMed Central

Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; BenMohamed, Lbachir

2012-01-01

Targeting the mucosal immune system of the genital tract (GT) with subunit vaccines failed to induce potent and durable local CD8+ T cell immunity, crucial for protection against many sexually transmitted viral (STV) pathogens, including herpes simplex virus type 2 (HSV-2) that causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8+ T cell immunity to protect the female genital tract from herpes. The lipopeptide and the rAdv5 vaccine express the immunodominant HSV-2 CD8+ T cell epitope (gB498-505) and both were delivered intravaginally (IVAG) in the progesterone-induced B6 mouse model of genital herpes. Compared to its homologous lipopeptide/lipopeptide (Lipo/Lipo); the Lipo/rAdv5 prime/boost immunized mice: (i) developed potent and sustained HSV-specific CD8+ T cells, detected in both the GT draining nodes (GT-DLN) and in the vaginal mucosa (VM); (ii) had significantly lower virus titers; (iii) had decreased overt signs of genital herpes disease; and (iv) did not succumb to lethal infection (p < 0.005), following intravaginal HSV-2 challenge. Polyfunctional CD8+ T cells, producing IFN-γ, TNF-α and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8+ T cell response was significantly compromised in the absence of the adaptor myeloid differentiation factor 88 (MyD88) (p = 0.0001). Taken together, these findings indicate that targeting the VM with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8+ T cell protective immunity against sexually transmitted herpes infection and disease. PMID:23018456

Electrostimulation improves muscle perfusion but does not affect either muscle deoxygenation or pulmonary oxygen consumption kinetics during a heavy constant-load exercise.

PubMed

Layec, Gwenael; Millet, Grégoire P; Jougla, Aurélie; Micallef, Jean-Paul; Bendahan, David

2008-02-01

Electromyostimulation (EMS) is commonly used as part of training programs. However, the exact effects at the muscle level are largely unknown and it has been recently hypothesized that the beneficial effect of EMS could be mediated by an improved muscle perfusion. In the present study, we investigated rates of changes in pulmonary oxygen consumption (VO(2p)) and muscle deoxygenation during a standardized exercise performed after an EMS warm-up session. We aimed at determining whether EMS could modify pulmonary O(2) uptake and muscle deoxygenation as a result of improved oxygen delivery. Nine subjects performed a 6-min heavy constant load cycling exercise bout preceded either by an EMS session (EMS) or under control conditions (CONT). VO(2p) and heart rate (HR) were measured while deoxy-(HHb), oxy-(HbO(2)) and total haemoglobin/myoglobin (Hb(tot)) relative contents were measured using near infrared spectroscopy. EMS significantly increased (P < 0.05) the Hb(tot) resting level illustrating a residual hyperaemia. The EMS priming exercise did not affect either the HHb time constant (17.7 +/- 14.2 s vs. 13.1 +/- 2.3 s under control conditions) or the VO(2p) kinetics (time-constant = 18.2 +/- 5.2 s vs. 15.4 +/- 4.6 s under control conditions). Likewise, the other VO(2p) parameters were unchanged. Our results further indicated that EMS warm-up improved muscle perfusion through a residual hyperaemia. However, neither VO(2p) nor [HHb] kinetics were modified accordingly. These results suggest that improved O(2) delivery by residual hyperaemia induced by EMS does not accelerate the rate of aerobic metabolism during heavy exercise at least in trained subjects.

Protocatechuic aldehyde inhibits migration and proliferation of vascular smooth muscle cells and intravascular thrombosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moon, Chang Yoon; Endocrinology, Brain Korea 21 Project for Medical Science, Institute of Endocrine Research, and Severance Integrative Research Institute for Cerebral and Cardiovascular Disease, Yonsei University College of Medicine, Seoul; Ku, Cheol Ryong

2012-06-22

Highlights: Black-Right-Pointing-Pointer Protocatechuic aldehyde (PCA) inhibits ROS production in VSMCs. Black-Right-Pointing-Pointer PCA inhibits proliferation and migration in PDGF-induced VSMCs. Black-Right-Pointing-Pointer PCA has anti-platelet effects in ex vivo rat whole blood. Black-Right-Pointing-Pointer We report the potential therapeutic role of PCA in atherosclerosis. -- Abstract: The migration and proliferation of vascular smooth muscle cells (VSMCs) and formation of intravascular thrombosis play crucial roles in the development of atherosclerotic lesions. This study examined the effects of protocatechuic aldehyde (PCA), a compound isolated from the aqueous extract of the root of Salvia miltiorrhiza, an herb used in traditional Chinese medicine to treat a varietymore » of vascular diseases, on the migration and proliferation of VSMCs and platelets due to platelet-derived growth factor (PDGF). DNA 5-bromo-2 Prime -deoxy-uridine (BrdU) incorporation and wound-healing assays indicated that PCA significantly attenuated PDGF-induced proliferation and migration of VSMCs at a pharmacologically relevant concentration (100 {mu}M). On a molecular level, we observed down-regulation of the phosphatidylinositol 3-kinase (PI3K)/Akt and the mitogen-activated protein kinase (MAPK) pathways, both of which regulate key enzymes associated with migration and proliferation. We also found that PCA induced S-phase arrest of the VSMC cell cycle and suppressed cyclin D2 expression. In addition, PCA inhibited PDGF-BB-stimulated reactive oxygen species production in VSMCs, indicating that PCA's antioxidant properties may contribute to its suppression of PDGF-induced migration and proliferation in VSMCs. Finally, PCA exhibited an anti-thrombotic effect related to its inhibition of platelet aggregation, confirmed with an aggregometer. Together, these findings suggest a potential therapeutic role of PCA in the treatment of atherosclerosis and angioplasty-induced vascular restenosis.« less

jsc2013e048273

NASA Image and Video Library

2013-05-22

Behind the Cosmonaut Hotel crew quarters in Baikonur, Kazakhstan, the Expedition 36/37 backup and prime crewmembers pose for pictures in front of a Proton rocket statue May 22 following traditional ceremonies. From left to right are backup Flight Engineer Koichi Wakata of the Japan Aerospace Exploration Agency, backup Soyuz Commander Mikhail Tyurin, backup Flight Engineer Rick Mastracchio of NASA, prime Flight Engineer Karen Nyberg of NASA, prime Soyuz Commander Fyodor Yurchikhin and prime Flight Engineer Luca Parmitano of the European Space Agency. Nyberg, Yurchikhin and Parmitano are preparing for their launch May 29, Kazakh time, in the Soyuz TMA-09M spacecraft to begin a 5 ½ month mission on the International Space Station. NASA/Victor Zelentsov

Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

PubMed

Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

2003-05-01

Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

P-8A Poseidon Multi-Mission Maritime Aircraft (P-8A)

DTIC Science & Technology

2013-12-01

NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND...2013 rated the P-8A as operationally effective , operationally suitable, and recommended Fleet introduction. Integrated testing of deficiency...lot through effective negotiations with the prime contractor and through development and implementation of production process improvement

Treatment Outcomes in a Decentralized Antiretroviral Therapy Program: A Comparison of Two Levels of Care in North Central Nigeria

PubMed Central

Okonkwo, Prosper; Sagay, Atiene S.; Agaba, Patricia A.; Yohanna, Stephen; Agbaji, Oche O.; Imade, Godwin E.; Banigbe, Bolanle; Adeola, Juliet; Oyebode, Tinuade A.; Idoko, John A.; Kanki, Phyllis J.

2014-01-01

Background. Decentralization of antiretroviral therapy (ART) services is a key strategy to achieving universal access to treatment for people living with HIV/AIDS. Our objective was to assess clinical and laboratory outcomes within a decentralized program in Nigeria. Methods. Using a tiered hub-and-spoke model to decentralize services, a tertiary hospital scaled down services to 13 secondary-level hospitals using national and program guidelines. We obtained sociodemographic, clinical, and immunovirologic data on previously antiretroviral drug naïve patients aged ≥15 years that received HAART for at least 6 months and compared treatment outcomes between the prime and satellite sites. Results. Out of 7,747 patients, 3729 (48.1%) were enrolled at the satellites while on HAART, prime site patients achieved better immune reconstitution based on CD4+ cell counts at 12 (P < 0.001) and 24 weeks (P < 0.001) with similar responses at 48 weeks (P = 0.11) and higher rates of viral suppression (<400 c/mL) at 12 (P < 0.001) and 48 weeks (P = 0.03), but similar responses at 24 weeks (P = 0.21). Mortality was 2.3% versus 5.0% (P < 0.001) at prime and satellite sites, while transfer rate was 8.7% versus 5.5% (P = 0.001) at prime and satellites. Conclusion. ART decentralization is feasible in resource-limited settings, but efforts have to be intensified to maintain good quality of care. PMID:25028610

Absence of the aflatoxin biosynthesis gene, norA, allows accumulation of deoxyaflatoxin B1 in Aspergillus flavus cultures.

PubMed

Ehrlich, Kenneth C; Chang, Perng-Kuang; Scharfenstein, Leslie L; Cary, Jeffrey W; Crawford, Jason M; Townsend, Craig A

2010-04-01

Biosynthesis of the highly toxic and carcinogenic aflatoxins in select Aspergillus species from the common intermediate O-methylsterigmatocystin has been postulated to require only the cytochrome P450 monooxygenase, OrdA (AflQ). We now provide evidence that the aryl alcohol dehydrogenase NorA (AflE) encoded by the aflatoxin biosynthetic gene cluster in Aspergillus flavus affects the accumulation of aflatoxins in the final steps of aflatoxin biosynthesis. Mutants with inactive norA produced reduced quantities of aflatoxin B(1) (AFB(1)), but elevated quantities of a new metabolite, deoxyAFB(1). To explain this result, we suggest that, in the absence of NorA, the AFB(1) reduction product, aflatoxicol, is produced and is readily dehydrated to deoxyAFB(1) in the acidic medium, enabling us to observe this otherwise minor toxin produced in wild-type A. flavus.

40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

Code of Federal Regulations, 2014 CFR

2014-07-01

...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

Code of Federal Regulations, 2012 CFR

2012-07-01

...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

Code of Federal Regulations, 2011 CFR

2011-07-01

...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

Code of Federal Regulations, 2013 CFR

2013-07-01

...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

Comparative metabolism of the pyrethroids bifenthrin and deltamethrin in the bulb mite Rhizoglyphus robini

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruzo, L.O.; Cohen, E.; Capua, S.

The fate of {sup 14}C-radiolabeled bifenthrin and deltamethrin was studied in the mite, Rhizoglyphus robini. Administered either by ingestion or by contact, both pyrethroids were efficiently metabolized, but deltamethrin was degraded to a much greater extent. The identified metabolites arise from a combination of ester cleavage, oxidation, and conjugation reactions. With {sup 14}C-acid- and {sup 14}C-alcohol-labeled bifenthrin, the free metabolites detected were the 4{prime}-hydroxy derivative of the ester, the primary ester cleavage products, the acid, and its 4{prime}-hydroxy derivative from the alcohol moiety, as well as several unidentified metabolites. Using {sup 14}C-alcohol-labeled deltamethrin, 3-phenoxybenzoic acid and its 4{prime}-hydroxylated product andmore » several unknown metabolites were detected. Conjugates comprised the bulk of total pyrethroid metabolites. In addition to ester cleavage products, the 4{prime}-hydroxylated bifenthrin was also identified. For the first time in invertebrates, a conjugated pyrethroid ester was observed.« less

Leukocyte common antigen-related phosphatase (LRP) gene structure: Conservation of the genomic organization of transmembrane protein tyrosine phosphatases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, E.C.C.; Mullersman, J.E.; Thomas, M.L.

1993-07-01

The leukocyte common antigen-related protein tyrosine phosphatase (LRP) is a widely expressed transmembrane glycoprotein thought to be involved in cell growth and differentiation. Similar to most other transmembrane protein tyrosine phosphatases, LRP contains two tandem cytoplasmic phosphatase domains. To understand further the regulation and evolution of LRP, the authors have isolated and characterized mouse [lambda] genomic clones. Thirteen genomic clones could be divided into two non-overlapping clusters. The first cluster contained the transcription initiation site and the exon encoding most of the 5[prime] untranslated region. The second cluster contained the remaining exons encoding the protein and the 3[prime] untranslated region.more » The gene consists of 22 exons spanning over 75 kb. The distance between exon 1 and exon 2 is at least 25 kb. Characterization of the 5[prime] ends of LRP mRNA by S1 nuclease protection identifies putative initiation start sites within a G/C-rich region. The upstream region does not contain a TATA box. Comparison of the LRP gene structure to the mammalian protein tyrosine phosphatase gene, CD45, shows striking similarities in size and genomic organization. 29 refs., 5 figs., 1 tab.« less

Systematic screening for mutations in the 5{prime}-regulatory region of the human dopamine D{sub 1} receptor (DRD1) gene in patients with schizophrenia and bipolar affective disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cichon, S.; Noethen, M.M.; Stoeber, G.

1996-07-26

A possible dysregulation of dopaminergic neurotransmission has been implicated in a variety of neuropsychiatric diseases. In the present study we systematically searched for the presence of mutations in the 5{prime}-flanking region of the dopamine D{sub 1} receptor (DRD1) gene. This region has previously been shown to contain a functional promoter. We investigated 119 unrelated individuals (including 36 schizophrenic patients, 38 bipolar affective patients, and 45 healthy controls) using single-strand conformation analysis (SSCA). Eleven overlapping PCR fragments covered 2,189 bp of DNA sequence. We identified six single base substitutions: -2218T/C, -2102C/A, -2030T/C, -1992G/A, -1251G/C, and -800T/C. None of the mutations wasmore » found to be located in regions which have important influence on the level of transcriptional activity. Allele frequencies were similar in patients and controls, indicating that genetic variation in the 5{prime}-regulatory region of the DRD1 gene is unlikely to play a frequent, major role in the genetic predisposition to either schizophrenia or bipolar affective disorder. 31 refs., 3 tabs.« less

Quantification of Changes in Oxygen Release from Red Blood Cells as a Function of Age Based on Magnetic Susceptibility Measurements

PubMed Central

Jin, Xiaoxia; Yazer, Mark H.; Chalmers, Jeffrey J.; Zborowski, Maciej

2013-01-01

This study extends the in vitro understanding of the RBC storage lesion by serially analyzing the RBC’s magneophoretic mobility, a property dependent on the content and oxygenation or oxidation state of hemoglobin (Hb) iron, during storage. Four prestorage leukoreduced, AS-5 preserved RBC units were stored between 1–6°C for 42 days. Weekly starting on storage day 7, each unit was sampled, the aliquot divided into 3 portions and subjected to different reactions: one portion was exposed to room air to produce oxyhemoglobin (oxyHb), another portion was mixed with sodium nitrite to produce methemoglobin (metHb), while the third portion was desaturated of oxygen (deoxyhemoglobin, deoxyHb) using nitrogen gas. These portions were placed into a cell tracking velocimetry (CTV) apparatus which measured both the settling velocity (us) of the RBCs as well as their magnetically induced velocity (um). The um/us ratio depends on the oxygenation or oxidation state and quantity of iron within the RBC. RBC density was measured by percoll centrifugation. There was a significant reduction in the um/us ratio for the deoxyHb RBC portion as storage time elapsed, with a smaller but still significant reduction in the um/us ratio for the metHb portion. The average RBC density decreased very slightly during storage, as determined by percoll centrifugation technique, although the average settling velocity (another measure of cell density) seemed to fluctuate during storage. The decrease in magnetophoretic mobility of the deoxyHb portion, presented as the ratio of um/us, is explicable either by Hb’s increased affinity for oxygen during storage, or a loss of iron from the cells. PMID:21647486

Mycothiol-Deficient Mycobacterium smegmatis Mutants Are Hypersensitive to Alkylating Agents, Free Radicals, and Antibiotics

PubMed Central

Rawat, Mamta; Newton, Gerald L.; Ko, Mary; Martinez, Gladys J.; Fahey, Robert C.; Av-Gay, Yossef

2002-01-01

Mycothiol (MSH; 1d-myo-inosityl 2-[N-acetyl-l-cysteinyl]amido-2-deoxy-α-d-glucopyranoside) is the major low-molecular-weight thiol produced by mycobacteria. Mutants of Mycobacterium smegmatis mc2155 deficient in MSH production were produced by chemical mutagenesis as well as by transposon mutagenesis. One chemical mutant (mutant I64) and two transposon mutants (mutants Tn1 and Tn2) stably deficient in MSH production were isolated by screening for reduced levels of MSH content. The MSH contents of transposon mutants Tn1 and Tn2 were found to be less than 0.1% that of the parent strain, and the MSH content of I64 was found to be 1 to 5% that of the parent strain. All three strains accumulated 1d-myo-inosityl 2-deoxy-α-d-glucopyranoside to levels 20- to 25-fold the level found in the parent strain. The cysteine:1d-myo-inosityl 2-amino-2-deoxy-α-d-glucopyranoside ligase (MshC) activities of the three mutant strains were ≤2% that of the parent strain. Phenotypic analysis revealed that these MSH-deficient mutants possess increased susceptibilities to free radicals and alkylating agents and to a wide range of antibiotics including erythromycin, azithromycin, vancomycin, penicillin G, rifamycin, and rifampin. Conversely, the mutants possess at least 200-fold higher levels of resistance to isoniazid than the wild type. We mapped the mutation in the chemical mutant by sequencing the mshC gene and showed that a single amino acid substitution (L205P) is responsible for reduced MSH production and its associated phenotype. Our results demonstrate that there is a direct correlation between MSH depletion and enhanced sensitivity to toxins and antibiotics. PMID:12384335

Far-UV Spectroscopy of the Planet-hosting Star WASP-13: High-energy Irradiance, Distance, Age, Planetary Mass-loss Rate, and Circumstellar Environment

NASA Astrophysics Data System (ADS)

Fossati, L.; France, K.; Koskinen, T.; Juvan, I. G.; Haswell, C. A.; Lendl, M.

2015-12-01

Several transiting hot Jupiters orbit relatively inactive main-sequence stars. For some of those, the {log}{R}{HK}\\prime activity parameter lies below the basal level (-5.1). Two explanations have been proposed so far: (i) the planet affects the stellar dynamo, (ii) the {log}{R}{HK}\\prime measurements are biased by extrinsic absorption, either by the interstellar medium (ISM) or by material local to the system. We present here Hubble Space Telescope/COS far-UV spectra of WASP-13, which hosts an inflated hot Jupiter and has a measured {log}{R}{HK}\\prime value (-5.26), well below the basal level. From the star’s spectral energy distribution we obtain an extinction E(B - V) = 0.045 ± 0.025 mag and a distance d = 232 ± 8 pc. We detect at ≳4σ lines belonging to three different ionization states of carbon (C i, C ii, and C iv) and the Si iv doublet at ˜3σ. Using far-UV spectra of nearby early G-type stars of known age, we derive a C iv/C i flux ratio-age relation, from which we estimate WASP-13's age to be 5.1 ± 2.0 Gyr. We rescale the solar irradiance reference spectrum to match the flux of the C iv 1548 doublet. By integrating the rescaled solar spectrum, we obtain an XUV flux at 1 AU of 5.4 erg s-1 cm-2. We use a detailed model of the planet’s upper atmosphere, deriving a mass-loss rate of 1.5 × 1011 g s-1. Despite the low {log}{R}{HK}\\prime value, the star shows a far-UV spectrum typical of middle-aged solar-type stars, pointing toward the presence of significant extrinsic absorption. The analysis of a high-resolution spectrum of the Ca ii H&K lines indicates that the ISM absorption could be the origin of the low {log}{R}{HK}\\prime value. Nevertheless, the large uncertainty in the Ca ii ISM abundance does not allow us to firmly exclude the presence of circumstellar gas. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained from MAST at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with program #13859.

Diazepam dose-dependently increases or decreases implicit priming of alcohol associations in problem drinkers.

PubMed

Zack, Martin; Poulos, Constantine X; Woodford, Tracy M

2006-01-01

Words denoting negative affect (NEG) have been found to prime alcohol-related words (ALC) on semantic priming tasks, and this effect is tied to severity of addiction. Previous research suggested that high doses of benzodiazepines may dampen NEG-ALC priming. The present study tested this possibility and the role of motivation for alcohol in this process. A placebo-controlled, double blind, between-within, counterbalanced design was employed. Two groups of male problem drinkers (n = 6/group) received a high (15-mg) or low (5-mg) dose of diazepam versus placebo on two identical test sessions. A lexical decision task assessed priming. Under placebo, significant NEG-->ALC priming emerged in each group. High-dose diazepam selectively reversed this effect, while low-dose selectively enhanced it. Correlations between NEG-->ALC priming and desire for alcohol provided further support that semantic priming of ALC concepts reflects a motivational process. The bi-directional effects found here parallel the effects of high- versus low-dose benzodiazepines on alcohol self-administration in animals. High-dose diazepam reduces prime-induced activation of ALC concepts in problem drinkers. Low-dose diazepam facilitates this process, and cross-priming of motivation for alcohol appears to explain this effect. Neurochemical modulation of the alcohol memory network may contribute to the motivational effects of benzodiazepines in problem drinkers.

Helminth antigens selectively differentiate unsensitized CD45RA+ CD4+ human T cells in vitro.

PubMed

Steel, C; Nutman, T B

1998-01-01

Human filarial helminth infections are characterized by type 2 immune responses to parasite Ag that can persist for the life of the individual; one possible cause for this may be prenatal exposure to the blood-borne microfilarial (Mf) stage of the parasite. To examine the relationship between early exposure to filarial Ag and subsequent immune responsiveness, CD45RA+ CD4+ cells frp, normal unsensitized donors were stimulated in vitro with soluble microfilarial Ag (MfAg) from the filarial parasite Brugia malayi in the presence of APCs. MfAg alone induced proliferation and IFN-gamma and IL-5 production in unsensitized CD45RA+ CD4+ cells, demonstrating the ability of filarial Ags to prime naive T cells in the absence of exogenous cytokines and dendritic cells. Adding exogenous cytokine(s) (particularly IL-12 and IL-4) during priming was able to alter the MfAg-specific responses of CD45RA+ CD4+ cells as well as subsequent responses to Ag. Interestingly, priming solely with MfAg led to enhanced IL-5 production following Ag restimulation, suggesting that MfAg preferentially primes for type 2 responses. These data demonstrate that filarial Ags by themselves can specifically prime CD45RA+ CD4+ cells in vitro and do so in such a way as to deviate the immune response.

Epicubenol and Ferruginol induce DC from human monocytes and differentiate IL-10-producing regulatory T cells in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takei, Masao; Umeyama, Akemi; Arihara, Shigenobu

2005-11-18

Epicubenol and 19-hydroxyferruginol (Ferruginol) are sesquiterpenes isolated from the black heartwood of Cryptomeria japonica. Dendritic cells (DC) are specialized antigen-presenting cells that monitor the antigenic environment and activate naive T cells. The role of DC is not only to sense danger but also to tolerize the immune system to antigens encountered in the absence of maturation/inflammatory stimuli. In this study, we attempted to investigate the effects of Epicubenol and Ferruginol on the phenotypic and functional maturation of human monocytes-derived DC in vitro. Human monocytes were cultured with GM-CSF and IL-4 for 6 days under standard conditions, followed by another 2more » days with Epicubenol or Ferruginol. The expression levels of CD1a, CD83, and HLA-DR as expressed by mean fluorescence intensity (MFI) on Epicubenol-primed DC or Ferruginol-primed DC were enhanced. Allogeneic Epicubenol-primed DC or Ferruginol-primed DC co-cultured with naive T cells at 1:5 ratio, secreted IL-10 and TGF-{beta}, but little IL-4. Moreover, T cells that develop in co-culture of Epicubenol-primed DC or Ferruginol-primed DC and naive T cells at 1:5 ratio suppressed the proliferation of autologous T cells at Treg cells: Ttarget cells and this suppression of proliferation was inhibited by anti-IL-10 mAb. The expression of FoxP3 mRNA on T cells that develop in co-culture of Epicubenol-primed DC or Ferruginol-primed DC and naive T cells was lower. From these results, Epicubenol and Ferruginol may induce IL-10-producing Treg 1 cells from naive T cells by modulating DC function. It seems that Epicubenol and Ferruginol appear to be a target for tolerance after transplantation and in autoimmune diseases.« less

Synthesis and characterization of poly[d(G-z5C)]. B-Z transition and inhibition of DNA methylase.

PubMed

McIntosh, L P; Zielinski, W S; Kalisch, B W; Pfeifer, G P; Sprinzl, M; Drahovsky, D; van de Sande, J H; Jovin, T M

1985-08-27

Deoxy-5-azacytidine 5'-triphosphate was synthesized and used as a substrate for the enzymatic synthesis of the polynucleotide poly[d(G-z5C)]. Whereas the triphosphate decomposes in solution, the azacytosine analogue incorporated into DNA is stable under conditions preserving the double-helical structure. Poly[d(G-z5C)] undergoes the transition to the left-handed Z conformation at salt (NaCl and MgCl2) concentrations approximately 30% higher than those required for unsubstituted poly[d(G-C)]. However, the incorporation of azacytidine potentiates the formation at room temperature of the Z helix stabilized by the transition metal Mn2+; in the case of poly[d(G-C)], a heating step is required. The spectral properties of the two polymers in the B and Z forms are similar. Both left-handed forms are recognized by anti-Z DNA immunoglobulins, indicating that the DNAs bear common antigenic features. Poly[d(G-z5C)] is not a substrate for the DNA cytosine 5-methyltransferase from human placenta. It is a potent inhibitor of the enzyme when tested in a competitive binding assay. These results are compatible with a very strong, possibly covalent, mode of interaction between methyltransferases and DNA containing 5-azacytosine.

An Experimental Analysis of Some Procedures to Teach Priming and Reinforcement Skills to Preschool Teachers.

ERIC Educational Resources Information Center

Thomson, Carolyn L.; And Others

1978-01-01

Reports the results of teaching preschool teachers to use priming and reinforcement to increase the desired behaviors of their children. Five teacher-training techniques were examined: (1) written assignments, (2) feedback from viewing graphs, (3) on-the-spot feedback from a wireless radio (Bug-in-the-Ear), (4) feedback from an observer, and (5)…

Apollo 7 prime crew during water egress training in Gulf of Mexico

NASA Image and Video Library

1968-08-05

S68-46604 (5 Aug. 1968) --- The prime crew of the first manned Apollo mission (Spacecraft 101/Saturn 205) is seen in Apollo Command Module Boilerplate 1102 during water egress training in the Gulf of Mexico. In foreground is astronaut Walter M. Schirra Jr., in center is astronaut Donn F. Eisele, and in background is astronaut Walter Cunningham.

KSC-2009-1367

NASA Image and Video Library

2008-11-04

VANDENBERG AIR FORCE BASE, Calif. – The latest polar-orbiting operational environmental weather satellite developed by NASA for the National Oceanic and Atmospheric Administration, called NOAA-N Prime, is offloaded from the C-5A military cargo aircraft at Vandenberg Air Force Base, Calif., in preparation for a Feb. 4 launch. NOAA-N Prime, built by Lockheed Martin, is similar to NOAA-N launched on May 20, 2005.

KSC-2009-1365

NASA Image and Video Library

2008-11-04

VANDENBERG AIR FORCE BASE, Calif. – The latest polar-orbiting operational environmental weather satellite developed by NASA for the National Oceanic and Atmospheric Administration, called NOAA-N Prime, arrived by C-5A military cargo aircraft at Vandenberg Air Force Base, Calif., in preparation for a Feb. 4 launch. NOAA-N Prime, built by Lockheed Martin, is similar to NOAA-N launched on May 20, 2005.

Shear rupture of a directionally solidified eutectic gamma/gamma prime - alpha (Mo) alloy

NASA Technical Reports Server (NTRS)

Harf, F. H.

1978-01-01

Directionally solidified Mo alloys are evaluated to determine the shear rupture strength and to possibly improve it by microstructural and heat treatment variations. Bars of the alloy containing nominally 5.7% Al and 33.5% Mo by weight with balance Ni were directionally solidified at rates between 10 and 100 mm per hour in furnaces with thermal gradients at the liquid-solid interface of 250 or 100 C per cm. A limited number of longitudinal shear rupture tests were conducted at 760 C and 207 MPa in the as - solidified and in several heat treated conditions. It is shown that shear rupture failures are partly transgranular and that resistance to failure is prompted by good fiber alignment and a matrix structure consisting mainly of gamma prime. Well aligned as - solidified specimens sustained the shear stress for an average of 81 hours. A simulated coating heat treatment appeared to increase the transformation of gamma to gamma prime and raised the average shear life of aligned specimens to 111 hours. However, heat treatments at 1245 C and especially at 1190 C appeared to be detrimental by causing partial solutioning of the gamma prime, and reducing lives to 47 and 10 hours, respectively.

Solid state proton and electron mediating membrane and use in catalytic membrane reactors

DOEpatents

White, J.H.; Schwartz, M.; Sammells, A.F.

1998-10-13

This invention provides catalytic proton and electron mediating membranes useful in catalytic reactors. The membranes have an oxidation and a reduction surface and comprise a single-phase mixed metal oxide material of the formula: AB{sub 1{minus}x}B{prime}{sub x}O{sub 3{minus}y} wherein A is selected from Ca, Sr or Ba ions; B is selected from Ce, Tb, Pr, or Th ions; B{prime} is selected from Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Al, Ga, or In ions, or combinations thereof; and x is greater than or equal to 0.02 and less than or equal to 0.5. The membranes can further comprise a catalyst on either the oxidation or reduction surface, or both. Membranes include those which are fabricated by combining powders of metal oxides or metal carbonates of metal A ion, metal B ion and metal B{prime} ion such that the stoichiometric ratio A:B:B{prime} is 1:1{minus}x:x where 0.2{<=}{times}0.5, repeatedly calcining and milling the combined powders until a single-phase material is obtained and pressing and sintering the single phase material to obtain a membrane. 6 figs.

EASY SYNTHESIS OF Li4Ti5O12/C MICROSPHERES CONTAINING NANOPARTICLES AS ANODE MATERIAL FOR HIGH-RATE Li-ION BATTERIES

NASA Astrophysics Data System (ADS)

Zheng, Xiaodong; Dong, Lina; Dong, Chenchu

2014-01-01

A microspherical Li4Ti5O12/C composite composed of interconnected nanoparticles with BP-2000 carbon black as carbon source is synthesized for use as an anode material in high-power lithium-ion batteries. The composite is prepared through precursor pretreatment including pre-sintering, ball-milling, and spray-drying. The structure, size and surface morphology of the as-prepared particles are investigated by X-ray diffraction and scanning electron microscopy. Results show that the obtained material has a microspherical morphology consisting of nanosized prime particles with compact structure. The precursor pretreatment effectively reduced the agglomeration of the prime particles caused by high temperature sintering and led to a more uniform distribution of BP-2000 on the surface of prime particles generating highly efficient conductive network. The specific capacity of the electrode at 20 C rate is 131 mAh g-1 and the loss of capacity is less than 2% after the 60 variation cycles (from 1 C to 20 C and back to 1 C). This excellent performance is attributed to the effective conductive network between the prime particles and the reduction of the lithium-ion diffusion pathway.

Rutin-Mediated Priming of Plant Resistance to Three Bacterial Pathogens Initiating the Early SA Signal Pathway

PubMed Central

Li, Yang; Wang, Yingzi; Li, Ming; Wang, Yong; Ding, Xinhua; Chu, Zhaohui

2016-01-01

Flavonoids are ubiquitous in the plant kingdom and have many diverse functions, including UV protection, auxin transport inhibition, allelopathy, flower coloring and insect resistance. Here we show that rutin, a proud member of the flavonoid family, could be functional as an activator to improve plant disease resistances. Three plant species pretreated with 2 mM rutin were found to enhance resistance to Xanthomonas oryzae pv. oryzae, Ralstonia solanacearum, and Pseudomonas syringae pv. tomato strain DC3000 in rice, tobacco and Arabidopsis thaliana respectively. While they were normally propagated on the cultural medium supplemented with 2 mM rutin for those pathogenic bacteria. The enhanced resistance was associated with primed expression of several pathogenesis-related genes. We also demonstrated that the rutin-mediated priming resistance was attenuated in npr1, eds1, eds5, pad4-1, ndr1 mutants, and NahG transgenic Arabidopsis plant, while not in either snc1-11, ein2-5 or jar1 mutants. We concluded that the rutin-priming defense signal was modulated by the salicylic acid (SA)-dependent pathway from an early stage upstream of NDR1 and EDS1. PMID:26751786

Langerin negative dendritic cells promote potent CD8+ T-cell priming by skin delivery of live adenovirus vaccine microneedle arrays

PubMed Central

Bachy, Veronique; Hervouet, Catherine; Becker, Pablo D.; Chorro, Laurent; Carlin, Leo M.; Herath, Shanthi; Papagatsias, Timos; Barbaroux, Jean-Baptiste; Oh, Sea-Jin; Benlahrech, Adel; Athanasopoulos, Takis; Dickson, George; Patterson, Steven; Kwon, Sung-Yun; Geissmann, Frederic; Klavinskis, Linda S.

2013-01-01

Stabilization of virus protein structure and nucleic acid integrity is challenging yet essential to preserve the transcriptional competence of live recombinant viral vaccine vectors in the absence of a cold chain. When coupled with needle-free skin delivery, such a platform would address an unmet need in global vaccine coverage against HIV and other global pathogens. Herein, we show that a simple dissolvable microneedle array (MA) delivery system preserves the immunogenicity of vaccines encoded by live recombinant human adenovirus type 5 (rAdHu5). Specifically, dried rAdHu5 MA immunization induced CD8+ T-cell expansion and multifunctional cytokine responses equipotent with conventional injectable routes of immunization. Intravital imaging demonstrated MA cargo distributed both in the epidermis and dermis, with acquisition by CD11c+ dendritic cells (DCs) in the dermis. The MA immunizing properties were attributable to CD11c+ MHCIIhi CD8αneg epithelial cell adhesion molecule (EpCAMneg) CD11b+ langerin (Lang; CD207)neg DCs, but neither Langerhans cells nor Lang+ DCs were required for CD8+ T-cell priming. This study demonstrates an important technical advance for viral vaccine vectors progressing to the clinic and provides insights into the mechanism of CD8+ T-cell priming by live rAdHu5 MAs. PMID:23386724

Langerin negative dendritic cells promote potent CD8+ T-cell priming by skin delivery of live adenovirus vaccine microneedle arrays.

PubMed

Bachy, Veronique; Hervouet, Catherine; Becker, Pablo D; Chorro, Laurent; Carlin, Leo M; Herath, Shanthi; Papagatsias, Timos; Barbaroux, Jean-Baptiste; Oh, Sea-Jin; Benlahrech, Adel; Athanasopoulos, Takis; Dickson, George; Patterson, Steven; Kwon, Sung-Yun; Geissmann, Frederic; Klavinskis, Linda S

2013-02-19

Stabilization of virus protein structure and nucleic acid integrity is challenging yet essential to preserve the transcriptional competence of live recombinant viral vaccine vectors in the absence of a cold chain. When coupled with needle-free skin delivery, such a platform would address an unmet need in global vaccine coverage against HIV and other global pathogens. Herein, we show that a simple dissolvable microneedle array (MA) delivery system preserves the immunogenicity of vaccines encoded by live recombinant human adenovirus type 5 (rAdHu5). Specifically, dried rAdHu5 MA immunization induced CD8(+) T-cell expansion and multifunctional cytokine responses equipotent with conventional injectable routes of immunization. Intravital imaging demonstrated MA cargo distributed both in the epidermis and dermis, with acquisition by CD11c(+) dendritic cells (DCs) in the dermis. The MA immunizing properties were attributable to CD11c(+) MHCII(hi) CD8α(neg) epithelial cell adhesion molecule (EpCAM(neg)) CD11b(+) langerin (Lang; CD207)(neg) DCs, but neither Langerhans cells nor Lang(+) DCs were required for CD8(+) T-cell priming. This study demonstrates an important technical advance for viral vaccine vectors progressing to the clinic and provides insights into the mechanism of CD8(+) T-cell priming by live rAdHu5 MAs.

Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng Zongwu; Bald, Ilko; Illenberger, Eugen

2007-10-14

Highly charged heavy ion traversal of a biological medium can produce energetic secondary fragment ions. These fragment ions can in turn cause collisional and reactive scattering damage to DNA. Here we report hyperthermal (1-100 eV) scattering of one such fragment ion (N{sup +}) from biologically relevant sugar molecules D-ribose and 2-deoxy-D-ribose condensed on polycrystalline Pt substrate. The results indicate that N{sup +} ion scattering at kinetic energies down to 10 eV induces effective decomposition of both sugar molecules and leads to the desorption of abundant cation and anion fragments. Use of isotope-labeled molecules (5-{sup 13}C D-ribose and 1-D D-ribose) partlymore » reveals some site specificity of the fragment origin. Several scattering reactions are also observed. Both ionic and neutral nitrogen atoms abstract carbon from the molecules to form CN{sup -} anion at energies down to {approx}5 eV. N{sup +} ions also abstract hydrogen from hydroxyl groups of the molecules to form NH{sup -} and NH{sub 2}{sup -} anions. A fraction of O/O{sup -} fragments abstract hydrogen to form OH{sup -}. The formation of H{sub 3}O{sup +} ions also involves hydrogen abstraction as well as intramolecular proton transfer. These findings suggest a variety of severe damaging pathways to DNA molecules which occur on the picosecond time scale following heavy ion irradiation of a cell, and prior to the late diffusion-limited homogeneous chemical processes.« less

HPLC and TLC methods for analysis of [18F]FDG and its metabolites from biological samples.

PubMed

Rokka, Johanna; Grönroos, Tove J; Viljanen, Tapio; Solin, Olof; Haaparanta-Solin, Merja

2017-03-24

The most used positron emission tomography (PET) tracer, 2-[ 18 F]fluoro-2-deoxy-d-glucose ([ 18 F]FDG), is a glucose analogue that is used to measure tissue glucose consumption. Traditionally, the Sokoloff model is the basis for [ 18 F]FDG modeling. According to this model, [ 18 F]FDG is expected to be trapped in a cell in the form of [ 18 F]FDG-6-phosphate ([ 18 F]FDG-6-P). However, several studies have shown that in tissues, [ 18 F]FDG metabolism goes beyond [ 18 F]FDG-6-P. Our aim was to develop radioHPLC and radioTLC methods for analysis of [ 18 F]FDG metabolites from tissue samples. The radioHPLC method uses a sensitive on-line scintillation detector to detect radioactivity, and the radioTLC method employs digital autoradiography to detect the radioactivity distribution on a TLC plate. The HPLC and TLC methods were developed using enzymatically in vitro-produced metabolites of [ 18 F]FDG as reference standards. For this purpose, three [ 18 F]FDG metabolites were synthesized: [ 18 F]FDG-6-P, [ 18 F]FD-PGL, and [ 18 F]FDG-1,6-P2. The two methods were evaluated by analyzing the [ 18 F]FDG metabolic profile from rodent ex vivo tissue homogenates. The HPLC method with an on-line scintillation detector had a wide linearity in a range of 5Bq-5kBq (LOD 46Bq, LOQ 139Bq) and a good resolution (Rs ≥1.9), and separated [ 18 F]FDG and its metabolites clearly. The TLC method combined with digital autoradiography had a high sensitivity in a wide range of radioactivity (0.1Bq-2kBq, LOD 0.24Bq, LOQ 0.31Bq), and multiple samples could be analyzed simultaneously. As our test and the method validation with ex vivo samples showed, both methods are useful, and at best they complement each other in analysis of [ 18 F]FDG and its radioactive metabolites from biological samples. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of the C-2 hydroxyl group on the mesomorphism of alkyl glycosides: synthesis and thermotropic behavior of alkyl 2-deoxy-D-arabino-hexopyranosides.

PubMed

Singh, Madan Kumar; Jayaraman, Narayanaswamy; Rao, D S Shankar; Prasad, S Krishna

2008-10-01

A homologous series of alkyl 2-deoxy-alpha-d-arabino-hexopyranosides and alkyl 2-deoxy-beta-d-arabino-hexopyranosides were synthesized, upon glycosylation of 1-alkanols (from C8 to C18 alkanols) with ethyl 2-deoxy-3,4,6-tri-O-acetyl-1-thio-d-arabino-hexopyranoside, followed by a deprotection. The thermotropic behavior of these new types of alkyl glycosides was investigated. It was observed that the beta-anomers of these alkyl glycosides, bearing nonyl to tetradecyl alkyl chain are mesomorphic, exhibiting monotropic smectic A phase. In contrast, the alpha-anomers are all non-mesomorphic. An effort to identify the liquid crystalline behavior of binary mixtures of the alpha- and beta-anomers was undertaken and it was found that mixtures containing equimolar amounts of the anomers exhibited mesomorphic behavior. A fine balance of the hydrophilic and hydrophobic components within the molecule is also found to be important for the alkyl 2-deoxy glycosides to form the mesophase.

Glucose uptake in rat soleus - Effect of acute unloading and subsequent reloading

NASA Technical Reports Server (NTRS)

Henriksen, Eric J.; Tischler, Marc E.

1988-01-01

The effect of acutely reduced weight bearing (unloading) on the in vitro uptake of 2-1,2-H-3-deoxy-D-glucose was studied in the soleus muscle by tail casting and suspending rats. After just 4 h, the uptake of 2-deoxy-D-glucose fell (-19 percent) and declined further after an additional 20 h of unloading. This diminution at 24 h was associated with slower oxidation of C-14-glucose and incorporation of C-14-glucose into glycogen. At 3 days of unloading, basal uptake of 2-deoxy-D-glucose did not differ from control. Reloading of the soleus after 1 or 3 days of unloading increased uptake of 2-deoxy-D-glucose above control and returned it to normal within 6 h and 4 days, respectively. These effects of unloading and recovery were caused by local changes in the soleus, because the extensor digitorum longus from the same hindlimbs did not display any alterations in uptake of 2-deoxy-D-glucose or metabolism of glucose.

G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.; Deschenes, S.

We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

Findings of 2-fluoro-2-deoxy-d-glucose positron emission tomography in hemorrhoids.

PubMed

Tsai, Shih-Chuan; Jeng, Long-Bin; Yeh, Jun-Jun; Lin, Cheng-Chieh; Chen, Jin-Hua; Lin, Wan-Yu; Kao, Chia-Hung

2011-10-01

Hemorrhoids are very common in adults. The data regarding the incidence of high 2-fluoro-2-deoxy-D: -glucose (FDG) uptake in hemorrhoids is incomplete. In this study, we evaluated FDG uptake in hemorrhoids and calculated the rate of high FDG uptake in these lesions. One hundred and seventy six subjects who undertook whole body FDG-PET for health screening examination were investigated retrospectively. All patients had colonoscopy and 156 subjects were found to have hemorrhoids and 20 had no hemorrhoids. Quantitative analysis of FDG uptake in the anal region was performed by calculating the maximum standard uptake value (SUV(max)). The SUV(max) ranged from 1.8 to 4.1 (2.8 ± 0.6) for normal subjects and ranged from 1.4 to 8.3 (2.9 ± 0.8) for patients with hemorrhoids. No statistical difference was noted between these two groups using a Student's t-tests. If the highest SUV(max), which was 4.1 in normal subjects, was used as a cutoff, 5.1% (8/156) hemorrhoid patients had a SUV(max) greater than 4.1. Hemorrhoids can be one possible cause of focal high FDG uptake in the rectum.

Preferentially Cytotoxic Constituents of Andrographis paniculata and their Preferential Cytotoxicity against Human Pancreatic Cancer Cell Lines.

PubMed

Lee, Sullim; Morita, Hiroyuki; Tezuka, Yasuhiro

2015-07-01

In the course of our search for anticancer agents based on a novel anti-austerity strategy, we found that the 70% EtOH extract of the crude drug Andrographis Herba (aerial parts of Andrographis paniculata), used in Japanese Kampo medicines, killed PANC-1 human pancreatic cancer cells preferentially in nutrient-deprived medium (NDM). Phytochemical investigation of the 70% EtOH extract led to the isolation of 21 known compounds consisting of six labdane-type diterpenes (11, 15, 17-19, 21), six flavones (5, 7, 10, 12, 14, 20), three flavanones (2, 6, 16), two sterols (3, 8), a fatty acid (1), a phthalate (4), a triterpene (9), and a monoterpene (13). Among them, 14-deoxy-11,12-didehydroandrographolide (17) displayed the most potent preferential cytotoxicity against PANC-1 and PSN-1 cells with PC50 values of 10.0 μM and 9.27 μM, respectively. Microscopical observation, double staining with ethidium bromide (EB) and acridine orange (AO), and flow cytometry with propidium iodide/annexin V double staining indicated that 14-deoxy-11,12-didehydroandrographolide (17) triggered apoptosis-like cell death in NDM with an amino acids and/or serum-sensitive mode.

Low Volume Aerobic Training Heightens Muscle Deoxygenation in Early Post-Angina Pectoris Patients.

PubMed

Takagi, Shun; Murase, Norio; Kime, Ryotaro; Niwayama, Masatsugu; Osada, Takuya; Katsumura, Toshihito

2016-01-01

The aim of this study was to investigate the effect of low volume aerobic exercise training on muscle O2 dynamics during exercise in early post-angina pectoris (AP) patients, as a pilot study. Seven AP patients (age: 72 ± 6 years) participated in aerobic exercise training for 12 weeks. Training consisted of continuous cycling exercise for 30 min at the individual's estimated lactate threshold, and the subjects trained for 15 ± 5 exercise sessions over 12 weeks. Before and after training, the subjects performed ramp cycling exercise until exhaustion. Muscle O2 saturation (SmO2) and relative changes from rest in deoxygenated hemoglobin concentration (∆Deoxy-Hb) and total hemoglobin concentration (∆Total-Hb) were monitored at the vastus lateralis by near infrared spatial resolved spectroscopy during exercise. The SmO2 was significantly lower and ∆Deoxy-Hb was significantly higher after training than before training, while there were no significant changes in ∆Total-Hb. These results indicated that muscle deoxygenation and muscle O2 extraction were potentially heightened by aerobic exercise training in AP patients, even though the exercise training volume was low.

Method for heat treating iron-nickel-chromium alloy

DOEpatents

Korenko, Michael K.

1980-01-01

A method for heat treating an age-hardenable iron-nickel-chromium alloy to obtain a morphology of the gamma-double prime phase enveloping the gamma-prime phase, the alloy consisting essentially of about 40 to 50% nickel, 7.5 to 14% chromium, 1.5 to 4% niobium, 0.3 to 0.75% silicon, 1 to 3% titanium, 0.1 to 0.5% aluminum, 0.02 to 1% carbon, 0.002 to 0.0015% boron and the remain substantially all iron. To obtain optimal results, the alloy is cold-worked 20 to 60% followed by heating at 1050.degree. C. for 1/2 hour with an air-cool plus heating at 800.degree. C. for 2 hours with a furnace cool to 625.degree. C. The alloy is then held at 625.degree. C. for 12 hours, followed by an air-cool.

Blockade of mGluR5 in the nucleus accumbens shell but not core attenuates heroin seeking behavior in rats

PubMed Central

Lou, Zhong-ze; Chen, Ling-hong; Liu, Hui-feng; Ruan, Lie-min; Zhou, Wen-hua

2014-01-01

Aim: Glutamatergic neurotransmission in the nucleus accumbens (NAc) is crucial for the relapse to heroin seeking. The aim of this study was to determine whether mGluR5 in the NAc core or shell involved in heroin seeking behavior in rats. Methods: Male SD rats were self-administered heroin under a fixed-ratio 1 (FR1) reinforcement schedule for 14 d, and subsequently withdrawn for 2 weeks. The selective mGluR5 antagonist 2-methyl-6-phenylethynyl-pyridine (MPEP, 5, 15 and 50 nmol per side) was then microinjected into the NAc core or shell 10 min before a heroin-seeking test induced by context, cues or heroin priming. Results: Microinjection of MPEP into the NAc shell dose-dependently decreased the heroin seeking induced by context, cues or heroin priming. In contrast, microinjection of MPEP into the NAc core did not alter the heroin seeking induced by cues or heroin priming. In addition, microinjection with MPEP (15 nmol per side) in the NAc shell reversed both the percentage of open arms entries (OE%) and the percentage of time spent in open arms (OT%) after heroin withdrawal. Microinjection of MPEP (50 nmol per side) in the striatum as a control location did not affect the heroin seeking behavior. Microinjection of MPEP in the 3 locations did not change the locomotion activities. Conclusion: Blockade of mGluR5 in NAc shell in rats specifically suppresses the relapse to heroin-seeking and anxiety-like behavior, suggesting that mGluR5 antagonists may be a potential candidate for the therapy of heroin addiction. PMID:25399651

Tooth surface treatment strategies for adhesive cementation

PubMed Central

2017-01-01

PURPOSE The aim of this study was to evaluate the effect of tooth surface pre-treatment steps on shear bond strength, which is essential for understanding the adhesive cementation process. MATERIALS AND METHODS Shear bond strengths of different cements with various tooth surface treatments (none, etching, priming, or etching and priming) on enamel and dentin of human teeth were measured using the Swiss shear test design. Three adhesives (Permaflo DC, Panavia F 2.0, and Panavia V5) and one self-adhesive cement (Panavia SA plus) were included in this study. The interface of the cement and the tooth surface with the different pre-treatments was analyzed using SEM. pH values of the cements and primers were measured. RESULTS The highest bond strength values for all cements were achieved with etching and primer on enamel (25.6 ± 5.3 - 32.3 ± 10.4 MPa). On dentin, etching and priming produced the highest bond strength values for all cements (8.6 ± 2.9 - 11.7 ± 3.5 MPa) except for Panavia V5, which achieved significantly higher bond strengths when pre-treated with primer only (15.3 ± 4.1 MPa). Shear bond strength values were correlated with the micro-retentive surface topography of enamel and the tag length on dentin except for Panavia V5, which revealed the highest bond strength with primer application only without etching, resulting in short but sturdy tags. CONCLUSION The highest bond strength can be achieved for Panavia F 2.0, Permaflo DC, and Panavia SA plus when the tooth substrate is previously etched and the respective primer is applied. The new cement Panavia V5 displayed low technique-sensitivity and attained significantly higher adhesion of all tested cements to dentin when only primer was applied. PMID:28435616

In 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated primates, the selective 5-hydroxytryptamine 1a agonist (R)-(+)-8-OHDPAT inhibits levodopa-induced dyskinesia but only with\\ increased motor disability.

PubMed

Iravani, Mahmoud M; Tayarani-Binazir, Kayhan; Chu, Wing B; Jackson, Michael J; Jenner, Peter

2006-12-01

5-Hydroxytryptamine 1a (5-HT(1a)) receptor agonists, such as sarizotan and tandospirone, are reported to reduce levodopa-induced dyskinesia in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-treated macaques and in Parkinson's disease without worsening motor disability. However, these compounds are not specific for 5-HT(1a) receptors and also possess dopamine antagonist actions. We now report on the effects of (2R)-(+)-8-hydroxy-2-(di-n-propylamino)tetralin [(R)-(+)-8-OHDPAT], a selective 5-HT(1a) agonist lacking dopaminergic activity, on motor disability and dyskinesia (chorea and dystonia) in levodopa-primed MPTP-treated common marmosets. Administration of (R)-(+)-8-OHDPAT (0.2, 0.6, and 2.0 mg/kg s.c), in conjunction with levodopa/carbidopa (12.5 mg/kg each p.o.) to levodopa-primed animals, dose-dependently reduced levodopa-induced chorea but did not affect dystonic movements. However, (R)-(+)-8-OHDPAT treatment also reduced locomotor activity and the reversal of motor disability. Administration of (R)-(+)-8-OHDPAT alone had no effects of motor behaviors. The effects of (R)-(+)-8-OHDPAT on levodopa-induced motor behaviors were antagonized by the 5-HT(1a) receptor antagonist N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-2-pyridinylcyclohexanecarboxamide maleate (WAY-100635) (1.0 mg/kg s.c.). Administration of (R)-(+)-8-OHDPAT (0.6 mg/kg s.c.) also reduced chorea produced by the administration of the D(2)/D(3) dopamine receptor agonist pramipexole (0.06 mg/kg p.o.) to levodopa-primed MPTP-treated animals. However, again the increase in locomotor activity and reversal of motor disability produced by pramipexole were also inhibited. These data suggest that selective 5-HT(1a) agonists do not provide an effective means of suppressing levodopa-induced dyskinesia, except with worsening of parkinsonism.

Elevation of plasma 1-deoxy-sphingolipids in type 2 diabetes mellitus: a susceptibility to neuropathy?

PubMed

Dohrn, M F; Othman, A; Hirshman, S K; Bode, H; Alecu, I; Fähndrich, E; Karges, W; Weis, J; Schulz, J B; Hornemann, T; Claeys, K G

2015-05-01

Diabetic distal sensorimotor polyneuropathy (DSPN) is a frequent, disabling complication of diabetes mellitus. There is increasing evidence that sphingolipids play a role in insulin resistance and type 2 diabetes (T2DM). Whether neurotoxic 1-deoxy-sphingolipids are elevated in DSPN patients' plasma and whether levels correlate to the DSPN stage were examined. The plasma profile of 12 sphingoid bases in patients with DSPN and T2DM(n = 39) were cross-sectionally compared to other nerve disorders including chronic inflammatory demyelinating polyneuropathy (CIDP) (n = 13), transthyretin-related familial amyloid polyneuropathy (FAP) (n = 10), amyotrophic lateral sclerosis (ALS) (n = 13) and small fibre neuropathy (n = 12) by liquid chromatography mass spectrometry. Correlations to the DSPN stage were additionally performed. Furthermore, the sphingoid base distribution in sural nerve specimens was measured in patients with DSPN (n = 6) compared to CIDP (n = 3). A significantly increased amount of 1-deoxy-sphingolipids [1-deoxy-sphinganine (0.11 ± 0.06 μmol/l), 1-deoxy-sphingosine (0.24 ± 0.16 μmol/l)] in patients with DSPN was observed compared to age-matched healthy controls (0.06 ± 0.03 μmol/l; 0.12 ± 0.05 μmol/l) and to the other groups. (Para)clinical parameters including sensory loss, neuropathic pain, weakness, vibration perception, nerve conduction velocity, sensory nerve action potentials (sural nerve) and duration of T2DM did not correlate with plasma 1-deoxy-sphingolipid levels, neither did the clinical stage according to the Dyck classification for DSPN. Sphingolipid levels in sural nerve biopsies showed no differences between DSPN and CIDP. Contrarily, patients with a small fibre neuropathy had decreased C₂₀-sphingosine plasma levels. 1-deoxy-sphingolipid plasma levels are significantly elevated in DSPN. They are already detectable in early disease stages but do not correlate with the clinical course. Further knowledge on 1-deoxy-sphingolipids might lead to a better pathophysiological understanding and future treatment options in DSPN. © 2015 EAN.

How sex puts you in gendered shoes: sexuality-priming leads to gender-based self-perception and behavior.

PubMed

Hundhammer, Tanja; Mussweiler, Thomas

2012-07-01

Scripts for sexual behavior dictate that women be submissive and tender and that men be assertive and dominant, reflecting the stereotypical view of women as communal and of men as agentic. Six experiments tested the hypothesis that exposure to sexuality cues causes men's and women's momentary self-perceptions and concomitant behavior to become more gender-typical. Using both pictorial and verbal prime materials that were presented both supraliminally and subliminally, we found that sex-priming strengthened gender-based self-perceptions (i.e., faster self-categorization as a woman or man; Study 1), heightened identification with one's own gender (Study 2), increased gender self-stereotyping (Study 3), and elicited greater submissiveness in women's behavior and greater assertiveness in men's behavior (Studies 4 and 5). These findings indicate that sex-priming causes self-perception and social behavior to become "attuned" to gender stereotypes. Study 6 demonstrated that these sex-priming effects can be eliminated by modern gender role primes. The potentially detrimental effects of sex-priming and possible countermeasures are discussed. PsycINFO Database Record (c) 2012 APA, all rights reserved

PSI-7851, a pronucleotide of beta-D-2'-deoxy-2'-fluoro-2'-C-methyluridine monophosphate, is a potent and pan-genotype inhibitor of hepatitis C virus replication.

PubMed

Lam, Angela M; Murakami, Eisuke; Espiritu, Christine; Steuer, Holly M Micolochick; Niu, Congrong; Keilman, Meg; Bao, Haiying; Zennou, Veronique; Bourne, Nigel; Julander, Justin G; Morrey, John D; Smee, Donald F; Frick, David N; Heck, Julie A; Wang, Peiyuan; Nagarathnam, Dhanapalan; Ross, Bruce S; Sofia, Michael J; Otto, Michael J; Furman, Phillip A

2010-08-01

The hepatitis C virus (HCV) NS5B RNA polymerase facilitates the RNA synthesis step during the HCV replication cycle. Nucleoside analogs targeting the NS5B provide an attractive approach to treating HCV infections because of their high barrier to resistance and pan-genotype activity. PSI-7851, a pronucleotide of beta-D-2'-deoxy-2'-fluoro-2'-C-methyluridine-5'-monophosphate, is a highly active nucleotide analog inhibitor of HCV for which a phase 1b multiple ascending dose study of genotype 1-infected individuals was recently completed (M. Rodriguez-Torres, E. Lawitz, S. Flach, J. M. Denning, E. Albanis, W. T. Symonds, and M. M. Berry, Abstr. 60th Annu. Meet. Am. Assoc. Study Liver Dis., abstr. LB17, 2009). The studies described here characterize the in vitro antiviral activity and cytotoxicity profile of PSI-7851. The 50% effective concentration for PSI-7851 against the genotype 1b replicon was determined to be 0.075+/-0.050 microM (mean+/-standard deviation). PSI-7851 was similarly effective against replicons derived from genotypes 1a, 1b, and 2a and the genotype 1a and 2a infectious virus systems. The active triphosphate, PSI-7409, inhibited recombinant NS5B polymerases from genotypes 1 to 4 with comparable 50% inhibitory concentrations. PSI-7851 is a specific HCV inhibitor, as it lacks antiviral activity against other closely related and unrelated viruses. PSI-7409 also lacked any significant activity against cellular DNA and RNA polymerases. No cytotoxicity, mitochondrial toxicity, or bone marrow toxicity was associated with PSI-7851 at the highest concentration tested (100 microM). Cross-resistance studies using replicon mutants conferring resistance to modified nucleoside analogs showed that PSI-7851 was less active against the S282T replicon mutant, whereas cells expressing a replicon containing the S96T/N142T mutation remained fully susceptible to PSI-7851. Clearance studies using replicon cells demonstrated that PSI-7851 was able to clear cells of HCV replicon RNA and prevent viral rebound.

APOLLO-SOYUZ TEST PROJECT (ASTP) - CREWMEN - JSC

NASA Image and Video Library

1975-07-09

S75-28361 (9 July 1975) --- These ten American astronauts compose the U.S. prime crew, the backup crew and the crew support team for the joint U.S.-USSR Apollo-Soyuz Test Project docking mission in Earth orbit. They are, left to right, Robert L. Crippen, support team; Robert F. Overmyer, support team; Richard H. Truly, support team; Karol J. Bobko, support team; Donald K. Slayton, prime crew docking module pilot; Thomas P. Stafford, prime crew commander; Vance D. Brand, prime crew command module pilot; Jack R. Lousma, backup crew docking module pilot; Ronald E. Evans, backup crew command module pilot; and Alan L. Bean, backup crew commander. They are photographed by the Apollo Mission Simulator console in Building 5 at NASA's Johnson Space Center.

Development of space stable semitransparent polyquinoxaline films

NASA Technical Reports Server (NTRS)

Hergenrother, P. M.

1972-01-01

Three polyphenylquinoxalines underwent preliminary study for potential use as coatings on aircraft and spacecraft. These polymers were prepared from the reaction of 3,3 prime, 4,4 prime-tetraaminodiphenyl ether with p,p prime-oxydibenzil and with m -bis (phenylglyoxalyl) benzene and from the reaction of 3,3 prime, 4,4 prime-tetraaminodiphenylsulfone with p,p prime-oxydibenzil. High purity reactants and solvents were used in polymer preparation to minimize color in the polymer films. High molecular weight polymers were prepared at ambient temperature at 12 to 15 percent concentration by upsetting the stoichiometry by 0.5 to 1.0 percent in favor of the bis (1,2-dicarbonyl) reactant. A portion of each polymer was endcapped with benzil and with o-phenylenediamine. Certain properties of the endcapped and unendcapped versions of each polymer are compared. Uniform films of 2.0 and 0.1 mil thickness were cast from solutions of the unendcapped and endcapped versions of each of the three polymers.

Sodium-dependent transport of sugars and iodide from the cerebral venticles of the rabbit.

PubMed

Bradbury, M W; Brondsted, H E

1973-10-01

1. The objective was to discover whether the extraction of sugars and iodide from the perfused cerebral ventricles is Na(+)-dependent.2. In the ventriculo-aqueductal and ventriculo-cisternal perfusion systems in the rabbit the extraction of (14)C-labelled D-hexoses (glucose, 3-O-methyl-glucose, alpha-methyl-glucoside and galactose), (131)I(-) and (24)Na was inhibited when 82% of the Na(+) in the perfusion fluid was replaced by choline. The extraction returned to control levels when the Na(+) concentration in the perfusion fluid was returned to normal.3. Ouabain, 5 x 10(-5)M in the perfusion fluid inhibited the extraction of the above (14)C sugars and (131)I(-), but hardly affected that of [(3)H]2-deoxy-D-glucose. It enhanced the extraction of (24)Na. C.s.f. production was usually totally inhibited.4. The extraction of [(14)C]urea remained unchanged during perfusion with low Na(+) fluid or ouabain.5. Recovery from brain of [(14)C]3-O-methyl-glucose, [(3)H]2-deoxy-glucose and (131)I(-) was low while recovery of [(14)C]alpha-methyl-glucoside and (24)Na was high. On an equal weight basis recovery of [(14)C]3-O-methyl-glucose was about twelve times higher from the choroid plexus than from the brain.6. Part of the movement of (14)C sugars may be explained on basis of a Na(+)-gradient hypothesis with involvement of the Na(+) pump at the blood-c.s.f. or blood-brain barriers.7. The rate of c.s.f. production from the first three ventricles comprised about 40% of the rate from all four ventricles. The extraction of sugars, urea and cations was similar in both perfusion systems while the extraction of (131)I(-) was higher in the ventriculo-cisternal system than in the ventriculo-aqueductal system.

Development and Single-Laboratory Validation of a Liquid Chromatography Tandem Mass Spectrometry Method for Quantitation of Tetrodotoxin in Mussels and Oysters.

PubMed

Turner, Andrew D; Boundy, Michael J; Rapkova, Monika Dhanji

2017-09-01

In recent years, evidence has grown for the presence of tetrodotoxin (TTX) in bivalve mollusks, leading to the potential for consumers of contaminated products to be affected by Tetrodotoxin Shellfish Poisoning (TSP). A single-laboratory validation was conducted for the hydrophilic interaction LC (HILIC) tandem MS (MS/MS) analysis of TTX in common mussels and Pacific oysters-the bivalve species that have been found to contain TTXs in the United Kingdom in recent years. The method consists of a single-step dispersive extraction in 1% acetic acid, followed by a carbon SPE cleanup step before dilution and instrumental analysis. The full method was developed as a rapid tool for the quantitation of TTX, as well as for the associated analogs 4-epi-TTX; 5,6,11-trideoxy TTX; 11-nor TTX-6-ol; 5-deoxy TTX; and 4,9-anhydro TTX. The method can also be run as the acquisition of TTX together with paralytic shellfish toxins. Results demonstrated acceptable method performance characteristics for specificity, linearity, recovery, ruggedness, repeatability, matrix variability, and within-laboratory reproducibility for the analysis of TTX. The LOD and LOQ were fit-for-purpose in comparison to the current action limit for TTX enforced in The Netherlands. In addition, aspects of method performance (LOD, LOQ, and within-laboratory reproducibility) were found to be satisfactory for three other TTX analogs (11-nor TTX-6-ol, 5-deoxy TTX, and 4,9-anhydro TTX). The method was found to be practical and suitable for use in regulatory testing, providing rapid turnaround of sample analysis. Plans currently underway on a full collaborative study to validate a HILIC-MS/MS method for paralytic shellfish poisoning toxins will be extended to include TTX in order to generate international acceptance, ultimately for use as an alternative official control testing method should regulatory controls be adopted.

Up-Regulation of 1-Deoxy-d-Xylulose-5-Phosphate Synthase Enhances Production of Essential Oils in Transgenic Spike Lavender1

PubMed Central

Muñoz-Bertomeu, Jesús; Arrillaga, Isabel; Ros, Roc; Segura, Juan

2006-01-01

Spike lavender (Lavandula latifolia) is an aromatic shrub cultivated worldwide for the production of essential oils. The major constituents of these oils are monoterpenes, which are obtained from isopentenyl diphosphate and dimethylallyl diphosphate precursors through the plastidial methylerythritol phosphate (MEP) pathway and/or the cytosolic mevalonate pathway. 1-Deoxy-d-xylulose-5-P synthase (DXS) catalyzes the first step of the MEP pathway. A cDNA coding for the Arabidopsis (Arabidopsis thaliana) DXS was constitutively expressed in spike lavender. Gas chromatography/mass spectrometry analyses revealed that transgenic plants accumulated significantly more essential oils compared to controls (from 101.5% to 359.0% and from 12.2% to 74.1% yield increase compared to controls in leaves and flowers, respectively). T0 transgenic plants were grown for 2 years, self-pollinated, and the T1 seeds obtained. The inheritance of the DXS transgene was studied in the T1 generation. The increased essential oil phenotype observed in the transgenic T0 plants was maintained in the progeny that inherited the DXS transgene. Total chlorophyll and carotenoid content in DXS progenies that inherited the transgene depended on the analyzed plant, showing either no variation or a significant decrease in respect to their counterparts without the transgene. Transgenic plants had a visual phenotype similar to untransformed plants (controls) in terms of morphology, growth habit, flowering, and seed germination. Our results demonstrate that the MEP pathway contributes to essential oil production in spike lavender. They also demonstrate that the DXS enzyme plays a crucial role in monoterpene precursor biosynthesis and, thus, in essential oil production in spike lavender. In addition, our results provide a strategy to increase the essential oil production in spike lavender by metabolic engineering of the MEP pathway without apparent detrimental effects on plant development and fitness. PMID:16980564

Fate of Escherichia coli O157:H7 in mechanically tenderized beef prime rib following searing, cooking, and holding under commercial conditions.

PubMed

Porto-Fett, Anna C S; Shoyer, Bradley A; Thippareddi, Harshavardhan; Luchansky, John B

2013-03-01

We evaluated the effect of commercial times and temperatures for searing, cooking, and holding on the destruction of Escherichia coli O157:H7 (ECOH) within mechanically tenderized prime rib. Boneless beef ribeye was inoculated on the fat side with ca. 5.7 log CFU/g of a five-strain cocktail of ECOH and then passed once through a mechanical tenderizer with the fat side facing upward. The inoculated and tenderized prime rib was seared by broiling at 260°C for 15 min in a conventional oven and then cooked in a commercial convection oven at 121.1°C to internal temperatures of 37.8, 48.9, 60.0, and 71.1°C before being placed in a commercial holding oven maintained at 60.0°C for up to 8 h. After searing, ECOH levels decreased by ca. 1.0 log CFU/g. Following cooking to internal temperatures of 37.8 to 71.1°C, pathogen levels decreased by an additional ca. 2.7 to 4.0 log CFU/g. After cooking to 37.8, 48.9, or 60.0°C and then warm holding at 60.0°C for 2 h, pathogen levels increased by ca. 0.2 to 0.7 log CFU/g. However, for prime rib cooked to 37.8°C, pathogen levels remained relatively unchanged over the next 6 h of warm holding, whereas for those cooked to 48.9 or 60.0°C pathogen levels decreased by ca. 0.3 to 0.7 log CFU/g over the next 6 h of warm holding. In contrast, after cooking prime rib to 71.1°C and holding for up to 8 h at 60.0°C, ECOH levels decreased by an additional ca. 0.5 log CFU/g. Our results demonstrated that to achieve a 5.0-log reduction of ECOH in blade tenderized prime rib, it would be necessary to sear at 260°C for 15 min, cook prime rib to internal temperatures of 48.9, 60.0, or 71.1°C, and then hold at 60.0°C for at least 8 h.

Organic materials with nonlinear optical properties

DOEpatents

Stupp, S.I.; Son, S.; Lin, H.C.

1995-05-02

The present invention is directed to organic materials that have the ability to double or triple the frequency of light that is directed through the materials. Particularly, the present invention is directed to the compound 4-[4-(2R)-2-cyano-7-(4{prime}-pentyloxy-4-biphenylcarbonyloxy)phenylheptylidenephenylcarbonyloxy]benzaldehyde, which can double the frequency of light that is directed through the compound. The invention is also directed to the compound (12-hydroxy-5,7-dodecadiynyl)-4{prime}-[(4{prime}-pentyloxy-4-biphenyl)carbonyloxy]-4-biphenylcarboxylate, and its polymeric form. The polymeric form can triple the frequency of light directed through it. 4 figs.

Microstructural observations in rapidly-solidified and heat-treated Ni3Al-Cr alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carro, G.; Flanagan, W.F.

1992-08-01

The microstructural development following heat treatments of several rapidly-solidified Ni3Al-Cr and Ni3Al-Cr-B alloys is presented. Depending on composition, the as-solidified samples were either 100 percent gamma-prime phase - in the form of fine antiphase domains (APD) - or a mixture of gamma-prime (APDs) and beta phases. Upon annealing, the as-solidified microstructures transform to either APD-free gamma-prime or mixtures of gamma and gamma-prime phases. For those compositions where the quenched microstructures were 100 percent gamma-prime it was observed that APD coarsening followed conventional grain-growth kinetics, but when gamma phase precipitated on the APD boundaries the rate constant changed abruptly while themore » time exponent remained unaffected. It was also found that alloys containing critical amounts of chromium and boron are susceptible to precipitation of the boride Cr5B3. 14 refs.« less

Microstructural observations in rapidly-solidified and heat-treated Ni3Al-Cr alloys

NASA Technical Reports Server (NTRS)

Carro, G.; Flanagan, W. F.

1992-01-01

The microstructural development following heat treatments of several rapidly-solidified Ni3Al-Cr and Ni3Al-Cr-B alloys is presented. Depending on composition, the as-solidified samples were either 100 percent gamma-prime phase - in the form of fine antiphase domains (APD) - or a mixture of gamma-prime (APDs) and beta phases. Upon annealing, the as-solidified microstructures transform to either APD-free gamma-prime or mixtures of gamma and gamma-prime phases. For those compositions where the quenched microstructures were 100 percent gamma-prime it was observed that APD coarsening followed conventional grain-growth kinetics, but when gamma phase precipitated on the APD boundaries the rate constant changed abruptly while the time exponent remained unaffected. It was also found that alloys containing critical amounts of chromium and boron are susceptible to precipitation of the boride Cr5B3.

Reconciling Mechanistic Hypotheses About Rhizosphere Priming

NASA Astrophysics Data System (ADS)

Cheng, W.

2016-12-01

Rhizosphere priming on soil organic matter decomposition has emerged as a key mechanism regulating biogeochemnical cycling of carbon, nitrogen and other elements from local to global scales. The level of the rhizosphere priming effect on decomposition rates can be comparable to the levels of controls from soil temperature and moisture conditions. However, our understanding on mechanisms responsible for rhizosphere priming remains rudimentary and controversial. The following individual hypotheses have been postulated in the published literature: (1) microbial activation, (2) microbial community succession, (3) aggregate turnover, (4) nitrogen mining, (5) nutrient competition, (6) preferential substrate utilization, and (7) drying-rewetting. Meshing these hypotheses with existing empirical evidence tends to support a general conclusion: each of these 7 hypotheses represents an aspect of the overall rhizosphere priming complex while the relative contribution by each individual aspect varies depending on the actual plant-soil conditions across time and space.

Category priming with aliens: analysing the influence of targets' prototypicality on the centre surround inhibition mechanism.

PubMed

Frings, Christian; Göbel, Ariane; Mast, Frank; Sutter, Julia; Bermeitinger, Christina; Wentura, Dirk

2011-08-01

Marginally perceptible prototypes as primes lead to slowed reactions to related category exemplars as compared to unrelated ones. This at first glance counterintuitive finding has been interpreted as evidence for a particular mechanism of lateral inhibition, namely the centre surround inhibition mechanism. We investigated the semantic surround of category labels by experimentally manipulating the prototypicality of stimuli. Participants first learned two new categories of fantasy creatures in a 5-day-long learning phase before they worked through a semantic priming task with the category prototypes as primes and category exemplars as targets. For high-prototypical targets we observed benefit effects from related primes, whereas for low-prototypical targets we observed cost effects. The results define when the centre surround inhibition mechanism is applied, and furthermore might explain why previous studies with word stimuli (i.e., material that prevents experimental manipulation of prototypicality) observed mixed results concerning the prototypicality of targets.

Effects of Rhenium Addition on the Temporal Evolution of the Nanostructure and Chemistry of a Model Ni-Cr-Al Superalloy. 1; Experimental Observations

NASA Technical Reports Server (NTRS)

Yoon, Kevin E.; Noebe, Ronald D.; Seidman, David N.

2006-01-01

The temporal evolution of the nanostructure and chemistry of a model Ni-8.5 at.% Cr-10 at. % Al alloy, with the addition of 2 at.% Re, aged at 1073 K from 0.25 to 264 h, was studied. Transmission electron microscopy and atom-probe tomography were used to measure the number density and mean radius of the gamma prime (L1(sub 2) structure)-precipitates and the chemistry of the gamma prime-precipitates and the gamma (face-centered cubic)-matrix, including the partitioning behavior of all alloying elements between the gamma- and gamma prime-phases and the segregation behavior at gamma/gamma prime interfaces. The precipitates remained spheroidal for an aging time of up to 264 h and, unlike commercial nickel-based superalloys containing Re, there was not confined (nonmonotonic) Re segregation at the gamma/gamma prime interfaces.

Gamma Prime Precipitation, Dislocation Densities, and TiN in Creep-Exposed Inconel 617 Alloy

NASA Astrophysics Data System (ADS)

Krishna, Ram; Atkinson, Helen V.; Hainsworth, Sarah V.; Gill, Simon P.

2016-01-01

Inconel 617 is a solid-solution-strengthened Ni-based superalloy with a small amount of gamma prime (γ') present. Here, samples are examined in the as-received condition and after creep exposure at 923 K (650 °C) for 574 hours and 45,000 hours and at 973 K (700 °C) for 4000 hours. The stress levels are intermediate (estimated, respectively, as of the order of 350, 275, and 200 MPa) and at levels of interest for the future operation of power plant. The hardness of the specimens has been measured in the gage length and the head. TEM thin foils have been obtained to quantify dislocation densities (3.5 × 1013 for the as-received, 5.0 × 1014, 5.9 × 1014, and 3.5 × 1014 lines/m2 for the creep-exposed specimens, respectively). There are no previous data in the literature for dislocation densities in this alloy after creep exposure. There is some evidence from the dislocation densities that for the creep-exposed samples, the higher hardness in the gage length in comparison with the creep test specimen head is due to work hardening rather than any other effect. Carbon replicas have been used to extract gamma prime precipitates. The morphology of γ' precipitates in the `as-received' condition was spheroidal with an average diameter of 18 nm. The morphology of these particles does not change with creep exposure but the size increases to 30 nm after 574 hours at 923 K (650 °C) but with little coarsening in 45,000 hours. At 973 K (700 °C) 4000 hours, the average gamma prime size is 32 nm. In the TEM images of the replicas, the particles overlap, and therefore, a methodology has been developed to estimate the volume fraction of gamma prime in the alloy given the carbon replica film thickness. The results are 5.8 vol pct in the as-received and then 2.9, 3.2, and 3.4 vol pct, respectively, for the creep-exposed specimens. The results are compared with predictions from thermodynamic analysis given the alloy compositions. Thermodynamic prediction shows that nitrogen content is important in determining the gamma prime volume fraction. This has not previously been identified in the literature. The higher the nitrogen content, the lower the gamma prime volume fraction. This may explain inconsistencies between previous experimental estimates of gamma prime volume fraction in the literature and the results here. The observed decrease in the γ' volume fraction with creep exposure would correspond to an increase in TiN. At present, there are insufficient experimental data to prove that this predicted relationship occurs in practice. However, it is observed that there is a higher volume fraction of TiN precipitates in the gage length of a creep sample than in the head. This suggests that secondary TiN particles are precipitating at the expense of existing γ' due to the ingress of N from the atmosphere, possibly via creep cracks penetrating in from the surface of the gage length. This effect is not expected to be observed in real components which are much larger and operate in different atmospheres. However, this highlights the need to be conscious of this possibility when carrying out creep testing.

Apollo 9 prime crew inside Apollo command module boilerplate during training

NASA Image and Video Library

1968-11-05

S68-54850 (5 Nov. 1968) --- The prime crew of the Apollo 9 (Spacecraft 104/Lunar Module 3/Saturn 504) space mission are seen inside an Apollo command module boilerplate during water egress training activity in the Gulf of Mexico. From foreground, are astronauts James A. McDivitt, commander; David R. Scott, command module pilot; and Russell L. Schweickart, lunar module pilot.

Priming Infants to Use Pattern Information in an Object Individuation Task: The Role of Comparison

ERIC Educational Resources Information Center

Wilcox, Teresa; Smith, Tracy; Woods, Rebecca

2011-01-01

There is evidence that 4.5-month-olds do not always use surface pattern to individuate objects but that they can be primed to attend to pattern differences through select experiences. For example, if infants are first shown events in which the pattern of an object predicts its function (dotted containers pound and striped containers pour), they…

The Role of Negative Priming in Preschoolers' Flexible Rule Use on the Dimensional Change Card Sort Task

ERIC Educational Resources Information Center

Muller, Ulrich; Dick, Anthony Steven; Gela, Katherine; Overton, Willis F.; Zelazo, Philip David

2006-01-01

Four experiments examined the development of negative priming (NP) in 3-5-year-old children using as a measure of children's executive function (EF) the dimensional change card sort (DCCS) task. In the NP version of the DCCS, the values of the sorting dimension that is relevant during the preswitch phase are removed during the postswitch phase.…

KSC-2009-1366

NASA Image and Video Library

2008-11-04

VANDENBERG AIR FORCE BASE, Calif. – The latest polar-orbiting operational environmental weather satellite developed by NASA for the National Oceanic and Atmospheric Administration, called NOAA-N Prime, is being offloaded from the C-5A military cargo aircraft at Vandenberg Air Force Base, Calif., in preparation for a Feb. 4 launch. NOAA-N Prime, built by Lockheed Martin, is similar to NOAA-N launched on May 20, 2005.

The written voice: implicit memory effects of voice characteristics following silent reading and auditory presentation.

PubMed

Abramson, Marianne

2007-12-01

After being familiarized with two voices, either implicit (auditory lexical decision) or explicit memory (auditory recognition) for words from silently read sentences was assessed among 32 men and 32 women volunteers. In the silently read sentences, the sex of speaker was implied in the initial words, e.g., "He said, ..." or "She said...". Tone in question versus statement was also manipulated by appropriate punctuation. Auditory lexical decision priming was found for sex- and tone-consistent items following silent reading, but only up to 5 min. after silent reading. In a second study, similar lexical decision priming was found following listening to the sentences, although these effects remained reliable after a 2-day delay. The effect sizes for lexical decision priming showed that tone-consistency and sex-consistency were strong following both silent reading and listening 5 min. after studying. These results suggest that readers create episodic traces of text from auditory images of silently read sentences as they do during listening.

pH profile of the adsorption of nucleotides onto montmorillonite. I - Selected homoionic clays

NASA Technical Reports Server (NTRS)

Lawless, J. G.; Church, F. M.; Mazzurco, J.; Banin, A.; Huff, R.; Kao, J.; Cook, A.; Lowe, T.; Orenberg, J. B.; Edelson, E.

1985-01-01

The effect of pH and adsorbed ions on the adsorption of purine and pyrimidine nucleotides on montmorillonite clay was studied experimentally. The specific nucleotides examined were: 5 prime-AMP; 3-prime AMP; and 5 prime-CMP. The pH of the clay samples was adjusted to various levels in the 2-12 pH range using microliter volumes of concentrated acid (1N HCl) and base (1NHNaOH). It was found that preferential adsorption among nulceotides was dependent on the pH level and on the characteristics of the substituted metal cation and anion exchange mechanisms. Below pH 4, adsorption was attributed to cation and anion exchange mechanisms. Above pH 4, however, adsorption was attributed to the complexation mechanisms occurring between the metal cations in the clay exchange site and in the biomolecule. The possible role of homoionic clays in the concentration mechanisms of biomonomers in the prebiotic environment is discussed.

The influence of time of maternal exposure to 2,4,5,2 prime ,4 prime ,5 prime -hexachlorobiphenyl on its accumulation in their nursing offspring

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gallenberg, L.A.; Ring, B.J.; Vodicnik, M.J.

2,4,5,2',4',5'-Hexachlorobiphenyl (6-CB) is mobilized from rodent tissues during the lipid depletion associated with food restriction or lactation, the latter condition resulting in the substantial elimination of the maternal body burden of the chemical to nursing offspring. The present study was undertaken to determine whether the rate and/or magnitude of accumulation of 6-CB in nursing offspring differed with time following PCB administration to the maternal animal. Female ICR mice were administered two doses of 6-CB. Group I animals received (14C)-6-CB as weanlings (15-20 g) followed by unlabeled 6-CB 5 weeks later, after mating, on Day 1 of gestation. Group II receivedmore » unlabeled 6-CB as weanlings and (14C)-6-CB on Day 1 of gestation. Thus, 14C identified the mobilization and elimination of either the first or the second dose of 6-CB in the treatment groups (I = (14C)-6-CB, 6-CB; II = 6-CB, (14C)-6-CB). Both groups of animals retained approximately 80% of the administered radiolabeled dose. The tissue distribution of (14C)-6-CB in group II as a percentage of the body burden was not different from that in group I as determined from maternal tissue concentrations on Day 14 of gestation. The percentage of the maternal body burden of (14C)-6-CB accumulated in suckling offspring of group II mothers was significantly greater than that in group I offspring on Day 1 (I, 2.2 +/- 0.5%; II, 3.5 +/- 0.4%), Day 3 (I, 14.8 +/- 1.9%; II, 24.6 +/- 2.7%), Day 5 (I, 16.8 +/- 1.4%; II, 24.8 +/- 0.8%), and Day 12 (I, 32.3 +/- 0.5%; II, 45.5 +/- 1.7%) postpartum. This differential elimination was reflected in the t1/2 of elimination of the radiolabeled dose from parametrial fat during lactation, which was significantly longer in group I (14 days) than group II maternal animals (9 days).« less

Improved tolerance to post-anthesis drought stress by pre-drought priming at vegetative stages in drought-tolerant and -sensitive wheat cultivars.

PubMed

Abid, Muhammad; Tian, Zhongwei; Ata-Ul-Karim, Syed Tahir; Liu, Yang; Cui, Yakun; Zahoor, Rizwan; Jiang, Dong; Dai, Tingbo

2016-09-01

Wheat crop endures a considerable penalty of yield reduction to escape the drought events during post-anthesis period. Drought priming under a pre-drought stress can enhance the crop potential to tolerate the subsequent drought stress by triggering a faster and stronger defense mechanism. Towards these understandings, a set of controlled moderate drought stress at 55-60% field capacity (FC) was developed to prime the plants of two wheat cultivars namely Luhan-7 (drought tolerant) and Yangmai-16 (drought sensitive) during tillering (Feekes 2 stage) and jointing (Feekes 6 stage), respectively. The comparative response of primed and non-primed plants, cultivars and priming stages was evaluated by applying a subsequent severe drought stress at 7 days after anthesis. The results showed that primed plants of both cultivars showed higher potential to tolerate the post-anthesis drought stress through improved leaf water potential, more chlorophyll, and ribulose-1, 5-bisphosphate carboxylase/oxygenase contents, enhanced photosynthesis, better photoprotection and efficient enzymatic antioxidant system leading to less yield reductions. The primed plants of Luhan-7 showed higher capability to adapt the drought stress events than Yangmai-16. The positive effects of drought priming to sustain higher grain yield were pronounced in plants primed at tillering than those primed at jointing. In consequence, upregulated functioning of photosynthetic apparatus and efficient enzymatic antioxidant activities in primed plants indicated their superior potential to alleviate a subsequently occurring drought stress, which contributed to lower yield reductions than non-primed plants. However, genotypic and priming stages differences in response to drought stress also contributed to affect the capability of primed plants to tolerate the post-anthesis drought stress conditions in wheat. Copyright © 2016. Published by Elsevier Masson SAS.

Bisphosphonate Inhibitors Reveal a Large Elasticity of Plastidic Isoprenoid Synthesis Pathway in Isoprene-Emitting Hybrid Aspen1

PubMed Central

2015-01-01

Recently, a feedback inhibition of the chloroplastic 1-deoxy-d-xylulose 5-phosphate (DXP)/2-C-methyl-d-erythritol 4-phosphate (MEP) pathway of isoprenoid synthesis by end products dimethylallyl diphosphate (DMADP) and isopentenyl diphosphate (IDP) was postulated, but the extent to which DMADP and IDP can build up is not known. We used bisphosphonate inhibitors, alendronate and zoledronate, that inhibit the consumption of DMADP and IDP by prenyltransferases to gain insight into the extent of end product accumulation and possible feedback inhibition in isoprene-emitting hybrid aspen (Populus tremula × Populus tremuloides). A kinetic method based on dark release of isoprene emission at the expense of substrate pools accumulated in light was used to estimate the in vivo pool sizes of DMADP and upstream metabolites. Feeding with fosmidomycin, an inhibitor of DXP reductoisomerase, alone or in combination with bisphosphonates was used to inhibit carbon input into DXP/MEP pathway or both input and output. We observed a major increase in pathway intermediates, 3- to 4-fold, upstream of DMADP in bisphosphonate-inhibited leaves, but the DMADP pool was enhanced much less, 1.3- to 1.5-fold. In combined fosmidomycin/bisphosphonate treatment, pathway intermediates accumulated, reflecting cytosolic flux of intermediates that can be important under strong metabolic pull in physiological conditions. The data suggested that metabolites accumulated upstream of DMADP consist of phosphorylated intermediates and IDP. Slow conversion of the huge pools of intermediates to DMADP was limited by reductive energy supply. These data indicate that the DXP/MEP pathway is extremely elastic, and the presence of a significant pool of phosphorylated intermediates provides an important valve for fine tuning the pathway flux. PMID:25926480

Divergent strategy for the synthesis of alpha-aryl-substituted fosmidomycin analogues.

PubMed

Devreux, Vincent; Wiesner, Jochen; Jomaa, Hassan; Rozenski, Jef; Van der Eycken, Johan; Van Calenbergh, Serge

2007-05-11

Fosmidomycin is the first representative of a new class of antimalarial drugs acting through inhibition of 1-deoxy-D-xylulose 5-phosphate (DOXP) reductoisomerase (DXR), an essential enzyme in the non-mevalonate pathway for the synthesis of isoprenoids. This work describes a divergent strategy for the synthesis of a series of alpha-aryl-substituted fosmidomycin analogues, featuring a palladium-catalyzed Stille coupling as the key step. An alpha-(4-cyanophenyl)fosmidomycin analogue emerged as the most potent analogue in the present series. Its antimalarial activity clearly surpasses that of the reference compound fosmidomycin.

Cyclopentenone prostaglandins as potential inducers of phase II detoxification enzymes. 15-deoxy-delta(12,14)-prostaglandin j2-induced expression of glutathione S-transferases.

PubMed

Kawamoto, Y; Nakamura, Y; Naito, Y; Torii, Y; Kumagai, T; Osawa, T; Ohigashi, H; Satoh, K; Imagawa, M; Uchida, K

2000-04-14

Exposure of cells to a wide variety of chemoprotective compounds confers resistance to a broad set of carcinogens. For a subset of the chemoprotective compounds, protection is generated by an increase in the abundance of protective enzymes, such as glutathione S-transferases (GSTs). In the present study, we developed a cell culture system that potently responds to phenolic antioxidants and found that antitumor prostaglandins (PGs) are potential inducers of GSTs. We screened primary hepatocytes and multiple cell lines for inducing GST activity upon incubation with the phenolic antioxidant (tert-butylhydroquinone) and found that rat liver epithelial RL34 cells most potently responded. Based on an extensive screening of diverse chemical agents on the induction of GST activity in RL34 cells, the J2 series of PGs, 15-deoxy-Delta(12,14)-prostaglandin J2 (15-deoxy-Delta(12,14)-PGJ2) in particular, were found to be potential inducers of GST. Enhanced gene expression of Class pi GST isozyme (GSTP1) by 15-deoxy-Delta(12,14)-PGJ2 was evident as a drastic elevation of the mRNA level. Hence, we examined the molecular mechanism underlying the 15-deoxy-Delta(12, 14)-PGJ2-induced GSTP1 gene expression. From functional analysis of various deletion mutant genes, we found that the 15-deoxy-Delta(12, 14)-PGJ2 reponse element was localized in a region containing a GSTP1 enhancer I (GPEI) that consists of two imperfect phorbol 12-O-tetradecanoylphorbol-13-acetate response elements. When the GPEI was combined with the minimum GSTP1 promoter, the element indeed showed an enhancer activity in response to 15-deoxy-Delta(12, 14)-PGJ2. Point mutations of either of the two imperfect 12-O-tetradecanoylphorbol-13-acetate response elements in GPEI completely abolished the enhancer activity. Gel mobility shift assays demonstrated that 15-deoxy-Delta(12,14)-PGJ2 specifically stimulated the binding of nuclear proteins including the transcription factor c-Jun, but not Nrf2, to GPEI. These results suggest that 15-deoxy-Delta(12,14)-PGJ2 induces the expression of the rat GSTP1 gene through binding of proteins, including c-Jun, to a specific GPEI.

5. VIEW EAST, height finder radar towers, radar tower (unknown ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. VIEW EAST, height finder radar towers, radar tower (unknown function), prime search radar tower, operations building, and central heating plant - Fort Custer Military Reservation, P-67 Radar Station, .25 mile north of Dickman Road, east of Clark Road, Battle Creek, Calhoun County, MI

Radio Selection of the Most Distant Galaxy Clusters

NASA Astrophysics Data System (ADS)

Daddi, E.; Jin, S.; Strazzullo, V.; Sargent, M. T.; Wang, T.; Ferrari, C.; Schinnerer, E.; Smolčić, V.; Calabró, A.; Coogan, R.; Delhaize, J.; Delvecchio, I.; Elbaz, D.; Gobat, R.; Gu, Q.; Liu, D.; Novak, M.; Valentino, F.

2017-09-01

We show that the most distant X-ray-detected cluster known to date, Cl J1001 at {z}{spec}=2.506, hosts a strong overdensity of radio sources. Six of them are individually detected (within 10\\prime\\prime ) in deep 0\\buildrel{\\prime\\prime}\\over{.} 75 resolution VLA 3 GHz imaging, with {S}3{GHz}> 8 μ {Jy}. Of the six, an active galactic nucleus (AGN) likely affects the radio emission in two galaxies, while star formation is the dominant source powering the remaining four. We searched for cluster candidates over the full COSMOS 2 deg2 field using radio-detected 3 GHz sources and looking for peaks in {{{Σ }}}5 density maps. Cl J1001 is the strongest overdensity by far with > 10σ , with a simple {z}{phot}> 1.5 preselection. A cruder photometric rejection of z< 1 radio foregrounds leaves Cl J1001 as the second strongest overdensity, while even using all radio sources Cl J1001 remains among the four strongest projected overdensities. We conclude that there are great prospects for future deep and wide-area radio surveys to discover large samples of the first generation of forming galaxy clusters. In these remarkable structures, widespread star formation and AGN activity of massive galaxy cluster members, residing within the inner cluster core, will ultimately lead to radio continuum as one of the most effective means for their identification, with detection rates expected in the ballpark of 0.1-1 per square degree at z≳ 2.5. Samples of hundreds such high-redshift clusters could potentially constrain cosmological parameters and test cluster and galaxy formation models.

Increased Plasma Levels of Select Deoxy-ceramide and Ceramide Species are Associated with Increased Odds of Diabetic Neuropathy in Type 1 Diabetes: A Pilot Study.

PubMed

Hammad, Samar M; Baker, Nathaniel L; El Abiad, Jad M; Spassieva, Stefanka D; Pierce, Jason S; Rembiesa, Barbara; Bielawski, Jacek; Lopes-Virella, Maria F; Klein, Richard L

2017-03-01

Plasma deoxy-sphingoid bases are elevated in type 2 diabetes patients and correlate with the stage of diabetic distal sensorimotor polyneuropathy; however, associations between deoxy-sphingolipids (DSL) and neuropathy in type 1 diabetes have not been examined. The primary aim of this exploratory pilot study was to assess the associations between multiple sphingolipid species including DSL and free amino acids and the presence of symptomatic neuropathy in a DCCT/EDIC type 1 diabetes subcohort. Using mass spectroscopy, plasma levels of DSL and free amino acids in DCCT/EDIC type 1 diabetes participants (n = 80), with and without symptoms of neuropathy, were investigated. Patient-determined neuropathy was based on 15-item self-administered questionnaire (Michigan Neuropathy Screening Instrument) developed to assess distal symmetrical peripheral neuropathy in diabetes. Patients who scored ≥4, or reported inability to sense their feet during walking or to distinguish hot from cold water while bathing were considered neuropathic. Plasma levels of ceramide, sphingomyelin, hexosyl- and lactosylceramide species, and amino acids were measured and analyzed relative to neuropathy status in the patient. Deoxy-C24-ceramide, C24- and C26-ceramide were higher in patients with neuropathy than those without neuropathy. Cysteine was higher in patients with neuropathy. No differences in other sphingolipids or amino acids were detected. The covariate-adjusted Odds Ratios of positive patient-reported neuropathy was associated with increased levels of deoxy-C24-, and deoxy-C24:1-ceramide; C22-, C24-, and C26-ceramide; and cysteine. Plasma deoxy-ceramide and ceramide species may have potential diagnostic and prognostic significance in diabetic neuropathy.

Increased Plasma Levels of Select Deoxy-ceramide and Ceramide Species are Associated with Increased Odds of Diabetic Neuropathy in Type 1 Diabetes: A Pilot Study

PubMed Central

Baker, Nathaniel L.; El Abiad, Jad M.; Spassieva, Stefanka D.; Pierce, Jason S.; Rembiesa, Barbara; Bielawski, Jacek; Lopes-Virella, Maria F.; Klein, Richard L.; Investigators, DCCT/EDIC Group of

2017-01-01

Plasma deoxy-sphingoid bases are elevated in type 2 diabetes patients and correlate with the stage of diabetic distal sensorimotor polyneuropathy; however, associations between deoxy-sphingolipids (DSL) and neuropathy in type 1 diabetes have not been examined. The primary aim of this exploratory pilot study was to assess the associations between multiple sphingolipid species including DSL and free amino acids and the presence of symptomatic neuropathy in a DCCT/EDIC type 1 diabetes subcohort. Using mass spectroscopy, plasma levels of DSL and free amino acids in DCCT/EDIC type 1 diabetes participants (n = 80), with and without symptoms of neuropathy, were investigated. Patient-determined neuropathy was based on 15-item self-administered questionnaire (Michigan Neuropathy Screening Instrument) developed to assess distal symmetrical peripheral neuropathy in diabetes. Patients who scored ≥4, or reported inability to sense their feet during walking or to distinguish hot from cold water while bathing were considered neuropathic. Plasma levels of ceramide, sphingomyelin, hexosyl- and lactosylceramide species, and amino acids were measured and analyzed relative to neuropathy status in the patient. Deoxy-C24-ceramide, C24- and C26-ceramide were higher in patients with neuropathy than those without neuropathy. Cysteine was higher in patients with neuropathy. No differences in other sphingolipids or amino acids were detected. The covariate-adjusted Odds Ratios of positive patient-reported neuropathy was associated with increased levels of deoxy-C24-, and deoxy-C24:1-ceramide; C22-, C24-, and C26-ceramide; and cysteine. Plasma deoxy-ceramide and ceramide species may have potential diagnostic and prognostic significance in diabetic neuropathy. PMID:27388466

Synthesis and In Vitro Evaluation of 5-[18F]Fluoroalkyl Pyrimidine Nucleosides for Molecular Imaging of Herpes Simplex Virus Type-1 Thymidine Kinase Reporter Gene Expression

PubMed Central

Chacko, Ann-Marie; Qu, Wenchao; Kung, Hank F.

2014-01-01

Two novel series of 5-fluoroalkyl-2′-deoxyuridines (FPrDU, FBuDU, FPeDU) and 2′-fluoro-2′-deoxy-5-fluoroalkylarabinouridines (FFPrAU, FFBuAU, FFPeAU), having three, four or five methylene units (propyl, butyl, or pentyl) at C-5, were prepared and tested as reporter probes for imaging HSV1-tk gene expression. The Negishi coupling methodology was employed to efficiently synthesize the radiolabeling precursors. All six 5-[18F]fluoroalkyl pyrimidines were prepared readily from 3-N-benzoyl-3′,5′-di-O-benzoyl-protected 5-O-mesylate precursors in 17–35% radiochemical yield (decay-corrected). In vitro studies highlighted that all six [18F]labeled nucleosides selectively accumulated in cells expressing the HSV1-TK protein, with negligible uptake in control cells. [18F]FPrDU, [18F]FBuDU, [18F]FPeDU, and [18F]FFBuAU had the best uptake profiles. Despite selective accumulation in HSV1-tk expressing cells, all 5-fluoroalkyl pyrimidine nucleosides had low to negligible cytotoxic activity (CC50>1000–209 μM). Ultimately, results demonstrated that 5-[18F]fluoropropyl, [18F]fluorobutyl, and [18F]fluoropentyl pyrimidine nucleosides have potential as in vivo HSV1-TK PET reporter probes over a dynamic range of reporter gene expression levels. PMID:18800764

[HPLC Specific Fingerprint of Alcohol Extract of Andrographis paniculata].

PubMed

Liu, Fei-fei; Fan, Chun-lin; Huang, Xiao-jun; Wang, Gui-yang; Wang, Ying; Ye, Wen-cai

2015-07-01

To establish the specific fingerprint of alcohol extract of Andrographis paniculata by HPLC. The analysis was performed on Cosmosil 5C18 -MS-II (250 mm x 4. 6 mm, 5 µm) column, with gradient phase consisting of acetonitrile and water at the flow rate of 1. 0 mL/min. The UV detection wavelength was set at 225 nm, and column temperature was 30 °C. The specific fingerprint chromatogram was established and seven common peaks were identified by comparison with the reference standards and LC-MS. The relative retention times were 1. 00 (No. 1, andrographolide), 1. 04 (No. 2, deoxyandrographoside), 1. 07 (No. 3, isoandrographolide), 1. 10 (No. 4, 14-deoxy-11, 12-didehydroandrographoside), 1. 50 (No. 5, neoandrographolide), 1. 75 ( No. 6, deoxyandrographolide) and 1. 79 (No. 7, dehydroandrographolide). The method is simple and reproducible with high precision, which can provide the basis for the quality control and evaluation of alcohol extract of Andrographis paniculata and its preparations.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

PubMed

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

Analysis of amadori-glycated phosphatidylethanolamine in the plasma of healthy subjects and diabetic patients by liquid chromatography-tandem mass spectrometry.

PubMed

Miyazawa, Teruo; Ibusuki, Daigo; Yamashita, Shinji; Nakagawa, Kiyotaka

2008-04-01

Peroxidized phospholipid-mediated cytotoxity, the abnormal increase in the levels of phosphatidylcholine hydroperoxide (PCOOH) found in the plasma of type 2 diabetic patients, is involved in the pathophysiology of many diseases. PCOOH accumulation may be related to Amadori-glycated phosphatidylethanolamine (deoxy-D-fructosyl PE, or Amadori-PE) because Amadori-PE causes oxidative stress. However, the occurrence of lipid glycation products, including Amadori-PE, in vivo remains unclear. We developed a method to analyze Amadori-PE by using quadrupole/linear ion-trap mass spectrometry, the Applied Biosystems 4000 Q TRAP. We found that pyridoxals could easily be condensed with PE before the glucose-PE reaction occurred. The PE-pyridoxal 5'-phosphate adduct was detectable in human red blood cells, and the increased plasma Amadori-PE concentration in streptozotocin-induced diabetic rats was decreased by dietary supplementation with pyridoxal 5'-phosphate. Therefore, it is likely that pyridoxal 5'-phosphate acts as a lipid glycation inhibitor in vivo, and this may contribute to diabetes prevention.

Comparison of Prime Movers Suitable for USMC Expeditionary Power Sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Theiss, T J; Conklin, J. C.; Thomas, John F.

2000-04-18

This report documents the results of the ORNL investigation into prime movers that would be desirable for the construction of a power system suitable for the United States Marine Corps (USMC) expeditionary forces under Operational Maneuvers From The Sea (OMFTS) doctrine. Discrete power levels of {approx}1, 5, 15, and 30 kW are considered. The only requirement is that the prime mover consumes diesel fuel. A brief description is given for the prime movers to describe their basic scientific foundations and relative advantages and disadvantages. A list of key attributes developed by ORNL has been weighted by the USMC to indicatemore » the level of importance. A total of 14 different prime movers were scored by ORNL personnel in four size ranges (1,5, 15, & 30 kW) for their relative strength in each attribute area. The resulting weighted analysis was used to indicate which prime movers are likely to be suitable for USMC needs. No single engine or prime mover emerged as the clear-cut favorite but several engines scored as well or better than the diesel engine. At the higher load levels (15 & 30 kW), the results indicate that the open Brayton (gas turbine) is a relatively mature technology and likely a suitable choice to meet USMC needs. At the lower power levels, the situation is more difficult and the market alone is not likely to provide an optimum solution in the time frame desired (2010). Several prime movers should be considered for future developments and may be satisfactory; specifically, the Atkinson cycle, the open Brayton cycle (gas turbine), the 2-stroke diesel. The rotary diesel and the solid oxide fuel cell should be backup candidates. Of all these prime movers, the Atkinson cycle may well be the most suitable for this application but is an immature technology. Additional demonstrations of this engine will be conducted at ORNL. If this analysis is positive, then the performance of a generator set using this engine, the open Brayton and the 2-stroke diesel should be estimated to evaluate its potential suitability for expeditionary forces. The overriding conclusion of this effort is that we feel a suitable prime mover can be found but that the development will be technically challenging and trade-offs will be made before an optimum solution is found.« less

Development and characteristics of a subline of Ehrlich ascites carcinoma cells persistently resistant to 5-fluoro-2'-deoxyuridine.

PubMed

Jastreboff, M M; Zielińska, Z M

1983-01-01

A subline of Ehrlich ascites carcinoma (EAC) cells resistant to 5-fluoro-2'-deoxy-uridine (FdUrd) was developed by continuous exposure to progressively increasing concentrations of the drug (35-75 mg/kg per day) during 15 passages through mice. Since then, the EAC cells have been retransplanted more than 80 times through drug-untreated mice and continue to be resistant. After adaptation to growth in suspension culture the drug-adapted cells were 1000 times more resistant to FdUrd in comparison with parental ones, and remained near-tetraploid with doubling time longer than in parental line. The activity of thymidine kinase was deeply depressed (100-fold) whereas that of thymidylate synthetase several-fold increased in the resistant EAC cells, both grown in vivo and in vitro.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Early-Emerging Cognitive Vulnerability to Depression and the Serotonin Transporter Promoter Region Polymorphism

PubMed Central

Hayden, Elizabeth P.; Dougherty, Lea R.; Maloney, Bryan; Olino, Thomas M.; Sheikh, Haroon; Durbin, C. Emily; Nurnberger, John I.; Lahiri, Debomoy K.; Klein, Daniel N.

2009-01-01

Background Serotonin transporter promoter (5-HTTLPR) genotype appears to increase risk for depression in the context of stressful life events. However, the effects of this genotype on measures of stress sensitivity are poorly understood. Therefore, this study examined whether 5-HTTLPR genotype was associated with negative information processing biases in early childhood. Method Thirty-nine unselected seven-year-old children completed a negative mood induction procedure and a self-referent encoding task designed to measure positive and negative schematic processing. Children were also genotyped for the 5-HTTLPR gene. Results Children who were homozygous for the short allele of the 5-HTTLPR gene showed greater negative schematic processing following a negative mood prime than those with other genotypes. 5-HTTLPR genotype was not significantly associated with positive schematic processing. Limitations The sample size for this study was small. We did not analyze more recently reported variants of the 5-HTTLPR long alleles. Conclusions 5-HTTLPR genotype is associated with negative information processing styles following a negative mood prime in a nonclinical sample of young children. Such cognitive styles are thought to be activated in response to stressful life events, leading to depressive symptoms; thus, cognitive styles may index the “stress-sensitivity” conferred by this genotype. PMID:17804080

Extended Minus-Strand DNA as Template for R-U5-Mediated Second-Strand Transfer in Recombinational Rescue of Primer Binding Site-Modified Retroviral Vectors

PubMed Central

Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou

1998-01-01

We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117

Food deprivation facilitates reinstatement of morphine-induced conditioned place preference: Role of intra-accumbal dopamine D2-like receptors in associating reinstatement of morphine CPP with stress.

PubMed

Sadeghzadeh, Fatemeh; Babapour, Vahab; Haghparast, Abbas

2017-04-01

The high rate of relapse to drug use is one of the main problems in the treatment of addiction. Stress plays the essential role in drug abuse and relapse; nevertheless, little is known about the mechanisms underlying stress and relapse. Accordingly, the effects of intra-accumbal administration of Sulpiride, as a dopamine D2-like receptor antagonist, on an ineffective morphine dose + food deprivation(FD)- and morphine priming-induced reinstatement of conditioned place preference (CPP). About 104 adult male albino Wistar rats weighing 200-280 g were bilaterally implanted by cannula into the nucleus accumbens (NAc). Subcutaneous (sc) injection of morphine (5 mg kg -1 ) was used daily during a 3-day conditioning phase. After a 24-hr "off" period following achievement of extinction criterion, rats were tested for FD- and priming-induced reinstatement of morphine CPP by an ineffective (0.5 mg kg -1 , sc) and priming (1 mg kg -1 , sc) dose of morphine, respectively. In the next experiments, animals received different doses of intra-accumbal Sulpiride (0.25, 1, and 4 µg/0.5 µL saline) bilaterally and were subsequently tested for morphine reinstatement. Our findings indicated that the 24-hr FD facilitated reinstatement of morphine CPP. Furthermore, the D2-like receptor antagonist attenuated the ineffective morphine dose+ FD- and priming-induced reinstatement of morphine CPP dose-dependently. Also, contribution of D2-like receptors in mediation of the ineffective morphine dose+ FD-induced reinstatement of CPP was greater than morphine priming-induced reinstatement of CPP. The role of dopaminergic system in morphine reinstatement through a neural pathway in the NAc provides the evidence that D2-like receptor antagonist can be useful therapeutic targets for reinstatement of morphine CPP. © 2016 Wiley Periodicals, Inc.

Potential drug sequestration during extracorporeal membrane oxygenation: results from an ex vivo experiment.

PubMed

Mehta, Nilesh M; Halwick, David R; Dodson, Brenda L; Thompson, John E; Arnold, John H

2007-06-01

Using an ex vivo simulation model we set out to estimate the amount of drug lost due to sequestration within the extracorporeal circuit over time. Simulated closed-loop extracorporeal membrane oxygenation (ECMO) circuits were prepared using a 1.5-m2 silicone membrane oxygenator. Group A consisted of heparin, dopamine, ampicillin, vancomycin, phenobarbital and fentanyl. Group B consisted of epinephrine, cefazolin, hydrocortisone, fosphenytoin and morphine. Drugs were tested in crystalloid and blood-primed circuits. After administration of a one-time dose of drugs in the priming fluid, baseline drug concentrations were obtained (P0). A simultaneous specimen was stored for stability testing at 24 h (P4). Serial post-membrane drug concentrations were then obtained at 30 min (P1), 3 h (P2) and 24 h (P3) from circuit fluid. One hundred and one samples were analyzed. At the end of 24 h in crystalloid-primed circuits, 71.8% of ampicillin, 96.7% of epinephrine, 17.6% of fosphenytoin, 33.3% of heparin, 17.5% of morphine and 87% of fentanyl was lost. At the end of 24 h in blood-primed extracorporeal circuits, 15.4% of ampicillin, 21% of cefazolin, 71% of voriconazole, 31.4% of fosphenytoin, 53.3% of heparin and 100% of fentanyl was lost. There was a significant decrease in overall drug concentrations from 30 min to 24 h for both crystalloid-primed circuits (p = 0.023) and blood-primed circuits (p = 0.04). Our ex vivo study demonstrates serial losses of several drugs commonly used during ECMO therapy. Therapeutic concentrations of fentanyl, voriconazole, antimicrobials and heparin cannot be guaranteed in patients on ECMO.

Synthesis of P1-(11-phenoxyundecyl)-P2-(2-acetamido-2-deoxy-3-O-α-D-rhamnopyranosyl-α-D-glucopyranosyl) diphosphate and P1-(11-phenoxyundecyl)-P2-(2-acetamido-2-deoxy-3-O-β-D-galactopyranosyl-α-D-galactopyranosyl) diphosphate for the investigation of biosynthesis of O-antigenic polysaccharides in Pseudomonas aeruginosa and Escherichia coli O104.

PubMed

Torgov, Vladimir; Danilov, Leonid; Utkina, Natalia; Veselovsky, Vladimir; Brockhausen, Inka

2017-12-01

Two new phenoxyundecyl diphosphate sugars were synthesized for the first time: P 1 -(11-phenoxyundecyl)-P 2 - (2-acetamido-2-deoxy-3-O-α-D-rhamnopyranosyl-α-D-glucopyranosyl) diphosphate and P 1 -(11-phenoxyundecyl)-P 2 -(2-acetamido-2-deoxy-3-O-β-D-galactopyranosyl-α-D-galactopyranosyl) diphosphate to study the third step of biosynthesis of the repeating units of O-antigenic polysaccharides in Pseudomonas aeruginosa and E.coli O104 respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

Late effects of radiation on the lumbar spinal cord of guinea pigs: Re-treatment tolerance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mason, K.A.; Withers, H.R.; Chiang, Chi-Shiun

Using a guinea pig model of lumbar myelopathy, various factors affecting the tolerance of spinal cord to irradiation were assessed: (a) extent of initial injury; (b) time interval between priming and test doses; and (c) animal age at the time of initial radiation treatment. A 3 cm section of lumbar spinal cord of guinea pigs was irradiated with fractionated doses of 4.5 Gy gamma rays given as 9 fractions per week. Guinea pigs were primed with 9 x 4.5 Gy in 7 days which is 60% of the ED[sub 50] for a continuous course of treatment. After 28 or 40more » weeks, animal were retreated with 6-14 fractions of 4.5 Gy. Animals were observed for 2 years following the priming dose and both the incidence and latency of myelopathy recorded. Young adult guinea pigs (8 wk old) showed both a decreased radiation tolerance and latency compared to old individuals (40 wk old). At 28 or 40 wk after 9 x 4.5 Gy, only about 8% of the initial injury was remembered in young adult guinea pigs. The amount of residual injury was dependent on the initial damage as a proportion of the tolerance dose. The spinal cord shows a greater capacity for long-term recovery than generally appreciated and re-treatment doses clinically prescribed may be lower than necessary. 8 refs., 3 figs., 2 tabs.« less

Administration of the glial cell modulator, minocycline, in the nucleus accumbens attenuated the maintenance and reinstatement of morphine-seeking behavior.

PubMed

Arezoomandan, Reza; Haghparast, Abbas

2016-03-01

Relapse to drug use is one of the most difficult clinical problems in treating addiction. Glial activation has been linked with the drug abuse, and the glia modulators such as minocycline can modulate the drug abuse effects. The aim of the present study was to determine whether minocycline could attenuate the maintenance and reinstatement of morphine. Conditioned place preference (CPP) was induced by subcutaneous injection of morphine (5 mg/kg) for 3 days. Following the acquisition of the CPP, the rats were given daily bilateral intra-NAc injections of either minocycline (1, 5, and 10 μg/0.5 μL) or saline (0.5 μL). The animals were tested for conditioning score 60 min after each injection. To induce the reinstatement, a priming dose of morphine (1 mg/kg) was injected 1 day after the final extinction day. The morphine-induced CPP lasted for 7 days after cessation of morphine treatment. Our data revealed that a priming dose of morphine could reinstate the extinguished morphine-induced CPP. Daily intra-accumbal injection of minocycline during the extinction period blocked the maintenance of morphine CPP and also attenuated the priming-induced reinstatement. Our findings indicated that minocycline could facilitate the extinction and attenuate the reinstatement of morphine. These results provided new evidence that minocycline might be considered as a promising therapeutic agent for the treatment of several symptoms associated with morphine abuse.

Emotional and neutral scenes in competition: orienting, efficiency, and identification.

PubMed

Calvo, Manuel G; Nummenmaa, Lauri; Hyönä, Jukka

2007-12-01

To investigate preferential processing of emotional scenes competing for limited attentional resources with neutral scenes, prime pictures were presented briefly (450 ms), peripherally (5.2 degrees away from fixation), and simultaneously (one emotional and one neutral scene) versus singly. Primes were followed by a mask and a probe for recognition. Hit rate was higher for emotional than for neutral scenes in the dual- but not in the single-prime condition, and A' sensitivity decreased for neutral but not for emotional scenes in the dual-prime condition. This preferential processing involved both selective orienting and efficient encoding, as revealed, respectively, by a higher probability of first fixation on--and shorter saccade latencies to--emotional scenes and by shorter fixation time needed to accurately identify emotional scenes, in comparison with neutral scenes.

Optimization of inactivated H5N9 highly pathogenic avian influenza vaccine and inactivated Salmonella enterica serovar Typhimurium vaccine with antigen dose and prime-boost regimen in domestic ducks.

PubMed

Yuk, Seong-Su; To, Eredene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Hong, Woo-Tack; Jeong, Jei-Hyun; Gwon, Gyeong-Bin; Song, Chang-Seon

2017-09-01

Owing to the increase in the number of diseases affecting ducks and the demand for food safety by consumers, vaccination has become one of the factors that influence duck meat productivity. The highly pathogenic avian influenza (HPAI) virus is one of the most prevalent and causes one of the most lethal diseases in domestic ducks, and Salmonella enterica serovar Typhimurium is a food-borne pathogen persistent in the domestic duck population. To better understand the optimal usage of HPAI and S. enterica serovar Typhimurium vaccines, we aimed to determine antigen dose, oil and gel adjuvant usage with prime-boost regimen, and vaccination age, inducing the best immune response in ducks, without an effect on body weight gain. In the case of the inactivated H5N9 vaccine, a single dose of vaccine was inadequate to induce proper antibody titer when administered to day-old ducks, which necessitates boost vaccination. Administration of the oil-adjuvanted H5N9 vaccine administration in day-old and 2-week-old ducks resulted in a lower body weight at the time of slaughtering, compared to that of gel-adjuvanted H5N9 vaccine. However, gel-adjuvanted H5N9 vaccine failed to induce proper immune response to an extent recommend by OIE-World Organization for Animal Health. In the case of the Salmonella enterica serovar Typhimurium vaccine, a moderate or low dose of vaccine was appropriate for day-old ducks receiving the gel prime-oil boost vaccination. Single vaccination with oil adjuvants affects the mean body weight of 7-week-old ducks, suggesting that the gel adjuvant is more suitable for meat production. We expect that the use of adjuvants in a prime-boost regimen and at antigen doses set in this study will be helpful to maximize body weight in the case of domestic duck production at the actual farm site. © 2017 Poultry Science Association Inc.

Fate of Escherichia coli O157:H7 in mechanically tenderized beef prime rib following searing, cooking and holding under commercial conditions

USDA-ARS?s Scientific Manuscript database

We evaluated the effect of commercial times/temperatures for searing, cooking, and holding for the destruction of Escherichia coli O157:H7 (ECOH) from mechanically tenderized prime rib. Boneless beef ribeye was inoculated on the fat side with ca. 5.7 log CFU/g of a five-strain cocktail of ECOH and t...

Derivations of a Prime Ring Which Satisfy a Polynomial Identity.

DTIC Science & Technology

1983-01-01

that R is commutative and prime, and present three minor but interesting results. We will see Lemma 3.5 again in Chapter 4. One should compare Lemmas 3.6...such that (6ztyy - yzt6y) # 0 and. (Xztyy - yztAy) # 0. By Lemna 3.8, X - d6 for some d E C. Therefore, y - aX + bS - a(dS) + bW - (ad + b)d and

ASTRONAUT SCOTT, DAVID R. - INTERIOR - WATER EGRESS TRAINING (GEMINI-TITAN [GT]-8 PRIME CREW) - MSC

NASA Image and Video Library

1966-01-05

S66-15743 (5 Jan. 1966) --- Astronaut David R. Scott, pilot of the Gemini-8 prime crew, undergoes water egress training in a special tank in building 260A at the Manned Spacecraft Center (MSC), Houston, Texas. An MSC swimmer assists in the training exercise. A boilerplate model of a Gemini spacecraft floats in the water beside Scott. Photo credit: NASA

Sensitivity of embryos of chicken, domestic duck, and common eider duck to polychlorinated and non-halogenated aromatic hydrocarbons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunstroem, B.

Embryos of chicken (Gallus domesticus), domestic duck (Anas platyrhynchos), and common eider duck (Somateria mollissima) were exposed in ovo to PCBs and to polycyclic aromatic hydrocarbons. Two coplanar PCBs, 3,3{prime},4,4{prime}-tetrachlorobiphenyl (PCB {number_sign}77) and 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PCB {number_sign}126), were considerably more lethal and potent as inducers of 7-ethoxyresorufin O-deethylase (EROD) in chicken embryos (Gallus domesticus) than in embryos of the other two species. In chicken embryos, these compounds caused edema and eye and beak deformities. An artificial mixture of 18 PAHs which all have been detected in environmental samples, was slightly more toxic to embryos of the domestic duck and the commonmore » eider duck than to chicken embryos. The most potent compound in the mixture was benzo(k)fluoranthene. When chicken embryo livers were exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in vitro, EROD was induced by very low concentrations and the EC{sub 50} value obtained was 5 {times} 10{sup {minus}12} M. Livers from embryos of eider ducks and domestic ducks were 2--4 orders of magnitude less responsive to TCDD than chicken embryo livers in terms of EROD induction in vitro.« less

Pharmacological Interventions for Acceleration of the Onset Time of Rocuronium: A Meta-Analysis

PubMed Central

Dong, Jing; Gao, Lingqi; Lu, Wenqing; Xu, Zifeng; Zheng, Jijian

2014-01-01

Background Rocuronium is an acceptable alternative when succinylcholine is contraindicated for facilitating the endotracheal intubation. However, the onset time of rocuronium for good intubation condition is still slower than that condition of succinylcholine. This study systematically investigated the most efficacious pharmacological interventions for accelerating the onset time of rocuronium. Methods Medline, Embase, Cochrane Library databases, www.clinicaltrials.gov, and hand searching from the reference lists of identified papers were searched for randomized controlled trials comparing drug interventions with placebo or another drug to shorten the onset time of rocuronium. Statistical analyses were performed using RevMan5.2 and ADDIS 1.16.5 softwares. Mean differences (MDs) with their 95% confidence intervals (95% CIs) were used to analyze the effects of drug interventions on the onset time of rocuronium. Results 43 randomized controlled trials with 2,465 patients were analyzed. The average onset time of rocuronium was 102.4±24.9 s. Priming with rocuronium [Mean difference (MD) −21.0 s, 95% confidence interval (95% CI) (−27.6 to −14.3 s)], pretreatment with ephedrine [−22.3 s (−29.1 to −15.5 s)], pretreatment with magnesium sulphate [−28.2 s (−50.9 to −5.6 s)] were all effective in reducing the onset time of rocuronium. Statistical testing of indirect comparisons showed that rocuronium priming, pretreatment with ephedrine, and pretreatment with magnesium sulphate had the similar efficacy. Conclusion Rocuronium priming, pretreatment with ephedrine, and pretreatment with magnesium sulphate were all effective in accelerating the onset time of rocuronium, and furthermore their efficacies were similar. Considering the convenience and efficacy, priming with rocuronium is recommended for accelerating the onset time of rocuronium. However, more strict clinical trials are still needed to reach a more solid conclusion due to the large heterogeneities exist among different studies. PMID:25460931

Can 3'-Deoxy-3'-((18)F) Fluorothymidine Out Perform 2-Deoxy-2-((18)F) Fluoro-D-Glucose Positron Emission Tomography/Computed Tomography in the Diagnosis of Cervical Lymphadenopathy in Patients With Oral/Head and Neck Cancer?

PubMed

Schaefferkoetter, Joshua D; Carlson, Eric R; Heidel, Robert E

2015-07-01

The present study investigated the performance of cellular metabolism imaging with 2-deoxy-2-((18)F) fluoro-D-glucose (FDG) versus cellular proliferation imaging with 3'-deoxy-3'-((18)F) fluorothymidine (FLT) in the detection of cervical lymph node metastases in oral/head and neck cancer. We conducted a prospective cohort study to assess a head-to-head performance of FLT imaging and clinical FDG imaging for characterizing cervical lymph node metastases in patients with squamous cell carcinoma (SCC) of the oral/head and neck region. The primary predictor variable of the study was the presence of FDG or FLT avidity within the cervical lymph nodes. The primary outcome variable was the histologic presence of metastatic SCC in the cervical lymph nodes. The performance was reported in terms of the sensitivity, specificity, accuracy, and positive and negative predictive values. The overall accuracy for discriminating positive from negative lymph nodes was evaluated as a function of the positron emission tomography (PET) standardized uptake value (SUV). Receiver operating characteristic (ROC) analyses were performed for both tracers. Eleven patients undergoing surgical resection of SCC of the oral/head and neck region underwent preoperative FDG and FLT PET-computed tomography (CT) scans on separate days. The interpretation of the FDG PET-CT imaging resulted in sensitivity, specificity, accuracy, positive predictive value, and negative predictive value of 43.2, 99.5, 94.4, 88.9, and 94.7%, respectively. The sensitivity, specificity, accuracy, positive predictive value, and negative predictive value for FLT PET-CT imaging was 75.7, 99.2, 97.1, 90.3, and 97.7%, respectively. The areas under the curve for the ROC curves were 0.9 and 0.84 for FDG and FLT, respectively. Poor correlation was observed between the SUV for FDG and FLT within the lymph nodes and tumors. FLT showed better overall performance for detecting lymphadenopathy on qualitative assessment within the total nodal population. This notwithstanding, FDG SUV performed better for pathologic discrimination within the visible lymph nodes. Copyright © 2015 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Synthesis, X-ray structure, and physical and photophysical properties of the heterobimetallic complex Fe({eta}{sup 5}-C{sub 5}H{sub 4}PPh{sub 2}){sub 2}Pt(bph)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, G.Y.; Rillema, D.P.; Reibenspies, J.H.

1999-02-22

A chromophore-electroactive compound, Fe({eta}{sup 5}-C{sub 5}H{sub 4}PPh{sub 2}){sub 2}Pt(bph), where bph is the biphenyl dianion and Fe({eta}{sup 5}C{sub 5}H{sub 4}PPh{sub 2}){sub 2} is 1,1{prime}-bis(diphenylphosphino)ferrocene-P,P{prime} has been synthesized. The single-crystal X-ray structural characteristics of this heterobimetallic complex and its disolvated methylene chloride derivative are respectively as follows: empirical formula C{sub 46}H{sub 36}FeP{sub 2}Pt. An electrochemical study shows that the anodic potential for the oxidation of the ferrocenyl moiety of this compound increases by +0.13 V, compared to that for Fe({eta}{sup 5}-C{sub 5}H{sub 4}PPh{sub 2}){sub 2}. This change in oxidation potential agrees well with the change in energy of 0.11 eV formore » the d{pi}(Fe) {yields} {pi}{sup *}(Cp) MLCT transition upon coordination with Pt. The resultant excited state from the d{pi}(Pt) {yields} {pi}{sup *}(bph) MLCT transition is readily quenched by the ferrocenyl moiety unit as expected, and charge-separated redox-active centers are formed.« less

A new glycation product ‘norpronyl-lysine,’ and direct characterization of cross linking and other glycation adducts: NMR of model compounds and collagen

PubMed Central

Bullock, Peter T. B.; Reid, David G.; Ying Chow, W.; Lau, Wendy P. W.; Duer, Melinda J.

2014-01-01

NMR is ideal for characterizing non-enzymatic protein glycation, including AGEs (advanced glycation endproducts) underlying tissue pathologies in diabetes and ageing. Ribose, R5P (ribose-5-phosphate) and ADPR (ADP-ribose), could be significant and underinvestigated biological glycating agents especially in chronic inflammation. Using [U-13C]ribose we have identified a novel glycoxidation adduct, 5-deoxy-5-desmethylpronyl-lysine, ‘norpronyl-lysine’, as well as numerous free ketones, acids and amino group reaction products. Glycation by R5P and ADPR proceeds rapidly with R5P generating a brown precipitate with PLL (poly-L-lysine) within hours. ssNMR (solid-state NMR) 13C–13C COSY identifies several crosslinking adducts such as the newly identified norpronyl-lysine, in situ, from the glycating reaction of 13C5-ribose with collagen. The same adducts are also identifiable after reaction of collagen with R5P. We also demonstrate for the first time bio-amine (spermidine, N-acetyl lysine, PLL) catalysed ribose 2-epimerization to arabinose at physiological pH. This work raises the prospect of advancing understanding of the mechanisms and consequences of glycation in actual tissues, in vitro or even ex vivo, using NMR isotope-labelled glycating agents, without analyses requiring chemical or enzymatic degradations, or prior assumptions about glycation products. PMID:27919030

Effects of autonomous motivational priming on motivation and affective responses towards high-intensity interval training.

PubMed

Brown, Denver M Y; Teseo, Amanda J; Bray, Steven R

2016-08-01

This study examined the effect of autonomous motivational priming on motivation, attitudes and intentions towards high-intensity interval training (HIT). Participants (N = 42) performed a graded exercise test to determine their peak aerobic power (WPEAK). At a subsequent testing session, participants were randomised to complete either an autonomous or neutral motivational priming task followed by a 10 × 1 HIT exercise protocol, alternating 1-min bouts of hard (70% WPEAK) and light (12.5% WPEAK) exercises for 20 min. Participants primed with autonomous motivation reported greater enjoyment, P = .009, ηp(2) = .16, and perceived competence, P = .005, ηp(2) = .18, post-exercise compared to those in the neutral priming condition. Participants in the autonomous motivational priming condition also reported more positive attitudes, P = .014, ηp(2) = .14, towards HIT; however, there was no difference between the conditions for task motivation during HIT or intentions, P = .53, ηp(2) = .01, to engage in HIT. These findings highlight autonomous motivational priming as a method of enhancing affective and motivational experiences regarding HIT.

The Evil Animal: A Terror Management Theory Perspective on the Human Tendency to Kill Animals.

PubMed

Lifshin, Uri; Greenberg, Jeff; Zestcott, Colin A; Sullivan, Daniel

2017-06-01

This research tested whether support for the killing of animals serves a terror management function. In five studies, death primes caused participants to support the killing of animals more than control primes, unless the participants' self-esteem had been elevated (Study 4). This effect was not moderated by gender, preexisting attitudes toward killing animals or animal rights, perceived human-animal similarity, religiosity, political orientation, or by the degree to which the killing was justified. Support for killing animals after subliminal death primes was also associated with an increased sense of power and invulnerability (Study 5). Implications and future directions are discussed.

Biosynthesis of the phytoalexin pisatin. [Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preisig, C.L.; Bell, J.N.; Matthews, D.E.

1990-11-01

NADPH-dependent reduction of 2{prime},7-dihydroxy-4{prime},5{prime}-methylenedioxyisoflavone to the isoflavanone sophorol, a proposed intermediate step in pisatin biosynthesis, was detected in extracts of Pisum sativum. This isoflavone reductase activity was inducible by treatment of pea seedlings with CuCl{sub 2}. The timing of induction coincided with that of the 6a-hydroxymaackiain 3-O-methyltransferase, which catalyzes the terminal biosynthetic step. Neither enzyme was light inducible. Further NADPH-dependent metabolism of sophorol by extracts of CuCl{sub 2}-treated seedlings was also observed; three products were radiolabeled when ({sup 3}H)sophorol was the substrate, one of which is tentatively identified as maackiain.

Dodecyl Amino Glucoside Enhances Transdermal and Topical Drug Delivery via Reversible Interaction with Skin Barrier Lipids.

PubMed

Kopečná, Monika; Macháček, Miloslav; Prchalová, Eva; Štěpánek, Petr; Drašar, Pavel; Kotora, Martin; Vávrová, Kateřina

2017-03-01

Skin permeation/penetration enhancers are substances that enable drug delivery through or into the skin. To search for new enhancers with high but reversible activity and acceptable toxicity, we synthesized a series of D-glucose derivatives, both hydrophilic and amphiphilic. Initial evaluation of the ability of these sugar derivatives to increase permeation and penetration of theophylline through/into human skin compared with a control (no enhancer) or sorbitan monolaurate (Span 20; positive control) revealed dodecyl 6-amino-6-deoxy-α-D-glucopyranoside 5 as a promising enhancer. Furthermore, this amino sugar 5 increased epidermal concentration of a highly hydrophilic antiviral cidofovir by a factor of 7. The effect of compound 5 on skin electrical impedance suggested its direct interaction with the skin barrier. Infrared spectroscopy of isolated stratum corneum revealed no effect of enhancer 5 on the stratum corneum proteins but an overall decrease in the lipid chain order. The enhancer showed acceptable toxicity on HaCaT keratinocyte and 3T3 fibroblast cell lines. Finally, transepidermal water loss returned to baseline values after enhancer 5 had been removed from the skin. Compound 5, a dodecyl amino glucoside, is a promising enhancer that acts through a reversible interaction with the stratum corneum lipids.

Flowery odor formation revealed by differential expression of monoterpene biosynthetic genes and monoterpene accumulation in rose (Rosa rugosa Thunb.).

PubMed

Feng, Liguo; Chen, Chen; Li, Tinglin; Wang, Meng; Tao, Jun; Zhao, Daqiu; Sheng, Lixia

2014-02-01

Rosa rugosa is an important ornamental and economical plant. In this paper, four genes encoding 1-deoxy-D-xylulose-5-phosphate synthase (DXS), 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), alcohol acyltransferase (AAT) and linalool synthase (LIS) involved in the monoterpene biosynthesis pathways were isolated from R. rugosa 'Tangzi', and the expression patterns of these genes in different flower development stages and different parts of floral organs were determined by real-time quantitative fluorescence PCR. Furthermore, a comprehensive analysis was carried out into the relationship between expression of four monoterpene synthesis genes and accumulation of main volatile monoterpenes and their acetic acid ester derivatives. The results showed that the genes RrDXS, RrDXR and RrLIS showed consistent expressions during the development process for R. rugosa flower from budding to withering stage, the overall expression levels of gene RrDXS and RrLIS were obviously lower as compared with those of gene RrDXR and RrAAT. Although the gene RrDXS, RrDXR, RrAAT and RrLIS were expressed in all parts of R. rugosa floral organs, the expression levels varied significantly. The variations in the constituent and content of volatile monoterpenes including citronellol, geraniol, nerol, linalool, citronellyl acetate, geranyl acetate and neryl acetate at different development stages and parts of floral organs were significantly different. On this basis, we concluded that the gene RrDXR and RrAAT might play a key role in the biosynthesis of volatile monoterpenes in R. rugosa flowers, and the two genes are important candidate genes for the regulation of secondary metabolism for rose aromatic components. Copyright © 2013 Elsevier Masson SAS. All rights reserved.