Science.gov

Sample records for metarhizium anisopliae ascomycota

  1. Biocontrol of pigeon tick Argas reflexus (Acari: Argasidae) by entomopathogenic fungus Metarhizium Anisopliae (Ascomycota: Hypocreales)

    PubMed Central

    Tavassoli, Mosa; Pourseyed, Seyed Hassan; Ownagh, Abdulghaffar; Bernousi, Iraj; Mardani, Karim

    2011-01-01

    The pigeon tick Argas reflexus is a pathogen-transmitting soft tick that typically feeds on pigeons, but can also attack humans causing local and systemic reactions. Chemical control is made difficult due to environmental contamination and resistance development. As a result, there is much interest in increasing the role of other strategies like biological control. In this study, the efficacy of three strains (V245, 685 and 715C) of entomopathogenic fungus Metarhizium anisopliae for biological control of three life stages of pigeon tick A. reflexus including eggs, larvae, engorged and unfed adults was investigated under laboratory conditions. Five concentrations of different strains of M. anisopliae ranging from 103 to 107 conidia/ml were used. All fungal strains significantly decreased hatchability of A. reflexus eggs. Strain V245 was the most effective strain on the mortality of larval stage with nearly 100% mortality at the lowest concentration (103 conidia/ml) at 10 days post-inoculation. The mortality rate of both engorged and unfed adult ticks were also increased significantly exposed to different conidial concentrations compared to the control groups (P < 0.05) making this fungus a potential biological control agent of pigeon tick reducing the use of chemical acaricides. PMID:24031777

  2. The use of a semiochemical bait to enhance exposure of Amblyomma variegatum (Acari: Ixodidae) to Metarhizium anisopliae (Ascomycota: Hypocreales).

    PubMed

    Nchu, F; Maniania, N K; Touré, A; Hassanali, A; Eloff, J N

    2009-03-23

    Experiments were conducted to explore the use of a semiochemical bait to enhance exposure of Amblyomma variegatum Fabricius (Acari: Ixodidae) to different formulations of the entomopathogenic fungus Metarhizium anisopliae (Metsch.) Sorok. (Ascomycota: Hypocreales). Initially, the relative efficacies of attraction-aggregation-attachment pheromone (AAAP), made up of o-nitrophenol, methyl salicylate and nonanoic acid in the ratio 2:1:8, 1-octen-3-ol and butyric acid, were evaluated in an olfactometer. Only AAAP and 1-octen-3-ol were found to elicit attractive responses to the tick. Simultaneous release of 1-octen-3-ol and AAAP together with CO(2) from a trap in semifield plots attracted up to 94.0+/-6% of adult ticks from a distance of 6m, and up to 24.0+/-5.1% from 8m. Formulations of M. anisopliae (dry powder, oil, and emulsifiable) applied within the trap baited with AAAP, 1-octen-3-ol and CO(2) resulted in high levels of contamination of the ticks attracted to the traps. However, 48h after autoinoculation, 89.1 and 33.3% of conidia were lost in dry powder and oil formulations, respectively. Emulsifiable formulation showed least loss of propagules (17.1%). Samples of ticks attracted to the baited traps were transferred to plastic basins containing grass and maintained for 5 weeks. The experiment was conducted in rainy and dry seasons. Emulsifiable formulation gave the highest relative tick reduction in both seasons: 54.7 and 46.5% in rainy and dry seasons, respectively, followed by oil formulation (32.0 and 23.8%) and powder formulation (38.0 and 24.4%).

  3. Cuticle Fatty Acid Composition and Differential Susceptibility of Three Species of Cockroaches to the Entomopathogenic Fungi Metarhizium anisopliae (Ascomycota, Hypocreales).

    PubMed

    Gutierrez, Alejandra C; Gołębiowski, Marek; Pennisi, Mariana; Peterson, Graciela; García, Juan J; Manfrino, Romina G; López Lastra, Claudia C

    2015-04-01

    Differences in free fatty acids (FFAs) chemical composition of insects may be responsible for susceptibility or resistance to fungal infection. Determination of FFAs found in cuticular lipids can effectively contribute to the knowledge concerning insect defense mechanisms. In this study, we have evaluated the susceptibility of three species of cockroaches to the entomopathogenic fungi Metarhizium anisopliae (Metschnikoff) Sorokin by topical application. Mortality due to M. anisopliae was highly significant on adults and nymphs of Blattella germanica L. (Blattodea: Blattellidae). However, mortality was faster in adults than in nymphs. Adults of Blatta orientalis L. (Blattodea: Blattidae) were not susceptible to the fungus, and nymphs of Blaptica dubia Serville (Blattodea: Blaberidae) were more susceptible to the fungus than adults. The composition of cuticular FFAs in the three species of cockroaches was also studied. The analysis indicated that all of the fatty acids were mostly straight-chain, long-chain, saturated or unsaturated. Cuticular lipids of three species of cockroaches contained 19 FFAs, ranging from C14:0 to C24:0. The predominant fatty acids found in the three studied species of cockroaches were oleic, linoleic, palmitic, and stearic acid. Only in adults of Bl. orientalis, myristoleic acid, γ-linolenic acid, arachidic acid, dihomolinoleic acid, and behenic acid were identified. Lignoceric acid was detected only in nymphs of Bl. orientalis. Heneicosylic acid and docosahexaenoic acid were identified in adults of Ba. dubia.

  4. New insights into the infection of the American cockroach Periplaneta americana nymphs with Metarhizium anisopliae s.l. (Ascomycota: Hypocreales).

    PubMed

    Gutierrez, A C; Machado, J A R; Hubner-Campos, R; Pennisi, M A; Rodrigues, J; López Lástra, C C; García, J J; Fernandes, É K K; Luz, C

    2016-11-01

    To study the marked resistance of Periplaneta americana to entomopathogenic Metarhizium anisopliae. The low susceptibility of 4th instar nymphs applied topically with conidia seemed to be related to an active removal of conidia by the cockroach and to a disabled or retarded germination and subsequent development of conidia on the cuticle (up to 80% germination in the next 7 days after application). Inhibitions or delays of germination were related to the composition of the epicuticular fatty acids (30·1% w/w oleic, 28·3% w/w linoleic, 24·5% w/w palmitic and 11·7% w/w stearic acid) reported here. Propagules invading the nymphs through the cuticle took at least 3 days to reach the haemocoel, and no propagules were found after day 8 post-treatment. Strain IP 46 infected >50% of nymphs treated with doses ≥2 × 10(4)  hyphal bodies (HB) nymph(-1) and reduced the survival of nymphs ≤50%. Most nymphs (>70%) survived after injection of 6 × 10(3) and 2 × 10(3)  HB nymph(-1) . Findings emphasize a distinct resistance of nymphs of the American cockroach to infections by M. anisopliae. Our findings provide support for the development of biological control of this synanthropic cockroach pest. © 2016 The Society for Applied Microbiology.

  5. Metarhizium anisopliae enzymes and toxins.

    PubMed

    Schrank, Augusto; Vainstein, Marilene Henning

    2010-12-15

    Entomopathogenic fungi are both a feasible system for the control of insect pests in agriculture with a growing market and an important model for studies of host-pathogen interaction. In the last ten years the actual use of fungi, mainly Metarhizium anisopliae and Beauveria bassiana, is increasing reaching commercial scale in Countries like Brazil, China and Mexico among others. At the same time important progress has occurred in the understanding of the molecular aspects of the pathogenesis and in the development of tools to validate putative virulence factors by the construction of over-expressing and knock-out strains. This wealth of knowledge is helping to access more efficient strains from the biodiversity and to optimize formulation for large scale use of this efficient, economic and environmental safer form of insect plague control. Here we focus some of the progress accumulated specially in M. anisopliae and give an overview of the host infection process.

  6. Metarhizium anisopliae (Ascomycota: Hypocreales): an effective alternative to chemical acaricides against different developmental stages of fowl tick Argas persicus (Acari: Argasidae).

    PubMed

    Pourseyed, S H; Tavassoli, M; Bernousi, I; Mardani, K

    2010-09-20

    The fowl bloodsucking tick Argas persicus is of great medical and veterinary importance in tropical and subtropical regions because of its role as vector of certain parasitic, bacterial and viral pathogens. A variety of acaricides are used for the control of tick infestation in poultry, resulting in environmental contamination and the development of resistance. In order to develop an alternative control method, the efficacy of three strains (V245, 685 and 715C) of entomopathogenic fungus Metarhizium anisopliae against different life stages of A. persicus including eggs, larvae, unfed and engorged adult females was evaluated under laboratory conditions. Five concentrations of different strains of M. anisopliae ranging from 10(3) to 10(7)conidia/ml were utilized. The effects of fungal strains on egg hatchability and larva and adult female mortality were significant and dose-dependent compared to the control groups (P<0.05). The mortality rates of larvae ranged from 92% to 100% for two different concentrations (10(3) and 10(4)conidia/ml) of M. anisopliae strains. Treated engorged females were more susceptible than the unfed females reaching mortality rate of 100% at the highest concentration (10(7)conidia/ml) at 18 days post-inoculation. Among strains used in this study, V245 was the most virulent strain regarding the LC(50) values for adult females exposed to fungal conidia. The results demonstrate that the application of M. anisopliae as a biocontrol agent is a promising option in reducing the use of chemical acaricides, resulting in benefits to poultry and the environment.

  7. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    EPA Science Inventory

    Introduction

    The goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  8. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    EPA Science Inventory

    Introduction

    The goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  9. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    EPA Science Inventory

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  10. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    EPA Science Inventory

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  11. Beauveria bassiana, Metarhizium anisopliae, and Metarhizium anisopliae var. acridum conidia: tolerance to imbibitional damage

    USDA-ARS?s Scientific Manuscript database

    When dry fungal cells are immersed in water, rapid imbibition (water uptake) may compromise the plasma membrane, killing the cell. This study investigated the impact of imbibitional damage (measured in terms of reduced viability) on Beauveria bassiana (Bb), Metarhizium anisopliae (Ma) and M. anisop...

  12. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    EPA Science Inventory

    Background
    The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  13. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    EPA Science Inventory

    Background
    The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  14. Serinocyclins A and B, Cyclic Heptapeptides from Metarhizium anisopliae

    USDA-ARS?s Scientific Manuscript database

    Two new cyclic heptapeptides, serinocyclins A (1) and B (2), were isolated from conidia of the entomopathogenic fungus Metarhizium anisopliae. Structures were elucidated by a combination of mass spectrometric, NMR, and X-ray diffraction techniques. Serinocyclin A (1) contains three serine units, a...

  15. 40 CFR 180.1303 - Metarhizium anisopliae strain F52; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Metarhizium anisopliae strain F52... RESIDUES IN FOOD Exemptions From Tolerances § 180.1303 Metarhizium anisopliae strain F52; exemption from... residues of Metarhizium anisopliae strain F52 in or on all food commodities when applied as an insecticide...

  16. The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

    PubMed

    Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

    2004-07-01

    The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

  17. Cecropins from Plutella xylostella and Their Interaction with Metarhizium anisopliae

    PubMed Central

    Freed, Shoaib; Gao, Yanfu; Yu, Jing; Wang, Shuang; Ju, Wenyan; Zhang, Yuqing; Jin, Fengliang

    2015-01-01

    Cecropins are the most potent induced peptides to resist invading microorganisms. In the present study, two full length cDNA encoding cecropin2 (Px-cec2) and cecropin3 (Px-cec3) were obtained from P. xylostella by integrated analysis of genome and transcriptome data. qRT-PCR analysis revealed the high levels of transcripts of Px-cecs (Px-cec1, Px-cec2 and Px-cec3) in epidermis, fat body and hemocytes after 24, 30 and 36 h induction of Metarhizium anisopliae, respectively. Silencing of Spätzle and Dorsal separately caused the low expression of cecropins in the fat body, epidermis and hemocytes, and made the P.xylostella larvae more susceptible to M. anisopliae. Antimicrobial assays demonstrated that the purified recombinant cecropins, i.e., Px-cec1, Px-cec2 and Px-cec3, exerted a broad spectrum of antimicrobial activity against fungi, as well as Gram-positive and Gram-negative bacteria. Especially, Px-cecs showed higher activity against M. anisopliae than another selected fungi isolates. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that cecropins exerted the vital morphological alterations to the spores of M. anisopliae. Based on our results, cecropins played an imperative role in resisting infection of M. anisopliae, which will provide the foundation of biological control of insect pests by using cecorpins as a target in the future. PMID:26544076

  18. Efficacy of Metarhizium anisopliae microsclerotial granules

    USDA-ARS?s Scientific Manuscript database

    Soil incorporation bioassays of dried microsclerotial (MS) preparations of three isolates of M. anisopliae isolates were conducted using third instar Tetanops myopaeformis (sugarbeet root maggot) in clay and/or clay loam field soils as a model system to demonstrate efficacy. At rates as low as 23 mg...

  19. The genome sequence of the biocontrol fungus Metarhizium anisopliae and comparative genomics of Metarhizium species.

    PubMed

    Pattemore, Julie A; Hane, James K; Williams, Angela H; Wilson, Bree A L; Stodart, Ben J; Ash, Gavin J

    2014-08-07

    Metarhizium anisopliae is an important fungal biocontrol agent of insect pests of agricultural crops. Genomics can aid the successful commercialization of biopesticides by identification of key genes differentiating closely related species, selection of virulent microbial isolates which are amenable to industrial scale production and formulation and through the reduction of phenotypic variability. The genome of Metarhizium isolate ARSEF23 was recently published as a model for M. anisopliae, however phylogenetic analysis has since re-classified this isolate as M. robertsii. We present a new annotated genome sequence of M. anisopliae (isolate Ma69) and whole genome comparison to M. robertsii (ARSEF23) and M. acridum (CQMa 102). Whole genome analysis of M. anisopliae indicates significant macrosynteny with M. robertsii but with some large genomic inversions. In comparison to M. acridum, the genome of M. anisopliae shares lower sequence homology. While alignments overall are co-linear, the genome of M. acridum is not contiguous enough to conclusively observe macrosynteny. Mating type gene analysis revealed both MAT1-1 and MAT1-2 genes present in M. anisopliae suggesting putative homothallism, despite having no known teleomorph, in contrast with the putatively heterothallic M. acridum isolate CQMa 102 (MAT1-2) and M. robertsii isolate ARSEF23 (altered MAT1-1). Repetitive DNA and RIP analysis revealed M. acridum to have twice the repetitive content of the other two species and M. anisopliae to be five times more RIP affected than M. robertsii. We also present an initial bioinformatic survey of candidate pathogenicity genes in M. anisopliae. The annotated genome of M. anisopliae is an important resource for the identification of virulence genes specific to M. anisopliae and development of species- and strain- specific assays. New insight into the possibility of homothallism and RIP affectedness has important implications for the development of M. anisopliae as a

  20. Exposure of Bed Bugs to Metarhizium anisopliae at Different Humidities.

    PubMed

    Ulrich, Kevin R; Feldlaufer, Mark F; Kramer, Matthew; St Leger, Raymond J

    2014-12-01

    Bed bugs Cimex lectularius L. were exposed to conidia (spores) of the entomopathogenic fungus Metarhizium anisopliae by feeding, aerosol spray, or contact with a treated surface. Feeding experiments demonstrated that bed bugs were innately susceptible to this fungus. However, only at 98% humidity were mortality rates high, regardless of whether bed bugs were sprayed with a fungal solution or contacted a treated surface. Mortality in treated bed bugs at ambient humidity did not increase when these bed bugs were kept in aggregation with other bed bugs that had recently blood fed to repletion. Based on these laboratory studies, we conclude that M. anisopliae is a poor pathogen for use in control of bed bugs, particularly at humidities that would likely be encountered under field conditions.

  1. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    EPA Science Inventory

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  2. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    EPA Science Inventory

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  3. Beauveria bassiana and Metarhizium anisopliae endophytically colonize cassava roots following soil drench inoculation

    USDA-ARS?s Scientific Manuscript database

    The fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae were investigated to determine if endophytic colonization could be achieved in cassava. An inoculation method based on drenching the soil around cassava stems using conidial suspensions resulted in endophytic colonization of ca...

  4. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    USGS Publications Warehouse

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  5. Production of Microsclerotia of Metarhizium anisopliae Using Deep-Tank Liquid Fermentation

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Metarhizium anisopliae is a pathogen of numerous soil-dwelling insects and has been registered in the United States and other countries as a bioinsecticide. Recent studies using various strains of M. anisopliae showed that small sclerotia (microsclerotia) were produced i...

  6. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    EPA Science Inventory

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA.
    Metarhizium anisopli...

  7. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    EPA Science Inventory

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA.
    Metarhizium anisopli...

  8. Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

    PubMed

    Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

    2008-06-01

    The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

  9. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    USGS Publications Warehouse

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  10. 76 FR 26194 - Metarhizium anisopliae Strain F52; Exemption From the Requirement of a Tolerance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-06

    ... accordance with good agricultural practices. Novozymes Biologicals, Inc. submitted a petition to ] EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), requesting an exemption from the requirement of a... in accordance with good agricultural practices, Metarhizium anisopliae strain F52, a known...

  11. Species limits, phylogeography and reproductive mode in the Metarhizium anisopliae complex

    USDA-ARS?s Scientific Manuscript database

    An essential first step toward understanding the ecology and life histories of Metarhizium anisopliae-group species as entomopathogens, endophytes and soil-adapted fungi is the ability to accurately define species limits and confidently infer a species tree. Here we present a multilocus phylogeny of...

  12. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  13. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae Extract

    Marsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker3
    1ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  14. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae Extract

    Marsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker3
    1ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  15. Susceptibility of Agrilus planipennis (Coleoptera: Buprestidae) to Beauveria bassiana and Metarhizium anisopliae

    Treesearch

    Houping Lui; Leah S. Bauer

    2006-01-01

    The susceptibility of Agrilus planipennis Fairmaire (Coleoptera: Buprestidae) to selected strains of the entomopathogenic fungi Beauveria bassiana (Balsamo) Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin was evaluated through bioassays with direct immersion or foliar exposure under laboratory conditions. Results showed that A. planipennis adults were...

  16. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  17. Soil Persistence of Metarhizium anisopliae Applied to Manage Sugarbeet Root Maggot in a Cover Crop Microenvironment

    USDA-ARS?s Scientific Manuscript database

    The sugarbeet root maggot, Tetanops myopaeformis (Röder), is a major insect pest of sugarbeet, Beta vulgaris L., in North Dakota, Minnesota, and Idaho. Three field trials using the insect pathogen Metarhizium anisopliae (Metch.) Sorok. ATCC 62176 in conjunction with cover crops were conducted in 200...

  18. Evaluation of Metarhizium anisopliae, Beauveria bassiana and Paecilomyces fumosoroseus as entomopathogens of the cactus moth, Cactoblastis cactorum (Lepidoptera:Pyralidae)

    USDA-ARS?s Scientific Manuscript database

    The fungal pathogens Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), Paecilomyces fumosoroseus (Wize) Brown & Smith (Deuteromycotina: Hyphomycetes), and Beauveria bassiana (Bals.-Criv.) Vuill. (Hypocreales: Clavicipitaceae) were evaluated as potential biological control ...

  19. Heat-stressed Metarhizium anisopliae: Viability (in vitro) and virulence (in vivo) assessments against the tick Rhipicephalus sanguineus

    USDA-ARS?s Scientific Manuscript database

    The current study investigated the thermotolerance of Metarhizium anisopliae s.l. conidia from the commercial products Metarril® SP Organic and Metarril® WP. The efficacy of these M. anisopliae formulations against the tick Rhipicephalus sanguineus s.l. was studied in laboratory under optimum or hea...

  20. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  1. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  2. Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

    PubMed Central

    Shang, Yanfang; Duan, Zhibing; Hu, Xiao; Xie, Xue-Qin; Zhou, Gang; Peng, Guoxiong; Luo, Zhibing; Huang, Wei; Wang, Bing; Fang, Weiguo; Wang, Sibao; Zhong, Yi; Ma, Li-Jun; St. Leger, Raymond J.; Zhao, Guo-Ping; Pei, Yan; Feng, Ming-Guang; Xia, Yuxian; Wang, Chengshu

    2011-01-01

    Metarhizium spp. are being used as environmentally friendly alternatives to chemical insecticides, as model systems for studying insect-fungus interactions, and as a resource of genes for biotechnology. We present a comparative analysis of the genome sequences of the broad-spectrum insect pathogen Metarhizium anisopliae and the acridid-specific M. acridum. Whole-genome analyses indicate that the genome structures of these two species are highly syntenic and suggest that the genus Metarhizium evolved from plant endophytes or pathogens. Both M. anisopliae and M. acridum have a strikingly larger proportion of genes encoding secreted proteins than other fungi, while ∼30% of these have no functionally characterized homologs, suggesting hitherto unsuspected interactions between fungal pathogens and insects. The analysis of transposase genes provided evidence of repeat-induced point mutations occurring in M. acridum but not in M. anisopliae. With the help of pathogen-host interaction gene database, ∼16% of Metarhizium genes were identified that are similar to experimentally verified genes involved in pathogenicity in other fungi, particularly plant pathogens. However, relative to M. acridum, M. anisopliae has evolved with many expanded gene families of proteases, chitinases, cytochrome P450s, polyketide synthases, and nonribosomal peptide synthetases for cuticle-degradation, detoxification, and toxin biosynthesis that may facilitate its ability to adapt to heterogenous environments. Transcriptional analysis of both fungi during early infection processes provided further insights into the genes and pathways involved in infectivity and specificity. Of particular note, M. acridum transcribed distinct G-protein coupled receptors on cuticles from locusts (the natural hosts) and cockroaches, whereas M. anisopliae transcribed the same receptor on both hosts. This study will facilitate the identification of virulence genes and the development of improved biocontrol strains

  3. Susceptibility of Loxosceles sp. to the arthropod pathogenic fungus Metarhizium anisopliae: potential biocontrol of the brown spider.

    PubMed

    Beys-da-Silva, Walter O; Santi, Lucélia; Berger, Markus; Guimarães, Jorge A; Schrank, Augusto; Vainstein, Marilene H

    2013-01-01

    Loxosceles genus (brown spider) is an important pest with great impact on public health. Thus, more effective strategies for spider control are necessary. Three isolates of Metarhizium anisopliae fungus were tested for the control of Loxosceles sp. Metarhizium anisopliae isolate E6 was highly virulent to the Loxosceles sp. spider, causing 100% mortality at 10(9) conidia/ml after 12 days and 9 days for juvenile and adult spiders, respectively. This is the first report of the pathogenicity of M. anisopliae against a venomous arthropod. This fungus could offer an interesting alternative to reduce loxoscelism in future biocontrol strategies.

  4. Diversity of entomopathogenic fungi near leaf-cutting ant nests in a neotropical forest, with particular reference to Metarhizium anisopliae var. anisopliae.

    PubMed

    Hughes, W O H; Thomsen, L; Eilenberg, J; Boomsma, J J

    2004-01-01

    We investigated the prevalence of entomopathogenic fungi associated with leaf-cutting ant colonies in a small area of tropical forest in Panama. There was a high abundance of Metarhizium anisopliae var. anisopliae near the colonies. Beauveria bassiana was also detected in the soil, Aspergillus flavus in dump material, and six Camponotus atriceps ants were found infected with Cordyceps sp. Based on a partial sequence of the IGS region, almost all of the M. anisopliae var. anisopliae isolates fell within one of the three main clades of M. anisopliae var. anisopliae, but with there still being considerable diversity within this clade. The vast majority of leaf-cutting ants collected were not infected by any entomopathogenic fungi. While leaf-cutting ants at this site must, therefore, regularly come into contact with a diversity of entomopathogenic fungi, they do not appear to be normally infected by them.

  5. Selectivity of Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Hymenoptera: Braconidae).

    PubMed

    Rossoni, Camila; Loureiro, Elisângela De Souza; Pereira, Fabricio Fagundes; Kassab, Samir Oliveira; Costa, Daniele Perassa; Barbosa, Rogério Hidalgo

    2014-01-01

    Understanding mortality patterns and interactions between entomopathogenic fungi and parasitoids is important to improve insect biological control programs. The aim of this study was to evaluate the effect of Metarhizium anisopliae (Metschnikoff, 1879) Sorokin, 1833 and Beauveria bassiana (Balsamo) Vuillemin, 1912 (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Cameron, 1891) (Hymenoptera: Braconidae) with biological insecticides Biometha WP Plus (M. anisopliae), Biovéria G (B. bassiana), Boverril WP (B. bassiana), Metarril WP (M. anisopliae), and Metie WP (M. anisopliae) at concentrations of 1 x 10(9) conidia (con).mL(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1). In the experimental, 10 females of C. flavipes were packed in disposable cups capped with a contact surface (filter paper, 9 cm2) treated with commercial product. The experimental design was completely randomized, with 16 treatments and five replicates of 10 females each. Mortality was assessed at 24, 48, 72, 96, and 120 hours after exposition (HAE) of the products. In general, B. bassiana and M. anisopliae in the concentrations of 1 x 10(9) con.ml(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1) can't affect C. flavipes females because the peak of mortality in treatments with bioinsecticides was similar to the control and this demonstrated the selectivity of fungi B. bassiana and M. anisopliae on C. flavipes females.

  6. Pure culture of Metarhizium anisopliae LHL07 reprograms soybean to higher growth and mitigates salt stress.

    PubMed

    Khan, Abdul Latif; Hamayun, Muhammad; Khan, Sumera Afzal; Kang, Sang-Mo; Shinwari, Zabta Khan; Kamran, Muhammad; Ur Rehman, Shafiq; Kim, Jong-Guk; Lee, In-Jung

    2012-04-01

    Little is known about the role of endophytic fungi against abiotic stresses and isoflavonoids (IF) contents of soybean. In current study, we investigated the role of fungal endophytes on the growth of soybean under salt stress conditions. Pure cultures of nine endophytic fungi were isolated from the roots of field-grown soybean plants, and their culture filtrates were screened on Waito-C and Dongjin-byeo rice cultivars; for identification of plant growth promoting fungal strains. It was observed that fungal isolate GMC-2B significantly promoted the growth of both Waito-C and Dongjin-byeo. GMC-2B was later identified as a new strain of Metarhizium anisopliae LHL07 on the basis of 18S rDNA sequences and phylogenetic analysis. Metarhizium anisopliae LHL07 inoculated soybean plants recorded significantly higher shoot length, shoot fresh and dry biomass, chlorophyll contents, transpiration rate, photosynthetic rate and leaf area; under sodium chloride induced salt stress as compared to non-inoculated control plants. An elevated proline and reduced superoxide dismutase and malondialdehyde contents in M. anisopliae LHL07 inoculated soybean plants demonstrated mitigation of salt induced oxidative stress. Furthermore, reduced abscisic acid and elevated jasmonic acid contents in soybean plants confirmed that lesser stress was convened to M. anisopliae inoculated-plants under salinity stress. We also assessed the role of M. anisopliae interaction on IF biosynthesis of soybean, and found significantly higher IF contents in M. anisopliae inoculated soybean plants. In conclusion, endophytic fungal interactions with soybean can be beneficial to improve soybean quality and quantity under salt affected agricultural systems.

  7. Performance of a Metarhizium anisopliae-treated semiochemical-baited trap in reducing Amblyomma variegatum populations in the field.

    PubMed

    Nchu, F; Maniania, N K; Hassanali, A; Eloff, J N

    2010-05-11

    Experiments were carried out to evaluate the efficacy of Metarhizium anisopliae (Metsch.) Sorok. (Ascomycota: Hypocreales)-treated semiochemical-baited traps for control of Amblyomma variegatum Fabriscius (Acari: Ixodidae) under field conditions. Unfed A. variegatum adults (118) were seeded in each 100-m plot and allowed to acclimatise for 3 days. On the fourth day (Day 4), an emulsifiable formulation of M. anisopliae (consisting of 49.5% sterile distilled water, fungal conidia, 49.5% corn oil and 1% Tween 80) titrated at 10(9)conidia ml(-1) was applied in semiochemical-baited traps (900 cm(2)) which were placed at five spots within the plot. The control and fungal treatments were repeated after 14 and 28 days soon after rotating the traps clockwise (45 degrees ) in order to cover different sections of the plot. In the control plots, emulsifiable formulation without fungus was applied in the semiochemical-baited traps. Six weeks after the initiation of the experiments, five semiochemical-baited traps (untreated) were deployed in each plot for 3 successive days to trap ticks in the treated and control plots. The percentage of ticks recovered in the fungus-treated plots were significantly lower (31.1+/-5.2%) than in the control plots (85.6+/-3%) (P<0.001), which represented a relative tick reduction of 63.7%. Mortality of 93.8+/-2.3% was observed among the ticks that were recovered from the field and maintained in the laboratory for 2 weeks; while only 3.3+/-0.9% died from the control plots. The results of this study open up the possibility of developing an environmentally friendly and low cost application strategy to control Amblyomma ticks. (c) 2010 Elsevier B.V. All rights reserved.

  8. Conidia of the insect pathogenic fungus, Metarhizium anisopliae, fail to adhere to mosquito larval cuticle

    PubMed Central

    Greenfield, Bethany P. J.; Lord, Alex M.; Dudley, Ed; Butt, Tariq M.

    2014-01-01

    Adhesion of conidia of the insect pathogenic fungus, Metarhizium anisopliae, to the arthropod host cuticle initially involves hydrophobic forces followed by consolidation facilitated by the action of extracellular enzymes and secretion of mucilage. Gene expression analysis and atomic force microscopy were used to directly quantify recognition and adhesion between single conidia of M. anisopliae and the cuticle of the aquatic larval stage of Aedes aegypti and a representative terrestrial host, Tenebrio molitor. Gene expression data indicated recognition by the pathogen of both hosts; however, the forces for adhesion to the mosquito were approximately five times lower than those observed for Tenebrio. Although weak forces were recorded in response to Aedes, Metarhizium was unable to consolidate firm attachment. An analysis of the cuticular composition revealed an absence of long-chain hydrocarbons in Aedes larvae which are thought to be required for fungal development on host cuticle. This study provides, to our knowledge, the first evidence that Metarhizium does not form firm attachment to Ae. aegypti larvae in situ, therefore preventing the normal route of invasion and pathogenesis from occuring. PMID:26064542

  9. The entomopathogenic fungus Metarhizium anisopliae alters ambient pH, allowing extracellular protease production and activity.

    PubMed

    St Leger, R J; Nelson, J O; Screen, S E

    1999-10-01

    Ambient pH regulates the expression of virulence genes of Metarhizium anisopliae, but it was unknown if M. anisopliae can regulate ambient pH. Mutants of M. anisopliae altered in production of oxalic acid were evaluated for the interrelationship of ambient pH, buffering capacity added to media, growth, and generation of extracellular proteases and ammonia. Wild-type and acid-overproducing mutants [Acid(+)] grew almost as well at pH 8 as at pH 6, but acid-non-producing [Acid(-)] mutants showed limited growth at pH 8, indicating that acid production is linked to the ability to grow at higher pH. Production of ammonia by M. anisopliae was strongly stimulated by low levels of amino acids in the medium when cells were derepressed for nitrogen and carbon. Likewise, although Aspergillus fumigatus and Neurospora crassa produced some ammonia in minimal media, addition of low levels of amino acids enhanced production. Ammonia production by A. fumigatus, N. crassa and M. anisopliae increased the pH of the medium and allowed production of subtilisin proteases, whose activities are observed only at basic pH. In contrast, protease production by the Acid(+) mutants of M. anisopliae was greatly reduced because of the acidification of the medium. This suggests that alkalinization by ammonia production is adaptive by facilitating the utilization of proteinaceous nutrients. Collectively, the data imply that ammonia may have functions related to regulation of the microenvironment and that it represents a previously unconsidered virulence factor in diverse fungi with the potential to harm tissues and disturb the host's immune system.

  10. Laboratory evaluation of Beauveria bassiana and Metarhizium anisopliae in the control of Haemaphysalis qinghaiensis in China.

    PubMed

    Ren, Qiaoyun; Chen, Ze; Luo, Jin; Liu, Guangyuan; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Li, Youquan; Niu, Qingli; Liu, Junlong; Yang, Jifei; Han, Xueqing; Yin, Hong; Luo, Jianxun

    2016-06-01

    Haemaphysalis qinghaiensis, a prevalent tick species in China, is an ectoparasite that preferentially infests small ruminants and can transmit Theileria sp. and Babesia sp. In this study, we evaluated the pathogenicity of individual and mixed infections of the fungi Beauveria bassiana and Metarhizium anisopliae to H. qinghaiensis nymphs. The estimated LC50 for ticks immersed in solutions of B. bassiana, M. anisopliae and a mixture thereof were: 5.88056 × 10(4), 2.65 × 10(4), and 2.85 × 10(4) conidia mL(-1) respectively, and the nymphal mortality ranged from 52 to 100 %. Thus, these results suggest a potential approach for the biocontrol of H. qinghaiensis.

  11. Protein analysis in a pleomorphically deteriorated strain of the insect-pathogenic fungus Metarhizium anisopliae.

    PubMed

    Kamp, Andrena M; Bidochka, Michael J

    2002-09-01

    Pleomorphic deterioration is a process where a fungal isolate loses the ability to produce conidia during repeated subculturing. We have previously isolated strains of the entomopathogenic fungus Metarhizium anisopliae that have irreversibly lost the ability to produce conidia and only produce mycelia when grown on agar. Gel electrophoresis was used to examine differences in intracellular protein patterns (urea-soluble proteins and urea-insoluble proteins (i.e., hydrophobins)) in conidiating and mycelial cultures of M. anisopliae. Two major proteins present in a conidiating culture and one from a mycelial culture were N-terminally sequenced but showed no homologies to known proteins. The presence of hydrophobins in conidiating and mycelial cultures was also examined, and it was shown that these proteins were abundant in conidiating cultures but not in mycelial cultures. We also used primers designed from regulatory genes involved in conidiation in Aspergillus nidulans. The amplified fragments were not homologous to A. nidulans genes.

  12. Virulence of Entomopathogenic Fungi Metarhizium anisopliae and Paecilomyces fumosoroseus for the Microbial Control of Spodoptera exigua

    PubMed Central

    Han, Ji Hee; Jin, Byung Rae; Lee, Sang Yeob

    2014-01-01

    The beet armyworm Spodoptera exigua (Lepidoptera: Noctuidae) is difficult to control using chemical insecticides because of the development of insecticide resistance. Several pest control agents are used to control the beet armyworm. Entomopathogenic fungi are one of the candidates for eco-friendly pest control instead of chemical control agents. In this study, among various entomopathogenic fungal strains isolated from soil two isolates were selected as high virulence pathogens against larva of beet armyworm. Control efficacy of fungal conidia was influenced by conidia concentration, temperature, and relative humidity (RH). The isolates Metarhizium anisopliae FT83 showed 100% cumulative mortality against second instar larvae of S. exigua 3 days after treatment at 1 × 107 conidia/mL and Paecilomyces fumosoroseus FG340 caused 100% mortality 6 days after treatment at 1 × 104 conidia/mL. Both M. anisopliae FT83 and P. fumosoroseus FG340 effectively controlled the moth at 20~30℃. M. anisopliae FT83 was significantly affected mortality by RH: mortality was 86.7% at 85% RH and 13.4% at 45% RH. P. fumosoroseus FG340 showed high mortality as 90% at 45% RH and 100% at 75% RH 6 days after conidia treatments. These results suggest that P. fumosoroseus FG340 and M. anisopliae FT83 have high potential to develop as a biocontrol agent against the beet armyworm. PMID:25606011

  13. Metarhizium anisopliae Pathogenesis of Mosquito Larvae: A Verdict of Accidental Death

    PubMed Central

    Butt, Tariq M.; Greenfield, Bethany P. J.; Greig, Carolyn; Maffeis, Thierry G. G.; Taylor, James W. D.; Piasecka, Justyna; Dudley, Ed; Abdulla, Ahmed; Dubovskiy, Ivan M.; Garrido-Jurado, Inmaculada; Quesada-Moraga, Enrique; Penny, Mark W.; Eastwood, Daniel C.

    2013-01-01

    Metarhizium anisopliae, a fungal pathogen of terrestrial arthropods, kills the aquatic larvae of Aedes aegypti, the vector of dengue and yellow fever. The fungus kills without adhering to the host cuticle. Ingested conidia also fail to germinate and are expelled in fecal pellets. This study investigates the mechanism by which this fungus adapted to terrestrial hosts kills aquatic mosquito larvae. Genes associated with the M. anisopliae early pathogenic response (proteinases Pr1 and Pr2, and adhesins, Mad1 and Mad2) are upregulated in the presence of larvae, but the established infection process observed in terrestrial hosts does not progress and insecticidal destruxins were not detected. Protease inhibitors reduce larval mortality indicating the importance of proteases in the host interaction. The Ae. aegypti immune response to M. anisopliae appears limited, whilst the oxidative stress response gene encoding for thiol peroxidase is upregulated. Cecropin and Hsp70 genes are downregulated as larval death occurs, and insect mortality appears to be linked to autolysis through caspase activity regulated by Hsp70 and inhibited, in infected larvae, by protease inhibitors. Evidence is presented that a traditional host-pathogen response does not occur as the species have not evolved to interact. M. anisopliae retains pre-formed pathogenic determinants which mediate host mortality, but unlike true aquatic fungal pathogens, does not recognise and colonise the larval host. PMID:24349111

  14. Flexible metabolism in Metarhizium anisopliae and Beauveria bassiana: role of the glyoxylate cycle during insect pathogenesis.

    PubMed

    Padilla-Guerrero, Israel Enrique; Barelli, Larissa; González-Hernández, Gloria Angélica; Torres-Guzmán, Juan Carlos; Bidochka, Michael J

    2011-01-01

    Insect pathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have an increasing role in the control of agricultural insect pests and vectors of human diseases. Many of the virulence factors are well studied but less is known of the metabolism of these fungi during the course of insect infection or saprobic growth. Here, we assessed enzyme activity and gene expression in the central carbon metabolic pathway, including isocitrate dehydrogenase, aconitase, citrate synthase, malate synthase (MLS) and isocitrate lyase (ICL), with particular attention to the glyoxylate cycle when M. anisopliae and B. bassiana were grown under various conditions. We observed that ICL and MLS, glyoxylate cycle intermediates, were upregulated during growth on 2-carbon compounds (acetate and ethanol) as well as in insect haemolymph. We fused the promoter of the M. anisopliae ICL gene (Ma-icl) to a marker gene (mCherry) and showed that Ma-icl was upregulated when M. anisopliae was grown in the presence of acetate. Furthermore, Ma-icl was upregulated when fungi were engulfed by insect haemocytes as well as during appressorium formation. Addition of the ICL inhibitor 3-nitroproprionate delayed conidial germination and inhibited appressorium formation. These results show that these insect pathogenic fungi have a flexible metabolism that includes the glyoxylate cycle as an integral part of germination, pathogenesis and saprobic growth.

  15. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae.

    PubMed

    Bukhari, Tullu; Takken, Willem; Koenraadt, Constantianus J M

    2011-02-22

    The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80), dry (organic and inorganic) and oil (mineral and synthetic) formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. When formulated in a synthetic oil (ShellSol T), fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with a suitable carrier are a promising tool for control of larval

  16. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae

    PubMed Central

    2011-01-01

    Background The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Methods Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80), dry (organic and inorganic) and oil (mineral and synthetic) formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. Results When formulated in a synthetic oil (ShellSol T), fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. Conclusions ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with a suitable carrier are a

  17. Efficacy of Metarhizium anisopliae isolate MAX-2 from Shangri-la, China under desiccation stress

    PubMed Central

    2014-01-01

    Background Metarhizium anisopliae, a soil-borne entomopathogen found worldwide, is an interesting fungus for biological control. However, its efficacy in the fields is significantly affected by environmental conditions, particularly moisture. To overcome the weakness of Metarhizium and determine its isolates with antistress capacity, the efficacies of four M. anisopliae isolates, which were collected from arid regions of Yunnan Province in China during the dry season, were determined at different moisture levels, and the efficacy of the isolate MAX-2 from Shangri-la under desiccation stress was evaluated at low moisture level. Results M. anisopliae isolates MAX-2, MAC-6, MAL-1, and MAQ-28 showed gradient descent efficacies against sterile Tenebrio molitor larvae, and gradient descent capacities against desiccation with the decrease in moisture levels. The efficacy of MAX-2 showed no significant differences at 35% moisture level than those of the other isolates. However, significant differences were found at 8% to 30% moisture levels. The efficacies of all isolates decreased with the decrease in moisture levels. MAX-2 was relatively less affected by desiccation stress. Its efficacy was almost unaffected by the decrease at moisture levels > 25%, but slowly decreased at moisture levels < 25%. By contrast, the efficacies of other isolates rapidly decreased with the decrease in moisture levels. MAX-2 caused different infection characteristics on T. molitor larvae under desiccation stress and in wet microhabitat. Local black patches were found on the cuticles of the insects, and the cadavers dried without fungal growth under desiccation stress. However, dark black internodes and fungal growth were found after death of the insects in the wet microhabitat. Conclusions MAX-2 showed significantly higher efficacy and superior antistress capacity than the other isolates under desiccation stress. The infection of sterile T. molitor larvae at low moisture level constituted a

  18. Species limits, phylogeography and reproductive mode in the Metarhizium anisopliae complex.

    PubMed

    Rehner, Stephen A; Kepler, Ryan M

    2017-09-01

    An essential first step to elucidating the ecology and life histories of Metarhizium anisopliae-group species as entomopathogens, endophytes and soil-adapted fungi is the ability to define species limits and confidently infer a species phylogeny. In a multilocus phylogeny of the core Metarhizium anisopliae species complex, the majority of isolates sampled herein group within the currently defined limits of M. pingshaense, M. anisopliae, M. robertsii and M. brunneum, designated informally as the "PARB" clade. Multilocus phylogenetic analyses reveal pervasive congruent hierarchical structure among the genomic regions analyzed, which suggest that current PARB species delimitations likely encompass additional cryptic complexes. Further, the interpolation of isolates from different continents throughout each species lineage indicates periodic inter-continental dispersals. Although no PARB species has yet been confirmed to produce a sexual state, we demonstrate the mutually exclusive incidence of the MAT1 and MAT2 mating type idiomorphs among individuals in all PARB species. This configuration of mating type is diagnostic of a heterothallic, obligately outcrossing mating system, indicating the conservation of and ongoing potential for sexual reproduction in all PARB species. As one example of the utility of IGS markers, the commercially registered M. anisopliae strain F52, which is widely used for pest control in North America, Canada and Europe, is shown to be a member of the M. brunneum complex. While current PARB species delimitations evidently encompass cryptic partitions, formal recognition of segregate species should be approached cautiously until further evidence of their phylogenetic exclusivity, ecological distinctiveness or other unique attributes is demonstrated. Nevertheless, acknowledgment of these intraspecific partitions will provide a useful conceptual framework to guide future investigations of the community structure, phylogeography, population genetics

  19. Lack of acute pathogenicity and toxicity in mice of an isolate of Metarhizium anisopliae var. anisopliae from spittlebugs.

    PubMed

    Toriello, C; Pérez-Torres, A; Burciaga-Díaz, A; Navarro-Barranco, H; Pérez-Mejía, A; Lorenzana-Jiménez, M; Mier, T

    2006-10-01

    A monospore strain of Metarhizium anisopliae var. anisopliae (EH-479/2), isolated in Mexico from Aeneolamia sp., was tested for oral acute intragastric pathogenicity and toxicity in CD-1 mice, including a thorough histological study. Animals were inoculated by gavage with one dose (10(8) conidia/animal) of viable (72 mice) and nonviable (24 mice) conidia and compared to 18 control mice. Clinical observations were done daily; mycological and histological tests were performed during necropsies at days 3, 10, 17, and 21 after the inoculation. At the end of the study, no mice showed clinical symptoms of illness, and the animals' mean weight corresponded to that of healthy adults. No inflammatory reactions were identified in analyzed organs, suggesting the nonimmunogenic status of this fungal strain. Evidence of fungal germination was noted in two lymph nodes and in liver and lung of one dead mouse, out of 72 viable-conidia treated mice. There was no evidence of toxicity symptoms in mice inoculated with nonviable conidia. The results obtained support the nonpathogenic and nontoxic status of this fungal strain when administered in a sole intragastric dose in mice.

  20. Computed tomography of granulomatous pneumonia with oxalosis in an American alligator (Alligator mississippiensis) associated with Metarhizium anisopliae var anisopliae.

    PubMed

    Hall, Natalie H; Conley, Kenneth; Berry, Clifford; Farina, Lisa; Sigler, Lynne; Wellehan, James F X; Roehrl, Michael H A; Heard, Darryl

    2011-12-01

    An 18-yr-old, male, albino, American alligator (Alligator mississippiensis) was evaluated for decreased appetite and abnormal buoyancy. Computed tomography (CT) of the coelomic cavity showed multifocal mineral and soft tissue attenuating pulmonary masses consistent with pulmonary fungal granulomas. Additionally, multifocal areas of generalized, severe emphysema and pulmonary and pleural thickening were identified. The alligator was euthanized and necropsy revealed severe fungal pneumonia associated with oxalosis. Metarhizium anisopliae var. anisopliae was cultured from lung tissue and exhibited oxalate crystal formation in vitro. Crystals were identified as calcium oxalate monohydrate by X-ray powder defractometry. Fungal identification was based on morphology, including tissue sporulation, and DNA sequence analysis. This organism is typically thought of as an entomopathogen. Clinical signs of fungal pneumonia in nonavian reptiles are often inapparent until the disease is at an advanced stage, making antemortem diagnosis challenging. This case demonstrates the value of CT for pulmonary assessment and diagnosis of fungal pneumonia in the American alligator. Fungal infection with associated oxalosis should not be presumed to be aspergillosis.

  1. Exposure of bed bugs to metarhizium anisopliae, and the effect of defensive secretions on fungal growth in vitro

    USDA-ARS?s Scientific Manuscript database

    Bed bugs Cimex lectularius were treated with conidia of the entomopathogenic fungus Metarhizium anisopliae by topical, spray, and contact exposure. One week post-exposure, inconsistent mortalities were observed, averaging 30% across all treatment groups and replicates. Microscopic examination of top...

  2. Laboratory mortality and mycosis of adult Curculio caryae (Coleoptera: Curculionidae) following application of Metarhizium anisopliae in the laboratory and field

    USDA-ARS?s Scientific Manuscript database

    The pecan weevil, Curculio caryae, is a key pest of pecans. Our objective was to determine the potential of Metarhizium anisopliae to control emerging C. caryae adults. First, a laboratory test was conducted to compare four Beauveria bassiana strains (Bb GA2, BbLA3, BbMS1, and GHA) and three M. an...

  3. Influence of Temperature and Relative Humidity on the Insecticidal Efficacy of Metarhizium anisopliae against Larvae of Ephestia kuehniella (Lepidoptera: Pyralidae) on Wheat

    PubMed Central

    Kavallieratos, Nickolas G.; Rumbos, Christos I.; Kontodimas, Demetrius C.

    2017-01-01

    A series of laboratory bioassays were conducted for the evaluation of the insecticidal efficacy of an isolate of Metarhizium anisopliae (Metschnikoff) Sorokin (Ascomycota: Hypocreales) against larvae of the Mediterranean flour moth, Ephestia kuehniella Zeller (Lepidoptera: Pyralidae), under various temperature–relative humidity (r.h.) conditions. The fungus was applied at four doses (0, 8 × 106, 8 × 108, and 8 × 1010 conidia ml−1) on wheat and insect mortality was assessed after exposure of 1, 2, 7, and 14 d. Bioassays were conducted at three temperatures (20, 25, and 30 °C) and two r.h. levels (55 and 75%). Although complete control was not achieved in any case, the fungus provided a considerable level of insect control. Mortality of E. kuehniella larvae on wheat treated with M. anisopliae ranged between 41.1 and 93.3% after 14 d of exposure, whereas the respective mortality levels in control dishes never exceeded 28.3%. The increase of temperature resulted in most cases to higher efficacy, indicating that temperature is an important factor for the performance of the fungus. In contrast, in most cases r.h. did not significantly affect the efficacy of the fungus, at least for the humidity levels tested.

  4. Diatomaceous earth and oil enhance effectiveness of Metarhizium anisopliae against Triatoma infestans.

    PubMed

    Luz, Christian; Rodrigues, Juscelino; Rocha, Luiz F N

    2012-04-01

    Entomopathogenic fungi, especially Metarhizium anisopliae, have potential for integrated control of peridomestic triatomine bugs. However, the high susceptibility of these vectors to fungal infection at elevated ambient humidities decreases in the comparatively dry conditions that often prevail in their microhabitats. A formulation adapted to this target pest that induces high and quick mortality can help to overcome these drawbacks. In the present study diatomaceous earth, which is used against pests of stored grains or as an additive to mycoinsecticides, delayed but did not reduce in vitro germination of M. anisopliae s.l. IP 46 conidia after >24h agitation without affecting viability, and did not hamper the survival of Triatoma infestans nymphs exposed to treated surfaces. The settling behavior of nymphs on a treated surface in choice tests depended on the concentration of diatomaceous earth and ambient light level. Conidia formulated with diatomaceous earth and a vegetable oil synergized the insecticidal effect of the fungus in nymphs, and quickly killed all treated insects, even at 75% relative humidity (LT(90) 8.3 days) where unformulated conidia caused only 25% mortality after a 25 days exposure. The improved performance of a combined oil and desiccant dust formulation of this Metarhizium isolate raises the likelihood for its successful mycoinsecticidal use for triatomine control and, apparently, against other domestic insect pests. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Optimization of compatible non-ionic surfactant for formulation development of hydrophobic conidia of entomopathogenic fungi, Beauveria bassiana (Hypocreales:Cordycipitaceae) and Metarhizium anisopliae Hypocreales:Clavicipita

    USDA-ARS?s Scientific Manuscript database

    Aerial conidia, especially dried conidia of entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae are hydrophobic, and therefore surfactants are needed for developing water-based formulations in laboratory studies, greenhouse bioassays, and field trials as well as commercial product ...

  6. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen).

    PubMed

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W; Zhang, Zehua

    2016-06-22

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca(2+) disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control.

  7. Effectiveness of Metarhizium anisopliae (Deuteromycetes) against Ixodes scapularis (Acari: Ixodidae) engorging on Peromnyscus leucopus.

    PubMed

    Hornbostel, V L; Ostfeld, Richard S; Benjamin, Michael A

    2005-06-01

    With the incidence of Lyme disease increasing throughout the United States, reducing risk of exposure to the disease is of the utmost concern. In the northeastern U.S., the blacklegged tick, Ixodes scapularis, is the primary vector and the white-footed mouse, (Peromyscus leucopus), the primary reservoir for Borrelia burgdorteri, the bacterium causing Lyme disease. Targeting I. scapularis engorging on white-footed mice with an effective biological control agent, such as the fungus Metarhizium anisopliae, could be an effective and relatively safe control technique. In 2002-2003, we performed laboratory and field experiments to determine whether M anisopliae-treated nesting material could effectively control larval I. scapularis ticks engorging on white-footed mice, and therefore reduce the number of infected nymphal I. scapularis questing the following summer. Our laboratory experiment demonstrated a strong negative effect of M. anisopliae-treated nesting material on survival of I. scapularis larvae feeding on P. leucopus, with 75% versus 35% larval mortality in treatment versus control nests. Our field trials caused only modest, localized reductions in nymphal abundance and had no effect on the proportion of nymphal I. scapularis infected with B. burgdorferi. Field results probably could be improved by increasing the density of nestboxes to allow fungal delivery to a higher proportion of the mouse population and by deploying nestboxes in an area with lower mammalian diversity, such as a suburban landscape.

  8. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen)

    PubMed Central

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W.; Zhang, Zehua

    2016-01-01

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca2+ disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control. PMID:27328936

  9. Beauveria bassiana and Metarhizium anisopliae endophytically colonize cassava roots following soil drench inoculation

    PubMed Central

    Greenfield, Melinda; Gómez-Jiménez, María I.; Ortiz, Viviana; Vega, Fernando E.; Kramer, Matthew; Parsa, Soroush

    2016-01-01

    We investigated the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae to determine if endophytic colonization could be achieved in cassava. An inoculation method based on drenching the soil around cassava stem cuttings using conidial suspensions resulted in endophytic colonization of cassava roots by both entomopathogens, though neither was found in the leaves or stems of the treated cassava plants. Both fungal entomopathogens were detected more often in the proximal end of the root than in the distal end. Colonization levels of B. bassiana were higher when plants were sampled at 7–9 days post-inoculation (84%) compared to 47–49 days post-inoculation (40%). In contrast, the colonization levels of M. anisopliae remained constant from 7–9 days post-inoculation (80%) to 47–49 days post-inoculation (80%), which suggests M. anisopliae is better able to persist in the soil, or as an endophyte in cassava roots over time. Differences in colonization success and plant growth were found among the fungal entomopathogen treatments. PMID:27103778

  10. Novel technique for quantifying adhesion of Metarhizium anisopliae conidia to the tick cuticle.

    PubMed

    Ment, Dana; Gindin, Galina; Rot, Asael; Soroker, Victoria; Glazer, Itamar; Barel, Shimon; Samish, Michael

    2010-06-01

    The present study describes an accurate quantitative method for quantifying the adherence of conidia to the arthropod cuticle and the dynamics of conidial germination on the host. The method was developed using conidia of Metarhizium anisopliae var. anisopliae (Metschn.) Sorokin (Hypocreales: Clavicipitaceae) and engorged Rhipicephalus annulatus (Say) (Arachnida: Ixodidae) females and was also verified for M. anisopliae var. acridum Driver et Milner (Hypocreales: Clavicipitaceae) and Alphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae) larvae. This novel method is based on using an organic solvent (dichloromethane [DCM]) to remove the adhered conidia from the tick cuticle, suspending the conidia in a detergent solution, and then counting them using a hemocytometer. To confirm the efficacy of the method, scanning electron microscopy (SEM) was used to observe the conidial adherence to and removal from the tick cuticle. As the concentration of conidia in the suspension increased, there were correlating increases in both the number of conidia adhering to engorged female R. annulatus and tick mortality. However, no correlation was observed between a tick's susceptibility to fungal infection and the amount of adhered conidia. These findings support the commonly accepted understanding of the nature of the adhesion process. The mechanism enabling the removal of the adhered conidia from the host cuticle is discussed.

  11. Catalase overexpression reduces the germination time and increases the pathogenicity of the fungus Metarhizium anisopliae.

    PubMed

    Morales Hernandez, Claudia Erika; Padilla Guerrero, Israel Enrique; Gonzalez Hernandez, Gloria Angelica; Salazar Solis, Eduardo; Torres Guzman, Juan Carlos

    2010-07-01

    Catalases and peroxidases are the most important enzymes that degrade hydrogen peroxide into water and oxygen. These enzymes and superoxide dismutase are the first lines of cell defense against reactive oxygen species. Metarhizium anisopliae displays an increase in catalase-peroxidase activity during germination and growth. To determine the importance of catalase during the invasion process of M. anisopliae, we isolated the cat1 gene. cat1 cDNA expression in Escherichia coli and the subsequent purification of the protein confirmed that the cat1 gene codes for a monofunctional catalase. Expression analysis of this gene by RT-PCR from RNA isolated from fungus grown in liquid cultures showed a decrease in the expression level of the cat1 gene during germination and an increase during mycelium growth. The expression of this gene in the fungus during the infection process of the larvae of Plutella xylostella also showed a significant increase during invasive growth. Transgenic strains overexpressing the cat1 gene had twice the catalase activity of the wild-type strain. This increase in catalase activity was accompanied by a higher level of resistance to exogenous hydrogen peroxide and a reduction in the germination time. This improvement was also observed during the infection of P. xylostella larvae. M. anisopliae transgenic strains overexpressing the cat1 gene grew and spread faster in the soft tissue of the insect, reducing the time to death of the insect by 25% and the dose required to kill 50% of the population 14-fold.

  12. Biological control of Ixodes ricinus larvae and nymphs with Metarhizium anisopliae blastospores.

    PubMed

    Wassermann, Marion; Selzer, Philipp; Steidle, Johannes L M; Mackenstedt, Ute

    2016-07-01

    The entomopathogenic fungus Metarhizium anisopliae is used as a biological pest control agent against various arthropod species, including ticks. However, the efficacy depends on tick species, tick stage and fungus strain. We studied the effect of M. anisopliae on engorged larvae and nymphs of Ixodes ricinus, the most abundant tick species in Europe, under laboratory and semi-field conditions. A significant reduction of engorged larvae and nymphs could be shown under laboratory as well as under semi-field conditions. Only 3.5% of the larvae treated in the lab and only 18.5% kept under semi-field conditions were able to develop into nymphs compared to the recovered nymphs of the control groups, which were regarded as 100%. Only 7.1% of nymphs were recovered as adult ticks after fungal treatment under semi-field conditions compared to the control (100%). The efficacy of blastospores of M. anisopliae against engorged larvae and nymphs of I. ricinus under semi-field conditions was demonstrated in this study, showing their high potential as a biological control agent of ticks. Further studies will have to investigate the effect of this agent against other stages of I. ricinus as well as other tick species before its value as a biological control agent against ticks can be fully assessed. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. Effect of Infection by Beauveria bassiana and Metarhizium anisopliae on the Feeding of Uvarovistia zebra

    PubMed Central

    Mohammadbeigi, A.; Port, G.

    2015-01-01

    To identify the susceptibility of long-horned grasshoppers to entomopathogenic fungi, the effect of infection with the fungi Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae) on food consumption by Uvarovistia zebra (Uvarov) (Orthoptera: Tettigoniidae) was investigated. Preliminary results showed that both fungi had a negative effect on food consumption of the insects. For both fungi a significant reduction of food consumption and faeces production by insects were observed between the highest spore concentration (5 × 106 spores/ml) and other treatments. Compared with control insects, the insects treated with 5 × 106 spores/ml of B. bassiana and M. anisopliae showed 60 and 63% reduction in mean food consumption/insect, respectively. The corrected cumulative percent mortality of the insects treated with the highest concentration of B. bassiana and M. anisopliae were 57.7 and 55.5%, respectively. This was the first account of these entomopathogenic fungi being used against a species from this family, therefore based on the results obtained from this research, it could be said that the fungi have pathogenicity effect on U. zebra as a long-horned grasshopper.

  14. Potential nontarget effects of Metarhizium anisopliae (Deuteromycetes) used for biological control of ticks (Acari: Ixodidae)

    USGS Publications Warehouse

    Ginsberg, Howard S.; LeBrun, Roger A.; Heyer, Klaus; Zhioua, Elyes

    2002-01-01

    The potential for nontarget effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin, when used for biological control of ticks, was assessed in laboratory trials. Fungal pathogenicity was studied against convergent ladybird beetles, Hippodamia convergens Guérin-Méneville, house crickets, Acheta domesticus (L.), and the milkweed bugs Oncopeltus fasciatus (Dallas). Fungal spores applied with a spray tower produced significant mortality in H. convergens and A. domesticus, but effects on O. fasciatus were marginal. Placing treated insects with untreated individuals resulted in mortality from horizontal transmission to untreated beetles and crickets, but not milkweed bugs. Spread of fungal infection in the beetles resulted in mortality on days 4–10 after treatment, while in crickets mortality was on day 2 after treatment, suggesting different levels of pathogenicity and possibly different modes of transmission. Therefore, M. anisopliae varies in pathogenicity to different insects. Inundative applications can potentially affect nontarget species, but M. anisopliae is already widely distributed in North America, so applications for tick control generally would not introduce a novel pathogen into the environment. Pathogenicity in lab trials does not, by itself, demonstrate activity under natural conditions, so field trials are needed to confirm these results and to assess methods to minimize nontarget exposure.

  15. The antileukaemic cell cycle regulatory activities of swainsonine purified from Metarhizium anisopliae fermentation broth.

    PubMed

    Singh, Digar; Kaur, Gurvinder

    2014-01-01

    Swainsonine is a Metarhizium secondary metabolite known differentially for its specific mannosidase inhibitory, toxic and therapeutic activities. Here, the standard and purified swainsonine from Metarhizium anisopliae fermentation broth were comparatively evaluated for their in situ antileukaemic activities in human promyelocytic cell line, HL-60. Both the standard (IC50 = 6.96 μM) and purified (IC50 = 9.50 μM) compounds inhibited the leukaemic cell proliferation without inflicting cell membrane disruption at 48 h of post-treatment incubation. The DNA cell cycle analysis showed approximately 48.81% and 60.72% of the treated cells arrested in the synthetic phase (S-phase) at 36 and 48 h, respectively, upon treatment with IC50 concentration of the purified swainsonine. However, only 29.62% of cells were arrested in S-phase with standard swainsonine at 48 h, suggesting the comprehensive action of certain other metabolites sharing the similar paradigm of antiproliferative properties in Metarhizium broth extract.

  16. Field evaluations of simulated aerial sprays of Beauveria bassiana and Metarhizium anisopliae against immature Mormon cricket (Anabrus simples) in newly designed cages

    USDA-ARS?s Scientific Manuscript database

    Three entomopathogenic fungi, Beauveria bassiana Strain GHA, Metarhizium anisopliae Strain F52 and M. anisopliae Strain DWR346 (discovered by Utah State University) were evaluated for their efficacy against Mormon Cricket, Anabrus simplex, in an outdoor cage trial in northeastern Montana. Fungal mat...

  17. Metarhizium anisopliae conidial responses to lipids from tick cuticle and tick mammalian host surface.

    PubMed

    Ment, Dana; Gindin, Galina; Soroker, Victoria; Glazer, Itamar; Rot, Asael; Samish, Michael

    2010-02-01

    Conidial germination and the formation of appressoria are important events in the interactions between entomopathogenic fungi and their arthropod hosts. In this study, we demonstrate the effects of lipids extracted from tick epicuticle and the surface of a mammalian host (calf) on conidial germination and the development of appressoria in two subspecies of Metarhizium anisopliae, M. anisopliae var. anisopliae (M.an.an.-7) and M. anisopliae var. acridum (M.an.ac.-5), which have different levels of virulence toward ticks. Pentane extracts of epicuticles of ticks susceptible and resistant to fungal infection always stimulated the germination of M.an.an.-7 conidia and the development of their appressoria; whereas the effects of dichloromethane (DCM) extracts of tick epicuticle varied depending on the tick. The DCM extracts from most of the tick species and developmental stages stimulated conidial germination and/or the formation of appressoria in M.an.an.-7. However, a DCM extract of lipids from the most resistant tick, engorged Hyalomma excavatum female, inhibited the germination of M.an.an.-7 conidia. Conidia of the non-virulent M.an.ac.-5 did not germinate on agarose amended with any of the examined tick extracts. However, when the tick extracts were placed on bactoagar, conidial germination increased 7- to 8-fold. Extracts from the skin, hair and ear secretions of a calf stimulated conidial germination and the formation of appressoria in M.an.an.-7, but not M.an.ac.-5. This study demonstrates that lipids from tick epicuticles and mammalian skin selectively affect the germination of conidia of entomopathogenic fungi. The effects of these lipids may explain the variability in tick control these fungi provide for different hosts.

  18. Antifungal activity of the termite alkaloid norharmane against the mycelial growth of Metarhizium anisopliae and Aspergillus nomius.

    PubMed

    Chouvenc, Thomas; Su, Nan-Yao; Elliott, Monica I

    2008-11-01

    Antifungal activity of norharmane, a beta-carboline alkaloid found in termites (Isoptera, Rhinotermitidae) was tested against two entomopathogenic fungi, Metarhizium anisopliae and Aspergillus nomius. It was determined that, at physiological concentration (10 microg ml(-1)), norharmane had no significant effect on A. nomius mycelial growth rate but reduced M. anisopliae growth rate by 11.9%. Contrary to previous findings, we suggest that norharmane has a limited role in disease resistance against fungal pathogens in individual subterranean termites, and we discuss the potential role of this chemical at a colony level.

  19. Screening of entomopathogenic Metarhizium anisopliae isolates and proteomic analysis of secretion synthesized in response to cowpea weevil (Callosobruchus maculatus) exoskeleton.

    PubMed

    Murad, André M; Laumann, Raul A; Lima, Thaina de A; Sarmento, Rubia B C; Noronha, Eliane F; Rocha, Thales L; Valadares-Inglis, Maria C; Franco, Octávio L

    2006-01-01

    Cowpea crops are severely attacked by Callosobruchus maculatus, a Coleopteran that at the larval stage penetrates into stored seeds and feeds on cotyledons. Cowpea weevil control could be based in utilization of bacteria and fungi to reduce pest development. Entomopathogenic fungi, such as Metarhizium anisopliae, are able to control insect-pests and are widely applied in biological control. This report evaluated ten M. anisopliae isolates according to their virulence, correlating chitinolytic, proteolytic and alpha-amylolytic activities, as well proteomic analysis by two dimensional gels of fungal secretions in response to an induced medium containing C. maculatus shells, indicating novel biotechnological tools capable of improving cowpea crop resistance.

  20. Differentially-expressed glycoproteins in Locusta migratoria hemolymph infected with Metarhizium anisopliae.

    PubMed

    Wang, Chutao; Cao, Yueqing; Wang, Zhongkang; Yin, Youping; Peng, Guoxiong; Li, Zhenlun; Zhao, Hua; Xia, Yuxian

    2007-11-01

    Glycoproteins play important roles in insect physiology. Infection with pathogen always results in the differential expression of some glycoproteins, which may be involved in host-pathogen interactions. In this report, differentially-expressed glycoproteins from the hemolymph of locusts infected with Metarhizium anisopliae were analyzed by two-dimensional electrophoresis (2-DE) and PDQuest software. The results showed that 13 spots were differentially expressed, of which nine spots were upregulated and four were downregulated. Using MS/MS with de novo sequencing and NCBI database searches, three upregulated proteins were identified as locust transferrin, apolipoprotein precursor, and hexameric storage protein 3. These proteins have been reported to be involved in the insect innate immune response to microbial challenge. Due to the limited available genome information and protein sequences of locusts, the possible functions of the other 10 differentially-expressed spots remain unknown.

  1. Entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana reduce the survival of Xenopsylla brasiliensis larvae (Siphonaptera: Pulicidae).

    PubMed

    Mnyone, Ladslaus L; Ng'habi, Kija R; Mazigo, Humphrey D; Katakweba, Abdul A; Lyimo, Issa N

    2012-09-19

    Entomopathogenic fungi, particularly those belonging to the genera Metarhizium and Beauveria have shown great promise as arthropod vector control tools. These agents, however, have not been evaluated against flea vectors of plague. A 3-h exposure to the fungi coated paper at a concentration of 2 × 108 conidia m-2 infected >90% of flea larvae cadavers in the treatment groups. The infection reduced the survival of larvae that had been exposed to fungus relative to controls. The daily risk of dying was four- and over three-fold greater in larvae exposed to M. anisopliae (HR = 4, p<0.001) and B. bassiana (HR = 3.5, p<0.001) respectively. Both fungi can successfully infect and kill larvae of X. brasiliensis with a pooled median survival time (MST±SE) of 2 ± 0.31 days post-exposure. These findings justify further research to investigate the bio-control potential of entomopathogenic fungi against fleas.

  2. Proteomic analysis of Metarhizium anisopliae secretion in the presence of the insect pest Callosobruchus maculatus.

    PubMed

    Murad, André M; Noronha, Eliane F; Miller, Robert N G; Costa, Fabio T; Pereira, Caroline D; Mehta, Angela; Caldas, Ruy A; Franco, Octávio L

    2008-12-01

    Crop improvement in agriculture generally focuses on yield, seed quality and nutritional characteristics, as opposed to resistance to biotic stresses. Consequently, natural antifeedant toxins are often rare in seed material, with commercial crops being prone to insect pest predation. In the specific case of cowpea (Vigna unguiculata), smallholder cropping is affected by insect pests that reproduce inside the stored seeds. Entomopathogenic organisms can offer an alternative to conventional pesticides for pest control, producing hydrolases that degrade insect exoskeleton. In this study, protein secretions of the ascomycete Metarhizium anisopliae, which conferred bioinsecticidal activity against Callosobruchus maculatus, were characterized via 2D electrophoresis and mass spectrometry. Proteases, reductases and acetyltransferase enzymes were detected. These may be involved in degradation and nutrient uptake from dehydrated C. maculatus. Proteins identified in this work allowed description of metabolic pathways. Their potential applications in biotechnology include both novel compound development and production of genetically modified plants resistant to insect pests.

  3. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

    PubMed Central

    Niassy, Saliou; Subramanian, Sevgan; Ekesi, Sunday; Bargul, Joel L.; Villinger, Jandouwe; Maniania, Nguya K.

    2013-01-01

    Virulence is the primary factor used for selection of entomopathogenic fungi (EPF) for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates. PMID:23936804

  4. Field bioassay of Metarhizium anisopliae strains to control the poultry red mite Dermanyssus gallinae.

    PubMed

    Tavassoli, M; Allymehr, M; Pourseyed, S H; Ownag, A; Bernousi, I; Mardani, K; Ghorbanzadegan, M; Shokrpoor, S

    2011-06-10

    The poultry red mite, Dermanyssus gallinae is one of the most economically deleterious ectoparasite of laying hens worldwide. To evaluate the efficacy of three strains (V245, 3247 and 715C) of entomopathogenic fungus Metarhizium anisopliae with potential as acaricides against D. gallinae, this investigation was carried out in a commercial caged laying poultry farm in Naghedeh, West Azarbaijan of Iran. The parasite infestation already existed in the farm. Sunflower oil suspension of all fungal strains, each in two concentrations (1×10(7) and 1×10(9) conidia/ml) were used separately as spray on hens and cages, and in the control group the cages were only sprayed with sunflower oil and sterile distilled water. For estimating the population rate of mites before and after treatment, special cardboard traps were fixed to cages during a 1-month period. The traps were placed on weeks -1, 0, 1, 2 and 3 and always removed after 1 w. The results showed that the population rates post fungal treatment with the lower concentration were not significantly different compared to the control group. However, the reduction in mite numbers induced by all three strains at the concentration of 1×10(9) conidia/ml was significantly higher than the control (P<0.05). The results revealed that under field conditions, higher concentrations of M. anisopliae will be required for controlling D. gallinae.

  5. Virulence of Metarhizium anisopliae (Deuteromycotina: Hyphomycetes) on Anastrepha ludens (Diptera: Tephritidae): laboratory and field trials.

    PubMed

    Lezama-Gutiérrez, R; Trujillo-de la Luz, A; Molina-Ochoa, J; Rebolledo-Dominguez, O; Pescador, A R; López-Edwards, M; Aluja, M

    2000-08-01

    Twenty isolates of the fungus Metarhizium anisopliae (Metsch). Sorkin (Ma) were evaluated to determine their virulence against last instar and adult emergence of Mexican fruit fly, Anastrepha ludens (Loew). Larvae were exposed by immersion in a conidial suspension at a concentration of 10(8) UFC/ml under laboratory conditions. Larvae and pupae cumulative mortality rates ranged from 37.9 to 98.75%. Thirteen isolates caused mortality rates > 83.7%, and their LT50 values ranged from 1.8 to 6.2 d. The Ma2, Ma8, and Ma16 isolates were evaluated at seven different concentrations ranging from 10(1) to 10(7) UFC/ml, showing LC50 values from 3.7 to 4.8 x 10(5) UFC/ml. In a field-cage experiment, 200 ml of a conidial suspension of Ma2, at a concentration of 2.5 x 10(6) UFC/ml, was applied on 2,500 cm2 soil surface (2 x 10(5) UFC/cm2). The fungus reduced adult emergence, 22% fewer adults emerging in a sandy loam soil, and 43% fewer in loam soil, compared with the controls. M. anisopliae may offer a preferable alternative to chemicals as a biological control agent against A. ludens.

  6. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    PubMed

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p < or = 0.05) reduced. It was, also, shown that the fungus had ability to adhere to the cuticle and penetrate the integument of the tick. Conidia of the fungus were isolated from their internal tissues. This phenomenon is important in considering fungi as bioinsecticides. Infection of eggs laid by treated engorged female ticks, with the fungus might demonstrate suggesting transovarian transmission. The use of M. anisopliae to control ticks is discussed.

  7. Infectivity of Metarhizium anisopliae (Hypocreales: Clavicipitaceae) to Phlebotomus papatasi (Diptera: Psychodidae) under laboratory conditions.

    PubMed

    Zayed, Alia; Soliman, Mustafa M; El-Shazly, Mohamed M

    2013-07-01

    Susceptibility of Phlebotomus papatasi Scopoli (Diptera: Psychodidae) larvae to the entomopathogenic fungus Metarhizium anisopliae (Metschinkoff) Sorokin (Ma79) (Hypocreales: Clavicipitaceae) was evaluated at two different temperatures. The ability of the fungus to reinfect healthy sand flies was followed up for approximately 20 wk and the effect of in vivo repassage on the enhancement of its virulence was assessed. The fungus reduced the adult emergence at 26 +/- 1 degrees C when applied to larval diet. Six spore concentrations were used in the bioassays ranging from 1 x 10(6) to 5 x 10(8) spores/ml. Mortality decreased significantly when the temperature was raised to 31 +/- 1 degrees C at all tested concentrations. Fungus-treated vials were assayed against sand fly larvae at different time lapses without additional reapplication of the fungus in the media to determine whether the level of inocula persisting in the media was sufficient to reinfect healthy sand flies. Twenty weeks postapplication, there were still enough infectious propagules of Ma79 to infect 40% of P. papatasi larvae. A comparison between the infectivity of 10 subsequent in vitro cultures and the host-passed inocula of the fungus against sand fly larvae was conducted. Mortalities of P. papatasi larvae changed significantly when exposed to inocula passed through different insects. Presented data can provide vector control decision makers and end users with fundamental information for the introduction and application of M. anisopliae as an effective control agent against the main cutaneous leishmaniasis old-world vector P. papatasi.

  8. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    PubMed

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (P<0.05); the same occurred during the adult phase. No effect was observed at the larval stage. The pesticides applied to the soil affected the activity of M. anisopliae slightly: only in the dry conidia assay the fungicides chlorothalonyl and tebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  9. Selection of indigenous isolates of entomopathogenic soil fungus Metarhizium anisopliae under laboratory conditions.

    PubMed

    Skalický, Aleš; Bohatá, Andrea; Šimková, Jana; Osborne, Lance S; Landa, Zdeněk

    2014-07-01

    Eight native isolates of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin were obtained by monitoring soils cultivated in a conventional manner. These isolates were compared in three areas: (a) conidial germination, (b) radial growth and sporulation and (c) ability of conidia to infect Tenebrio molitor larvae. All bioassays were carried out at constant temperatures of 10, 15, and 20 °C. Conidia of individual isolates demonstrated differences in germination after a 24-h long incubation at all evaluated temperatures. At 20 °C, the germination ranged from 67 to 100 % and at 15 °C from 5.33 to 46.67 %. At 10 °C, no germination was observed after 24 h; nevertheless, it was 8.67-44.67 % after 48 h. In terms of radial growth, the culture diameters and the associated production of spores of all isolates increased with increasing temperature. At 10 °C, sporulation was observed in three isolates while all remaining cultures appeared sterile. Three weeks post-inoculation, conidia of all assessed isolates caused 100 % cumulative mortality of treated larvae of T. molitor at 15 and 20 °C with the exception of isolate 110108 that induced 81.33 % mortality at 15 °C. At 10 °C, larval cumulative mortality ranged from 6.67 to 85.33 % depending on the isolate. Isolates 110108 and 110111 showed significantly slower outset and a much lower rate of infection at all temperatures compared to other tested isolates of M. anisopliae. The bioassays were carried out with the purpose to sort and select indigenous isolates of M. anisopliae useful as biocontrol agents in their original habitat.

  10. Isolation of a nitrogen response regulator gene (nrr1) from Metarhizium anisopliae.

    PubMed

    Screen, S; Bailey, A; Charnley, K; Cooper, R; Clarkson, J

    1998-10-09

    Attempts to improve the effectiveness of entomopathogenic fungi as biological control agents require a clear understanding of the pathogenicity determinants at both the biochemical and molecular level. Proteases play a key role in entomopathogenicity, allowing the fungus to penetrate the insect cuticle and rapidly invade the host. The most extensively studied of these protease activities, PR1A and PR2, are both subject to nitrogen derepression. The Metarhizium anisopliae nrr1 (nitrogen response regulator 1) gene was identified using a PCR-based strategy; it encodes a putative DNA-binding protein with a single zinc finger motif defined by the C-X2-C-X17-C-X2-C sequence. M. anisopliae NRR1 shows a significant sequence similarity to Neurospora crassa NIT2. Sequence analysis identified the presence of two introns, suggesting a greater degree of similarity to N. crassa nit2 than to the areA-like genes that have been identified. However, functional equivalence of nrr1 to areA was demonstrated, by co-transformation and complementation of an A. nidulans areA loss-of-function mutant (areA18 argB2 pabaA1 inoB2) with the M. anisopliae nrr1 gene. The areA-/nrr1+ Aspergillus transformants were able to grow on media with nitrate and glutamate as the sole nitrogen source, whereas the areA- strain is unable to grow under these conditions. The possible relevance of nitrogen regulation to pathogenicity is discussed.

  11. Application of the entomogenous fungus, Metarhizium anisopliae, for leafroller (Cnaphalocrocis medinalis) control and its effect on rice phyllosphere microbial diversity.

    PubMed

    Hong, Mingsheng; Peng, Guoxiong; Keyhani, Nemat O; Xia, Yuxian

    2017-07-10

    Microbial pesticides form critical components of integrated pest management (IPM) practices. Little, however, is known regarding the impacts of these organisms on the indigenous microbial community. We show that Metarhizium anisopliae strain CQMa421 was highly effective in controlling the rice leafroller, Cnaphalocrocis medinalis Guenee. In addition, M. anisopliae distribution and its effects on phyllosphere microbial diversity after application in field trials were investigated. Phylloplane specific distribution of the fungus was observed over time, with more rapid declines of M. anisopliae CFUs (colony-forming units) seen in the top leaf layer as compared to lower layers. Application of the fungus resulted in transient changes in the endogenous microbial diversity with variations seen in the bacterial observed species and Shannon index. Notable increases in both parameters were seen at 6-day post-application of M. anisopliae, although significant variation within sample replicates for bacteria and fungi were noted. Application of M. anisopliae increased the relative distribution of bacterial species implicated in plant growth promotion and organic pollutant degradation, e.g., Methylobacterium, Sphingobium, and Deinococcus. These data show minimal impact of M. anisopliae on endogenous microbial diversity with transient changes in bacterial abundance/diversity that may result in added benefits to crops.

  12. Evaluation of Pathogenicity of the Fungi Metarhizium anisopliae and Beauveria bassiana in Hazelnut Weevil (Curculio nucum L., Coleoptera, Curculionidae) Larvae.

    PubMed

    Cheng, Yunqing; Liu, Ting; Zhao, Yixin; Geng, Wanting; Chen, Longtao; Liu, Jianfeng

    2016-12-01

    The nut weevil (Curculio nucum) is one of the most important and widespread pests in hazelnut orchards. In order to screen entomopathogenic fungal strains with high virulence against C. nucum, the growth rate, sporulation, and cumulative mortality of different Metarhizium anisopliae and Beauveria bassiana strains were investigated, and the process by which M. anisopliae CoM 02 infects C. nucum larvae was observed using scanning electron microscopy. The results indicated that the growth rate and sporulation of different fungal strains significantly differed. Thirteen days after inoculation with M. anisopliae CoM 02, the cumulative mortality of C. nucum larvae reached 100 %, which was considerably higher than that of the other five strains. As the most virulent of the six test strains, the cadaver rate, LT50, and LT90 of M. anisopliae CoM 02 were 93.4 %, 7.05 and 11.90 days, respectively. Analysis of the infection process by scanning electron microscopy showed that the spore attachment, hyphal germination, hyphal rapid growth, and sporulation of M. anisopliae CoM 02 occurred on the 3rd, 5th, 7th, and 11th day after inoculation, respectively, indicating that the infection cycle takes approximately 11 days. This finding suggests that the highly virulent M. anisopliae plays an important role in the biocontrol of C. nucum in China.

  13. Effect of Beauveria bassiana and Metarhizium anisopliae (Deuteromycetes) upon the coffee berry borer (Coleoptera: Scolytidae) under field conditions.

    PubMed

    De la Rosa, W; Alatorre, R; Barrera, J F; Toreillo, C

    2000-10-01

    The effect of three strains of the fungus Beauveria bassiana (Balsamo) Vuillemin and two strains of Metarhizium anisopliae (Metschnikoff) Sorokin upon the coffee berry borer, Hypothenemus hampei (Ferrari), was studied in three coffee farms at different altitudes (450-1,100 m above sea level) in Soconusco, Chiapas, Mexico. The maximum average percentage mycosis varied according to altitude. At 450 m asl (El Rincon) mycosis was 14.3% for B. bassiana and 6.3% for M. anisopliae; at 880 m asl (Santa Anita) mycosis was 40.6% for B. bassiana and 12.6% for M. anisopliae, and at 1,100 m asl (Alpujarras) 33.9% for B. bassiana and 22. 1% for M. anisopliae. The effect of fungal mycosis through time was not significant (P > 0.01) in any of the farms, but there was a significant difference between the strains of the fungus (P < 0.01); the best strains being Bb25 and Ma4 at the lower altitude, Bb26 and Ma4 for the middle altitude and Bb26 and Ma4 at the higher altitude. Environmental factors such as temperature, relative humidity and rain were not correlated with the percentage mycosis caused by B. bassiana and M. anisopliae. However, in the case of B. bassiana there was a significant, positive correlation (P < 0.01) between the infestation levels of the pest and the mycosis response of the entomopathogen.

  14. Horizontal Transmission of Beauveria bassiana (Hypocreales: Cordycipitaceae) and Metarhizium anisopliae (Hypocreales: Clavicipitaceae) in Musca domestica (Diptera: Muscidae).

    PubMed

    Cárcamo, M C; Felchicher, F; Duarte, J P; Bernardi, E; Ribeiro, P B

    2015-08-01

    Beauveria bassiana Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin are fungi with potential for controlling Musca domestica L. However, the impact on this dipteral may vary depending on the fungal isolates and the methodology used. This study evaluated the pathogenicity of direct application and horizontal transmission of B. bassiana (CG240) and M. anisopliae (CG34) on adult M. domestica individuals. The impact of B. bassiana and M. anisopliae on M. domestica was evaluated at the concentrations 2 × 10(4), 2 × 10(5), 2 × 10(6), and 2 × 10(7) conidia/ml. Horizontal transmission was also estimated between sexes at different infection periods of the vector insect. The mortality of adult M. domestica individuals directly infected with B. bassiana was above 90%, and the mortality of those infected with M. anisopliae ranged from 25.50 to 97.78%. Horizontal transmission of B. bassiana caused the death of 100% of individuals, in turn, that of M. anisopliae killed 55% of male and 100% of female individuals. Horizontal transmission of fungi was negatively influenced by time. This study shows the potential of these fungi for controlling M. domestica, both with the direct implementation strategy and horizontal transmission. However, field studies are needed to evaluate the capacity to decrease the M. domestica population using these alternatives.

  15. Dissemination of Metarhizium anisopliae of low and high virulence by mating behavior in Aedes aegypti

    PubMed Central

    2011-01-01

    Background Dengue is a viral disease transmitted by Aedes mosquitoes. It is a threat for public health worldwide and its primary vector Aedes aegypti is becoming resistant to chemical insecticides. These factors have encouraged studies to evaluate entomopathogenic fungi against the vector. Here we evaluated mortality, infection, insemination and fecundity rates in A. aegypti females after infection by autodissemination with two Mexican strains of Metarhizium anisopliae. Methods Two M. anisopliae strains were tested: The Ma-CBG-1 least virulent (lv), and the Ma-CBG-2 highly virulent (hv) strain. The lv was tested as non mosquito-passed (NMP), and mosquito-passed (MP), while the hv was examined only as MP version, therefore including the control four treatments were used. In the first bioassay virulence of fungal strains towards female mosquitoes was determined by indirect exposure for 48 hours to conidia-impregnated paper. In the second bioassay autodissemination of fungal conidia from fungus-contaminated males to females was evaluated. Daily mortality allowed computation of survival curves and calculation of the LT50 by the Kaplan-Meier model. All combinations of fungal sporulation and mating insemination across the four treatments were analyzed by χ2. The mean fecundity was analyzed by ANOVA and means contrasted with the Ryan test. Results Indirect exposure to conidia allowed a faster rate of mortality, but exposure to a fungal-contaminated male was also an effective method of infecting female mosquitoes. All females confined with the hv strain-contaminated male died in fifteen days with a LT50 of 7.57 (± 0.45) where the control was 24.82 (± 0.92). For the lv strain, it was possible to increase fungal virulence by passing the strain through mosquitoes. 85% of females exposed to hv-contaminated males became infected and of them just 10% were inseminated; control insemination was 46%. The hv strain reduced fecundity by up to 99%, and the lv strain caused a 40

  16. Expression of a chitinase gene from Metarhizium anisopliae in tobacco plants confers resistance against Rhizoctonia solani.

    PubMed

    Kern, Marcelo Fernando; Maraschin, Simone de Faria; Vom Endt, Débora; Schrank, Augusto; Vainstein, Marilene Henning; Pasquali, Giancarlo

    2010-04-01

    The chit1 gene from the entomopathogenic fungus Metarhizium anisopliae, encoding the endochitinase CHIT42, was placed under the control of the CaMV 35S promoter, and the resulting construct was transferred to tobacco. Seventeen kanamycin-resistant transgenic lines were recovered, and the presence of the transgene was confirmed by polymerase chain reactions and Southern blot hybridization. The number of chit1 copies was determined to be varying from one to four. Copy number had observable effects neither on plant growth nor development. Substantial heterogeneity concerning production of the recombinant chitinase, and both general and specific chitinolytic activities were detected in leaf extracts from primary transformants. The highest chitinase activities were found in plants harboring two copies of chit1 inserts at different loci. Progeny derived from self-pollination of the primary transgenics revealed a stable inheritance pattern, with transgene segregation following a mendelian dihybrid ratio. Two selected plants expressing high levels of CHIT42 were consistently resistant to the soilborne pathogen Rhizoctonia solani, suggesting a direct relationship between enzyme activity and reduction of foliar area affected by fungal lesions. To date, this is the first report of resistance to fungal attack in plants mediated by a recombinant chitinase from an entomopathogenic and acaricide fungus.

  17. Optimization of different process variables for the production of an indolizidine alkaloid, swainsonine from Metarhizium anisopliae.

    PubMed

    Singh, Digar; Kaur, Gurvinder

    2012-10-01

    Swainsonine is a polyhydroxylated indolizidine alkaloid having anticancer, antimetastatic, antiproliferative and immunomodulatory activities and also potential therapeutic applications against AIDS. In the present study, ten isolates of M. anisopliae were screened and enzyme assayed for the production of swainsonine in different media (Complex oatmeal, Czapekdox media with and without lysine (8% w/v) and Sabouraud dextrose broth (SDB)). Among these strains, ARSEF 1724 (UM8) was found to produce highest amount of swainsonine (1.34 μg/l) after 72 h of incubation under shake flask conditions at 180 rpm and 28 °C in complex oatmeal media. In order to maximize the yield of swainsonine the media composition including macro and micronutrients were optimized. The process variables including the chemical factors like carbon sources, nitrogen sources of both organic and inorganic nature and pH with constant inoculum size (1 × 10(8) spores/ml) were screened using classical one-factor-at-a-time (OFAT) approach to find their optimum levels. The present study shows that the nutrient requirement is specific for each strain of Metarhizium. Oatmeal extract (6%) was found to be the best supporting media along with nitrogen source, glucose (2%) as best carbon source and pH (~5) as the best for swainsonine production.

  18. Investigations on the destruxin production of the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Wang, Chengshu; Skrobek, Anke; Butt, Tariq M

    2004-03-01

    The dynamics of cyclic peptide destruxins (dtxs) produced by Metarhizium anisopliae strains V245 and V275 were monitored both on solid and in liquid media. The results showed that both strains did not produce dtxs in large-scale fermenter cultures or solid Czapek Dox (CD) agar. Production of the major dtxs A and B could be determined in both strains when grown on rice for up to 10-30 days. The main dtxs A, B, E, and E diol were detected in CD liquid culture filtrate from both strains after three days post-inoculation on. Parallel decrease of dtx E and increase of E diol in the culture medium were found, indicating that the latter is the hydrolytic product from the former. Production of dtxs A and B was significantly positively correlated. A negative correlation was observed between the production of the metabolites and pH value of the medium. The influence of different nutrient sources on dtx production was evaluated by using media with different carbon and nitrogen ratios as well as with different insect homogenates. The findings showed that the amount of dtxs A, B, and E increased with the increasing content of peptone in the medium. When insect homogenate was used as single nutrient source or added to CD medium, no toxins were detected in the culture filtrate. The potential risk posed by the toxic metabolites during mass production is discussed.

  19. Entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana reduce the survival of Xenopsylla brasiliensis larvae (Siphonaptera: Pulicidae)

    PubMed Central

    2012-01-01

    Background Entomopathogenic fungi, particularly those belonging to the genera Metarhizium and Beauveria have shown great promise as arthropod vector control tools. These agents, however, have not been evaluated against flea vectors of plague. Findings A 3-h exposure to the fungi coated paper at a concentration of 2 × 108 conidia m-2 infected >90% of flea larvae cadavers in the treatment groups. The infection reduced the survival of larvae that had been exposed to fungus relative to controls. The daily risk of dying was four- and over three-fold greater in larvae exposed to M. anisopliae (HR = 4, p<0.001) and B. bassiana (HR = 3.5, p<0.001) respectively. Both fungi can successfully infect and kill larvae of X. brasiliensis with a pooled median survival time (MST±SE) of 2±0.31 days post-exposure. Conclusion These findings justify further research to investigate the bio-control potential of entomopathogenic fungi against fleas. PMID:22992264

  20. Production of Conidia by the Fungus Metarhizium anisopliae Using Solid-State Fermentation.

    PubMed

    Loera-Corral, Octavio; Porcayo-Loza, Javier; Montesinos-Matias, Roberto; Favela-Torres, Ernesto

    2016-01-01

    This chapter describes the production of conidia by Metarhizium anisopliae using solid-state fermentation. Before production of conidia, procedures for strains conservation, reactivation, and propagation are essential in order to provide genetic stability of the strains. The strain is conserved in freeze-dried vials and then reactivated through insect inoculation. Rice is used as a substrate for the conidia production in two different bioreactors: plastic bags and tubular bioreactor. The CO2 production in the tubular bioreactors is measured with a respirometer; this system allows calculating indirect growth parameters as lag time (tlag) (25-35 h), maximum rate of CO2 production (rCO2 max) (0.5-0.7 mg/gdm h), specific rate of CO2 production (μ) (0.10-0.15 1/h), and final CO2 production (CO2) (100-120 mg/gdm). Conidial yield per gram of dry substrate (gdm) should be above 1 × 10(9) conidia/gdm after 10 days of incubation. Germination and viability of conidia obtained after 10 days of incubation should be above 80 % and 75 %, respectively. Bioassays using of Tenebrio molitor as a host insect should yield a final mortality above 80 %.

  1. Algorithm-based design of synthetic growth media stimulating virulence properties of Metarhizium anisopliae conidia.

    PubMed

    Hutwimmer, S; Wagner, S; Affenzeller, M; Burgstaller, W; Strasser, H

    2008-12-01

    Synthetic media should be designed for the production of Metarhizium anisopliae conidia with improved virulence properties. A genetic algorithm (GA), demonstrated to be suitable for the design of media for spore mass production (Hutwimmer et al. 2008), was utilized for a multi-objective medium design to improve conidia yield and three proposed virulence properties of conidia: C : N ratio, germination speed and amount of spore-bound Pr1 protease. After five iterative optimizations, 52 media were improved over Sabouraud dextrose agar (SDA). Four media exhibited medium performances (a factor derived from the four single optimization variables) of around 0.7; cf. SDA = 0.532; media with enhanced properties were reached for each single optimization variable; Bioassays against Tenebrio larvae indicated also a slight improvement in virulence of conidia from designed media. A degenerated phenotype of the same strain did not exhibit differences in colony appearance, spore characteristics and virulence if grown on designed media. The application of a problem-oriented GA is a practical and rapid method to design media for multi-objective purposes. The applicability of a GA for multi-objective medium design was demonstrated for the cultivation of anamorphic fungi on solid media.

  2. In vivo interactions of entomopathogenic fungi, Beauveria spp. and Metarhizium anisopliae with selected opportunistic soil fungi of sugarcane ecosystem.

    PubMed

    Geetha, N; Preseetha, M; Hari, K; Santhalakshmi, G; Bai, K Subadra

    2012-07-01

    In the present study, the interactions of entomopathogenic fungi viz., Beauveria bassiana, Beauveria brongniartii and Metarhizium anisopliae among themselves and three other opportunistic soil fungi from the sugarcane ecosystem namely, Fusarium saachari, Aspergillus sp. and Penecillium sp. were assayed in vivo against Galleria mellonella larvae. The tested fungi were co-applied on IV instar G. mellonella @ 1 x 10(7) ml(-1), in combinations of two, at the interval of 24 hrs either preceding or succeeding each otherto assess their efficacy and sporulation rates. Results showed that often mortality rates did not correspond to the spore harvest of the mortality agent and presence of other fungus may be antagonistic. The efficacy of B. bassiana (90%) and B. brongniartii (100%) was not enhanced further but was negatively affected in most combinations with other fungi. In case of M. anisopliae compatibility was higher, resulting in higher mortality by application of B. bassiana before (100%) or after (83.3%) M. anisopliae than when it was applied alone (70%). During sporulation, B. bassiana faced the most intense competition from M. anisopliae (2.75 x 10(6) larva(-1)) and enhancement due to F sacchari irrespective of sequence of application. In case of B. brongniartii, sporulation was lowest in the combination of B. brongniartiipreceding M. anisopliae (1.83 x10(6) larva(-1)) and B. brongniartii succeeding B. bassiana (1.58 x 10(6) larva(-1)). Of all fungi tested, except F sacchari (65.33 x 10(6) larva(-1)) all the other species affected sporulation of M. ansiopliae with the least in treatment of B. bassiana application following M. anisopliae. Similar kind of interaction was observed during sporulation of soil fungi when combined with entomopathogenic fungi, though individually they could not cause mortality of larvae.

  3. Susceptibility of Adults of the Cerambycid Beetle Hedypathes betulinus to the Entomopathogenic Fungi Beauveria bassiana, Metarhizium anisopliae, and Purpureocillium Lilacinum

    PubMed Central

    Schapovaloff, M. E.; Alves, L. F. A.; Fanti, A. L.; Alzogaray, R. A.; Lastra, C. C. López

    2014-01-01

    The cerambycid beetle Hedypathes betulinus (Klug) (Coleoptera: Cerambycidae) causes severe damage to yerba mate plants (Ilex paraguariensis (St. Hilaire) (Aquifoliales: Aquifoliaceae)), which results in large losses of production. In this study, the pathogenicity of entomopathogenic fungi of the species Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Hypocreales: Cordycipitaceae), Metarhizium anisopliae sensu lato (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae), and Purpureocillium lilacinum (Thom) Luangsa-ard, Hywel-Jones, Houbraken and Samson (Hypocreales: Ophiocordycipitaceae) on yerba mate were evaluated. Fifteen isolates of B. bassiana, two of M. anisopliae, and seven of P. lilacinum on H. betulinus adults were analyzed under laboratory conditions. The raw mortality rate caused by B. bassiana isolates varied from 51.1 to 86.3%, and their LT50 values varied between 8.7 and 13.6 d. The isolates of M. anisopliae caused 69.6–81.8% mortality, and their LT50 values varied between 7.4 and 7.9 d. In contrast, isolates of P. lilacinum were not pathogenic. M. anisopliae and B. bassiana isolates were pathogenic against H. betulinus adults, suggesting that they may be useful in biological control programs for insect pests of yerba mate. PMID:25368071

  4. Prospects of using Metarhizium anisopliae to check the breeding of insect pest, Oryctes rhinoceros L. in coconut leaf vermicomposting sites.

    PubMed

    Gopal, Murali; Gupta, Alka; Thomas, George V

    2006-10-01

    During vermicomposting of coconut leaves by the earthworm Eudrilus sp., Oryctes rhinoceros L. (rhinoceros beetle), an insect pest of palms, was found to breed in the decomposing organic material. Metarhizium anisopliae var. major was tried as a biocontrol agent for management of this pest. The effect of pathogen at spore loads of 10(3), 10(4) and 10(5) per 10 g of substrate was tested in laboratory on Eudrilus sp. kept with O. rhinoceros grubs and on Eudrilus sp. alone for the pathogenic capability of the fungus on the pest and its possible toxicity towards the vermin. The efficacy of the entomopathogen was also tested in the field in vermicomposting tanks. In laboratory bioassay, 100% mycosis of O. rhinoceros grubs could be obtained while the entomopathogen had no toxic effect on the earthworms. There was a positive change in the number and weight of the earthworms on treatment with M. anisopliae. In the field, application of M. anisopliae reduced O. rhinoceros grubs in the vermicomposting tanks upto an extent of 72%. In conclusion, M. anisopliae could effectively control O. rhinoceros in vermicomposting sites and was non-hazardous to the vermicomposting process as well as the Eudrilus sp.

  5. [Hemocyte characterization of Nasutitermes coxipoensis (Holmgren) (Isoptera: Termitidae) workers and hemocyte evaluation after parasitism by Metarhizium anisopliae].

    PubMed

    Cunha, Franklin M; Wanderley-Teixeira, Valéria; Teixeira, Alvaro A C; Albuquerque, Auristela C; Alves, Luiz C; Lima, Elza A L A

    2009-01-01

    We aimed to characterize the morphology and ultrastructure of hemocytes of Nasutitermes coxipoensis (Holmgren) workers and to quantify the cell types 24 h, 48 h and 72 h after inoculation with Metarhizium anisopliae. Six hemocytes types were identified, plasmatocyte, granulocyte, spherulocyte, prohemocyte, adipohemocyte and eonocytoid Hemocytes did not present any morphological alteration at the several observation periods, but they did have a change in their abundance, as observed for spherulocytes, adipohemocytes and eonocytoids at all intervals, and for plasmatocytes and granulocytes at 48 h after host inoculation. We argue on the possible reasons and implications of the observed changes.

  6. Inhibition of the entomopathogenic fungus Metarhizium anisopliae in vitro by the bed bug defensive secretions (E)-2-hexenal and (E)-2-octenal

    USDA-ARS?s Scientific Manuscript database

    The two major aldehydes (E)-2-hexenal and (E)-2-octenal emitted as defensive secretions by bed bugs Cimex lectularius L. (Hemiptera: Cimicidae), inhibit the in vitro growth of Metarhizium anisopliae (Metsch.) Sokorin (Hypocreales: Clavicipitaceae). These chemicals inhibit fungal growth by direct con...

  7. Agrobacterium-mediated disruption of a nonribosomal peptide synthetase gene in the invertebrate pathogen Metarhizium anisopliae reveals a peptide spore factor

    USDA-ARS?s Scientific Manuscript database

    Numerous secondary metabolites have been isolated from the insect pathogenic fungus Metarhizium anisopliae, but the roles of these compounds as virulence factors in disease development are poorly understood. We targeted for disruption by Agrobacterium tumefaciens-mediated transformation a putative n...

  8. Effect of Metarhizium anisopliae (Ascomycete), Cypermethrin, and D-limonene, alone and combined, on larval mortality of Rhipicephalus sanguineus (Acari: Ixodidae)

    USDA-ARS?s Scientific Manuscript database

    The effect of the fungus Metarhizium anisopliae Ma14 strain, D-limonene and cypermethrin, alone and combined, on the mortality of Rhipicephalus sanguineus larvae was evaluated. Eight groups with 25 tick larvae were inoculated with the fungus, eight groups were treated with cypermethrin, eight groups...

  9. Sweetpotato weevil, Cylas formicarius (Fab.) (Coleoptera: Brentidae) avoids its host plant when a virulent Metarhizium anisopliae isolate is present.

    PubMed

    Dotaona, Ronnie; Wilson, Bree A L; Ash, Gavin J; Holloway, Joanne; Stevens, Mark M

    2017-09-01

    Metarhizium anisopliae has a wide range of coleopteran hosts, including weevils. Some susceptible insects are known to modify their behavior to prevent infection, typically detecting virulent strains by olfaction, and avoiding physical contact with sources of infection. Laboratory olfactometer assays were conducted on the sweetpotato weevil Cylas formicarius to test the hypothesis that insects would avoid a more virulent strain of M. anisopliae when presented with a strain of low virulence or an untreated control. When adult weevils were allowed to choose between paired test arenas containing sweetpotato roots and M. anisopliae isolates on agar cores, weevils avoided arenas with the highly virulent isolate QS155, showing a preference for either roots with uninoculated agar cores or cores with the low virulence isolate QS002-3. When roots or whole sweetpotato plants were inoculated with M. anisopliae, the preferences of weevils remained broadly similar; weevils were repelled by the highly virulent isolate QS155 when tested against either QS002-3 or uninoculated roots and plants, however weevils were not repelled by the low virulence isolate QS002-3 tested against uninoculated controls. When single-sex groups of weevils were tested separately in the olfactometer using uninoculated whole plants and plants treated with isolate QS155, males and females responded similarly and statistically identical preferences were found for the untreated plants. When weevils were released singly at different times of the day the response time for males was significantly shorter in the afternoon compared to the morning. Males were always significantly faster to respond to olfactory stimuli than females. Understanding factors that may lead to avoidance of virulent M. anisopliae strains by C. formicarius will be an essential part of developing an 'attract-and-infect' strategy for the management of C. formicarius. Copyright © 2017. Published by Elsevier Inc.

  10. Commercial formulation of Metarhizium anisopliae for the control of Rhipicephalus microplus in a pen study.

    PubMed

    Camargo, Mariana G; Marciano, Allan F; Sá, Fillipe A; Perinotto, Wendell M S; Quinelato, Simone; Gôlo, Patrícia S; Angelo, Isabele C; Prata, Márcia C A; Bittencourt, Vânia R E P

    2014-09-15

    The present study evaluated, for the first time, the effect of the commercial formulation Metarril(®) SP Organic of Metarhizium anisopliae plus 10% mineral oil to control Rhipicephalus microplus in a pen study. Three groups were formed with six animals each: the first group was exposed to Metarril(®) plus 10% mineral oil and 1% Tween 80; the second group was exposed to sterile distilled water, mineral oil and Tween 80 (oil control group); and the third group received no treatment (control group). The fungal formulation contained 1 × 10(8)conidiaml(-1). Each animal was sprayed with 3L of formulation. Fallen ticks were counted daily and a sample of 20 engorged females per day was incubated for assessment of biological parameters. Throughout the study period, Metarril(®) oil-based formulation showed an efficacy ranging from 19.20% to 67.39% in comparison with the control group; and from 8.18% to 61.38% in comparison with the oil control group. The average efficacy of Metarril(®) oil-based formulation was 47.74% and 40.89% in comparison with control and oil control groups, respectively. Changes in the biological parameters of engorged R. microplus females were observed in the first three days after treatment, with a significant reduction in hatching percentage and egg production index. We concluded that Metarril(®) SP Organic plus 10% mineral oil was efficient against R. microplus in pen studies. However, further in vivo studies are required to increase the efficacy and to establish a protocol for the use of this product in the field against the cattle tick.

  11. Monomorphic subtelomeric DNA in the filamentous fungus, Metarhizium anisopliae,contains a RecQ helicase-like gene.

    PubMed

    Inglis, Peter W; Rigden, Daniel J; Mello, Luciane V; Louis, Edward J; Valadares-Inglis, M Cléria

    2005-08-01

    In most filamentous fungi, telomere-associated sequences (TASs) are polymorphic, and the presence of restriction fragment length polymorphisms (RFLPs) may permit the number of chromosome ends to be estimated from the number of telomeric bands obtained by restriction digestion. Here, we describe strains of Metarhizium, Gliocladium and Paecilomyces species in which only one or a few telomeric bands of unequal intensity are detectable by Southern hybridization, indicating that interchromosomal TAS exchange occurs. We also studied an anomalous strain of Metarhizium anisopliae, which produces polymorphic telomeric bands larger than 8 kb upon digestion of genomic DNA with XhoI. In this case, the first XhoI site in from the chromosome end must lie beyond the presumed monomorphic region. Cloned telomeres from this strain comprise 18-26 TTAGGG repeats, followed at the internal end of the telomere tract by five repeats of the telomere-like sequence TAAACGCTGG. An 8.1-kb TAS clone also contains a gene for a RecQ-like helicase, designated TAH1, suggesting that this TAS is analogous to the Y' elements in yeast and the subtelomeric helicase ORFs of Ustilago maydis (UTASRecQ) and Magnaporthe grisea (TLH1). The TAS in the anomalous strain of M. anisopliae, however, appears distinct from these in that it is found at most telomeres and its predicted protein product possesses a significantly longer N-terminal region in comparison to the M. grisea and U. maydis helicases. Hybridization analyses showed that TAH1 homologues are present in all other anomalous M. anisopliae strains studied, as well as in some other polymorphic strains, where the recQ-like gene also appears to be telomere-associated.

  12. Ultrastructure of Tuta absoluta parasitized eggs and the reproductive potential of females after parasitism by Metarhizium anisopliae.

    PubMed

    Pires, Laurici M; Marques, Edmilson J; Wanderley-Teixeira, Valéria; Teixeira, Alvaro A C; Alves, Luis C; Alves, E Sérgio B

    2009-02-01

    Among the microorganisms used in biological control, the muscadine fungus Metarhizium anisopliae (Metsch.) Sorok. is produced and formulated world wide aiming to control pests from several agricultural crops. This work evaluated effects of M. anisopliae isolate UFRPE-6 on the fecundity and mortality of Tuta absoluta (Lepidoptera: Gelechiidae) females and the mechanism of infection on eggs. The infection of the females by the fungus did not affect their oviposition and fecundity; however it affected the survival with total and confirmed mortality of 54.2% and 37.14%, respectively. The eggs were treated with suspension at concentration of 10(6)conidia/mL. The analysis under scanning electron microscopy showed that conidia germination and penetration processes in the eggs of T. absoluta started within the period of 6h after the inoculation. Several hyphal bodies were observed from 12h and an intense extrusion of the mycelium covering all the external surface of the eggs 72h after inoculation. Despite its moderate activity in adults, the isolate URPE-6 of M. anisopliae showed promising in the control of T. absoluta due to its pathogenicity and virulence to eggs from this pest.

  13. Production and quality of conidia by Metarhizium anisopliae var. lepidiotum: critical oxygen level and period of mycelium competence.

    PubMed

    Garcia-Ortiz, Nohemi; Tlecuitl-Beristain, Saúl; Favela-Torres, Ernesto; Loera, Octavio

    2015-03-01

    Mycoinsecticides application within Integral Pest Management requires high quantities of conidia, with the proper quality and resistance against environmental conditions. Metarhizium anisopliae var. lepidiotum conidia were produced in normal atmospheric conditions (21 % O2) and different concentrations of oxygen pulses (16, 26, 30, and 40 %); conidia obtained under hypoxic conditions showed significantly lower viability, hydrophobicity, and virulence against Tenebrio molitor larvae or mealworm, compared with those obtained under normal atmospheric conditions. Higher concentrations of oxygen (26 and 30 %) improved conidial production. However, when a 30 % oxygen concentration was applied, maximal conidial yields were obtained at earlier times (132 h) relative to 26 % oxygen pulses (156 h); additionally, with 30 % oxygen pulses, conidia thermotolerance was improved, maintaining viability, hydrophobicity, and virulence. Although conidial production was not affected when 40 % oxygen pulses were applied, viability and virulence were diminished in those conidia. In order to find a critical time for mycelia competence to respond to these oxidant conditions, oxygen pulses were first applied either at 36, 48, 60, and 72 h. A critical time of 60 h was determined to be the best time for the M. anisopliae var. lepidiotum mycelia to respond to oxygen pulses in order to increase conidial production and also to maintain the quality features. Therefore, oxygen-enriched (30 %) pulses starting at 60 h are recommended for a high production without the impairment of quality of M. anisopliae var. lepidiotum conidia.

  14. The effect of temperature and relative humidity on the formation of Metarhizium anisopliae chlamydospores in tick eggs.

    PubMed

    Ment, Dana; Gindin, Galina; Glazer, Itamar; Perl, Shmuel; Elad, Daniel; Samish, Michael

    2010-01-01

    The influence of ambient conditions on the development of Metarhizium anisopliae chlamydospores in tick eggs is reported for the first time. The infection of tick eggs by M. anisopliae involves common events, such as adhesion, conidial germination, appressoria formation, invasion, and development within the eggs. However, the final stage of fungal development differs according to the environmental conditions. At high humidity (close to 100%) and moderate temperature (25°C) the fungus emerged from the eggs and formed conidiophores and conidia externally on the dead eggs. Elevating the temperature to 30°C or reducing humidity to 55-75% induced the production of chlamydospores inside the eggs, without conidiogenesis. When eggs with mature chlamydospores were returned to the appropriate conditions (25°C and 100% RH), conidiogenesis was recovered. Formation of chlamydospores, observed by means of histology and TEM, began with the thickening and septation of hyphae. As the chlamydospore wall thickened a new external undulated wall layer appeared. The mature chlamydospore in eggs has an oval shape (5.3 ± 0.9 microm long, 2.5 ± 0.2 microm wide); its wall comprises three distinct layers. The ability of M. anisopliae to produce chlamydospores under harsh conditions is advantageous and should be considered in application.

  15. Assessing the optimal virulence of malaria-targeting mosquito pathogens: a mathematical study of engineered Metarhizium anisopliae.

    PubMed

    Konrad, Bernhard P; Lindstrom, Michael; Gumpinger, Anja; Zhu, Jielin; Coombs, Daniel

    2014-01-08

    Metarhizium anisopliae is a naturally occurring fungal pathogen of mosquitoes. Recently, Metarhizium has been engineered to act against malaria by directly killing the disease agent within mosquito vectors and also effectively blocking onward transmission. It has been proposed that efforts should be made to minimize the virulence of the fungal pathogen, in order to slow the development of resistant mosquitoes following an actual deployment. Two mathematical models were developed and analysed to examine the efficacy of the fungal pathogen. It was found that, in many plausible scenarios, the best effects are achieved with a reduced or minimal pathogen virulence, even if the likelihood of resistance to the fungus is negligible. The results for both models depend on the interplay between two main effects: the ability of the fungus to reduce the mosquito population, and the ability of fungus-infected mosquitoes to compete for resources with non-fungus-infected mosquitoes. The results indicate that there is no obvious choice of virulence for engineered Metarhizium or similar pathogens, and that all available information regarding the population ecology of the combined mosquito-fungus system should be carefully considered. The models provide a basic framework for examination of anti-malarial mosquito pathogens that should be extended and improved as new laboratory and field data become available.

  16. Different Effects of Metarhizium anisopliae Strains IMI330189 and IBC200614 on Enzymes Activities and Hemocytes of Locusta migratoria L.

    PubMed Central

    Cao, Guangchun; Jia, Miao; Zhao, Xia; Wang, Lei; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Zhang, Zehua

    2016-01-01

    Background Metarhizium is an important class of entomopathogenic fungi in the biocontrol of insects, but its virulence is affected by insect immunity. To clarify the mechanism in virulence of Metarhizium, we compared the immunological differences in Locusta migratoria L. when exposed to two strains of Metarhizium anisopliae (Ma). Results The virulence of Ma IMI330189 was significantly higher than that of Ma IBC200614 to locust, and IMI330189 overcame the hemocytes and began destroying the hemocytes of locust at 72 h after spray, while locust is immune to IBC200614. IMI330189 could overcome the humoral immunity of locust by inhibiting the activities of phenol oxidase (PO), esterases, multi-function oxidases (MFOs) and acetylcholinesterases in locust while increasing the activities of glutathione-S-transferases (GSTs), catalase and aryl-acylamidase (AA). However IBC200614 inhibit the activities of GSTs and AA in locust and increase the activities of MFOs, PO, superoxide dismutase, peroxidase and chitinase in locust. The changes of enzymes activities in period of infection showed that the time period between the 2nd and the 5th day after spray is critical in the pathogenic process. Conclusion These results found the phenomenon that Ma initiatively broke host hemocytes, revealed the correlation between the virulence of Ma and the changes of enzymes activities in host induced by Ma, and clarified the critical period in the infection of Ma. So, these results should provide guidance for the construction of efficient biocontrol Ma strains. PMID:27227835

  17. Identification of a hybrid PKS-NRPS required for the biosynthesis of NG-391 in Metarhizium anisopliae var. anisopliae

    USDA-ARS?s Scientific Manuscript database

    A 19,818 kb genomic region harboring six predicted ORFs was identified in M. anisopliae ARSEF 2575. ORF4, putatively encoding a hybrid polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) was targeted using Agrobacterium-mediated gene knockout. Homologous recombinants failed to produce det...

  18. Virulence, horizontal transmission, and sublethal reproductive effects of Metarhizium anisopliae (Anamorphic fungi) on the German cockroach (Blattodea: Blattellidae).

    PubMed

    Quesada-Moraga, E; Santos-Quirós, R; Valverde-García, P; Santiago-Alvarez, C

    2004-09-01

    Virulence of Metarhizium anisopliae (Metschnikoff) Sorokin strain EAMa 01/121-Su against the German Cockroach, Blatella germanica (L.), was determined using four concentrations ranging from 4.2 x 10(6) to 4.2 x 10(9) spores per milliliter. The LD50 value was 1.4 x 10(7) spores per milliliter (56,000 spores per cockroach) and LT50 values were 14.8 days and 5.3 days for 4.2 x 10(8) and 4.2 x 10(9) spores per milliliter, respectively. An experiment was conducted to evaluate whether a fungal transmission could exist among infected and healthy cockroaches. Percentage mortality at a ratio of 1:10 of infected to unexposed cockroaches was 87.5% and LT50 was 12.2 days, which indicated the potential of this strain to be horizontally transmitted and to rapidly spread the infection in the insect population. The effect of a sublethal dose (ca. LD60) of M. anisopliae EAMa 01/121-Su strain, applied topically on German cockroaches, was studied by reciprocal crossing. Othecal production, oothecal hatchability, and nymphal production declined upon exposure to M. anisopliae EAMa 01/121-Su strain. The mean number of oothecae laid by female was progressively and significantly reduced by fungal treatment from second oviposition period onwards. Oothecal hatch of fungally challenged females was reduced by 46-49%, oothecal viability by 48-85%, and nymphal production by 22-35%. Only treated females showed an effect on oothecal production, oothecal hatch, and nymphal production, although oothecal hatch was also governed by treated males at a higher significance level. Our results on virulence and horizontal transmission of fungal conidia of M. anisopliae EAMa 01/121-Su strain and its sublethal reproductive effects on German cockroach females are discussed in terms of its potential to decrease the pest status of B. germanica in the short and long terms.

  19. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle

    PubMed Central

    Erler, Fedai; Ates, A. Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 109 conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m3 of moist soil medium for GR (9 × 108 cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 109 conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo. PMID:25881632

  20. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle.

    PubMed

    Erler, Fedai; Ates, A Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 10(9) conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m(3) of moist soil medium for GR (9 × 10(8) cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 10(9) conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo.

  1. Genomic Analyses and Transcriptional Profiles of the Glycoside Hydrolase Family 18 Genes of the Entomopathogenic Fungus Metarhizium anisopliae

    PubMed Central

    Junges, Ângela; Boldo, Juliano Tomazzoni; Souza, Bárbara Kunzler; Guedes, Rafael Lucas Muniz; Sbaraini, Nicolau; Kmetzsch, Lívia; Thompson, Claudia Elizabeth; Staats, Charley Christian; de Almeida, Luis Gonzaga Paula; de Vasconcelos, Ana Tereza Ribeiro; Vainstein, Marilene Henning; Schrank, Augusto

    2014-01-01

    Fungal chitin metabolism involves diverse processes such as metabolically active cell wall maintenance, basic nutrition, and different aspects of virulence. Chitinases are enzymes belonging to the glycoside hydrolase family 18 (GH18) and 19 (GH19) and are responsible for the hydrolysis of β-1,4-linkages in chitin. This linear homopolymer of N-acetyl-β-D-glucosamine is an essential constituent of fungal cell walls and arthropod exoskeletons. Several chitinases have been directly implicated in structural, morphogenetic, autolytic and nutritional activities of fungal cells. In the entomopathogen Metarhizium anisopliae, chitinases are also involved in virulence. Filamentous fungi genomes exhibit a higher number of chitinase-coding genes than bacteria or yeasts. The survey performed in the M. anisopliae genome has successfully identified 24 genes belonging to glycoside hydrolase family 18, including three previously experimentally determined chitinase-coding genes named chit1, chi2 and chi3. These putative chitinases were classified based on domain organization and phylogenetic analysis into the previously described A, B and C chitinase subgroups, and into a new subgroup D. Moreover, three GH18 proteins could be classified as putative endo-N-acetyl-β-D-glucosaminidases, enzymes that are associated with deglycosylation and were therefore assigned to a new subgroup E. The transcriptional profile of the GH18 genes was evaluated by qPCR with RNA extracted from eight culture conditions, representing different stages of development or different nutritional states. The transcripts from the GH18 genes were detected in at least one of the different M. anisopliae developmental stages, thus validating the proposed genes. Moreover, not all members from the same chitinase subgroup presented equal patterns of transcript expression under the eight distinct conditions studied. The determination of M. anisopliae chitinases and ENGases and a more detailed study concerning the enzymes

  2. Statistical optimization of process variables for the large-scale production of Metarhizium anisopliae conidiospores in solid-state fermentation.

    PubMed

    Bhanu Prakash, G V S; Padmaja, V; Siva Kiran, R R

    2008-04-01

    Optimization of conidial production was achieved by response surface methodology (RSM), a powerful mathematical approach widely applied in the optimization of fermentation process, using the three substrates; rice, barley and sorghum at variable pH, moisture content and yeast extract concentrations. These three factors were found to be important, affecting Metarhizium anisopliae spore production. A 2(3) full factorial central composite design and RSM were applied to determine the optimal concentration of each variable. A second-order polynomial was determined by the multiple regression analysis of the experimental data. Moisture content of 75.68% for sorghum, 73.21% for barley and 22.34% for rice produced optimal results. Maximal conidial yield was recorded for rice at a pH of 7.01; at 7.06 for sorghum and at 6.76 for barley.

  3. Density, Viability Conidia And Symptoms of Metarhizium anisopliae infection on Oryctes rhinoceros larvae

    NASA Astrophysics Data System (ADS)

    Indriyanti, D. R.; Putri, R. I. P.; Widiyaningrum, P.; Herlina, L.

    2017-04-01

    M. anisopliae is parasitic fungus on insect pests; it is used as a biocontrol agent. M. anisopliae can be propagated on maize or rice substrate. M. anisopliae is currently sold in the form of kaolin powder formulations. Before it is used to check the density, viability and pathogenicity of M. anisopliae. However the problem is the kaolin powder very soft, so it difficult to distinguish between kaolin and conidia. This article gives information on how to calculate conidia density, viability and symptoms of M. anisopliae infection on Oryctes rhinoceros larvae. The study was conducted in the laboratory to determine the density and viability. The pathogenicity testing was done using pots. The Pot is containing soil substrate mixed with M. Anispoliae and ten tails O. Rhinoceros larvae per pot. The results showed that the density of M. anisopliae conidia was 1.81 x 108 conidia mL-1 and the viability was 94% within 24 hours. The larval mortality began to emerge in the 1st week, and all larvae died at the sixth week. The symptom of M. anisopliae infection on Oryctes rhinoceros larvae, there was a black spot on the larval integument. The larvae movements become slow and poor appetite; it will die within 3-7 days. The larvae die hard, and the white hyphae grow on the body surface that turns green.

  4. The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

    PubMed

    Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

    2010-03-01

    The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

  5. Identification of genes differentially expressed by Metarhizium anisopliae growing on Locusta migratoria wings using suppression subtractive hybridization.

    PubMed

    Zhang, Chuanbo; Xia, Yuxian; Li, Zhongyuan

    2011-05-01

    Insect-pathogenic fungi penetrate their hosts directly through the cuticle. To better understand this process, we identified genes that were up-regulated by Metarhizium anisopliae germinating and differentiating on Locusta migratoria wings using suppression subtractive hybridization (SSH). A total of 78 unique expressed sequence tags (ESTs) up-regulated more than twofold during fungal growth on locust wings were identified. Among these 78 ESTs, 30 (38.5%) shared significant similarity with NCBI annotated hypothetical proteins, 16 (20.5%) shared low similarity to known or predicted genes, might represent novel genes, and 32 (41.0%) shared significant similarity with known proteins that are involved in various cell and molecular processes such as cell metabolism, protein metabolism, stress response and defense, and cell structure and function. Semi-quantitative RT-PCR analysis of six randomly selected genes confirmed the SSH results, verifying the fidelity of the SSH data. The results of this study provide novel information on genes expressed during early stages of infection with M. anisopliae, and improve current understanding of fungal pathogenesis.

  6. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite Are Compared in a Mouse Model.

    PubMed

    Ward, Marsha D W; Chung, Yong Joo; Copeland, Lisa B; Doerfler, Donald L

    2011-01-01

    Biopesticides can be effective in controlling their target pest. However, research regarding allergenicity and asthma development is limited. We compared the ability of fungal biopesticide Metarhizium anisopliae (MACA) and house dust mite (HDM) extracts to induce allergic responses in BALB/c mice. The extracts were administered by intratracheal aspiration at doubling doses (2.5-80 μg protein) 4X over a four-week period. Three days after the last exposure, serum and bronchoalveolar lavage fluid (BALF) were collected. The extracts' relative allergenicity was evaluated based on response robustness (lowest significant dose response compared to control (0 μg)). MACA induced a more robust serum total IgE response than HDM. However, in the antigen-specific IgE assay, a similar dose of both MACA and HDM was required to achieve the same response level. Our data suggest a threshold dose of MACA for allergy induction and that M. anisopliae may be similar to HDM in allergy induction potential.

  7. Comparative transcriptomic analysis of the heat stress response in the filamentous fungus Metarhizium anisopliae using RNA-Seq.

    PubMed

    Wang, Zhang-Xun; Zhou, Xia-Zhi; Meng, Hui-Min; Liu, Yu-Jun; Zhou, Quan; Huang, Bo

    2014-06-01

    The entomopathogenic fungus Metarhizium anisopliae is widely used for biological control of a variety of insect pests. The effectiveness of the microbial pest control agent, however, is limited by poor thermotolerance. The molecular mechanism underlying the response to heat stress in the conidia of entomopathogenic fungi remains unclear. Here, we conducted high-throughput RNA-Seq to analyze the differential gene expression between control and heat treated conidia of M. anisopliae at the transcriptome level. RNA-Seq analysis generated 6,284,262 and 5,826,934 clean reads in the control and heat treated groups, respectively. A total of 2,722 up-regulated and 788 down-regulated genes, with a cutoff of twofold change, were identified by expression analysis. Among these differentially expressed genes, many were related to metabolic processes, biological regulation, cellular processes and response to stimuli. The majority of genes involved in endocytic pathways, proteosome pathways and regulation of autophagy were up-regulated, while most genes involved in the ribosome pathway were down-regulated. These results suggest that these differentially expressed genes may be involved in the heat stress response in conidia. As expected, significant changes in expression levels of genes encoding heat shock proteins and proteins involved in trehalose accumulation were observed in conditions of heat stress. These results expand our understanding of the molecular mechanisms of the heat stress response of conidia and provide a foundation for future investigations.

  8. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed.

  9. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite Are Compared in a Mouse Model

    PubMed Central

    Ward, Marsha D. W.; Chung, Yong Joo; Copeland, Lisa B.; Doerfler, Donald L.

    2011-01-01

    Biopesticides can be effective in controlling their target pest. However, research regarding allergenicity and asthma development is limited. We compared the ability of fungal biopesticide Metarhizium anisopliae (MACA) and house dust mite (HDM) extracts to induce allergic responses in BALB/c mice. The extracts were administered by intratracheal aspiration at doubling doses (2.5–80 μg protein) 4X over a four-week period. Three days after the last exposure, serum and bronchoalveolar lavage fluid (BALF) were collected. The extracts' relative allergenicity was evaluated based on response robustness (lowest significant dose response compared to control (0 μg)). MACA induced a more robust serum total IgE response than HDM. However, in the antigen-specific IgE assay, a similar dose of both MACA and HDM was required to achieve the same response level. Our data suggest a threshold dose of MACA for allergy induction and that M. anisopliae may be similar to HDM in allergy induction potential. PMID:21785589

  10. Transformation system of Beauveria bassiana and Metarhizium anisopliae using nitrate reductase gene of Aspergillus nidulans.

    PubMed

    Sandhu, S S; Kinghorn, J R; Rajak, R C; Unkles, S E

    2001-07-01

    An heterologous transformation system for entomopathogenic fungi B. bassiana and M. anisopliae was developed based on the use of A. nidulans nitrate reductase gene (niaD). B. bassiana and M. anisopliae niaD stable mutants were selected by treatment of protoplast with ethane methane sulphonate (EMS) and regenerated on chlorate medium. The cloned gene was capable of transforming B. bassiana and M. anisopliae at a frequency of 5.8 to 20 transformants per microg of DNA. Most of them were mitotically stable.

  11. Differential susceptibility of adults and nymphs of Blattella germanica (L.) (Blattodea: Blattellidae) to infection by Metarhizium anisopliae and assessment of delivery strategies.

    PubMed

    Lopes, R B; Alves, S B

    2011-01-01

    Microbial insecticides for cockroach control, such as those containing entomopathogenic fungi, may be an alternative to reduce contamination by chemicals in housing and food storage environments. Virulence of isolate ESALQ1037 belonging to the Metarhizium anisopliae complex against nymphs and adults of Blattella germanica (L.), and its infectivity following exposure of insects to a contaminated surface or to M. anisopliae-bait were determined under laboratory conditions. Estimated LD50 15 d following topical inoculation was 2.69 x 10(5) conidia per adult, whereas for nymphs the maximum mortality was lower than 50%. Baits amended with M. anisopliae conidia had no repellent effect on targets; adult mortality was inferior to 25%, and nymphs were not susceptible. All conidia found in the digestive tract of M. anisopliae-bait fed cockroaches were unviable, and bait-treated insects that succumbed to fungal infection showed a typical mycelial growth on mouthparts and front legs, but not on the hind body parts. As opposed to baits, the use of a M. anisopliae powdery formulation for surface treatment was effective in attaining high mortality rates of B. germanica. Both nymphs and adults were infected when this delivery strategy was used, and mycelia growth occurred all over the body surface. Our results suggest that the development of powders or similar formulations of M. anisopliae to control B. germanica may provide faster and better results than some of the strategies based on baits currently available.

  12. Mutants and isolates of Metarhizium anisopliae are diverse in their relationships between conidial pigmentation and stress tolerance.

    PubMed

    Rangel, Drauzio E N; Butler, Michael J; Torabinejad, Javad; Anderson, Anne J; Braga, Gilberto U L; Day, Alan W; Roberts, Donald W

    2006-11-01

    Conidial pigmentation is involved in protection against heat and UV radiation in several fungal species. In this study, we compare the tolerance of 17 color mutants of wild-type ARSEF 23 plus 13 color mutants of wild-type ARSEF 2575 of Metarhizium anisopliae var. anisopliae to wet-heat and UV-B or simulated-solar radiation. The stress tolerance of each mutant was compared with that of its wild-type parent, and with the most thermo- and UV-tolerant wild-type Metarhizium we have tested to date, M. anisopliae var. acridum (ARSEF 324). The color of each isolate or mutant was identified with the PANTONE Color Standard book [Eiseman, L., Herbert, L., 1990. The PANTONE((R)) Book of Color: over 1000 color standards: color basics and guidelines for design, fashion, furnishing... and more. Harry N. Abrams, Inc., Publishers, New York]. In addition, the pigments of each mutant or wild-type were extracted and the UV absorbances of the extracts compared to the stress tolerance of those isolates; but no relationships were detected. Color mutants of ARSEF 23, in general, were less UV tolerant than their parent wild-type. With ARSEF 23 and its mutants, conidial pigmentation was important to conidial tolerance to UV-B and simulated-solar radiation; but color had less impact on ARSEF 2575 and its mutants. The ARSEF 2575 color mutants were less variable in UV tolerance than those of ARSEF 23, even though very similar colors occurred in the two groups of mutants. When color mutants of ARSEF 23 reverted to wild-type color they recovered wild-type levels of UV tolerance. Results of UV-B and UV-A exposures of wild-types ARSEF 23 and ARSEF 2575 conidia indicated that they are equally tolerant of UV-A, but differ in UV-B-response. For thermotolerance, several mutants were more heat tolerant than their wild-type parents. Accordingly, darker pigmentation of wild-type isolates was not important to protection against heat.

  13. A Field Experiment to Assess the Rate of Infestation in Honey Bee Populations of Two Metarhizium anisopliae Isolates on Varroa destructor (Acari: Mesostigmata)

    PubMed Central

    Pirali-kheirabadi, Khodadad; Teixeira-da-Silva, Jaime A; Razzaghi-Abyaneh, Mehdi; Nazemnia, Mehdi

    2013-01-01

    Background: The protective effect of two isolates of an entomopathogenic fungus, Metarhizium anisopliae (DEMI 002 and Iran 437C) on the adult stage of Varroa destructor was evaluated in comparison with fluvalinate strips in the field. Methods: A total of 12 honey bee colonies were provided from an apiculture farm. The selected hives were divided into 4 groups (3 hives per group). The first group was the control, treated with distilled water. The other two groups were exposed to different fungi (M. anisopliae isolates DEMI 002 and Iran 437C) and the last group was treated with one strip of fluvalinate per colony. The number of fallen mites was counted using sticky traps during a 6-day period, six days before and after treatments. A fungal suspension at a concentration of 5× 106 conidia/mL was sprayed onto the frames and the number of fallen mites was counted. Results: Metarhizium anisopliae DEMI 002 and Iran 437C isolates were as effective (i.e., caused as much mite fall) as the fluvalinate strip in controlling bee colonies than no treatment. Conclusion: Both M. anisopliae isolates are promising candidates as agents in the control of Varroa mites under field conditions. Isolate DEMI 002 can be considered as a possible non-chemical biocontrol agent for controlling bee infestation with V. destructor in the field. In order to substantiate this hypothesis, tests are currently being performed using larger colonies and larger doses than tested in the present study in our beekeeping. PMID:23785691

  14. The extracellular constitutive production of chitin deacetylase in Metarhizium anisopliae: possible edge to entomopathogenic fungi in the biological control of insect pests.

    PubMed

    Nahar, Pallavi; Ghormade, Vandana; Deshpande, Mukund V

    2004-02-01

    The possible contribution of extracellular constitutively produced chitin deacetylase by Metarhizium anisopliae in the process of insect pathogenesis has been evaluated. Chitin deacetylase converts chitin, a beta-1,4-linked N-acetylglucosamine polymer, into its deacetylated form chitosan, a glucosamine polymer. When grown in a yeast extract-peptone medium, M. anisopliae constitutively produced the enzymes protease, lipase, and two chitin-metabolizing enzymes, viz. chitin deacetylase (CDA) and chitosanase. Chitinase activity was induced in chitin-containing medium. Staining of 7.5% native polyacrylamide gels at pH 8.9 revealed CDA activity in three bands. SDS-PAGE showed that the apparent molecular masses of the three isoforms were 70, 37, and 26 kDa, respectively. Solubilized melanin (10microg) inhibited chitinase activity, whereas CDA was unaffected. Following germination of M. anisopliae conidia on isolated Helicoverpa armigera, cuticle revealed the presence of chitosan by staining with 3-methyl-2-benzothiazoline hydrazone. Blue patches of chitosan were observed on cuticle, indicating conversion of chitin to chitosan. Hydrolysis of chitin with constitutively produced enzymes of M. anisopliae suggested that CDA along with chitosanase contributed significantly to chitin hydrolysis. Thus, chitin deacetylase was important in initiating pathogenesis of M. anisopliae softening the insect cuticle to aid mycelial penetration. Evaluation of CDA and chitinase activities in other isolates of Metarhizium showed that those strains had low chitinase activity but high CDA activity. Chemical assays of M. anisopliae cell wall composition revealed the presence of chitosan. CDA may have a dual role in modifying the insect cuticular chitin for easy penetration as well as for altering its own cell walls for defense from insect chitinase.

  15. Secondary metabolite gene clusters in the entomopathogen fungus Metarhizium anisopliae: genome identification and patterns of expression in a cuticle infection model.

    PubMed

    Sbaraini, Nicolau; Guedes, Rafael Lucas Muniz; Andreis, Fábio Carrer; Junges, Ângela; de Morais, Guilherme Loss; Vainstein, Marilene Henning; de Vasconcelos, Ana Tereza Ribeiro; Schrank, Augusto

    2016-10-25

    The described species from the Metarhizium genus are cosmopolitan fungi that infect arthropod hosts. Interestingly, while some species infect a wide range of hosts (host-generalists), other species infect only a few arthropods (host-specialists). This singular evolutionary trait permits unique comparisons to determine how pathogens and virulence determinants emerge. Among the several virulence determinants that have been described, secondary metabolites (SMs) are suggested to play essential roles during fungal infection. Despite progress in the study of pathogen-host relationships, the majority of genes related to SM production in Metarhizium spp. are uncharacterized, and little is known about their genomic organization, expression and regulation. To better understand how infection conditions may affect SM production in Metarhizium anisopliae, we have performed a deep survey and description of SM biosynthetic gene clusters (BGCs) in M. anisopliae, analyzed RNA-seq data from fungi grown on cattle-tick cuticles, evaluated the differential expression of BGCs, and assessed conservation among the Metarhizium genus. Furthermore, our analysis extended to the construction of a phylogeny for the following three BGCs: a tropolone/citrinin-related compound (MaPKS1), a pseurotin-related compound (MaNRPS-PKS2), and a putative helvolic acid (MaTERP1). Among 73 BGCs identified in M. anisopliae, 20 % were up-regulated during initial tick cuticle infection and presumably possess virulence-related roles. These up-regulated BGCs include known clusters, such as destruxin, NG39x and ferricrocin, together with putative helvolic acid and, pseurotin and tropolone/citrinin-related compound clusters as well as uncharacterized clusters. Furthermore, several previously characterized and putative BGCs were silent or down-regulated in initial infection conditions, indicating minor participation over the course of infection. Interestingly, several up-regulated BGCs were not conserved in host

  16. Horizontal Transmission of Metarhizium anisopliae in Fruit Flies and Effect of Fungal Infection on Egg Laying and Fertility

    PubMed Central

    Dimbi, Susan; Maniania, Nguya K.; Ekesi, Sunday

    2013-01-01

    Fly-to-fly transmission of conidia of the entomopathogenic fungus Metarhizium anisopliae and the effect of fungal infection on the reproductive potential of females surviving infection were investigated in three fruit fly species, Ceratitis cosyra, C. fasciventris, and C. capitata. The number of conidia picked up by a single fruit fly was determined in C. cosyra. The initial uptake (Day 0) of conidia by a single fly was approx. 1.1 × 106 conidia after exposure to the treated substrate. However, the number of conidia dropped from 7.2 × 105 to 4.1 × 105 conidia after 2 and 8 h post-exposure, respectively. The number of conidia picked up by a single fungus-treated fly (“donor”) varied between 3.8 × 105 and 1.0 × 106 in the three fruit fly species, resulting in 100% mortality 5–6 days post-exposure. When fungus-free flies of both sexes (“recipient” flies) were allowed to mate with “donor” flies, the number of conidia picked up by a single fly varied between 1.0 × 105 and 2.5 × 105, resulting in a mortality of 83–100% in C. capitata, 72–85% in C. cosyra and 71–93% in C. fasciventris 10–15 days post-inoculation. There was an effect of fungal infection on female egg laying in the three species of fruit flies as control flies laid more eggs than fungus-treated females. The percentage reduction in fecundity in flies infected with M. anisopliae was 82, 73 and 37% in C. capitata, C. fasciventris and C. cosyra, respectively. The results are discussed with regard to application in autodissemination techniques. PMID:26464386

  17. Heat-stressed Metarhizium anisopliae: viability (in vitro) and virulence (in vivo) assessments against the tick Rhipicephalus sanguineus.

    PubMed

    Alves, Fabrício M; Bernardo, Cíntia C; Paixão, Flávia R S; Barreto, Lucas P; Luz, Christian; Humber, Richard A; Fernandes, Éverton K K

    2017-01-01

    The current study investigated the thermotolerance of Metarhizium anisopliae s.l. conidia from the commercial products Metarril® SP Organic and Metarril® WP. The efficacy of these M. anisopliae formulations against the tick Rhipicephalus sanguineus s.l. was studied in laboratory under optimum or heat-stress conditions. The products were prepared in water [Tween® 80, 0.01 % (v/v)] or pure mineral oil. Conidia from Metarril® SP Organic suspended in water presented markedly delayed germination after heating to constant 40 °C (for 2, 4, or 6 h) compared to conidia suspended in mineral oil. Metarril® SP Organic suspended in oil and exposed to daily cycles of heat-stress (40 °C for 4 h and 25 °C for 19 h for 5 consecutive days) presented relative germination of conidia ranging from 92.8 to 87.2 % from day 1 to day 5, respectively. Conversely, germination of conidia prepared in water ranged from 79.3 to 39.1 % from day 1 to day 5, respectively. Culturability of Metarril® WP decreased from 96 % when conidia were cultured for 30 min prior to heat exposure (40 °C for 4 h) to 9 % when conidia were cultured for 8 h. Tick percent control was distinctly higher when engorged females were treated with oil suspensions rather than water suspensions, even when treated ticks were exposed to heat-stress regimen. Oil-based applications protected fungal conidia against heat-stress. Although Metarril® is not registered for tick control, it may be useful for controlling R. sanguineus, especially if it is prepared in mineral oil.

  18. Human sera IgE reacts with a Metarhizium anisopliae fungal catalase

    EPA Science Inventory

    Background: Previous studies have demonstrated that Metarhzium anisopliae extract can induce immune responses in a mouse model that are characteristic of human allergic asthma. Objectives: The objective of this study was to identify and characterize the extract proteins t...

  19. Human sera IgE reacts with a Metarhizium anisopliae fungal catalase

    EPA Science Inventory

    Background: Previous studies have demonstrated that Metarhzium anisopliae extract can induce immune responses in a mouse model that are characteristic of human allergic asthma. Objectives: The objective of this study was to identify and characterize the extract proteins t...

  20. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  1. Susceptibility of adult female Aedes aegypti (Diptera: Culicidae) to the entomopathogenic fungus Metarhizium anisopliae is modified following blood feeding.

    PubMed

    Paula, Adriano R; Carolino, Aline T; Silva, Carlos P; Samuels, Richard I

    2011-05-26

    The mosquito Aedes aegypti, vector of dengue fever, is a target for control by entomopathogenic fungi. Recent studies by our group have shown the susceptibility of adult A. aegypti to fungal infection by Metarhizium anisopliae. This fungus is currently being tested under field conditions. However, it is unknown whether blood-fed A. aegypti females are equally susceptible to infection by entomopathogenic fungi as sucrose fed females. Insect populations will be composed of females in a range of nutritional states. The fungus should be equally efficient at reducing survival of insects that rest on fungus impregnated surfaces following a blood meal as those coming into contact with fungi before host feeding. This could be an important factor when considering the behavior of A. aegypti females that can blood feed on multiple hosts over a short time period. Female A. aegypti of the Rockefeller strain and a wild strain were infected with two isolates of the entomopathogenic fungus M. anisopliae (LPP 133 and ESALQ 818) using an indirect contact bioassay at different times following blood feeding. Survival rates were monitored on a daily basis and one-way analysis of variance combined with Duncan's post-hoc test or Log-rank survival curve analysis were used for statistical comparisons of susceptibility to infection. Blood feeding rapidly reduced susceptibility to infection, determined by the difference in survival rates and survival curves, when females were exposed to either of the two M. anisopliae isolates. Following a time lag which probably coincided with digestion of the blood meal (96-120 h post-feeding), host susceptibility to infection returned to pre-blood fed (sucrose fed) levels. Reduced susceptibility of A. aegypti to fungi following a blood meal is of concern. Furthermore, engorged females seeking out intra-domicile resting places post-blood feeding, would be predicted to rest for prolonged periods on fungus impregnated black cloths, thus optimizing infection

  2. Copulation Activity, Sperm Production and Conidia Transfer in Aedes aegypti Males Contaminated by Metarhizium anisopliae: A Biological Control Prospect.

    PubMed

    Garza-Hernández, Javier A; Reyes-Villanueva, Filiberto; Russell, Tanya L; Braks, Marieta A H; Garcia-Munguia, Alberto M; Rodríguez-Pérez, Mario A

    2015-01-01

    Dengue is the most prevalent arboviral disease transmitted by Aedes aegypti worldwide, whose chemical control is difficult, expensive, and of inconsistent efficacy. Releases of Metarhizium anisopliae--exposed Ae. aegypti males to disseminate conidia among female mosquitoes by mating represents a promising biological control approach against this important vector. A better understanding of fungus virulence and impact on reproductive parameters of Ae. aegypti, is need before testing auto-dissemination strategies. Mortality, mating competitiveness, sperm production, and the capacity to auto-disseminate the fungus to females up to the 5 th copulation, were compared between Aedes aegypti males exposed to 5.96 x 10(7) conidia per cm2 of M. anisopliae and uninfected males. Half (50%) of fungus-exposed males (FEMs) died within the first 4 days post-exposure (PE). FEMs required 34% more time to successively copulate with 5 females (165 ± 3 minutes) than uninfected males (109 ± 3 minutes). Additionally, fungus infection reduced the sperm production by 87% at 5 days PE. Some beneficial impacts were observed, FEMs were able to successfully compete with uninfected males in cages, inseminating an equivalent number of females (about 25%). Under semi-field conditions, the ability of FEMs to search for and inseminate females was also equivalent to uninfected males (both inseminating about 40% females); but for the remaining females that were not inseminated, evidence of tarsal contact (transfer of fluorescent dust) was significantly greater in FEMs compared to controls. The estimated conidia load of a female exposed on the 5th copulation was 5,200 mL(-1) which was sufficient to cause mortality. Our study is the first to demonstrate auto-dissemination of M. anisopliae through transfer of fungus from males to female Ae. aegypti during mating under semi-field conditions. Our results suggest that auto-dissemination studies using releases of FEMs inside households could successfully

  3. Autodissemination of the entomopathogenic fungus Metarhizium anisopliae amongst adults of the malaria vector Anopheles gambiae s.s.

    PubMed Central

    Scholte, Ernst-Jan; Knols, Bart GJ; Takken, Willem

    2004-01-01

    Background The entomopathogenic fungus Metarhizium anisopliae is being considered as a biocontrol agent for adult African malaria vectors. In the laboratory, work was carried out to assess whether horizontal transmission of the pathogen can take place during copulation, as this would enhance the impact of the fungus on target populations when compared with insecticides. Methods Virgin female Anopheles gambiae sensu stricto were exposed to conidia whilst resting on fungus-impregnated paper. These females were then placed together for one hour with uncontaminated males in proportions of either 1:1 or 1:10 shortly before the onset of mating activity. Results Males that had acquired fungal infection after mating indicate that passive transfer of the pathogen from infected females does occur, with mean male infection rates between 10.7 ± 3.2% and 33.3 ± 3.8%. The infections caused by horizontal transmission did not result in overall differences in survival between males from test and control groups, but in one of the three experiments the infected males had significantly shorter life spans than uninfected males (P < 0.05). Conclusion This study shows that autodissemination of fungal inoculum between An. gambiae s.s. mosquitoes during mating activity is possible under laboratory conditions. Field studies are required next, to assess the extent to which this phenomenon may augment the primary contamination pathway (i.e. direct contact with fungus-impregnated targets) of vector populations in the field. PMID:15566626

  4. Ethanol production from chitosan by the nematophagous fungus Pochonia chlamydosporia and the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana.

    PubMed

    Aranda-Martinez, Almudena; Naranjo Ortiz, Miguel Ángel; Abihssira García, Isabel Sofía; Zavala-Gonzalez, Ernesto A; Lopez-Llorca, Luis Vicente

    2017-11-01

    Chitin is the second most abundant biopolymer after cellulose and virtually unexplored as raw material for bioethanol production. In this paper, we investigate chitosan, the deacetylated form of chitin which is the main component of shellfish waste, as substrate for bioethanol production by fungi. Fungal parasites of invertebrates such as the nematophagous Pochonia chlamydosporia (Pc) or the entomopathogens Beauveria bassiana (Bb) and Metarhizium anisopliae (Ma) are biocontrol agents of plant parasitic nematodes (eg. Meloidogyne spp.) or insect pests such as the red palm weevil (Rhynchophorus ferrugineus). These fungi degrade chitin-rich barriers for host penetration. We have therefore tested the chitin/chitosanolytic capabilities of Pc, Bb and Ma for generating reducing sugars using chitosan as only nutrient. Among the microorganisms used in this study, Pc is the best chitosan degrader, even under anaerobic conditions. These fungi have alcohol dehydrogenase (ADH) and pyruvate decarboxylase (PDC) encoding genes in their genomes. We have therefore analyzed their ethanol production under anaerobic conditions using chitosan as raw material. P. chlamydosporia is the largest ethanol producer from chitosan. Our studies are a starting point to develop chitin-chitosan based biofuels. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Evaluation of Metarhizium anisopliae (Metsch) Sorok. to target larvae and adults of Capnodis tenebrionis (L.) (Coleoptera: Buprestidae) in soil and fiber band applications.

    PubMed

    Marannino, Pierdomenico; Santiago-Alvarez, Cándido; de Lillo, Enrico; Quesada-Moraga, Enrique

    2008-03-01

    The aim of this work has been to evaluate in the laboratory the potential of entomopathogenic fungi against adults and larvae of Capnodis tenebrionis (L.) (Coleoptera: Buprestidae) through fiber band application and a potted plant bioassay with soil application, respectively. Our previous findings revealed that Metarhizium anisopliae EAMa 01/58-Su isolate was the most virulent against neonate larvae of the buprestid. In the present work, M. anisopliae EAMa 01/58-Su isolate has been also shown to be highly virulent against adult beetles by immersion in a conidial suspension; thus it was selected to accomplish our objectives. When adult beetles were stimulated to climb 100 x 200 mm non-woven commercial fiber bands impregnated with conidia of M. anisopliae EAMa 01/58-Su isolate, total mortality rates varied from 85.7% to 100.0%; whereas no significant correlation was detected between the time needed to cross the band (mean value 648.7+/-22.4s) and the time of death, with mean average survival time ranging between 10.3 and 16.0 days, compared to 28 days of the controls. Potted seedlings (5-6 months old) of cherry plum (Prunus myrobalana Lois.), a commonly used apricot rootstock, were used to study the efficacy of soil treatment with M. anisopliae EAMa 01/58-Su isolate against neonate C. tenebrionis larvae. The soil inoculation with M. anisopliae EAMa 01/58-Su isolate had a significant effect on the mean number of dead larvae recovered from the roots, with mean mortality ranging from 83.3% to 91.6%; whereas no significant differences were detected between the three fungal doses. In all cases, dead larvae found within roots exhibited external signs of fungal growth. Hence, it may be possible to use M. anisopliae EAMa 01/58-Su isolate in a biocontrol strategy targeting both adults and larvae of C. tenebrionis.

  6. Influence of entomopathogenic fungus, Metarhizium anisopliae, alone and in combination with diatomaceous earth and thiamethoxam on mortality, progeny production, mycosis, and sporulation of the stored grain insect pests.

    PubMed

    Ashraf, Misbah; Farooq, Muhammad; Shakeel, Muhammad; Din, Naima; Hussain, Shahbaz; Saeed, Nadia; Shakeel, Qaiser; Rajput, Nasir Ahmed

    2017-10-10

    The stored grain insects cause great damage to grains under storage conditions. Synthetic insecticides and fumigants are considered as key measures to control these stored grain insect pests. However, the major issue with these chemicals is grain contamination with chemical residues and development of resistance by insect pests to these chemicals. Biological control is considered as a potential alternative to chemical control especially with the use of pathogens, alone or in combination with selective insecticides. The present study was conducted to evaluate the synergism of Metarhizium anisopliae with diatomaceous earth (DE) and thiamethoxam against four insect pests on the stored wheat grains. In the first bioassay, the M. anisopliae was applied at 1.4 × 10(4) and 1.4 × 10(6)conidia/ml alone and in integration with two concentrations (250 and 500 ppm) of tested DE. The tested fungus when combined with DE and thiamethoxam possessed synergistic impact as compared to their individual efficacy. Adult mortality increased with respect to increased exposure interval and doses. In the second bioassay, M. anisopliae was applied at 1.4 × 10(4) conidia/ml individually and in combination with three concentrations (0.50, 0.75, and 1.00 ppm) of thiamethoxam. Results concluded that M. anisopliae integrated with DE and thiamethoxam provides more effective control of stored grain insect pests.

  7. The effect of leaf biopesticide Mirabilis jalapa and fungi Metarhizium anisopliae to immune response and mortality of Spodoptera exigua instar IV

    NASA Astrophysics Data System (ADS)

    Suryani, A. Irma; Anggraeni, Tjandra

    2014-03-01

    Spodoptera exigua is one of insect causing damage in agriculture sector. This insect can be controlled by a natural biopesticide by combining two agents of biological control, biopesticides Mirabilis jalapa and entomopathogenic fungi Metarhizium anisopliae, considered to be virulent toward a wide range of insects. The objective of research was to determine the effect of biopesticides M. jalapa and fungi M. anisopliae against immune system and mortality of S. exigua. This research used a complete randomized block design with five concentrations Mirabilis jalapa and optimum dose of M. anisopliae. A high dose of M. jalapa (0.8% w/v) is the most effective one to decrease total haemocytes especially granulocyt and plasmatocyt (cellular immune) and decrease the concentration of lectin (humoral immune) from S. exigua (p < 0.05). The combination of M. jalapa (0, 8% w/v) and lethal dose of M. anisopliae 2.59 × 107 spore/ml were significant to increase mortality of S. exigua within 48 hours (p < 0.05).

  8. Neem oil increases the efficiency of the entomopathogenic fungus Metarhizium anisopliae for the control of Aedes aegypti (Diptera: Culicidae) larvae.

    PubMed

    Gomes, Simone A; Paula, Adriano R; Ribeiro, Anderson; Moraes, Catia O P; Santos, Jonathan W A B; Silva, Carlos P; Samuels, Richard I

    2015-12-30

    Entomopathogenic fungi are potential candidates for use in integrated vector management and many isolates are compatible with synthetic and natural insecticides. Neem oil was tested separately and in combination with the entomopathogenic fungus Metarhizium anisopliae against larvae of the dengue vector Aedes aegypti. Our aim was to increase the effectiveness of the fungus for the control of larval mosquito populations. Commercially available neem oil was used at concentrations ranging from 0.0001 to 1%. Larval survival rates were monitored over a 7 day period following exposure to neem. The virulence of the fungus M. anisopliae was confirmed using five conidial concentrations (1 × 10(5) to 1 × 10(9) conidia mL(-1)) and survival monitored over 7 days. Two concentrations of fungal conidia were then tested together with neem (0.001%). Survival curve comparisons were carried out using the Log-rank test and end-point survival rates were compared using one-way ANOVA. 1% neem was toxic to A. aegypti larvae reducing survival to 18% with S50 of 2 days. Neem had no effect on conidial germination or fungal vegetative growth in vitro. Larval survival rates were reduced to 24% (S50 = 3 days) when using 1 × 10(9) conidia mL(-1). Using 1 × 10(8) conidia mL(-1), 30% survival (S50 = 3 days) was observed. We tested a "sub-lethal" neem concentration (0.001%) together with these concentrations of conidia. For combinations of neem + fungus, the survival rates were significantly lower than the survival rates seen for fungus alone or for neem alone. Using a combination of 1 × 10(7) conidia mL(-1) + neem (0.001%), the survival rates were 36%, whereas exposure to the fungus alone resulted in 74% survival and exposure to neem alone resulted in 78% survival. When using 1 × 10(8) conidia mL(-1), the survival curves were modified, with a combination of the fungus + neem resulting in 12% survival, whilst the fungus alone at this concentration also

  9. Pyrethroid resistance in Anopheles gambiae leads to increased susceptibility to the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana

    PubMed Central

    2010-01-01

    Background Entomopathogenic fungi are being investigated as a new mosquito control tool because insecticide resistance is preventing successful mosquito control in many countries, and new methods are required that can target insecticide-resistant malaria vectors. Although laboratory studies have previously examined the effects of entomopathogenic fungi against adult mosquitoes, most application methods used cannot be readily deployed in the field. Because the fungi are biological organisms it is important to test potential field application methods that will not adversely affect them. The two objectives of this study were to investigate any differences in fungal susceptibility between an insecticide-resistant and insecticide-susceptible strain of Anopheles gambiae sensu stricto, and to test a potential field application method with respect to the viability and virulence of two fungal species Methods Pieces of white polyester netting were dipped in Metarhizium anisopliae ICIPE-30 or Beauveria bassiana IMI391510 mineral oil suspensions. These were kept at 27 ± 1°C, 80 ± 10% RH and the viability of the fungal conidia was recorded at different time points. Tube bioassays were used to infect insecticide-resistant (VKPER) and insecticide-susceptible (SKK) strains of An. gambiae s.s., and survival analysis was used to determine effects of mosquito strain, fungus species or time since fungal treatment of the net. Results The resistant VKPER strain was significantly more susceptible to fungal infection than the insecticide-susceptible SKK strain. Furthermore, B. bassiana was significantly more virulent than M. anisopliae for both mosquito strains, although this may be linked to the different viabilities of these fungal species. The viability of both fungal species decreased significantly one day after application onto polyester netting when compared to the viability of conidia remaining in suspension. Conclusions The insecticide-resistant mosquito strain was susceptible

  10. Effects of temperature and relative humidity on sporulation of Metarhizium anisopliae var. acridum in mycosed cadavers of Schistocerca gregaria.

    PubMed

    Arthurs, S; Thomas, M B

    2001-08-01

    The effects of relative humidity (RH) and temperature on the sporulation of Metarhizium anisopliae var. acridum on mycosed cadavers of desert locust, Schistocerca gregaria, were assessed in the laboratory. Quantitative assessments of conidial production over 10 days under constant conditions showed that sporulation was optimized at RH > 96% and at temperatures between 20 and 30 degrees C. Under both these conditions >10(9) conidia/cadaver were produced. At 25 degrees C, conidial yield was maximized under conditions in which cadavers remained in contact with damp substrate. Relatively little sporulation occurred at 15 degrees C (< 3 x 10(7) conidia/cadaver) and 40 degrees C (< 4 x 10(6) conidia/cadaver) and no sporulation occurred at 10 or 45 degrees C. Following incubation, conidial yield was closely related to the water content of locust cadavers. In separate tests, locust cadavers were incubated for 10 days under diurnally fluctuating temperature and RH that comprised favorable (25 degrees C/100% RH) alternating with unfavorable (40 degrees C/80% RH) conditions for sporulation. In this case, fewer conidia were produced compared with cadavers that were incubated under the favorable conditions for an equal period cumulatively but were not periodically exposed to unfavorable conditions. However, this reduced sporulation observed with the fluctuating condition was not observed when cadavers were similarly incubated under favorable/unfavorable conditions of temperature but were not periodically exposed to the low RH condition. This result implies that sporulation is a dynamic process, dependent not only on periodic exposure to favorable RH but also on the interrelation of this with low RH. Associated tests and the monitoring of changes in cadaver weights imply that the mechanism driving the reduced sporulation under fluctuating RH is the net water balance of cadavers, i.e. the cumulative ability of the fungus/cadaver to adsorb water necessary for sporulation at high

  11. Copulation Activity, Sperm Production and Conidia Transfer in Aedes aegypti Males Contaminated by Metarhizium anisopliae: A Biological Control Prospect

    PubMed Central

    Russell, Tanya L.; Braks, Marieta A. H.

    2015-01-01

    Background Dengue is the most prevalent arboviral disease transmitted by Aedes aegypti worldwide, whose chemical control is difficult, expensive, and of inconsistent efficacy. Releases of Metarhizium anisopliae—exposed Ae. aegypti males to disseminate conidia among female mosquitoes by mating represents a promising biological control approach against this important vector. A better understanding of fungus virulence and impact on reproductive parameters of Ae. aegypti, is need before testing auto-dissemination strategies. Methodology/Principal Findings Mortality, mating competitiveness, sperm production, and the capacity to auto-disseminate the fungus to females up to the 5thcopulation, were compared between Aedes aegypti males exposed to 5.96 x 107 conidia per cm2 of M. anisopliae and uninfected males. Half (50%) of fungus-exposed males (FEMs) died within the first 4 days post-exposure (PE). FEMs required 34% more time to successively copulate with 5 females (165 ± 3 minutes) than uninfected males (109 ± 3 minutes). Additionally, fungus infection reduced the sperm production by 87% at 5 days PE. Some beneficial impacts were observed, FEMs were able to successfully compete with uninfected males in cages, inseminating an equivalent number of females (about 25%). Under semi-field conditions, the ability of FEMs to search for and inseminate females was also equivalent to uninfected males (both inseminating about 40% females); but for the remaining females that were not inseminated, evidence of tarsal contact (transfer of fluorescent dust) was significantly greater in FEMs compared to controls. The estimated conidia load of a female exposed on the 5th copulation was 5,200 mL-1 which was sufficient to cause mortality. Conclusion/Significance Our study is the first to demonstrate auto-dissemination of M. anisopliae through transfer of fungus from males to female Ae. aegypti during mating under semi-field conditions. Our results suggest that auto-dissemination studies

  12. Effects of conidial densities and spray volume of Metarhizium anisopliae and Beauveria bassiana fungal suspensions on conidial viability, droplet size and deposition coverage in bioassay using a novel bioassay spray system

    USDA-ARS?s Scientific Manuscript database

    Experiments were conducted to study the conidial viability during bioassay spray with different suspensions of Metarhizium anisopliae ATCC 62176 and Beauveria bassiana NI8, and to investigate the effects of conidial density and spray volume on the distribution of droplet size and deposit coverage us...

  13. Effectiveness of Bacillus thuringiensis-Transgenic Chickpeas and the Entomopathogenic Fungus Metarhizium anisopliae in Controlling Helicoverpa armigera (Lepidoptera: Noctuidae)▿

    PubMed Central

    Lawo, N. C.; Mahon, R. J.; Milner, R. J.; Sarmah, B. K.; Higgins, T. J. V.; Romeis, J.

    2008-01-01

    The use of genetically modified (Bt) crops expressing lepidopteran-specific Cry proteins derived from the soil bacterium Bacillus thuringiensis is an effective method to control the polyphagous pest Helicoverpa armigera. As H. armigera potentially develops resistance to Cry proteins, Bt crops should be regarded as one tool in integrated pest management. Therefore, they should be compatible with biological control. Bioassays were conducted to understand the interactions between a Cry2Aa-expressing chickpea line, either a susceptible or a Cry2A-resistant H. armigera strain, and the entomopathogenic fungus Metarhizium anisopliae. In a first concentration-response assay, Cry2A-resistant larvae were more tolerant of M. anisopliae than susceptible larvae, while in a second bioassay, the fungus caused similar mortalities in the two strains fed control chickpea leaves. Thus, resistance to Cry2A did not cause any fitness costs that became visible as increased susceptibility to the fungus. On Bt chickpea leaves, susceptible H. armigera larvae were more sensitive to M. anisopliae than on control leaves. It appeared that sublethal damage induced by the B. thuringiensis toxin enhanced the effectiveness of M. anisopliae. For Cry2A-resistant larvae, the mortalities caused by the fungus were similar when they were fed either food source. To examine which strain would be more likely to be exposed to the fungus, their movements on control and Bt chickpea plants were compared. Movement did not appear to differ among larvae on Bt or conventional chickpeas, as indicated by the number of leaflets damaged per leaf. The findings suggest that Bt chickpeas and M. anisopliae are compatible to control H. armigera. PMID:18487396

  14. Isolation of Metarhizium anisopliae carboxypeptidase A with native disulfide bonds from the cytosol of Escherichia coli BL21(DE3)

    PubMed Central

    Austin, Brian P.; Waugh, David S.

    2011-01-01

    The carboxypeptidase A enzyme from Metarhizium anisopliae (MeCPA) has broader specificity than the mammalian A-type carboxypeptidases, making it a more useful reagent for the removal of short affinity tags and disordered residues from the C-termini of recombinant proteins. When secreted from baculovirus-infected insect cells, the yield of pure MeCPA was 0.25 mg per liter of conditioned medium. Here, we describe a procedure for the production of MeCPA in the cytosol of Escherichia coli that yields approximately 0.5 mg of pure enzyme per liter of cell culture. The bacterial system is much easier to scale up and far less expensive than the insect cell system. The expression strategy entails maintaining the proMeCPA zymogen in a soluble state by fusing it to the C-terminus of maltose-binding protein (MBP) while simultaneously overproducing the protein disulfide isomerase DsbC in the cytosol from a separate plasmid. Unexpectedly, we found that the yield of active and properly oxidized MeCPA was highest when coexpressed with DsbC in BL21(DE3) cells that do not also contain mutations in the trxB and gor genes. Moreover, the formation of active MeCPA was only partially dependent on the disulfide-isomerase activity of DsbC. Intriguingly, we observed that most of the active MeCPA was generated after cell lysis and amylose affinity purification of the MBP-proMeCPA fusion protein, during the time that the partially purified protein was held overnight at 4 °C prior to activation with thermolysin. Following removal of the MBP-propeptide by thermolysin digestion, active MeCPA (with a C-terminal polyhistidine tag) was purified to homogeneity by immobilized metal affinity chromatography (IMAC), ion exchange chromatography and gel filtration. PMID:22197595

  15. Infection of malaria (Anopheles gambiae s.s.) and filariasis (Culex quinquefasciatus) vectors with the entomopathogenic fungus Metarhizium anisopliae

    PubMed Central

    Scholte, Ernst-Jan; Njiru, Basilio N; Smallegange, Renate C; Takken, Willem; Knols, Bart GJ

    2003-01-01

    Background Current intra-domiciliary vector control depends on the application of residual insecticides and/or repellents. Although biological control agents have been developed against aquatic mosquito stages, none are available for adults. Following successful use of an entomopathogenic fungus against tsetse flies (Diptera: Glossinidae) we investigated the potency of this fungus as a biological control agent for adult malaria and filariasis vector mosquitoes. Methods In the laboratory, both sexes of Anopheles gambiae sensu stricto and Culex quinquefasciatus were passively contaminated with dry conidia of Metarhizium anisopliae. Pathogenicity of this fungus for An. gambiae was further tested for varying exposure times and different doses of oil-formulated conidia. Results Comparison of Gompertz survival curves and LT50 values for treated and untreated specimens showed that, for both species, infected mosquitoes died significantly earlier (p < 0.0001) than uninfected control groups. No differences in LT50 values were found for different exposure times (24, 48 hrs or continuous exposure) of An. gambiae to dry conidia. Exposure to oil-formulated conidia (doses ranging from 1.6 × 107 to 1.6 × 1010 conidia/m2) gave LT50 values of 9.69 ± 1.24 (lowest dose) to 5.89 ± 0.35 days (highest dose), with infection percentages ranging from 4.4–83.7%. Conclusion Our study marks the first to use an entomopathogenic fungus against adult Afrotropical disease vectors. Given its high pathogenicity for both adult Anopheles and Culex mosquitoes we recommend development of novel targeted indoor application methods for the control of endophagic host-seeking females. PMID:14565851

  16. Infection of malaria (Anopheles gambiae s.s.) and filariasis (Culex quinquefasciatus) vectors with the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Scholte, Ernst-Jan; Njiru, Basilio N; Smallegange, Renate C; Takken, Willem; Knols, Bart G J

    2003-09-15

    Current intra-domiciliary vector control depends on the application of residual insecticides and/or repellents. Although biological control agents have been developed against aquatic mosquito stages, none are available for adults. Following successful use of an entomopathogenic fungus against tsetse flies (Diptera: Glossinidae) we investigated the potency of this fungus as a biological control agent for adult malaria and filariasis vector mosquitoes. In the laboratory, both sexes of Anopheles gambiae sensu stricto and Culex quinquefasciatus were passively contaminated with dry conidia of Metarhizium anisopliae. Pathogenicity of this fungus for An. gambiae was further tested for varying exposure times and different doses of oil-formulated conidia. Comparison of Gompertz survival curves and LT50 values for treated and untreated specimens showed that, for both species, infected mosquitoes died significantly earlier (p < 0.0001) than uninfected control groups. No differences in LT50 values were found for different exposure times (24, 48 hrs or continuous exposure) of An. gambiae to dry conidia. Exposure to oil-formulated conidia (doses ranging from 1.6 x 10(7) to 1.6 x 10(10) conidia/m2) gave LT50 values of 9.69 +/- 1.24 (lowest dose) to 5.89 +/- 0.35 days (highest dose), with infection percentages ranging from 4.4-83.7%. Our study marks the first to use an entomopathogenic fungus against adult Afrotropical disease vectors. Given its high pathogenicity for both adult Anopheles and Culex mosquitoes we recommend development of novel targeted indoor application methods for the control of endophagic host-seeking females.

  17. Laboratory evaluation of the entomopathogenic fungus, Metarhizium anisopliae for the control of the groundnut bruchid, Caryedon serratus on groundnut.

    PubMed

    Ekesi, S; Egwurube, E A.; Akpa, A D.; Onu, I

    2001-10-01

    The pathogenicity of five isolates of Metarhizium anisopliae to adult Caryedon serratus was evaluated in the laboratory. All the isolates tested were virulent to the beetle but pathogenicity varied among the isolates. One isolate, CPD 4 was consistently superior to all other isolates in terms of mortality of the beetle, protection of groundnut pods from damage, reduction in progeny production and repellency to the beetle. At 10 days post-treatment, adult mortality treated with 0.1, 0.5 and 1.0g of dry conidia equivalent to 3.6x10(8), 1.8x10(9) and 3.6x10(9) conidia of isolate CPD 4 per 50g of groundnut pods was 100% which did not differ significantly from pirimiphos-methyl-treated pods at 10ppm. At the lowest dosage of 0.1g of conidia per 50g of pods, damage in pods protected with isolate CPD 4 was 5% which did not differ significantly from the 2% damage in pods protected by pirimiphos-methyl at 10ppm but significantly differed from damage in untreated pods which was 26%. Isolate CPD 4 caused complete reduction in progeny emergence at all dosages tested. It also exhibited some degree of repellency to the beetle with percentage repellency values of between 40-79% at concentrations of 0.1-1.0g of conidia per 50g of groundnut pods. These combined virulence and repellency characteristics of this isolate may increase its protectant potential against C. serratus.

  18. In vitro interaction of Metarhizium anisopliae Ma9236 and Beauveria bassiana Bb9205 with Heterorhabditis bacteriophora HNI0100 for the control of Plutella xylostella.

    PubMed

    Correa-Cuadros, J P; Sáenz-Aponte, A; Rodríguez-Bocanegra, M X

    2016-01-01

    The diamondback moth (Plutella xylostella) is a major pest of broccoli crops in Colombia. To control P. xylostella, we evaluated the interaction of Beauveria bassiana Bb9205 and Metarhizium anisopliae Ma9236 with Heterorhabditis bacteriophora HNI0100 and its bacterial symbiont Photorhabdus luminescens HNI0100. We used antagonism and disk diffusion assays with fungal extracts to test the interaction between symbiotic bacterium and fungi. P. luminescens inhibited the growth of B. bassiana and M. anisopliae up to 40% by the secretion of secondary metabolites, whereas fungal extracts did not inhibit P. luminescens; this explains the in vivo interactions of these biological control agents. To test the interaction between fungi and nematodes, we first inoculated the fungi followed by the nematodes on different days (0, 2, 4, and 6). We identified the type of interaction using the formula by Nishimatsu and Jackson (J Econ Entomol 91:410-418, 1998) and established that on days 0, 2 and 4 there was an antagonistic interaction, while a synergistic interaction occurred on day 6. Therefore, the use of the interaction between H. bacteriophora HNI0100 with M. anisopliae Ma9236 and B. bassiana Bb9205 is an innovative alternative for the control of P. xylostella.

  19. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius.

  20. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. This is an open access paper. We use the Creative Commons Attribution 3.0 license that permits unrestricted use, provided that the paper is properly attributed.

  1. Effect of Metarhizium anisopliae on the Fertility and Fecundity of Two Species of Fruit Flies and Horizontal Transmission of Mycotic Infection

    PubMed Central

    Sookar, P.; Bhagwant, S.; Allymamod, M.N.

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. PMID:25201230

  2. Secretome of the Biocontrol Agent Metarhizium anisopliae Induced by the Cuticle of the Cotton Pest Dysdercus peruvianus Reveals New Insights into Infection

    PubMed Central

    2015-01-01

    Metarhizium anisopliae is an entomopathogenic fungus that has evolved specialized strategies to infect insect hosts. Here we analyzed secreted proteins related to Dysdercus peruvianus infection. Using shotgun proteomics, abundance changes in 71 proteins were identified after exposure to host cuticle. Among these proteins were classical fungal effectors secreted by pathogens to degrade physical barriers and alter host physiology. These include lipolytic enzymes, Pr1A, B, C, I, and J proteases, ROS-related proteins, oxidorreductases, and signaling proteins. Protein interaction networks were generated postulating interesting candidates for further studies, including Pr1C, based on possible functional interactions. On the basis of these results, we propose that M. anisopliae is degrading host components and actively secreting proteins to manage the physiology of the host. Interestingly, the secretion of these factors occurs in the absence of a host response. The findings presented here are an important step in understanding the host–pathogen interaction and developing more efficient biocontrol of D. peruvianus by M. anisopliae. PMID:24702058

  3. Histopathology Caused by the Entomopathogenic Fungi, Beauveria bassiana and Metarhizium anisopliae, in the Adult Planthopper, Peregrinus maidis, a Maize Virus Vector

    PubMed Central

    Toledo, A.V.; de Remes Lenicov, A.M.M.; López Lastra, C.C.

    2010-01-01

    The planthopper Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae) is an important vector of maize viruses in tropical and subtropical areas. Planthoppers are biologically controlled with several species of entomopathogenic fungi that have been isolated from these insect pests of rice in Asia. Beauveria bassiana (Balsamo-Crivelli) Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae) appear to be the most useful against planthoppers because of their ease of mass production, storage, virulence, and application. In the present study, adults of P. maidis infected with B. bassiana and M. anisopliae were observed under light and scanning electron microscopy to characterize morphologically the process of infection and the development of these fungi, prior to and after the death of the host. The hydrophobic conidia of both fungal species were able to attach to all body regions, with a preference for surfaces containing hairs. Few germinated conidia were observed on the insect's body surface at 24, 48, and 72 hr post-inoculation. On the cuticular surface of P. maidis treated with B. bassiana and M. anisopliae, bacillus-like bacteria were observed. These microorganisms could be interacting with fungal conidia, playing a role of antibiosis that will not allow the fungal pathogens to germinate and penetrate. In the colonization events observed in this study, the formation and multiplication of hyphal bodies by both fungal species inside the host's body was noted. The host's whole body was invaded by hyphae between five and six days post-inoculation, and body fat was the most affected tissue. PMID:20578956

  4. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  5. Interactions between isolates of the entomopathogenic fungus Metarhizium anisopliae and the entomopathogenic nematode Heterorhabditis bacteriophora JPM4 during infection of the sugar cane borer Diatraea saccharalis (Lepidoptera: Pyralidae).

    PubMed

    Acevedo, Juan Pablo Molina; Samuels, Richard Ian; Machado, Inês Ribeiro; Dolinski, Claudia

    2007-10-01

    Interactions between the nematode Heterorhabditis bacteriophora isolate JPM4 and the fungus Metarhizium anisopliae, isolates LPP45 and LPP39, were studied during dual infections of Diatraea saccharalis. Mortality, production of infective juveniles (IJs) and production of conidia were evaluated. A positive effect was demonstrated for host mortality in duel infections of JPM4 and LPP39, causing 100% mortality with LT(50) and LT(95) values of 1.8 and 2.8 days, respectively. Higher values were seen when using the nematode or fungi individually. However, a combination of JPM4+LPP39 caused a significant reduction in IJ production. The results show that faster time to death, a moderately virulent fungal isolate could be combined with the nematode, however at the expense of IJ production.

  6. Construction and preliminary analysis of a normalized cDNA library from Locusta migratoria manilensis topically infected with Metarhizium anisopliae var. acridum.

    PubMed

    Wang, Jie; Xia, Yuxian

    2010-08-01

    The insect immune response to fungal infection is poorly understood at the molecular level. To explore the molecular basis of this process, a novel method to analyze the gene transcripts of insects in response to pathogenic fungus was established. A normalized cDNA library based on the SMART method combined with DSN (duplex-specific nuclease) treatment was constructed using mRNA extracted from the fat body and hemocytes of Locusta migratoria manilensis 6-24h after being topically infected with Metarhizium anisopliae var. acridum. Analysis of 259 unigenes out of 303 sequenced inserts from the cDNA library revealed that the cDNA library was not contaminated with M. anisopliae transcripts and validated the presence of the immune-related genes characterized here. These results suggest that this method overcame the difficulties of contamination from a fungal source in constructing the host cDNA library from mycosed insects and proved that this method is reliable and feasible for investigation of host genes in response to fungal infection. Further studies of the expressed sequence tags from this library will provide insights into the molecular basis of insect immune response to fungal infection.

  7. Field trials using the fungal pathogen, Metarhizium anisopliae (Deuteromycetes: Hyphomycetes) to control the ectoparasitic mite, Varroa destructor (Acari: Varroidae) in honey bee, Apis mellifera (Hymenoptera: Apidae) colonies.

    PubMed

    Kanga, Lambert Houssou Ble; Jones, Walker A; James, Rosalind R

    2003-08-01

    The potential for Metarhizium anisopliae (Metschinkoff) to control the parasitic mite, Varroa destructor (Anderson and Trueman) in honey bee colonies was evaluated in field trials against the miticide, tau-fluvalinate (Apistan). Peak mortality of V. destructor occurred 3-4 d after the conidia were applied; however, the mites were still infected 42 d posttreatments. Two application methods were tested: dusts and strips coated with the fungal conidia, and both methods resulted in successful control of mite populations. The fungal treatments were as effective as the Apistan, at the end of the 42-d period of the experiment. The data suggested that optimum mite control could be achieved when no brood is being produced, or when brood production is low, such as in the early spring or late fall. M. anisopliae was harmless to the honey bees (adult bees, or brood) and colony development was not affected. Mite mortality was highly correlated with mycosis in dead mites collected from sticky traps, indicating that the fungus was infecting and killing the mites. Because workers and drones drift between hives, the adult bees were able to spread the fungus between honey bee colonies in the apiary, a situation that could be beneficial to beekeepers.

  8. Nucleotide excision repair and photoreactivation in the entomopathogenic fungi Beauveria bassiana, Beauveria brongniartii, Beauveria nivea, Metarhizium anisopliae, Paecilomyces farinosus and Verticillium lecanii.

    PubMed

    Chelico, L; Haughian, J L; Khachatourians, G G

    2006-05-01

    To compare the DNA repair capabilities of the entomopathogenic fungus (EPF) bassiana to the EPF Beauveria brongniartii, Beauveria nivea, Metarhizium anisopliae, Paecilomyces farinosus, Verticillium lecanii, and the fungi Aspergillus niger and Neurospora crassa. Germination of B. bassiana conidiospores following ultraviolet (UV) irradiation was used to show that nucleotide excision repair and photoreactivation decrease the post-UV germination delay. These two modes of repair were characterized and compared between the aforementioned EPF, A. niger and N. crassa using a physiological assay where per cent survival post-UV irradiation was scored as colony forming units. The results showed B. bassiana and M. anisopliae are the most UV-tolerant EPF. The DNA repair capabilities indicated that EPF do not have all DNA repair options available to fungi, such as A. niger and N. crassa. A key factor detrimental to the survival of EPF in agro-ecosystems is UV light from solar radiation. The EPF literature pertaining to UV irradiation is varied with respect to methodology, UV source, and dose, which prevented comparisons. Here we have characterized the fungi by a standard method and established the repair capabilities of EPF under optimal conditions.

  9. Increased pathogenicity against coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae) by Metarhizium anisopliae expressing the scorpion toxin (AaIT) gene.

    PubMed

    Pava-Ripoll, Monica; Posada, Francisco J; Momen, Bahram; Wang, Chengshu; St Leger, Raymond

    2008-10-01

    Coffee berry borer (CBB) is the Worlds most devastating coffee pest causing an estimated US$500 million worth of losses annually through damage and control costs. Beauveria bassiana and Metarhizium anisopliae have been employed to control this pest but their low virulence (slow kill and large inoculums) is an important factor constraining their use. M. anisopliae (AaIT-Ma549) has been modified to express the scorpion toxin (AaIT) in insect hemolymph and this greatly increased pathogenicity against Manduca sexta and Aedes aegypti. Here, we demonstrate that AaIT-Ma549 was also dramatically more virulent against CBB, and we provide a much more comprehensive analysis of infection processes and post-mortality development than in the previous research. We evaluated several spore concentrations (10(1) through 10(7)spores/ml) of both the wild type and recombinant strain. At concentrations of 10(1), 10(2) and 10(3)spores/ml, the recombinant strain significantly increased mortality of CBB by 32.2%, 56.6% and 24.6%, respectively. The medial lethal concentration (LC(50)) was reduced 15.7-fold and the average survival time (AST) was reduced by 20.1% to 2.98+/-0.1 days with 10(7)spores/ml. This is the first occasion that an entomopathogenic fungus has been found to kill CBB in less than 3 days. However, AaIT-Ma549 produces significantly fewer spores on cadavers than the parental strain.

  10. Acaricidal activity of Metarhizium anisopliae isolated from paddocks in the Mexican tropics against two populations of the cattle tick Rhipicephalus microplus.

    PubMed

    Fernández-Salas, A; Alonso-Díaz, M A; Alonso-Morales, R A; Lezama-Gutiérrez, R; Rodríguez-Rodríguez, J C; Cervantes-Chávez, J A

    2017-03-01

    The acaricidal effects of 55 strains of Metarhizium anisopliae (Metschnikoff) Sorokin, 1883 (Hypocreales: Clavicipitaceae) isolated from paddocks of cattle farms were evaluated in two Rhipicephalus microplus (Canestrini 1887) (Ixodida: Ixodidae) populations, of which one was multi-resistant and one was susceptible to chemical acaricides. Percentage mortality and reproductive efficiency indices in R. microplus were evaluated by adult immersion tests at a dose of 1 × 10(8) conidia/mL for each fungal strain. Some strains were selected to calculate lethal concentrations to kill 50% (LC50 ) and 99% (LC99 ) of engorged ticks. Strains MaV22, MaV26 and MaV55 induced 100% mortality in R. microplus on day 14. Strains MaV05, MaV09 and MaV22 caused mortality of >90% from day 12 onward in both tick populations. The most effective acaricidal fungal strain, MaV55, inhibited egg laying by 54.86 and 55.86% in acaricide-resistant and -susceptible R. microplus populations, respectively. None of the fungal strains had statistically significant effects on larval hatching. In conclusion, nine strains of M. anisopliae demonstrated high acaricidal effects against R. microplus and reduced its egg laying. No differences in acaricidal effects were observed between the two populations of ticks tested. © 2016 The Royal Entomological Society.

  11. African water storage pots for the delivery of the entomopathogenic fungus Metarhizium anisopliae to the malaria vectors Anopheles gambiae s.s. and Anopheles funestus.

    PubMed

    Farenhorst, Marit; Farina, Daniela; Scholte, Ernst-Jan; Takken, Willem; Hunt, Richard H; Coetzee, Maureen; Knols, Bart G J

    2008-06-01

    We studied the use of African water storage pots for point source application of Metarhizium anisopliae against the malaria vectors Anopheles gambiae s.s. and An. funestus. Clay pots were shown to be attractive resting sites for male and female An. gambiae s.s. and were not repellent after impregnation with fungus. M. anisopliae was highly infective and virulent after spray application inside pots. At a dosage of 4 x 10(10) conidia/m(2), an average of 95 +/- 1.2% of An. gambiae s.s. obtained a fungal infection. A lower dosage of 1 x 10(10) conidia/m(2) infected an average of 91.5 +/- 0.6% of An. gambiae s.s. and 91.8 +/- 1.2% of An. funestus mosquitoes. Fungal infection significantly reduced mosquito longevity, as shown by differences between survival curves and LT(50) values. These pots are suitable for application of entomopathogenic fungi against malaria vectors and their potential for sustainable field implementation is discussed.

  12. Identification of genes differentially expressed in vivo by Metarhizium anisopliae in the hemolymph of Locusta migratoria using suppression-subtractive hybridization.

    PubMed

    Zhang, Chuanbo; Xia, Yuxian

    2009-08-01

    Metarhizium anisopliae is an important insect pathogenic fungus widely used in biological pest control. The aim of this study was to identify genes differentially expressed in vivo by M. anisopliae CQMa102 in the hemolymph of infected Locusta migratoria. Suppression-subtractive hybridization was performed using cDNA generated from hyphal bodies purified from hemolymph and the fungus germinating and differentiating on locust wings. A total of 350/1,600 random clones screened by cDNA array dot blotting were sequenced, resulting in 120 uniquely expressed sequence tags (ESTs) that were up-regulated during colonization of hemolymph. Among these 120 ESTs, 42 (35.0%) had matches in the NR protein database, and 29 (24.2%) were significantly similar to known proteins involved in various cellular processes, including general metabolism, cell wall remodeling, protein synthesis, signal transduction and stress responses. In contrast, the remaining 78 ESTs (65.0%) either had low similarity in the NR database or represented novel genes. Semi-quantitative RT-PCR analysis of five randomly selected genes revealed that all were highly expressed in the host hemolymph. These results provide new insight into the underlying molecular mechanisms of adaptation to host hemolymph and may increase understanding of host-pathogen interactions.

  13. Enhancement of microbial hydroxylation of 13-ethyl-gon-4-ene-3,17-dione by Metarhizium anisopliae using nano-liposome technique.

    PubMed

    Feng, Meiqing; Liao, Ziwei; Han, Lei; Li, Jiyang; Ye, Li

    2014-04-01

    The introduction of 11α-hydroxy to 13-ethyl-gon-4-ene-3,17-dione (GD) by microbial transformation is a key step in the synthesis of oral contraceptive desogestrel, while low substrate solubility and uptake into cells are tough problems influencing biotransformation efficiency greatly. Nano-liposome technique was used in the hydroxylation of GD by Metarhizium anisopliae. The substrate GD was processed to be GD-loaded nano-liposomes (GNLs) with high stability and encapsulation efficiency, and then applied in microbial hydroxylation by M. anisopliae. The results proved that the yield of the main product 11α-hydroxy-13-ethyl-gon-4-ene-3,17-dione (HGD) tripled compared to regular solvent dimethylformamide dispersion method at 2 g/l of substrate feeding concentration, and the HGD conversion rate showed no obvious reduction when the substrate feeding concentration increased from 2 to 6 g/l, which indicated the improvement of GNL addition method on biotransformation. Furthermore, the main byproduct changed from 6β-hydroxy derivative of GD (with similar polarity to HGD) to 6β,11α-dihydroxy derivative, which benefits the following purification of HGD from fermentation broth. These advantages suggest a great potential for the application of nano-liposome technique in microbial steroid transformation.

  14. Efficacy of the entomopathogenic fungi Metarhizium anisopliae in the control of infestation by stable flies Stomoxys calcitrans (L.), under natural infestation conditions.

    PubMed

    Cruz-Vazquez, C; Carvajal Márquez, J; Lezama-Gutiérrez, R; Vitela-Mendoza, I; Ramos-Parra, M

    2015-09-15

    The objective of this study was to evaluate the efficacy of an isolate of Metarhizium anisopliae applied by aspersion to control of Stomoxys calcitrans flies in dairy cattle naturally infested. Was applied by aspersion an aqueous formulation of M. anisopliae sensu lato (Ma134), at a concentration of 1×10(8)conidia/ml, four times with seven day intervals, on a group of eight Holstein cows; a control group of eight Holstein cows, received a water solution with Tween 80 (0.1%). The average number of flies per animal was estimated one day before each application, and then daily counts were done in both groups. The effectiveness of the formulation was calculated using the Abbott's formula. At the same time, defensive behaviors of stamp/kicks and tail movements were evaluated daily, estimating relative frequency per hour. The Ma134 formulation had an infestation control efficacy of 73%, taking into consideration the four study weeks. The population reduction effect was observed since the first week post-application (p<0.05), and the effect increased with the subsequent applications. Defensive behaviors were reduced beginning from the first application, reaching a reduction of 66% and 70%, respectively, during the four weeks of study. These results demonstrated the effectiveness of the formulation to control infestation by S. calcitrans, as well as reduce defensive behaviors which involves the infestation.

  15. Evaluation of Conidia-Dust Formulation of the Entomopathogenic Fungus, Metarhizium anisopliae to Biocontrol the Brown-Banded Cockroach, Supella longipalpa F.

    PubMed Central

    Sharififard, Mona; Mossadegh, Mohammad Saeed; Vazirianzadeh, Babak; Latifi, Seyed Mahmood

    2014-01-01

    Background: The brown-banded cockroach Supella longipalpa (F.) as a mechanical vector of pathogens and source of allergens has recently become widespread in the city of Ahvaz, southwestern Iran. Objectives: This research was done to evaluate the efficacy of a dust-formulation of Metarhizium anisopliae isolate IRAN 437C, as a common entomopathogenous fungus, against S. longipalpa. Materials and Methods: Conidia dust-formulations of M. anisopliae were prepared in proportions of 1%, 5%, 10%, 25%, 50% and 100% with bad wheat flour as the carrier. Cockroaches were exposed to surfaces treated with 1.5 mg/cm2 of the formulations under laboratory and semi-field conditions. Results: Cockroach mortality rates increased and survival times (ST50) decreased with an increased proportion of conidia from 1% to 100% but records taken for mortality and survival time from proportions of 25%, 50% and 100% were not significantly different. The mortality rates reached 100% and 90-100% in adults and nymphs, respectively on the seventh day. The lowest ST50 was related to the proportion of 100% (3 days). Probit analysis indicated LD50 and LD90 values of 1.7 × 106 and 1.7 × 107 conidia/cm2 for adults and these values changed to 4.5 × 106 and 2.9 × 107 for third and fourth instar nymphs at three days post exposure. Proportion of 25% caused mortality rates of 87%, 81% and 73% in adult, adult & nymph and nymph populations, respectively at four days after exposure under room conditions. Conclusions: Conidia dust-formulation of M. anospliae isolate IRAN 437C could present a promising alternative to control the brown-banded cockroach. PMID:25371804

  16. The combination of the entomopathogenic fungus Metarhizium anisopliae with the insecticide Imidacloprid increases virulence against the dengue vector Aedes aegypti (Diptera: Culicidae).

    PubMed

    Paula, Adriano R; Carolino, Aline T; Paula, Cátia O; Samuels, Richard I

    2011-01-25

    Dengue fever transmitted by the mosquito Aedes aegypti, is one of the most rapidly spreading insect borne diseases, stimulating the search for alternatives to current control measures. The dengue vector A. aegypti has received less attention than anophelene species, although more than 2.5 billion people are at risk of infection worldwide. Entomopathogenic fungi are emerging as potential candidates for the control of mosquitoes. Here we continue our studies on the pathogenicity of the entomopathogenic fungus Metarhizium anisopliae against adult A. aegypti females. With the aim of further reducing mean survival times of A. aegypti exposed to fungus impregnated surfaces, a sub-lethal concentration of the neonicotinoid insecticide Imidacloprid (IMI) was added to fungal suspensions. A sub-lethal concentration of IMI that did not significantly alter the daily survival rates or mean survival percentages of mosquitoes was identified to be 0.1 ppm. This sub-lethal concentration was combined with M. anisopliae conidia (1 × 10(9) conidia mL(-1)). Both the combined treatment and the conidia alone were able to reduce the survival of A. aegypti compared with untreated or IMI treated mosquitoes. Importantly, mosquito survival following exposure to the combined treatment for 6 and 12 hrs was significantly reduced when compared with mosquitoes exposed to conidia alone. This is the first time that a combination of an insecticide and an entomopathogenic fungus has been tested against A. aegypti. Firstly, the study showed the potential of IMI as an alternative to the currently employed pyrethroid adulticides. Secondly, as an alternative to applications of high concentrations of chemical insecticides, we suggest that adult A. aegypti could be controlled by surface application of entomopathogenic fungi and that the efficiency of these fungi could be increased by combining the fungi with ultra-low concentrations of insecticides, resulting in higher mortality following relatively short

  17. Efficacy of Metarhizium anisopliae in controlling the two-spotted spider mite Tetranychus urticae on common bean in screenhouse and field experiments.

    PubMed

    Bugeme, David Mugisho; Knapp, Markus; Ekesi, Sunday; Chabi-Olaye, Adenirin; Boga, Hamadi Iddi; Maniania, Nguya Kalemba

    2015-02-01

    The efficacy of aqueous and emulsifiable formulations of the fungus Metarhizium anisopliae isolate ICIPE78 was evaluated on the population density of Tetranychus urticae infesting common bean plants under screenhouse and field conditions. Synthetic acaricide abamectin was included as a check. Bean plants were artificially infested with T. urticae and allowed to multiply. Three treatments were applied in the screenhouse and 1 treatment in field trials. Mite density was recorded 2 d before spraying and weekly postspraying. The number of pods per plant, number of seeds per pod, and the dry weight of seeds per plant were recorded only in the screenhouse trials. In both screenhouse and field trials, fungal formulations applied at the concentration of 10(8) conidia/mL and the acaricide reduced the population density of mites as compared to the controls. There were significant differences in T. urticae population densities between the treatments at the various post-spraying sampling dates. In the screenhouse, the mite densities were near zero from 3-week postspraying in the treated leaves. At 4-week postspraying, there were no more leaves in the untreated control (T1) and in the control water + Silwet-L77 (T2). Fungal formulations were as effective as abamectin in reducing mite densities in both screenhouse and field experiments. There were significant differences in the production parameters during the 2 screenhouse trials, with fungal and abamectin treatments generally having the highest yield. Results of this study underline the potential of the M. anisopliae isolate ICIPE78 as an alternative to acaricides for T. urticae management. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  18. Genome-assisted development of nuclear intergenic sequence markers for entomopathogenic fungi of the Metarhizium anisopliae species complex

    USDA-ARS?s Scientific Manuscript database

    Entomopathogenic fungi in the genus Metarhizium have proven useful for the biological control of economically important pests across the globe. Understanding the true diversity of this group is hampered by convergent morphologies between species. The application of molecular techniques has enabled...

  19. Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae).

    PubMed

    Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I

    2014-04-25

    Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the

  20. Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae)

    PubMed Central

    2014-01-01

    Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of

  1. BmSI-7, a novel subtilisin inhibitor from Boophilus microplus, with activity toward Pr1 proteases from the fungus Metarhizium anisopliae.

    PubMed

    Sasaki, Sergio D; de Lima, Cássia A; Lovato, Diogo V; Juliano, Maria A; Torquato, Ricardo J S; Tanaka, Aparecida S

    2008-02-01

    BmSI-7 and BmSI-6, two Boophilus microplus subtilisin inhibitors (BmSI) were purified and characterized from eggs. The inhibitors isolated by classical purification methods presented molecular masses of 7408 and 7271Da, respectively, by MALDI-TOF-MS. Both BmSI-7 and BmSI-6 inhibited neutrophil elastase (K(i) 0.4 and 0.3nM) and subtilisin A (K(i) 1.4nM for both inhibitors). They also strongly inhibited Pr1 proteases from the fungus Metarhizium anisopliae; BmSI-7 (K(i) 50nM) and BmSI-6 (K(i) 2.2nM). The BmSI-7 full length cDNA was obtained using amino acid sequence information of BmSI-7 peptides generated by proteolytic digestion. BmSI-7 belongs to trypsin inhibitor like cysteine rich domain family (TIL), and it is transcribed in ovary, fat body, gut, salivary gland and haemocytes. BmSI-7 is the first TIL inhibitor described with inhibitory activity toward subtilisin A and Pr1 proteases of entomopathogenic fungi.

  2. Carbon regulation of the cuticle-degrading enzyme PR1 from Metarhizium anisopliae may involve a trans-acting DNA-binding protein CRR1, a functional equivalent of the Aspergillus nidulans CREA protein.

    PubMed

    Screen, S; Bailey, A; Charnley, K; Cooper, R; Clarkson, J

    1997-06-01

    The pr1 gene of the entomopathogenic fungus Metarhizium anisopliae encodes a serine protease that is highly active towards the insect cuticle and whose synthesis is subject to both carbon and nitrogen repression. The pr1 promoter region was sequenced revealing the presence of putative CREA- and AREA-binding sites. In vitro bandshift experiments demonstrated that an Aspergillus nidulans GST-CREA fusion protein was capable of binding to two of the three putative CREA sites. Using a PCR-based strategy the M. anisopliae crr1 gene was identified; it encodes a putative C2H2-type DNA-binding protein with significant sequence similarity to A. nidulans CREA. Complementation experiments with an A. nidulans strain carrying creA204 demonstrated that CRR1 can partially substitute for CREA function.

  3. The physiological effects of multi-walled carbon nanotubes (MWCNTs) on conidia and the development of the entomopathogenic fungus, Metarhizium anisopliae (Metsch.) Sorok.

    PubMed

    Gorczyca, Anna; Kasprowicz, Marek J; Lemek, Tadeusz

    2014-01-01

    The aim of the study was an in vitro evaluation of the effect of MWCNTs on the conidia of two strains of entomopathogenic fungus, Metarhizium anisopliae. The study made use of water suspensions of MWCNTs (concentration ∼ 3 mg·mL(-1)) made from commercial nanotubes and centrifuged. The conidia were placed in contact with nanotubes for 240 h. An assessment of MWCNT influence on conidia was performed after 1, 24, 72 and 240 h and focused on the linear growth of vegetative mycelium derived from these conidia, mycelium sporulation in subcultures and pathogenicity. Using TEM imaging, it was demonstrated that carbon nanotubes are able to damage cell membranes of the examined fungi conidia. However, the absence was noted of a significantly fungistatic effect of both MWCNT suspensions on the examined strains with respect to the physiological features in question. The increase in vegetative mycelium effected by spores after contact with MWCNTs was characterized by a slight modification in relation to the control. There was no strong trend (inhibition - stimulation), in relation to the effect of the tested suspension of carbon nanotubes, on the development of the vegetative mycelium in in vitro culture. Sporulation of the mycelium after completion of the culture only occurred in one case (strain Ma73F and culture of spores after 24-h contact with MWCNTs) significantly more intensely than in the controls. With respect to pathogenicity for test insects compared to the control strain, Ma73F spores grown from the longest contact with nanotubes suspensions performed significantly better. On the basis of the calculated of mycelium index growth rates and the time of death of the test insects (LT50), it was found that the adverse effects of water suspension MWCNTs on the spores of M. anisopliae were applied after a short contact with biological material. This indicates unfavorable physical rather than chemical effects on the tested cell. Over time, nanotube aggregation in water

  4. Effect of Metarhizium anisopliae (Ascomycete), Cypermethrin, and D-Limonene, Alone and Combined, on Larval Mortality of Rhipicephalus sanguineus (Acari: Ixodidae).

    PubMed

    Prado-Rebolledo, Omar Francisco; Molina-Ochoa, Jaime; Lezama-Gutiérrez, Roberto; García-Márquez, Luis Jorge; Minchaca-Llerenas, Yureida B; Morales-Barrera, Eduardo; Tellez, Guillermo; Hargis, Billy; Skoda, Steven R; Foster, John E

    2017-09-01

    The effect of the fungus Metarhizium anisopliae Ma14 strain, D-limonene, and cypermethrin, alone and combined, on the mortality of Rhipicephalus sanguineus Latreille larvae was evaluated. Eight separate groups with 25 tick larvae were inoculated with the fungus, cypermethrin, and D-limonene, and four groups were used as untreated controls. The groups were inoculated with serial dilutions of each treatment material: for example, conidial concentrations were 1 × 101, 1 × 102, 1 × 103, 1 × 104, 1 × 105, 1 × 106, 1 × 107, and 1 × 108. A complete randomized experimental design was used. Significant differences were obtained between fungal concentrations, with larval mortalities ranging from 29 to 100%; the D-limonene concentrations showed significant differences, with mortalities that ranged from 47.9 to 82.6%, and cypermethrin mortalities ranged from 69.9 to 89.9% when each was applied alone. In the combined application, the serial dilution of the Ma14 fungus plus cypermethrin at 0.1% concentration caused mortalities ranging from 92.9 to 100%; the mix of serially diluted Ma14 plus D-limonene at 0.1% caused mortalities from 10.3 to 100%; and the mix consisting of serially diluted D-limonene plus cypermethrin at 0.1% caused mortalities from 7.4 to 35.9%. Further laboratory and field research could show that these materials, alone and in combinations, are useful in future tick management and control programs. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Development of a user-friendly delivery method for the fungus Metarhizium anisopliae to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies.

    PubMed

    Kanga, Lambert H B; Adamczyk, John; Patt, Joseph; Gracia, Carlos; Cascino, John

    2010-12-01

    A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducted in 2006 in Texas using freshly harvested spores indicated that patty blend formulations of 10 g of conidia per hive (applied twice) significantly reduced the numbers of mites per adult bee, mites in sealed brood cells, and residual mites at the end of the 47-day experimental period. Colony development in terms of adult bee populations and brood production also improved. Field trials conducted in 2007 in Florida using less virulent spores produced mixed results. Patty blends of 10 g of conidia per hive (applied twice) were less successful in significantly reducing the number of mites per adult bee. However, hive survivorship and colony strength were improved, and the numbers of residual mites were significantly reduced at the end of the 42-day experimental period. The overall results from 2003 to 2008 field trials indicated that it was critical to have fungal spores with good germination, pathogenicity and virulence. We determined that fungal spores (1 × 10(10) viable spores per gram) with 98% germination and high pathogenicity (95% mite mortality at day 7) provided successful control of mite populations in established honey bee colonies at 10 g of conidia per hive (applied twice). Overall, microbial control of Varroa mite with M. anisopliae is feasible and could be a useful component of an integrated pest management program.

  6. Pathogenicity of entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) isolates to the adult pea leafminer (Diptera: Agromyzidae) and prospects of an autoinoculation device for infection in the field.

    PubMed

    Migiro, L N; Maniania, N K; Chabi-Olaye, A; Vandenberg, J

    2010-04-01

    Seventeen isolates of Metarhizium anisopliae (Metschnikoff) Sorokin and three isolates of Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) were evaluated for their pathogenicity to the adult pea leafminer, Liriomyza huidobrensis (Blanchard) (Diptera: Agromyzidae), in the laboratory. Flies were contaminated with dry conidia through a velvet material wrapped around the inner side of a cylindrical plastic tube. All the isolates were pathogenic to the pea leafminer, causing mortality between 40 and 100% at 5 d after exposure. The lethal time for 50% mortality (LT(50)) ranged from 2.6 to 5.4 d, whereas the LT(90) values varied between 3.2 and 9.1 d depending on the isolate. An autoinoculation device was evaluated in cage field experiments using only one of the virulent isolates, M. anisopliae ICIPE 20. The device was loaded with 2-3 g of dry conidia. Mortality of up to 100% was observed in flies captured from fungus-treated cages held under laboratory conditions. The average number of spores picked up by a single fly visiting the device increased with days after inoculation. One day after the inoculation, adults picked up an average of 4.1 +/- 0.7 x 10(5) conidia and 39.6 +/- 4.0 x 10(5) conidia 5 d after inoculation. Depending on the sampling date, the LT(50) varied between 1.8 and 3.4 d. Results indicate that some isolates of B. bassiana and M. anisopliae are highly pathogenic to L. huidobrensis, suggesting a potential for their use in the control of this pest. They also suggest the possibility of L. huidobrensis suppression with fungi using an autoinoculation device.

  7. UV-B radiation reduces in vitro germination of Metarhizium anisopliae s.l. but does not affect virulence in fungus-treated Aedes aegypti adults and development on dead mosquitoes.

    PubMed

    Falvo, M L; Pereira-Junior, R A; Rodrigues, J; López Lastra, C C; García, J J; Fernandes, É K K; Luz, C

    2016-12-01

    Control of diurnal Aedes aegypti with mycoinsecticides should consider the exposure of fungus-treated adults to sunlight, and especially to UV-B radiation that might affect activity of conidia applied on the mosquito's surface. Germination of Metarhizium anisopliae s.l. IP 46 conidia on SDAY medium was not affected at the lowest level of radiation with UV-B, 0·69 kJ m(-2) , but was retarded and reduced at higher 2·075 and 4·15 kJ m(-2) , and completely inhibited at ≥8·3 kJ m(-2) . In contrast, germination of conidia applied onto fibreglass nettings and exposed from 0 to 16·6 kJ m(-2) did not differ significantly among levels of irradiance exposure and the controls. There was also no significant impact of UV-B up to 16·6 kJ m(-2) on the adulticidal activity of IP 46 and on the subsequent conidiogenesis on cadavers. The Quaite-weighted UV-B irradiance in the laboratory (1152 mW m(-2) ) was higher than the natural sunlight irradiance observed in the city of Goiânia in Central Brazil on midday (706 mW m(-2) in August to 911 mW m(-2) in October 2015). UV-B does not impair the activity of IP 46 conidia applied previously to radiation on A. aegypti adults. Findings contribute to a better understanding of the effectiveness of M. anisopliae against day-active A. aegypti and its potential for biological mosquito control. © 2016 The Society for Applied Microbiology.

  8. Identification of a hybrid PKS-NRPS required for the biosynthesis of NG-391 and NG-393 metabolites in Metarhizium anisopliae

    USDA-ARS?s Scientific Manuscript database

    A 19,818 kb genomic region harboring six predicted ORFs was identified in M. anisopliae ARSEF 2575. The ORF4 CDS, putatively encoding a hybrid polyketide synthase/nonribosomal peptide synthetase (PKS-NRPS) was targeted using Agrobacterium-mediated gene knockout. Homologous, but not heterolog...

  9. Larvicidal and pupicidal properties of Acalypha alnifolia Klein ex willd.(Euphorbiaceae) leaf extract and the microbial insecticide Metarhizium anisopliae (Metsch.) against lymphatic filarial vector, Culex quinquefasciatus Sa

    USDA-ARS?s Scientific Manuscript database

    This study was made to determine the mosquitocidal properties of Acalypha alnifolia leaf extract combined with the use of Metarizhium anisopliae spores for control of the lymphatic filariasis vector Culex quinquefasciatus. The methanolic leaf extract showed larvicidal and pupicidal effects after 24...

  10. Larvicidal and pupicidal properties of Acalypha alnifolia Klein ex Willd. (Euphorbiaceae) leaf extract and the microbial insecticide Metarhizium anisopliae (Metsch.) against lymphatic filarial vector, Culex quinquefasciatus..

    USDA-ARS?s Scientific Manuscript database

    This study was made to determine the mosquitocidal properties of Acalypha alnifolia leaf extract combined with the use of Metarizhium anisopliae spores for control of the lymphatic filariasis vector Culex quinquefasciatus. The methanolic leaf extract showed larvicidal and pupicidal effects after 24...

  11. Cloning and sequence analysis of ornithine decarboxylase gene fragments from the Ascomycota.

    PubMed

    Jiménez-Bremont, Juan Francisco; Rodríguez-Kessler, Margarita; Rodríguez-Guerra, Raul; Cortes-Penagos, Carlos; Torres-Guzman, Juan Carlos; Williamson, June Simpson

    2006-06-01

    Ornithine decarboxylase (ODC; EC 4.1.1.17) catalyzes the initial step in the biosynthesis of polyamines, the conversion of ornithine to putrescine. Based on the most conserved regions of fungal ODCs, we designed and synthesized oligonucleotides to amplify homologous fragments of three important plant pathogenic Pyrenomycete fungi (Ascomycota), Magnaporthe grisea, Colletotrichum lindemuthianum and Fusarium solani, and one insect pathogenic fungus Metarhizium anisopliae. Cloning and sequencing of the amplified fragments revealed homologies of between 37 to 88% with other fungal ODCs. The predicted peptide sequences were compared by Clustal analysis and conserved sequences corresponding to the substrate and cofactor binding sites were identified. Comparative analyses of the ODC fragments isolated in this study, revealed high homology between them (68.3-81.1%) and also with other Pyrenomycetes such as Neurospora crassa (order Sordariales; 68.6-72.9%) and Fusarium graminearum (order Hypocreales; 70.8-88.1%). Data obtained in this work revealed that these fungi constitute a compact group separated from other eukaryotic ODCs.

  12. Biolarvicidal and pupicidal activity of Acalypha alnifolia Klein ex Willd.(Family:Euphorbiaceae) leaf extract and microbial insecticide, Metarhizium anisopliae(Metsch.)against malaria fever mosquito Anopheles stephensi Liston

    USDA-ARS?s Scientific Manuscript database

    This study was made to determine the biological activity of Acalypha alnifolia leaf extract and the microbial insecticide Metarizhium anisopliae against larvae and pupae of the malaria vector Anopheles stephensi. Ethanolic A. alnifolia leaf extract tested against 1st through 4th instars and pupae o...

  13. Characterization of Metarhizium species and varieties based on molecular analysis, heat tolerance and cold activity

    USGS Publications Warehouse

    Fernandes, E.K.K.; Keyser, C.A.; Chong, J.P.; Rangel, D.E.N.; Miller, M.P.; Roberts, D.W.

    2010-01-01

    Aims: The genetic relationships and conidial tolerances to high and low temperatures were determined for isolates of several Metarhizium species and varieties. Methods and Results: Molecular-based techniques [AFLP and rDNA (ITS1, ITS2 and 5??8S) gene sequencing] were used to characterize morphologically identified Metarhizium spp. isolates from a wide range of sources. Conidial suspensions of isolates were exposed to wet heat (45 ?? 0??2??C) and plated on potato dextrose agar plus yeast extract (PDAY) medium. After 8-h exposure, the isolates divided clearly into two groups: (i) all isolates of Metarhizium anisopliae var. anisopliae (Ma-an) and Metarhizium from the flavoviride complex (Mf) had virtually zero conidial relative germination (RG), (ii) Metarhizium anisopliae var. acridum (Ma-ac) isolates demonstrated high heat tolerance (c. 70-100% RG). Conidial suspensions also were plated on PDAY and incubated at 5??C for 15 days, during which time RGs for Ma-an and Ma-ac isolates were virtually zero, whereas the two Mf were highly cold active (100% RG). Conclusions: Heat and cold exposures can be used as rapid tools to tentatively identify some important Metarhizium species and varieties. Significance and Impact of the Study: Identification of Metarhizium spp. currently relies primarily on DNA-based methods; we suggest a simple temperature-based screen to quickly obtain tentative identification of isolates as to species or species complexes. ?? 2009 The Society for Applied Microbiology.

  14. Detection of potentially valuable polymorphisms in four group I intron insertion sites at the 3'-end of the LSU rDNA genes in biocontrol isolates of Metarhizium anisopliae

    PubMed Central

    Márquez, Marcela; Iturriaga, Enrique A; Quesada-Moraga, Enrique; Santiago-Álvarez, Cándido; Monte, Enrique; Hermosa, Rosa

    2006-01-01

    Background The entomopathogenic anamorphic fungus Metarhizum anisopliae is currently used as a biocontrol agent (BCA) of insects. In the present work, we analyzed the sequence data obtained from group I introns in the large subunit (LSU) of rDNA genes with a view to determining the genetic diversity present in an autochthonous collection of twenty-six M. anisopliae isolates selected as BCAs. Results DNA fragments corresponding to the 3'-end of the nuclear LSU rDNA genes of 26 M. anisopliae isolates were amplified by PCR. The amplicon sizes ranged from 0.8 to 3.4-kb. Four intron insertion sites, according to Escherichia coli J01695 numbering, were detected- Ec1921, Ec2066, Ec2449 and Ec2563- after sequencing and analysis of the PCR products. The presence/absence of introns allowed the 26 isolates to be distributed into seven genotypes. Nine of the isolates tested showed no introns, 4 had only one, 3 two, and 10 displayed three introns. The most frequent insertion sites were Ec1921 and Ec2449. Of the 26 isolates, 11 showed insertions at Ec2563 and a 1754-bp sequence was observed in ten of them. The most-parsimonious (MP) tree obtained from parsimony analysis of the introns revealed a main set containing four-groups that corresponded to the four insertion sites. Conclusion Four insertion sites of group I introns in the LSU rDNA genes allowed the establishment of seven genotypes among the twenty-six biocontrol isolates of M. anisopliae. Intron insertions at the Ec2563 site were observed for first time in this species. PMID:16978412

  15. Metachelins, mannosylated and N-oxidized coprogen-type siderophores from Metarhizium robertsii

    USDA-ARS?s Scientific Manuscript database

    Under iron-depleted culture conditions, the entomopathogenic fungus Metarhizium robertsii (Bischoff, Humber, and Rehner) (= M. anisopliae) produces a complex of extracellular siderophores including novel O-glycosylated and/or N-oxidized coprogen-type compounds as well as the known fungal siderophore...

  16. Production of microsclerotia by brazilian strains of metarhizium spp. using submerged liquid culture fermentation

    USDA-ARS?s Scientific Manuscript database

    We investigated the potential production and desiccation tolerance of microsclerotia (MS) by Brazilian strains of Metarhizium. anisopliae [Ma], M. acridum [Mc] and M. robertsii [Mr]. These fungi were grown in a liquid medium containing 16 g carbon l-1 with a carbon:nitrogen ratio of 50:1. One hundre...

  17. Comparative impact of artificial selection for fungicide resistance on Beauveria bassiana and Metarhizium brunncum

    USDA-ARS?s Scientific Manuscript database

    Hypocreales fungi such as Beauveria bassiana and Metarhizium anisopliae can be negatively affected by fungicides thereby reducing their biocontrol potential. The overall goal of this study was to investigate the impact of artificial selection for fungicide resistance on two commercial entomopathoge...

  18. Molecular diversity of the entomopathogenic fungal Metarhizium community within an agroecosystem.

    PubMed

    Steinwender, Bernhardt M; Enkerli, Jürg; Widmer, Franco; Eilenberg, Jørgen; Thorup-Kristensen, Kristian; Meyling, Nicolai V

    2014-11-01

    The entomopathogenic fungal Metarhizium anisopliae lineage harbors cryptic diversity and was recently split into several species. Metarhizium spp. are frequently isolated from soil environments, but the abundance and distribution of the separate species in local communities is still largely unknown. Entomopathogenic isolates of Metarhizium spp. were obtained from 32 bulked soil samples of a single agroecosystem in Denmark using Tenebrio molitor as bait insect. To assess the Metarhizium community in soil from the agricultural field and surrounding hedgerow, 123 isolates were identified by sequence analysis of 5' end of elongation factor 1-α and their genotypic diversity characterized by multilocus simple sequence repeat (SSR) typing. Metarhizium brunneum was most frequent (78.8%) followed by M. robertsii (14.6%), while M. majus and M. flavoviride were infrequent (3.3% each) revealing co-occurrence of at least four Metarhizium species in the soil of the same agroecosystem. Based on SSR fragment length analysis five genotypes of M. brunneum and six genotypes of M. robertsii were identified among the isolates. A single genotype within M. brunneum predominated (72.3% of all genotypes) while the remaining genotypes of M. brunneum and M. robertsii were found at low frequencies throughout the investigated area indicating a diverse Metarhizium community. The results may indicate potentially favorable adaptations of the predominant M. brunneum genotype to the agricultural soil environment. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Fungal tyrosine betaine, a novel secondary metabolite from conidia of entomopathogenic Metarhizium spp. fungi.

    PubMed

    Carollo, Carlos A; Calil, Ana Luiza A; Schiave, Letícia A; Guaratini, Thais; Roberts, Donald W; Lopes, Norberto P; Braga, Gilberto U L

    2010-01-01

    Fungi, including the entomopathogenic deuteromycete Metarhizium anisopliae, produce a wide diversity of secondary metabolites that either can be secreted or stored in specific developmental structures, e.g., conidia. Some secondary metabolites, such as pigments, polyols and mycosporines, are associated with pathogenicity and/or fungal tolerance to several stress-inducing environmental factors, including temperature and solar radiation extremes. Extracts of M. anisopliae var. anisopliae (strain ESALQ-1037) conidia were purified by chromatographic procedures and the isolated compounds analyzed by ¹H and ¹³C nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry. LC-MS analyses were carried out to search for mycosporines (the initial targets), but no compounds of this class were detected. A molecule whose natural occurrence was previously undescribed was identified. It consists of betaine conjugated with tyrosine, and the structure was identified as 2-{[1-carboxy-2-(4-hydroxyphenyl)ethyl]amino}-N,N,N-trimethyl-2-oxoethanammonium. Mannitol was the predominant compound in the alcoholic conidial extract, but no amino acids other than tyrosine were found to be conjugated with betaine in conidia. The fungal tyrosine betaine was detected also in conidial extracts of three other M. anisopliae var. anisopliae (ARSEF 1095, 5626 and 5749) and three M. anisopliae var. acridum isolates (ARSEF 324, 3391 and 7486), but it was not detected in Aspergillus nidulans conidial extract (ATCC 10074).

  20. Development of pilot-scale fermentation and stabilization processes for the production of microsclerotia of the entomopathogenic fungus Metarhizium brunneun strain F52

    USDA-ARS?s Scientific Manuscript database

    Using 100L stirred-tank bioreactors, we evaluated the effect of fermentation parameters and drying protocols on the production and stabilization of microsclerotia (MS) of the entomopathogenic fungus Metarhizium brunneum (formerly M. anisopliae F52). Results showed that stirred-tank bioreactors can ...

  1. Genetic diversity of the fungal pathogen Metarhizium spp., causing epizootics in Chinese burrower bugs in the Jingting Mountains, eastern China.

    PubMed

    Luan, Fenggang; Zhang, Shengli; Wang, Bin; Huang, Bo; Li, Zengzhi

    2013-01-01

    Based on the internal transcribed spacer and inter-simple sequence repeats (ISSR), the phylogenetic relationship and genetic diversity of Metarhizium spp., pathogens found in Chinese burrower bugs, Schiodtella formosana, were analyzed. The results showed that the causative agents of the epizootic green muscardine disease in populations of S. formosana were actually composed of M. anisopliae and its sister species, M. robertsii. The genetic structure of Metarhizium spp. populations were assessed using ten ISSR. A 3D principal component analysis of 51 isolates sampled on different occasions revealed that the Metarhizium spp. populations were temporally heterogeneous. They differentiated into two main clades including over 71 % of all strains causing epizootics, with a similarity of 83 %. The population differentiation was relatively low (G ( ST ), 0.2080), reflecting a large proportion of gene differentiation (79.2 %) within the populations. Further knowledge of the complex species and heterogeneous populations of Metarhizium spp. may be necessary for sustainable control methods of S. formosana.

  2. Specific Diversity of Metarhizium Isolates Infecting Aeneolamia spp. (Hemiptera: Cercopidae) in Sugarcane Plantations.

    PubMed

    Hernández-Domínguez, C; Guzmán-Franco, A W; Carrillo-Benítez, M G; Alatorre-Rosas, R; Rodríguez-Leyva, E; Villanueva-Jiménez, J A

    2016-02-01

    Spittlebugs from the genus Aeneolamia are important pests of sugarcane. Although the use of the entomopathogenic fungus Metarhizum anisopliae s.l. for control of this pest is becoming more common in Mexico, fundamental information regarding M. anisopliae in sugarcane plantations is practically non-existent. Using phylogenetic analysis, we determined the specific diversity of Metarhizium spp. infecting adult spittlebugs in sugarcane plantations from four Mexican states. We obtained 29 isolates of M. anisopliae s.str. Haplotype network analysis revealed the existence of eight haplotypes. Eight selected isolates, representing the four Mexican states, were grown at different temperatures in vitro; isolates from Oaxaca achieved the greatest growth followed by isolates from Veracruz, San Luis Potosi and Tabasco. No relationship was found between in vitro growth and haplotype diversity. Our results represent a significant contribution to the better understanding of the ecology of Metarhizum spp. in the sugarcane agroecosystem.

  3. Resistant ticks inhibit Metarhizium infection prior to haemocoel invasion by reducing fungal viability on the cuticle surface.

    PubMed

    Ment, Dana; Churchill, Alice C L; Gindin, Galina; Belausov, Eduard; Glazer, Itamar; Rehner, Stephen A; Rot, Asael; Donzelli, Bruno G G; Samish, Michael

    2012-06-01

    We studied disease progression of, and host responses to, four species in the Metarhizium anisopliae complex expressing green fluorescent protein (GFP). We compared development and determined their relative levels of virulence against two susceptible arthropods, the cattle tick Rhipicephalus annulatus and the lepidopteran Galleria mellonella, and two resistant ticks, Hyalomma excavatum and Rhipicephalus sanguineus. Metarhizium brunneum Ma7 caused the greatest mortality of R. annulatus, Metarhizium robertsii ARSEF 2575 and Metarhizium pingshaense PPRC51 exhibited intermediate levels of virulence, and Metarhizium majus PPRC27 caused low mortality of cattle ticks. Conidia of all four species germinated on all hosts examined, but on resistant hosts, sustained hyphal growth was inhibited and GFP emission steadily and significantly decreased over time, suggesting a loss of fungal viability. Cuticle penetration was observed only for the three most virulent species infecting susceptible hosts. Cuticles of resistant and susceptible engorged female ticks showed significant increases in red autofluorescence at sites immediately under fungal hyphae. This is the first report (i) of tick mortality occurring after cuticle penetration but prior to haemocoel colonization and (ii) that resistant ticks do not support development of Metarhizium germlings on the outer surface of the cuticle. Whether reduced Metarhizium viability on resistant tick cuticles is due to antibiosis or limited nutrient availability is unknown.

  4. Imbibitional damage in conidia of the entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, and Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    When dried organisms are immersed in water, rapid imbibition may cause severe damage to plasma membranes; in unicellular organisms, such damage is usually lethal. This study investigated effects of pre-immersion moisture levels and immersion temperature on imbibitional damage in three insect pathoge...

  5. Biocontrol of the Brown-Banded Cockroach, Supella longipalpa F. (Blattaria: Blattellidae), with Entomopathogenic Fungus, Metharhizium anisopliae

    PubMed Central

    Sharififard, Mona; Mossadegh, Mohammad Saeed; Vazirianzadeh, Babak; Latifi, Seyed Mahmood

    2016-01-01

    Background: Considering to the high distribution of cockroaches as urban pests, the efficacy of different formulations of Metarhizium anisopliae strain Iran 437C were assessed against the brown-banded cockroach, Supella longipalpa F. under laboratory and field conditions. Methods: Metarhizium anisopliae isolates were screened with immersing adults of the brown-banded cockroachs in aqueous suspension of 108 conidia ml−1 followed by surface or bait treated with different doses of the most virulent isolate against the nymphs. Then formulations of conidia oil-in-water were examined versus cockroach nymphs using different plant oils and paraffin. Then they were evaluated and compared with aqueous suspension and control group. On a large-scale, the sunflower oil-in-water formulation of conidia was sprayed at houses using a hand sprayer. Results: Metarhizium anisopliae IRAN 437C was the most virulent isolate against the brown-banded cockroach, causing 100% mortality in adults at seven days post-exposure. Inoculated bait with this isolate was not enough pathogenic against the cockroach even at two weeks after treatment. Treated surface with conidia as aqueous suspension or oil-in-water formulation was more effective than the bait formulation against the cockroach caused 39.4–97.2% mortality compared with 2.5% mortality in control group after two days. Spraying the conidia formulated with sunflower oil was an effective formulation causing 76.1% reduction in the cockroach density on the third day post treatment in the houses. Conclusion: The oil-in-water formulation of M. anisopliae IRAN 437C could be recommended as a promising alternative for cockroach control. PMID:27308292

  6. Interkingdom Gene Transfer of a Hybrid NPS/PKS from Bacteria to Filamentous Ascomycota

    PubMed Central

    Lawrence, Daniel P.; Kroken, Scott; Pryor, Barry M.; Arnold, A. Elizabeth

    2011-01-01

    Nonribosomal peptides (NRPs) and polyketides (PKs) are ecologically important secondary metabolites produced by bacteria and fungi using multidomain enzymes called nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), respectively. Previous phylogenetic analyses of fungal NRPSs and PKSs have suggested that a few of these genes were acquired by fungi via horizontal gene transfer (HGT) from bacteria, including a hybrid NPS/PKS found in Cochliobolus heterostrophus (Dothideomycetes, Ascomycota). Here, we identify this hybrid gene in fungi representing two additional classes of Ascomycota (Aspergillus spp., Microsporum canis, Arthroderma spp., and Trichophyton spp., Eurotiomycetes; Chaetomium spp. and Metarhizium spp., Sordariomycetes) and use phylogenetic analyses of the most highly conserved domains from NRPSs (adenylation (A) domain) and PKSs (ketoacyl synthase (KS) domain) to examine the hypothesis that the hybrid NPS7/PKS24 was acquired by fungi from bacteria via HGT relatively early in the evolution of the Pezizomycotina. Our results reveal a unique ancestry of the A domain and KS domain in the hybrid gene relative to known fungal NRPSs and PKSs, provide strong evidence for HGT of the hybrid gene from a putative bacterial donor in the Burkholderiales, and suggest the HGT event occurred early in the evolution of the filamentous Ascomycota. PMID:22140558

  7. Interactions of Metarhizium anisoplae and tree-based mulches in repellence and mycoses against Coptotermes formosanus (Isoptera: Rhinotermitidae).

    PubMed

    Sun, Jian-Zhong; Fuxa, James R; Richter, Arthur; Ring, Dennis

    2008-06-01

    The use of mulch in urban landscapes has increased in the United States for the past decade. Tree-based organic mulches can supply Coptotermes formosanus Shiraki with food, moisture, and shelter. The current research contributes to mulch management technology in termite control. A choice test arena was designed to determine the repellence and mortality caused by commercial mulches treated with different concentrations of the fungus Metarhizium anisopliae (Metschnikoff) against C. formosanus. Each of six tree-based mulches (pine bark, pine straw, bald cypress, eucalyptus, water oak, and melaleuca) was coated with six conidial concentrations ranging from 1 x 10(3) to 1 x 10(8) conidia/ml. The foragers of C. formosanus were repelled significantly by the fungal-treated mulch substrates; the proportion of termites on fungal-treated mulch was usually <20% during the 28-d test. By day 28, >99% of the termites were killed in test arenas containing a chamber with mulch treated with 10(7) or 10(8) conidia/ml. M. anisopliae significantly reduced mulch consumption by 34-71%. Mulch consumption by the termites was negatively correlated with fungal concentration, and the type of mulch also affected consumption. The differences in termite foraging activities, mortality, and food consumption among mulches were usually confounded by differences in fungal concentrations of M. anisopliae. The results indicate that repellence and virulence of M. anisopliae conidia should significantly reduce the suitability of these six mulches as a habitat for C. formosanus.

  8. Multiplexed microsatellite markers for seven Metarhizium species

    USDA-ARS?s Scientific Manuscript database

    Cross-species transferability of 41 previously published simple sequence repeat (SSR) markers was assessed for 11 species of the entomopathogenic fungus Metarhizium. A collection of 65 Metarhizium isolates including all 54 used in a recent phylogenetic revision of the genus were characterized. Betwe...

  9. Metarhizium brunneum Blastospore Pathogenesis in Aedes aegypti Larvae: Attack on Several Fronts Accelerates Mortality.

    PubMed

    Alkhaibari, Abeer M; Carolino, Aline T; Yavasoglu, Sare I; Maffeis, Thierry; Mattoso, Thalles C; Bull, James C; Samuels, Richard I; Butt, Tariq M

    2016-07-01

    Aedes aegypti is the vector of a wide range of diseases (e.g. yellow fever, dengue, Chikungunya and Zika) which impact on over half the world's population. Entomopathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have been found to be highly efficacious in killing mosquito larvae but only now are the underlying mechanisms for pathogenesis being elucidated. Recently it was shown that conidia of M. anisopliae caused stress induced mortality in Ae. aegypti larvae, a different mode of pathogenicity to that normally seen in terrestrial hosts. Blastospores constitute a different form of inoculum produced by this fungus when cultured in liquid media and although blastospores are generally considered to be more virulent than conidia no evidence has been presented to explain why. In our study, using a range of biochemical, molecular and microscopy methods, the infection process of Metarhizium brunneum (formerly M. anisopliae) ARSEF 4556 blastospores was investigated. It appears that the blastospores, unlike conidia, readily adhere to and penetrate mosquito larval cuticle. The blastospores are readily ingested by the larvae but unlike the conidia are able infect the insect through the gut and rapidly invade the haemocoel. The fact that pathogenicity related genes were upregulated in blastospores exposed to larvae prior to invasion, suggests the fungus was detecting host derived cues. Similarly, immune and defence genes were upregulated in the host prior to infection suggesting mosquitoes were also able to detect pathogen-derived cues. The hydrophilic blastospores produce copious mucilage, which probably facilitates adhesion to the host but do not appear to depend on production of Pr1, a cuticle degrading subtilisin protease, for penetration since protease inhibitors did not significantly alter blastospore virulence. The fact the blastospores have multiple routes of entry (cuticle and gut) may explain why this form of the inoculum killed Ae. aegypti larvae

  10. Metarhizium brunneum Blastospore Pathogenesis in Aedes aegypti Larvae: Attack on Several Fronts Accelerates Mortality

    PubMed Central

    Alkhaibari, Abeer M.; Carolino, Aline T.; Yavasoglu, Sare I.; Maffeis, Thierry; Mattoso, Thalles C.; Bull, James C.; Samuels, Richard I.; Butt, Tariq M.

    2016-01-01

    Aedes aegypti is the vector of a wide range of diseases (e.g. yellow fever, dengue, Chikungunya and Zika) which impact on over half the world’s population. Entomopathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have been found to be highly efficacious in killing mosquito larvae but only now are the underlying mechanisms for pathogenesis being elucidated. Recently it was shown that conidia of M. anisopliae caused stress induced mortality in Ae. aegypti larvae, a different mode of pathogenicity to that normally seen in terrestrial hosts. Blastospores constitute a different form of inoculum produced by this fungus when cultured in liquid media and although blastospores are generally considered to be more virulent than conidia no evidence has been presented to explain why. In our study, using a range of biochemical, molecular and microscopy methods, the infection process of Metarhizium brunneum (formerly M. anisopliae) ARSEF 4556 blastospores was investigated. It appears that the blastospores, unlike conidia, readily adhere to and penetrate mosquito larval cuticle. The blastospores are readily ingested by the larvae but unlike the conidia are able infect the insect through the gut and rapidly invade the haemocoel. The fact that pathogenicity related genes were upregulated in blastospores exposed to larvae prior to invasion, suggests the fungus was detecting host derived cues. Similarly, immune and defence genes were upregulated in the host prior to infection suggesting mosquitoes were also able to detect pathogen-derived cues. The hydrophilic blastospores produce copious mucilage, which probably facilitates adhesion to the host but do not appear to depend on production of Pr1, a cuticle degrading subtilisin protease, for penetration since protease inhibitors did not significantly alter blastospore virulence. The fact the blastospores have multiple routes of entry (cuticle and gut) may explain why this form of the inoculum killed Ae. aegypti

  11. Dating the Diversification of the Major Lineages of Ascomycota (Fungi)

    PubMed Central

    Prieto, María; Wedin, Mats

    2013-01-01

    Establishing the dates for the origin and main diversification events in the phylogeny of Ascomycota is among the most crucial remaining goals in understanding the evolution of Fungi. There have been several analyses of divergence times in the fungal tree of life in the last two decades, but most have yielded contrasting results for the origin of the major lineages. Moreover, very few studies have provided temporal estimates for a large set of clades within Ascomycota. We performed molecular dating to estimate the divergence times of most of the major groups of Ascomycota. To account for paleontological uncertainty, we included alternative fossil constraints as different scenarios to enable a discussion of the effect of selection of fossils. We used data from 6 molecular markers and 121 extant taxa within Ascomycota. Our various ‘relaxed clock’ scenarios suggest that the origin and diversification of the Pezizomycotina occurred in the Cambrian. The main lineages of lichen–forming Ascomycota originated at least as early as the Carboniferous, with successive radiations in the Jurassic and Cretaceous generating the diversity of the main modern groups. Our study provides new information about the timing of the main diversification events in Ascomycota, including estimates for classes, orders and families of both lichenized and non–lichenized Ascomycota, many of which had not been previously dated. PMID:23799026

  12. Identification of Metarhizium anisopliae transcripts expressed during the fungus- insect interaction

    USDA-ARS?s Scientific Manuscript database

    The identification of genes contributing to the establishment and disease progression of entomopathogenic fungi within their insect hosts has been conducted to date largely using in vitro systems mimicking specific phases of the infection. We are exploring the use of in vivo techniques to identify f...

  13. Storage conditions affect speed of germination in Beauveria bassiana and Metarhizium anisopliae conidia

    USDA-ARS?s Scientific Manuscript database

    The retention of high viability during storage is essential for effectiveness and thus market acceptance of fungus-based biopesticides. The length of adequate shelf-lives for mycoinsecticides is controversial, with proposed requirements varying from a few weeks to 18 months. Shelf-life determination...

  14. THE IDENTIFICATION AND CHARACTERIZATION OF AN LGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    Molds are ubiquitous components of the indoor environment and have been associated with exacerbation of asthma as well as a number of other health effects. Their contribution to the induction of allergic asthma is less certain. Previously, we have shown that BALB/c mice exposed...

  15. Synergistic effect of dual imidacloprid-Metarhizium anisopliae applications against Asian longhorned beetles (Anoplophora glabripennis)

    Treesearch

    Todd A. Ugine; Calum W. Russell; Ann E. Hajek

    2011-01-01

    Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae), a longhorned beetle species native to Asia, has been introduced into several North American and European cities. Currently, eradication and preventive measures are limited to identifying and destroying infested trees and protecting uninfested trees with trunk or soil-injections of the...

  16. THE IDENTIFICATION AND CHARACTERIZATION OF AN LGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    Molds are ubiquitous components of the indoor environment and have been associated with exacerbation of asthma as well as a number of other health effects. Their contribution to the induction of allergic asthma is less certain. Previously, we have shown that BALB/c mice exposed...

  17. Species Diversity and Population Dynamics of Entomopathogenic Fungal Species in the Genus Metarhizium-a Spatiotemporal Study.

    PubMed

    Hernández-Domínguez, Carmela; Guzmán-Franco, Ariel W

    2017-01-26

    We studied the species diversity and population genetic structure of isolates of fungi from the entomopathogenic genus Metarhizium that had been isolated from sugarcane crops and surrounding grass. Soil and leaf samples were taken on four sampling occasions over 13 months (October 2014-October 2015). Isolations were made using the Galleria mellonella baiting method and selective media. Phylogenetic placement of isolates was done by sequencing a fragment of the 5' of the elongation factor 1-α gene (EF1-α). Population genetic structure was determined by analysing this sequence information using AMOVA and Haplotype network analyses. Genotypic diversity was studied using microsatellite genotyping. The most abundant species was M. anisopliae s.s. (80 isolates), then M. pingshaense (three isolates), and M. guizhouense (one isolate). More than 50% of the genetic variation was explained by the time the samples were collected regardless of plant host association. Some haplotypes were found on the first sampling date and then not found on subsequent sampling dates, while other haplotypes were found initially, disappeared, but then found again on the last sampling date. To the best of our knowledge, this is the first report of the population genetic structure of M. anisopliae species in time and space. The effect of abiotic factors is discussed.

  18. Mrt, a gene unique to fungi, encodes an oligosaccharide transporter and facilitates rhizosphere competency in Metarhizium robertsii.

    PubMed

    Fang, Weiguo; St Leger, Raymond J

    2010-11-01

    The symbiotic associations between rhizospheric fungi and plants have enormous environmental impact. Fungi are crucial to plant health as antagonists of pathogens and herbivores and facilitate the uptake of soil nutrients. However, little is known about the plant products obtained by fungi in exchange or how they are transported through the symbiotic interface. Here, we demonstrate that sucrose and raffinose family oligosaccharides in root exudates are important for rhizosphere competence in the insect pathogen Metarhizium robertsii (formerly known as Metarhizium anisopliae). We identified mutants in the Metarhizium raffinose transporter (Mrt) gene of M. robertsii that grew poorly in root exudate and were greatly reduced in rhizosphere competence on grass roots. Studies on sugar uptake, including competition assays, revealed that MRT was a sucrose and galactoside transporter. Disrupting MRT resulted in greatly reduced or no growth on sucrose and galactosides but did not affect growth on monosaccharides or oligosaccharides composed entirely of glucose subunits. Consistent with this, expression of Mrt is exclusively up-regulated by galactosides and sucrose. Expressing a green fluorescent protein gene under the control of the Mrt promoter confirmed that MRT was expressed by germlings in the vicinity of grass roots but not in surrounding bulk soil. Disrupting Mrt did not reduce virulence to insects, demonstrating that Mrt is exclusively involved in M. robertsii's interactions with plants. To our knowledge, MRT is the first oligosaccharide transporter identified and characterized in a fungus and is unique to filamentous fungi, but homologous genes in Magnaporthe, Ustilago, Aspergillus, Fusarium, Epichloe, and Penicillium species indicate that oligosaccharide transport is of widespread significance.

  19. Production of microsclerotia by Brazilian strains of Metarhizium spp. using submerged liquid culture fermentation.

    PubMed

    Mascarin, Gabriel Moura; Kobori, Nilce Naomi; de Jesus Vital, Rayan Carlos; Jackson, Mark Alan; Quintela, Eliane Dias

    2014-05-01

    We investigated the potential production and desiccation tolerance of microsclerotia (MS) by Brazilian strains of Metarhizium anisopliae (Ma), M. acridum (Mc) and M. robertsii (Mr). These fungi were grown in a liquid medium containing 16 g carbon l⁻¹ with a carbon:nitrogen ratio of 50:1. One hundred milliliters cultures were grown in 250 ml Erlenmeyer flasks in a rotary incubator shaker at 28 °C and 200 rpm for 5 days. Five-day-old MS were harvested, mixed with diatomaceous earth (DE) and air-dried for 2 days at 30 °C. The air-dried MS-DE granular preparations were milled by mortar + pestle and stored in centrifuged tubes at either 26 or -20 °C. Desiccation tolerance and conidia production were assessed for dried MS granules by measuring hyphal germination after incubation for 2 days on water agar plates at 26 °C and for conidia production following 7 days incubation. Yields of MS by all strains of Metarhizium were 6.1-7.3 × 10⁶ l⁻¹ after 3 days growth with maximum MS yields (0.7-1.1 × 10⁷ l⁻¹) after 5 days growth. No differences in biomass accumulation were observed after 3 days growth, whereas Ma-CG168 showed the highest biomass accumulation after 5 days growth. Dried MS-DE preparations of all fungal strains were equally tolerant to desiccation (≥93 % germination) and the highest conidia production was obtained by MS granules of Mc-CG423 (4 × 10⁹ conidia g⁻¹). All MS granules showed similar stability after storage at either 26 or -20 °C for 3.5 months.

  20. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIEA

    EPA Science Inventory

    The goal of this project is the identification and characterization of allergens from the fungus M. Anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaerosol contamination. One of ...

  1. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIEA

    EPA Science Inventory

    The goal of this project is the identification and characterization of allergens from the fungus M. Anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaerosol contamination. One of ...

  2. Metachelins, mannosylated and N-oxidized coprogen-type siderophores from Metarhizium robertsii.

    PubMed

    Krasnoff, Stuart B; Keresztes, Ivan; Donzelli, Bruno G G; Gibson, Donna M

    2014-07-25

    Under iron-depleted culture conditions, the entomopathogenic fungus Metarhizium robertsii (Bischoff, Humber, and Rehner) (= M. anisopliae) produces a complex of extracellular siderophores including novel O-glycosylated and N-oxidized coprogen-type compounds as well as the known fungal siderophores N(α)-dimethylcoprogen (NADC) and dimerumic acid (DA). Metachelin A (1), the most abundant component in the M. robertsii siderophore mixture, was characterized as a 1094 Da analogue of NADC that is O-glycosylated by β-mannose at both terminal hydroxyl groups and N-oxidized at the dimethylated α-nitrogen. The mixture also contained a 1078 Da analogue, metachelin B (2), which lacks the N-oxide modification. Also characterized were the aglycone of 1, i.e., the N-oxide of NADC (3), and the monomannoside of DA (6). N-Oxide and O-glycosyl substituents are unprecedented among microbial siderophores. At high ESIMS source energy and at room temperature in DMSO, 1 underwent Cope elimination, resulting in loss of the N(α)-dimethyl group and dehydration of the α-β bond. High-resolution ESIMS data confirmed that all tri- and dihydroxamate siderophores (1-6) complex with trivalent Fe, Al, and Ga. In a chrome azurol S assay, all of the M. robertsii siderophores showed iron-binding activity roughly equivalent to that of desferrioxamine B.

  3. Outline of the Ascomycota – subphyla Saccharomycotina and Taphrinomycotina

    USDA-ARS?s Scientific Manuscript database

    This review describes all presently recognized genera of the Saccharomycotina (budding yeasts) and the Taphrinomycotina (fission yeasts and related). This update will appear as part of a world wide effort to provide brief description of currently recognized genera of the ascomycete fungi (Ascomycota...

  4. Phylogenetic diversity of Brazilian Metarhizium associated with sugarcane agriculture

    USDA-ARS?s Scientific Manuscript database

    Biological control of spittlebug with Metarhizium in sugarcane is an example of the successful application of sustainable pest management in Brazil. However little is known about the richness, distribution and ecology of Metarhizium species in the agroecosystems and natural environments of Brazil. W...

  5. Insertion of an Esterase Gene into a Specific Locust Pathogen (Metarhizium acridum) Enables It to Infect Caterpillars

    PubMed Central

    Wang, Sibao; Fang, Weiguo; Wang, Chengshu; St. Leger, Raymond J.

    2011-01-01

    An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae) as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta) cuticle, M. robertsii up-regulates a gene (Mest1) that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta), while virulence to grasshoppers (Melanoplus femurrubrum) was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene. PMID:21731492

  6. Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum) enables it to infect caterpillars.

    PubMed

    Wang, Sibao; Fang, Weiguo; Wang, Chengshu; St Leger, Raymond J

    2011-06-01

    An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae) as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta) cuticle, M. robertsii up-regulates a gene (Mest1) that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta), while virulence to grasshoppers (Melanoplus femurrubrum) was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

  7. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite are Compared in a Mouse Model

    EPA Science Inventory

    Biopesticides can be effective in controlling their target pest. However, research regarding mammalian health impacts of these agents has focused on toxicity and pathogenicity, with limited research regarding allergenicity and asthma development. We compared the ability of funga...

  8. MALDI-TOF mass spectrometry applied to identifying species of insect-pathogenic fungi from the Metarhizium anisopliae complex

    USDA-ARS?s Scientific Manuscript database

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has proven to be a powerful tool for taxonomic resolution of microorganisms. In this proof-of-concept study, we assessed the effectiveness of this technique to track the current gene sequence-based phylogenet...

  9. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite are Compared in a Mouse Model

    EPA Science Inventory

    Biopesticides can be effective in controlling their target pest. However, research regarding mammalian health impacts of these agents has focused on toxicity and pathogenicity, with limited research regarding allergenicity and asthma development. We compared the ability of funga...

  10. Innovation and constraint leading to complex multicellularity in the Ascomycota

    PubMed Central

    Nguyen, Tu Anh; Cissé, Ousmane H.; Yun Wong, Jie; Zheng, Peng; Hewitt, David; Nowrousian, Minou; Stajich, Jason E.; Jedd, Gregory

    2017-01-01

    The advent of complex multicellularity (CM) was a pivotal event in the evolution of animals, plants and fungi. In the fungal Ascomycota, CM is based on hyphal filaments and arose in the Pezizomycotina. The genus Neolecta defines an enigma: phylogenetically placed in a related group containing mostly yeasts, Neolecta nevertheless possesses Pezizomycotina-like CM. Here we sequence the Neolecta irregularis genome and identify CM-associated functions by searching for genes conserved in Neolecta and the Pezizomycotina, which are absent or divergent in budding or fission yeasts. This group of 1,050 genes is enriched for functions related to diverse endomembrane systems and their organization. Remarkably, most show evidence for divergence in both yeasts. Using functional genomics, we identify new genes involved in fungal complexification. Together, these data show that rudimentary multicellularity is deeply rooted in the Ascomycota. Extensive parallel gene divergence during simplification and constraint leading to CM suggest a deterministic process where shared modes of cellular organization select for similarly configured organelle- and transport-related machineries. PMID:28176784

  11. Innovation and constraint leading to complex multicellularity in the Ascomycota.

    PubMed

    Nguyen, Tu Anh; Cissé, Ousmane H; Yun Wong, Jie; Zheng, Peng; Hewitt, David; Nowrousian, Minou; Stajich, Jason E; Jedd, Gregory

    2017-02-08

    The advent of complex multicellularity (CM) was a pivotal event in the evolution of animals, plants and fungi. In the fungal Ascomycota, CM is based on hyphal filaments and arose in the Pezizomycotina. The genus Neolecta defines an enigma: phylogenetically placed in a related group containing mostly yeasts, Neolecta nevertheless possesses Pezizomycotina-like CM. Here we sequence the Neolecta irregularis genome and identify CM-associated functions by searching for genes conserved in Neolecta and the Pezizomycotina, which are absent or divergent in budding or fission yeasts. This group of 1,050 genes is enriched for functions related to diverse endomembrane systems and their organization. Remarkably, most show evidence for divergence in both yeasts. Using functional genomics, we identify new genes involved in fungal complexification. Together, these data show that rudimentary multicellularity is deeply rooted in the Ascomycota. Extensive parallel gene divergence during simplification and constraint leading to CM suggest a deterministic process where shared modes of cellular organization select for similarly configured organelle- and transport-related machineries.

  12. Saccharomycotina and Taphrinomycotina: the yeasts and yeast-like fungi of the Ascomycota

    USDA-ARS?s Scientific Manuscript database

    The phylum Ascomycota has been resolved into three major phylogenetic lineages: the subphyla Saccharomycotina (e.g., Saccharomyces, Pichia, Candida), Taphrinomycotina (e.g., Protomyces, Taphrina, Pneumocystis), and the Pezizomycotina (e.g., Aspergillus, Neurospora, Peziza). We discuss the ecology, ...

  13. Independent origins of diploidy in Metarhizium.

    PubMed

    Kepler, Ryan Michael; Chen, Yuan; Kilcrease, James; Shao, Jonathan; Rehner, Stephen A

    2016-09-12

    In fungi, stable diploid genome arrangements are rare. Here we present evidence from nuclear intergenic DNA sequencing, microsatellite genotyping, and configuration of the mating-type locus to demonstrate two independent origins of persistent diploid genome organization in the Metarhizium majus species complex. Most taxa in the complex are genotypically haploid, with individual isolates consistently displaying a single allele across all nuclear loci, as well as having a single mating-type locus. In contrast, individuals of M. majus and the clade designated here MGT1 are shown to be diploid, based on a consistent finding of heterozygosity and the presence of both MAT1 and MAT2 mating-type loci. In single locus phylogenies, nuclear intergenic alleles of M. majus and MGT1 each form monophyletic groups, indicating that diploidy in both taxa likely originated by the union of conspecific individuals. Sequence divergence in the APN2/MAT1-1-3 and APN2/MAT2-1 intergenic spacers indicate the two MAT loci are physically separated in the genomes of both diploid taxa, although the linkage relationship of the MAT loci to one another is unknown. The presence of both mating genes in a single nucleus suggests these diploid genomes may represent a mating event that failed to complete meiosis. Whether or not these isolates are able to complete the sexual cycle under any conditions and form ascospores remains an open question.

  14. Metacridamides A and B from the biocontrol fungus metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

  15. Unveiling the biosynthetic puzzle of destruxins in Metarhizium species

    PubMed Central

    Wang, Bing; Kang, Qianjin; Lu, Yuzhen; Bai, Linquan; Wang, Chengshu

    2012-01-01

    Insect pathogenic fungi produce a plethora of insecticidally and pharmaceutically active compounds, including 39 cyclohexadepsipeptide destruxins (dtxs). Even though dtxs were first discovered more than 50 y ago, the genes responsible for their biosynthesis were unknown until this study. Based on our comparative genomic information and targeted gene disruptions, we report the gene cluster for dtx biosynthesis in the insect pathogen Metarhizium robertsii. The nonribosomal peptide synthetase DtxS1 has six adenylation domains, two of which are capable of selecting different amino acids to synthesize dtx B and its analogs. The cytochrome P450 enzyme DtxS2 converts dtx B into other dtxs by a chain of reactions, each producing a new derivative. The aldo-keto reductase DtxS3 and aspartic acid decarboxylase DtxS4 are responsible for the conversion and provision of the first and last substrates for the dtx assembly line, respectively. Insect bioassays showed that dtxs could suppress both cellular and humoral immune responses thereby assisting fungal propagation in insects. The differing abilities of Metarhizium species to produce toxins is dependent on the presence of the dtxS1 gene. The toxigenic species are capable of killing multiple orders of insects, whereas the nontoxigenic Metarhizium spp. have narrow host ranges. Thus, the acquisition or retention of the dtx biosynthesis gene cluster in Metarhizium lineages has been coordinated with the evolution of fungal host specificity. The data from this study will facilitate the development of dtxs as bioinsecticides or pharmaceuticals. PMID:22232661

  16. Molecular genetics of secondary chemistry in Metarhizium fungi

    USDA-ARS?s Scientific Manuscript database

    As with many microbes, entomopathogenic fungi from the genus Metarhizium produce a plethora of small molecule metabolites, often referred to as secondary metabolites. Although these intriguing compounds are a conspicuous feature of the biology of the producing fungi, their roles in pathogenicity and...

  17. Origin and evolution of carnivorism in the Ascomycota (fungi)

    PubMed Central

    Yang, Ence; Xu, Lingling; Yang, Ying; Zhang, Xinyu; Xiang, Meichun; Wang, Chengshu; An, Zhiqiang; Liu, Xingzhong

    2012-01-01

    Carnivorism is one of the basic life strategies of fungi. Carnivorous fungi possess the ability to trap and digest their preys by sophisticated trapping devices. However, the origin and development of fungal carnivorism remains a gap in evolution biology. In this study, five protein-encoding genes were used to construct the phylogeny of the carnivorous fungi in the phylum Ascomycota; these fungi prey on nematodes by means of specialized trapping structures such as constricting rings and adhesive traps. Our analysis revealed a definitive pattern of evolutionary development for these trapping structures. Molecular clock calibration based on two fossil records revealed that fungal carnivorism diverged from saprophytism about 419 Mya, which was after the origin of nematodes about 550–600 Mya. Active carnivorism (fungi with constricting rings) and passive carnivorism (fungi with adhesive traps) diverged from each other around 246 Mya, shortly after the occurrence of the Permian–Triassic extinction event about 251.4 Mya. The major adhesive traps evolved around 198–208 Mya, which was within the time frame of the Triassic–Jurassic extinction event about 201.4 Mya. However, no major carnivorous ascomycetes divergence was correlated to the Cretaceous–Tertiary extinction event, which occurred more recently (about 65.5 Mya). Therefore, a causal relationship between mass extinction events and fungal carnivorism evolution is not validated in this study. More evidence including additional fossil records is needed to establish if fungal carnivorism evolution was a response to mass extinction events. PMID:22715289

  18. Origin and evolution of carnivorism in the Ascomycota (fungi).

    PubMed

    Yang, Ence; Xu, Lingling; Yang, Ying; Zhang, Xinyu; Xiang, Meichun; Wang, Chengshu; An, Zhiqiang; Liu, Xingzhong

    2012-07-03

    Carnivorism is one of the basic life strategies of fungi. Carnivorous fungi possess the ability to trap and digest their preys by sophisticated trapping devices. However, the origin and development of fungal carnivorism remains a gap in evolution biology. In this study, five protein-encoding genes were used to construct the phylogeny of the carnivorous fungi in the phylum Ascomycota; these fungi prey on nematodes by means of specialized trapping structures such as constricting rings and adhesive traps. Our analysis revealed a definitive pattern of evolutionary development for these trapping structures. Molecular clock calibration based on two fossil records revealed that fungal carnivorism diverged from saprophytism about 419 Mya, which was after the origin of nematodes about 550-600 Mya. Active carnivorism (fungi with constricting rings) and passive carnivorism (fungi with adhesive traps) diverged from each other around 246 Mya, shortly after the occurrence of the Permian-Triassic extinction event about 251.4 Mya. The major adhesive traps evolved around 198-208 Mya, which was within the time frame of the Triassic-Jurassic extinction event about 201.4 Mya. However, no major carnivorous ascomycetes divergence was correlated to the Cretaceous-Tertiary extinction event, which occurred more recently (about 65.5 Mya). Therefore, a causal relationship between mass extinction events and fungal carnivorism evolution is not validated in this study. More evidence including additional fossil records is needed to establish if fungal carnivorism evolution was a response to mass extinction events.

  19. Identification of Molecular Variants in Mitochondrial DNAs of Members of the Genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium.

    PubMed

    Hegedus, D D; Khachatourians, G G

    1993-12-01

    A set of five mitochondrial (mt) probes derived from a strain of Beauveria bassiana was used to evaluate the similarity of mtDNAs from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. The probes and genes encoded for (shown in parentheses) were pBbmtE2 (NADI, ATP6), pBbmtE3 (ATP6, small rRNA [srRNA]), pBbmtE4 (srRNA, CO3, NAD6), pBbSE1 (NAD6, tRNA, large rRNA [lrRNA]), and pBbXS1 (lrRNA). The probes produced identical hybridization patterns in EcoRI-digested DNA from nearly all isolates of B. bassiana and Beauveria caledonica. Similar patterns were also observed with Beauveria densa. The isolates of B. caledonica and B. densa DNAs could be differentiated from each other and from B. bassiana on the basis of a HindIII digestion and probing with pBbmtE3. Probe pBbmtE2 produced either a 5.0-kb or a 4.1-kb band in all of the B. bassiana isolates. This observation was used to categorize the mtDNA of B. bassiana into two types, designated A and B. Hybridization of the five probes produced distinct banding patterns in Beauveria brongniartii, Tolypocladium cylindrosporum, Tolypocladium nivea, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus. Hybridizations carried out with multiple probes simultaneously present produced unique patterns which characterized the B. bassiana group from all other fungi tested. These results are discussed in terms of how mtDNA polymorphisms in B. bassiana may relate to natural population structures, mt transmission in deuteromycetes, and the use of mtDNA polymorphisms in structural analysis of mtDNA.

  20. Identification of Molecular Variants in Mitochondrial DNAs of Members of the Genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium

    PubMed Central

    Hegedus, Dwayne D.; Khachatourians, George G.

    1993-01-01

    A set of five mitochondrial (mt) probes derived from a strain of Beauveria bassiana was used to evaluate the similarity of mtDNAs from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. The probes and genes encoded for (shown in parentheses) were pBbmtE2 (NADI, ATP6), pBbmtE3 (ATP6, small rRNA [srRNA]), pBbmtE4 (srRNA, CO3, NAD6), pBbSE1 (NAD6, tRNAVal, Ile, Ser, Trp, Pro, large rRNA [lrRNA]), and pBbXS1 (lrRNA). The probes produced identical hybridization patterns in EcoRI-digested DNA from nearly all isolates of B. bassiana and Beauveria caledonica. Similar patterns were also observed with Beauveria densa. The isolates of B. caledonica and B. densa DNAs could be differentiated from each other and from B. bassiana on the basis of a HindIII digestion and probing with pBbmtE3. Probe pBbmtE2 produced either a 5.0-kb or a 4.1-kb band in all of the B. bassiana isolates. This observation was used to categorize the mtDNA of B. bassiana into two types, designated A and B. Hybridization of the five probes produced distinct banding patterns in Beauveria brongniartii, Tolypocladium cylindrosporum, Tolypocladium nivea, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus. Hybridizations carried out with multiple probes simultaneously present produced unique patterns which characterized the B. bassiana group from all other fungi tested. These results are discussed in terms of how mtDNA polymorphisms in B. bassiana may relate to natural population structures, mt transmission in deuteromycetes, and the use of mtDNA polymorphisms in structural analysis of mtDNA. Images PMID:16349124

  1. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics

    USDA-ARS?s Scientific Manuscript database

    The genus Metarhizium traditionally refers to green-spored asexual insect pathogenic fungi. Through culturing and molecular methods, Metarhizium has been linked to Metacordyceps sexual states. Historically, fungal nomenclature has allowed separate names for the different life-stages of pleomorphic...

  2. Production of destruxins from metarhizium spp. fungi in artificial medium and in endophytically colonized cowpea plants

    USDA-ARS?s Scientific Manuscript database

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E prod...

  3. Production of destruxins from Metarhizium spp. fungi in artificial medium and in endophytically colonized Cowpea Plants

    USDA-ARS?s Scientific Manuscript database

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E prod...

  4. Clavicipitaceous entomopathogens: New species of Metarhizium and a new genus Nigelia

    USDA-ARS?s Scientific Manuscript database

    In several surveys in the tropical forests in Thailand, specimens that looked morphologically similar to Metarhizium martialis and Cordyceps variegata, as well as Metarhizium species were collected and cultured in vitro. A combined phylogeny of several genes including the small (18S) and large (28S)...

  5. Estimating the Phanerozoic history of the Ascomycota lineages: combining fossil and molecular data.

    PubMed

    Beimforde, Christina; Feldberg, Kathrin; Nylinder, Stephan; Rikkinen, Jouko; Tuovila, Hanna; Dörfelt, Heinrich; Gube, Matthias; Jackson, Daniel J; Reitner, Joachim; Seyfullah, Leyla J; Schmidt, Alexander R

    2014-09-01

    The phylum Ascomycota is by far the largest group in the fungal kingdom. Ecologically important mutualistic associations such as mycorrhizae and lichens have evolved in this group, which are regarded as key innovations that supported the evolution of land plants. Only a few attempts have been made to date the origin of Ascomycota lineages by using molecular clock methods, which is primarily due to the lack of satisfactory fossil calibration data. For this reason we have evaluated all of the oldest available ascomycete fossils from amber (Albian to Miocene) and chert (Devonian and Maastrichtian). The fossils represent five major ascomycete classes (Coniocybomycetes, Dothideomycetes, Eurotiomycetes, Laboulbeniomycetes, and Lecanoromycetes). We have assembled a multi-gene data set (18SrDNA, 28SrDNA, RPB1 and RPB2) from a total of 145 taxa representing most groups of the Ascomycota and utilized fossil calibration points solely from within the ascomycetes to estimate divergence times of Ascomycota lineages with a Bayesian approach. Our results suggest an initial diversification of the Pezizomycotina in the Ordovician, followed by repeated splits of lineages throughout the Phanerozoic, and indicate that this continuous diversification was unaffected by mass extinctions. We suggest that the ecological diversity within each lineage ensured that at least some taxa of each group were able to survive global crises and rapidly recovered. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species

    USDA-ARS?s Scientific Manuscript database

    Phylogenetic relatedness among ascomycetous yeast genera (subphylum Saccharomycotina, phylum Ascomycota) has been uncertain. In the present study, type species of 70 currently recognized genera are compared from divergence in the nearly entire nuclear gene sequences for large subunit rRNA, small sub...

  7. Metabolic Conservation and Diversification of Metarhizium Species Correlate with Fungal Host-Specificity

    PubMed Central

    Xu, Yong-Jiang; Luo, Feifei; Li, Bing; Shang, Yanfang; Wang, Chengshu

    2016-01-01

    The ascomycete genus Metarhizium contains several species of insect pathogenic fungi ranging from specialists with narrow host ranges to generalists that can infect diverse invertebrates. Genetic and metabolic conservations and diversifications of Metarhizium species are not well understood. In this study, using the genome information of seven Metarhizium species, we performed a comparative analysis of gene clusters involved in secondary metabolisms (SMs) in these species. The results revealed that the generalist species contain more SM gene clusters than the specialists, and that both conserved and divergent evolutions may have occurred in SM genes during fungal speciation. In particular, the loss/gain events, as well as gene mutagenesis, are evident for the gene cluster responsible for the biosynthesis of non-ribosomal cyclopeptide destruxins. The presence of conserved SM gene clusters in Metarhizium and other divergently evolved insect pathogenic fungi implies their link to fungal entomopathogenicity. Mass spectrometry based metabolomic analyses were also conducted to investigate the chemical diversities of seven Metarhizium species. Consistent with the evolutionary relationships of SM genes among the seven species, significant differences are observed in fungal metabolic profiles, whether the same or different metabolites are produced in different species. Clustering analysis based on the metabolome data revealed that Metarhizium species could be grouped based on their association to fungal host specificity. Our metabolomics-based methods also facilitate the identification of bioactive metabolites that have not been reported previously in Metarhizium. The results of this study will benefit future investigations of the chemical biology of insect-fungal interactions. PMID:28018335

  8. Extracellular polysaccharides from Ascomycota and Basidiomycota: production conditions, biochemical characteristics, and biological properties.

    PubMed

    Osińska-Jaroszuk, Monika; Jarosz-Wilkołazka, Anna; Jaroszuk-Ściseł, Jolanta; Szałapata, Katarzyna; Nowak, Artur; Jaszek, Magdalena; Ozimek, Ewa; Majewska, Małgorzata

    2015-12-01

    Fungal polysaccharides (PSs) are the subject of research in many fields of science and industry. Many properties of PSs have already been confirmed and the list of postulated functions continues to grow. Fungal PSs are classified into different groups according to systematic affinity, structure (linear and branched), sugar composition (homo- and heteropolysaccharides), type of bonds between the monomers (β-(1 → 3), β-(1 → 6), and α-(1 → 3)) and their location in the cell (cell wall PSs, exoPSs, and endoPSs). Exopolysaccharides (EPSs) are most frequently studied fungal PSs but their definition, classification, and origin are still not clear and should be explained. Ascomycota and Basidiomycota fungi producing EPS have different ecological positions (saprotrophic and endophytic, pathogenic or symbiotic-mycorrhizae fungi); therefore, EPSs play different biological functions, for example in the protection against environmental stress factors and in interactions with other organisms. EPSs obtained from Ascomycota and Basidiomycota fungal cultures are known for their antioxidant, immunostimulating, antitumor, and antimicrobial properties. The major objective of the presented review article was to provide a detailed description of the state-of-the-art knowledge of the effectiveness of EPS production by filamentous and yeast Ascomycota and Basidiomycota fungi and techniques of derivation of EPSs, their biochemical characteristics, and biological properties allowing comprehensive analysis as well as indication of similarities and differences between these fungal groups. Understanding the role of EPSs in a variety of processes and their application in food or pharmaceutical industries requires improvement of the techniques of their derivation, purification, and characterization. The detailed analyses of data concerning the derivation and application of Ascomycota and Basidiomycota EPSs can facilitate development and trace the direction of application of these EPSs

  9. Evaluation of Metarhizium brunneum F52 (Hypocreales: Clavicipitaceae) for control of Japanese beetle larvae in turfgrass

    USDA-ARS?s Scientific Manuscript database

    Experimental and commercial preparations of Metarhizium brunneum strain F52 were evaluated for control of Japanese beetle Popillia japonica Newman (Coleoptera: Scarbaeidae) larvae (white grubs) in the laboratory and under field conditions. Experimental preparations consisted of granule and liquid f...

  10. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics.

    PubMed

    Kepler, Ryan M; Humber, Richard A; Bischoff, Joseph F; Rehner, Stephen A

    2014-01-01

    The genus Metarhizium historically refers to green-spored asexual insect pathogenic fungi. Through culturing and molecular methods, Metarhizium has been linked to Metacordyceps sexual states. Historically fungal nomenclature has allowed separate names for the different life stages of pleomorphic fungi. However, with the move to one name for one fungus regardless of life stage, there is a need to determine which name is correct. For Metarhizium the situation is complicated by the fact that Metacordyceps sexual states are interspersed among additional asexual genera, including Pochonia, Nomuraea and Paecilomyces. Metarhizium has priority as the earliest available name, but delimiting the boundaries of this genus remains problematic. To clarify relationships among these taxa we have obtained representative material for each genus and established a molecular dataset of the protein-coding genes BTUB, RPB1, RPB2 and TEF. The resulting phylogeny supports Metarhizium combining the majority of species recognized in Metacordyceps as well as the green-spored Nomuraea species and those in the more recently described genus Chamaeleomyces. Pochonia is polyphyletic, and we restrict the definition of this genus to those species forming a monophyletic clade with P. chlamydosporia, and the excluded species are transferred to Metapochonia gen. nov. It is our hope that this unified concept of sexual and asexual states in Metarhizium will foster advances in communication and understanding the unique ecologies of the associated species. © 2014 by The Mycological Society of America.

  11. Evaluating the virulence and longevity of non-woven fiber bands impregnated with Metarhizium anisopliae against the Asian longhorned beetle, Anoplophora glabripennis (Coleoptera: Cerambycidae)

    Treesearch

    Ryan P. Shanley; Melody Keena; Micheal M. Wheeler; Jarrod Leland; Ann E. Hajek

    2009-01-01

    Fiber bands impregnated with entomopathogenic fungi (=fungal bands) provide an effective method for controlling the invasive Asian longhorned beetle, Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae). In this study we investigated the effective longevity of fungal bands for use against A. glabripennis, using...

  12. Use of the entomopathogenic fungi Metarhizium anisopliae, Cordyceps bassiana and Isaria fumosorosea to control Diaphorina citri (Hemiptera: Psylidae) in Persian lime under field conditions

    USDA-ARS?s Scientific Manuscript database

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), is a destructive insect pest in the citriculture, because it is an efficient vector of the proteobacteria, ‘Candidatus Liberibacter asiaticus’ (Las), ‘Ca. L. Africanus’ (Laf), and ‘Ca. L. Americanus’ (Lam). These bacteria c...

  13. Multilocus sequence typing of Metarhizium anisopliae var acridum isolates as microbial agents for locust and grasshopper control. Genbank Accession numbers FJ787311 to FJ787325

    USDA-ARS?s Scientific Manuscript database

    A growing interest in the biological control of locusts and grasshoppers (Acrididae) has led to the development of biopesticides based on naturally occurring pathogens which offers an environmentally safe alternative to chemical pesticides. However, the fungal strains which are being sought for biop...

  14. Field Applications of Entomopathogenic Fungi Beauveria bassiana (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae F52 (Hypocreales: Nectriaceae) for the Control of Ixodes scapularis (Acari: Ixodidae)

    USDA-ARS?s Scientific Manuscript database

    Two commercial formulations of Beauveria bassiana (Balsamo-Crivelli) Vuillemin were applied to residential sites in Old Lyme, Connecticut for the control of nymphs of the blacklegged tick, Ixodes scapularis in 1999 and 2000. The pyrethroid bifenthrin was applied to other homes for comparison with B....

  15. [Fungus, Metarrhizium anisopliae, as a possible regulator of the number of horseflies].

    PubMed

    Saubenova, O G

    1976-01-01

    In water bodies of the flood-plains of the Ili and Turgen rivers (Alma-Ata district) there were found larvae of Tabanus autumnalis infected with the fungus Metarrhizium anisopliae. Experiments on the infection of T. autumnalis with this fungus yielded 100% mortality of larvae and adult insects. The possibility of creation of an artificial infection nidus under natural conditions was established.

  16. Laboratory bioassays and field-cage trials of Metarhizium spp. isolates with field-collected Mormon crickets (Anabrus simplex)

    USDA-ARS?s Scientific Manuscript database

    The Mormon cricket, Anabrus simplex, is an important pest in the western United States. This study evaluates the virulence of 32 isolates of Metarhizium towards field-collected Mormon crickets. Additionally, several isolates were tested in outdoor field-cage studies. All 32 Metarhizium isolates were...

  17. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    NASA Astrophysics Data System (ADS)

    Bercu, V.; Negut, C. D.; Duliu, O. G.

    2010-12-01

    The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  18. Metarhizium robertsii Produces an Extracellular Invertase (MrINV) That Plays a Pivotal Role in Rhizospheric Interactions and Root Colonization

    PubMed Central

    Liao, Xinggang; Fang, Weiguo; Lin, Liangcai; Lu, Hsiao-Ling; Leger, Raymond J. St.

    2013-01-01

    As well as killing pest insects, the rhizosphere competent insect-pathogenic fungus Metarhizium robertsii also boosts plant growth by providing nitrogenous nutrients and increasing resistance to plant pathogens. Plant roots secrete abundant nutrients but little is known about their utilization by Metarhizium spp. and the mechanistic basis of Metarhizium-plant associations. We report here that M. robertsii produces an extracellular invertase (MrInv) on plant roots. Deletion of MrInv (⊿MrInv) reduced M. robertsii growth on sucrose and rhizospheric exudates but increased colonization of Panicum virgatum and Arabidopsis thaliana roots. This could be accounted for by a reduction in carbon catabolite repression in ⊿MrInv increasing production of plant cell wall-degrading depolymerases. A non-rhizosphere competent scarab beetle specialist Metarhizium majus lacks invertase which suggests that rhizospheric competence may be related to the sugar metabolism of different Metarhizium species. PMID:24205119

  19. Metarhizium robertsii produces an extracellular invertase (MrINV) that plays a pivotal role in rhizospheric interactions and root colonization.

    PubMed

    Liao, Xinggang; Fang, Weiguo; Lin, Liangcai; Lu, Hsiao-Ling; St Leger, Raymond J

    2013-01-01

    As well as killing pest insects, the rhizosphere competent insect-pathogenic fungus Metarhizium robertsii also boosts plant growth by providing nitrogenous nutrients and increasing resistance to plant pathogens. Plant roots secrete abundant nutrients but little is known about their utilization by Metarhizium spp. and the mechanistic basis of Metarhizium-plant associations. We report here that M. robertsii produces an extracellular invertase (MrInv) on plant roots. Deletion of MrInv (ΔMrInv) reduced M. robertsii growth on sucrose and rhizospheric exudates but increased colonization of Panicum virgatum and Arabidopsis thaliana roots. This could be accounted for by a reduction in carbon catabolite repression in ΔMrInv increasing production of plant cell wall-degrading depolymerases. A non-rhizosphere competent scarab beetle specialist Metarhizium majus lacks invertase which suggests that rhizospheric competence may be related to the sugar metabolism of different Metarhizium species.

  20. Isolation of Endohyphal Bacteria from Foliar Ascomycota and In Vitro Establishment of Their Symbiotic Associations

    PubMed Central

    Arendt, Kayla R.; Hockett, Kevin L.; Araldi-Brondolo, Sarah J.; Baltrus, David A.

    2016-01-01

    Endohyphal bacteria (EHB) can influence fungal phenotypes and shape the outcomes of plant-fungal interactions. Previous work has suggested that EHB form facultative associations with many foliar fungi in the Ascomycota. These bacteria can be isolated in culture, and fungi can be cured of EHB using antibiotics. Here, we present methods for successfully introducing EHB into axenic mycelia of strains representing two classes of Ascomycota. We first establish in vitro conditions favoring reintroduction of two strains of EHB (Luteibacter sp.) into axenic cultures of their original fungal hosts, focusing on fungi isolated from healthy plant tissue as endophytes: Microdiplodia sp. (Dothideomycetes) and Pestalotiopsis sp. (Sordariomycetes). We then demonstrate that these EHB can be introduced into a novel fungal host under the same conditions, successfully transferring EHB between fungi representing different classes. Finally, we manipulate conditions to optimize reintroduction in a focal EHB-fungal association. We show that EHB infections were initiated and maintained more often under low-nutrient culture conditions and when EHB and fungal hyphae were washed with MgCl2 prior to reassociation. Our study provides new methods for experimental assessment of the effects of EHB on fungal phenotypes and shows how the identity of the fungal host and growth conditions can define the establishment of these widespread and important symbioses. PMID:26969692

  1. A monograph of Allantonectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, Ascomycota) and their pycnidial, sporodochial, and synnematous anamorphs

    USDA-ARS?s Scientific Manuscript database

    Although Nectria is the type genus of Nectriaceae (Hypocreales, Sordariomycetes, Pezizomycotina, Ascomycota), the systematics of the teleomorphic and anamorphic state of Nectria sensu Rossman has not been studied in detail. The objectives of this study were to 1) provide a phylogenetic overview to d...

  2. Kodamaea ohmeri (Ascomycota: Saccharomycotina) presence in commercial Bombus impatiens Cresson and feral Bombus pensylvanicus DeGeer (Hymenoptera: Apidae) colonies

    USDA-ARS?s Scientific Manuscript database

    In this study, eight commercial and three feral bumble bee (Bombus impatiens Cresson and Bombus pensylvanicus DeGeer respectively, Hymenoptera: Apidae) colonies were tested for the presence of Kodamaea ohmeri (Ascomycota: Saccharomycotina), a yeast known to attract small hive beetles (SHB) (Aethina ...

  3. Genetic basis of destruxin production in the entomopathogen Metarhizium robertsii.

    PubMed

    Giuliano Garisto Donzelli, Bruno; Krasnoff, Stuart B; Moon, Yong-Sun; Sun-Moon, Yong; Churchill, Alice C L; Gibson, Donna M

    2012-04-01

    Destruxins are among the most exhaustively researched secondary metabolites of entomopathogenic fungi, yet definitive evidence for their roles in pathogenicity and virulence has yet to be shown. To establish the genetic bases for the biosynthesis of this family of depsipeptides, we identified a 23,792-bp gene in Metarhizium robertsii ARSEF 2575 containing six complete nonribosomal peptide synthetase modules, with an N-methyltransferase domain in each of the last two modules. This domain arrangement is consistent with the positioning of the adjacent amino acids N-methyl-L: -valine and N-methyl-L: -alanine within the depsipeptide structure of destruxin. DXS expression levels in vitro and in vivo exhibited comparable patterns, beginning at low levels during the early growth phases and increasing with time. Targeted gene knockout using Agrobacterium-mediated transformation produced mutants that failed to synthesize destruxins, in comparison with wild type and ectopic control strains, indicating the involvement of this gene in destruxin biosynthesis. The destruxin synthetase (DXS) disruption mutant was as virulent as the control strain when conidial inoculum was topically applied to larvae of Spodoptera exigua, Galleria mellonella, and Tenebrio molitor indicating that destruxins are dispensable for virulence in these insect hosts. The DXS mutants exhibited no other detectable changes in morphology and development.

  4. Antioxidative Polyketones from the Mangrove-Derived Fungus Ascomycota sp. SK2YWS-L

    PubMed Central

    Tan, Chunbin; Liu, Zhaoming; Chen, Senhua; Huang, Xishan; Cui, Hui; Long, Yuhua; Lu, Yongjun; She, Zhigang

    2016-01-01

    Three novel 2,3-diaryl indone derivatives, ascomindones A−C (1−3), and two new isobenzofuran derivatives, ascomfurans A (4) and B (5), together with four know compounds (6−9) were isolated from the culture of a mangrove-derived fungus Ascomycota sp. SK2YWS-L. Their structures were elucidated on the interpretation of spectroscopic data. 1 and 4 were further constructed by analysis of X-ray diffraction. Antioxidant properties based on 2,2-diphenyl-1-picrylhydrazyl (DPPH), hydroxyl radical scavenging activities and the ferric reducing ability power (FRAP) of the new compounds were assayed. All of them exhibited significant effects, of which 1 showed more potent activity than ascorbic acid in scavenging DPPH radical with IC50 value of 18.1 μM. PMID:27811993

  5. Promising approaches towards biotransformation of polycyclic aromatic hydrocarbons with Ascomycota fungi.

    PubMed

    Aranda, Elisabet

    2016-04-01

    The bioremediation of hazardous aromatic pollutants such as polycyclic aromatic hydrocarbons (PAHs) has been extensively studied in recent decades, including the potential use of different phyla of fungi for this purpose. Molecular technologies are starting to reveal that the real players in polluted environments are mainly represented by the phylum Ascomycota and the subphylum Mucoromycotina and, to a lesser extent, the phylum Basidiomycota. Paradoxically, despite their key involvement, these groups of fungi are often treated as a black box, and their potential roles in the transformation of xenobiotics and catabolic pathways remain poorly understood. The complex intracellular metabolism seems to play a major role in the ability of these fungi to transform or remove PAHs, and their associated enzymes are encoded in the xenome. Functional genomics offers novel information about this enzymatic system, which is widely distributed among all phyla.

  6. Saitoella coloradoensis sp. nov., a new species of the Ascomycota, subphylum Taphrinomycotina.

    PubMed

    Kurtzman, Cletus P; Robnett, Christie J

    2012-05-01

    Saitoella coloradoensis sp. nov. (NRRL YB-2330, CBS 12360, type strain, MycoBank accession number 563858) is described. This new member of the phylum Ascomycota, subphylum Taphrinomycotina was isolated from insect frass occurring in an Engelmann spruce (Picea engelmannii) that was growing in Colorado, USA. Multigene sequence analysis showed that S. coloradoensis is distinct from Saitoella complicata, the only other known species of Saitoella. The two species may be separated phenotypically from growth reactions on D: -xylose, ribitol and methyl-α-D: -glucoside. Asexual reproduction is by budding and both species produce thick-walled, spherical cells that appear morphologically similar to the ascogenous cells formed in plant host tissue by species of Protomyces and some species of Taphrina. The thick-walled cells did not form ascospores but did produce buds when placed on fresh growth media.

  7. An in vivo transcriptome for entomopathogenic fungus Metarhizium robertsii ARSEF 2575

    USDA-ARS?s Scientific Manuscript database

    Molecular mechanisms underlying the pathogenic process of the insect pathogen Metarhizium robertsii ARSEF 2575 in its host are only partially understood. To probe the transcriptional responses of the fungus during the interaction with insects, we have developed a method to specifically recover patho...

  8. Ovicidal activity of Metarhizium brunneum (Mb F52) on dengue fever vector, Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    The ovicidal activity of Metarhizium brunneum F52 (Mb F52) grown from granules was evaluated against Aedes aegypti eggs over time. Survival of larvae from treated eggs was significantly less when compared with untreated eggs at 7, 10 and 14 days post treatment. Only 27 % of treated eggs produced vi...

  9. Metarhizium microsclerotia and hydrogel versus hydromulch: testing fungal formulations against Asian longhorned beetles

    USDA-ARS?s Scientific Manuscript database

    The efficacy of microsclerotia of Metarhizium brunneum (Petch) (Hypocreales: Clavicipitaceae) strain F52 (ARSEF 7711) was tested using samples that had been exposed on forest trees, allowing time for conidia to be produced. An aqueous mixture of microsclerotial granules (61.3% of dry mass), a straw ...

  10. Metacridamides A and B, bioactive macrocycles from conidia of the entomopathogenic fungus Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. Its conidia produce two novel 17-membered macrocycles, metacridamides A (1) and B (2), which consist of a Phe unit condensed with a nonaketide....

  11. New insecticidal antibiotics, hydroxyfungerins A and B, produced by Metarhizium sp. FKI-1079.

    PubMed

    Uchida, Ryuji; Imasato, Rie; Yamaguchi, Yuichi; Masuma, Rokuro; Shiomi, Kazuro; Tomoda, Hiroshi; Omura, Satoshi

    2005-12-01

    New insecticidal antibiotics designated hydroxyfungerins A and B were isolated from the culture broth of a fungal strain Metarhizium sp. FKI-1079 together with a known compound, fungerin. The structures of hydroxyfungerins A and B were elucidated by spectroscopic studies including various NMR experiments. Hydroxyfungerins A and B showed growth inhibitory activity against brine shrimps, Artemia salina.

  12. Microsclerotia of Metarhizium brunneum F52 applied in hydromulch for control of Asian longhorned beetles (Coleoptera: Cerambycidae)

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Metarhizium brunneum (Petch), strain F52 (Hypocreales: Clavicipitaceae) is able to produce environmentally persistent microsclerotia. Incorporating these desiccation-tolerant M. brunneum F52 microsclerotia (Mb MS) granules into hydromulch [a mixture of water + wheat straw...

  13. Evaluating different carriers of Metarhizium brunneum F52 microsclerotia for control of adult Asian longhorned beetles (Coleoptera: Cerambycidae)

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia (MS) of Metarhizium brunneum strain F52 (Hypocreales: Clavicipitaceae), were processed as granules using three carriers: kaolin clay, microcrystalline cellulose (MCC) or diatomaceous earth (DE). In a series of experiments aimed at comparing viable conidial production and subsequent pe...

  14. Virulence of Mexican isolates of entomopathogenic fungi upon Rhipicephalus-Boophilus microplus larvae and the efficacy of conidia formulations to reduce larval tick density under field conditions

    USDA-ARS?s Scientific Manuscript database

    The first objective was laboratory evaluation of the virulence of 53 Mexican isolates of fungi against larvae of Rhipicephalus (Boophilus) microplus. Thirty three isolates of Metarhizium anisopliae var. anisopliae (Metschnickoff) Sorokin (Hypocreales: Clavicipitaceae) and 20 isolates of Isaria (Paec...

  15. Functional Operons in Secondary Metabolic Gene Clusters in Glarea lozoyensis (Fungi, Ascomycota, Leotiomycetes)

    PubMed Central

    Yue, Qun; Chen, Li; Li, Yan; Bills, Gerald F.; Zhang, Xinyu; Xiang, Meichun; Li, Shaojie; Che, Yongsheng; Niu, Xuemei

    2015-01-01

    ABSTRACT Operons are multigene transcriptional units which occur mostly in prokaryotes but rarely in eukaryotes. Protein-coding operons have not been reported in the Fungi even though they represent a very diverse kingdom of organisms. Here, we report a functional operon involved in the secondary metabolism of the fungus Glarea lozoyensis belonging to Leotiomycetes (Ascomycota). Two contiguous genes, glpks3 and glnrps7, encoding polyketide synthase and nonribosomal peptide synthetase, respectively, are cotranscribed into one dicistronic mRNA under the control of the same promoter, and the mRNA is then translated into two individual proteins, GLPKS3 and GLNRPS7. Heterologous expression in Aspergillus nidulans shows that the GLPKS3-GLNRPS7 enzyme complex catalyzes the biosynthesis of a novel pyrrolidinedione-containing compound, xenolozoyenone (compound 1), which indicates the operon is functional. Although it is structurally similar to prokaryotic operons, the glpks3-glnrps7 operon locus has a monophylogenic origin from fungi rather than having been horizontally transferred from prokaryotes. Moreover, two additional operons, glpks28-glnrps8 and glpks29-glnrps9, were verified at the transcriptional level in the same fungus. This is the first report of protein-coding operons in a member of the Fungi. PMID:26081635

  16. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species.

    PubMed

    Kurtzman, Cletus P; Robnett, Christie J

    2013-02-01

    Relationships among ascomycetous yeast genera (subphylum Saccharomycotina, phylum Ascomycota) have been uncertain. In the present study, type species of 70 currently recognized genera are compared from divergence in the nearly entire nuclear gene sequences for large subunit rRNA, small subunit (SSU) rRNA, translation elongation factor-1α, and RNA polymerase II, subunits 1 (RPB1) and 2 (RPB2). The analysis substantiates earlier proposals that all known ascomycetous yeast genera now assigned to the Saccharomycotina represent a single clade. Maximum likelihood analysis resolved the taxa into eight large multigenus clades and four-one- and two-genus clades. Maximum parsimony and neighbor-joining analyses gave similar results. Genera of the family Saccharomycetaceae remain as one large clade as previously demonstrated, to which the genus Cyniclomyces is now assigned. Pichia, Saturnispora, Kregervanrija, Dekkera, Ogataea and Ambrosiozyma are members of a single large clade, which is separate from the clade that includes Barnettozyma, Cyberlindnera, Phaffomyces, Starmera and Wickerhamomyces. Other clades include Kodamaea, Metschnikowia, Debaryomyces, Cephaloascus and related genera, which are separate from the clade that includes Zygoascus, Trichomonascus, Yarrowia and others. This study once again demonstrates that there is limited congruence between a system of classification based on phenotype and a system determined from DNA sequences.

  17. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system.

    PubMed

    Kepler, Ryan M; Ugine, Todd A; Maul, Jude E; Cavigelli, Michel A; Rehner, Stephen A

    2015-08-01

    Fungi in the genus Metarhizium are insect pathogens able to function in other niches, including soil and plant rhizosphere habitats. In agroecosystems, cropping and tillage practices influence soil fungal communities with unknown effects on the distribution of Metarhizium, whose presence can reduce populations of crop pests. We report results from a selective media survey of Metarhizium in soils sampled from a long-term experimental farming project in the mid-Atlantic region. Field plots under soybean cultivation produced higher numbers of Metarhizium colony-forming units (cfu) than corn or alfalfa. Plots managed organically and via chisel-till harboured higher numbers of Metarhizium cfu than no-till plots. Sequence typing of Metarhizium isolates revealed four species, with M. robertsii and M. brunneum predominating. The M. brunneum population was essentially fixed for a single clone as determined by multilocus microsatellite genotyping. In contrast, M. robertsii was found to contain significant diversity, with the majority of isolates distributed between two principal clades. Evidence for recombination was observed only in the most abundant clade. These findings illuminate multiple levels of Metarhizium diversity that can be used to inform strategies by which soil Metarhizium populations may be manipulated to exert downward pressure on pest insects and promote plant health.

  18. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex

    USDA-ARS?s Scientific Manuscript database

    A wild, forest-dwelling cockroach from the subfamily Ectobiidae (order Blattodea) in a nature reserve in Cavalcante, in the state of Goias, Brazil, was found to be infected by a new, genetically distinct species in the Metarhizium flavoviride species complex that we describe here as Metarhizium blat...

  19. Production of Destruxins from Metarhizium spp. Fungi in Artificial Medium and in Endophytically Colonized Cowpea Plants

    PubMed Central

    Golo, Patrícia S.; Gardner, Dale R.; Grilley, Michelle M.; Takemoto, Jon Y.; Krasnoff, Stuart B.; Pires, Marcus S.; Fernandes, Éverton K. K.; Bittencourt, Vânia R. E. P.; Roberts, Donald W.

    2014-01-01

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E produced by these same isolates in submerged (shaken) cultures. Eight of the isolates (ARSEF 324, 724, 760, 1448, 1882, 1883, 3479, and 3918) did not produce DTXs A, B, or E during the five days of submerged culture. DTXs were first detected in culture medium at 2–3 days in submerged culture. Galleria mellonella and Tenebrio molitor showed considerable variation in their susceptibility to the Metarhizium isolates. The concentration of DTXs produced in vitro did not correlate with percent or speed of insect kill. We established endophytic associations of M. robertsii and M. acridum isolates in Vigna unguiculata (cowpeas) and Cucumis sativus (cucumber) plants. DTXs were detected in cowpeas colonized by M. robertsii ARSEF 2575 12 days after fungal inoculation, but DTXs were not detected in cucumber. This is the first instance of DTXs detected in plants endophytically colonized by M. robertsii. This finding has implications for new approaches to fungus-based biological control of pest arthropods. PMID:25127450

  20. Molecular analysis reveals two new dimorphic species of Hesperomyces (Ascomycota, Laboulbeniomycetes) parasitic on the ladybird Coleomegilla maculata (Coleoptera, Coccinellidae).

    PubMed

    Goldmann, Lauren; Weir, Alex; Rossi, Walter

    2013-01-01

    Four morphotypes of Hesperomyces (Ascomycota, Laboulbeniomycetes) were found on the ladybird Coleomegilla maculata (Coleoptera, Coccinellidae) from Costa Rica and Ecuador. Partial SSU and ITS rDNA sequence analysis revealed that these belong to two phylogenetic species, each with a pair of morphotypes displaying position specificity. Confirmation of dimorphism in Laboulbeniales highlights the need for a thorough systematic revision of species concepts within the order. The theory of 'position specificity' also needs to be revisited. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  1. Resistant ticks inhibit Metarhizium infection prior to hemocoel invasion by reducing fungal viability on the cuticle surface

    USDA-ARS?s Scientific Manuscript database

    We studied disease progression of, and host responses to, four species in the M. anisopliae complex expressing green fluorescent protein (GFP). We compared development and determined their relative levels of virulence against two susceptible arthropods, the cattle tick Rhipicephalus annulatus and th...

  2. [Role of G-protein alpha sub-units in the morphogenic processes of filamentous Ascomycota fungi].

    PubMed

    García-Rico, Ramón O; Fierro, Francisco

    The phylum Ascomycota comprises about 75% of all the fungal species described, and includes species of medical, phytosanitary, agricultural, and biotechnological importance. The ability to spread, explore, and colonise new substrates is a feature of critical importance for this group of organisms. In this regard, basic processes such as conidial germination, the extension of hyphae and sporulation, make up the backbone of development in most filamentous fungi. These processes require specialised morphogenic machinery, coordinated and regulated by mechanisms that are still being elucidated. In recent years, substantial progress has been made in understanding the role of the signalling pathway mediated by heterotrimericG proteins in basic biological processes of many filamentous fungi. This review focuses on the role of the alpha subunits of heterotrimericG proteins in the morphogenic processes of filamentous Ascomycota. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  3. Draft Genome Sequence of Phaeomoniella chlamydospora Strain RR-HG1, a Grapevine Trunk Disease (Esca)-Related Member of the Ascomycota

    PubMed Central

    Antonielli, Livio; Compant, Stéphane; Strauss, Joseph; Sessitsch, Angela

    2014-01-01

    The Ascomycota species Phaeomoniella chlamydospora, in concert with other fungi, is a causal agent for grapevine trunk diseases. Here, we present the first draft of the P. chlamydospora genome sequence, which comprises 355 scaffolds, with a total length of 26.59 Mb and 7,279 predicted protein-coding genes. PMID:24723699

  4. Draft Genome Sequence of Phaeomoniella chlamydospora Strain RR-HG1, a Grapevine Trunk Disease (Esca)-Related Member of the Ascomycota.

    PubMed

    Antonielli, Livio; Compant, Stéphane; Strauss, Joseph; Sessitsch, Angela; Berger, Harald

    2014-04-10

    The Ascomycota species Phaeomoniella chlamydospora, in concert with other fungi, is a causal agent for grapevine trunk diseases. Here, we present the first draft of the P. chlamydospora genome sequence, which comprises 355 scaffolds, with a total length of 26.59 Mb and 7,279 predicted protein-coding genes.

  5. The Ascomycota tree of life: a phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits

    Treesearch

    C.L. Schoch; G.-H. Sung; F. Lopez-Giraldez

    2009-01-01

    We present a six-gene, 420-species maximum-likelihood phylogeny of Ascomycota, the largest phylum of fungi. This analysis is the most taxonomically complete to date with species sampled from all 15 currently circumscribed classes. A number of superclass-level nodes that have previously evaded resolution and were unnamed in classifications of the fungi are resolved for...

  6. Wingnut (Juglandaceae) as a new generic host for Pityophthorus juglandis (Coleoptera: Curculionidae) and the thousand cankers disease pathogen, Geosmithia morbida (Ascomycota: Hypocreales)

    Treesearch

    Stacy M. Hishinuma; Paul L. Dallara; Mohammad A. Yaghmour; Marcelo M. Zerillo; Corwin M. Parker; Tatiana V. Roubtsova; Tivonne L. Nguyen; Ned A. Tisserat; Richard M. Bostock; Mary L. Flint; Steven J. Seybold

    2016-01-01

    The walnut twig beetle (WTB), Pityophthorus juglandis Blackman (Coleoptera: Curculionidae), vectors a fungus, Geosmithia morbida Kolarík, Freeland, Utley, and Tisserat (Ascomycota: Hypocreales), which colonises and kills the phloem of walnut and butternut trees, Juglans Linnaeus (Juglandaceae). Over the...

  7. Conidial production, persistence and pathogenicity of hydromulch formulations of Metarhizium brunneum F52 microsclerotia under forest conditions

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia granules of Metarhizium brunneum Petch strain F52 (Hypocreales: Clavicipitaceae) in hydromulch (water, wheat straw, and tackifier) were sprayed onto bark or wood samples during two spray trials in 2013 and six spray trials in 2014. Microsclerotial granules in hydromulch continued to p...

  8. Effect of fermentation media on the production, efficacy and storage stability of Metarhizium brunneum microsclerotia formulated as a prototype granule

    USDA-ARS?s Scientific Manuscript database

    New liquid fermentation techniques for the production of the bioinsecticidal fungus Metarhizium brunneum strain F-52 have resulted in the formation of microsclerotia (MS), a compact, melonized-hyphal structure capable of surviving desiccation and formulation as dry granules. When rehydrated, these M...

  9. Specific diversity of the entomopathogenic fungi Beauveria and Metarhizium in Mexican agricultural soils.

    PubMed

    Pérez-González, Víctor H; Guzmán-Franco, Ariel W; Alatorre-Rosas, Raquel; Hernández-López, Jorge; Hernández-López, Antonio; Carrillo-Benítez, María G; Baverstock, Jason

    2014-06-01

    Prior knowledge of the local population structure of entomopathogenic fungi is considered an important requisite when developing microbial control strategies against major pests of crops such as white grubs. An extensive survey in the estate of Guanajuato, one of the main agricultural regions of Mexico, was carried out to determine the abundance and diversity of entomopathogenic fungi in soil. Soil collected from 11 locations was baited for entomopathogenic fungi using Galleria mellonella. In addition, all isolates were morphologically identified and selected isolates of Beauveria and Metarhizium isolates identified using Bloc and ITS or Elongation Factor 1-α and ITS sequence information respectively. Genotypic diversity was then studied using microsatellite genotyping. The proportion of isolates belonging to each genus varied amongst all locations. The species Beauveria bassiana, B. pseudobassiana and Metarhizium robertsii were found, with B. bassiana being the most abundant and widely distributed. Microsatellite genotyping showed that the 36 B. bassiana isolates were grouped in 29 unique haplotypes, but with no separation according to geographical origin.

  10. Dosage response mortality of Japanese beetle, masked chafer, and June beetle (Coleoptera: Scarabaeidae) adults when exposed to experimental and commercially available granules containing Metarhizium brunneum

    USDA-ARS?s Scientific Manuscript database

    Adult beetles of three different white grub species, Japanese beetle, Popillia japonica, June beetle, Phyllophaga spp., and masked chafer, Cyclocephala spp. were exposed to experimental and commercially available granules containing Metarhizium brunneum (Petch) strain F52, to determine susceptibilit...

  11. First and southernmost records of Hirsutella (Ascomycota: Hypocreales) and Pandora (Zygomycota: Entomophthorales) species infecting Dermaptera and Psocodea.

    PubMed

    Toledo, A V; Humber, R A; Lastra, C C López

    2008-02-01

    We present the first and southernmost records of the fungi Hirsutella strigosa Petch, H. citriformis Speare (Ascomycota: Hypocreales), and Pandora nouryi (Remaudière & Hennebert) Humber (Zygomycota: Entomophthorales) infecting Doru lineare (Eschscholtz) (Dermaptera: Forficulidae), Ectopsocus californicus (Banks) (Psocodea: Ectopsocidae), and Heterocaecilius sp. (Psocodea: Pseudocaeciliidae), respectively. This is the first report of naturally occurring pathogenic fungi infecting Psocoptera, and it is also the first report of P. nouryi from any host outside of the Aphididae. The three fungal species were morphologically described from their host insects and from microscopic preparations. Attempts to obtain pure fungal isolates were unsuccessful but slides and photographs of these fungi were preserved and deposited in mycological collections as herbarium material.

  12. Exposure of Metarhizium acridum mycelium to light induces tolerance to UV-B radiation.

    PubMed

    Brancini, Guilherme T P; Rangel, Drauzio E N; Braga, Gilberto Ú L

    2016-03-01

    Metarhizium acridum is an entomopathogenic fungus commonly used as a bioinsecticide. The conidium is the fungal stage normally employed as field inoculum in biological control programs and must survive under field conditions such as high ultraviolet-B (UV-B) exposure. Light, which is an important stimulus for many fungi, has been shown to induce the production of M. robertsii conidia with increased stress tolerance. Here we show that a two-hour exposure to white or blue/UV-A light of fast-growing mycelium induces tolerance to subsequent UV-B irradiation. Red light, however, does not have the same effect. In addition, we established that this induction can take place with as little as 1 min of white-light exposure. This brief illumination scheme could be relevant in future studies of M. acridum photobiology and for the production of UV-B resistant mycelium used in mycelium-based formulations for biological control.

  13. A strong promoter, PMagpd, provides a tool for high gene expression in entomopathogenic fungus, Metarhizium acridum.

    PubMed

    Cao, Yueqing; Jiao, Run; Xia, Yuxian

    2012-03-01

    A glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter (PMagpd) was obtained from Metarhizium acridum and its active region analyzed by 5'-deletion strategy using β-glucuronidase (GUS) as a reporter. Sequence analysis revealed that typical regulatory elements of PMagpd were included in the 1.7 kb region upstream of the start codon of the Magpd gene. Deletion of the region from -1,691 bp to -1,463 bp, where the gpd box is harbored, did not significantly affect the PMagpd activity. Deletions of the regions upstream of -946 bp and upstream of -684 bp caused a major decrease of GUS activity. Compared with PgpdA (2.2 kb) in Aspergillus nidulans, PMagpd (1.4 kb) had a shorter sequence and significantly higher activity in M. acridum. This study provides an applicable promoter for over-expression of target genes in M. acridum.

  14. Agrobacterium-Mediated Co-transformation of Multiple Genes in Metarhizium robertsii

    PubMed Central

    Bidochka, Michael J.

    2017-01-01

    Fungi of the Metarhizium genus are a very versatile model for understanding pathogenicity in insects and their symbiotic relationship with plants. To establish a co-transformation system for the transformation of multiple M. robertsii genes using Agrobacterium tumefaciens, we evaluated whether the antibiotic nourseothricin has the same marker selection efficiency as phosphinothricin using separate vectors. Subsequently, in the two vectors containing the nourseothricin and phosphinothricin resistance cassettes were inserted eGFP and mCherry expression cassettes, respectively. These new vectors were then introduced independently into A. tumefaciens and used to transform M. robertsii either in independent events or in one single co-transformation event using an equimolar mixture of A. tumefaciens cultures. The number of transformants obtained by co-transformation was similar to that obtained by the individual transformation events. This method provides an additional strategy for the simultaneous insertion of multiple genes into M. robertsii. PMID:28781540

  15. Insecticidal Activity of a Destruxin-Containing Extract of Metarhizium brunneum Against Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Lozano-Tovar, M D; Garrido-Jurado, I; Lafont, F; Quesada-Moraga, E

    2015-04-01

    Tephritid fruit flies are major pests that limit fruit production around the world; they cause important damages, increasing directly and indirectly annual costs, and their management is predominately based on the use of chemical insecticides. This research investigated the insecticidal activity of the crude extract obtained of Metarhizium brunneum Petch EAMb 09/01-Su strain and its capacity to secrete secondary metabolites including destruxins (dtx). Dtx A and A2 had insecticidal activity against Ceratitis capitata (Wiedemann) when administered per os. The crude extract of seven Metarhizium and one Beauveria isolates were evaluated per os against medfly adults. The crude extracts of the isolate EAMb 09/01-Su resulted in mortality ranging between 95 and 100% at 48 h. The high-pressure liquid chromatography profile showed two active peaks (F5B and F6 subfractions) related with dtx A2 and dtx A, which caused 70 and 100% mortality on C. capitata at 48 h postfeeding, respectively. The LC50 was 104.92 ppm of dtx A, contained in the F6 subfraction, and the LT50 was 4.16 h at a concentration of 400 ppm of dtx A contained in the F6 subfraction. Moreover, the average survival time of adults exposed to this subfraction was 12.6 h with only 1 h of exposure. The insecticide metabolites of the F6 subfraction of the EAMb 09/01-Su isolate retained >90% of its insecticidal activity after exposure to 60°C for 2 h and 120°C for 20 min. These results highlight the potential of this strain as a source of new insecticidal compounds of natural origin for fruit fly control.

  16. Variability in the insect and plant adhesins, Mad1 and Mad2, within the fungal genus metarhizium suggest plant adaptation as an evolutionary force.

    PubMed

    Wyrebek, Michael; Bidochka, Michael J

    2013-01-01

    Several species of the insect pathogenic fungus Metarhizium are associated with certain plant types and genome analyses suggested a bifunctional lifestyle; as an insect pathogen and as a plant symbiont. Here we wanted to explore whether there was more variation in genes devoted to plant association (Mad2) or to insect association (Mad1) overall in the genus Metarhizium. Greater divergence within the genus Metarhizium in one of these genes may provide evidence for whether host insect or plant is a driving force in adaptation and evolution in the genus Metarhizium. We compared differences in variation in the insect adhesin gene, Mad1, which enables attachment to insect cuticle, and the plant adhesin gene, Mad2, which enables attachment to plants. Overall variation for the Mad1 promoter region (7.1%), Mad1 open reading frame (6.7%), and Mad2 open reading frame (7.4%) were similar, while it was higher in the Mad2 promoter region (9.9%). Analysis of the transcriptional elements within the Mad2 promoter region revealed variable STRE, PDS, degenerative TATA box, and TATA box-like regions, while this level of variation was not found for Mad1. Sequences were also phylogenetically compared to EF-1α, which is used for species identification, in 14 isolates representing 7 different species in the genus Metarhizium. Phylogenetic analysis demonstrated that the Mad2 phylogeny is more congruent with 5' EF-1α than Mad1. This would suggest that Mad2 has diverged among Metarhizium lineages, contributing to clade- and species-specific variation, while it appears that Mad1 has been largely conserved. While other abiotic and biotic factors cannot be excluded in contributing to divergence, these results suggest that plant relationships, rather than insect host, have been a major driving factor in the divergence of the genus Metarhizium.

  17. Disentangling the Collema-Leptogium complex through a molecular phylogenetic study of the Collemataceae (Peltigerales, lichen-forming Ascomycota).

    PubMed

    Otálora, Mónica A G; Aragón, Gregorio; Molina, M Carmen; Martínez, Isabel; Lutzoni, François

    2010-01-01

    Family Collemataceae (Peltigerales, Ascomycota) includes species of cyanolichens with foliose to fruticose or crustose thalli, with simple or septate ascospores. The current classification divides this family into two groups on the basis of ascospore types. The objective of this study was to evaluate the phylogenetic relationships within this family. Combined DNA sequence data from the nuclear large subunit and mitochondrial small subunit ribosomal RNA genes were used to evaluate monophyly of the family and the relationships between the largest genera of this family. The results revealed that this family is not monophyletic. Genera Staurolemma and Physma, currently classified within the Collemataceae, were found nested within the Pannariaceae. The second result of this study confirms that the genera Collema and Leptogium, both part of the Collemataceae s. str., are not monophyletic and that the presence of a thallus cortex is not a synapomorphy for Leptogium. The main taxonomic conclusion is that families Collemataceae and Pannariaceae were recircumscribed in light of molecular findings with the latter family now including Staurolemma and Physma. Genera Collema and Leptogium form a single mixed monophyletic group. Inferred ancestral character states within the Collema-Leptogium complex revealed that the ancestor of this family had a thallus without cortex and that a cortex evolved at least twice relatively early in the evolution of the Collemataceae s. str. These independent gains of a thallus cortex seems to be associated with a transition from colonizing bare rocks and soils in semi-arid and exposed habitats to epiphytism in shady humid forests.

  18. Seasonality of Laboulbenia phaeoxanthae (Ascomycota, Laboulbeniales) and its host Phaeoxantha aequinoctialis (Coleoptera, Carabidae) at a central Amazonian blackwater floodplain.

    PubMed

    Zerm, Matthias; Adis, Joachim

    2004-05-01

    Terrestrial invertebrates in central Amazonian floodplains must cope with annual long-term inundation. Parasites should be affected mainly indirectly through the specific life-cycles of their hosts. We studied the temporal structure of a beetle-fungus system at a central Amazonian blackwater floodplain (Rio Negro, Brazil). The host species Phaeoxantha aequinoctialis (Coleoptera, Carabidae, Cicindelinae) showed a seasonal, univoltine life-cycle triggered by the annual flood pulse. Infestation frequency of its fungal parasite, Laboulbenia phaeoxanthae (Ascomycota, Laboulbeniales), varied seasonally. However, the seasonality was opposed in host and parasite: the lowest infestation frequencies were observed during periods of highest beetle abundance and vice versa. Periods of lowest beetle abundance coincided with the end of the old generation, those with highest abundance with the appearance of new adults. The resulting annual patterns of a slow spread in the host population resembled the few records of temporal patterns from temperate regions. It is explicitly demonstrated that older adult female beetles are more frequently infested than younger ones. Future studies may reveal whether this is simply the result of specific host life-cycles (driven by a flood pulse, winter, or other factors), or might also be related to potentially easier infestation in older individuals.

  19. Ultrastructural and cytochemical characterization of brown soft scale Coccus hesperidum (Hemiptera: Coccidae) infected by the Lecanicillium lecanii (Ascomycota: Hypocreales).

    PubMed

    Liu, Weimin; Xie, Yingping; Xue, Jiaoliang; Zhang, Yanfeng; Zhang, Xiaomin

    2011-01-01

    The ultrastructural and cytochemical characterization of the brown soft scale, Coccus hesperidum L. (Hemiptera: Coccidae) infected by the hyphomycete Lecanicillium lecanii (Zimmermann) Gams & Zare, belonging to the phylum Ascomycota and order Hypocreales, was investigated by light, scanning and transmission electron microscopy. Gold cytochemistry was used to label chitin in the cuticle of the scale insect. The results revealed that the pathogenic fungus, L. lecanii generally infected by penetrating the integument, especially at anus, vulva, spiracles, stigmatic furrow, body margin, and the areas of cuticle with grooves, fissures and rugoses areas. The conidia became attached to the host body surface and germinated into hyphae that established colonies by branching repeatedly. Hyphae penetrated the integument by means of their penetration pegs using mechanical force and extracellular enzymes. During integument penetration, the hyphae extended vertically or parallel along the cuticle. Labeling with the WGA/Ovo-G complex showed disruption of the parallel sheets of chitin and a decrease in the density of the gold particles surrounding the penetrated hyphae. Hyphal invasion also separated the cuticle and epidermis from each other. Once in the haemocoele, blastospores of the fungus infected the haemocytes and internal organs. After some time, the nutritive value of the haemocoele decreased and the insect's internal organs disappeared. The hyphae then produced conidiophores and released them through the cuticle of the scale insect cadaver.

  20. Histopathological effects of Aspergillus clavatus (Ascomycota: Trichocomaceae) on larvae of the southern house mosquito, Culex quinquefasciatus (Diptera: Culicidae).

    PubMed

    Bawin, Thomas; Seye, Fawrou; Boukraa, Slimane; Zimmer, Jean-Yves; Raharimalala, Fara Nantenaina; Ndiaye, Mady; Compere, Philippe; Delvigne, Frank; Francis, Frédéric

    2016-04-01

    Aspergillus clavatus (Ascomycota: Trichocomaceae) was previously found to be an opportunistic pathogen of mosquitoes (Diptera: Culicidae). In the present study, the mechanism leading to its insecticidal activity was investigated regarding histological damages on Culex quinquefasciatus larvae exposed to A. clavatus spores. Multiple concentration assays using spore suspensions (0.5-2.5 × 10(8) spores ml(-1)) revealed 17.0-74.3 % corrected mortalities after 48 h exposure. Heat-deactivated spores induced a lower mortality compared to nonheated spores suggesting that insecticidal effects are actively exerted. Spore-treated and untreated larvae were prepared for light microscopy as well as for scanning and transmission electron microscopy. Spores failed to adhere to the external body surface (except the mouth parts) of these aquatic immature stages but progressively filled the digestive tract where their metabolism seemed to activate. In parallel, the internal tissues of the larvae, i.e. the midgut wall, the skeletal muscles, and the cuticle-secreting epidermis, were progressively destroyed between 8 and 24 h of exposure. These observations suggest that toxins secreted by active germinating spores of A. clavatus in the digestive tract altered the larval tissues, leading to their necrosis and causing larval death. Fungal proliferation and sporulation then occurred during a saprophytic phase. A. clavatus enzymes or toxins responsible for these pathogenic effects need to be identified in further studies before any use of this fungus in mosquito control.

  1. Explaining mycoinsecticide activity: poor performance of spray and bait formulations of Beauveria bassiana and Metarhizium brunneum against Mormon cricket in field cage studies

    USDA-ARS?s Scientific Manuscript database

    Our objectives were threefold: (1) to evaluate B. bassiana GHA and M. anisopliae F52 for potential use against Mormon cricket (Anabrus simplex Haldeman); (2) to compare spray and bait formulations of each fungus against immature and adult Mormon cricket; and (3) to understand the effect of optimal a...

  2. Wright-Giemsa staining to observe phagocytes in Locusta migratoria infected with Metarhizium acridum.

    PubMed

    Yu, Ying; Cao, Yueqing; Xia, Yuxian; Liu, Feihong

    2016-09-01

    Hemocytes are the first line of defense in the invertebrate immune system. Understanding their roles in cellular immunity is important for developing more efficient mycoinsecticides. However, the exact classification of hemocytes has been inconsistent and the various types of phagocytes in Locusta migratoria are poorly defined. Herein, the Wright-Giemsa staining method and microscopy were employed to characterize the hemocytes of L. migratoria following infection by Metarhizium acridum. Hemocytes were classified into four types, including granulocytes, plasmatocytes, prohemocytes, and oenocytoids, based on size, morphology, and dye-staining properties. Each type of hemocyte was classified into several subtypes according to different ultrastructural features. At least four subtypes of granulocytes or plasmatocytes, including small-nucleus plasmatocytes, basophil vacuolated plasmatocytes, homogeneous plasmatocytes, and eosinophilic granulocytes, carried out phagocytosis. The percentage of total phagocytes increased two days after infection by M. acridum, then gradually declined during the next two days, and then increased sharply again at the fifth day. Our data suggested that plasmatocytes and granulocytes may be the major phagocytes that protect against invasion by a fungal pathogen in L. migratoria. Total hemocytes in locusts significantly increased in the initial days after infection and decreased in the late period of infection compared to controls. In the hemocoel, hyphal bodies were recognized, enwrapped, and digested by the phagocytes. Then, the broken hyphal pieces were packaged as vesicles to be secreted from the cell. Moreover, locusts might have a sensitive and efficient cellular immune system that can regulate phagocyte differentiation and proliferation before fungi colonize the host hemolymph.

  3. MrSkn7 Controls Sporulation, Cell Wall Integrity, Autolysis, and Virulence in Metarhizium robertsii

    PubMed Central

    Shang, Yanfang; Chen, Peilin; Chen, Yixiong; Lu, Yuzhen

    2015-01-01

    Two-component signaling pathways generally include sensor histidine kinases and response regulators. We identified an ortholog of the response regulator protein Skn7 in the insect-pathogenic fungus Metarhizium robertsii, which we named MrSkn7. Gene deletion assays and functional characterizations indicated that MrSkn7 functions as a transcription factor. The MrSkn7 null mutant of M. robertsii lost the ability to sporulate and had defects in cell wall biosynthesis but was not sensitive to oxidative and osmotic stresses compared to the wild type. However, the mutant was able to produce spores under salt stress. Insect bioassays using these spores showed that the virulence of the mutant was significantly impaired compared to that of the wild type due to the failures to form the infection structure appressorium and evade host immunity. In particular, deletion of MrSkn7 triggered cell autolysis with typical features such as cell vacuolization, downregulation of repressor genes, and upregulation of autolysis-related genes such as extracellular chitinases and proteases. Promoter binding assays confirmed that MrSkn7 could directly or indirectly control different putative target genes. Taken together, the results of this study help us understand the functional divergence of Skn7 orthologs as well as the mechanisms underlying the development and control of virulence in insect-pathogenic fungi. PMID:25710964

  4. Ametryn removal by Metarhizium brunneum: Biodegradation pathway proposal and metabolic background revealed.

    PubMed

    Szewczyk, Rafał; Kuśmierska, Anna; Bernat, Przemysław

    2017-10-03

    Ametryn is a representative of a class of s-triazine herbicides absorbed by plant roots and leaves and characterized as a photosynthesis inhibitor. It is still in use in some countries in the farming of pineapples, soybean, corn, cotton, sugar cane or bananas; however, due to the adverse effects of s-triazine herbicides on living organisms use of these pesticides in the European Union has been banned. In the current study, we characterized the biodegradation of ametryn (100 mg L(-1)) by entomopathogenic fungal cosmopolite Metarhizium brunneum. Ametryn significantly inhibited the growth and glucose uptake in fungal cultures. The concentration of the xenobiotic drops to 87.75 mg L(-1) at the end of culturing and the biodegradation process leads to formation of four metabolites: 2-hydroxy atrazine, ethyl hydroxylated ametryn, S-demethylated ametryn and deethylametryn. Inhibited growth is reflected in the metabolomics data, where significant differences in concentrations of L-proline, gamma-aminobutyric acid, L-glutamine, 4-hydroxyproline, L-glutamic acid, ornithine and L-arginine were observed in the presence of the xenobiotic when compared to control cultures. The metabolomics data demonstrated that the presence of ametryn in the fungal culture induced oxidative stress and serious disruptions of the carbon and nitrogen metabolism. Our results provide deeper insights into the microorganism strategy for xenobiotic biodegradation which may result in future enhancements to ametryn removal by the tested strain. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Genome-wide identification of pathogenicity, conidiation and colony sectorization genes in Metarhizium robertsii.

    PubMed

    Zeng, Guohong; Chen, Xiaoxuan; Zhang, Xing; Zhang, Qiangqiang; Xu, Chuan; Mi, Wubin; Guo, Na; Zhao, Hong; You, Yue; Dryburgh, Farah-Jade; Bidochka, Michael J; St Leger, Raymond J; Zhang, Lei; Fang, Weiguo

    2017-04-26

    Metarhizium robertsii occupies a wide array of ecological niches and has diverse lifestyle options (saprophyte, insect pathogen and plant symbiont), that renders it an unusually effective model for studying genetic mechanisms for fungal adaptation. Here over 20,000 M. robertsii T-DNA mutants were screened in order to elucidate genetic mechanism by which M. robertsii replicates and persists in diverse niches. About 287 conidiation, colony sectorization or pathogenicity loci, many of which have not been reported in other fungi were identified. By analysing a series of conidial pigmentation mutants, a new fungal pigmentation gene cluster, which contains Mr-Pks1, Mr-EthD and Mlac1 was identified. A conserved conidiation regulatory pathway containing Mr-BrlA, Mr-AbaA and Mr-WetA regulates expression of these pigmentation genes. During conidiation Mr-BlrA up-regulates Mr-AbaA, which in turn controls Mr-WetA. It was found that Hog1-MAPK regulates fungal conidiation by controlling the conidiation regulatory pathway, and that all three pigmentation genes exercise feedback regulation of conidiation. This work provided the foundation for deeper understanding of the genetic processes behind M. robertsii adaptive phenotypes, and advances our insights into conidiation and pigmentation in this fungus. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Host range and diversity of the genus Geosmithia (Ascomycota: Hypocreales) living in association with bark beetles in the Mediterranean area.

    PubMed

    Kolarík, Miroslav; Kostovcík, Martin; Pazoutová, Sylvie

    2007-11-01

    Geosmithia spp. (Ascomycota: Hypocreales) are dry-spored fungi that occur in galleries built by many phloeophagous bark beetles. This study mapped the diversity, host spectrum and area of distribution of Geosmithia spp. occurring in galleries of bark beetle species with a Mediterranean distribution. Eighty-six wood samples of 19 tree species infested by 18 subcortical insect species were collected from across the Mediterranean Basin during the years 2003-2006. Geosmithia spp. were found in 82 samples of angiosperms and two host trees from the family Juniperaceae infested by 14 bark beetles and the bostrichid Scobicia pustulata, suggesting that the association of Geosmithia and phloeophagous bark beetles is very widespread in the Mediterranean. Geosmithia isolates were sorted into 13 operational taxonomic units (OTUs) based on their phenotype similarity and phylogeny of their ITS regions of rDNA (ITS1-5.8S-ITS2). The OTUs represent five known species (G. flava, G. langdonii, G. lavendula, G. pallida, G. putterillii) and seven undescribed taxa. Most of the bark beetles were associated with on average 1-2.5 OTUs per sample. G. lavendula, considered very uncommon in nature, was found as a common associate of bark beetles. Six out of 13 OTUs were found to be distributed in the Mediterranean but not in neighbouring areas of temperate Europe suggesting that Geosmithia spp. have a geographically limited distribution, probably due to their dependency on the geographically limited area of their vectors. The proportion of generalists and specialists among Geosmithia spp. was smaller compared with data from temperate Europe. A possible explanation is the effective dispersal of Geosmithia by polyphagous bostrichids across the niches defined by mutually exclusive bark beetles.

  7. New molecular markers for fungal phylogenetics: two genes for species-level systematics in the Sordariomycetes (Ascomycota).

    PubMed

    Walker, Donald M; Castlebury, Lisa A; Rossman, Amy Y; White, James F

    2012-09-01

    Although significant progress has been made resolving deep branches of the fungal tree of life, many fungal systematists are interested in species-level questions to both define species and assess fungal biodiversity. Fungal genome sequences are a useful resource to systematic biologists for developing new phylogenetic markers that better represent the whole genome. Here we report primers for two newly identified single-copy protein-coding genes, FG1093 and MS204, for use with ascomycetes. Although fungi were the focus of this study, this methodological approach could be easily applied to marker development for studies of other organisms. The tests used here to assess phylogenetic informativeness are computationally rapid, require only rudimentary datasets to evaluate existing or newly developed markers, and can be applied to other non-model organisms to assist in experimental design of phylogenetic studies. Phylogenetic utility of the markers was tested in two genera, Gnomoniopsis and Ophiognomonia (Gnomoniaceae, Diaporthales). The phylogenetic performance of β-tubulin, ITS, and tef-1α was compared with FG1093 and MS204. Phylogenies inferred from FG1093 and MS204 were largely in agreement with β-tubulin, ITS, and tef-1α although some topological conflict was observed. Resolution and support for branches differed based on the combination of markers used for each genus. Based on two independent tests of phylogenetic performance, FG1093 and MS204 were determined to be equal to or better than β-tubulin, ITS, and tef-1α in resolving species relationships. Differences were found in site-specific rate of evolution in all five markers. In addition, isolates from 15 orders and 22 families of Ascomycota were screened using primers for FG1093 and MS204 to demonstrate primer utility across a wide diversity of ascomycetes. The primer sets for the newly identified genes FG1093 and MS204 and methods used to develop them are useful additions to the ascomycete systematists

  8. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in adult bumble bees.

    PubMed

    Maxfield-Taylor, Sarah A; Mujic, Alija B; Rao, Sujaya

    2015-01-01

    Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  9. First Detection of the Larval Chalkbrood Disease Pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in Adult Bumble Bees

    PubMed Central

    Maxfield-Taylor, Sarah A.; Mujic, Alija B.; Rao, Sujaya

    2015-01-01

    Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen. PMID:25885679

  10. Miocene and Pliocene dominated diversification of the lichen-forming fungal genus Melanohalea (Parmeliaceae, Ascomycota) and Pleistocene population expansions

    PubMed Central

    2012-01-01

    Background Factors promoting diversification in lichen symbioses remain largely unexplored. While Pleistocene events have been important for driving diversification and affecting distributions in many groups, recent estimates suggest that major radiations within some genera in the largest clade of macrolichens (Parmeliaceae, Ascomycota) vastly predate the Pleistocene. To better understand the temporal placement and sequence of diversification events in lichens, we estimated divergence times in a common lichen-forming fungal genus, Melanohalea, in the Northern Hemisphere. Divergence times were estimated using both concatenated gene tree and coalescent-based multilocus species tree approaches to assess the temporal context of major radiation events within Melanohalea. In order to complement our understanding of processes impacting genetic differentiation, we also evaluated the effects of Pleistocene glacial cycles on population demographics of distinct Melanohalea lineages, differing in reproductive strategies. Results We found that divergence estimates, from both concatenated gene tree and coalescent-based multilocus species tree approaches, suggest that diversification within Melanohalea occurred predominantly during the Miocene and Pliocene, although estimated of divergence times differed by up to 8.3 million years between the two methods. These results indicate that, in some cases, taxonomically diagnostic characters may be maintained among divergent lineages for millions of years. In other cases, similar phenotypic characters among non-sister taxa, including reproductive strategies, suggest the potential for convergent evolution due to similar selective pressures among distinct lineages. Our analyses provide evidence of population expansions predating the last glacial maximum in the sampled lineages. These results suggest that Pleistocene glaciations were not inherently unfavorable or restrictive for some Melanohalea species, albeit with apparently different

  11. Origin and diversification of major clades in parmelioid lichens (Parmeliaceae, Ascomycota) during the Paleogene inferred by Bayesian analysis.

    PubMed

    Amo de Paz, Guillermo; Cubas, Paloma; Divakar, Pradeep K; Lumbsch, H Thorsten; Crespo, Ana

    2011-01-01

    There is a long-standing debate on the extent of vicariance and long-distance dispersal events to explain the current distribution of organisms, especially in those with small diaspores potentially prone to long-distance dispersal. Age estimates of clades play a crucial role in evaluating the impact of these processes. The aim of this study is to understand the evolutionary history of the largest clade of macrolichens, the parmelioid lichens (Parmeliaceae, Lecanoromycetes, Ascomycota) by dating the origin of the group and its major lineages. They have a worldwide distribution with centers of distribution in the Neo- and Paleotropics, and semi-arid subtropical regions of the Southern Hemisphere. Phylogenetic analyses were performed using DNA sequences of nuLSU and mtSSU rDNA, and the protein-coding RPB1 gene. The three DNA regions had different evolutionary rates: RPB1 gave a rate two to four times higher than nuLSU and mtSSU. Divergence times of the major clades were estimated with partitioned BEAST analyses allowing different rates for each DNA region and using a relaxed clock model. Three calibrations points were used to date the tree: an inferred age at the stem of Lecanoromycetes, and two dated fossils: Parmelia in the parmelioid group, and Alectoria. Palaeoclimatic conditions and the palaeogeological area cladogram were compared to the dated phylogeny of parmelioid. The parmelioid group diversified around the K/T boundary, and the major clades diverged during the Eocene and Oligocene. The radiation of the genera occurred through globally changing climatic condition of the early Oligocene, Miocene and early Pliocene. The estimated divergence times are consistent with long-distance dispersal events being the major factor to explain the biogeographical distribution patterns of Southern Hemisphere parmelioids, especially for Africa-Australia disjunctions, because the sequential break-up of Gondwana started much earlier than the origin of these clades. However, our

  12. Multigene Molecular Phylogeny and Biogeographic Diversification of the Earth Tongue Fungi in the Genera Cudonia and Spathularia (Rhytismatales, Ascomycota)

    PubMed Central

    Ge, Zai-Wei; Yang, Zhu L.; Pfister, Donald H.; Carbone, Matteo; Bau, Tolgor; Smith, Matthew E.

    2014-01-01

    The family Cudoniaceae (Rhytismatales, Ascomycota) was erected to accommodate the “earth tongue fungi” in the genera Cudonia and Spathularia. There have been no recent taxonomic studies of these genera, and the evolutionary relationships within and among these fungi are largely unknown. Here we explore the molecular phylogenetic relationships within Cudonia and Spathularia using maximum likelihood and Bayesian inference analyses based on 111 collections from across the Northern Hemisphere. Phylogenies based on the combined data from ITS, nrLSU, rpb2 and tef-1α sequences support the monophyly of three main clades, the /flavida, /velutipes, and /cudonia clades. The genus Cudonia and the family Cudoniaceae are supported as monophyletic groups, while the genus Spathularia is not monophyletic. Although Cudoniaceae is monophyletic, our analyses agree with previous studies that this family is nested within the Rhytismataceae. Our phylogenetic analyses circumscribes 32 species-level clades, including the putative recognition of 23 undescribed phylogenetic species. Our molecular phylogeny also revealed an unexpectedly high species diversity of Cudonia and Spathularia in eastern Asia, with 16 (out of 21) species-level clades of Cudonia and 8 (out of 11) species-level clades of Spathularia. We estimate that the divergence time of the Cudoniaceae was in the Paleogene approximately 28 Million years ago (Mya) and that the ancestral area for this group of fungi was in Eastern Asia based on the current data. We hypothesize that the large-scale geological and climatic events in Oligocene (e.g. the global cooling and the uplift of the Tibetan plateau) may have triggered evolutionary radiations in this group of fungi in East Asia. This work provides a foundation for future studies on the phylogeny, diversity, and evolution of Cudonia and Spathularia and highlights the need for more molecular studies on collections from Europe and North America. PMID:25084276

  13. Efficacy of the biofumigant fungus Muscodor albus (Ascomycota: Xylariales) for control of codling moth (Lepidoptera: Tortricidae) in simulated storage conditions.

    PubMed

    Lacey, L A; Horton, D R; Jones, D C; Headrick, H L; Neven, L G

    2009-02-01

    Codling moth, Cydia pomonella (L.) (Lepidoptera: Tortricidae), a serious pest of pome fruit, is a threat to exportation of apples (Malus spp.) because of the possibility of shipping infested fruit. The need for alternatives to fumigants such as methyl bromide for quarantine security of exported fruit has encouraged the development of effective fumigants with reduced side effects. The endophytic fungus Muscodor albus Worapong, Strobel and Hess (Ascomycota: Xylariales) produces volatile compounds that are biocidal for several pest organisms, including plant pathogens and insect pests. The objectives of our research were to determine the effects of M. albus volatile organic compounds (VOCs) on codling moth adults, neonate larvae, larvae in infested apples, and diapausing cocooned larvae in simulated storage conditions. Fumigation of adult codling moth with VOCs produced by M. albus for 3 d and incubating in fresh air for 24 h at 25 degrees C resulted in 81% corrected mortality. Four- and 5-d exposures resulted in higher mortality (84 and 100%, respectively), but control mortality was also high due to the short life span of the moths. Exposure of neonate larvae to VOCs for 3 d on apples and incubating for 7 d resulted in 86% corrected mortality. Treated larvae were predominantly first instars, whereas 85% of control larvae developed to second and third instars. Exposure of apples that had been infested for 5 d, fumigated with M. albus VOCs for 3 d, and incubated as described above resulted in 71% corrected larval mortality. Exposure of diapausing cocooned codling moth larvae to VOCs for 7 or 14 d resulted in 31 and 100% mortality, respectively, with negligible control mortality. Our data on treatment of several stages of codling moth with M. albus VOCs indicate that the fungus could provide an alternative to broad spectrum chemical fumigants for codling moth control in storage and contribute to the systems approach to achieve quarantine security of exported apples.

  14. Origin and Diversification of Major Clades in Parmelioid Lichens (Parmeliaceae, Ascomycota) during the Paleogene Inferred by Bayesian Analysis

    PubMed Central

    Amo de Paz, Guillermo; Cubas, Paloma; Divakar, Pradeep K.; Lumbsch, H. Thorsten; Crespo, Ana

    2011-01-01

    There is a long-standing debate on the extent of vicariance and long-distance dispersal events to explain the current distribution of organisms, especially in those with small diaspores potentially prone to long-distance dispersal. Age estimates of clades play a crucial role in evaluating the impact of these processes. The aim of this study is to understand the evolutionary history of the largest clade of macrolichens, the parmelioid lichens (Parmeliaceae, Lecanoromycetes, Ascomycota) by dating the origin of the group and its major lineages. They have a worldwide distribution with centers of distribution in the Neo- and Paleotropics, and semi-arid subtropical regions of the Southern Hemisphere. Phylogenetic analyses were performed using DNA sequences of nuLSU and mtSSU rDNA, and the protein-coding RPB1 gene. The three DNA regions had different evolutionary rates: RPB1 gave a rate two to four times higher than nuLSU and mtSSU. Divergence times of the major clades were estimated with partitioned BEAST analyses allowing different rates for each DNA region and using a relaxed clock model. Three calibrations points were used to date the tree: an inferred age at the stem of Lecanoromycetes, and two dated fossils: Parmelia in the parmelioid group, and Alectoria. Palaeoclimatic conditions and the palaeogeological area cladogram were compared to the dated phylogeny of parmelioid. The parmelioid group diversified around the K/T boundary, and the major clades diverged during the Eocene and Oligocene. The radiation of the genera occurred through globally changing climatic condition of the early Oligocene, Miocene and early Pliocene. The estimated divergence times are consistent with long-distance dispersal events being the major factor to explain the biogeographical distribution patterns of Southern Hemisphere parmelioids, especially for Africa-Australia disjunctions, because the sequential break-up of Gondwana started much earlier than the origin of these clades. However, our

  15. What an rRNA Secondary Structure Tells about Phylogeny of Fungi in Ascomycota with Emphasis on Evolution of Major Types of Ascus

    PubMed Central

    Zhuang, Wen-Ying; Liu, Chao-Yang

    2012-01-01

    Background RNA secondary structure is highly conserved throughout evolution. The higher order structure is fundamental in establishing important structure-function relationships. Nucleotide sequences from ribosomal RNA (rRNA) genes have made a great contribution to our understanding of Ascomycota phylogeny. However, filling the gaps between molecular phylogeny and morphological assumptions based on ascus dehiscence modes and type of fruitbodies at the higher level classification of the phylum remains an unfulfilled task faced by mycologists. Methodology/Principal Findings We selected some major groups of Ascomycota to view their phylogenetic relationships based on analyses of rRNA secondary structure. Using rRNA secondary structural information, here, we converted nucleotide sequences into the structure ones over a 20-symbol code. Our structural analyses together with ancestral character state reconstruction produced reasonable phylogenetic position for the class Geoglossomycetes as opposed to the classic nucleotide analyses. Judging from the secondary structure analyses with consideration of mode of ascus dehiscence and the ability of forming fruitbodies, we draw a clear picture of a possible evolutionary route for fungal asci and some major groups of fungi in Ascomycota. The secondary structure trees show a more reasonable phylogenetic position for the class Geoglossomycetes. Conclusions Our results illustrate that asci lacking of any dehiscence mechanism represent the most primitive type. Passing through the operculate and Orbilia-type asci, bitunicate asci occurred. The evolution came to the most advanced inoperculate type. The ascus-producing fungi might be derived from groups lacking of the capacity to form fruitbodies, and then evolved multiple times. The apothecial type of fruitbodies represents the ancestral state, and the ostiolar type is advanced. The class Geoglossomycetes is closely related to Leotiomycetes and Sordariomycetes having a similar ascus

  16. A proteomic approach to identifying proteins differentially expressed in conidia and mycelium of the entomopathogenic fungus Metarhizium acridum.

    PubMed

    Barros, Bruno H R; da Silva, Sérgio H; dos ReisMarques, Everaldo Dos Reis; Rosa, José C; Yatsuda, Ana Patrícia; Roberts, Donald W; Braga, Gilberto U L

    2010-07-01

    Metarhizium spp. is an important worldwide group of entomopathogenic fungi used as an interesting alternative to chemical insecticides in programs of agricultural pest and disease vector control. Metarhizium conidia are important in fungal propagation and also are responsible for host infection. Despite their importance, several aspects of conidial biology, including their proteome, are still unknown. We have established conidial and mycelial proteome reference maps for Metarhizium acridum using two-dimensional gel electrophoresis (2-DE) and matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF MS). In all, 1130±102 and 1200±97 protein spots were detected in ungerminated conidia and fast-growing mycelia, respectively. Comparison of the two protein-expression profiles reveled that only 35% of the protein spots were common to both developmental stages. Out of 94 2-DE protein spots (65 from conidia, 25 from mycelia and two common to both) analyzed using mass spectrometry, seven proteins from conidia, 15 from mycelia and one common to both stages were identified. The identified protein spots exclusive to conidia contained sequences similar to known fungal stress-protector proteins (such as heat shock proteins (HSP) and 6-phosphogluconate dehydrogenase) plus the fungal allergen Alt a 7, actin and the enzyme cobalamin-independent methionine synthase. The identified protein spots exclusive to mycelia included proteins involved in several cell housekeeping biological processes. Three proteins (HSP 90, 6-phosphogluconate dehydrogenase and allergen Alt a 7) were present in spots in conidial and mycelial gels, but they differed in their locations on the two gels.

  17. Metarhizium pingshaense applied as a seed treatment induces fungal infection in larvae of the white grub Anomala cincta.

    PubMed

    Peña-Peña, A J; Santillán-Galicia, M T; Hernández-López, J; Guzmán-Franco, A W

    2015-09-01

    Metarhizium pingshaense has potential as a control agent of the white grub Anomala cincta. We compared its ability to cause infection when applied as a seed treatment or directly to the compost around the plant roots. Although the greatest infection (93%) occured in the direct inoculation treatment, 50% of larvae still became infected by M. pingshaense applied as a seed treatment. The fungus persisted in the compost and also colonised the roots of the developing maize plants endophytically. More research is required but seed treatments with M. pingshaense have potential as cost-effective control options for A. cincta.

  18. Impact of metarhizium brunneum petch clavicipitaceae (Hypocreales) on pre-imaginal Rhagoletis indifferens (Diptera: Tephritidae) within and on the surface of orchard soil

    USDA-ARS?s Scientific Manuscript database

    When last instar laboratory-reared Rhagoletis indifferens were allowed to pupate within non-sterile orchard soil containing Metarhizium brunneum isolate F52 conidia, a dose related proportion died from developmental abnormalities and mycosis. Similarly, when last instar larvae entered soil that was ...

  19. Impact of Metarhizium brunneum (Hypocreales: Clavicipitaceae) on pre-imaginal Rhagoletis indifferens (Diptera: Tephritidae) within and on the surface of orchard soil

    USDA-ARS?s Scientific Manuscript database

    When last instar laboratory-reared Rhagoletis indifferens (Cherry Fruit Fly) were allowed to pupate within non-sterile orchard soil containing incorporated Metarhizium brunneum isolate F52 conidia, a dose-related proportion died from developmental abnormalities and mycosis. Similarly, when prepupal ...

  20. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system

    USDA-ARS?s Scientific Manuscript database

    Fungi in the genus Metarhizium are facultative pathogens of insects with the capacity to function in other niches, including soil and plant rhizosphere habitats. In agroecosystems, cropping and tillage practices heavily influence soil fungal communities with unknown effects on the distribution of M...

  1. Development of a user-friendly delivery method for the fungus Metarhizium anisopliac to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies

    USDA-ARS?s Scientific Manuscript database

    A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducte...

  2. Simulated aerial sprays for field cage evaluation of Beauveria bassiana and Metarhizium brunneum (Ascomycetes: Hypocreales) against Anabrus simplex (Orthoptera: Tettigoniidae) in Montana

    USDA-ARS?s Scientific Manuscript database

    Field efficacy of the entomopathogenic Ascomycete Beauveria bassiana strain GHA and Metarhizium brunneum strain F52 was evaluated against nymphs of the Mormon cricket, Anabrus simplex. Fungi were applied with a new apparatus that allows simulated aerial sprays to 0.1m2 areas in the field. The Mormon...

  3. Differential Pathogenicity of Metarhizium Blastospores and Conidia Against Larvae of Three Mosquito Species.

    PubMed

    Alkhaibari, A M; Carolino, A T; Bull, J C; Samuels, R I; Butt, T M

    2017-05-01

    Biorational insecticides are being increasingly used in integrated pest management programs. In laboratory bioassays, the pathogenicity of blastospores and conidia of the entomopathogenic fungus Metarhizium brunneum ARSEF 4556 was evaluated against larvae of three mosquito species. Three propagule concentrations (1 × 106, 1 × 107, and 1 × 108 spores ml - 1) were used in the bioassays. Results showed that Aedes aegypti had lower survival rates when exposed to blastospores than when exposed to conidia, whereas the converse was true for Culex quinquefasciatus larvae. Anopheles stephensi larvae survival rates were similar when exposed to blastospores and conidia, except at the higher doses, where blastospores were more virulent. Several assays showed little difference in mortalities when using either 1 × 107 or 1 × 108 spores ml - 1, suggesting a threshold above which no higher control levels or economic benefit would be achieved. When tested at the lowest dose, the LT50 of Cx. quinquefasciatus using blastospores, wet conidia, and dry conidia was 3.2, 1.9, and 4.4 d, respectively. The LT50 of Ae. aegypti using blastospores, wet conidia, and dry conidia was 1.3, 3.3, and 6.2 d, respectively. The LT50 of An. stephensi using blastospores, wet conidia, and dry conidia was 2.0, 1.9, and 2.1 d, respectively. These observations suggest that for optimized control, two different formulations of the fungus may be needed when treating areas where there are mixed populations of Aedes, Anopheles, and Culex. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Genetic diversity and population structure of the Chinese Fungus Metarhizium rileyi causing green muscardine in silkworm.

    PubMed

    Zhang, Shengli; Chen, Xue; Luan, Fenggang; He, Lingmin; Pu, Shunchang; Li, Zengzhi

    2016-10-01

    Green muscardine caused by Metarhizium rileyi affects sericulture, and is typically enzootic and occurs frequently at low incidence. We collected 152 M. rileyi isolates from silkworm cadavers in eight sericulture areas in seven provinces of China, and four strains from other Lepidoptera larvae in Qianshan(QS) County, Anhui province. Nine microsatellite inter-simple sequence repeat (ISSR) primers produced 91 distinct and reproducible bands, revealing a high level (90.11%) of DNA polymorphism. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) cluster analysis divided the populations into four groups, with isolates from Qianshan County forming a single branch. All the 156 M. rileyi isolates were heterogenic and polyphyletic and did not displayed typical regional distribution except strains from Qianshan country. PCA analysis of the nine populations of M. rileyi revealed similar phylogenies among accessions. Genetic differentiation index (Gst) among eight enzootic populations was 0.3789 and gene flow (Nm) was 0.4098, suggesting the low gene flow maintained a high degree of differentiation. Gst between the enzootic population of Qianshan County and other seven populations exceeded the threshold of severe differentiation, with moderate differentiation between the remaining seven enzootic populations. Analysis of molecular variance (AMOVA) showed most ISSR variation (61%) among isolates occurred within populations. No significant correlation was observed between geographical and genetic distance. According to cluster analysis based on single enzootic population, every enzootic population showed dominance, namely mainly constituted of strains with high genetic similarity. These data indicated that the green muscardine in each local silkworm population was predominantly caused by a native group of M. rileyi. Furthermore, Gst and Nm of M. rileyi from silkworm and other Lepidoptera larvae in Qianshan County were 0.1174 and 1.8791, respectively, suggesting strains

  5. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract.

  6. Who's getting around? Assessing species diversity and phylogeography in the widely distributed lichen-forming fungal genus Montanelia (Parmeliaceae, Ascomycota).

    PubMed

    Leavitt, Steven D; Divakar, Pradeep K; Ohmura, Yoshihito; Wang, Li-Song; Esslinger, Theodore L; Lumbsch, H Thorsten

    2015-09-01

    Brown parmelioid lichens comprise a number of distinct genera in one of the most species-rich families of lichen-forming fungi, Parmeliaceae (Ascomycota). In spite of their superficial similarity, a number of studies of brown parmelioids have provided important insight into diversification in lichen-forming fungi with cosmopolitan distributions. In this study we assess species diversity, biogeography and diversification of the genus Montanelia, which includes alpine to temperate saxicolous species. We sampled each of the five known species, four of which are known from broad, intercontinental distributions. In order to identify potential biogeographical patterns, each broadly distributed species was represented by individuals collected across their intercontinental distributions. Molecular sequence data were generated for six loci, including three nuclear protein-coding markers (MCM7, RPB1, and RPB2), two nuclear ribosomal markers (ITS and nrLSU), and a fragment of the mitochondrial small subunit. We used three sequence-based species delimitations methods to validate traditional, phenotype-based species and circumscribe previously unrecognized species-level lineages in Montanelia. Relationships among putative lineages and divergence times were estimated within a coalescent-based multi-locus species tree framework. Based on the results of the species delimitation analyses, we propose that the genus Montanelia is likely comprised of six to nine species-level lineages, including previously unrecognized species-level diversity in the nominal taxa M. panniformis and M. tominii. In contrast, molecular sequence data suggest that M. predisjuncta may be conspecific with the widespread taxon M. disjuncta in spite of distinct morphological differences. The rate-based age estimation of the most recent common ancestor of Montanelia (ca. 23.1Ma) was similar to previous estimates based on the fossil record. Furthermore, our data suggest that diversification in Montanelia occurred

  7. Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.

    PubMed

    Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo

    2017-04-01

    RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer (M. robertsiidcl1 [Mrdcl1] and Mrdcl2) and Argonaute (Mrago1 and Mrago2) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δdcl2 and Δago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δdcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δdcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δdcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsiiIMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role in regulating

  8. A high-throughput gene disruption methodology for the entomopathogenic fungus Metarhizium robertsii.

    PubMed

    Xu, Chuan; Zhang, Xing; Qian, Ying; Chen, Xiaoxuan; Liu, Ran; Zeng, Guohong; Zhao, Hong; Fang, Weiguo

    2014-01-01

    Systematic gene disruption is a direct way to interrogate a fungal genome to functionally characterize the full suite of genes involved in various biological processes. Metarhizium robertsii is extraordinarily versatile, and it is a pathogen of arthropods, a saprophyte and a beneficial colonizer of rhizospheres. Thus, M. robertsii can be used as a representative to simultaneously study several major lifestyles that are not shared by the "model" fungi Saccharomyces cerevisiae and Neurospora crassa; a systematic genetic analysis of M. robertsii will benefit studies in other fungi. In order to systematically disrupt genes in M. robertsii, we developed a high-throughput gene disruption methodology, which includes two technologies. One is the modified OSCAR-based, high-throughput construction of gene disruption plasmids. This technology involves two donor plasmids (pA-Bar-OSCAR with the herbicide resistance genes Bar and pA-Sur-OSCAR with another herbicide resistance gene Sur) and a recipient binary plasmid pPK2-OSCAR-GFP that was produced by replacing the Bar cassette in pPK2-bar-GFP with a ccdB cassette and recombination recognition sites. Using this technology, a gene disruption plasmid can be constructed in one cloning step in two days. The other is a highly efficient gene disruption technology based on homologous recombination using a Ku70 deletion mutant (ΔMrKu70) as the recipient strain. The deletion of MrKu70, a gene encoding a key component involved in nonhomologous end-joining DNA repair in fungi, dramatically increases the gene disruption efficiency. The frequency of disrupting the conidiation-associated gene Cag8 in ΔMrKu70 was 93% compared to 7% in the wild-type strain. Since ΔMrKu70 is not different from the wild-type strain in development, pathogenicity and tolerance to various abiotic stresses, it can be used as a recipient strain for a systematic gene disruption project to characterize the whole suite of genes involved in the biological processes of

  9. Comparative impact of artificial selection for fungicide resistance on Beauveria bassiana and Metarhizium brunneum.

    PubMed

    Shapiro-Ilan, David I; Reilly, Charles C; Hotchkiss, Michael W

    2011-02-01

    Hypocreales fungi such as Beauveria bassiana (Balsamo) Vuillemin and Metarhizium brunneum Petch can be negatively affected by fungicides thereby reducing their biocontrol potential. In a previous study, we demonstrated enhanced fungicide resistance in B. bassiana through artificial selection. However, it is not clear if the enhanced resistance was because of improved germination, vegetative growth, or both. Additionally, the enhanced fungicide resistance has only been demonstrated in B. bassiana, and therefore it is of interest to investigate the potential to enhance resistance in other fungi. Thus, the objectives in this study were to determine the potential to enhance fungicide resistance in M. brunneum through artificial selection, and investigate if selection is based on germination, vegetative growth, or both in B. bassiana and M. brunneum. Selection for resistance to fenbuconazole, and triphenyltin hydroxide was assessed through inhibition evaluations on solid media, and germination and mycelial growth in liquid media. Increased resistance after selection was observed for all fungicide-fungus combinations on solid and or liquid media. Selection resulted in increased resistance to fenbuconazole in both fungi in solid and liquid media; in liquid culture fungicide resistance in B. bassiana was manifested by increased germination and mycelial growth, whereas in M. brunneum fungicide resistance concerned only mycelial growth. Selection for resistance to triphenyltin hydroxide varied in the different media. For B. bassiana, triphenyltin hydroxide resistance was enhanced on solid media but not in liquid, whereas enhanced resistance of M. brunneum was detected in both media. Fungicide sensitivity and selection potential differs based on the medium and fungal species. Selection for fungicide resistance, had negative effects on other beneficial traits when fungicide pressure was removed, for example, some selected populations showed decreased germination or growth

  10. A monograph of Allantonectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, Ascomycota) and their pycnidial, sporodochial, and synnematous anamorphs

    PubMed Central

    Hirooka, Y.; Rossman, A.Y.; Samuels, G.J.; Lechat, C.; Chaverri, P.

    2012-01-01

    Although Nectria is the type genus of Nectriaceae (Hypocreales, Sordariomycetes, Pezizomycotina, Ascomycota), the systematics of the teleomorphic and anamorphic state of Nectria sensu Rossman has not been studied in detail. The objectives of this study are to 1) provide a phylogenetic overview to determine if species of Nectria with Gyrostroma, Tubercularia, and Zythiostroma anamorphs form a monophyletic group; 2) define Nectria, segregate genera, and their species using morphologically informative characters of teleomorphic and anamorphic states; and 3) provide descriptions and illustrations of these genera and species. To accomplish these objectives, results of phylogenetic analyses of DNA sequence data from six loci (act, ITS, LSU, rpb1, tef1 and tub), were integrated with morphological characterisations of anamorphs and teleomorphs. Results from the phylogenetic analyses demonstrate that species previously regarded as the genus Nectria having Gyrostroma, Tubercularia, and Zythiostroma anamorphs belong in two major paraphyletic clades. The first major clade regarded as the genus Pleonectria contains 26 species with ascoconidia produced by ascospores in asci, perithecial walls having bright yellow scurf, and immersed or superficial pycnidial anamorphs (Zythiostroma = Gyrostroma). A lineage basal to the Pleonectria clade includes Nectria miltina having very small, aseptate ascospores, and trichoderma-like conidiophores and occurring on monocotyledonous plants. These characteristics are unusual in Pleonectria, thus we recognise the monotypic genus Allantonectria with Allantonectria miltina. The second major clade comprises the genus Nectria sensu stricto including the type species, N. cinnabarina, and 28 additional species. Within the genus Nectria, four subclades exist. One subclade includes species with sporodochial anamorphs and another with synnematous anamorphs. The other two paraphyletic subclades include species that produce abundant stromata in which the

  11. A monograph of Allantonectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, Ascomycota) and their pycnidial, sporodochial, and synnematous anamorphs.

    PubMed

    Hirooka, Y; Rossman, A Y; Samuels, G J; Lechat, C; Chaverri, P

    2012-03-15

    Although Nectria is the type genus of Nectriaceae (Hypocreales, Sordariomycetes, Pezizomycotina, Ascomycota), the systematics of the teleomorphic and anamorphic state of Nectriasensu Rossman has not been studied in detail. The objectives of this study are to 1) provide a phylogenetic overview to determine if species of Nectria with Gyrostroma, Tubercularia, and Zythiostroma anamorphs form a monophyletic group; 2) define Nectria, segregate genera, and their species using morphologically informative characters of teleomorphic and anamorphic states; and 3) provide descriptions and illustrations of these genera and species. To accomplish these objectives, results of phylogenetic analyses of DNA sequence data from six loci (act, ITS, LSU, rpb1, tef1 and tub), were integrated with morphological characterisations of anamorphs and teleomorphs. Results from the phylogenetic analyses demonstrate that species previously regarded as the genus Nectria having Gyrostroma,Tubercularia, and Zythiostroma anamorphs belong in two major paraphyletic clades. The first major clade regarded as the genus Pleonectria contains 26 species with ascoconidia produced by ascospores in asci, perithecial walls having bright yellow scurf, and immersed or superficial pycnidial anamorphs (Zythiostroma = Gyrostroma). A lineage basal to the Pleonectria clade includes Nectria miltina having very small, aseptate ascospores, and trichoderma-like conidiophores and occurring on monocotyledonous plants. These characteristics are unusual in Pleonectria, thus we recognise the monotypic genus Allantonectria with Allantonectria miltina. The second major clade comprises the genus Nectriasensu stricto including the type species, N. cinnabarina, and 28 additional species. Within the genus Nectria, four subclades exist. One subclade includes species with sporodochial anamorphs and another with synnematous anamorphs. The other two paraphyletic subclades include species that produce abundant stromata in which the large

  12. Behavioral and electrophysiological responses of Coptotermes formosanus Shiraki towards entomopathogenic fungal volatiles

    USDA-ARS?s Scientific Manuscript database

    Termites adjust their response to entomopathogenic fungi according to the profile of the fungal volatile organic compounds (VOCs). This study first demonstrated the pathogenicity of Metarhizium anisopliae, Beauveria bassiana and Isaria fumosorosea (=Paecilomyces fumosoroseus) towards the Formosan s...

  13. DIFFERENTIAL ALLERGIC AND NEUROTROPHIN RESPONSES TO FUNGAL COMPONENT EXTRACTS IN BALB/C MICE

    EPA Science Inventory

    Metarhizium anisopliae mycelium (MYC), conidia (CON) and inducible protease (IND) extracts were combined to produce the antigen MACA to screen for allergenic potential. Involuntary aspiration (IA) exposure to MACA in BALB/c mice has caused immune, inflammatory and physiological ...

  14. Isolation of endosymbionts from Ipomoea carnea and Swainsona canescens that produce swainsonine

    USDA-ARS?s Scientific Manuscript database

    Fungi including Metarhizium anisopliae (Clavicipitaceae), Rhizoctonia leguminicola (Ceratobasidiaceae), and Undifilum (Pleosporaceae), an endophyte found in the plant genera Astragalus and Oxytropis (Fabaceae) have been reported to be responsible for the production of swainsonine. Based upon the ass...

  15. DIFFERENTIAL ALLERGIC AND NEUROTROPHIN RESPONSES TO FUNGAL COMPONENT EXTRACTS IN BALB/C MICE

    EPA Science Inventory

    Metarhizium anisopliae mycelium (MYC), conidia (CON) and inducible protease (IND) extracts were combined to produce the antigen MACA to screen for allergenic potential. Involuntary aspiration (IA) exposure to MACA in BALB/c mice has caused immune, inflammatory and physiological ...

  16. A new species of Phyllopsora (Lecanorales, lichen-forming Ascomycota) from Dominican amber, with remarks on the fossil history of lichens.

    PubMed

    Rikkinen, Jouko; Poinar, George O

    2008-01-01

    Phyllopsora dominicanus sp. nov. (Bacidiaceae, Lecanorales, lichen-forming Ascomycota) is described and illustrated from Dominican amber. The diagnostic features of the lichen include a minute subfolious thallus of lacinulate, ascending squamules, a well-developed upper cortex, and a net-like pseudocortex on the lower surface. The algal symbionts are unicellular green algae, forming a distinct layer immediately below the upper cortex. The fossil demonstrates that distinguishing features of Phyllopsora have remained unchanged for tens of millions of years. The fossil also provides the first detailed views of mycobiont-photobiont contacts in Tertiary green algal lichens. The mycobiont hyphae formed apical and intercalary appressoria by pressing closely against the photobiont cells. This indicates that a conserved maintenance of structure is also seen in the fine details of the fungal-algal interface.

  17. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex.

    PubMed

    Montalva, Cristian; Collier, Karin; Rocha, Luiz Fernando Nunes; Inglis, Peter Ward; Lopes, Rogério Biaggioni; Luz, Christian; Humber, Richard A

    2016-05-01

    A wild, forest-dwelling cockroach from the subfamily Ectobiidae (order Blattodea) in a nature reserve in Cavalcante, in the state of Goiás, Brazil, was found to be infected by a new, genetically distinct species in the Metarhizium flavoviride species complex that we describe here as Metarhizium blattodeae. The status of this fungus as a new species is supported by both multigenic sequence comparisons and protein profiles generated by MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. This is one of the first reports of a naturally occurring fungal pathogen affecting any sylvatic (forest-dwelling) cockroach from any part of the world. M. blattodeae caused up to 96 % mortality of Periplaneta americana nymphs (a serious peridomestic cockroach species) after 10 d. Published by Elsevier Ltd.

  18. Efficacy of spray applications of entomopathogenic fungi against western flower thrips infesting greenhouse impatiens under variable moisture conditions

    USDA-ARS?s Scientific Manuscript database

    Efficacy tests of three entomopathogenic fungi (Beauveria bassiana strain GHA, Metarhizium brunneum strain F52, and Metarhizium anisopliae s.l. strain ESC-1) were conducted against thrips infesting greenhouse crops of single impatiens under variable moisture conditions. Fungal conidia suspended in 0...

  19. Unusual compact rDNA gene arrangements within some members of the Ascomycota: evidence for molecular co-evolution between ITS1 and ITS2.

    PubMed

    Hausner, Georg; Wang, Xi

    2005-08-01

    The internal transcribed spacers of the ribosomal DNA tandem repeat were examined in members of the ascomycetous genus Sphaeronaemella. Species of Sphaeronaemella and its mitotic counterpart Gabarnaudia, have a compact rDNA gene arrangement due to unusually short internal transcribed spacer (ITS) regions. Examination of these regions from phylogenetically related taxa, Cornuvesica, Gondwanamyces, and Ceratocystis, showed that their ITS1 and ITS2 regions could be folded into central hairpin-like structures with the size reduction in species of Sphaeronaemella being due to length reduction of the main-hairpin and the loss of smaller hairpin-like structures that emanate from the main hairpin. A databank compilation, combined with newly obtained sequences, provided an ITS data set that includes sequences of 600 species belonging to the Ascomycota. Correlation analysis revealed that the sizes of ITS1 and ITS2 show a strong positive correlation, suggesting that the 2 rDNA regions have co-evolved. This supports biochemical evidence indicating that the ITS1 and ITS2 segments interact to facilitate the maturation of the rRNA precursor.

  20. Expression of scorpion toxin LqhIT2 increases the virulence of Metarhizium acridum towards Locusta migratoria manilensis.

    PubMed

    Peng, Guoxiong; Xia, Yuxian

    2014-11-01

    LqhIT2 is an insect-specific neurotoxin from the venom of scorpion. In this study, the LqhIT2 gene was introduced into the entomopathogenic fungus, Metarhizium acridum. The virulence of the genetically modified strain MaLqhIT2 was then evaluated against locusts (Locusta migratoria manilensis). Compared with the wild-type strain, the median lethal cell density (LC50) for MaLqhIT2 was a 22.6-fold lower, and the median times to death (LT50) for MaLqhIT2 were reduced by 30.3 and 29.6 %, respectively, after topical inoculation and injection. MaLqhIT2 also grew significantly faster in the hemolymph than wild-type strain. There were no significant differences in germination, appressorium formation and sporulation in locust carcasses between the MaLqhIT2 and wild-type strain. These results indicate that LqhIT2 increased the virulence of M. acridum towards locusts by shortening the in vivo infection period, without affecting cuticle penetration or conidia formation in the carcasses. LqhIT2 thus shows considerable potential for increasing fungal virulence against locusts.

  1. Immune-physiological aspects of synergy between avermectins and the entomopathogenic fungus Metarhizium robertsii in Colorado potato beetle larvae.

    PubMed

    Tomilova, Oksana G; Kryukov, Vadim Yu; Duisembekov, Bahytzhan A; Yaroslavtseva, Olga N; Tyurin, Maksim V; Kryukova, Natalia A; Skorokhod, Valery; Dubovskiy, Ivan M; Glupov, Viktor V

    2016-10-01

    The interaction between the entomopathogenic fungus Metarhizium robertsii and natural avermectin metabolites of the actinomycete Streptomyces avermitilis were investigated on Colorado potato beetle larvae. A synergy in the mortality of larvae was detected after simultaneous treatment with half-lethal doses of avermectins (commercial name actarophit) 0.005% and fungus (5×10(5)conidia/ml). The treatment with avermectins led to rapid fungal colonization of the hemolymph. The defense strategies of insects infected by fungus and treated with avermectins and untreated insects were compared to investigate the mechanisms of this synergy. We have shown an increase in hemocytes, especially immunocompetent cells - plasmatocytes and granular cells in the initial stages of mycosis (third day post inoculation). In contrast, avermectins suppressed cellular immunity in hemolymph. Specifically, avermectins dramatically decreased the count of granular cells in larvae infected and uninfected with fungus. Apoptosis inducement and hemocyte necrosis under the influence of avermectins has been shown in vitro as one of the possible reasons for hemocyte mortality. In addition, avermectins enhanced the activity of phenoloxidases in integuments and hemolymph and increased the activity of glutathione-S-transferases activity in the fat body and hemolymph of infected and uninfected larvae, thereby intensifying the development of fungal infection by M. robertsii in Colorado potato beetle larvae. The combination of fungal infection and avermectins constitutes a new perspective for developing multicomponent bioinsecticides. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The MrCYP52 Cytochrome P450 Monoxygenase Gene of Metarhizium robertsii Is Important for Utilizing Insect Epicuticular Hydrocarbons

    PubMed Central

    Lin, Liangcai; Fang, Weiguo; Liao, Xinggang; Wang, Fengqing; Wei, Dongzhi; St. Leger, Raymond J.

    2011-01-01

    Fungal pathogens of plants and insects infect their hosts by direct penetration of the cuticle. Plant and insect cuticles are covered by a hydrocarbon-rich waxy outer layer that represents the first barrier against infection. However, the fungal genes that underlie insect waxy layer degradation have received little attention. Here we characterize the single cytochrome P450 monoxygenase family 52 (MrCYP52) gene of the insect pathogen Metarhizium robertsii, and demonstrate that it encodes an enzyme required for efficient utilization of host hydrocarbons. Expressing a green florescent protein gene under control of the MrCYP52 promoter confirmed that MrCYP52 is up regulated on insect cuticle as well as by artificial media containing decane (C10), extracted cuticle hydrocarbons, and to a lesser extent long chain alkanes. Disrupting MrCYP52 resulted in reduced growth on epicuticular hydrocarbons and delayed developmental processes on insect cuticle, including germination and production of appressoria (infection structures). Extraction of alkanes from cuticle prevented induction of MrCYP52 and reduced growth. Insect bioassays against caterpillars (Galleria mellonella) confirmed that disruption of MrCYP52 significantly reduces virulence. However, MrCYP52 was dispensable for normal germination and appressorial formation in vitro when the fungus was supplied with nitrogenous nutrients. We conclude therefore that MrCYP52 mediates degradation of epicuticular hydrocarbons and these are an important nutrient source, but not a source of chemical signals that trigger infection processes. PMID:22194968

  3. The Bax inhibitor MrBI-1 regulates heat tolerance, apoptotic-like cell death, and virulence in Metarhizium robertsii

    PubMed Central

    Chen, Yixiong; Duan, Zhibing; Chen, Peilin; Shang, Yanfang; Wang, Chengshu

    2015-01-01

    Bax inhibitor 1 (BI-1) is a highly conserved protein originally identified as a suppressor of the proapoptotic protein Bax to inhibit cell death in animals and plants. The orthologs of BI-1 are widely distributed in filamentous fungi but their functions remain largely unknown. Herein, we report the identification and characterizations of MrBI-1, an ortholog of BI-1, in the entomopathogenic fungus Metarhizium robertsii. First, we found that MrBI-1 could partially rescue mammalian Bax-induced cell death in yeast. Deletion of MrBI-1 impaired fungal development, virulence and heat tolerance in M. robertsii. We also demonstrated that inactivation of MrBI-1 reduced fungal resistance to farnesol but not to hydrogen peroxide, suggesting that MrBI-1 contributes to antiapoptotic-like cell death via the endoplasmic reticulum stress-signaling pathway rather than the classical mitochondrium-dependent pathway. In particular, we found that unlike the observations in yeasts and plants, expression of mammalian Bax did not lead to a lethal effect in M. robertsii; however, it did aggravate the fungal apoptotic effect of farnesol. The results of this study advance our understanding of BI-1-like protein functions in filamentous fungi. PMID:26023866

  4. Efficient dibutyltin (DBT) elimination by the microscopic fungus Metarhizium robertsii under conditions of intensive aeration and ascorbic acid supplementation.

    PubMed

    Siewiera, Paulina; Różalska, Sylwia; Bernat, Przemysław

    2017-03-27

    Dibutyltin (DBT) is an environmental pollutant characterized by immunotoxic, neurotoxic, and pro-oxidant properties. In this study, an attempt was made to enhance DBT elimination by the Metarhizium robertsii strain. We observed enhanced fungal growth in the bioreactor (pO2 ≥ 20%) compared to flask cultures (μ max increased from 0.061 to 0.086 h(-1)). Moreover, under aerated conditions, M. robertsii mycelium with "hairy" morphology biodegraded DBT (20 mg l(-1)) 10-fold faster in the bioreactor than in the flask cultures. Monobutyltin (MBT) and a hydroxylated derivative of MBT (OHBuSnH2) were detected as by-products of dibutyltin debutylation. Simultaneous usage of glucose and butyltins indicates the comatabolic nature of monobutyltin and dibutyltin removal. In order to protect fungal cells from oxidative stress caused by DBT presence, vitamin C (20 mg l(-1)) was applied. Supplementation with ascorbic acid (AA) resulted in a 3-fold acceleration of MBT removal during the first 7 h of incubation. Using the HPLC-MS/MS technique, a quantitative analysis of malondialdehyde (MDA), a marker of oxidative stress, was performed. In the AA presence, a decrease in the MDA amount (about 45%) was observed compared to the case with fungal cells exposed to DBT alone.

  5. The high osmotic response and cell wall integrity pathways cooperate to regulate morphology, microsclerotia development, and virulence in Metarhizium rileyi

    PubMed Central

    Song, Zhangyong; Zhong, Qiang; Yin, Youping; Shen, Ling; Li, Yan; Wang, Zhongkang

    2016-01-01

    Microsclerotia (MS) formation was successfully induced in Metarhizium rileyi under changing liquid culture conditions. Mitogen-activated protein kinases (MAPKs) play important roles in fungal development and in coordinating many stress responses. To investigate how M. rileyi transduces growth stress and regulates MS differentiation, we characterized the roles of two MAPKs, Hog1- and Slt2-type orthologues, in M. rileyi. Compared with the wild-type strain, the deletion mutants of Mrhog1 (ΔMrhog1) and Mrslt2 (ΔMrslt2) delayed germination and vegetative growth, displayed sensitivities to various stress, and produced morphologically abnormal clones. The ΔMrhog1 and ΔMrslt2 mutants significantly reduced conidial (42–99%) and MS (96–99%) yields. A transcriptional analysis showed that the two MAPKs regulate MS development in a cooperative manner. Insect bioassays revealed that ΔMrhog1 and ΔMrslt2 had decreased virulence levels in topical (36–56%) and injection (78–93%) bioassays. Our results confirmed the roles of MrHog1 and MrSlt2 in sensing growth-related stress and in regulating MS differentiation. PMID:27941838

  6. The Bax inhibitor MrBI-1 regulates heat tolerance, apoptotic-like cell death, and virulence in Metarhizium robertsii.

    PubMed

    Chen, Yixiong; Duan, Zhibing; Chen, Peilin; Shang, Yanfang; Wang, Chengshu

    2015-05-29

    Bax inhibitor 1 (BI-1) is a highly conserved protein originally identified as a suppressor of the proapoptotic protein Bax to inhibit cell death in animals and plants. The orthologs of BI-1 are widely distributed in filamentous fungi but their functions remain largely unknown. Herein, we report the identification and characterizations of MrBI-1, an ortholog of BI-1, in the entomopathogenic fungus Metarhizium robertsii. First, we found that MrBI-1 could partially rescue mammalian Bax-induced cell death in yeast. Deletion of MrBI-1 impaired fungal development, virulence and heat tolerance in M. robertsii. We also demonstrated that inactivation of MrBI-1 reduced fungal resistance to farnesol but not to hydrogen peroxide, suggesting that MrBI-1 contributes to antiapoptotic-like cell death via the endoplasmic reticulum stress-signaling pathway rather than the classical mitochondrium-dependent pathway. In particular, we found that unlike the observations in yeasts and plants, expression of mammalian Bax did not lead to a lethal effect in M. robertsii; however, it did aggravate the fungal apoptotic effect of farnesol. The results of this study advance our understanding of BI-1-like protein functions in filamentous fungi.

  7. Glycerol-3-Phosphate Acyltransferase Contributes to Triacylglycerol Biosynthesis, Lipid Droplet Formation, and Host Invasion in Metarhizium robertsii

    PubMed Central

    Gao, Qiang; Shang, Yanfang; Huang, Wei

    2013-01-01

    Enzymes involved in the triacylglycerol (TAG) biosynthesis have been well studied in the model organisms of yeasts and animals. Among these, the isoforms of glycerol-3-phosphate acyltransferase (GPAT) redundantly catalyze the first and rate-limiting step in glycerolipid synthesis. Here, we report the functions of mrGAT, a GPAT ortholog, in an insect-pathogenic fungus, Metarhizium robertsii. Unlike in yeasts and animals, a single copy of the mrGAT gene is present in the fungal genome and the gene deletion mutant is viable. Compared to the wild type and the gene-rescued mutant, the ΔmrGAT mutant demonstrated reduced abilities to produce conidia and synthesize TAG, glycerol, and total lipids. More importantly, we found that mrGAT is localized to the endoplasmic reticulum and directly linked to the formation of lipid droplets (LDs) in fungal cells. Insect bioassay results showed that mrGAT is required for full fungal virulence by aiding fungal penetration of host cuticles. Data from this study not only advance our understanding of GPAT functions in fungi but also suggest that filamentous fungi such as M. robertsii can serve as a good model to elucidate the role of the glycerol phosphate pathway in fungal physiology, particularly to determine the mechanistic connection of GPAT to LD formation. PMID:24077712

  8. A re-evaluation of the genus Myceliophthora (Sordariales, Ascomycota): its segregation into four genera and description of Corynascus fumimontanus sp. nov.

    PubMed

    Marin-Felix, Yasmina; Stchigel, Alberto M; Miller, Andrew N; Guarro, Josep; Cano-Lira, José F

    2015-01-01

    Based on a number of isolates of Myceliophthora (Chaetomiaceae, Sordariales, Ascomycota) recently isolated from soil samples collected in USA, the taxonomy of the genus was re-evaluated through phylogenetic analyses of sequences from the nuc rDNA internal transcribed spacer region and genes for the second largest subunit of RNA polymerase II and translation elongation factor 1α. Members of Myceliophthora were split into four monophyletic clades strongly supported by molecular and phenotypic data. Such clades correspond with Myceliophthora, now restricted only to the type species of the genus Corynascus, which is re-established with five species, the new monotypic genus Crassicarpon and also the new genus Thermothelomyces (comprising four species). Myceliophthora lutea is mesophilic and a permanently asexual morph compared to the members of the other three mentioned genera, which also are able to sexually reproduce morphs with experimentally proven links to their asexual morphs. The asexual morph of M. lutea is characterized by broadly ellipsoidal, smooth-walled conidia with a wide, truncate base. Crassicarpon thermophilum is thermophilic and heterothallic and produces spherical to cuneiform, smooth-walled conidia and cleistothecial ascomata of smooth-walled, angular cells and ascospores with a germ pore at each end. Corynascus spp. are homothallic and mesophilic and produce spherical, mostly ornamented conidia and cleistothecial ascomata with textura epidermoidea composed of ornamented wall cells, and ascospores with one germ pore at each end. Thermothelomyces spp. are thermophilic, heterothallic and characterized by similar ascomata and conidia as Corynascus spp., but its ascospores exhibit only a single germ pore. A dichotomous key to distinguish Myceliophthora from the other mentioned genera are provided, as well as dichotomous keys to identify the species of Corynascus and Thermothelomyces. A new species, namely Corynascus fumimontanus, characterized by

  9. Multilocus phylogeny of the lichen-forming fungal genus Melanohalea (Parmeliaceae, Ascomycota): insights on diversity, distributions, and a comparison of species tree and concatenated topologies.

    PubMed

    Leavitt, Steven D; Esslinger, Theodore L; Spribille, Toby; Divakar, Pradeep K; Thorsten Lumbsch, H

    2013-01-01

    Accurate species circumscriptions are central for many biological disciplines and have critical implications for ecological and conservation studies. An increasing body of evidence suggests that in some cases traditional morphology-based taxonomy have underestimated diversity in lichen-forming fungi. Therefore, genetic data play an increasing role for recognizing distinct lineages of lichenized fungi that it would otherwise be improbable to recognize using classical phenotypic characters. Melanohalea (Parmeliaceae, Ascomycota) is one of the most widespread and common lichen-forming genera in the northern Hemisphere. In this study, we assess traditional phenotype-based species boundaries, identify previously unrecognized species-level lineages and discuss biogeographic patterns in Melanohalea. We sampled 487 individuals worldwide, representing 18 of the 22 described Melanohalea species, and generated DNA sequence data from mitochondrial, nuclear ribosomal, and protein-coding markers. Diversity previously hidden within traditional species was identified using a genealogical concordance approach. We inferred relationships among sampled species-level lineages within Melanohalea using both concatenated phylogenetic methods and a coalescent-based multilocus species tree approach. Although lineages identified from genetic data are largely congruent with traditional taxonomy, we found strong evidence supporting the presence of previously unrecognized species in six of the 18 sampled taxa. Strong nodal support and overall congruence among independent loci suggest long-term reproductive isolation among most species-level lineages. While some Melanohalea taxa are truly widespread, a limited number of clades appear to have much more restricted distributional ranges. In most instances the concatenated gene tree and multilocus species tree approaches provided similar estimates of relationships. However, nodal support was generally higher in the phylogeny estimated from

  10. Clades of γ-glutamyltransferases (GGTs) in the ascomycota and heterologous expression of Colletotrichum graminicola CgGGT1, a member of the pezizomycotina-only GGT clade.

    PubMed

    Bello, Marco H; Epstein, Lynn

    2013-02-01

    Gamma-glutamyltransferase (GGT, EC 2.3.2.2) cleaves the γ-glutamyl linkage in glutathione (GSH). Ascomycetes in either the Saccharomycotina or the Taphrinomycotina have one to three GGTs, whereas members of the Pezizomycotina have two to four GGTs. A Bayesian analysis indicates there are three well-supported main clades of GGTs in the Ascomycota. 1) A Saccharomycotina and a Taphrinomycotina-specific GGT sub-clade form a yeast main clade. This clade has the three relatively well-characterized fungal GGTs: (Saccharomyces cerevisiae CIS2 and Schizosaccharomyces pombe Ggt1 and Ggt2) and most of its members have all 14 of the highly conserved and critical amino acids that are found in GGTs in the other kingdoms. 2) In contrast, a main clade (GGT3) differs in 11 of the 14 highly conserved amino acids that are found in GGTs in the other kingdoms. All of the 44 Pezizomycotina analyzed have either one or two GGT3s. 3) There is a Pezizomycotina-only GGT clade that has two well-supported sub-clades (GGT1 and GGT2); this clade differs in only two of the 14 highly conserved amino acids found in GGTs in the other kingdoms. Because the Pezizomycotina GGTs differ in apparently critical amino acids from the cross-kingdom consensus, a putative GGT from Colletotrichum graminicola, a member of the Pezizomycotina, was cloned and the protein product was expressed as a secreted protein in Pichia pastoris. A GGT enzyme assay of the P. pastoris supernatant showed that the recombinant protein was active, thereby demonstrating that CgGGT1 is a bona fide GGT.

  11. Microsclerotia of Metarhizium brunneum F52 Applied in Hydromulch for Control of Asian Longhorned Beetles (Coleoptera: Cerambycidae).

    PubMed

    Goble, Tarryn A; Hajek, Ann E; Jackson, Mark A; Gardescu, Sana

    2015-04-01

    The entomopathogenic fungus Metarhizium brunneum (Petch) strain F52 (Hypocreales: Clavicipitaceae) is able to produce environmentally persistent microsclerotia (hyphal aggregates). Microsclerotia of strain F52 produced as granules and incorporated into hydromulch (hydro-seeding straw, water, and a natural glue) provides a novel mycoinsecticide that could be sprayed onto urban, forest, or orchard trees. We tested this formulation against adult Asian longhorned beetles (Anoplophora glabripennis (Motschulsky)) using three substrates (moistened bark, dry bark, absorbent bench liner) sprayed with a low rate (9 microsclerotia granules/cm2) of hydromulch. Median survival times of beetles continuously exposed to sprayed moist bark or absorbent liner were 17.5 and 19.5 d, respectively. Beetles exposed to sprayed dry bark, which had a lower measured water activity, lived significantly longer. When moist bark pieces were sprayed with increased rates of microsclerotia granules in hydromulch, 50% died by 12.5 d at the highest application rate, significantly sooner than beetles exposed to lower application rates (16.5-17.5 d). To measure fecundity effects, hydromulch with or without microsclerotia was sprayed onto small logs and pairs of beetles were exposed for a 2-wk oviposition period in containers with 98 or 66% relative humidity. At 98% humidity, oviposition in the logs was highest for controls (18.3±1.4 viable offspring per female) versus 3.9±0.8 for beetles exposed to microsclerotia. At 66% humidity, fecundities of controls and beetles exposed to microsclerotia were not significantly different. This article presents the first evaluation of M. brunneum microsclerotia in hydromulch applied for control of an arboreal insect pest. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps)

    PubMed Central

    Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2016-01-01

    ABSTRACT Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride. According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity. PMID:28003420

  13. Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps).

    PubMed

    Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2017-03-01

    Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity.

  14. On-host control of the brown dog tick Rhipicephalus sanguineus Latreille (Acari: Ixodidae) by Metarhizium brunneum (Hypocreales: Clavicipitaceae).

    PubMed

    Rot, A; Gindin, G; Ment, D; Mishoutchenko, A; Glazer, I; Samish, M

    2013-03-31

    Ticks are obligatory blood-sucking arthropods. Their life cycle includes a relatively short period of feeding on a vertebrate host and a long off-host period spent in the upper layer of the soil. Entomopathogenic fungi are known to be highly effective tick pathogens and the on-host application of these fungi may be a promising economic approach for tick control. In this study, we evaluated the tick control provided by spraying Metarhizium brunneum onto the tick's vertebrate host, specifically gerbils (Meriones tristrami) and rabbits (Oryctolagus cuniculus). The efficacy of the fungal treatment was not limited to a direct effect on the mortality of feeding ticks, but continued during molting (off host) and, in the case of female ticks, the treatment reduced the production of eggs and their hatching rate. The direct control of the on-host stages was relatively low (from 19 to 38%); whereas the effects of the applied fungus on subsequent tick development reduced the yield of the following engorged stages up to 30-63%. Engorged females that dropped from rabbits sprayed with M. brunneum laid 21.5% fewer eggs than the control females. Moreover, these ticks transmitted conidia by contact to the eggs which they laid, resulting a 3-fold reduction in the rate of hatching relative to the control. Based on theoretical cumulative calculations, these results suggest that if the progeny of each unfed stage feed on fungus-sprayed hosts, there will be a 92% reduction in the tick population within one generation. Two spray formulations, one based on mineral oil and another based on a starch-sucrose mixture, significantly enhanced on-host tick control, in comparison with an unformulated conidial suspension. The reduction in the number of nymphs that fed on the treated host and later developed into unfed adults was 54.9% for unformulated conidia, 70.4% for the oil formulation and 86.4% for the starch-sucrose formulation. Increasing the environmental humidity around the gerbils while

  15. Calcium gluconate as cross-linker improves survival and shelf life of encapsulated and dried Metarhizium brunneum and Saccharomyces cerevisiae for the application as biological control agents.

    PubMed

    Humbert, Pascal; Przyklenk, Michael; Vemmer, Marina; Patel, Anant V

    2017-02-01

    Calcium chloride (CC) is the most common cross-linker for the encapsulation of biocontrol microorganisms in alginate beads. The aim of this study was to evaluate if calcium gluconate (CG) can replace CC as cross-linker and at the same time improve viability after drying and rehydration, hygroscopic properties, shelf life and nutrient supply. Hence, the biocontrol fungi Metarhizium brunneum and Saccharomyces cerevisiae were encapsulated in Ca-alginate beads supplemented with starch. Beads were dried and maximum survival was found in beads cross-linked with CG. Beads prepared with CG showed lower hygroscopic properties, but a higher shelf life for encapsulated fungi. Moreover, we demonstrated that gluconate has a nutritive effect on encapsulated fungi, leading to increased mycelium growth of M. brunneum and to enhanced CO2 release from beads containing Saccharomyces cerevisiae. The application of CG as cross-linker will pave the way towards increasing drying survival and shelf life of various, especially drying-sensitive microbes.

  16. Fungal dermatitis, glossitis and disseminated visceral mycosis caused by different Metarhizium granulomatis genotypes in veiled chameleons (Chamaeleo calyptratus) and first isolation in healthy lizards.

    PubMed

    Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2017-08-01

    Metarhizium (M.) granulomatis (formerly Chamaeleomyces granulomatis) invariably causes fatal fungal glossitis and systemic mycosis in veiled chameleons (Chamaeleo calyptratus). Isolation of M. granulomatis in other lizards thus far has not been described. The aim of this study therefore was to obtain information on the presence of M. granulomatis in reptiles kept as pets, and to examine whether there was an association between specific genotypes and clinical/pathological outcomes. Besides 18S ribosomal (r) DNA (SSU) and internal transcribed spacer1-5.8S (ITS1-5.8S) rDNA, a fragment of the large subunit of the 28S rDNA (LSU), including the domains 1 (D1) and D2, were sequenced for identification of the fungus and phylogenetic analysis. Metarhizium granulomatis was isolated from 23 veiled chameleons, two panther chameleons (Furcifer pardalis) and one central bearded dragon (Pogona vitticeps). Only the veiled chameleons revealed corresponding pathological findings in the form of glossal hemorrhage, granulomatous glossitis, pharyngitis, dermatitis and/or visceral mycosis. The infection site correlated to survival times of infected veiled chameleons. Combined long-term treatment with terbinafine and nystatin based on susceptibility testing may be helpful for prevention of disease and visceral spreading of the fungus, but elimination of the fungal pathogen or successful treatment of diseased veiled chameleons have not been achieved yet. Sequencing of the ribosomal genes yielded five different genotypes, with genotype A being strongly correlated with dermatitis, and remaining genotypes with pharyngitis and glossitis. However, disseminated visceral mycosis developed irrespective of the genotypes. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Development of transgenic fungi that kill human malaria parasites in mosquitoes.

    PubMed

    Fang, Weiguo; Vega-Rodríguez, Joel; Ghosh, Anil K; Jacobs-Lorena, Marcelo; Kang, Angray; St Leger, Raymond J

    2011-02-25

    Metarhizium anisopliae infects mosquitoes through the cuticle and proliferates in the hemolymph. To allow M. anisopliae to combat malaria in mosquitoes with advanced malaria infections, we produced recombinant strains expressing molecules that target sporozoites as they travel through the hemolymph to the salivary glands. Eleven days after a Plasmodium-infected blood meal, mosquitoes were treated with M. anisopliae expressing salivary gland and midgut peptide 1 (SM1), which blocks attachment of sporozoites to salivary glands; a single-chain antibody that agglutinates sporozoites; or scorpine, which is an antimicrobial toxin. These reduced sporozoite counts by 71%, 85%, and 90%, respectively. M. anisopliae expressing scorpine and an [SM1](8):scorpine fusion protein reduced sporozoite counts by 98%, suggesting that Metarhizium-mediated inhibition of Plasmodium development could be a powerful weapon for combating malaria.

  18. UV-B radiation-related effects on conidial inactivation and virulence against Ceratitis capitata (Wiedemann) (Diptera; Tephritidae) of phylloplane and soil Metarhizium sp. strains.

    PubMed

    Fernández-Bravo, María; Flores-León, Alejandro; Calero-López, Salvador; Gutiérrez-Sánchez, Fernando; Valverde-García, Pablo; Quesada-Moraga, Enrique

    2017-09-01

    Recent studies have demonstrated the presence of Metarhizium species on the epigeal areas of weeds and woody plants in various Mediterranean ecosystems, and the question arises whether isolates from the phylloplane, which experiences greater exposure to environmental UV-B radiation than soil isolates do, could have better UV-B radiation tolerance. The in vitro response of 18 Metarhizium strains isolated from phylloplane and soil of several Mediterranean ecosystems to UV-B radiation and the in vitro and in vivo effects of UV-B radiation on the viability and virulence of a selected M. brunneum strain against C. capitata were determined. The conidial germination, culturability and colony growth of these strains exposed to 1200mWm(-2) for 2, 4 or 6h were evaluated. Germination rates below 30% and poor conidia recovery rates were observed for all strains. However, no relationship between the Metarhizium species or isolation habitat and the effect of UV-B radiation was found. Strain EAMa 01/58-Su, which showed a high tolerance to UV-B inactivation in terms of relative germination, was subsequently selected to investigate the UV-B related effects on virulence toward C. capitata adults. In a series of bioassays, the virulence and viability was determined using pure dry conidia, which were irradiated with 1200mWm(-2) for 6h prior or after adult flies were inoculated, which resulted in a significant 84.7-86.4% decrease in conidial viability but only a slightly significant reduction of virulence, with 100.0% and 91.4% adult mortality rates and 4.6 and 5.9days average survival time for the no UV-B and UV-B treatments, respectively. A second series of experiments was performed to determine whether the UV-B effects on strain EAMa 01/58-Su were dose- or exposure time-dependent. Adult flies were inoculated with five doses (1.0×10(4)-1.0×10(8)conidiaml(-1)) and then irradiated at 1200mWm(-2) for 6h, and similar LC50 values, 3.8×10(7) and 4.3×10(7)conidiaml(-1), were determined

  19. Potential of Tenebrio molitor (Coleoptera: Tenebrionidae) as a bioassay probe for Metarhizium brunneum (Hypocreales: Clavicipitaceae) activity against Ixodes scapularis (Acari: Ixodidae).

    PubMed

    Bharadwaj, Anuja; Stafford, Kirby C

    2011-12-01

    The yellow mealworm, Tenebrio molitor L., has been used to indicate qualitatively the presence of entomopathogenic fungi in the soil or as a model for evaluating stress and other factors on fungal activity. Although this beetle appears highly susceptible to many of these fungi, little quantitative information is available on the sensitivity of T. molitor to a specific fungus and, therefore, fungal presence or as an indicator for pathogenicity to other species. The purpose of this study was to establish the suitability of T. molitor larvae as a bioassay probe for Metarhizium brunneum for comparison against the blacklegged tick, Ixodes scapularis. Nine concentrations of M. brunneum strain F52 ranging from 1.0 x 10(1) to 8.4 x 10(8) conidial/ml were simultaneously tested against T. molitor larvae and I. scapularis adults. Larvae of yellow mealworm were less sensitive to M. brunneum than I. scapularis adults (LC50's 4.4 x 10(7) and 1.7 x 10(5) conidia/ml, respectively, 4-wk post-treatment). The greater sensitivity of I. scapularis to the fungus suggests that the detection of fungal mycosis in mealworms would indicate sufficient inoculum to be pathogenic to I. scapularis and make this insect a suitable probe for evaluation of the presence and activity of M. brunneum against the blacklegged tick in field applications.

  20. Basic Leucine Zipper (bZIP) Domain Transcription Factor MBZ1 Regulates Cell Wall Integrity, Spore Adherence, and Virulence in Metarhizium robertsii *

    PubMed Central

    Huang, Wei; Shang, Yanfang; Chen, Peilin; Cen, Kai; Wang, Chengshu

    2015-01-01

    Transcription factors (TFs) containing the basic leucine zipper (bZIP) domain are widely distributed in eukaryotes and display an array of distinct functions. In this study, a bZIP-type TF gene (MBZ1) was deleted and functionally characterized in the insect pathogenic fungus Metarhizium robertsii. The deletion mutant (ΔMBZ1) showed defects in cell wall integrity, adhesion to hydrophobic surfaces, and topical infection of insects. Relative to the WT, ΔMBZ1 was also impaired in growth and conidiogenesis. Examination of putative target gene expression indicated that the genes involved in chitin biosynthesis were differentially transcribed in ΔMBZ1 compared with the WT, which led to the accumulation of a higher level of chitin in mutant cell walls. MBZ1 exhibited negative regulation of subtilisin proteases, but positive control of an adhesin gene, which is consistent with the observation of effects on cell autolysis and a reduction in spore adherence to hydrophobic surfaces in ΔMBZ1. Promoter binding assays indicated that MBZ1 can bind to different target genes and suggested the possibility of heterodimer formation to increase the diversity of the MBZ1 regulatory network. The results of this study advance our understanding of the divergence of bZIP-type TFs at both intra- and interspecific levels. PMID:25673695

  1. Interactions of two insect pathogens, Paranosema locustae (Protista: Microsporidia) and Metarhizium acridum (Fungi: Hypocreales), during a mixed infection of Locusta migratoria (Insecta: Orthoptera) nymphs.

    PubMed

    Tokarev, Yuri S; Levchenko, Maxim V; Naumov, Anton M; Senderskiy, Igor V; Lednev, Georgiy R

    2011-02-01

    Locusta migratoria nymphs were fed Paranosema locustae spores and/or surface-treated with Metarhizium acridum 3 (assay 1), 6 (assay 2) or 9 days (assay 3) post microsporidia application (p.m.a.). These three dates corresponded to the key phases of P. locustae development: (a) mass proliferation, (b) transition to sporogenesis and (c) onset of spore maturation, respectively. As a result, locust mortality due to mixed treatment increased slower, equally and faster, as compared to mortality expected from the combination of two pathogens in assays 1-3, respectively. However, a statistically significant difference in survival times was observed only in assay 3, indicating that only at the phase of spore maturation microsporidia drastically increase locust susceptibility to fungal infection. Analysis of perished nymphs showed that fungal treatment 3 days p.m.a. impeded development of microsporidia. Fungal sporulation on locust cadavers was not affected by co-occurring microsporidiosis. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. A bifunctional catalase-peroxidase, MakatG1, contributes to virulence of Metarhizium acridum by overcoming oxidative stress on the host insect cuticle.

    PubMed

    Li, Guohong; Fan, Anni; Peng, Guoxiong; Keyhani, Nemat O; Xin, Jiankang; Cao, Yueqing; Xia, Yuxian

    2017-09-19

    Microbial pathogens are exposed to damaging reactive oxygen species (ROS) produced from a variety of sources including chemical reactions due to exposure to stress (UV, heat) or by hosts as a defense response. Here we demonstrate that a bifunctional catalase-peroxidase, MakatG1, in the locust-specific fungal pathogen, Metarhizium acridum, functions as a ROS detoxification mechanism during host cuticle penetration. MakatG1 expression was highly induced during on-cuticle appressoria development as compared to vegetative (mycelia) growth or during in vivo growth in the insect hemocoel. A MakatG1 deletion mutant strain (ΔMakatG1) showed decreased catalase and peroxidase activities and significantly increased susceptibility to oxidative (H2 O2 and menadione) and UV stress as compared to wild type and complemented strains. Insect bioassays revealed significantly reduced virulence of the ΔMakatG1 mutant when topically inoculated, but no impairment when the insect cuticle was bypassed. Germination and appressoria formation rates for the ΔMakatG1 mutant were decreased on locust wings and quinone/phenolic compounds derived from locust wings, but were not affected on plastic surfaces compared with the wild type strain. These data indicate that MakatG1 plays a pivotal role in penetration, reacting to and detoxifying specific cuticular compounds present on the host cuticle during the early stages of fungal infection. This article is protected by copyright. All rights reserved. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Basic leucine zipper (bZIP) domain transcription factor MBZ1 regulates cell wall integrity, spore adherence, and virulence in Metarhizium robertsii.

    PubMed

    Huang, Wei; Shang, Yanfang; Chen, Peilin; Cen, Kai; Wang, Chengshu

    2015-03-27

    Transcription factors (TFs) containing the basic leucine zipper (bZIP) domain are widely distributed in eukaryotes and display an array of distinct functions. In this study, a bZIP-type TF gene (MBZ1) was deleted and functionally characterized in the insect pathogenic fungus Metarhizium robertsii. The deletion mutant (ΔMBZ1) showed defects in cell wall integrity, adhesion to hydrophobic surfaces, and topical infection of insects. Relative to the WT, ΔMBZ1 was also impaired in growth and conidiogenesis. Examination of putative target gene expression indicated that the genes involved in chitin biosynthesis were differentially transcribed in ΔMBZ1 compared with the WT, which led to the accumulation of a higher level of chitin in mutant cell walls. MBZ1 exhibited negative regulation of subtilisin proteases, but positive control of an adhesin gene, which is consistent with the observation of effects on cell autolysis and a reduction in spore adherence to hydrophobic surfaces in ΔMBZ1. Promoter binding assays indicated that MBZ1 can bind to different target genes and suggested the possibility of heterodimer formation to increase the diversity of the MBZ1 regulatory network. The results of this study advance our understanding of the divergence of bZIP-type TFs at both intra- and interspecific levels. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Dosage Response Mortality of Japanese Beetle, Masked Chafer, and June Beetle (Coleoptera: Scarabaeidae) Adults When Exposed to Experimental and Commercially Available Granules Containing Metarhizium brunneum.

    PubMed

    Behle, Robert W; Goett, Erica J

    2016-05-01

    Field-collected adults of three genera of turf-infesting scarabs, Japanese beetle (Popillia japonica Newman), June beetles (Phyllophaga spp.), and masked chafers (Cyclocephala spp.), were exposed to experimental and commercial granule formulations of the entomopathogenic fungus Metarhizium brunneum (Petch) strain F52 to determine their relative susceptibility. Experimental granules contained microsclerotia produced by liquid fermentation with the ability to produce fresh conidia when rehydrated and commercial granules were Met 52 granular bioinsecticide. All three groups of scarab adults showed a positive dosage response to the fungus when exposed in cups of potting mix treated with the granules. LC50 values for microsclerotia granules were 1.9 × 10(7), 7.1 × 10(6), and 3.2 × 10(6) conidia cup(-1) for P. japonica, Phyllophaga spp., and Cyclocephala spp., respectively. LC50 values for Met 52 granules were 5.9 × 10(7), 5.1 × 10(7), and 7.6 × 10(6) conidia cup(-1), respectively. The experimental granules containing microsclerotia show promise as a viable commercial control agent. They can be produced using lower cost fermentation methods and applied at lower dosages (97 g for 100 m(2) as opposed to 489 g per 100 m(2) for Met 52). If M. brunneum is applied to control the aforementioned white grubs, our data indicate the potential for the adult beetles to also be infected as they enter the soil to lay eggs.

  5. New natural products isolated from Metarhizium robertsii ARSEF 23 by chemical screening and identification of the gene cluster through engineered biosynthesis in Aspergillus nidulans A1145.

    PubMed

    Kato, Hiroki; Tsunematsu, Yuta; Yamamoto, Tsuyoshi; Namiki, Takuya; Kishimoto, Shinji; Noguchi, Hiroshi; Watanabe, Kenji

    2016-07-01

    To rapidly identify novel natural products and their associated biosynthetic genes from underutilized and genetically difficult-to-manipulate microbes, we developed a method that uses (1) chemical screening to isolate novel microbial secondary metabolites, (2) bioinformatic analyses to identify a potential biosynthetic gene cluster and (3) heterologous expression of the genes in a convenient host to confirm the identity of the gene cluster and the proposed biosynthetic mechanism. The chemical screen was achieved by searching known natural product databases with data from liquid chromatographic and high-resolution mass spectrometric analyses collected on the extract from a target microbe culture. Using this method, we were able to isolate two new meroterpenes, subglutinols C (1) and D (2), from an entomopathogenic filamentous fungus Metarhizium robertsii ARSEF 23. Bioinformatics analysis of the genome allowed us to identify a gene cluster likely to be responsible for the formation of subglutinols. Heterologous expression of three genes from the gene cluster encoding a polyketide synthase, a prenyltransferase and a geranylgeranyl pyrophosphate synthase in Aspergillus nidulans A1145 afforded an α-pyrone-fused uncyclized diterpene, the expected intermediate of the subglutinol biosynthesis, thereby confirming the gene cluster to be responsible for the subglutinol biosynthesis. These results indicate the usefulness of our methodology in isolating new natural products and identifying their associated biosynthetic gene cluster from microbes that are not amenable to genetic manipulation. Our method should facilitate the natural product discovery efforts by expediting the identification of new secondary metabolites and their associated biosynthetic genes from a wider source of microbes.

  6. Root environment is a key determinant of fungal entomopathogen endophytism following seed treatment in the common bean, Phaseolus vulgaris

    USDA-ARS?s Scientific Manuscript database

    The common bean is the most important food legume in the world. We examined the potential of the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae applied as seed treatments for their endophytic establishment in the common bean. Endophytic colonization in sterile sand:peat average...

  7. Integrated control of sugarbeet root maggot by using resistant germplasm, an insect pathogen, and an insecticidal seed treatment

    USDA-ARS?s Scientific Manuscript database

    This investigation was carried out during the 2014 growing season to evaluate the following for SBRM management in the Red River Valley growing area: 1) a granular formulation of the fungal insect pathogen, Metarhizium anisopliae (Metschnikoff) Sorokin strain MA1200; 2) an experimental SBRM-resistan...

  8. Relationship of black vine weevil egg density and damage to two cranberry cultivars

    USDA-ARS?s Scientific Manuscript database

    Field and laboratory trials compared Metarhizium anisopliae and Steinernema kraussei to imidacloprid for black vine weevil (BVW), Otiorhynchus sulcatus, larval control in cranberry. Two field sites were treated in fall of 2009 and soil samples collected during 2009 and 2010 to assess treatment effic...

  9. Directed Evolution of a Filamentous Fungus for Thermotolerance

    USDA-ARS?s Scientific Manuscript database

    Filamentous fungi represent the most widely used eukaryotic biocatalysts in industrial and chemical applications. Metarhizium anisopliae is a broad-host-range entomopathogenic fungus currently under intensive investigation as a biologically based alternative to chemical pesticides. One of the most p...

  10. Effects of single and combined applications of entomopathogenic fungi and nematodes against Rhynchophorus ferrugineus (Olivier)

    USDA-ARS?s Scientific Manuscript database

    This study was carried out to investigate the insecticidal properties of Beauveria bassiana and Metarhizium anisopliae, and Heterorhabditis bacteriophora Poinar for their virulence against 2nd, 4th and 6th instar larvae of Rhynchophorus ferrugineus (Olivier). Both fungi were either applied alone or ...

  11. Influence of substrate and relative humidity on the efficacy of three entomopathogenic fungi for the hide beetle, Dermestes maculatus

    USDA-ARS?s Scientific Manuscript database

    Dermestes maculatus is carrion feeder that is also a pest of poultry houses, museums, silkworm culture, and many stored foods. The Hypocreales, Beauveria bassiana, Metarhizium anisopliae, and Isaria fumosorosea, were tested for efficacy against D. maculatus larvae on concrete, plastic, leather, and ...

  12. CATALASE FROM A FUNGAL MICROBIAL PESTICIDE INDUCES A UNIQUE IGE RESPONSE.

    EPA Science Inventory

    BALB/c mice exposed by involuntary aspiration to Metarhizium anisopliae extract (MACA), a microbial pesticide, have shown responses characteristic of human allergic lung disease/asthma. IgE-binding proteins have been identified in MACA by Western blot analysis, 2-dimensio...

  13. Molecular characterization and pathogenicity of fungal isolates for use against the small hive beetle (Aethina tumida)

    USDA-ARS?s Scientific Manuscript database

    The analysis of DNA sequences from fungal pathogens obtained from cadavers of the small hive beetle (SHB) collected from several apiaries in Florida revealed a mixture of saprobes and two potential primary entomopathogens, Metarhizium anisopliae and Beauveria bassiana. Spray tower bioassays indicate...

  14. Entomopathogenic Fungi (Hypocreales) for Control of Potato Psyllid

    USDA-ARS?s Scientific Manuscript database

    Laboratory and field trials of the four isolates of entomopathogenic fungi, Isaria fumosorosea and Metarhizium anisopliae were conducted to evaluate their potential for control of the potato psyllid. In the laboratory, 2 ml aqueous suspension of 107conidia/ml in a of each isolate applied in a Potte...

  15. CATALASE FROM A FUNGAL MICROBIAL PESTICIDE INDUCES A UNIQUE IGE RESPONSE.

    EPA Science Inventory

    BALB/c mice exposed by involuntary aspiration to Metarhizium anisopliae extract (MACA), a microbial pesticide, have shown responses characteristic of human allergic lung disease/asthma. IgE-binding proteins have been identified in MACA by Western blot analysis, 2-dimensio...

  16. Mass production of entomopathogenic hypocreales

    USDA-ARS?s Scientific Manuscript database

    The Hypocreales, Beauveria bassiana, Metarhizium anisopliae sensu lato, Isaria fumosorosea and I. farinosus, and Nomuraea rileyi, have become important insect control agents in recent times and consequently subjects of much scientific study and development. Mass production of infective stages is imp...

  17. Efficacy of entomopathogenic fungi in suppressing pecan weevil, Curculio caryae (Coleoptera: Curculionidae) in commercial pecan orchards

    USDA-ARS?s Scientific Manuscript database

    The pecan weevil, Curculio caryae (Horn), is a key pest of pecans. Here we report the efficacy of entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae applied to trees in grower orchards at three locations. In Fort Valley, Georgia, treatments included B. bassiana applied to the tru...

  18. Abundance of soil-borne entomopathogenic fungi in organic and conventional fields in the Midwestern USA with an emphasis on the effect of herbicides and fungicides on fungal persistence

    USDA-ARS?s Scientific Manuscript database

    Naturally-occurring entomopathogenic fungi provide a valued service of killing agricultural pests and subduing pest outbreaks. Species such as Beauveria bassiana and Metarhizium anisopliae have been researched in many experiments and have proven to be effective pathogens. This research will focus ...

  19. Efficacy of entomopathogenic hypocrealean fungi against Periplaneta americana.

    PubMed

    Hubner-Campos, Rayssa Fátima; Leles, Renan Nunes; Rodrigues, Juscelino; Luz, Christian

    2013-12-01

    The American cockroach Periplaneta americana, one of the worlds' most important urban insect pests was tested with entomopathogenic fungi. Most promising Metarhizium anisopliae, Metarhizium robertsii and Beauveria bassiana killed nymphs (≥ 81.7% mortality, 25 days after treatment), and these fungi developed on all dead insects. Other fungi tested were less virulent (Metarhizium frigidum and Purpureocillium lilacinum) or avirulent (Isaria cateniobliqua, Isaria farinosa, Simplicillium lanosoniveum, Sporothrix insectorum and Tolypocladium cylindrosporum). Intrageneric and intraspecific variability of fungal activity was detected. Adults were highly susceptible, and oothecae proved to be more resistant than nymphs and adults to infection with M. anisopliae IP 46. Findings of the study underscore the potential of fungi as biocontrol agents against this pest.

  20. Australian species of Elaphomyces (Elaphomycetaceae, Eurotiales, Ascomycota)

    Treesearch

    Michael A. Castellano; James M. Trappe; Karl. Vernes

    2011-01-01

    The sequestrate ascomycete genus Elaphomyces is described and illustrated from Australia. The following thirteen new species are described: Elaphomyces aurantias, E. austrogranulatus, E. chlorocarpus, E. cooloolanus, E. coralloideus, E. laetiluteus, E. nothofagi, E. pedicellaris, E. queenslandicus, E. rugosisporus, E. suejoyceae, E....

  1. Magnaporthiopsis, a new genus in Magnaporthaceae (Ascomycota).

    PubMed

    Luo, Jing; Zhang, Ning

    2013-01-01

    The phylogenetic relationships among taxa in the Magnaporthaceae are investigated based on DNA sequences of multiple genes including SSU, ITS, LSU, MCM7, RPB1 and TEF1. The genera Magnaporthe and Gaeumannomyces are shown to be polyphyletic and their members are divided into four major groups based on the phylogenetic analyses. Considering morphological, biological and molecular data, we establish a new genus, Magnaporthiopsis. It is characterized by black and globose perithecia with a cylindrical neck, two-layered perithecial wall, clavate asci with a refractive apical ring, fusiform to fusoid and septate ascospores, simple hyphopodia, and Phialophora-like anamorph. Species in this genus are necrotrophic parasites infecting roots of grasses. Three new combinations, Magnaporthiopsis poae, M. rhizophila and M. incrustans, are proposed accordingly. Pyricularia is suggested as the generic name for the rice blast fungus over Magnaporthe, following Article 59.1 of the International Code of Nomenclature for algae, fungi and plants. A new combination, Nakataea oryzae, is proposed for the rice stem rot fungus.

  2. Diversity and genetic population structure of fungal pathogens infecting white grub larvae in agricultural soils.

    PubMed

    Carrillo-Benítez, María G; Guzmán-Franco, Ariel W; Alatorre-Rosas, Raquel; Enríquez-Vara, Jhony N

    2013-02-01

    White grub larvae are important soil-dwelling pests in many regions of Mexico as they attack many important crops such as maize. The use of synthetic chemicals is currently the main control strategy, but they are not always effective; thus, other alternatives are needed. Microbial control using entomopathogenic fungi represents an important alternative strategy, and species within the genera Beauveria and Metarhizium are considered amongst the most promising candidates. Seventeen Beauveria spp. and two Metarhizium spp. isolates were obtained in surveys of white grub larvae from different regions of Guanajuato, Mexico. All isolates were capable of infecting healthy larvae of the white grub Phyllophaga polyphilla in laboratory assays, but mortality never exceeded 50 %. Isolates were identified using morphological and molecular methods. Based on elongation factor1-α and ITS partial gene sequence data, all Beauveria isolates were identified as Beauveria pseudobassiana. Elongation factor1-α and β-tubulin sequence data identified the Metarhizium isolates to be Metarhizium pingshaense. In contrast, three additional Metarhizium isolates obtained the previous year in the same region were identified as M. pingshaense, Metarhizium anisopliae and Metarhizium robertsii. Microsatellite genotyping showed that all B. pseudobassiana isolates were the same haplotype. Enterobacterial Repetitive Intergenic Consensus fingerprinting information confirmed no significant variation amongst the B. pseudobassiana isolates. The ecological role of these isolates and their impact on white grub larvae populations are discussed.

  3. Biocontrol Potential of Siderophore Producing Heavy Metal Resistant Alcaligenes sp. and Pseudomonas aeruginosa RZS3 vis-à-vis Organophosphorus Fungicide.

    PubMed

    Sayyed, R Z; Patel, P R

    2011-07-01

    In present study in vitro phytopathogen suppression activity of siderophoregenic preparations of Ni and Mn resistant Alcaligenes sp. STC1 and Pseudomonas aeruginosa RZS3 SH-94B isolated from soil were found superior over the chemical pesticide. Siderophore rich culture broth and siderophore rich supernatant exerted antifungal activity against Aspergillus niger NCIM 1025, Aspergillus flavus NCIM 650, Fusarium oxysporum NCIM 1281, Alternaria alternata ARI 715, Cercospora arachichola, Metarhizium anisopliae NCIM 1311 and Pseudomonas solanacerum NCIM 5103. Siderophore rich broth and supernatant exhibited potent antifungal activity vis-à-vis oraganophosphorus chemical fungicide; kitazine. The minimum fungicidal concentration required was 25 μl for Aspergillus niger, Aspergillus flavus, Fusarium oxysporum, Cercospora arachichola, Metarhizium anisopliae, Pseudomonas solanacerum and 75 μl for A. alternata.

  4. Let your enemy do the work: within-host interactions between two fungal parasites of leaf-cutting ants.

    PubMed

    Hughes, W O H; Boomsma, J J

    2004-02-07

    Within-host competition is an important factor in host-parasite relationships, yet most studies consider interactions involving only single parasite species. We investigated the interaction between a virulent obligate entomopathogenic fungus, Metarhizium anisopliae var. anisopliae, and a normally avirulent, opportunistic fungal pathogen, Aspergillus flavus, in their leaf-cutting ant host, Acromyrmex echinatior. Surprisingly, the latter normally out-competed the former in mixed infections and had enhanced fitness relative to when infecting in isolation. The result is most probably due to Metarhizium inhibiting the host's immune defences, which would otherwise normally prevent infections by Aspergillus. With the host defences negated by the virulent parasite, the avirulent parasite was then able to out-compete its competitor. This result is strikingly similar to that seen in immunocompromised vertebrate hosts and indicates that avirulent parasites may play a more important role in host life histories than is generally realized.

  5. [Selection of isolates of entomopathogenic fungi for controlling Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and their compatibility with insecticides used in tomato crop].

    PubMed

    Pires, Lauricí M; Marques, Edmilson J; Oliveira, José V de; Alves, Sérgio B

    2010-01-01

    The activity of Metarhizium anisopliae and Beauveria bassiana towards eggs and larvae of Tuta absoluta (Meyrick) was evaluated. Our data showed that the isolates were pathogenic to both developmental stages tested and the eggs were more susceptible than the 1st instars. The isolates URPE-6 and URPE-19 of M. anisopliae were more pathogenic to eggs and larvae, respectively. The compatibility of these two isolates with the insecticides chlorfenapyr, spinosad, indoxacarb, abamectin, and neem were evaluated. Spinosad and indoxacarb were compatible with the two M. anisopliae isolates in all tested concentrations. At the average recommended concentration, chlorfenapyr was compatible to URPE-6 and abamectin to UFPE-19. The use of entomopathogenic fungi associated with compatible insecticides may be a useful alternative to control T. absoluta.

  6. Comparative genome analysis of entomopathogenic fungi reveals a complex set of secreted proteins.

    PubMed

    Staats, Charley Christian; Junges, Angela; Guedes, Rafael Lucas Muniz; Thompson, Claudia Elizabeth; de Morais, Guilherme Loss; Boldo, Juliano Tomazzoni; de Almeida, Luiz Gonzaga Paula; Andreis, Fábio Carrer; Gerber, Alexandra Lehmkuhl; Sbaraini, Nicolau; da Paixão, Rana Louise de Andrade; Broetto, Leonardo; Landell, Melissa; Santi, Lucélia; Beys-da-Silva, Walter Orlando; Silveira, Carolina Pereira; Serrano, Thaiane Rispoli; de Oliveira, Eder Silva; Kmetzsch, Lívia; Vainstein, Marilene Henning; de Vasconcelos, Ana Tereza Ribeiro; Schrank, Augusto

    2014-09-29

    Metarhizium anisopliae is an entomopathogenic fungus used in the biological control of some agricultural insect pests, and efforts are underway to use this fungus in the control of insect-borne human diseases. A large repertoire of proteins must be secreted by M. anisopliae to cope with the various available nutrients as this fungus switches through different lifestyles, i.e., from a saprophytic, to an infectious, to a plant endophytic stage. To further evaluate the predicted secretome of M. anisopliae, we employed genomic and transcriptomic analyses, coupled with phylogenomic analysis, focusing on the identification and characterization of secreted proteins. We determined the M. anisopliae E6 genome sequence and compared this sequence to other entomopathogenic fungi genomes. A robust pipeline was generated to evaluate the predicted secretomes of M. anisopliae and 15 other filamentous fungi, leading to the identification of a core of secreted proteins. Transcriptomic analysis using the tick Rhipicephalus microplus cuticle as an infection model during two periods of infection (48 and 144 h) allowed the identification of several differentially expressed genes. This analysis concluded that a large proportion of the predicted secretome coding genes contained altered transcript levels in the conditions analyzed in this study. In addition, some specific secreted proteins from Metarhizium have an evolutionary history similar to orthologs found in Beauveria/Cordyceps. This similarity suggests that a set of secreted proteins has evolved to participate in entomopathogenicity. The data presented represents an important step to the characterization of the role of secreted proteins in the virulence and pathogenicity of M. anisopliae.

  7. Understanding phenotypical character evolution in parmelioid lichenized fungi (Parmeliaceae, Ascomycota).

    PubMed

    Divakar, Pradeep K; Kauff, Frank; Crespo, Ana; Leavitt, Steven D; Lumbsch, H Thorsten

    2013-01-01

    Parmelioid lichens form a species-rich group of predominantly foliose and fruticose lichenized fungi encompassing a broad range of morphological and chemical diversity. Using a multilocus approach, we reconstructed a phylogeny including 323 OTUs of parmelioid lichens and employed ancestral character reconstruction methods to understand the phenotypical evolution within this speciose group of lichen-forming fungi. Specifically, we were interested in the evolution of growth form, epicortex structure, and cortical chemistry. Since previous studies have shown that results may differ depending on the reconstruction method used, here we employed both maximum-parsimony and maximum-likelihood approaches to reconstruct ancestral character states. We have also implemented binary and multistate coding of characters and performed parallel analyses with both coding types to assess for potential coding-based biases. We reconstructed the ancestral states for nine well-supported major clades in the parmelioid group, two higher-level sister groups and the ancestral character state for all parmelioid lichens. We found that different methods for coding phenotypical characters and different ancestral character state reconstruction methods mostly resulted in identical reconstructions but yield conflicting inferences of ancestral states, in some cases. However, we found support for the ancestor of parmelioid lichens having been a foliose lichen with a non-pored epicortex and pseudocyphellae. Our data suggest that some traits exhibit patterns of evolution consistent with adaptive radiation.

  8. Understanding Phenotypical Character Evolution in Parmelioid Lichenized Fungi (Parmeliaceae, Ascomycota)

    PubMed Central

    Divakar, Pradeep K.; Kauff, Frank; Crespo, Ana; Leavitt, Steven D.; Lumbsch, H. Thorsten

    2013-01-01

    Parmelioid lichens form a species-rich group of predominantly foliose and fruticose lichenized fungi encompassing a broad range of morphological and chemical diversity. Using a multilocus approach, we reconstructed a phylogeny including 323 OTUs of parmelioid lichens and employed ancestral character reconstruction methods to understand the phenotypical evolution within this speciose group of lichen-forming fungi. Specifically, we were interested in the evolution of growth form, epicortex structure, and cortical chemistry. Since previous studies have shown that results may differ depending on the reconstruction method used, here we employed both maximum-parsimony and maximum-likelihood approaches to reconstruct ancestral character states. We have also implemented binary and multistate coding of characters and performed parallel analyses with both coding types to assess for potential coding-based biases. We reconstructed the ancestral states for nine well-supported major clades in the parmelioid group, two higher-level sister groups and the ancestral character state for all parmelioid lichens. We found that different methods for coding phenotypical characters and different ancestral character state reconstruction methods mostly resulted in identical reconstructions but yield conflicting inferences of ancestral states, in some cases. However, we found support for the ancestor of parmelioid lichens having been a foliose lichen with a non-pored epicortex and pseudocyphellae. Our data suggest that some traits exhibit patterns of evolution consistent with adaptive radiation. PMID:24312438

  9. Australasian sequestrate fungi 17: The genus Hydnoplicata (Ascomycota, Pezizacae) resurrected

    Treesearch

    James M. Trappe; Andrew W. Claridge

    2006-01-01

    The genus Hydnoplicata and its type species, H. whitei, were described by Gilkey in 1954. Having discovered that it has amyloid asci and other characters that relate it to the genus Peziza, Trappe later proposed the new combination, Peziza whiten, even though the species is consistently...

  10. Sequestrate fungi of New Zealand: Elaphomyces (Ascomycota, Eurotiales, Elaphomycetaceae)

    Treesearch

    Michael A. Castellano; Ross E. Beever; James M. Trappe

    2012-01-01

    Four species of the sequestrate fungal genus Elaphomyces are reported from New Zealand: Elaphomyces bollardii sp. nov. associated with Leptospermum spp. and Kunzea ericoides, E. luteicrustus sp. nov. associated with Nothofagus menziesii, E. putridus sp. nov. associated with...

  11. The Genus Letrouitia (Letrouitiaceae: Lichenized Ascomycota) New to Cambodia

    PubMed Central

    Shi, Haixia; Qian, Zigang; Wang, Xinyu; Liu, Dong; Zhang, Yanyun; Ye, Xin; Harada, Hiroshi

    2015-01-01

    The genus Letrouitia is newly recorded for Cambodia, including the four species as L. domingensis, L. leprolytoides, L. sayeri, and L. subvulpina. A brief description and illustrations are provided. PMID:26190924

  12. Molecular phylogeny and evolution of the genus Neoerysiphe (Erysiphaceae, Ascomycota).

    PubMed

    Takamatsu, Susumu; Havrylenko, Maria; Wolcan, Silvia M; Matsuda, Sanae; Niinomi, Seiko

    2008-06-01

    The genus Neoerysiphe belongs to the tribe Golovinomyceteae of the Erysiphaceae together with the genera Arthrocladiella and Golovinomyces. This is a relatively small genus, comprising only six species, and having ca 300 species from six plant families as hosts. To investigate the molecular phylogeny and evolution of the genus, we determined the nucleotide sequences of the rDNA ITS regions and the divergent domains D1 and D2 of the 28S rDNA. The 30 ITS sequences from Neoerysiphe are divided into three monophyletic groups that are represented by their host families. Groups 1 and 3 consist of N. galeopsidis from Lamiaceae and N. galii from Rubiaceae, respectively, and the genetic diversity within each group is extremely low. Group 2 is represented by N. cumminsiana from Asteraceae. This group also includes Oidium baccharidis, O. maquii, and Oidium spp. from Galinsoga (Asteraceae) and Aloysia (Verbenaceae), and is further divided into four subgroups. N. galeopsidis is distributed worldwide, but is especially common in western Eurasia from Central Asia to Europe. N. galii is also common in western Eurasia. In contrast, the specimens of group 2 were all collected in the New World, except for one specimen that was collected in Japan; this may indicate a close relationship of group 2 with the New World. Molecular clock calibration demonstrated that Neoerysiphe split from other genera of the Erysiphaceae ca 35-45M years ago (Mya), and that the three groups of Neoerysiphe diverged between 10 and 15Mya, in the Miocene. Aloysia citriodora is a new host for the Erysiphaceae and the fungus on this plant is described as O. aloysiae sp. nov.

  13. The rise and fall of Sarawakus (Hypocreaceae, Ascomycota)

    PubMed Central

    Jaklitsch, Walter M.; Lechat, Christian; Voglmayr, Hermann

    2014-01-01

    Species of Sarawakus are rarely encountered. Their teleomorphs resemble sexual stages of Trichoderma, formerly called Hypocrea, but differ from that genus by unicellular ascospores. The two greenspored species S. britannicus and the type species of Sarawakus, S. lycogaloides, recently were collected, compared with their types and cultured. We redescribe and illustrate these species and transfer them to Trichoderma, based on phylogenetic analysis of the translation elongation factor 1-alpha encoding gene (tef1), containing the two last introns and exon, and a part of the rpb2 gene, encoding the second largest RNA polymerase subunit. Trichoderma lycogaloides, was found to cluster with Hypocrea sulawesensis, an unusual species of Trichoderma, while T. britannicum is closely related to T. aerugineum of the Spinulosa clade. The anamorphs of the two examined species are characterized by (odd) verticillium-like conidiophores, large cylindrical phialides and conidia, which belong to the largest of those species forming green conidia, oval to subglobose in T. lycogaloides and oblong in T. britannicum. All species currently recognized in Sarawakus are transferred to Trichoderma, introducing the new combinations T. fragile, T. hexasporum, T. izawae, T. sordidum, T. subtrachycarpum, T. succisum and T. trachycarpum and the new name T. rosellum. Trichoderma trachycarpum is redescribed and illustrated from an isotype. PMID:24603837

  14. New Elaphomyces species (Elaphomycetaceae, Eurotiales, Ascomycota) from Guyana

    Treesearch

    Michael A. Castellano; Terry W. Henkel; Steven L. Miller; Matthew E. Smith; M. Catherine. Aime

    2012-01-01

    Elaphomyces compleximurus sp. nov. and E. digitatus sp. nov. are described from the Pakaraima Mountains of Guyana. Macromorphological, micromorphological, habitat and DNA sequence data are provided for each new species. This is the first report of Elaphomyces ascomata associated with ectomycorrhizal members of the Fabaceae and also...

  15. Australasian sequestrate fungi 17: the genus Hydnoplicata (Ascomycota, Pezizaceae) resurrected.

    Treesearch

    James M. Trappe; Andrew W. Claridge

    2006-01-01

    The genus Hydnoplicata and its type species, H. whitei, were described by Gilkey in 1954. Having discovered that it has amyloid asci and other characters that relate it to the genus Peziza, Trappe later proposed the new combination, Peziza whitei, even though the species is consistently...

  16. Recommendations on generic names competing for use in Leotiomycetes (Ascomycota).

    PubMed

    Johnston, Peter R; Seifert, Keith A; Stone, Jeffrey K; Rossman, Amy Y; Marvanová, Ludmila

    2014-06-01

    In advancing to one scientific name for fungi, this paper treats genera competing for use in the phylogenetically defined class Leotiomycetes except for genera of Erysiphales. Two groups traditionally included in the so-called "inoperculate discomycetes" have been excluded from this class and are also not included here, specifically Geoglossomycetes and Orbiliomycetes. A recommendation is made about the generic name to use in cases in which two or more generic names are synonyms or taxonomically congruent along with the rationale for the recommendation. In some cases the recommended generic name does not have priority or is based on an asexual type species, thus needs to be protected and ultimately approved according to Art. 57.2 of the International Code of Nomenclature for algae, fungi and plants (ICN). A table is presented listing all competing generic names and their type species noting the recommended generic name. New combinations are introduced for the oldest epithet in the recommended genus including Ascocalyx berenice, Ascoconidium purpurascens, Ascocoryne albida, A. trichophora, Blumeriella filipendulae, B. ceanothi, Botrytis arachidis, B. fritillariae-pallidoflori, Calloria urticae, Calycellina aspera, Dematioscypha delicata, Dermea abietinum, D. boycei, D. stellata, Diplocarpon alpestre, D. fragariae, Godroniopsis peckii, Grovesinia moricola, Heterosphaera sublineolata, Hyphodiscus brachyconium, H. brevicollaris, H. luxurians, Leptotrochila campanulae, Monilinia polystroma, Neofabraea actinidae, N. citricarpa, N. vagabunda, Oculimacula aestiva, O. anguioides, Pezicula brunnea, P. californiae, P. cornina, P. diversispora, P. ericae, P. melanogena, P. querciphila, P. radicicola, P. rhizophila, Phialocephala piceae, Pilidium lythri, Rhabdocline laricis, Streptotinia streptothrix, Symphyosirinia parasitica, S. rosea, Unguiculariopsis caespitosa, and Vibrissea laxa.

  17. Accelerated evolutionary rates in tropical and oceanic parmelioid lichens (Ascomycota)

    PubMed Central

    2008-01-01

    Background The rate of nucleotide substitutions is not constant across the Tree of Life, and departures from a molecular clock have been commonly reported. Within parmelioid lichens, the largest group of macrolichens, large discrepancies in branch lengths between clades were found in previous studies. Using an extended taxon sampling, we test for presence of significant rate discrepancies within and between these clades and test our a priori hypothesis that such rate discrepancies may be explained by shifts in moisture regime or other environmental conditions. Results In this paper, the first statistical evidence for accelerated evolutionary rate in lichenized ascomycetes is presented. Our results give clear evidence for a faster rate of evolution in two Hypotrachyna clades that includes species occurring in tropical and oceanic habitats in comparison with clades consisting of species occurring in semi-arid and temperate habitats. Further we explore potential links between evolutionary rates and shifts in habitat by comparing alternative Ornstein-Uhlenbeck models. Conclusion Although there was only weak support for a shift at the base of a second tropical clade, where the observed nucleotide substitution rate is high, overall support for a shift in environmental conditions at cladogenesis is very strong. This suggests that speciation in some lichen clades has proceeded by dispersal into a novel environment, followed by radiation within that environment. We found moderate support for a shift in moisture regime at the base of one tropical clade and a clade occurring in semi-arid regions and a shift in minimum temperature at the base of a boreal-temperate clade. PMID:18808710

  18. Genetic engineering of fungal biocontrol agents to achieve greater efficacy against insect pests.

    PubMed

    St Leger, Raymond J; Wang, Chengshu

    2010-01-01

    Molecular biology methods have elucidated pathogenic processes in several fungal biocontrol agents including two of the most commonly applied entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana. In this review, we describe how a combination of molecular techniques has: (1) identified and characterized genes involved in infection; (2) manipulated the genes of the pathogen to improve biocontrol performance; and (3) allowed expression of a neurotoxin from the scorpion Androctonus australis. The complete sequencing of four exemplar species of entomopathogenic fungi including B. bassiana and M. anisopliae will be completed in 2010. Coverage of these genomes will help determine the identity, origin, and evolution of traits needed for diverse lifestyles and host switching. Such knowledge combined with the precision and malleability of molecular techniques will allow design of multiple pathogens with different strategies to be used for different ecosystems and avoid the possibility of the host developing resistance.

  19. Resource competition between two fungal parasites in subterranean termites

    NASA Astrophysics Data System (ADS)

    Chouvenc, Thomas; Efstathion, Caroline A.; Elliott, Monica L.; Su, Nan-Yao

    2012-11-01

    Subterranean termites live in large groups in underground nests where the pathogenic pressure of the soil environment has led to the evolution of a complex interaction among individual and social immune mechanisms in the colonies. However, groups of termites under stress can show increased susceptibility to opportunistic parasites. In this study, an isolate of Aspergillus nomius Kurtzman, Horn & Hessltine was obtained from a collapsed termite laboratory colony. We determined that it was primarily a saprophyte and, secondarily, a facultative parasite if the termite immunity is undergoing a form of stress. This was determined by stressing individuals of the Formosan subterranean termite Coptotermes formosanus Shiraki via a co-exposure to the virulent fungal parasite Metarhizium anisopliae (Metch.) Sorokin. We also examined the dynamics of a mixed infection of A. nomius and M. anisopliae in a single termite host. The virulent parasite M. anisopliae debilitated the termite immune system, but the facultative, fast growing parasite A. nomius dominated the mixed infection process. The resource utilization strategy of A. nomius during the infection resulted in successful conidia production, while the chance for M. anisopliae to complete its life cycle was reduced. Our results also suggest that the occurrence of opportunistic parasites such as A. nomius in collapsing termite laboratory colonies is the consequence of a previous stress, not the cause of the stress.

  20. Occurrence of Entomopathogenic Fungi from Agricultural and Natural Ecosystems in Saltillo, México, and their Virulence Towards Thrips and Whiteflies

    PubMed Central

    Sánchez-Peña, Sergio R.; Lara, Jorge San-Juan; Medina, Raúl F.

    2011-01-01

    Entomopathogenic fungi were collected from soil in four adjacent habitats (oak forest, agricultural soil, pine reforestation and chaparral habitat) in Saltillo, México using the insect bait method with Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) larvae as bait. Overall, of the larvae exposed to soil, 171 (20%) hosted Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Cordycipitaceae), 25 (3%) hosted Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae) and 1 (0.1%) hosted lsaria (=Paecilomyces) sp. (Hypocreales: Cordycipitaceae). B. bassiana was significantly more frequent on larvae exposed to oak forest soil. M. anisopliae was significantly more frequent on larvae exposed to agricultural soil. From the infected bait insects, 93 isolates of B. bassiana and 24 isolates of M. anisopliae were obtained. Strains were tested for their infectivity against Cuban laurel thrips, Gynaikothrips uzeli Zimmerman (Thysanoptera: Phlaeothripidae) and the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) (Hemiptera: Aleyrodidae). B. bassiana isolates caused the highest mortality on thrips (some causing 88% mortality after 6 days); both fungal species caused similarly high mortality levels against whiteflies (75%) after 6 days. Large amounts of germplasm of entomopathogenic fungi, fundamentally B. bassiana and M. anisopliae, exist in the habitats sampled; pathogenicity varied among strains, and some strains possessed significant virulence. Soils in these habitats are reservoirs of diverse strains with potential for use in biocontrol. PMID:21521145

  1. Effect of certain entomopathogenic fungi on oxidative stress and mortality of Periplaneta americana.

    PubMed

    Chaurasia, Abhilasha; Lone, Yaqoob; Wani, Owais; Gupta, U S

    2016-02-01

    The present paper reports the effects of Metarhizium anisopliae, Isaria fumosoroseus and Hirsutella thompsonaii on Periplaneta americana. I. fumosoroseus and H. thompsonaii were cultured at 28±1°C on potato carrot agar and M. anisopliae was cultured at 28±1°C on potato dextrose agar for 14days. Conidial suspensions of fungi were given to cockroaches through different routes. M. anisopliae shows high virulence against adult cockroaches and mortality ranges from 38.65% to 78.36% after 48h. I. fumosoroseus and H. thompsonii show less virulence compared to M. anisopliae. We also investigated the effect of these three fungi on the activity of lactate dehydrogenase, lipid peroxidation and catalase in different tissues of the insect to gain an understanding of the different target site. The result suggested that the activity of lactate dehydrogenase, catalase and level of malondialdehyde varies in different organs and through different routes of exposure. Based on mortality percentages, all tested fungi had high potentials for biocontrol agents against P. americana. Our study reveals for the first time that I. fumosoroseus and H. thompsonaii fungal infections initiate oxidative stress in the midgut, fat body, whole body and hemolymph of cockroach thereby suggesting them to be the target organs for oxidative damage.

  2. A proposed role for the cuticular fatty amides of Liposcelis bostrychophila (Psocoptera: Liposcelidae) in preventing adhesion of entomopathogenic fungi with dry-conidia.

    PubMed

    Lord, Jeffrey C; Howard, Ralph W

    2004-08-01

    Maximum challenge exposure of Liposcelis bostrychophila to Beauveria bassiana, Paecilomyces fumosoroseus, Aspergillus parasiticus or Metarhizium anisopliae resulted in no more than 16% mortality. We investigated several of L. bostrychophila's cuticular lipids for possible contributions to its tolerance for entomopathogenic fungi. Saturated C14 and C16 fatty acids did not reduce the germination rates of B. bassiana or M. anisopliae conidia. Saturated C6 to C12 fatty acids that have not been identified in L. bostrychophila cuticular extracts significantly reduced germination, but the reduction was mitigated by the presence of stearamide. Cis-6-hexadecenal did not affect germination rates. Mycelial growth of either fungal species did not occur in the presence of caprylic acid, was reduced by the presence of lauric acid, and was not significantly affected by palmitic acid. Liposcelis bostrychophila is the only insect for which fatty acid amides have been identified as cuticular components. Stearamide, its major fatty amide, did not reduce germination of B. bassiana or M. anisopliae conidia or growth of their mycelia. Adhesion of conidia to stearamide preparations did not differ significantly from adhesion to the cuticle of L. bostrychophila. Pretreatment of a beetle known to be fungus-susceptible, larval Oryzaephilus surinamensis, with stearamide significantly decreased adhesion of B. bassiana or M. anisopliae conidia to their cuticles. This evidence indicates that cuticular fatty amides may contribute to L. bostrychophila's tolerance for entomopathogenic fungi by decreasing hydrophobicity and static charge, thereby reducing conidial adhesion.

  3. Unveiling the oxidative metabolism of Rhipicephalus microplus (Acari: Ixodidae) experimentally exposed to entomopathogenic fungi.

    PubMed

    Tunholi-Alves, Vinícius Menezes; Tunholi Alves, Victor Menezes; da Silva, Jairo Pinheiro; Nora Castro, Rosane; Salgueiro, Fernanda Barbosa; Perinotto, Wendell Marcelo de Souza; Gôlo, Patrícia Silva; Camargo, Mariana Guedes; Angelo, Isabele da Costa; Bittencourt, Vânia Rita Elias Pinheiro

    2016-10-01

    Rhipicephalus microplus is an important tick in tropical regions due to the high economic losses caused by its parasitism. Metarhizium anisopliae and Beauveria bassiana are well-known entomopathogenic fungi that can afflict R. microplus ticks. The development of new targets and strategies to control this parasite can be driven by studies of this tick's physiology. Recently, it was reported that when exposed to adverse physiological conditions, ticks can activate fermentative pathways, indicating transition from aerobic to anaerobic metabolism. Nevertheless, the precise mechanism by which entomopathogenic fungi influence R. microplus metabolism has not been clarified, limiting understanding of the tick-fungus association. Thus, the present study aimed to evaluate the effect of infection of ticks by M. anisopliae and B. bassiana on the amount of selected carboxylic acids present in the hemolymph, enabling increased understanding of changes previously reported. The results showed preservation in the concentrations of oxalic, lactic, and pyruvic acids in the hemolymph 24 and 48 h after dropping from cattle; while there were variations in the concentration of these carboxylic acids after infection of female ticks to M. anisopliae and B. bassiana. Significant increases were observed in the concentration of oxalic and lactic acids and significant reduction of pyruvic acid for both observation times (24 and 48 h) after infection by entomopathogenic fungi. These results indicate that B. bassiana and M. anisopliae infection alters the basal metabolism of R. microplus females, resulting in the activation of fermentative pathways.

  4. Spore Density and Viability of Entomopathogenic Fungal Isolates from Indonesia, and Their Virulence against Aphis gossypii Glover (Homoptera: Aphididae).

    PubMed

    Herlinda, Siti

    2010-08-01

    The focus of this study was on quantifying fitness attributes, such as spore density and viability, and determining the virulence level against aphid (Aphis gossypii) nymphs of isolates from the fungal species Beauveria bassiana and Metarhizium anisopliae. The fungal isolates were obtained from several insects, including Plutella xylostella, Hypothenemus hampei, Bronstispa longissima, A. gossypii, Tenebrio molitor, and Leptocorisa acuta, that were collected from Indonesian islands, such as Sumatera, Java, and Sulawesi. Third instar aphid nymphs were inoculated via topical application of 10(6) conidia ml(-1) of the entomopathogenic fungal isolates. All of the B. bassiana and M. anisopliae isolates could produce very dense spores. The M. anisopliae isolate MaAg, which was obtained from the aphid, had the highest spore density at 6.70 × 10(8) conidia ml(-1). Among the B. bassiana isolates, the highest conidial viability belonged to isolate CPJW8, which was obtained from Chrysodeixis chalcites, with a 39% average viability. Among the M. anisopliae isolates, the highest viabilities belonged to the isolates MaAg and MaLa, which were obtained from L. acuta, with a 33% and 32% average viabilities, respectively. All of the B. bassiana and M. anisopliae isolates were virulent against aphid nymphs, with mortality rates ranging from 64% to 94%. The three most virulent isolates were BBY715 (94%), MPx (92%), and MaTm (92%), and the least virulent isolate was MaLa (64%). BBY715, the most virulent isolate, had the shortest lethal time median (LT50) against aphid nymphs at 2.97 hours, and MaLa had the longest LT50 at 61.81 hours.

  5. Density-dependence and within-host competition in a semelparous parasite of leaf-cutting ants

    PubMed Central

    Hughes, William OH; Petersen, Klaus S; Ugelvig, Line V; Pedersen, Dorthe; Thomsen, Lene; Poulsen, Michael; Boomsma, Jacobus J

    2004-01-01

    Background Parasite heterogeneity and within-host competition are thought to be important factors influencing the dynamics of host-parasite relationships. Yet, while there have been many theoretical investigations of how these factors may act, empirical data is more limited. We investigated the effects of parasite density and heterogeneity on parasite virulence and fitness using four strains of the entomopathogenic fungus, Metarhizium anisopliae var. anisopliae, and its leaf-cutting ant host Acromyrmex echinatior as the model system. Results The relationship between parasite density and infection was sigmoidal, with there being an invasion threshold for an infection to occur (an Allee effect). Although spore production was positively density-dependent, parasite fitness decreased with increasing parasite density, indicating within-host scramble competition. The dynamics differed little between the four strains tested. In mixed infections of three strains the infection-growth dynamics were unaffected by parasite heterogeneity. Conclusions The strength of within-host competition makes dispersal the best strategy for the parasite. Parasite heterogeneity may not have effected virulence or the infection dynamics either because the most virulent strain outcompeted the others, or because the interaction involved scramble competition that was impervious to parasite heterogeneity. The dynamics observed may be common for virulent parasites, such as Metarhizium, that produce aggregated transmission stages. Such parasites make useful models for investigating infection dynamics and the impact of parasite competition. PMID:15541185

  6. Effect of Three Entomopathogenic Fungi on Three Species of Stingless Bees (Hymenoptera: Apidae) Under Laboratory Conditions.

    PubMed

    Toledo-Hernández, R A; Ruíz-Toledo, J; Toledo, J; Sánchez, D

    2016-05-04

    Development of alternative strategies for pest control with reduced effect on beneficial organisms is a priority given the increasing global loss of biodiversity. Biological control with entomopathogenic fungi arises as a viable option to control insect pests. However, few studies have focused on the consequences of using these organisms on pollinators other than the honey bee (Apis mellifera L.) or bumble bees (Bombus spp). We evaluated the pathogenicity of commercial formulations of three widely used entomopathogenic fungi, Metarhizium anisopliae (Metschnikoff) Sorokin, Beauveria bassiana Vuillemin, and Isaria fumosorosea (Wize), to three species of stingless bees: Tetragonisca angustula Latreille, Scaptotrigona mexicana Guérin-Meneville, and Melipona beecheii Bennett. Bioassays consisted of exposing groups of bees to the recommended field concentration of each fungus using a microspray tower under laboratory conditions. Susceptibility to fungi varied greatly among species. Isaria fumosorosea (strain Ifu-lu 01) and the two formulations of B. bassiana (Bea-TNK and BotanicGard) caused <30.3% mortality in all bee species. Metarhizium anisopliae (Meta-TNK and strain Ma-lu 01) was highly active against T. angustula (94.2% mortality) and moderately active against M. beecheii (53.0% mortality) and S. mexicana (38.9% mortality). Though our laboratory-derived results suggest a moderate to high impact of these entomopathogenic fungi on stingless bees, further field studies are required to support this finding.

  7. Mortality and repellent effects of microbial pathogens on Coptotermes formosanus (Isoptera: Rhinotermitidae)

    PubMed Central

    2012-01-01

    Background Two entomopathogenic fungi, Isaria fumosorosea and Metarhizium anisopliae, and one bacterium, Bacillus thuringiensis, were tested for their ability to cause mortality of Formosan subterranean termites (FST), Coptotermes formosanus (Shiraki), after liquid exposure, and for their lack of propensity to repel FST. Results The fungus Isaria fumosorosea at 108 spores/ml caused 72.5% mortality on day 7, significantly higher than the control and 106 spores/ml treatment. On day 14, the 106 and 108 concentrations caused 38.8% and 92.5% mortality, respectively, significantly higher than the control. On day 21, 82.5% and 100% of the termites were killed by the 106 and 108 treatments, respectively. I. fumosorosea did not repel termites at 106 nor 108 spores/g in sand, soil or sawdust. The fungus Metarhizium anisopliae at 108 spores/ml caused 57.5% mortality on day 7, 77.5% mortality on day 14 and 100% mortality on day 21. Conclusions On all three days the rate of mortality was significantly higher than that of the control and 106 spores/ml treatment with I. fumosorosea. Neither I. fumosorosea nor M. anisopliae caused repellency of FST in sand, soil or sawdust. The bacterium Bacillus thuringiensis did not cause significant mortality on days 7, 14 or 21. When termites were exposed to cells of B. thuringiensis in sawdust and when termites were exposed to a mixture of spores and cells in sand, a significantly higher number remained in the control tubes. Repellency was not seen with B. thuringiensis spores alone, nor with the above treatments in the other substrates. PMID:23241169

  8. When Subterranean Termites Challenge the Rules of Fungal Epizootics

    PubMed Central

    Chouvenc, Thomas; Su, Nan-Yao

    2012-01-01

    Over the past 50 years, repeated attempts have been made to develop biological control technologies for use against economically important species of subterranean termites, focusing primarily on the use of the entomopathogenic fungus Metarhizium anisopliae. However, no successful field implementation of biological control has been reported. Most previous work has been conducted under the assumption that environmental conditions within termite nests would favor the growth and dispersion of entomopathogenic agents, resulting in an epizootic. Epizootics rely on the ability of the pathogenic microorganism to self-replicate and disperse among the host population. However, our study shows that due to multilevel disease resistance mechanisms, the incidence of an epizootic within a group of termites is unlikely. By exposing groups of 50 termites in planar arenas containing sand particles treated with a range of densities of an entomopathogenic fungus, we were able to quantify behavioral patterns as a function of the death ratios resulting from the fungal exposure. The inability of the fungal pathogen M. anisopliae to complete its life cycle within a Coptotermes formosanus (Isoptera: Rhinotermitidae) group was mainly the result of cannibalism and the burial behavior of the nest mates, even when termite mortality reached up to 75%. Because a subterranean termite colony, as a superorganism, can prevent epizootics of M. anisopliae, the traditional concepts of epizootiology may not apply to this social insect when exposed to fungal pathogens, or other pathogen for which termites have evolved behavioral and physiological means of disrupting their life cycle. PMID:22470575

  9. RNA binding proteins mediate the ability of a fungus to adapt to the cold.

    PubMed

    Fang, Weiguo; St Leger, Raymond J

    2010-03-01

    Little is known about how fungi adapt to chilling. In eubacteria, cold shock proteins (CSPs) facilitate translation by destabilizing RNA secondary structure. Animals and plants have homologous cold shock domains within proteins, and additional glycine-rich RNA binding proteins (GRPs), but their role in stress resistance is poorly understood. In this study, we identified GRP homologues in diverse fungi. However, only Aspergillus clavatus and Metarhizium anisopliae possessed cold shock domains. Both M. anisopliae's small eubacteria-like CSP (CRP1) and its GRP (CRP2) homologue were induced by cold. Disrupting either Crp1 or Crp2 greatly reduced metabolism and conidial germination rates at low temperatures, and decreased tolerance to freezing. However, while both Crp1 and Crp2 reduced freezing-induced production of reactive oxygen species, only Crp1 protected cells against H(2)O(2) and increased M. anisopliae's virulence to caterpillars. Unlike CRP2, CRP1 rescued the cold-sensitive growth defects of an Escherichia coli CSP deletion mutant, and CRP1 also demonstrated transcription anti-termination activity, so CRP1 can regulate transcription and translation at low temperature. Expressing either Crp1 or Crp2 in yeast increased metabolism at cold temperatures and Crp1 improved tolerance to freezing. Thus besides providing a model relevant to many biological systems, Crp1 and Crp2 have potential applications in biotechnology.

  10. Effect of oil-based formulations of acaripathogenic fungi to control Rhipicephalus microplus ticks under laboratory conditions.

    PubMed

    Camargo, Mariana G; Golo, Patrícia S; Angelo, Isabele C; Perinotto, Wendell M S; Sá, Fillipe A; Quinelato, Simone; Bittencourt, Vânia R E P

    2012-08-13

    The formulations of acaripathogenic fungi to control ticks have been widely studied. The present study evaluated the efficacy of oil-based formulations of Metarhizium anisopliae sensu lato (s.l.), isolate Ma 959, and Beauveria bassiana, isolate Bb 986, on different Rhipicephalus microplus stages, comparing the efficacy between aqueous suspensions and 10, 15 and 20% mineral oil formulations. Twelve groups were formed: one aqueous control group; three mineral oil control groups, at 10, 15 or 20%; two aqueous fungal suspensions of M. anisopliae s.l. or B. bassiana; and three formulations of M. anisopliae (s.l.) or B. bassiana containing 10, 15, and 20% mineral oil. To prepare aqueous suspensions and oily formulations, fungal isolates were cultivated on rice grains in polypropylene bags. The conidial suspensions and formulations had a concentration of 10(8)conidia/mL. Bioassays were repeated twice. After treatment, the following biological parameters of engorged females were evaluated: hatching percentage, egg production index, nutritional index, and percentage of tick control. The following parameters were evaluated in the bioassays with eggs: period of incubation, period of hatch, and hatching percentage. Mortality was evaluated in bioassays with larvae. M. anisopliae s.l. and B. bassiana oil-based formulations were more effective than aqueous suspensions against R. microplus eggs, larvae and engorged females, however, there was no significant difference between the three oil concentrations used. M. anisopliae s.l. and B. bassiana formulated in mineral oil reached 93.69% and 21.67% efficacy, respectively, while M. anisopliae s.l. and B. bassiana aqueous suspensions attained 18.70% and 1.72% efficacy, respectively. M. anisopliae s.l. oil-based formulations caused significant effects in all biological parameters of engorged females while B. bassiana oil-based formulations modified significantly the nutritional index only. Eggs treated with M. anisopliae s.l. and B

  11. Genetic basis of destruxin production in the entomopathogen Metarhizium robertsii

    USDA-ARS?s Scientific Manuscript database

    Destruxins are among the most exhaustively researched secondary metabolites of entomopathogenic fungi, yet definitive evidence for their roles in pathogenicity and virulence has yet to be shown. To establish the genetic bases for the biosynthesis of this family of depsipeptides, we identified a 23,7...

  12. Independent origins of diploidy in the entomopathogen Metarhizium

    USDA-ARS?s Scientific Manuscript database

    Understanding of ploidal variation in fungi lags behind that for plants and animals because cytogenetic tools are often unable to accurately resolve and size the typically small genomes of fungi by traditional optical methods. Variation in ploidal status is frequently associated with changes in phen...

  13. Isolation and Classification of Fungal Whitefly Entomopathogens from Soils of Qinghai-Tibet Plateau and Gansu Corridor in China.

    PubMed

    Dong, Tingyan; Zhang, Bowen; Jiang, Yanfang; Hu, Qiongbo

    2016-01-01

    Qinghai-Tibet Plateau and Gansu Corridor of China with distinct geographic and climatic conditions are remote and less disturbed by humans, in which are likely to find some new strains of fungal entomopathogens against B-biotype whiteflies that is a very important invading pest worldwide. In this research, nineteen strains among six species of entomogenous fungi were isolated from the soil samples collected from 32 locations in Qinghai-Tibet Plateau and Gansu Corridor. From the data of isolation rates, it was indicated that the good biodiversity of entomogenous fungi was found in the soil covered good vegetations. On the contrary, no strains were isolated from the desert areas. In addition, the dominant species, Isaria fumosorosea and Metarhizium anisopliae var. anisopliae in the Qinghai-Tibet Plateau are different from the strains of other places based on ITS genetic homology analysis. It was verified that the Qinghai-Tibet Plateau area was less disturbed by human, and the fungi in this place exchanged less compared with other regional species. All of these strains showed the pathogenicity against the B-biotype whitefly with the mortality of more than 30%. However, a few strains of Paecilomyces lilacinus, Lecanicillium psalliotae, Aspergillus ustus, I. fumosorosea and M. anisopliae var. anisopliae had better virulence with LC50s of 0.36-26.44×106 spores/mL on post-treatment day 6-7. Especially, the L. psalliotae strain LpTS01 was the greatest virulence with LC50 of 0.36×106spores/mL and LT50 of 4.23d. Our research thus presents some new insights to discover new entomopathogenic fungal strains used for B-biotype whitefly biocontrol.

  14. Nomuraea rileyi: a plausible fungi selectively controlling lepidopteron, Paraponyx stratiotata L. damaging queen palm (Livistona rotundifolia L.).

    PubMed

    Svinningen, A E; Jegathambigai, V; Mikunthan, G

    2010-01-01

    Queen Palm (Livistona rotundifolia) is cultivated extensively for both local and foreign ornamental markets with the desired characteristics of even and ever green, pest and disease free healthy palm and quality leaves. The root borer, Paraponyx stratiotata (Lepidoptera) is recently encountered on young palm roots and damaging them within. They emerged as a new pest on L. rotundifolia grown in all the area. Different entomopathogens were evaluated and determined the potential of Nomuroea rileyi selectively due to its greater infective ability. Field collected root borer larvae were reared and N. rileyi was evaluated both in-vitro and in net house conditions. Treatments comprising Beauveria bassiana, Metarhizium anisopliae, Trichoderma sp., N. rileyi, a standard check with 3% Carbofuran and water as a control were evaluated in potted seedlings (3 months old) of queen palms. Among the entomopathogens tested, N. rileyi was found more effective and recorded the best of 61% mortality. Subsequent experiment had been conducted with commercial bio-products alone or in combination with local isolates as treatments; N. rileyi, B. bassiana, M. anisopliae, B. bassiana + M. anisopliae, N. rileyi + M. anisopliae, N. rileyi+ B. bassiana, and water as a control were evaluated. Among these treatments N. rileyi was alone more effective than in combination with or other entomopathogens alone. In vitro study revealed LD50 of N. rileyi as best spore load of 1 x 10(8) spores/ml compare to other treatments. This proves the potential of N. rileyi on P. stratiotata. The application of N. rileyi had claimed not only to reduce the incidence of root damage but also to sustain the growth and vigor of the L. rotundifolia to most fit for exporting.

  15. Isolation and Classification of Fungal Whitefly Entomopathogens from Soils of Qinghai-Tibet Plateau and Gansu Corridor in China

    PubMed Central

    Jiang, Yanfang; Hu, Qiongbo

    2016-01-01

    Qinghai-Tibet Plateau and Gansu Corridor of China with distinct geographic and climatic conditions are remote and less disturbed by humans, in which are likely to find some new strains of fungal entomopathogens against B-biotype whiteflies that is a very important invading pest worldwide. In this research, nineteen strains among six species of entomogenous fungi were isolated from the soil samples collected from 32 locations in Qinghai-Tibet Plateau and Gansu Corridor. From the data of isolation rates, it was indicated that the good biodiversity of entomogenous fungi was found in the soil covered good vegetations. On the contrary, no strains were isolated from the desert areas. In addition, the dominant species, Isaria fumosorosea and Metarhizium anisopliae var. anisopliae in the Qinghai-Tibet Plateau are different from the strains of other places based on ITS genetic homology analysis. It was verified that the Qinghai-Tibet Plateau area was less disturbed by human, and the fungi in this place exchanged less compared with other regional species. All of these strains showed the pathogenicity against the B-biotype whitefly with the mortality of more than 30%. However, a few strains of Paecilomyces lilacinus, Lecanicillium psalliotae, Aspergillus ustus, I. fumosorosea and M. anisopliae var. anisopliae had better virulence with LC50s of 0.36–26.44×106 spores/mL on post-treatment day 6–7. Especially, the L. psalliotae strain LpTS01 was the greatest virulence with LC50 of 0.36×106spores/mL and LT50 of 4.23d. Our research thus presents some new insights to discover new entomopathogenic fungal strains used for B-biotype whitefly biocontrol. PMID:27228109

  16. Immune response of Chilo suppressalis Walker (Lepidoptera: Crambidae) larvae to different entomopathogenic fungi.

    PubMed

    Zibaee, A; Malagoli, D

    2014-04-01

    The current study reports mortality and effects on cellular immune response of several entomopathogenic fungi including isoleates BB1, BB2 and BB3 of Beauveria bassiana, Metarhizium anisopliae, Isaria fumosoroseus and Lecanicilium lecanii against larvae of Chilo suppressalis. Prohemocytes, granulocytes, plasmatocytes and oenocytoids were identified as the main circulating hemocytes in the hemolymph of larvae using Giemsa staining solution. Entomopathogenic fungi caused differential mortality on larvae: BB1, BB3, M. anisopliae lead to the highest mortality on larvae and L. lecanii caused the lowest mortality. The highest numbers of total hemocytes were observed 3 h post-injection of B. bassiana isolates and 6 h for the other treatments. The highest numbers of plasmatocytes were observed 3 h post-injection of BB1 and Tween 80, whereas BB2, BB3, M. anisopliae, I. fumosoroseus and L. lecani caused plasmatocyte increase 6 h post-injection. Similar results were obtained in case of granulocytes but only Tween 80 showed the highest number of hemocytes 3 h post-injection. The highest numbers of nodules were found at various time intervals after injection of fungal isolates and latex bead. The highest activities of phenoloxidase were observed 12 h post-injection by BbB1, BbB3, M. anisopliae and latex bead; 3-6 h post-injection by BbB2, 6 h post-injection by I. fumosoroseus and 3-6 h post-injection by L. lecanii. Our data demonstrate the possibility of utilizing different fungal extracts in the field to help reduce the risk of resistance evolution in C. suppressalis and encourage experimentations aimed to increase the number of biological control agent for insect pests such as the striped rice stem borer C. suppressalis.

  17. Factors affecting fungus-induced larval mortality in Anopheles gambiae and Anopheles stephensi

    PubMed Central

    2010-01-01

    Background Entomopathogenic fungi have shown great potential for the control of adult malaria vectors. However, their ability to control aquatic stages of anopheline vectors remains largely unexplored. Therefore, how larval characteristics (Anopheles species, age and larval density), fungus (species and concentration) and environmental effects (exposure duration and food availability) influence larval mortality caused by fungus, was studied. Methods Laboratory bioassays were performed on the larval stages of Anopheles gambiae and Anopheles stephensi with spores of two fungus species, Metarhizium anisopliae and Beauveria bassiana. For various larval and fungal characteristics and environmental effects the time to death was determined and survival curves established. These curves were compared by Kaplan Meier and Cox regression analyses. Results Beauveria bassiana and Metarhizium anisopliae caused high mortality of An. gambiae and An. stephensi larvae. However, Beauveria bassiana was less effective (Hazard ratio (HR) <1) compared to Metarhizium anisopliae. Anopheles stephensi and An. gambiae were equally susceptible to each fungus. Older larvae were less likely to die than young larvae (HR < 1). The effect of increase in fungus concentration on larval mortality was influenced by spore clumping. One day exposure to fungal spores was found to be equally effective as seven days exposure. In different exposure time treatments 0 - 4.9% of the total larvae, exposed to fungus, showed infection at either the pupal or adult stage. Mortality rate increased with increasing larval density and amount of available food. Conclusions This study shows that both fungus species have potential to kill mosquitoes in the larval stage, and that mortality rate depends on fungus species itself, larval stage targeted, larval density and amount of nutrients available to the larvae. Increasing the concentration of fungal spores or reducing the exposure time to spores did not show a proportional

  18. Phylogeny and taxonomic revision of Thelonectria discophora (Ascomycota, Hypocreales, Nectriaceae) species complex

    USDA-ARS?s Scientific Manuscript database

    Thelonectria discophora (Thelonectria, Nectriaceae, Hypocreales) is a conspicuous group of saprobic fungi on decaying plant material, characterized by red perithecia each with a broad mammiform (nipple-like) apex. The anamorphic state is characterized by a cylindrocarpon-like morphology, with 3–5 se...

  19. A Note on the Lichen Genus Ramalina (Ramalinaceae, Ascomycota) in the Hengduan Mountains in China

    PubMed Central

    Oh, Soon-Ok; Wang, Xin Yu; Wang, Li Song; Liu, Pei Gui

    2014-01-01

    On the basis of extensive field investigation and a series of herbarium specimen identifications, we present and discuss the descriptions and distribution of 22 species of Ramalina found in the Hengduan Mountains of southwestern China. In this revisionary study, representatives of the Ramalina genus, including R. americana, R. confirmata, R. dendriscoides, R. obtusata, R. pacifica, R. pentecostii, R. peruviana, R. shinanoana, and R. subcomplanata are found for the first time in this area. In addition, R. holstii is reported for the first time China. Finally, a newly described species identified as Ramalina hengduanshanensis S. O. Oh & L. S. Wang is reported. It is characterized as growing from a narrow holdfast, solid, sparsely or richly and irregularly dichotomously branched, palmate and flattened lobes with distinctly dorsiventral appearance, surface rugose to reticulate, surface rugosely cracked, dense chondroid tissue, helmet shaped soralia at the tip. The species grows on rock and tree at the highest elevations in this area. Although very few lichen species belonging to the genus Ramalina have been collected above 4,000 m, this new species is found at this elevation. We present detailed morphological, anatomical, and chemical descriptions of this species along with molecular phylogenetic analysis of the internal transcribed spacer rDNA sequences. PMID:25346599

  20. Two Species of Bryoria (Lichenized Ascomycota, Parmeliaceae) from the Sino-Himalayas

    PubMed Central

    Wang, Li-song; Harada, Hiroshi; Koh, Young Jin

    2005-01-01

    We performed a taxonomic study on two species of the genus Bryoria from the Sino-Himalayas, SW-China. B. nadvornikiana is new to China and B. furcellata is new to Yunnan and Sichuan provinces in the Sino-Himalayas. Morphology, habitat, distributions and chemistry of the two species are discussed. PMID:24049496

  1. Characterization of microsatellite loci in the lichen-forming fungus Cetraria aculeata (Parmeliaceae, Ascomycota).

    PubMed

    Lutsak, Tetiana; Fernández-Mendoza, Fernando; Greshake, Bastian; Dal Grande, Francesco; Ebersberger, Ingo; Ott, Sieglinde; Printzen, Christian

    2016-09-01

    Polymorphic microsatellite markers were developed for the lichen species Cetraria aculeata (Parmeliaceae) to study fine-scale population diversity and phylogeographic structure. Using Illumina HiSeq and MiSeq, 15 fungus-specific microsatellite markers were developed and tested on 81 specimens from four populations from Spain. The number of alleles ranged from four to 13 alleles per locus with a mean of 7.9, and average gene diversities varied from 0.40 to 0.73 over four populations. The amplification rates of 10 markers (CA01-CA10) in populations of C. aculeata exceeded 85%. The markers also amplified across a range of closely related species, except for locus CA05, which did not amplify in C. australiensis and C. "panamericana," and locus CA10 which did not amplify in C. australiensis. The identified microsatellite markers will be used to study the genetic diversity and phylogeographic structure in populations of C. aculeata in western Eurasia.

  2. Biogeography and Genetic Structure in Populations of a Widespread Lichen (Parmelina tiliacea, Parmeliaceae, Ascomycota)

    PubMed Central

    Hawksworth, David L.; Crespo, Ana

    2015-01-01

    The genetic diversity and population structure of the foliose lichenized fungus Parmelina tiliacea has been analyzed through its geographical range, including samples from Macaronesia (Canary Islands), the Mediterranean, and Eurosiberia. DNA sequences from the nuclear ribosomal internal transcribed spacer, the mitochondrial large subunit ribosomal RNA gene, and the translation elongation factor 1-α were used as molecular markers. The haplotypes of the three markers and the molecular variance analyses of multilocus haplotypes showed the highest diversity in the Canary Islands, while restricted haplotypes occurred at high frequencies in Mediterranean coastal samples. The multilocus haplotypes formed three unevenly distributed clusters (clusters 1-3). In the Canary Islands all the haplotypes were present in a similar proportion, while the coastal Mediterranean sites had almost exclusively haplotypes of cluster 3; cluster 2 predominated in inland Mediterranean sites; and cluster 1 was more abundant in central and northern Europe (Eurosiberian area). The distribution of clusters is partially explained by climatic factors, and its interaction with local spatial structure, but much of the variation remains unexplained. The high frequency of individuals in the Canary Islands with haplotypes shared with other areas suggests that could be a refugium of genetic diversity, and the high frequency of individuals of the Mediterranean coastal sites with restricted haplotypes indicates that gene flow to contiguous areas may be restricted. This is significant for the selection of areas for conservation purposes, as those with most genetic variation may reflect historical factors and biological properties of the species. PMID:25961726

  3. Sharpening the species boundaries in the Cladonia mediterranea complex (Cladoniaceae, Ascomycota).

    PubMed

    Pino-Bodas, R; Pérez-Vargas, I; Stenroos, S; Ahti, T; Burgaz, A R

    2016-12-01

    The complex Cladonia mediterranea belongs to the section Impexae and is formed by C. azorica, C. macaronesica and C.mediterranea. These species are basically distributed in the Mediterranean and Macaronesian Regions. In the present work the limits between the species of this complex are re-examined. To this end, the morphological characters were studied along with the secondary metabolites and the DNA sequences from three loci (ITS rDNA, IGS rDNA and rpb2). The morphological data were studied by principal component analysis (PCA), while the DNA sequences were analyzed using several approaches available to delimit species: genealogical concordance phylogenetic species recognition, species tree (BEAST* and spedeSTEM) and cohesion species recognition. In addition, the genealogical sorting index was used in order to assess the monophyly of the species. The different procedures used in our study turned out to be highly congruent with respect to the limits they establish, but these limits are not the ones separating the prior species. Either the morphological analysis or the different approaches to species delimitation indicate that C. mediterranea is a different species from C. macaronesica, while C. azorica and C. macaronesica, which are reduced to synonyms of C. portentosa, constitute a separate lineage.

  4. Proposal to conserve the name Bipolaris against Cochliobolus (Ascomycota: Pleosporales: Pleosporaceae)

    USDA-ARS?s Scientific Manuscript database

    The fungal genera Bipolaris Shoemaker and Cochliobolus Drechsler have been applied to economically important plant pathogens causing diseases of cereal crops worldwide, especially southern corn leaf blight. There are major accounts of these genera including those incorporating molecular phylogenetic...

  5. Seven wood-inhabiting new species of the genus Trichoderma (Fungi, Ascomycota) in Viride clade

    PubMed Central

    Qin, Wen-Tao; Zhuang, Wen-Ying

    2016-01-01

    More than 200 recent collections of Trichoderma from China were examined and 16 species belonging to the Viride clade were identified based on integrated studies of phenotypic and molecular data. Among them, seven wood-inhabiting new species, T. albofulvopsis, T. densum, T. laevisporum, T. sinokoningii, T. sparsum, T. sphaerosporum and T. subviride, are found. They form trichoderma- to verticillium-like conidiophores, lageniform to subulate phialides and globose to ellipsoidal conidia, but vary greatly in colony features, growth rates, and sizes of phialides and conidia. To explore their taxonomic positions, the phylogenetic tree including all the known species of the Viride clade is constructed based on sequence analyses of the combined RNA polymerase II subunit b and translation elongation factor 1 alpha exon genes. Our results indicated that the seven new species were well-located in the Koningii, Rogersonii and Neorufum subclades as well as a few independent terminal branches. They are clearly distinguishable from any existing species. Morphological distinctions and sequence divergences between the new species and their close relatives were discussed. PMID:27245694

  6. Known and two new species of Rhytisma (Rhytismatales, Ascomycota) from China.

    PubMed

    Hou, Cheng-Lin; Piepenbring, Meike

    2005-02-01

    Three species of Rhytisma are described based on recently collected specimens from the Anhui province, China. Rhytisma anhuiense is a new species causing a serious tar spot disease on Rhododendron simsii. Rhytisma yuexiense is a new species, which develops its stromata only on fallen leaves of Rhododendron ovatum. Rhytisma himalense on Ilex fargesii is a known species and probably widely distributed in China. Including the two new species, 11 species of Rhytisma are known from China which are presented in a key.

  7. Extreme phenotypic variation in Cetraria aculeata (lichenized Ascomycota): adaptation or incidental modification?

    PubMed Central

    Pérez-Ortega, Sergio; Fernández-Mendoza, Fernando; Raggio, José; Vivas, Mercedes; Ascaso, Carmen; Sancho, Leopoldo G.; Printzen, Christian; de los Ríos, Asunción

    2012-01-01

    Background and Aims Phenotypic variability is a successful strategy in lichens for colonizing different habitats. Vagrancy has been reported as a specific adaptation for lichens living in steppe habitats around the world. Among the facultatively vagrant species, the cosmopolitan Cetraria aculeata apparently forms extremely modified vagrant thalli in steppe habitats of Central Spain. The aim of this study was to investigate whether these changes are phenotypic plasticity (a single genotype producing different phenotypes), by characterizing the anatomical and ultrastructural changes observed in vagrant morphs, and measuring differences in ecophysiological performance. Methods Specimens of vagrant and attached populations of C. aculeata were collected on the steppes of Central Spain. The fungal internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GPD) and the large sub-unit of the mitochondrial ribosomal DNA (mtLSUm), and the algal ITS and actin were studied within a population genetics framework. Semi-thin and ultrathin sections were analysed by means of optical, scanning electron and transmission electron microscopy. Gas exchange and chlorophyll fluorescence were used to compare the physiological performance of both morphs. Key Results and Conclusions Vagrant and attached morphs share multilocus haplotypes which may indicate that they belong to the same species in spite of their completely different anatomy. However, differentiation tests suggested that vagrant specimens do not represent a random sub-set of the surrounding population. The morphological differences were related to anatomical and ultrastructural differences. Large intercalary growth rates of thalli after the loss of the basal–apical thallus polarity may be the cause of the increased growth shown by vagrant specimens. The anatomical and morphological changes lead to greater duration of ecophysiological activity in vagrant specimens. Although the anatomical and physiological changes could be chance effects, the genetic differentiation between vagrant and attached sub-populations and the higher biomass of the former show fitness effects and adaptation to dry environmental conditions in steppe habitats. PMID:22451601

  8. A phylogenetic perspective on the association between ants (Hymenoptera: Formicidae) and black yeasts (Ascomycota: Chaetothyriales).

    PubMed

    Vasse, Marie; Voglmayr, Hermann; Mayer, Veronika; Gueidan, Cécile; Nepel, Maximilian; Moreno, Leandro; de Hoog, Sybren; Selosse, Marc-André; McKey, Doyle; Blatrix, Rumsaïs

    2017-03-15

    The frequency and the geographical extent of symbiotic associations between ants and fungi of the order Chaetothyriales have been highlighted only recently. Using a phylogenetic approach based on seven molecular markers, we showed that ant-associated Chaetothyriales are scattered through the phylogeny of this order. There was no clustering according to geographical origin or to the taxonomy of the ant host. However, strains tended to be clustered according to the type of association with ants: strains from ant-made carton and strains from plant cavities occupied by ants ('domatia') rarely clustered together. Defining molecular operational taxonomic units (MOTUs) with an internal transcribed spacer sequence similarity cut-off of 99% revealed that a single MOTU could be composed of strains collected from various ant species and from several continents. Some ant-associated MOTUs also contained strains isolated from habitats other than ant-associated structures. Altogether, our results suggest that the degree of specialization of the interactions between ants and their fungal partners is highly variable. A better knowledge of the ecology of these interactions and a more comprehensive sampling of the fungal order are needed to elucidate the evolutionary history of mutualistic symbioses between ants and Chaetothyriales. © 2017 The Author(s).

  9. Nine new cytochalasan alkaloids from Chaetomium globosum TW1-1 (Ascomycota, Sordariales).

    PubMed

    Chen, Chunmei; Tong, Qingyi; Zhu, Hucheng; Tan, Dongdong; Zhang, Jinwen; Xue, Yongbo; Yao, Guangmin; Luo, Zengwei; Wang, Jianping; Wang, Yanyan; Zhang, Yonghui

    2016-01-07

    Chemical investigation on the methanol extract of Chaetomium globosum TW1-1, a fungus isolated from the common pillbug (Armadillidium vulgare), has resulted in the isolation of nine new highly oxygenated cytochalasan alkaloids, armochaetoglobins S-Z (1 and 3-9) and 7-O-acetylarmochaetoglobin S (2), together with eight structurally related known analogues (10-17). Their structures and absolute configurations were elucidated by spectroscopic analyses. Among them, compound 2 presents to be the first member of chaetoglobosin family with an acetyl group, and compounds 3 represents the first chaetoglobosin characterized by an 2',3'-epoxy-indole moiety. The discovery of these new compounds revealed the largely untapped chemical diversity of cytochalasans and enriched their chemical research. Compounds 1-9 were evaluated for their cytotoxic activities against five human cancer cell lines, and compounds 8 and 9 exhibited significant cytotoxic activities with IC50 values ranging from 10.45 to 30.42 μM.

  10. A Brief Chronicle of the Genus Cordyceps Fr., the Oldest Valid Genus in Cordycipitaceae (Hypocreales, Ascomycota)

    PubMed Central

    Tanaka, Eiji; Han, Jae-Gu; Oh, Junsang; Han, Sang-Kuk; Lee, Kang-Hyo

    2014-01-01

    The earliest pre-Linnaean fungal genera are briefly discussed here with special emphasis on the nomenclatural connection with the genus Cordyceps Fr. Since its valid publication under the basidiomycetous genus Clavaria Vaill. ex L. (Clavaria militaris L. Sp. Pl. 2:1182, 1753), the genus Cordyceps has undergone nomenclatural changes in the post-Linnaean era, but has stood firmly for approximately 200 years. Synonyms of Cordyceps were collected from different literature sources and analyzed based on the species they represent. True synonyms of Cordyceps Fr. were defined as genera that represented species of Cordyceps Fr. emend. G. H. Sung, J. M. Sung, Hywel-Jones & Spatafora. The most common synonyms of Cordyceps observed were Clavaria and Sphaeria Hall, reported in the 18th and in the first half of the 19th century, respectively. Cordyceps, the oldest genus in the Cordyceps s. s. clade of Cordycipitaceae, is the most preferred name under the "One Fungus = One Name" principle on priority bases. PMID:25071376

  11. Lichen-Associated Fungal Community in Hypogymnia hypotrypa (Parmeliaceae, Ascomycota) Affected by Geographic Distribution and Altitude

    PubMed Central

    Wang, Yanyan; Zheng, Yong; Wang, Xinyu; Wei, Xinli; Wei, Jiangchun

    2016-01-01

    Lichen-associated fungal species have already been investigated in almost all the main growth forms of lichens, however, whether or not they are homogeneous and constant within each lichen species are still inconclusive. Moreover, the related ecological factors to affect and structure the fungal composition have been poorly studied. In order to answer these questions, we took Hypogymnia hypotrypa as a model to study the relationship between the lichen-associated fungal composition and two ecological factors, i.e., site and altitude, using the method of IlluminaMiSeq sequencing. Four different sites and two levels of altitude were included in this study, and the effects of site and altitude on fungal community composition were assessed at three levels, i.e., operational taxonomic unit (OTU), class and phylum. The results showed that a total of 50 OTUs were identified and distributed in 4 phyla, 13 classes, and 20 orders. The lichen-associated fungal composition within H. hypotrypa were significantly affected by both site and altitude at OTU and class levels, while at the phylum level, it was only affected by altitude. While the lichen associated fungal communities were reported to be similar with endophytic fungi of the moss, our results indicated the opposite results in some degree. But whether there exist specific OTUs within this lichen species corresponding to different sites and altitudes is still open. More lichen species and ecological factors would be taken into the integrated analyses to address these knowledge gaps in the near future. PMID:27547204

  12. Proposal to conserve the name Diaporthe eres against all other competing names (Ascomycota, Diaporthales, Diaporthaceae)

    USDA-ARS?s Scientific Manuscript database

    With the change to one scientific name for pleomorphic fungi based on relative priority, Diaporthe represents the generic name that is older than the synonym Phomopsis. At present Diaporthe includes over 800 names while the number of names described in Phomopsis exceeds 1,000, thus merging these two...

  13. Molecular and morphological characterization of Leveillula (Ascomycota: Erysiphales) on monocotyledonous plants.

    PubMed

    Khodaparast, Seyed Akbar; Niinomi, Seiko; Takamatsu, Susumu

    2007-06-01

    Leveillula on monocotyledonous plants have been recorded as L. taurica by several authors, whereas the fungus on Allium has been described as an independent species, namely L. allii, by some authors. We sequenced ca 600bp of the rDNA ITS region for two Leveillula specimens from Allium and Polianthes (both from monocotyledons) and compared them with several already published sequences from Leveillula isolates from dicotyledons. Pair-wise percentages of sequence divergences were calculated for all Leveillula isolates. The ITS sequence of the Polianthes isolate was identical to L. taurica on Helianthus and Vicia. The sequence of the Allium isolate was 99.5% identical to L. taurica on Euphorbia, Haplophylum, Peganum, etc. These results suggest close relationships between monocot and dicot pathogenic Leveillula species. The identity between two monocot isolates was 98.4%. Phylogenetic analysis revealed that the two monocot isolates do not group into a clade together. This result suggests that Leveillula acquired parasitism to monocots at least twice independently.

  14. Evolutionary history of vegetative reproduction in Porpidia s.L. (Lichen-forming ascomycota).

    PubMed

    Buschbom, Jutta; Barker, Daniel

    2006-06-01

    The evolutionary history of gains and losses of vegetative reproductive propagules (soredia) in Porpidia s.l., a group of lichen-forming ascomycetes, was clarified using Bayesian Markov chain Monte Carlo (MCMC) approaches to monophyly tests and a combined MCMC and maximum likelihood approach to ancestral character state reconstructions. The MCMC framework provided confidence estimates for the reconstructions of relationships and ancestral character states, which formed the basis for tests of evolutionary hypotheses. Monophyly tests rejected all hypotheses that predicted any clustering of reproductive modes in extant taxa. In addition, a nearest-neighbor statistic could not reject the hypothesis that the vegetative reproductive mode is randomly distributed throughout the group. These results show that transitions between presence and absence of the vegetative reproductive mode within Porpidia s.l. occurred several times and independently of each other. Likelihood reconstructions of ancestral character states at selected nodes suggest that--contrary to previous thought--the ancestor to Porpidia s.l. already possessed the vegetative reproductive mode. Furthermore, transition rates are reconstructed asymmetrically with the vegetative reproductive mode being gained at a much lower rate than it is lost. A cautious note has to be added, because a simulation study showed that the ancestral character state reconstructions were highly dependent on taxon sampling. However, our central conclusions, particularly the higher rate of change from vegetative reproductive mode present to absent than vice versa within Porpidia s.l., were found to be broadly independent of taxon sampling.

  15. Study on the ice nucleation activity of fungal spores (Ascomycota and Basidiomycota)

    NASA Astrophysics Data System (ADS)

    Pummer, B. G.; Atanasova, L.; Bauer, H.; Bernardi, J.; Druzhinina, I. S.; Grothe, H.

    2012-04-01

    Biogenic ice nucleation (IN) in the atmosphere is a topic of growing interest, as, according to IPCC, the impact of IN on global climate is crucial to perform reliable climate model calculations. About 20 years ago IN activity of a few lichen and Fusarium species [1,2] was reported, while all other investigated fungi were IN-negative. However, as the fungal kingdom is vast, many abundant species, especially the Basidiomycota (most mushrooms), were not tested before. Furthermore, the focus of the past studies was on the IN activity of the mycelium as a cryoprotective mechanism, and not on the airborne spores. We carried out oil immersion measurements [3] with spores from 17 different fungal species of ecological, economical or sanitary importance. Most of these species have not been investigated before, like exponents of Aspergillus, Trichoderma and Agaricales (most mushrooms). Apart from F. avenaceum, spores of all measured species showed moderate or no IN activity, supporting the hypothesis that significant IN activity is a rather exclusive property of only a few species within the fungal kingdom. [1] Kieft TL and Ruscetti T: J. Bacteriol. 172, 3519-3523, 1990. [2] Pouleur S et al.: Appl. Environ. Microbiol., 58, 2960-2964, 1992. [3] Marcolli C et al.: Atmos. Chem. Phys. 7, 5081-5091, 2007.

  16. New molecular markers for fungal phylogenetics: Two genes for species level systematics in the Sordariomycetes (Ascomycota)

    USDA-ARS?s Scientific Manuscript database

    Although significant progress has been made resolving deep branches of the fungal tree of life in recent works, many fungal systematists are interested in species-level questions to both define species and to assess fungal biodiversity. Fungal genome sequences are a useful resource to systematic bio...

  17. Biogeography and Genetic Structure in Populations of a Widespread Lichen (Parmelina tiliacea, Parmeliaceae, Ascomycota).

    PubMed

    Núñez-Zapata, Jano; Cubas, Paloma; Hawksworth, David L; Crespo, Ana

    2015-01-01

    The genetic diversity and population structure of the foliose lichenized fungus Parmelina tiliacea has been analyzed through its geographical range, including samples from Macaronesia (Canary Islands), the Mediterranean, and Eurosiberia. DNA sequences from the nuclear ribosomal internal transcribed spacer, the mitochondrial large subunit ribosomal RNA gene, and the translation elongation factor 1-α were used as molecular markers. The haplotypes of the three markers and the molecular variance analyses of multilocus haplotypes showed the highest diversity in the Canary Islands, while restricted haplotypes occurred at high frequencies in Mediterranean coastal samples. The multilocus haplotypes formed three unevenly distributed clusters (clusters 1-3). In the Canary Islands all the haplotypes were present in a similar proportion, while the coastal Mediterranean sites had almost exclusively haplotypes of cluster 3; cluster 2 predominated in inland Mediterranean sites; and cluster 1 was more abundant in central and northern Europe (Eurosiberian area). The distribution of clusters is partially explained by climatic factors, and its interaction with local spatial structure, but much of the variation remains unexplained. The high frequency of individuals in the Canary Islands with haplotypes shared with other areas suggests that could be a refugium of genetic diversity, and the high frequency of individuals of the Mediterranean coastal sites with restricted haplotypes indicates that gene flow to contiguous areas may be restricted. This is significant for the selection of areas for conservation purposes, as those with most genetic variation may reflect historical factors and biological properties of the species.

  18. Sublethal Effects of Beauveria bassiana (Ascomycota: Hypocreales) on Life Table Parameters of Frankliniella occidentalis (Thysanoptera: Thripidae).

    PubMed

    Zhang, Tao; Reitz, Stuart R; Wang, Haihong; Lei, Zhongren

    2015-06-01

    We assessed effects of parental exposure to Beauveria bassiana on life history traits of subsequent generations of western flower thrips, Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Progeny from individuals that survived fungal exposure as second instars had significantly shorter egg stages, but longer prepupal development times than corresponding untreated controls. However, survivorship to adulthood of these progeny groups did not differ. Although fecundities of the parental types did not differ, the sex ratio of progeny from fungal-treated parents was male-biased, whereas sex ratio of progeny from untreated control parents was even. We calculated life table parameters for the progeny and found that all parameters, except for generation time, were significantly less for the progeny of fungal-treated parents than for progeny of untreated parents. The intrinsic rate of increase, finite rate of increase, net reproductive rate, mean generation time, and gross reproductive rate were 0.199 d(-1), 1.229 d(-1), 21.84, 15.48 d, and 27.273, respectively, for progeny of treated thrips, and 0.266 d(-1), 1.316 d(-1), 52.540, 14.92 d, and 70.64, respectively, for progeny of control thrips. Consequently, population projections demonstrated that offspring of parents exposed to B. bassiana would increase their population more slowly than those from untreated parents. These results demonstrate that B. bassiana has sublethal effects that reduce the reproductive success of F. occidentalis and these effects should be taken into account when evaluating its use in management programs for F. occidentalis.

  19. The phylogenetic relationship between Anisogramma virgultorum and A. anomala within the Diaporthales (Ascomycota)

    USDA-ARS?s Scientific Manuscript database

    The two diaporthalean fungi Anisogramma virgultorum and A. anomala are biotrophic parasites. Anisogramma virgultorum causes stromatal cankers on young shoots of birch and A. anomala infects young branches of Corylus avellana. Although previous classifications, based on morphological characteristics,...

  20. Saitoella coloradoensis sp. nov., a new species of the Ascomycota, subphylum Taphrinomycotina

    USDA-ARS?s Scientific Manuscript database

    Saitoella coloradoensis sp. nov. (NRRL YB-2330, CBS 12360, type strain) is described. This new member of the phylum Ascomycotina, subphylum Taphrinomycotina was isolated from insect frass occurring in an Engelmann spruce (Picea engelmannii) that was growing in Colorado, USA. Multigene sequence analy...

  1. Delimitation of Neonectria and Cylindrocarpon (Nectriaceae, Hypocreales, Ascomycota) and related genera with Cylindrocarpon-like anamorphs

    PubMed Central

    Chaverri, P.; Salgado, C.; Hirooka, Y.; Rossman, A.Y.; Samuels, G.J.

    2011-01-01

    Neonectria is a cosmopolitan genus and it is, in part, defined by its link to the anamorph genus Cylindrocarpon. Neonectria has been divided into informal groups on the basis of combined morphology of anamorph and teleomorph. Previously, Cylindrocarpon was divided into four groups defined by presence or absence of microconidia and chlamydospores. Molecular phylogenetic analyses have indicated that Neonectria sensu stricto and Cylindrocarpon sensu stricto are phylogenetically congeneric. In addition, morphological and molecular data accumulated over several years have indicated that Neonectria sensu lato and Cylindrocarpon sensu lato do not form a monophyletic group and that the respective informal groups may represent distinct genera. In the present work, a multilocus analysis (act, ITS, LSU, rpb1, tef1, tub) was applied to representatives of the informal groups to determine their level of phylogenetic support as a first step towards taxonomic revision of Neonectria sensu lato. Results show five distinct highly supported clades that correspond to some extent with the informal Neonectria and Cylindrocarpon groups that are here recognised as genera: (1) N. coccinea-group and Cylindrocarpon groups 1 & 4 (Neonectria/Cylindrocarpon sensu stricto); (2) N. rugulosa-group (Rugonectria gen. nov.); (3) N. mammoidea/N. veuillotiana-groups and Cylindrocarpon group 2 (Thelonectria gen. nov.); (4) N. radicicola-group and Cylindrocarpon group 3 (Ilyonectria gen. nov.); and (5) anamorph genus Campylocarpon. Characteristics of the anamorphs and teleomorphs correlate with the five genera, three of which are newly described. New combinations are made for species where their classification is confirmed by phylogenetic data. PMID:21523189

  2. Hypoxylon pulicicidum sp. nov. (Ascomycota, Xylariales), a Pantropical Insecticide-Producing Endophyte

    PubMed Central

    Bills, Gerald F.; González-Menéndez, Victor; Martín, Jesús; Platas, Gonzalo; Fournier, Jacques; Peršoh, Derek; Stadler, Marc

    2012-01-01

    Background Nodulisporic acids (NAs) are indole diterpene fungal metabolites exhibiting potent systemic efficacy against blood-feeding arthropods, e.g., bedbugs, fleas and ticks, via binding to arthropod specific glutamate-gated chloride channels. Intensive medicinal chemistry efforts employing a nodulisporic acid A template have led to the development of N-tert-butyl nodulisporamide as a product candidate for a once monthly treatment of fleas and ticks on companion animals. The source of the NAs is a monophyletic lineage of asexual endophytic fungal strains that is widely distributed in the tropics, tentatively identified as a Nodulisporium species and hypothesized to be the asexual state of a Hypoxylon species. Methods and Results Inferences from GenBank sequences indicated that multiple researchers have encountered similar Nodulisporium endophytes in tropical plants and in air samples. Ascomata-derived cultures from a wood-inhabiting fungus, from Martinique and closely resembling Hypoxylon investiens, belonged to the same monophyletic clade as the NAs-producing endophytes. The hypothesis that the Martinique Hypoxylon collections were the sexual state of the NAs-producing endophytes was tested by mass spectrometric analysis of NAs, multi-gene phylogenetic analysis, and phenotypic comparisons of the conidial states. We established that the Martinique Hypoxylon strains produced an ample spectrum of NAs and were conspecific with the pantropical Nodulisporium endophytes, yet were distinct from H. investiens. A new species, H. pulicicidum, is proposed to accommodate this widespread organism. Conclusions and Significance Knowledge of the life cycle of H. pulicicidum will facilitate an understanding of the role of insecticidal compounds produced by the fungus, the significance of its infections in living plants and how it colonizes dead wood. The case of H. pulicicidum exemplifies how life cycle studies can consolidate disparate observations of a fungal organism, whether from environmental sequences, vegetative mycelia or field specimens, resulting in holistic species concepts critical to the assessment of the dimensions of fungal diversity. PMID:23056404

  3. Draft genome of the fungus-growing termite pathogenic fungus Ophiocordyceps bispora (Ophiocordycipitaceae, Hypocreales, Ascomycota).

    PubMed

    Conlon, Benjamin H; Mitchell, Jannette; de Beer, Z Wilhelm; Carøe, Christian; Gilbert, M Thomas P; Eilenberg, Jørgen; Poulsen, Michael; de Fine Licht, Henrik H

    2017-04-01

    This article documents the public availability of genome sequence data and assembled contigs representing the partial draft genome of Ophiocordyceps bispora. As one of the few known pathogens of fungus-farming termites, a draft genome of O. bispora represents the opportunity to further the understanding of disease and resistance in these complex termite societies. With the ongoing attempts to resolve the taxonomy of the Hypocralaean family, more genetic data will also help to shed light on the phylogenetic relationship between sexual and asexual life stages. Next generation sequence data is available from the European Nucleotide Archive (ENA) under accession PRJEB13655; run numbers: ERR1368522, ERR1368523, and ERR1368524. Genome assembly available from ENA under accession numbers: FKNF01000001-FKNF01000302. Gene prediction available as protein fasta, nucleotide fasta and GFF file from Mendeley Data with accession doi:10.17632/r99fd6g3s4.2 (http://dx.doi.org/10.17632/r99fd6g3s4.2).

  4. Symbiotic lifestyle and phylogenetic relationships of the bionts of Mastodia tessellata (Ascomycota, incertae sedis).

    PubMed

    Pérez-Ortega, Sergio; Ríos, Asunción de Los; Crespo, Ana; Sancho, Leopoldo G

    2010-05-01

    The biological nature of some symbioses is unclear because it is often not easy to discern whether the symbionts obtain any benefits from the association. Mastodia tessellata, a symbiosis between a leafy green alga and a fungus of uncertain phylogenetic position, is among the most investigated, controversial, and poorly understood associations. Because it has been difficult to determine whether this association is mutually beneficial or parasitic, not all scientists accept M. tessellata as a true lichen symbiosis. Mastodia tessellata is thus an interesting model to illustrate the interactions and processes that occur in fungal-algal symbioses. To improve our understanding of this association, we address the phylogenetic positions of the bionts involved and examine their interactions at the ultrastructural level. Examining the nuLSU and nuSSU gene regions of the mycobiont and the rbcL gene region of the photobiont, we found the fungus to be related to a group of marine species in the genus Verrucaria, family Verrucariaceae, despite its present ascription to the family Mastodiaceae. In addition, the photobiont of the symbiosis emerged as closely related to the North American species Prasiola borealis. Our electron microscopy observations provide new information on the process of fungal colonization of the algal thalli, as well as on relationships between the symbionts during different stages of colonization. The special features of this lichen symbiosis are discussed and compared with other examples of fungal symbioses in nature.

  5. Characterization of microsatellite loci in the lichen-forming fungus Cetraria aculeata (Parmeliaceae, Ascomycota)1

    PubMed Central

    Lutsak, Tetiana; Fernández-Mendoza, Fernando; Greshake, Bastian; Dal Grande, Francesco; Ebersberger, Ingo; Ott, Sieglinde; Printzen, Christian

    2016-01-01

    Premise of the study: Polymorphic microsatellite markers were developed for the lichen species Cetraria aculeata (Parmeliaceae) to study fine-scale population diversity and phylogeographic structure. Methods and Results: Using Illumina HiSeq and MiSeq, 15 fungus-specific microsatellite markers were developed and tested on 81 specimens from four populations from Spain. The number of alleles ranged from four to 13 alleles per locus with a mean of 7.9, and average gene diversities varied from 0.40 to 0.73 over four populations. The amplification rates of 10 markers (CA01–CA10) in populations of C. aculeata exceeded 85%. The markers also amplified across a range of closely related species, except for locus CA05, which did not amplify in C. australiensis and C. “panamericana,” and locus CA10 which did not amplify in C. australiensis. Conclusions: The identified microsatellite markers will be used to study the genetic diversity and phylogeographic structure in populations of C. aculeata in western Eurasia. PMID:27672520

  6. Characterization of Beauveria bassiana (Ascomycota: Hypocreales) isolates associated with Agrilus planipennis (Coleoptera: Buprestidae) populations in Michigan

    Treesearch

    Louela A. Castrillo; Leah S. Bauer; Houping Liu; Michael H. Griggs; John D. Vandenberg

    2010-01-01

    Earlier research in Michigan on fungal entomopathogens of the emerald ash borer (EAB), a major invasive pest of ash trees, resulted in the isolation of Beauveria bassiana from late-instar larvae and pre-pupae. In the present study, some of these isolates were characterized and compared to ash bark- and soil-derived isolates to determine their...

  7. Four new species of Coenogonium (Ascomycota: Ostropales) from vulnerable forest ecosystems in Puerto Rico

    Treesearch

    J.A. Mercado-Diaz; W.A. Gould; G. Gonzalez; R. Lucking

    2013-01-01

    Four new species of Coenogonium are described from the Caribbean island of Puerto Rico—C. aurantiacum Mercado-Díaz & Lucking, C. borinquense Mercado-Díaz & Lucking, C. dimorphicum Mercado-Díaz & Lucking and C. portoricense Mercado-Díaz & Lucking. All were discovered in small and highly fragmented forest remnants of...

  8. Revisiting the phylogeny of Ocellularieae, the second largest tribe within Graphidaceae (lichenized Ascomycota: Ostropales)

    Treesearch

    Ekaphan Kraichak; Sittiporn Parnmen; Robert Lücking; Eimy Rivas Plata; Andre Aptroot; Marcela E.S. Caceres; Damien Ertz; Armin Mangold; Joel A. Mercado-Diaz; Khwanruan Papong; Dries Van der Broeck; Gothamie Weerakoon; H. Thorsten. Lumbsch; NO-VALUE

    2014-01-01

    We present an updated 3-locus molecular phylogeny of tribe Ocellularieae, the second largest tribe within subfamily Graphidoideae in the Graphidaceae. Adding 165 newly generated sequences from the mitochondrial small subunit rDNA (mtSSU), the nuclear large subunit rDNA (nuLSU), and the second largest subunit of the DNA-directed RNA polymerase II (RPB2), we currently...

  9. Common Microfungi of Costa Rica and Other Tropical Regions: An Illustrated Guide (Ascomycota, Pezizomycotina, Sordariomycetes)

    USDA-ARS?s Scientific Manuscript database

    One hundred and sixteen common tropical pyrenomycete fungi are described and illustrated in a bilingual (Spanish/English) guide. The pyrenomycete fungi include some of the most important plant and human pathogens and also are highly significant in nutrient cycling in tropical forest ecosystems. The...

  10. Evidence for a new lineage of primary ambrosia fungi in Geosmithia Pitt (Ascomycota: Hypocreales).

    PubMed

    Kolařík, Miroslav; Kirkendall, Lawrence R

    2010-08-01

    Geosmithia is a genus of mitosporic filamentous fungi typically associated with phloeophagous bark beetles world-wide. During this study, the fungal associates of ambrosia beetles Cnesinus lecontei, Eupagiocerus dentipes, and Microcorthylus sp. from Costa Rica, were studied using morphology and DNA sequences. Fungal associates belonged to four undescribed Geosmithia species. Geosmithia eupagioceri sp. nov. and G. microcorthyli sp. nov. are evidently primary ambrosia fungi of their respective vectors E. dentipes and Microcorthylus species. They both have convergently evolved distinct morphological adaptations including the production of large, solitary and globose conidia, and yeast-like cells. Tunnels of C. lecontei contained an undescribed Geosmithia species, but its nutritional importance for its vector is unclear. An auxiliary ambrosia fungus, Geosmithia rufescens sp. nov., was found associated with both G. eupagioceri and the Geosmithia species associated with C. lecontei. G. microcorthyli is genetically quite similar to the phloem-associated Geosmithia sp. 8 from Europe. Large differences in morphology between these two species suggest the rapid co-evolution resulting from the close symbiosis of the former with its beetle host. The ITS rDNA sequences of G. microcorthyli and Geosmithia sp. 8 were not diagnostic, suggesting that alternative markers such as EF-1α, IGS rDNA or β-tubulin should be used, together with morphological and ecological data, for species delimitation in this genus. The primary ambrosia fungi described here are derived from phloem-associated ancestors, and represent two independent lineages of ambrosia fungi in the Hypocreales and a new ecological strategy within Geosmithia. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  11. Parasites of parasites of bats: Laboulbeniales (Fungi: Ascomycota) on bat flies (Diptera: Nycteribiidae) in central Europe.

    PubMed

    Haelewaters, Danny; Pfliegler, Walter P; Szentiványi, Tamara; Földvári, Mihály; Sándor, Attila D; Barti, Levente; Camacho, Jasmin J; Gort, Gerrit; Estók, Péter; Hiller, Thomas; Dick, Carl W; Pfister, Donald H

    2017-02-21

    Bat flies (Streblidae and Nycteribiidae) are among the most specialized families of the order Diptera. Members of these two related families have an obligate ectoparasitic lifestyle on bats, and they are known disease vectors for their hosts. However, bat flies have their own ectoparasites: fungi of the order Laboulbeniales. In Europe, members of the Nycteribiidae are parasitized by four species belonging to the genus Arthrorhynchus. We carried out a systematic survey of the distribution and fungus-bat fly associations of the genus in central Europe (Hungary, Romania). We encountered the bat fly Nycteribia pedicularia and the fungus Arthrorhynchus eucampsipodae as new country records for Hungary. The following bat-bat fly associations are for the first time reported: Nycteribia kolenatii on Miniopterus schreibersii, Myotis blythii, Myotis capaccinii and Rhinolophus ferrumequinum; Penicillidia conspicua on Myotis daubentonii; and Phthiridium biarticulatum on Myotis capaccinii. Laboulbeniales infections were found on 45 of 1,494 screened bat flies (3.0%). We report two fungal species: Arthrorhynchus eucampsipodae on Nycteribia schmidlii, and A. nycteribiae on N. schmidlii, Penicillidia conspicua, and P. dufourii. Penicillidia conspicua was infected with Laboulbeniales most frequently (25%, n = 152), followed by N. schmidlii (3.1%, n = 159) and P. dufourii (2.0%, n = 102). Laboulbeniales seem to prefer female bat fly hosts to males. We think this might be due to a combination of factors: female bat flies have a longer life span, while during pregnancy female bat flies are significantly larger than males and accumulate an excess of fat reserves. Finally, ribosomal DNA sequences for A. nycteribiae are presented. We screened ectoparasitic bat flies from Hungary and Romania for the presence of ectoparasitic Laboulbeniales fungi. Arthrorhynchus eucampsipodae and A. nycteribiae were found on three species of bat flies. This study extends geographical and host ranges of both bat flies and Laboulbeniales fungi. The sequence data generated in this work contribute to molecular phylogenetic studies of the order Laboulbeniales. Our survey shows a complex network of bats, bat flies and Laboulbeniales fungi, of which the hyperparasitic fungi are rare and species-poor. Their host insects, on the other hand, are relatively abundant and diverse.

  12. Exploring the genomic diversity of black yeasts and relatives (Chaetothyriales, Ascomycota).

    PubMed

    Teixeira, M M; Moreno, L F; Stielow, B J; Muszewska, A; Hainaut, M; Gonzaga, L; Abouelleil, A; Patané, J S L; Priest, M; Souza, R; Young, S; Ferreira, K S; Zeng, Q; da Cunha, M M L; Gladki, A; Barker, B; Vicente, V A; de Souza, E M; Almeida, S; Henrissat, B; Vasconcelos, A T R; Deng, S; Voglmayr, H; Moussa, T A A; Gorbushina, A; Felipe, M S S; Cuomo, C A; de Hoog, G Sybren

    2017-03-01

    The order Chaetothyriales (Pezizomycotina, Ascomycetes) harbours obligatorily melanised fungi and includes numerous etiologic agents of chromoblastomycosis, phaeohyphomycosis and other diseases of vertebrate hosts. Diseases range from mild cutaneous to fatal cerebral or disseminated infections and affect humans and cold-blooded animals globally. In addition, Chaetothyriales comprise species with aquatic, rock-inhabiting, ant-associated, and mycoparasitic life-styles, as well as species that tolerate toxic compounds, suggesting a high degree of versatile extremotolerance. To understand their biology and divergent niche occupation, we sequenced and annotated a set of 23 genomes of main the human opportunists within the Chaetothyriales as well as related environmental species. Our analyses included fungi with diverse life-styles, namely opportunistic pathogens and closely related saprobes, to identify genomic adaptations related to pathogenesis. Furthermore, ecological preferences of Chaetothyriales were analysed, in conjuncture with the order-level phylogeny based on conserved ribosomal genes. General characteristics, phylogenomic relationships, transposable elements, sex-related genes, protein family evolution, genes related to protein degradation (MEROPS), carbohydrate-active enzymes (CAZymes), melanin synthesis and secondary metabolism were investigated and compared between species. Genome assemblies varied from 25.81 Mb (Capronia coronata) to 43.03 Mb (Cladophialophora immunda). The bantiana-clade contained the highest number of predicted genes (12 817 on average) as well as larger genomes. We found a low content of mobile elements, with DNA transposons from Tc1/Mariner superfamily being the most abundant across analysed species. Additionally, we identified a reduction of carbohydrate degrading enzymes, specifically many of the Glycosyl Hydrolase (GH) class, while most of the Pectin Lyase (PL) genes were lost in etiological agents of chromoblastomycosis and phaeohyphomycosis. An expansion was found in protein degrading peptidase enzyme families S12 (serine-type D-Ala-D-Ala carboxypeptidases) and M38 (isoaspartyl dipeptidases). Based on genomic information, a wide range of abilities of melanin biosynthesis was revealed; genes related to metabolically distinct DHN, DOPA and pyomelanin pathways were identified. The MAT (MAting Type) locus and other sex-related genes were recognized in all 23 black fungi. Members of the asexual genera Fonsecaea and Cladophialophora appear to be heterothallic with a single copy of either MAT-1-1 or MAT-1-2 in each individual. All Capronia species are homothallic as both MAT1-1 and MAT1-2 genes were found in each single genome. The genomic synteny of the MAT-locus flanking genes (SLA2-APN2-COX13) is not conserved in black fungi as is commonly observed in Eurotiomycetes, indicating a unique genomic context for MAT in those species. The heterokaryon (het) genes expansion associated with the low selective pressure at the MAT-locus suggests that a parasexual cycle may play an important role in generating diversity among those fungi.

  13. Convergent evolution of a symbiotic duet: the case of the lichen genus Polychidium (Peltigerales, Ascomycota).

    PubMed

    Muggia, Lucia; Nelson, Peter; Wheeler, Tim; Yakovchenko, Lidia S; Tønsberg, Tor; Spribille, Toby

    2011-10-01

    Thallus architecture has long been a powerful guide for classifying lichens and has often trumped photobiont association and ascomatal type, but the reliability of these characters to predict phylogenetic affinity has seldom been tested. The cyanolichen genus Polychidium unites species that have strikingly similar gross morphology but consort with different photobiont genera. If Polychidium were found to be monophyletic, photobiont switching among closely related species would be suggested. If, however, species were found to arise in different lineages, a convergent body plan and ascomatal type evolution would be inferred. We tested the monophyly of Polychidium with a multilocus phylogeny based on nuclear and mitochondrial sequence data from all known Peltigeralean families and reconstructed ancestral states for specific thallus architecture and ascomatal ontogeny types relative to Polychidium and other clades. We found that Polychidium consists of two species groups that arose independently in different suborders within the Peltigerales, associated with Nostoc and Scytonema photobionts, respectively. We infer from ancestral character state reconstruction that dendroid thallus architecture evolved independently in these two lineages. The independent development of similar dendroid thallus architecture in different fungal suborders with different photobionts represents a clear and previously overlooked example of convergent evolution in lichens. Our results also suggest a pattern of character state conservation, loss, and reversion in ascomatal ontogeny types, hitherto considered conserved traits useful for higher level ascomycete systematics.

  14. Elaphomyces appalachiensis and E. verruculosus sp. nov. (Ascomycota Eurotiales, Elaphomycetaceae) from eastern North America

    Treesearch

    Michael A. Castellano; Gonzalo Guevara Guerrero; Jesus Garcia Jimenez; James M. Trappe

    2012-01-01

    We describe Elaphomyces verruculosus as new species from eastern North America, ranging from Quebec, Canada south along the eastern USA and along the Gulf Coast to northeastern México. E. verruculosus is similar in overall morphology to E. granulatus of Europe. In addition we re-describe E....

  15. Phylogenetic overview of the genus Genea (Pezizales, Ascomycota) with an emphasis on European taxa.

    PubMed

    Alvarado, Pablo; Cabero, Julio; Moreno, Gabriel; Bratek, Zoltán; van Vooren, Nicolas; Kaounas, Vasileios; Konstantinidis, Giorgos; Agnello, Carlo; Merényi, Zsolt; Smith, Matthew E; Vizzini, Alfredo; Trappe, James M

    2016-01-01

    We constructed a comprehensive phylogeny of the genus Genea, with new molecular data from samples collected in several countries in temperate and Mediterranean Europe, as well as North America. Type specimens and authentic material of most species were examined to support identifications. The molecular identity of the most common species in Genea was compared with nuc rDNA internal transcribed spacer (ITS), D1-D2 domains of 28S nuc rDNA (28S rDNA) and translation elongation factor 1-α ene (TEF1) profiles of 10 recently proposed taxa, G. brunneocarpa, G. compressa, G. dentata, G. fageticola, G. lobulata, G. oxygala, G. pinicola, G. pseudobalsleyi, G. pseudoverrucosa and G. tuberculata, supporting their status as distinct species. Genea mexicana and G. thaxteri on the one hand and G. sphaerica and G. lespiaultii on the other are closely related. Multiple lineages were recorded for G. verrucosa and G. fragrans, but we found no morphological traits to discriminate among them, so we tentatively interpreted them as cryptic species. A key to species of the genus Genea is provided to facilitate identification. We provide macroscopic images of fresh specimens and of representative spores of most species. Finally, we conducted a molecular analysis of the divergence time for Genea and discuss the implications of our results.

  16. [Natural ocurrence of entomopathogenic fungi in soils cultivated with Paraguay tea (Ilex paraguariensis St. Hil.) in Misiones, Argentina].

    PubMed

    Schapovaloff, María E; Angeli Alves, Luis F; Urrutia, María I; López Lastra, Claudia C

    2015-01-01

    This study aimed to morphologically isolate, identify and characterize entomopathogenic fungi present in soils cultivated with Paraguay tea (Ilex paraguariensis). A survey of native entomopathogenic fungi was conducted from 40 soil samples grown with Paraguay tea in the province of Misiones, Argentina, from May 2008 to June 2010. The soil dilution plate methodology on selective culture media was used to isolate microorganisms. Taxonomic identification was performed using macroscopic and microscopic characters and specific keys. Twenty nine strains, belonging to the species Beauveria bassiana (n = 17), Metarhizium anisopliae (n = 2) and Purpureocillium lilacinum (n = 10) were isolated and identified. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Occurrence of pathogenic fungi to Amblyomma cajennense in a rural area of Central Brazil and their activities against vectors of Rocky Mountain spotted fever.

    PubMed

    D'Alessandro, Walmirton B; Humber, Richard A; Luz, Christian

    2012-08-13

    Two isolates of Beauveria bassiana and one of Purpureocillium lilacinum (=Paecilomyces lilacinus) were found infecting Amblyomma cajennense engorged females collected on horses (0.15% infection rate from a total of 1982 specimens) and another two isolates of P. lilacinum and one Metarhizium anisopliae detected in soils (2.1% from 144 samples) collected in typical pasture habitats of this tick in Central Brazil from October 2009 to March 2011. Fungi were isolated from soils with Rhipicephalus sanguineus as surrogate baits. No fungi were found in ticks or soils during the driest months (May to August). Testing pathogenicity of fungi all R. sanguineus females were killed regardless of the isolate and fungi sporulated abundantly on the cadavers. A. cajennense was less susceptible to infection with P. lilacinum within 20 days than R. sanguineus. All three fungal species probably act as natural antagonists of A. cajennense particularly in the rainy season and have interest for integrate control of vectors of Rocky Mountain spotted fever.

  18. Characterization of a hydrophobin of the ascomycete Paecilomyces farinosus.

    PubMed

    Lunkenbein, Stefan; Takenberg, Meike; Nimtz, Manfred; Berger, Ralf G

    2011-08-01

    The entomopathogenic ascomycete Paecilomyces farinosus (alternative name Isaria farinosa) synthesized a hydrophobin, irrespective of being grown in submerged or surface culture. The protein was extracted using trifluoroacetic acid and purified using preparative HPLC and SDS-PAGE. Partial sequences were obtained using ESI-MS/MS. The peptides were used as a start to apply a 'template switching oligo' protocol to elucidate the complete open reading frame of P. farinosus hydrophobin 1 (pfah1). The deduced protein sequence comprised 107 amino acids (10.7 kDa) including a 16 amino acid long hydrophobic signal peptide, showed a calculated pI of 4.56, and was interrupted by one intron. Phylogenetic analyses revealed relationships to hydrophobins of the ascomycetes Magnaporthe grisea and Metarhizium anisopliae. Based on solubility, hydropathy pattern and phylogeny PfaH1 was assigned to the class Ia hydrophobins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Influence of Fungal Odor on Grooming Behavior of the Termite, Coptotermes formosanus

    PubMed Central

    Yanagawa, Aya; Yokohari, Fumio; Shimizu, Susumu

    2010-01-01

    The termite Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) protects itself from entomopathogenic fungus by mutual grooming behavior. C. formosanus removes foreign organisms, such as fungal conidia, from the body surface of its nestmates by mutual grooming behavior and eating them. The conidia removal rate from the body surface differed according to the isolate of entomopathogenic fungi (Beauveria brongniartii 782, Paecilomyces fumosoroseus K3, and Metarhizium anisopliae 455), and the removal rate of the fungal isolates seemed to depend on feeding preference, which was detrmined using paper discs moistened with a fungal suspension. In addition, it was found that C. formosanus without antennae groomed their nestmates more frequently than those with antennae. Consequently, it seems that C. formosanus antennae detect substances without touching, such as via odor, and it affects the efficiency of grooming behavior. The results of single sensillum recording support the hypothesis that C. formosanus are capable of distinguishing three species of fungi by their odors. PMID:21073347

  20. Immunity in a Social Insect

    NASA Astrophysics Data System (ADS)

    Rosengaus, Rebeca B.; Traniello, James F. A.; Chen, Tammy; Brown, Julie J.; Karp, Richard D.

    Although pathogens appear to have exerted significant selective pressure on various aspects of sociality, mechanisms of disease resistance in the social insects are poorly understood. We report here on an immune response to infection by the dampwood termite, Zootermopsis angusticollis. Nymphs immunized with an injection of 7.6×107, 7.6×105, or 7.6×104 cells/ml glutaraldehyde-killed solution of the bacterium Pseudomonas aeruginosa had significantly higher survivorship than controls following a challenge with a lethal concentration of active bacteria. Similarly, nymphs exposed to a 9×10-1 spores/ml suspension of the fungus Metarhizium anisopliae had higher survivorship than controls after a challenge with a lethal concentration of spores. Prior exposure to a pathogen thus conferred upon termites a degree of protection during a subsequent encounter with the same pathogen. This represents the first demonstration of immune function in vivo in a social insect.

  1. Susceptibility of Vespula vulgaris (Hymenoptera: vespidae) to generalist entomopathogenic fungi and their potential for wasp control.

    PubMed

    Harris, R J; Harcourt, S J; Glare, T R; Rose, E A; Nelson, T J

    2000-05-01

    The pathogenicity of Vespula vulgaris wasp workers and larvae to a range of fungi was determined. All fungi were isolated in New Zealand and included isolates from Vespula, known generalist insect pathogens, and isolates generally nonpathogenic to insects. Workers and larvae were highly susceptible to pathogenic isolates at high spore concentrations (>1.75 x 10(5) cfu/individual). Eight isolates, two of Metarhizium anisopliae, five of Beauveria bassiana, and one of Aspergillus flavus were pathogenic while a single isolate of M. flavouiride var. novazealandicum, Cladosporium sp., and Paecilomyces sp. were not. The transfer of spores between workers, and between workers and larvae, was also investigated using several different application methods. Transfer of spores occurred between treated and untreated individuals, and for some of the application methods sufficient spores were transferred to cause mortality of the nontreated individuals. These findings are related to the potential of fungi for the control of wasps.

  2. Trials to control South American ticks with entomopathogenic fungi.

    PubMed

    Bittencourt, V R

    2000-01-01

    Ticks are parasites of great importance to man, domestic, and wild animals. In spite of the progress of the science, thus far, ticks are controlled mainly by chemical acaricides and when this technique is used in an indiscriminate way it can lead to ambiental pollution and development of tick resistance to acarcides. The studies developed in the Universidade Federal Rural do Rio de Janeiro demonstrate that some isolates of the fungi Metarhizium anisopliae and Beauveria bassiana are pathogens for ticks and their action effects the mortality of ticks and reduces the populational levels in subsequent generations. In future, research needs to address the search of new pathogens; the association of biological with chemical products seeking an synergistic action; the search of formulations that propitiate increased stability, and careful studies on the safety of biological products for use in animals.

  3. [Roles of phosphatases in pathogen infection: a review].

    PubMed

    Zhu, Pei; Li, Xinqiang; Li, Zhenlun

    2012-02-01

    Phosphatases play a key role not only in cell physiological functions of an organism, but also in host-pathogen interactions. Many studies demonstrated that some Gram-negative pathogenic bacteria could evade host immunity and promote pathogenicity by injecting phosphatases into host cells through type III secretion system. However, there were few reports about pathogenic fungi evading the immunity of hosts. Our researches indicated that the entomogenic fungus Metarhizium anisopliae could dephosphorylate the signal transduction substance of locust humoral immunity specifically in vitro by secreting extracellular protein tyrosine phosphatase, which implied that the fungus might interfere with the immune defense of locust. To provide reference for further studies of the functions of phosphatases, we reviewed the types of phosphatases and their roles in pathogen infection.

  4. Microbial control of the invasive spiraling whitefly on cassava with entomopathogenic fungi.

    PubMed

    Boopathi, Thangavel; Karuppuchamy, Palaniappan; Singh, Soibam B; Kalyanasundaram, Manickavasagam; Mohankumar, S; Ravi, Madhaiyan

    2015-01-01

    The entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, Lecanicillium lecanii and Isaria fumosorosea were tested for their efficacy in managing the exotic spiraling whitefly Aleurodicus dispersus (Hemiptera, Aleyrodidae) on cassava (Manihot esculenta) during 2 seasons (2011-2012 and 2012-2013). The fungi I. fumosorosea and L. lecanii exhibited promising levels of control (> 70% mortality of the A. dispersus population). The percent mortality increased over time in both seasons. Application of I. fumosorosea was highly pathogenic to A. dispersus in both seasons compared to the other entomopathogenic fungi. Analysis of the percent mortality in both seasons revealed differences in efficacy between 3 and 15 days after treatment. The season also influenced the effects of the fungi on the A. dispersus population. Thus, entomopathogenic fungi have the potential to manage A. dispersus infestation of cassava.

  5. Symbiotic bacteria on the cuticle of the leaf-cutting ant Acromyrmex subterraneus subterraneus protect workers from attack by entomopathogenic fungi

    PubMed Central

    Mattoso, Thalles C.; Moreira, Denise D. O.; Samuels, Richard I.

    2012-01-01

    Although only discovered in 1999, the symbiotic filamentous actinobacteria present on the integument of certain species of leaf-cutting ants have been the subject of intense research. These bacteria have been shown to specifically suppress fungal garden parasites by secretion of antibiotics. However, more recently, a wider role for these bacteria has been suggested from research revealing their generalist anti-fungal activity. Here we show, for the first time, evidence for a role of these bacteria in the defence of young worker ants against a fungal entomopathogen. Experimental removal of the bacterial bio-film using an antibiotic resulted in a significant increase in susceptibility of worker ants to infection by the entomopathogenic fungus Metarhizium anisopliae. This is the first direct evidence for the advantage of maintaining a bacterial bio-film on the cuticle as a defensive strategy of the ants themselves and not exclusively for protection of the fungus garden. PMID:22130174

  6. Microbial control of the invasive spiraling whitefly on cassava with entomopathogenic fungi

    PubMed Central

    Boopathi, Thangavel; Karuppuchamy, Palaniappan; Singh, Soibam B.; Kalyanasundaram, Manickavasagam; Mohankumar, S.; Ravi, Madhaiyan

    2015-01-01

    Abstract The entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, Lecanicillium lecanii and Isaria fumosorosea were tested for their efficacy in managing the exotic spiraling whitefly Aleurodicus dispersus (Hemiptera, Aleyrodidae) on cassava (Manihot esculenta) during 2 seasons (2011-2012 and 2012-2013). The fungi I. fumosorosea and L. lecanii exhibited promising levels of control (> 70% mortality of the A. dispersus population). The percent mortality increased over time in both seasons. Application of I. fumosorosea was highly pathogenic to A. dispersus in both seasons compared to the other entomopathogenic fungi. Analysis of the percent mortality in both seasons revealed differences in efficacy between 3 and 15 days after treatment. The season also influenced the effects of the fungi on the A. dispersus population. Thus, entomopathogenic fungi have the potential to manage A. dispersus infestation of cassava. PMID:26691465

  7. Symbiotic bacteria on the cuticle of the leaf-cutting ant Acromyrmex subterraneus subterraneus protect workers from attack by entomopathogenic fungi.

    PubMed

    Mattoso, Thalles C; Moreira, Denise D O; Samuels, Richard I

    2012-06-23

    Although only discovered in 1999, the symbiotic filamentous actinobacteria present on the integument of certain species of leaf-cutting ants have been the subject of intense research. These bacteria have been shown to specifically suppress fungal garden parasites by secretion of antibiotics. However, more recently, a wider role for these bacteria has been suggested from research revealing their generalist anti-fungal activity. Here we show, for the first time, evidence for a role of these bacteria in the defence of young worker ants against a fungal entomopathogen. Experimental removal of the bacterial bio-film using an antibiotic resulted in a significant increase in susceptibility of worker ants to infection by the entomopathogenic fungus Metarhizium anisopliae. This is the first direct evidence for the advantage of maintaining a bacterial bio-film on the cuticle as a defensive strategy of the ants themselves and not exclusively for protection of the fungus garden.

  8. Screening and secretomic analysis of enthomopatogenic Beauveria bassiana isolates in response to cowpea weevil (Callosobruchus maculatus) exoskeleton.

    PubMed

    Murad, André M; Laumann, Raul A; Mehta, Angela; Noronha, Eliane F; Franco, Octávio L

    2007-04-01

    The production of cowpea (Vigna unguiculata), an important self-sustained crop in Latin America and Africa, is severely affected by damage by the cowpea weevil Callosobruchus maculatus. The presence of a single larva in stored seeds can lead to losses of almost 40%. Control of C. maculatus currently relies on the inefficient use of chemical insecticides and post-harvest treatments. The use of entomopathogenic fungus became a reliable alternative for coleopteran pest control and has been extensively investigated. Among them, Beauveria bassiana and Metarhizium anisopliae were widely evaluated in order to measure their virulence toward many insects. In this report, we evaluated the insecticidal activity of ten strains of B. bassiana and the most lethal fungi strains were analyzed for proteinaceous secretions by two dimensional electrophoresis and for enzyme activities, including chitinolytic, proteolytic and alpha-amylolytic activities. This study could, in the near future, help to establish novel biotechnological tools to use for cowpea weevil control.

  9. Pathogen Alarm Behavior in a Termite: A New Form of Communication in Social Insects

    NASA Astrophysics Data System (ADS)

    Rosengaus, R. B.; Jordan, C.; Lefebvre, M. L.; Traniello, J. F. A.

    Dampwood termites, Zootermopsis angusticollis, show an alarm response after detecting the presence of spores of the pathogenic fungus Metarhizium anisopliae. Termites in direct contact with a high concentration of spores (107 spores/ml) show a striking vibratory display which appears to convey information about the presence of pathogens to nearby unexposed nestmates through substrate vibration. Nestmates not directly in contact with spores that perceive the vibrational signal increase significantly their distance from the spore-exposed vibrating termites, apparently to escape from the source of infection. The fleeing response is not induced by the presence of the spores alone or by pheromones, and requires the perception of the vibrations propagated through the substrate. This "pathogen alarm behavior" appears to be a previously unrecognized communication mechanism that allows termites to reduce disease risks within the nest.

  10. Entomopathogenic Fungus as a Biological Control for an Important Vector of Livestock Disease: The Culicoides Biting Midge

    PubMed Central

    Ansari, Minshad Ali; Pope, Edward C.; Carpenter, Simon; Scholte, Ernst-Jan; Butt, Tariq M.

    2011-01-01

    Background The recent outbreak of bluetongue virus in northern Europe has led to an urgent need to identify control measures for the Culicoides (Diptera: Ceratopogonidae) biting midges that transmit it. Following successful use of the entomopathogenic fungus Metarhizium anisopliae against larval stages of biting midge Culicoides nubeculosus Meigen, we investigated the efficacy of this strain and other fungi (Beauveria bassiana, Isaria fumosorosea and Lecanicillium longisporum) as biocontrol agents against adult C. nubeculosus in laboratory and greenhouse studies. Methodology/Findings Exposure of midges to ‘dry’ conidia of all fungal isolates caused significant reductions in survival compared to untreated controls. Metarhizium anisopliae strain V275 was the most virulent, causing a significantly decrease in midge survival compared to all other fungal strains tested. The LT50 value for strain V275 was 1.42 days compared to 2.21–3.22 days for the other isolates. The virulence of this strain was then further evaluated by exposing C. nubeculosus to varying doses (108–1011 conidia m−2) using different substrates (horse manure, damp peat, leaf litter) as a resting site. All exposed adults were found to be infected with the strain V275 four days after exposure. A further study exposed C. nubeculosus adults to ‘dry’ conidia and ‘wet’ conidia (conidia suspended in 0.03% aq. Tween 80) of strain V275 applied to damp peat and leaf litter in cages within a greenhouse. ‘Dry’ conidia were more effective than ‘wet’ conidia, causing 100% mortality after 5 days. Conclusion/Significance This is the first study to demonstrate that entomopathogenic fungi are potential biocontrol agents against adult Culicoides, through the application of ‘dry’ conidia on surfaces (e.g., manure, leaf litter, livestock) where the midges tend to rest. Subsequent conidial transmission between males and females may cause an increased level of fungi-induced mortality in midges

  11. Entomopathogenic fungus as a biological control for an important vector of livestock disease: the Culicoides biting midge.

    PubMed

    Ansari, Minshad Ali; Pope, Edward C; Carpenter, Simon; Scholte, Ernst-Jan; Butt, Tariq M

    2011-01-10

    The recent outbreak of bluetongue virus in northern Europe has led to an urgent need to identify control measures for the Culicoides (Diptera: Ceratopogonidae) biting midges that transmit it. Following successful use of the entomopathogenic fungus Metarhizium anisopliae against larval stages of biting midge Culicoides nubeculosus Meigen, we investigated the efficacy of this strain and other fungi (Beauveria bassiana, Isaria fumosorosea and Lecanicillium longisporum) as biocontrol agents against adult C. nubeculosus in laboratory and greenhouse studies. Exposure of midges to 'dry' conidia of all fungal isolates caused significant reductions in survival compared to untreated controls. Metarhizium anisopliae strain V275 was the most virulent, causing a significantly decrease in midge survival compared to all other fungal strains tested. The LT(50) value for strain V275 was 1.42 days compared to 2.21-3.22 days for the other isolates. The virulence of this strain was then further evaluated by exposing C. nubeculosus to varying doses (10(8)-10(11) conidia m(-2)) using different substrates (horse manure, damp peat, leaf litter) as a resting site. All exposed adults were found to be infected with the strain V275 four days after exposure. A further study exposed C. nubeculosus adults to 'dry' conidia and 'wet' conidia (conidia suspended in 0.03% aq. Tween 80) of strain V275 applied to damp peat and leaf litter in cages within a greenhouse. 'Dry' conidia were more effective than 'wet' conidia, causing 100% mortality after 5 days. This is the first study to demonstrate that entomopathogenic fungi are potential biocontrol agents against adult Culicoides, through the application of 'dry' conidia on surfaces (e.g., manure, leaf litter, livestock) where the midges tend to rest. Subsequent conidial transmission between males and females may cause an increased level of fungi-induced mortality in midges thus reducing the incidence of disease.

  12. Directed evolution of a filamentous fungus for thermotolerance

    PubMed Central

    de Crecy, Eudes; Jaronski, Stefan; Lyons, Benjamin; Lyons, Thomas J; Keyhani, Nemat O

    2009-01-01

    Background Filamentous fungi are the most widely used eukaryotic biocatalysts in industrial and chemical applications. Consequently, there is tremendous interest in methodology that can use the power of genetics to develop strains with improved performance. For example, Metarhizium anisopliae is a broad host range entomopathogenic fungus currently under intensive investigation as a biologically based alternative to chemical pesticides. However, it use is limited by the relatively low tolerance of this species to abiotic stresses such as heat, with most strains displaying little to no growth between 35–37°C. In this study, we used a newly developed automated continuous culture method called the Evolugator™, which takes advantage of a natural selection-adaptation strategy, to select for thermotolerant variants of M. anisopliae strain 2575 displaying robust growth at 37°C. Results Over a 4 month time course, 22 cycles of growth and dilution were used to select 2 thermotolerant variants of M. anisopliae. Both variants displayed robust growth at 36.5°C, whereas only one was able to grow at 37°C. Insect bioassays using Melanoplus sanguinipes (grasshoppers) were also performed to determine if thermotolerant variants of M. anisopliae retained entomopathogenicity. Assays confirmed that thermotolerant variants were, indeed, entomopathogenic, albeit with complex alterations in virulence parameters such as lethal dose responses (LD50) and median survival times (ST50). Conclusion We report the experimental evolution of a filamentous fungus via the novel application of a powerful new continuous culture device. This is the first example of using continuous culture to select for complex phenotypes such as thermotolerance. Temperature adapted variants of the insect-pathogenic, filamentous fungus M. anisopliae were isolated and demonstrated to show vigorous growth at a temperature that is inhibitory for the parent strain. Insect virulence assays confirmed that pathogenicity

  13. Liquid Culture Production of Fungal Microsclerotia.

    PubMed

    Jackson, Mark A; Payne, Angela R

    2016-01-01

    Fungal microsclerotia ("small" sclerotia) are compact hyphal aggregates, typically 50-600 μm in diameter, that are formed under unfavorable nutritional and/or environmental conditions. These structures are often melanized and desiccated to some degree containing endogenous nutritional reserves for use when favorable conditions return. Many fungi, mostly plant pathogens, produce microsclerotia as a survival structure. Liquid culture methods have been developed for producing microsclerotia of the Ascomycota Metarhizium spp, Colletotrichum truncatum, Mycoleptodiscus terrestris, and Trichoderma spp. While these fungi have varying culture conditions that optimize microsclerotia production, all share common nutritional and environmental requirements for microsclerotia formation. Described are the general liquid culture techniques, media components, and harvesting and drying methods necessary to produce stable microsclerotial granules of these fungi.

  14. The interactions between gut microbiota and entomopathogenic fungi: a potential approach for biological control of Blattella germanica (L.).

    PubMed

    Zhang, Fan; Sun, Xiao X; Zhang, Xian C; Zhang, Shuo; Lu, Jie; Xia, Yong M; Huang, Yan H; Wang, Xue J

    2017-09-09

    Metarhizium anisopliae and Beauveria bassiana mainly infect insects through the cuticle; gut infection occasionally occurs. Microorganisms existing in the gut may play a crucial role in the evolution and ecology of host defenses to fungal pathogens. To evaluate whether the gut bacteria participate in antifungal activity, and to determine their role in host protection, the interactions between gut bacteria and M. anisopliae and the diversity of gut microbiota in cockroaches were studied. Oral feeding test showed the mortality of conventional cockroaches was obviously decreased; both gut homogenates and aqueous fecal extracts showed antifungal activity, but the samples from germ-free cockroaches did not. Twenty-two bacterial strains with antifungal activity and siderophore producing ability were isolated from the gut and feces of cockroaches. Based on high-throughput sequencing techniques, a total of 23 different phyla and 212 genera were detected. The composition of the hindgut was vastly different from those of foregut and midgut; higher diversity and abundance of Bacteroides and Pseudomonas were found in the hindgut. The gut microbiota of German cockroaches might play a critical role in protecting cockroaches from fungi invasion and colonization. Removing certain bacteria in B. germanica microbiota may facilitate microbial control using fungal pathogens. This article is protected by copyright. All rights reserved.

  15. Acute toxicity of locust insecticides to two indigenous invertebrates from Sahelian temporary ponds.

    PubMed

    Lahr, J; Badji, A; Marquenie, S; Schuiling, E; Ndour, K B; Diallo, A O; Everts, J W

    2001-01-01

    During desert locust plagues large amounts of insecticides are used for control operations. Drift from these treatments and accidental overspraying may contaminate small surface waters such as temporary ponds. The present study describes methods for static acute toxicity tests with two abundant organisms that occur in temporary ponds in the African Sahel region: the fairy shrimp Streptocephalus sudanicus Daday (Branchiopoda, Anostraca, Streptocephalidae) and the backswimmer Anisops sardeus Herrich-Schåffer (Hemiptera, Notonectidae). The organisms were captured in the field and 48-h static toxicity tests were conducted in the laboratory. The assays were used to screen the toxicity of 11 formulated synthetic insecticides used in desert locust control and of spores of the mycopesticide Metarhizium anisopliae var. acridum. Most of the synthetic insecticides tested were highly toxic to both organisms (LC50 or EC50<1 mg/L). Exceptions were the toxicity of diflubenzuron to A. sardeus (moderately toxic: 1anisopliae var. acridum was moderately toxic to S. sudanicus and only slightly toxic to A. sardeus. EC50 values of the insecticides for S. sudanicus were not significantly correlated with L(E)C50 values for Daphnia magna collected from the literature. For A. sardeus a significant correlation with D. magna was found, but even in this data set the two species had widely differing sensitivities to some insecticides.

  16. Can Insects Develop Resistance to Insect Pathogenic Fungi?

    PubMed Central

    Yaroslavtseva, Olga N.; Greig, Carolyn; Kryukov, Vadim Y.; Grizanova, Ekaterina V.; Mukherjee, Krishnendu; Vilcinskas, Andreas; Glupov, Viktor V.; Butt, Tariq M.

    2013-01-01

    Microevolutionary adaptations and mechanisms of fungal pathogen resistance were explored in a melanic population of the Greater wax moth, Galleria mellonella. Under constant selective pressure from the insect pathogenic fungus Beauveria bassiana, 25th generation larvae exhibited significantly enhanced resistance, which was specific to this pathogen and not to another insect pathogenic fungus, Metarhizium anisopliae. Defense and stress management strategies of selected (resistant) and non-selected (susceptible) insect lines were compared to uncover mechanisms underpinning resistance, and the possible cost of those survival strategies. We hypothesize that the insects developed a transgenerationally primed resistance to the fungus B. bassiana, a costly trait that was achieved not by compromising life-history traits but rather by prioritizing and re-allocating pathogen-species-specific augmentations to integumental front-line defenses that are most likely to be encountered by invading fungi. Specifically during B. bassiana infection, systemic immune defenses are suppressed in favour of a more limited but targeted repertoire of enhanced responses in the cuticle and epidermis of the integument (e.g. expression of the fungal enzyme inhibitor IMPI, and cuticular phenoloxidase activity). A range of putative stress-management factors (e.g. antioxidants) is also activated during the specific response of selected insects to B. bassiana but not M. anisopliae. This too occurs primarily in the integument, and probably contributes to antifungal defense and/or helps ameliorate the damage inflicted by the fungus or the host’s own immune responses. PMID:23560083

  17. Can insects develop resistance to insect pathogenic fungi?

    PubMed

    Dubovskiy, Ivan M; Whitten, Miranda M A; Yaroslavtseva, Olga N; Greig, Carolyn; Kryukov, Vadim Y; Grizanova, Ekaterina V; Mukherjee, Krishnendu; Vilcinskas, Andreas; Glupov, Viktor V; Butt, Tariq M

    2013-01-01

    Microevolutionary adaptations and mechanisms of fungal pathogen resistance were explored in a melanic population of the Greater wax moth, Galleria mellonella. Under constant selective pressure from the insect pathogenic fungus Beauveria bassiana, 25(th) generation larvae exhibited significantly enhanced resistance, which was specific to this pathogen and not to another insect pathogenic fungus, Metarhizium anisopliae. Defense and stress management strategies of selected (resistant) and non-selected (susceptible) insect lines were compared to uncover mechanisms underpinning resistance, and the possible cost of those survival strategies. We hypothesize that the insects developed a transgenerationally primed resistance to the fungus B. bassiana, a costly trait that was achieved not by compromising life-history traits but rather by prioritizing and re-allocating pathogen-species-specific augmentations to integumental front-line defenses that are most likely to be encountered by invading fungi. Specifically during B. bassiana infection, systemic immune defenses are suppressed in favour of a more limited but targeted repertoire of enhanced responses in the cuticle and epidermis of the integument (e.g. expression of the fungal enzyme inhibitor IMPI, and cuticular phenoloxidase activity). A range of putative stress-management factors (e.g. antioxidants) is also activated during the specific response of selected insects to B. bassiana but not M. anisopliae. This too occurs primarily in the integument, and probably contributes to antifungal defense and/or helps ameliorate the damage inflicted by the fungus or the host's own immune responses.

  18. Enhancing the Stress Tolerance and Virulence of an Entomopathogen by Metabolic Engineering of Dihydroxynaphthalene Melanin Biosynthesis Genes ▿ †

    PubMed Central

    Tseng, Min N.; Chung, Pei C.; Tzean, Shean S.

    2011-01-01

    Entomopathogenic fungi have been used for biocontrol of insect pests for many decades. However, the efficacy of such fungi in field trials is often inconsistent, mainly due to environmental stresses, such as UV radiation, temperature extremes, and desiccation. To circumvent these hurdles, metabolic engineering of dihydroxynaphthalene (DHN) melanin biosynthetic genes (polyketide synthase, scytalone dehydratase, and 1,3,8-trihydroxynaphthalene reductase genes) cloned from Alternaria alternata were transformed into the amelanotic entomopathogenic fungus Metarhizium anisopliae via Agrobacterium-mediated transformation. Melanin expression in the transformant of M. anisopliae was verified by spectrophotometric methods, liquid chromatography/mass spectrometry (LC/MS), and confocal microscopy. The transformant, especially under stresses, showed notably enhanced antistress capacity and virulence, in terms of germination and survival rate, infectivity, and reduced median time to death (LT50) in killing diamondback moth (Plutella xylostella) larvae compared with the wild type. The possible mechanisms in enhancing the stress tolerance and virulence, and the significance and potential for engineering melanin biosynthesis genes in other biocontrol agents and crops to improve antistress fitness are discussed. PMID:21571888

  19. Testing fungus impregnated cloths for the control of adult Aedes aegypti under natural conditions.

    PubMed

    Paula, Adriano R; Carolino, Aline T; Silva, Carlos P; Pereira, César R; Samuels, Richard I

    2013-09-08

    Entomopathogenic fungi could be useful tools for reducing populations of the dengue mosquito Aedes aegypti. Here the efficiency of fungus (Metarhizium anisopliae) impregnated cloths (with and without imidacloprid [IMI]) was evaluated against adult A. aegypti in simulated human dwellings. Behaviour of mosquitoes in the presence of black cloths was also investigated. When mosquitoes were released into the test rooms, the lowest survival rates (38%) were seen when five black cloths impregnated with conidia of ESALQ 818 + 10 ppm IMI were fixed under tables and chairs. This result was significantly lower than the survival rate recorded when cloths were impregnated with ESALQ 818 alone (44%) or ESALQ 818 + 0.1 ppm IMI (43%). Blood fed A. aegypti had lower landing frequencies on black cloths than sucrose fed insects during the first 24 h following feeding, which may have been due to reduced flight activity. Few mosquitoes (4-5%) were observed to land on the cloths during the hours of darkness. The landing pattern of sucrose-fed mosquitoes on non-treated and fungus-treated cloths was similar. The synergism between M. anisopliae and IMI significantly reduced Aedes survival in simulated field conditions. The use of fungus impregnated cloths is a promising point source application method for the control of adult A. aegypti.

  20. Effects of carbon concentration and carbon to nitrogen ratio on the growth and sporulation of several biocontrol fungi.

    PubMed

    Gao, Li; Sun, Man H; Liu, Xing Z; Che, Yong S

    2007-01-01

    Effects of carbon concentration and carbon to nitrogen (C:N) ratio on six biocontrol fungal strains are reported in this paper. All fungal strains had extensive growth on the media supplemented with 6-12 gl(-1) carbon and C:N ratios from 10:1 to 80:1, and differed in nutrient requirements for sporulation. Except for the two strains of Paecilomyces lilacinus, all selected fungi attained the highest spore yields at a C:N ratio of 160:1 when the carbon concentration was 12 gl(-1) for Metarhizium anisopliae SQZ-1-21, 6 gl(-1) for M. anisopliae RS-4-1 and Trichoderma viride TV-1, and 8 gl(-1) for Lecanicillium lecanii CA-1-G. The optimal conditions for P. lilacinus sporulation were 8 gl(-1) carbon with a C:N ratio of 10:1 for M-14 and 12 gl(-1) carbon with a C:N ratio of 20:1 for IPC-P, respectively. The results indicated that the influence of carbon concentration and C:N ratio on fungal growth and sporulation is strain dependent; therefore, consideration for the complexity of nutrient requirements is essential for improving yields of fungal biocontrol agents.

  1. Effects of steam-distilled shoot extract of Tagetes minuta (Asterales: Asteraceae) and entomopathogenic fungi on larval Tetanops myopaeformis.

    PubMed

    Dunkel, Florence V; Jaronski, Stefan T; Sedlak, Christopher W; Meiler, Svenja U; Veo, Kendra D

    2010-06-01

    Interactions of a biopesticidal formulation of steam distilled shoot extract of Mexican marigold, Tagetes minuta, and entomopathogenic fungi were evaluated for management of the sugarbeet root maggot, Tetanops myopaeformis (Röder). Shoot extract plus surfactant (E-Z Mulse) (=T. minuta oil) was used in a 65:35 ratio to test the hypothesis that this fungicidal and nematocidal biopesticide causes dose-dependent mortality and developmental arrest of T. myopaeformis but does not interfere with the action of entomopathogenic fungi when applied together. A soil-petri dish bioassay system was developed to test the hypothesis. For diapausing, nonfeeding but active 12-mo-old third-instar larvae, 0.5% T. minuta oil treatment (=0.325% active ingredient [AI]) was sufficient to prevent pupation without mortality, but 0.75% T. minuta oil treatment (=0.458% AI) was lethal for 93% of the test insects. The effect of T. minuta oil on fungal efficacy under simultaneous use was studied using a model system of two entomopathogenic fungi, Beauveria bassiana (Bals.) Vuillemin. TM28 and Metarhizium anisopliae variety anisopliae (Metsch.) Sorokin MA 1200, in a soil-based bioassay with larval sugarbeet root maggots. No adverse effects of T. minuta oil on action of entomopathogenic fungi and no synergy were found; an additive effect of the T. minuta oil and each fungal isolate separately was found.

  2. Susceptibility of biological stages of the horn fly, Haematobia irritans, to entomopathogenic fungi (Hyphomycetes)

    PubMed Central

    Angel-Sahagún, C. A.; Lezama-Gutiérrez, R.; Molina-Ochoa, J.; Galindo-Velasco, E.; López-Edwards, M.; Rebolledo-Domínguez, O.; Cruz-Vázquez, C.; Reyes-Velázquez, W. P.; Skoda, S. R.; Foster, J. E.

    2005-01-01

    The susceptibility of the egg, pupa, and adult of Haematobia irritans (L.) (Diptera: Muscidae) to isolates of the fungi Metarhizium anisopliae (Metsch.) Sor., Beauveria bassiana (Bals.) Vuill., and Paecilomyces fumosoroseus (Wize) Brown and Smith, was evaluated under laboratory conditions. Groups of 20 eggs than 4 h old, pupae less than 48h old and adults were sprayed with a conidial suspension of each isolate. Eggs, pupae and adults of horn fly were susceptible to these entomopathogenic fungi. For treated eggs, the isolates Ma3, Ma 15, Ma25, Pfr1, and Pfr8 reduced adult emergence to 3.8% to 6.3% in comparison with the control (72%). The mortality of pupae infected by the isolates Ma2, Ma25, and Pfr10 ranged between 50% and 71.3%. Mortality of adults after treatment with the isolates Ma6, Ma 10, Ma 14, Ma 15, Pfr 1, Pfr 9, Pfr 10, Pfr 11, and Pfr12 were higher than 90%. The isolate Ma6 produced the lowest LC50 against adult horn flies (8.08 × 102conidia/ml). These findings supported the hypotheses that isolates of M. anisopliae, and P. fumosoroseus are pathogenic against the different biological stages of horn flies by reducing adult emergence when applied on groups of eggs and pupae, and producing mortality when applied to adults. PMID:17119632

  3. A Strong Immune Response in Young Adult Honeybees Masks Their Increased Susceptibility to Infection Compared to Older Bees

    PubMed Central

    Bull, James C.; Ryabov, Eugene V.; Prince, Gill; Mead, Andrew; Zhang, Cunjin; Baxter, Laura A.; Pell, Judith K.; Osborne, Juliet L.; Chandler, Dave

    2012-01-01

    Honeybees, Apis mellifera, show age-related division of labor in which young adults perform maintenance (“housekeeping”) tasks inside the colony before switching to outside foraging at approximately 23 days old. Disease resistance is an important feature of honeybee biology, but little is known about the interaction of pathogens and age-related division of labor. We tested a hypothesis that older forager bees and younger “house” bees differ in susceptibility to infection. We coupled an infection bioassay with a functional analysis of gene expression in individual bees using a whole genome microarray. Forager bees treated with the entomopathogenic fungus Metarhizium anisopliae s.l. survived for significantly longer than house bees. This was concomitant with substantial differences in gene expression including genes associated with immune function. In house bees, infection was associated with differential expression of 35 candidate immune genes contrasted with differential expression of only two candidate immune genes in forager bees. For control bees (i.e. not treated with M. anisopliae) the development from the house to the forager stage was associated with differential expression of 49 candidate immune genes, including up-regulation of the antimicrobial peptide gene abaecin, plus major components of the Toll pathway, serine proteases, and serpins. We infer that reduced pathogen susceptibility in forager bees was associated with age-related activation of specific immune system pathways. Our findings contrast with the view that the immunocompetence in social insects declines with the onset of foraging as a result of a trade-off in the allocation of resources for foraging. The up-regulation of immune-related genes in young adult bees in response to M. anisopliae infection was an indicator of disease susceptibility; this also challenges previous research in social insects, in which an elevated immune status has been used as a marker of increased disease

  4. Comparison of the effect of the chosen species of saprotrophic fungi on the development of Toxocara canis and Ascaris suum eggs.

    PubMed

    Mazurkiewicz-Zapałowicz, Kinga; Jaborowska-Jarmoluk, Magdalena; Kołodziejczyk, Lidia; Kuźna-Grygiel, Wanda

    2014-01-01

    The study aim was to compare the antagonistic interaction between saprotrophic soil fungi and embryonic development of geohelminths Toxocara canis and Ascaris suum. The experimental cultures were fertilized eggs of T.canis and A. suum incubated together with mycelium of strains: Fusarium culmorum, Metarhizium anisopliae,Paecilomyces fumosoroseus, Trichoderma viride and Trichothecium roseum. In the control cultures the eggs of both nematode species were incubated without fungi. The experiment was conducted at temp. 26°C for 60 days. Compared with the control, all of the tested species of fungi significantly extended the embryonic development of both T. canis and A. suum. Most inhibitory effect on the rate of embryonic development of T. canis and A. suum had three fungal species: P. fumosoreus, M. anisopliae and T. viride. Compared with the control, on the 60th day of incubation in the presence of each of the tested fungal species, a larger percentage (p<0.05) of morphological abnormalities was stated in developing embryos of T. canis (49–69%) than in A. suum (15.1–67.7%). Among the examined fungal species, only incubation with P. fumosoroseus resulted in significantly greater (p<0.05) incidence of embryonic malformations(embryopathies) in T. canis, as compared with A. suum. Also the percentage of dead larvae of T. canis in the control and in cultures with fungi (12% and 100%, respectively) was significantly higher in comparison with A. suum (0.5% and 10.3–36%, respectively). The highest percentage of non-viable larvae of A. suum was found in the presence of P.fumosoroseus, and the lowest in the presence of M. anisopliae. Findings may indicate that T. canis eggs are more sensitive to antagonistic interaction of the examined fungal strains than A. suum eggs.

  5. Development of a population-based threshold model of conidial germination for analysing the effects of physiological manipulation on the stress tolerance and infectivity of insect pathogenic fungi.

    PubMed

    Andersen, M; Magan, N; Mead, A; Chandler, D

    2006-09-01

    Entomopathogenic fungi are being used as biocontrol agents of insect pests, but their efficacy can be poor in environments where water availability is reduced. In this study, the potential to improve biocontrol by physiologically manipulating fungal inoculum was investigated. Cultures of Beauveria bassiana, Lecanicillium muscarium, Lecanicillium longisporum, Metarhizium anisopliae and Paecilomyces fumosoroseus were manipulated by growing them under conditions of water stress, which produced conidia with increased concentrations of erythritol. The time-course of germination of conidia at different water activities (water activity, aw) was described using a generalized linear model, and in most cases reducing the water activity of the germination medium delayed the onset of germination without affecting the distribution of germination times. The germination of M. anisopliae, L. muscarium, L. longisporum and P. fumosoroseus was accelerated over a range of aw levels as a result of physiological manipulation. However, the relationship between the effect of physiological manipulation on germination and the osmolyte content of conidia varied according to fungal species. There was a linear relationship between germination rate, expressed as the reciprocal of germination time, and aw of the germination medium, but there was no significant effect of fungal species or physiological manipulation on the aw threshold for germination. In bioassays with M. anisopliae, physiologically manipulated conidia germinated more rapidly on the surface of an insect host, the melon cotton aphid Aphis gossypii, and fungal virulence was increased even when relative humidity was reduced after an initial high period. It is concluded that physiological manipulation may lead to improvements in biocontrol in the field, but choice of fungal species/isolate will be critical. In addition, the population-based threshold model used in this study, which considered germination in terms of physiological

  6. Susceptibility of Diaphorina citri (Hemiptera: Liviidae) and Its Parasitoid Tamarixia radiata (Hymenoptera: Eulophidae) to Entomopathogenic Fungi under Laboratory Conditions.

    PubMed

    Ibarra-Cortés, K H; Guzmán-Franco, A W; González-Hernández, H; Ortega-Arenas, L D; Villanueva-Jiménez, J A; Robles-Bermúdez, A

    2017-07-18

    Diaphorina citri (Kuwayama) is a global pest of citrus that transmits the bacteria associated with the disease, Huanglongbing. Entomopathogenic fungi and the parasitoid Tamarixia radiata (Waterston) are important biological control agents of this pest and likely to interact in D. citri populations. As a basis for interaction studies, we determined the susceptibility of nymphs and adults of D. citri and adults of the parasitoid T. radiata to six fungal isolates from the species Beauveria bassiana s.l. (Bals.-Criv.) Vuill. (isolates B1 and B3), Metarhizium anisopliae s.s. (Metsch.) (Ma129 and Ma65) and Isaria fumosorosea Wize (I2 and Pae). We conducted experiments evaluating infection levels in all three insect groups following inoculation with a series of conidial concentrations (1 × 10(4)-1 × 10(8) conidia mL(-1)). Results showed that D. citri nymphs and T. radiata were more susceptible to fungal isolates than D. citri adults. Overall, B. bassiana and M. anisopliae isolates caused the greatest infection compared with I. fumosorosea isolates in all three groups of insects. Isolates B1 (B. bassiana) and Ma129 (M. anisopliae) infected a greater proportion of adults and nymphs of D. citri, respectively. Both isolates of B. bassiana caused greater infection in T. radiata compared with isolates of the other fungal species. We propose that isolates B1 and Ma129 are the strongest candidates for control of D. citri. Our results represent the first report of entomopathogenic fungi infecting T. radiata, and the basis for future studies to design a biological control programme that uses both agents more efficiently against D. citri populations.

  7. Efficiency of fungus-impregnated black cloths combined with imidacloprid for the control of adult Aedes aegypti (Diptera: Culicidae).

    PubMed

    Paula, A R; Carolino, A T; Silva, C P; Samuels, R I

    2013-08-01

    Entomopathogenic fungi are potential candidates for use in integrated vector management. However, efficient delivery systems for these fungi need to be investigated. It is known that adult mosquitoes are attracted to dark surfaces, and therefore, black cotton cloths impregnated with Metarhizium anisopliae alone or in combination with the insecticide imidacloprid (IMI) were tested under laboratory conditions. Black cloths impregnated with fungus were also tested in large-cage trials under natural extradomicile conditions. Blood-fed Rockefeller and wild-type strain Aedes aegypti had higher levels of survival when compared with sucrose-fed counterparts following exposure to fungus-impregnated cloths. However, when blood-fed A. aegypti were exposed to a combination of M. anisopliae + IMI, the survival rates were statistically equal to those of sucrose-fed females. Large-cage trials showed significant decreases in A. aegypti survival following a minimum 12 h exposure of the mosquitoes to fungus-impregnated cloths. Increased exposure times results in further reductions in survival. The synergism between M. anisopliae and IMI resulted in reduced survival rates independent of feeding regime under laboratory conditions. Fungus-impregnated cloths tested under simulated field conditions, considered to be unfavourable for fungal infection, resulted in significant reductions in adult A. aegypti survival. We are currently testing the combined use of fungi and insecticides against blood-fed insects under simulated field conditions. The use of fungus-impregnated cotton cloths is a promising point source application method for the control of adult Aedes aegypti, and this strategy could be incorporated into an integrated vector management programme aiming to reduce the incidence of dengue fever. © 2013 The Society for Applied Microbiology.

  8. A strong immune response in young adult honeybees masks their increased susceptibility to infection compared to older bees.

    PubMed

    Bull, James C; Ryabov, Eugene V; Prince, Gill; Mead, Andrew; Zhang, Cunjin; Baxter, Laura A; Pell, Judith K; Osborne, Juliet L; Chandler, Dave

    2012-12-01

    Honeybees, Apis mellifera, show age-related division of labor in which young adults perform maintenance ("housekeeping") tasks inside the colony before switching to outside foraging at approximately 23 days old. Disease resistance is an important feature of honeybee biology, but little is known about the interaction of pathogens and age-related division of labor. We tested a hypothesis that older forager bees and younger "house" bees differ in susceptibility to infection. We coupled an infection bioassay with a functional analysis of gene expression in individual bees using a whole genome microarray. Forager bees treated with the entomopathogenic fungus Metarhizium anisopliae s.l. survived for significantly longer than house bees. This was concomitant with substantial differences in gene expression including genes associated with immune function. In house bees, infection was associated with differential expression of 35 candidate immune genes contrasted with differential expression of only two candidate immune genes in forager bees. For control bees (i.e. not treated with M. anisopliae) the development from the house to the forager stage was associated with differential expression of 49 candidate immune genes, including up-regulation of the antimicrobial peptide gene abaecin, plus major components of the Toll pathway, serine proteases, and serpins. We infer that reduced pathogen susceptibility in forager bees was associated with age-related activation of specific immune system pathways. Our findings contrast with the view that the immunocompetence in social insects declines with the onset of foraging as a result of a trade-off in the allocation of resources for foraging. The up-regulation of immune-related genes in young adult bees in response to M. anisopliae infection was an indicator of disease susceptibility; this also challenges previous research in social insects, in which an elevated immune status has been used as a marker of increased disease resistance and

  9. Association between entomopathogenic nematodes and fungi for control of Rhipicephalus microplus (Acari: Ixodidae).

    PubMed

    Monteiro, Caio Márcio Oliveira; Araújo, Laryssa Xavier; Matos, Renata Silva; da Silva Golo, Patrícia; Angelo, Isabele Costa; de Souza Perinotto, Wendell Marcelo; Coelho Rodrigues, Camila Aparecida; Furlong, John; Bittencourt, Vânia Rita Elias Pinheiro; Prata, Márcia Cristina Azevedo

    2013-10-01

    The aim of the study was to assess the effect of the association of entomopathogenic nematodes and fungi on Rhipicephalus microplus. The nematodes used were Heterorhabditis bacteriophora HP88 and Heterorhabditis indica LPP1 and the fungi were Metarhizium anisopliae IBCB 116 and Beauveria bassiana ESALQ 986. In the groups treated with the fungi, the females were immersed for 3 min in a conidial suspension, while in the groups treated with the nematodes, the ticks were exposed to infective juveniles. To evaluate the interaction between entomopathogens, the females were first immersed in a conidial suspension and then exposed to the nematodes. The egg mass weight and hatching percentage values of the groups treated with M. anisopliae IBCB 116 and B. bassiana ESALQ 986 in the two experiments were statistically similar (p > 0.05) to the values of the control group. In the groups treated only with nematodes, there was a significant reduction (p < 0.05) in the egg mass weight, a fact also observed for the hatching percentage of the group treated with H. indica LPP1. In all the groups treated with nematodes in association with fungi, there was a significant reduction (p < 0.05) in the egg mass weight and hatching percentage. The percentage of control of the groups treated with fungi alone varied from 31 to 55%. In the groups treated with nematodes associated or not with fungi, the control percentage was always greater than 90% and reached 100% in the group treated with H. bacteriophora HP88 associated with the fungus M. anisopliae IBCB 116.

  10. Volatile organic compounds emitted by filamentous fungi isolated from flooded homes after Hurricane Sandy show toxicity in a Drosophila bioassay.

    PubMed

    Zhao, G; Yin, G; Inamdar, A A; Luo, J; Zhang, N; Yang, I; Buckley, B; Bennett, J W

    2016-10-17

    Superstorm Sandy provided an opportunity to study filamentous fungi (molds) associated with winter storm damage. We collected 36 morphologically distinct fungal isolates from flooded buildings. By combining traditional morphological and cultural characters with an analysis of ITS sequences (the fungal DNA barcode), we identified 24 fungal species that belong to eight genera: Penicillium (11 species), Fusarium (four species), Aspergillus (three species), Trichoderma (two species), and one species each of Metarhizium, Mucor, Pestalotiopsis, and Umbelopsis. Then, we used a Drosophila larval assay to assess possible toxicity of volatile organic compounds (VOCs) emitted by these molds. When cultured in a shared atmosphere with growing cultures of molds isolated after Hurricane Sandy, larval toxicity ranged from 15 to 80%. VOCs from Aspergillus niger 129B were the most toxic yielding 80% mortality to Drosophila after 12 days. The VOCs from Trichoderma longibrachiatum 117, Mucor racemosus 138a, and Metarhizium anisopliae 124 were relatively non-toxigenic. A preliminary analysis of VOCs was conducted using solid-phase microextraction-gas chromatography-mass spectrometry from two of the most toxic, two of the least toxic, and two species of intermediate toxicity. The more toxic molds produced higher concentrations of 1-octen-3-ol, 3-octanone, 3-octanol, 2-octen-1-ol, and 2-nonanone; while the less toxic molds produced more 3-methyl-1-butanol and 2-methyl-1-propanol, or an overall lower amount of volatiles. Our data support the hypothesis that at certain concentrations, some VOCs emitted by indoor molds are toxigenic.

  11. Limitations of Species Delimitation Based on Phylogenetic Analyses: A Case Study in the Hypogymnia hypotrypa Group (Parmeliaceae, Ascomycota)

    PubMed Central

    Wei, Xinli; McCune, Bruce; Lumbsch, H. Thorsten; Li, Hui; Leavitt, Steven; Yamamoto, Yoshikazu; Tchabanenko, Svetlana; Wei, Jiangchun

    2016-01-01

    Delimiting species boundaries among closely related lineages often requires a range of independent data sets and analytical approaches. Similar to other organismal groups, robust species circumscriptions in fungi are increasingly investigated within an empirical framework. Here we attempt to delimit species boundaries in a closely related clade of lichen-forming fungi endemic to Asia, the Hypogymnia hypotrypa group (Parmeliaceae). In the current classification, the Hypogymnia hypotrypa group includes two species: H. hypotrypa and H. flavida, which are separated based on distinctive reproductive modes, the former producing soredia but absent in the latter. We reexamined the relationship between these two species using phenotypic characters and molecular sequence data (ITS, GPD, and MCM7 sequences) to address species boundaries in this group. In addition to morphological investigations, we used Bayesian clustering to identify potential genetic groups in the H. hypotrypa/H. flavida clade. We also used a variety of empirical, sequence-based species delimitation approaches, including: the “Automatic Barcode Gap Discovery” (ABGD), the Poisson tree process model (PTP), the General Mixed Yule Coalescent (GMYC), and the multispecies coalescent approach BPP. Different species delimitation scenarios were compared using Bayes factors delimitation analysis, in addition to comparisons of pairwise genetic distances, pairwise fixation indices (FST). The majority of the species delimitation analyses implemented in this study failed to support H. hypotrypa and H. flavida as distinct lineages, as did the Bayesian clustering analysis. However, strong support for the evolutionary independence of H. hypotrypa and H. flavida was inferred using BPP and further supported by Bayes factor delimitation. In spite of rigorous morphological comparisons and a wide range of sequence-based approaches to delimit species, species boundaries in the H. hypotrypa group remain uncertain. This study reveals the potential limitations of relying on distinct reproductive strategies as diagnostic taxonomic characters for Hypogymnia and also the challenges of using popular sequence-based species delimitation methods in groups with recent diversification histories. PMID:27828951

  12. Pathogenic and enzyme activities of the entomopathogenic fungus Tolypocladium cylindrosporum (Ascomycota: Hypocreales) from Tierra del Fuego, Argentina.

    PubMed

    Scorsetti, Ana C; Elíades, Lorena A; Stenglein, Sebastián A; Cabello, Marta N; Pelizza, Sebastián A; Saparrat, Mario C N

    2012-06-01

    Tolypocladium cylindrosporum is an entomopathogenic fungi that has been studied as a biological control agent against insects of several orders. The fungus has been isolated from the soil as well as from insects of the orders Coleoptera, Lepidoptera, Diptera and Hymenoptera. In this study, we analyzed the ability of a strain of T cylindrosporum, isolated from soil samples taken in Tierra del Fuego, Argentina, to produce hydrolytic enzymes, and to study the relationship of those activities to the fungus pathogenicity against pest aphids. We have made the traditional and molecular characterization of this strain of T cylindrosporum. The expression of hydrolase activity in the fungal strain was estimated at three incubation temperatures (4 degreeC, 12 degreeC and 24 degreeC), on different agar media supplemented with the following specific substrates: chitin azure, Tween 20, casein, and urea for chitinase, lipase, protease, and urease activity, respectively. The hydrolytic-enzyme activity was estimated qualitatively according to the presence of a halo of clarification through hydrolase action, besides was expressed semi-quantitatively as the ratio between the hydrolytic-halo and colony diameters. The pathogenicity of the fungus was tested on adults of the aphid Rhopalosiphum padi at three temperatures of incubation (4 degree C, 12 degree C and 24 degree C). The suspension was adjusted to a concentration of 1x10(7) conidia/ml. In pathogenicity assays at seven days post-inoculation, the fungus caused the mortality of adults of Ropalosiphum padi at different temperatures also showed a broad ability to grow on several agar-culture media, supplemented with different carbon sources at the three incubation temperatures tested. Although, the growth was greater with higher incubation temperatures (with maximum levels at 24 degreeC), the fungus reached similar colony diameters after 15 days of incubation on the medium supplemented with Tween 20 at the lower two incubation temperatures of 4 degreeC or 12 degreeC. In accordance with the results on colony diameters, the fungus revealed an ability to degrade casein, chitin derivatives, Tween 20, and urea as evidenced by the appearance of a halo around the fungal colony. Because of its origin and temperature tolerance, this Argentine strain has great potential for use as a biocontrol agent for insect pest control in cold and temperate environments.

  13. Susceptibility of two hymenopteran parasitoids of Agrilus planipennis (Coleoptera: Buprestidae) to the entomopathogenic fungus Beauveria bassiana (Ascomycota: Hypocreales)

    USDA-ARS?s Scientific Manuscript database

    Emerald ash borer (EAB), Agrilus planipennis Fairmaire, native to Asia, is killing ash trees (Fraxinus spp.) in eastern North America. Integrated pest management using biological control is the only viable long-term approach for controlling the spread of EAB outside of host resistance. Three hymen...

  14. Paecilomyces niveus Stolk & Samson, 1971 (Ascomycota: Thermoascaceae) as a pathogen of Nasonovia ribisnigri (Mosley, 1841) (Hemiptera, Aphididae) in Brazil.

    PubMed

    Zawadneak, M A C; Pimentel, I C; Robl, D; Dalzoto, P; Vicente, V; Sosa-Gómez, D R; Porsani, M; Cuquel, F L

    2015-11-01

    Nasonovia ribisnigri is a key pest of lettuce (Lactuca sativa L.) in Brazil that requires alternative control methods to synthetic pesticides. We report, for the first time, the occurrence of Paecilomyces niveus as an entomopathogen of the aphid Nasonovia ribisnigri in Pinhais, Paraná, Brazil. Samples of mummified aphids were collected from lettuce crops. The fungus P. niveus (PaePR) was isolated from the insect bodies and identified by macro and micromorphology. The species was confirmed by sequencing Internal Transcribed Spacer (ITS) rDNA. We obtained a sequence of 528 bp (accession number HQ441751), which aligned with Byssochlamys nivea strains (100% identities). In a bioassay, 120 h after inoculation of N. ribisnigri with pathogenic P. niveus had an average mortality of 74%. The presence of P. niveus as a natural pathogen of N. ribisnigri in Brazil suggests that it may be possible to employ P. niveus to minimize the use of chemical insecticides.

  15. A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families.

    PubMed

    Miadlikowska, Jolanta; Kauff, Frank; Högnabba, Filip; Oliver, Jeffrey C; Molnár, Katalin; Fraker, Emily; Gaya, Ester; Hafellner, Josef; Hofstetter, Valérie; Gueidan, Cécile; Otálora, Mónica A G; Hodkinson, Brendan; Kukwa, Martin; Lücking, Robert; Björk, Curtis; Sipman, Harrie J M; Burgaz, Ana Rosa; Thell, Arne; Passo, Alfredo; Myllys, Leena; Goward, Trevor; Fernández-Brime, Samantha; Hestmark, Geir; Lendemer, James; Lumbsch, H Thorsten; Schmull, Michaela; Schoch, Conrad L; Sérusiaux, Emmanuël; Maddison, David R; Arnold, A Elizabeth; Lutzoni, François; Stenroos, Soili

    2014-10-01

    The Lecanoromycetes is the largest class of lichenized Fungi, and one of the most species-rich classes in the kingdom. Here we provide a multigene phylogenetic synthesis (using three ribosomal RNA-coding and two protein-coding genes) of the Lecanoromycetes based on 642 newly generated and 3329 publicly available sequences representing 1139 taxa, 317 genera, 66 families, 17 orders and five subclasses (four currently recognized: Acarosporomycetidae, Lecanoromycetidae, Ostropomycetidae, Umbilicariomycetidae; and one provisionarily recognized, 'Candelariomycetidae'). Maximum likelihood phylogenetic analyses on four multigene datasets assembled using a cumulative supermatrix approach with a progressively higher number of species and missing data (5-gene, 5+4-gene, 5+4+3-gene and 5+4+3+2-gene datasets) show that the current classification includes non-monophyletic taxa at various ranks, which need to be recircumscribed and require revisionary treatments based on denser taxon sampling and more loci. Two newly circumscribed orders (Arctomiales and Hymeneliales in the Ostropomycetidae) and three families (Ramboldiaceae and Psilolechiaceae in the Lecanorales, and Strangosporaceae in the Lecanoromycetes inc. sed.) are introduced. The potential resurrection of the families Eigleraceae and Lopadiaceae is considered here to alleviate phylogenetic and classification disparities. An overview of the photobionts associated with the main fungal lineages in the Lecanoromycetes based on available published records is provided. A revised schematic classification at the family level in the phylogenetic context of widely accepted and newly revealed relationships across Lecanoromycetes is included. The cumulative addition of taxa with an increasing amount of missing data (i.e., a cumulative supermatrix approach, starting with taxa for which sequences were available for all five targeted genes and ending with the addition of taxa for which only two genes have been sequenced) revealed relatively stable relationships for many families and orders. However, the increasing number of taxa without the addition of more loci also resulted in an expected substantial loss of phylogenetic resolving power and support (especially for deep phylogenetic relationships), potentially including the misplacements of several taxa. Future phylogenetic analyses should include additional single copy protein-coding markers in order to improve the tree of the Lecanoromycetes. As part of this study, a new module ("Hypha") of the freely available Mesquite software was developed to compare and display the internodal support values derived from this cumulative supermatrix approach.

  16. A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families

    PubMed Central

    Miadlikowska, Jolanta; Kauff, Frank; Högnabba, Filip; Oliver, Jeffrey C.; Molnár, Katalin; Fraker, Emily; Gaya, Ester; Hafellner, Josef; Hofstetter, Valérie; Gueidan, Cécile; Otálora, Mónica A.G.; Hodkinson, Brendan; Kukwa, Martin; Lücking, Robert; Björk, Curtis; Sipman, Harrie J.M.; Burgaz, Ana Rosa; Thell, Arne; Passo, Alfredo; Myllys, Leena; Goward, Trevor; Fernández-Brime, Samantha; Hestmark, Geir; Lendemer, James; Lumbsch, H. Thorsten; Schmull, Michaela; Schoch, Conrad; Sérusiaux, Emmanuël; Maddison, David R.; Arnold, A. Elizabeth; Lutzoni, François; Stenroos, Soili

    2014-01-01

    The Lecanoromycetes is the largest class of lichenized Fungi, and one of the most species-rich classes in the kingdom. Here we provide a multigene phylogenetic synthesis (using three ribosomal RNA-coding and two protein-coding genes) of the Lecanoromycetes based on 642 newly generated and 3329 publicly available sequences representing 1139 taxa, 317 genera, 66 families, 17 orders and five subclasses (four currently recognized: Acarosporomycetidae, Lecanoromycetidae, Ostropomycetidae, Umbilicariomycetidae; and one provisionarily recognized, ‘Candelariomycetidae’). Maximum likelihood phylogenetic analyses on four multigene datasets assembled using a cumulative supermatrix approach with a progressively higher number of species and missing data (5-gene, 5+4-gene, 5+4+3-gene and 5+4+3+2-gene datasets) show that the current classification includes non-monophyletic taxa at various ranks, which need to be recircumscribed and require revisionary treatments based on denser taxon sampling and more loci. Two newly circumscribed orders (Arctomiales and Hymeneliales in the Ostropomycetidae) and three families (Ramboldiaceae and Psilolechiaceae in the Lecanorales, and Strangosporaceae in the Lecanoromycetes inc. sed.) are introduced. The potential resurrection of the families Eigleraceae and Lopadiaceae is considered here to alleviate phylogenetic and classification disparities. An overview of the photobionts associated with the main fungal lineages in the Lecanoromycetes based on available published records is provided. A revised schematic classification at the family level in the phylogenetic context of widely accepted and newly revealed relationships across Lecanoromycetes is included. The cumulative addition of taxa with an increasing amount of missing data (i.e., a cumulative supermatrix approach, starting with taxa for which sequences were available for all five targeted genes and ending with the addition of taxa for which only two genes have been sequenced) revealed relatively stable relationships for many families and orders. However, the increasing number of taxa without the addition of more loci also resulted in an expected substantial loss of phylogenetic resolving power and support (especially for deep phylogenetic relationships), potentially including the misplacements of several taxa. Future phylogenetic analyses should include additional single copy protein-coding markers in order to improve the tree of the Lecanoromycetes. As part of this study, a new module (“Hypha”) of the freely available Mesquite software was developed to compare and display the internodal support values derived from this cumulative supermatrix approach. PMID:24747130

  17. Proposals to conserve Botryodiplodia theobromae (Lasiodiplodia theobromae) against Sphaeria glandicola, .....Ramularia brunnea against Sphaerella tussilaginis (Mycosphaerella tussilaginis) (Ascomycota: Dothideomycetes)

    USDA-ARS?s Scientific Manuscript database

    In the course of updating the scientific names of plant-associated fungi in the U. S. National Fungus Collections Fungal Databases to conform with one scientific name for fungi as required by the International Code of Nomenclature for algae, fungi and plants (ICN, McNeill & al. in Regnum Vegetable 1...

  18. Overlooked competing asexual and sexually typified generic names of Ascomycota with recommendations for their use or protection.

    PubMed

    Rossman, Amy Y; Allen, W Cavan; Braun, Uwe; Castlebury, Lisa A; Chaverri, Priscila; Crous, Pedro W; Hawksworth, David L; Hyde, Kevin D; Johnston, Peter; Lombard, Lorenzo; Romberg, Megan; Samson, Rob A; Seifert, Keith A; Stone, Jeffrey K; Udayanga, Dhanushka; White, James F

    2016-12-01

    With the change to one scientific name for fungal species, numerous papers have been published with recommendations for use or protection of competing generic names in major groups of ascomycetes. Although genera in each group of fungi were carefully considered, some competing generic names were overlooked. This paper makes recommendations for additional competing genera not considered in previous papers. Chairs of relevant Working Groups of the ICTF were consulted in the development of these recommendations. A number of generic names need protection, specifically Amarenographium over Amarenomyces, Amniculicola over Anguillospora, Balansia over Ephelis, Claviceps over Sphacelia, Drepanopeziza over Gloeosporidiella and Gloeosporium, Golovinomyces over Euoidium, Holwaya over Crinium, Hypocrella over Aschersonia, Labridella over Griphosphaerioma, Metacapnodium over Antennularia, and Neonectria over Cylindrocarpon and Heliscus. The following new combinations are made: Amniculicola longissima, Atichia maunauluana, Diaporthe columnaris, D. liquidambaris, D. longiparaphysata, D. palmicola, D. tersa, Elsinoë bucidae, E.caricae, E. choisyae, E. paeoniae, E. psidii, E. zorniae, Eupelte shoemakeri, Godronia myrtilli, G. raduloides, Sarcinella mirabilis, S. pulchra, Schizothyrium jamaicense, and Trichothallus niger. Finally, one new species name, Diaporthe azadirachte, is introduced to validate an earlier name, and the conservation of Discula with a new type, D. destructiva, is recommended.

  19. (2289) Proposal to conserve the name Morchella semilibera against Phallus crassipes, P. gigas and P. undosus (Ascomycota)

    USDA-ARS?s Scientific Manuscript database

    True morels (Morchella) are among the most highly prized and easily recognized edible mushrooms collected during spring throughout the Northern Hemisphere. To help ensure that commercial harvests are sustainable and species diversity is preserved, management practices and conservation policies need...

  20. Proposals to conserve Pyrenophora japonica (Drechslera japonica), Pyrenophora lolii, and Pleosphaeria seminiperda (Pyrenophora seminiperda) (Ascomycota, Dothideomycetes, Pleosporales)

    USDA-ARS?s Scientific Manuscript database

    The genus Pyrenophora Fr. (1849), with type P. phaeocomes (Rebent.) Fr. (1849), is a sexually typified genus that is congeneric with the asexually typified genus Drechslera S. Ito (1930), with type D. tritici-vulgaris (Y. Nisik.) S. Ito, now regarded as a synonym of P. tritici-repentis (Died.) Dresc...