Science.gov

Sample records for metarhizium anisopliae cultures

  1. Pure culture of Metarhizium anisopliae LHL07 reprograms soybean to higher growth and mitigates salt stress.

    PubMed

    Khan, Abdul Latif; Hamayun, Muhammad; Khan, Sumera Afzal; Kang, Sang-Mo; Shinwari, Zabta Khan; Kamran, Muhammad; Ur Rehman, Shafiq; Kim, Jong-Guk; Lee, In-Jung

    2012-04-01

    Little is known about the role of endophytic fungi against abiotic stresses and isoflavonoids (IF) contents of soybean. In current study, we investigated the role of fungal endophytes on the growth of soybean under salt stress conditions. Pure cultures of nine endophytic fungi were isolated from the roots of field-grown soybean plants, and their culture filtrates were screened on Waito-C and Dongjin-byeo rice cultivars; for identification of plant growth promoting fungal strains. It was observed that fungal isolate GMC-2B significantly promoted the growth of both Waito-C and Dongjin-byeo. GMC-2B was later identified as a new strain of Metarhizium anisopliae LHL07 on the basis of 18S rDNA sequences and phylogenetic analysis. Metarhizium anisopliae LHL07 inoculated soybean plants recorded significantly higher shoot length, shoot fresh and dry biomass, chlorophyll contents, transpiration rate, photosynthetic rate and leaf area; under sodium chloride induced salt stress as compared to non-inoculated control plants. An elevated proline and reduced superoxide dismutase and malondialdehyde contents in M. anisopliae LHL07 inoculated soybean plants demonstrated mitigation of salt induced oxidative stress. Furthermore, reduced abscisic acid and elevated jasmonic acid contents in soybean plants confirmed that lesser stress was convened to M. anisopliae inoculated-plants under salinity stress. We also assessed the role of M. anisopliae interaction on IF biosynthesis of soybean, and found significantly higher IF contents in M. anisopliae inoculated soybean plants. In conclusion, endophytic fungal interactions with soybean can be beneficial to improve soybean quality and quantity under salt affected agricultural systems.

  2. Metarhizium anisopliae enzymes and toxins.

    PubMed

    Schrank, Augusto; Vainstein, Marilene Henning

    2010-12-15

    Entomopathogenic fungi are both a feasible system for the control of insect pests in agriculture with a growing market and an important model for studies of host-pathogen interaction. In the last ten years the actual use of fungi, mainly Metarhizium anisopliae and Beauveria bassiana, is increasing reaching commercial scale in Countries like Brazil, China and Mexico among others. At the same time important progress has occurred in the understanding of the molecular aspects of the pathogenesis and in the development of tools to validate putative virulence factors by the construction of over-expressing and knock-out strains. This wealth of knowledge is helping to access more efficient strains from the biodiversity and to optimize formulation for large scale use of this efficient, economic and environmental safer form of insect plague control. Here we focus some of the progress accumulated specially in M. anisopliae and give an overview of the host infection process.

  3. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    EPA Science Inventory

    Introduction

    The goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  4. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    EPA Science Inventory

    Introduction

    The goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  5. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    EPA Science Inventory

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  6. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    EPA Science Inventory

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  7. Beauveria bassiana, Metarhizium anisopliae, and Metarhizium anisopliae var. acridum conidia: tolerance to imbibitional damage

    USDA-ARS?s Scientific Manuscript database

    When dry fungal cells are immersed in water, rapid imbibition (water uptake) may compromise the plasma membrane, killing the cell. This study investigated the impact of imbibitional damage (measured in terms of reduced viability) on Beauveria bassiana (Bb), Metarhizium anisopliae (Ma) and M. anisop...

  8. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    EPA Science Inventory

    Background
    The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  9. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    EPA Science Inventory

    Background
    The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  10. Serinocyclins A and B, Cyclic Heptapeptides from Metarhizium anisopliae

    USDA-ARS?s Scientific Manuscript database

    Two new cyclic heptapeptides, serinocyclins A (1) and B (2), were isolated from conidia of the entomopathogenic fungus Metarhizium anisopliae. Structures were elucidated by a combination of mass spectrometric, NMR, and X-ray diffraction techniques. Serinocyclin A (1) contains three serine units, a...

  11. 40 CFR 180.1303 - Metarhizium anisopliae strain F52; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Metarhizium anisopliae strain F52... RESIDUES IN FOOD Exemptions From Tolerances § 180.1303 Metarhizium anisopliae strain F52; exemption from... residues of Metarhizium anisopliae strain F52 in or on all food commodities when applied as an insecticide...

  12. The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

    PubMed

    Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

    2004-07-01

    The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

  13. Cecropins from Plutella xylostella and Their Interaction with Metarhizium anisopliae

    PubMed Central

    Freed, Shoaib; Gao, Yanfu; Yu, Jing; Wang, Shuang; Ju, Wenyan; Zhang, Yuqing; Jin, Fengliang

    2015-01-01

    Cecropins are the most potent induced peptides to resist invading microorganisms. In the present study, two full length cDNA encoding cecropin2 (Px-cec2) and cecropin3 (Px-cec3) were obtained from P. xylostella by integrated analysis of genome and transcriptome data. qRT-PCR analysis revealed the high levels of transcripts of Px-cecs (Px-cec1, Px-cec2 and Px-cec3) in epidermis, fat body and hemocytes after 24, 30 and 36 h induction of Metarhizium anisopliae, respectively. Silencing of Spätzle and Dorsal separately caused the low expression of cecropins in the fat body, epidermis and hemocytes, and made the P.xylostella larvae more susceptible to M. anisopliae. Antimicrobial assays demonstrated that the purified recombinant cecropins, i.e., Px-cec1, Px-cec2 and Px-cec3, exerted a broad spectrum of antimicrobial activity against fungi, as well as Gram-positive and Gram-negative bacteria. Especially, Px-cecs showed higher activity against M. anisopliae than another selected fungi isolates. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that cecropins exerted the vital morphological alterations to the spores of M. anisopliae. Based on our results, cecropins played an imperative role in resisting infection of M. anisopliae, which will provide the foundation of biological control of insect pests by using cecorpins as a target in the future. PMID:26544076

  14. Efficacy of Metarhizium anisopliae microsclerotial granules

    USDA-ARS?s Scientific Manuscript database

    Soil incorporation bioassays of dried microsclerotial (MS) preparations of three isolates of M. anisopliae isolates were conducted using third instar Tetanops myopaeformis (sugarbeet root maggot) in clay and/or clay loam field soils as a model system to demonstrate efficacy. At rates as low as 23 mg...

  15. Protein analysis in a pleomorphically deteriorated strain of the insect-pathogenic fungus Metarhizium anisopliae.

    PubMed

    Kamp, Andrena M; Bidochka, Michael J

    2002-09-01

    Pleomorphic deterioration is a process where a fungal isolate loses the ability to produce conidia during repeated subculturing. We have previously isolated strains of the entomopathogenic fungus Metarhizium anisopliae that have irreversibly lost the ability to produce conidia and only produce mycelia when grown on agar. Gel electrophoresis was used to examine differences in intracellular protein patterns (urea-soluble proteins and urea-insoluble proteins (i.e., hydrophobins)) in conidiating and mycelial cultures of M. anisopliae. Two major proteins present in a conidiating culture and one from a mycelial culture were N-terminally sequenced but showed no homologies to known proteins. The presence of hydrophobins in conidiating and mycelial cultures was also examined, and it was shown that these proteins were abundant in conidiating cultures but not in mycelial cultures. We also used primers designed from regulatory genes involved in conidiation in Aspergillus nidulans. The amplified fragments were not homologous to A. nidulans genes.

  16. The genome sequence of the biocontrol fungus Metarhizium anisopliae and comparative genomics of Metarhizium species.

    PubMed

    Pattemore, Julie A; Hane, James K; Williams, Angela H; Wilson, Bree A L; Stodart, Ben J; Ash, Gavin J

    2014-08-07

    Metarhizium anisopliae is an important fungal biocontrol agent of insect pests of agricultural crops. Genomics can aid the successful commercialization of biopesticides by identification of key genes differentiating closely related species, selection of virulent microbial isolates which are amenable to industrial scale production and formulation and through the reduction of phenotypic variability. The genome of Metarhizium isolate ARSEF23 was recently published as a model for M. anisopliae, however phylogenetic analysis has since re-classified this isolate as M. robertsii. We present a new annotated genome sequence of M. anisopliae (isolate Ma69) and whole genome comparison to M. robertsii (ARSEF23) and M. acridum (CQMa 102). Whole genome analysis of M. anisopliae indicates significant macrosynteny with M. robertsii but with some large genomic inversions. In comparison to M. acridum, the genome of M. anisopliae shares lower sequence homology. While alignments overall are co-linear, the genome of M. acridum is not contiguous enough to conclusively observe macrosynteny. Mating type gene analysis revealed both MAT1-1 and MAT1-2 genes present in M. anisopliae suggesting putative homothallism, despite having no known teleomorph, in contrast with the putatively heterothallic M. acridum isolate CQMa 102 (MAT1-2) and M. robertsii isolate ARSEF23 (altered MAT1-1). Repetitive DNA and RIP analysis revealed M. acridum to have twice the repetitive content of the other two species and M. anisopliae to be five times more RIP affected than M. robertsii. We also present an initial bioinformatic survey of candidate pathogenicity genes in M. anisopliae. The annotated genome of M. anisopliae is an important resource for the identification of virulence genes specific to M. anisopliae and development of species- and strain- specific assays. New insight into the possibility of homothallism and RIP affectedness has important implications for the development of M. anisopliae as a

  17. Exposure of Bed Bugs to Metarhizium anisopliae at Different Humidities.

    PubMed

    Ulrich, Kevin R; Feldlaufer, Mark F; Kramer, Matthew; St Leger, Raymond J

    2014-12-01

    Bed bugs Cimex lectularius L. were exposed to conidia (spores) of the entomopathogenic fungus Metarhizium anisopliae by feeding, aerosol spray, or contact with a treated surface. Feeding experiments demonstrated that bed bugs were innately susceptible to this fungus. However, only at 98% humidity were mortality rates high, regardless of whether bed bugs were sprayed with a fungal solution or contacted a treated surface. Mortality in treated bed bugs at ambient humidity did not increase when these bed bugs were kept in aggregation with other bed bugs that had recently blood fed to repletion. Based on these laboratory studies, we conclude that M. anisopliae is a poor pathogen for use in control of bed bugs, particularly at humidities that would likely be encountered under field conditions.

  18. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    EPA Science Inventory

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  19. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    EPA Science Inventory

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  20. Beauveria bassiana and Metarhizium anisopliae endophytically colonize cassava roots following soil drench inoculation

    USDA-ARS?s Scientific Manuscript database

    The fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae were investigated to determine if endophytic colonization could be achieved in cassava. An inoculation method based on drenching the soil around cassava stems using conidial suspensions resulted in endophytic colonization of ca...

  1. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    USGS Publications Warehouse

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  2. Production of Microsclerotia of Metarhizium anisopliae Using Deep-Tank Liquid Fermentation

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Metarhizium anisopliae is a pathogen of numerous soil-dwelling insects and has been registered in the United States and other countries as a bioinsecticide. Recent studies using various strains of M. anisopliae showed that small sclerotia (microsclerotia) were produced i...

  3. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    EPA Science Inventory

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA.
    Metarhizium anisopli...

  4. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    EPA Science Inventory

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA.
    Metarhizium anisopli...

  5. Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

    PubMed

    Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

    2008-06-01

    The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

  6. Computed tomography of granulomatous pneumonia with oxalosis in an American alligator (Alligator mississippiensis) associated with Metarhizium anisopliae var anisopliae.

    PubMed

    Hall, Natalie H; Conley, Kenneth; Berry, Clifford; Farina, Lisa; Sigler, Lynne; Wellehan, James F X; Roehrl, Michael H A; Heard, Darryl

    2011-12-01

    An 18-yr-old, male, albino, American alligator (Alligator mississippiensis) was evaluated for decreased appetite and abnormal buoyancy. Computed tomography (CT) of the coelomic cavity showed multifocal mineral and soft tissue attenuating pulmonary masses consistent with pulmonary fungal granulomas. Additionally, multifocal areas of generalized, severe emphysema and pulmonary and pleural thickening were identified. The alligator was euthanized and necropsy revealed severe fungal pneumonia associated with oxalosis. Metarhizium anisopliae var. anisopliae was cultured from lung tissue and exhibited oxalate crystal formation in vitro. Crystals were identified as calcium oxalate monohydrate by X-ray powder defractometry. Fungal identification was based on morphology, including tissue sporulation, and DNA sequence analysis. This organism is typically thought of as an entomopathogen. Clinical signs of fungal pneumonia in nonavian reptiles are often inapparent until the disease is at an advanced stage, making antemortem diagnosis challenging. This case demonstrates the value of CT for pulmonary assessment and diagnosis of fungal pneumonia in the American alligator. Fungal infection with associated oxalosis should not be presumed to be aspergillosis.

  7. Catalase overexpression reduces the germination time and increases the pathogenicity of the fungus Metarhizium anisopliae.

    PubMed

    Morales Hernandez, Claudia Erika; Padilla Guerrero, Israel Enrique; Gonzalez Hernandez, Gloria Angelica; Salazar Solis, Eduardo; Torres Guzman, Juan Carlos

    2010-07-01

    Catalases and peroxidases are the most important enzymes that degrade hydrogen peroxide into water and oxygen. These enzymes and superoxide dismutase are the first lines of cell defense against reactive oxygen species. Metarhizium anisopliae displays an increase in catalase-peroxidase activity during germination and growth. To determine the importance of catalase during the invasion process of M. anisopliae, we isolated the cat1 gene. cat1 cDNA expression in Escherichia coli and the subsequent purification of the protein confirmed that the cat1 gene codes for a monofunctional catalase. Expression analysis of this gene by RT-PCR from RNA isolated from fungus grown in liquid cultures showed a decrease in the expression level of the cat1 gene during germination and an increase during mycelium growth. The expression of this gene in the fungus during the infection process of the larvae of Plutella xylostella also showed a significant increase during invasive growth. Transgenic strains overexpressing the cat1 gene had twice the catalase activity of the wild-type strain. This increase in catalase activity was accompanied by a higher level of resistance to exogenous hydrogen peroxide and a reduction in the germination time. This improvement was also observed during the infection of P. xylostella larvae. M. anisopliae transgenic strains overexpressing the cat1 gene grew and spread faster in the soft tissue of the insect, reducing the time to death of the insect by 25% and the dose required to kill 50% of the population 14-fold.

  8. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    USGS Publications Warehouse

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  9. 76 FR 26194 - Metarhizium anisopliae Strain F52; Exemption From the Requirement of a Tolerance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-06

    ... accordance with good agricultural practices. Novozymes Biologicals, Inc. submitted a petition to ] EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), requesting an exemption from the requirement of a... in accordance with good agricultural practices, Metarhizium anisopliae strain F52, a known...

  10. Species limits, phylogeography and reproductive mode in the Metarhizium anisopliae complex

    USDA-ARS?s Scientific Manuscript database

    An essential first step toward understanding the ecology and life histories of Metarhizium anisopliae-group species as entomopathogens, endophytes and soil-adapted fungi is the ability to accurately define species limits and confidently infer a species tree. Here we present a multilocus phylogeny of...

  11. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  12. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae Extract

    Marsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker3
    1ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  13. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae Extract

    Marsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker3
    1ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  14. Susceptibility of Agrilus planipennis (Coleoptera: Buprestidae) to Beauveria bassiana and Metarhizium anisopliae

    Treesearch

    Houping Lui; Leah S. Bauer

    2006-01-01

    The susceptibility of Agrilus planipennis Fairmaire (Coleoptera: Buprestidae) to selected strains of the entomopathogenic fungi Beauveria bassiana (Balsamo) Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin was evaluated through bioassays with direct immersion or foliar exposure under laboratory conditions. Results showed that A. planipennis adults were...

  15. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  16. Soil Persistence of Metarhizium anisopliae Applied to Manage Sugarbeet Root Maggot in a Cover Crop Microenvironment

    USDA-ARS?s Scientific Manuscript database

    The sugarbeet root maggot, Tetanops myopaeformis (Röder), is a major insect pest of sugarbeet, Beta vulgaris L., in North Dakota, Minnesota, and Idaho. Three field trials using the insect pathogen Metarhizium anisopliae (Metch.) Sorok. ATCC 62176 in conjunction with cover crops were conducted in 200...

  17. Selection of indigenous isolates of entomopathogenic soil fungus Metarhizium anisopliae under laboratory conditions.

    PubMed

    Skalický, Aleš; Bohatá, Andrea; Šimková, Jana; Osborne, Lance S; Landa, Zdeněk

    2014-07-01

    Eight native isolates of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin were obtained by monitoring soils cultivated in a conventional manner. These isolates were compared in three areas: (a) conidial germination, (b) radial growth and sporulation and (c) ability of conidia to infect Tenebrio molitor larvae. All bioassays were carried out at constant temperatures of 10, 15, and 20 °C. Conidia of individual isolates demonstrated differences in germination after a 24-h long incubation at all evaluated temperatures. At 20 °C, the germination ranged from 67 to 100 % and at 15 °C from 5.33 to 46.67 %. At 10 °C, no germination was observed after 24 h; nevertheless, it was 8.67-44.67 % after 48 h. In terms of radial growth, the culture diameters and the associated production of spores of all isolates increased with increasing temperature. At 10 °C, sporulation was observed in three isolates while all remaining cultures appeared sterile. Three weeks post-inoculation, conidia of all assessed isolates caused 100 % cumulative mortality of treated larvae of T. molitor at 15 and 20 °C with the exception of isolate 110108 that induced 81.33 % mortality at 15 °C. At 10 °C, larval cumulative mortality ranged from 6.67 to 85.33 % depending on the isolate. Isolates 110108 and 110111 showed significantly slower outset and a much lower rate of infection at all temperatures compared to other tested isolates of M. anisopliae. The bioassays were carried out with the purpose to sort and select indigenous isolates of M. anisopliae useful as biocontrol agents in their original habitat.

  18. Evaluation of Metarhizium anisopliae, Beauveria bassiana and Paecilomyces fumosoroseus as entomopathogens of the cactus moth, Cactoblastis cactorum (Lepidoptera:Pyralidae)

    USDA-ARS?s Scientific Manuscript database

    The fungal pathogens Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), Paecilomyces fumosoroseus (Wize) Brown & Smith (Deuteromycotina: Hyphomycetes), and Beauveria bassiana (Bals.-Criv.) Vuill. (Hypocreales: Clavicipitaceae) were evaluated as potential biological control ...

  19. Infectivity of Metarhizium anisopliae (Hypocreales: Clavicipitaceae) to Phlebotomus papatasi (Diptera: Psychodidae) under laboratory conditions.

    PubMed

    Zayed, Alia; Soliman, Mustafa M; El-Shazly, Mohamed M

    2013-07-01

    Susceptibility of Phlebotomus papatasi Scopoli (Diptera: Psychodidae) larvae to the entomopathogenic fungus Metarhizium anisopliae (Metschinkoff) Sorokin (Ma79) (Hypocreales: Clavicipitaceae) was evaluated at two different temperatures. The ability of the fungus to reinfect healthy sand flies was followed up for approximately 20 wk and the effect of in vivo repassage on the enhancement of its virulence was assessed. The fungus reduced the adult emergence at 26 +/- 1 degrees C when applied to larval diet. Six spore concentrations were used in the bioassays ranging from 1 x 10(6) to 5 x 10(8) spores/ml. Mortality decreased significantly when the temperature was raised to 31 +/- 1 degrees C at all tested concentrations. Fungus-treated vials were assayed against sand fly larvae at different time lapses without additional reapplication of the fungus in the media to determine whether the level of inocula persisting in the media was sufficient to reinfect healthy sand flies. Twenty weeks postapplication, there were still enough infectious propagules of Ma79 to infect 40% of P. papatasi larvae. A comparison between the infectivity of 10 subsequent in vitro cultures and the host-passed inocula of the fungus against sand fly larvae was conducted. Mortalities of P. papatasi larvae changed significantly when exposed to inocula passed through different insects. Presented data can provide vector control decision makers and end users with fundamental information for the introduction and application of M. anisopliae as an effective control agent against the main cutaneous leishmaniasis old-world vector P. papatasi.

  20. Heat-stressed Metarhizium anisopliae: Viability (in vitro) and virulence (in vivo) assessments against the tick Rhipicephalus sanguineus

    USDA-ARS?s Scientific Manuscript database

    The current study investigated the thermotolerance of Metarhizium anisopliae s.l. conidia from the commercial products Metarril® SP Organic and Metarril® WP. The efficacy of these M. anisopliae formulations against the tick Rhipicephalus sanguineus s.l. was studied in laboratory under optimum or hea...

  1. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  2. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  3. Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

    PubMed Central

    Shang, Yanfang; Duan, Zhibing; Hu, Xiao; Xie, Xue-Qin; Zhou, Gang; Peng, Guoxiong; Luo, Zhibing; Huang, Wei; Wang, Bing; Fang, Weiguo; Wang, Sibao; Zhong, Yi; Ma, Li-Jun; St. Leger, Raymond J.; Zhao, Guo-Ping; Pei, Yan; Feng, Ming-Guang; Xia, Yuxian; Wang, Chengshu

    2011-01-01

    Metarhizium spp. are being used as environmentally friendly alternatives to chemical insecticides, as model systems for studying insect-fungus interactions, and as a resource of genes for biotechnology. We present a comparative analysis of the genome sequences of the broad-spectrum insect pathogen Metarhizium anisopliae and the acridid-specific M. acridum. Whole-genome analyses indicate that the genome structures of these two species are highly syntenic and suggest that the genus Metarhizium evolved from plant endophytes or pathogens. Both M. anisopliae and M. acridum have a strikingly larger proportion of genes encoding secreted proteins than other fungi, while ∼30% of these have no functionally characterized homologs, suggesting hitherto unsuspected interactions between fungal pathogens and insects. The analysis of transposase genes provided evidence of repeat-induced point mutations occurring in M. acridum but not in M. anisopliae. With the help of pathogen-host interaction gene database, ∼16% of Metarhizium genes were identified that are similar to experimentally verified genes involved in pathogenicity in other fungi, particularly plant pathogens. However, relative to M. acridum, M. anisopliae has evolved with many expanded gene families of proteases, chitinases, cytochrome P450s, polyketide synthases, and nonribosomal peptide synthetases for cuticle-degradation, detoxification, and toxin biosynthesis that may facilitate its ability to adapt to heterogenous environments. Transcriptional analysis of both fungi during early infection processes provided further insights into the genes and pathways involved in infectivity and specificity. Of particular note, M. acridum transcribed distinct G-protein coupled receptors on cuticles from locusts (the natural hosts) and cockroaches, whereas M. anisopliae transcribed the same receptor on both hosts. This study will facilitate the identification of virulence genes and the development of improved biocontrol strains

  4. Susceptibility of Loxosceles sp. to the arthropod pathogenic fungus Metarhizium anisopliae: potential biocontrol of the brown spider.

    PubMed

    Beys-da-Silva, Walter O; Santi, Lucélia; Berger, Markus; Guimarães, Jorge A; Schrank, Augusto; Vainstein, Marilene H

    2013-01-01

    Loxosceles genus (brown spider) is an important pest with great impact on public health. Thus, more effective strategies for spider control are necessary. Three isolates of Metarhizium anisopliae fungus were tested for the control of Loxosceles sp. Metarhizium anisopliae isolate E6 was highly virulent to the Loxosceles sp. spider, causing 100% mortality at 10(9) conidia/ml after 12 days and 9 days for juvenile and adult spiders, respectively. This is the first report of the pathogenicity of M. anisopliae against a venomous arthropod. This fungus could offer an interesting alternative to reduce loxoscelism in future biocontrol strategies.

  5. Diversity of entomopathogenic fungi near leaf-cutting ant nests in a neotropical forest, with particular reference to Metarhizium anisopliae var. anisopliae.

    PubMed

    Hughes, W O H; Thomsen, L; Eilenberg, J; Boomsma, J J

    2004-01-01

    We investigated the prevalence of entomopathogenic fungi associated with leaf-cutting ant colonies in a small area of tropical forest in Panama. There was a high abundance of Metarhizium anisopliae var. anisopliae near the colonies. Beauveria bassiana was also detected in the soil, Aspergillus flavus in dump material, and six Camponotus atriceps ants were found infected with Cordyceps sp. Based on a partial sequence of the IGS region, almost all of the M. anisopliae var. anisopliae isolates fell within one of the three main clades of M. anisopliae var. anisopliae, but with there still being considerable diversity within this clade. The vast majority of leaf-cutting ants collected were not infected by any entomopathogenic fungi. While leaf-cutting ants at this site must, therefore, regularly come into contact with a diversity of entomopathogenic fungi, they do not appear to be normally infected by them.

  6. Investigations on the destruxin production of the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Wang, Chengshu; Skrobek, Anke; Butt, Tariq M

    2004-03-01

    The dynamics of cyclic peptide destruxins (dtxs) produced by Metarhizium anisopliae strains V245 and V275 were monitored both on solid and in liquid media. The results showed that both strains did not produce dtxs in large-scale fermenter cultures or solid Czapek Dox (CD) agar. Production of the major dtxs A and B could be determined in both strains when grown on rice for up to 10-30 days. The main dtxs A, B, E, and E diol were detected in CD liquid culture filtrate from both strains after three days post-inoculation on. Parallel decrease of dtx E and increase of E diol in the culture medium were found, indicating that the latter is the hydrolytic product from the former. Production of dtxs A and B was significantly positively correlated. A negative correlation was observed between the production of the metabolites and pH value of the medium. The influence of different nutrient sources on dtx production was evaluated by using media with different carbon and nitrogen ratios as well as with different insect homogenates. The findings showed that the amount of dtxs A, B, and E increased with the increasing content of peptone in the medium. When insect homogenate was used as single nutrient source or added to CD medium, no toxins were detected in the culture filtrate. The potential risk posed by the toxic metabolites during mass production is discussed.

  7. Selectivity of Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Hymenoptera: Braconidae).

    PubMed

    Rossoni, Camila; Loureiro, Elisângela De Souza; Pereira, Fabricio Fagundes; Kassab, Samir Oliveira; Costa, Daniele Perassa; Barbosa, Rogério Hidalgo

    2014-01-01

    Understanding mortality patterns and interactions between entomopathogenic fungi and parasitoids is important to improve insect biological control programs. The aim of this study was to evaluate the effect of Metarhizium anisopliae (Metschnikoff, 1879) Sorokin, 1833 and Beauveria bassiana (Balsamo) Vuillemin, 1912 (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Cameron, 1891) (Hymenoptera: Braconidae) with biological insecticides Biometha WP Plus (M. anisopliae), Biovéria G (B. bassiana), Boverril WP (B. bassiana), Metarril WP (M. anisopliae), and Metie WP (M. anisopliae) at concentrations of 1 x 10(9) conidia (con).mL(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1). In the experimental, 10 females of C. flavipes were packed in disposable cups capped with a contact surface (filter paper, 9 cm2) treated with commercial product. The experimental design was completely randomized, with 16 treatments and five replicates of 10 females each. Mortality was assessed at 24, 48, 72, 96, and 120 hours after exposition (HAE) of the products. In general, B. bassiana and M. anisopliae in the concentrations of 1 x 10(9) con.ml(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1) can't affect C. flavipes females because the peak of mortality in treatments with bioinsecticides was similar to the control and this demonstrated the selectivity of fungi B. bassiana and M. anisopliae on C. flavipes females.

  8. Conidia of the insect pathogenic fungus, Metarhizium anisopliae, fail to adhere to mosquito larval cuticle

    PubMed Central

    Greenfield, Bethany P. J.; Lord, Alex M.; Dudley, Ed; Butt, Tariq M.

    2014-01-01

    Adhesion of conidia of the insect pathogenic fungus, Metarhizium anisopliae, to the arthropod host cuticle initially involves hydrophobic forces followed by consolidation facilitated by the action of extracellular enzymes and secretion of mucilage. Gene expression analysis and atomic force microscopy were used to directly quantify recognition and adhesion between single conidia of M. anisopliae and the cuticle of the aquatic larval stage of Aedes aegypti and a representative terrestrial host, Tenebrio molitor. Gene expression data indicated recognition by the pathogen of both hosts; however, the forces for adhesion to the mosquito were approximately five times lower than those observed for Tenebrio. Although weak forces were recorded in response to Aedes, Metarhizium was unable to consolidate firm attachment. An analysis of the cuticular composition revealed an absence of long-chain hydrocarbons in Aedes larvae which are thought to be required for fungal development on host cuticle. This study provides, to our knowledge, the first evidence that Metarhizium does not form firm attachment to Ae. aegypti larvae in situ, therefore preventing the normal route of invasion and pathogenesis from occuring. PMID:26064542

  9. Genomic Analyses and Transcriptional Profiles of the Glycoside Hydrolase Family 18 Genes of the Entomopathogenic Fungus Metarhizium anisopliae

    PubMed Central

    Junges, Ângela; Boldo, Juliano Tomazzoni; Souza, Bárbara Kunzler; Guedes, Rafael Lucas Muniz; Sbaraini, Nicolau; Kmetzsch, Lívia; Thompson, Claudia Elizabeth; Staats, Charley Christian; de Almeida, Luis Gonzaga Paula; de Vasconcelos, Ana Tereza Ribeiro; Vainstein, Marilene Henning; Schrank, Augusto

    2014-01-01

    Fungal chitin metabolism involves diverse processes such as metabolically active cell wall maintenance, basic nutrition, and different aspects of virulence. Chitinases are enzymes belonging to the glycoside hydrolase family 18 (GH18) and 19 (GH19) and are responsible for the hydrolysis of β-1,4-linkages in chitin. This linear homopolymer of N-acetyl-β-D-glucosamine is an essential constituent of fungal cell walls and arthropod exoskeletons. Several chitinases have been directly implicated in structural, morphogenetic, autolytic and nutritional activities of fungal cells. In the entomopathogen Metarhizium anisopliae, chitinases are also involved in virulence. Filamentous fungi genomes exhibit a higher number of chitinase-coding genes than bacteria or yeasts. The survey performed in the M. anisopliae genome has successfully identified 24 genes belonging to glycoside hydrolase family 18, including three previously experimentally determined chitinase-coding genes named chit1, chi2 and chi3. These putative chitinases were classified based on domain organization and phylogenetic analysis into the previously described A, B and C chitinase subgroups, and into a new subgroup D. Moreover, three GH18 proteins could be classified as putative endo-N-acetyl-β-D-glucosaminidases, enzymes that are associated with deglycosylation and were therefore assigned to a new subgroup E. The transcriptional profile of the GH18 genes was evaluated by qPCR with RNA extracted from eight culture conditions, representing different stages of development or different nutritional states. The transcripts from the GH18 genes were detected in at least one of the different M. anisopliae developmental stages, thus validating the proposed genes. Moreover, not all members from the same chitinase subgroup presented equal patterns of transcript expression under the eight distinct conditions studied. The determination of M. anisopliae chitinases and ENGases and a more detailed study concerning the enzymes

  10. The entomopathogenic fungus Metarhizium anisopliae alters ambient pH, allowing extracellular protease production and activity.

    PubMed

    St Leger, R J; Nelson, J O; Screen, S E

    1999-10-01

    Ambient pH regulates the expression of virulence genes of Metarhizium anisopliae, but it was unknown if M. anisopliae can regulate ambient pH. Mutants of M. anisopliae altered in production of oxalic acid were evaluated for the interrelationship of ambient pH, buffering capacity added to media, growth, and generation of extracellular proteases and ammonia. Wild-type and acid-overproducing mutants [Acid(+)] grew almost as well at pH 8 as at pH 6, but acid-non-producing [Acid(-)] mutants showed limited growth at pH 8, indicating that acid production is linked to the ability to grow at higher pH. Production of ammonia by M. anisopliae was strongly stimulated by low levels of amino acids in the medium when cells were derepressed for nitrogen and carbon. Likewise, although Aspergillus fumigatus and Neurospora crassa produced some ammonia in minimal media, addition of low levels of amino acids enhanced production. Ammonia production by A. fumigatus, N. crassa and M. anisopliae increased the pH of the medium and allowed production of subtilisin proteases, whose activities are observed only at basic pH. In contrast, protease production by the Acid(+) mutants of M. anisopliae was greatly reduced because of the acidification of the medium. This suggests that alkalinization by ammonia production is adaptive by facilitating the utilization of proteinaceous nutrients. Collectively, the data imply that ammonia may have functions related to regulation of the microenvironment and that it represents a previously unconsidered virulence factor in diverse fungi with the potential to harm tissues and disturb the host's immune system.

  11. Laboratory evaluation of Beauveria bassiana and Metarhizium anisopliae in the control of Haemaphysalis qinghaiensis in China.

    PubMed

    Ren, Qiaoyun; Chen, Ze; Luo, Jin; Liu, Guangyuan; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Li, Youquan; Niu, Qingli; Liu, Junlong; Yang, Jifei; Han, Xueqing; Yin, Hong; Luo, Jianxun

    2016-06-01

    Haemaphysalis qinghaiensis, a prevalent tick species in China, is an ectoparasite that preferentially infests small ruminants and can transmit Theileria sp. and Babesia sp. In this study, we evaluated the pathogenicity of individual and mixed infections of the fungi Beauveria bassiana and Metarhizium anisopliae to H. qinghaiensis nymphs. The estimated LC50 for ticks immersed in solutions of B. bassiana, M. anisopliae and a mixture thereof were: 5.88056 × 10(4), 2.65 × 10(4), and 2.85 × 10(4) conidia mL(-1) respectively, and the nymphal mortality ranged from 52 to 100 %. Thus, these results suggest a potential approach for the biocontrol of H. qinghaiensis.

  12. Virulence of Entomopathogenic Fungi Metarhizium anisopliae and Paecilomyces fumosoroseus for the Microbial Control of Spodoptera exigua

    PubMed Central

    Han, Ji Hee; Jin, Byung Rae; Lee, Sang Yeob

    2014-01-01

    The beet armyworm Spodoptera exigua (Lepidoptera: Noctuidae) is difficult to control using chemical insecticides because of the development of insecticide resistance. Several pest control agents are used to control the beet armyworm. Entomopathogenic fungi are one of the candidates for eco-friendly pest control instead of chemical control agents. In this study, among various entomopathogenic fungal strains isolated from soil two isolates were selected as high virulence pathogens against larva of beet armyworm. Control efficacy of fungal conidia was influenced by conidia concentration, temperature, and relative humidity (RH). The isolates Metarhizium anisopliae FT83 showed 100% cumulative mortality against second instar larvae of S. exigua 3 days after treatment at 1 × 107 conidia/mL and Paecilomyces fumosoroseus FG340 caused 100% mortality 6 days after treatment at 1 × 104 conidia/mL. Both M. anisopliae FT83 and P. fumosoroseus FG340 effectively controlled the moth at 20~30℃. M. anisopliae FT83 was significantly affected mortality by RH: mortality was 86.7% at 85% RH and 13.4% at 45% RH. P. fumosoroseus FG340 showed high mortality as 90% at 45% RH and 100% at 75% RH 6 days after conidia treatments. These results suggest that P. fumosoroseus FG340 and M. anisopliae FT83 have high potential to develop as a biocontrol agent against the beet armyworm. PMID:25606011

  13. Metarhizium anisopliae Pathogenesis of Mosquito Larvae: A Verdict of Accidental Death

    PubMed Central

    Butt, Tariq M.; Greenfield, Bethany P. J.; Greig, Carolyn; Maffeis, Thierry G. G.; Taylor, James W. D.; Piasecka, Justyna; Dudley, Ed; Abdulla, Ahmed; Dubovskiy, Ivan M.; Garrido-Jurado, Inmaculada; Quesada-Moraga, Enrique; Penny, Mark W.; Eastwood, Daniel C.

    2013-01-01

    Metarhizium anisopliae, a fungal pathogen of terrestrial arthropods, kills the aquatic larvae of Aedes aegypti, the vector of dengue and yellow fever. The fungus kills without adhering to the host cuticle. Ingested conidia also fail to germinate and are expelled in fecal pellets. This study investigates the mechanism by which this fungus adapted to terrestrial hosts kills aquatic mosquito larvae. Genes associated with the M. anisopliae early pathogenic response (proteinases Pr1 and Pr2, and adhesins, Mad1 and Mad2) are upregulated in the presence of larvae, but the established infection process observed in terrestrial hosts does not progress and insecticidal destruxins were not detected. Protease inhibitors reduce larval mortality indicating the importance of proteases in the host interaction. The Ae. aegypti immune response to M. anisopliae appears limited, whilst the oxidative stress response gene encoding for thiol peroxidase is upregulated. Cecropin and Hsp70 genes are downregulated as larval death occurs, and insect mortality appears to be linked to autolysis through caspase activity regulated by Hsp70 and inhibited, in infected larvae, by protease inhibitors. Evidence is presented that a traditional host-pathogen response does not occur as the species have not evolved to interact. M. anisopliae retains pre-formed pathogenic determinants which mediate host mortality, but unlike true aquatic fungal pathogens, does not recognise and colonise the larval host. PMID:24349111

  14. Flexible metabolism in Metarhizium anisopliae and Beauveria bassiana: role of the glyoxylate cycle during insect pathogenesis.

    PubMed

    Padilla-Guerrero, Israel Enrique; Barelli, Larissa; González-Hernández, Gloria Angélica; Torres-Guzmán, Juan Carlos; Bidochka, Michael J

    2011-01-01

    Insect pathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have an increasing role in the control of agricultural insect pests and vectors of human diseases. Many of the virulence factors are well studied but less is known of the metabolism of these fungi during the course of insect infection or saprobic growth. Here, we assessed enzyme activity and gene expression in the central carbon metabolic pathway, including isocitrate dehydrogenase, aconitase, citrate synthase, malate synthase (MLS) and isocitrate lyase (ICL), with particular attention to the glyoxylate cycle when M. anisopliae and B. bassiana were grown under various conditions. We observed that ICL and MLS, glyoxylate cycle intermediates, were upregulated during growth on 2-carbon compounds (acetate and ethanol) as well as in insect haemolymph. We fused the promoter of the M. anisopliae ICL gene (Ma-icl) to a marker gene (mCherry) and showed that Ma-icl was upregulated when M. anisopliae was grown in the presence of acetate. Furthermore, Ma-icl was upregulated when fungi were engulfed by insect haemocytes as well as during appressorium formation. Addition of the ICL inhibitor 3-nitroproprionate delayed conidial germination and inhibited appressorium formation. These results show that these insect pathogenic fungi have a flexible metabolism that includes the glyoxylate cycle as an integral part of germination, pathogenesis and saprobic growth.

  15. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae.

    PubMed

    Bukhari, Tullu; Takken, Willem; Koenraadt, Constantianus J M

    2011-02-22

    The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80), dry (organic and inorganic) and oil (mineral and synthetic) formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. When formulated in a synthetic oil (ShellSol T), fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with a suitable carrier are a promising tool for control of larval

  16. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae

    PubMed Central

    2011-01-01

    Background The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Methods Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80), dry (organic and inorganic) and oil (mineral and synthetic) formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. Results When formulated in a synthetic oil (ShellSol T), fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. Conclusions ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with a suitable carrier are a

  17. Efficacy of Metarhizium anisopliae isolate MAX-2 from Shangri-la, China under desiccation stress

    PubMed Central

    2014-01-01

    Background Metarhizium anisopliae, a soil-borne entomopathogen found worldwide, is an interesting fungus for biological control. However, its efficacy in the fields is significantly affected by environmental conditions, particularly moisture. To overcome the weakness of Metarhizium and determine its isolates with antistress capacity, the efficacies of four M. anisopliae isolates, which were collected from arid regions of Yunnan Province in China during the dry season, were determined at different moisture levels, and the efficacy of the isolate MAX-2 from Shangri-la under desiccation stress was evaluated at low moisture level. Results M. anisopliae isolates MAX-2, MAC-6, MAL-1, and MAQ-28 showed gradient descent efficacies against sterile Tenebrio molitor larvae, and gradient descent capacities against desiccation with the decrease in moisture levels. The efficacy of MAX-2 showed no significant differences at 35% moisture level than those of the other isolates. However, significant differences were found at 8% to 30% moisture levels. The efficacies of all isolates decreased with the decrease in moisture levels. MAX-2 was relatively less affected by desiccation stress. Its efficacy was almost unaffected by the decrease at moisture levels > 25%, but slowly decreased at moisture levels < 25%. By contrast, the efficacies of other isolates rapidly decreased with the decrease in moisture levels. MAX-2 caused different infection characteristics on T. molitor larvae under desiccation stress and in wet microhabitat. Local black patches were found on the cuticles of the insects, and the cadavers dried without fungal growth under desiccation stress. However, dark black internodes and fungal growth were found after death of the insects in the wet microhabitat. Conclusions MAX-2 showed significantly higher efficacy and superior antistress capacity than the other isolates under desiccation stress. The infection of sterile T. molitor larvae at low moisture level constituted a

  18. Species limits, phylogeography and reproductive mode in the Metarhizium anisopliae complex.

    PubMed

    Rehner, Stephen A; Kepler, Ryan M

    2017-09-01

    An essential first step to elucidating the ecology and life histories of Metarhizium anisopliae-group species as entomopathogens, endophytes and soil-adapted fungi is the ability to define species limits and confidently infer a species phylogeny. In a multilocus phylogeny of the core Metarhizium anisopliae species complex, the majority of isolates sampled herein group within the currently defined limits of M. pingshaense, M. anisopliae, M. robertsii and M. brunneum, designated informally as the "PARB" clade. Multilocus phylogenetic analyses reveal pervasive congruent hierarchical structure among the genomic regions analyzed, which suggest that current PARB species delimitations likely encompass additional cryptic complexes. Further, the interpolation of isolates from different continents throughout each species lineage indicates periodic inter-continental dispersals. Although no PARB species has yet been confirmed to produce a sexual state, we demonstrate the mutually exclusive incidence of the MAT1 and MAT2 mating type idiomorphs among individuals in all PARB species. This configuration of mating type is diagnostic of a heterothallic, obligately outcrossing mating system, indicating the conservation of and ongoing potential for sexual reproduction in all PARB species. As one example of the utility of IGS markers, the commercially registered M. anisopliae strain F52, which is widely used for pest control in North America, Canada and Europe, is shown to be a member of the M. brunneum complex. While current PARB species delimitations evidently encompass cryptic partitions, formal recognition of segregate species should be approached cautiously until further evidence of their phylogenetic exclusivity, ecological distinctiveness or other unique attributes is demonstrated. Nevertheless, acknowledgment of these intraspecific partitions will provide a useful conceptual framework to guide future investigations of the community structure, phylogeography, population genetics

  19. Lack of acute pathogenicity and toxicity in mice of an isolate of Metarhizium anisopliae var. anisopliae from spittlebugs.

    PubMed

    Toriello, C; Pérez-Torres, A; Burciaga-Díaz, A; Navarro-Barranco, H; Pérez-Mejía, A; Lorenzana-Jiménez, M; Mier, T

    2006-10-01

    A monospore strain of Metarhizium anisopliae var. anisopliae (EH-479/2), isolated in Mexico from Aeneolamia sp., was tested for oral acute intragastric pathogenicity and toxicity in CD-1 mice, including a thorough histological study. Animals were inoculated by gavage with one dose (10(8) conidia/animal) of viable (72 mice) and nonviable (24 mice) conidia and compared to 18 control mice. Clinical observations were done daily; mycological and histological tests were performed during necropsies at days 3, 10, 17, and 21 after the inoculation. At the end of the study, no mice showed clinical symptoms of illness, and the animals' mean weight corresponded to that of healthy adults. No inflammatory reactions were identified in analyzed organs, suggesting the nonimmunogenic status of this fungal strain. Evidence of fungal germination was noted in two lymph nodes and in liver and lung of one dead mouse, out of 72 viable-conidia treated mice. There was no evidence of toxicity symptoms in mice inoculated with nonviable conidia. The results obtained support the nonpathogenic and nontoxic status of this fungal strain when administered in a sole intragastric dose in mice.

  20. Exposure of bed bugs to metarhizium anisopliae, and the effect of defensive secretions on fungal growth in vitro

    USDA-ARS?s Scientific Manuscript database

    Bed bugs Cimex lectularius were treated with conidia of the entomopathogenic fungus Metarhizium anisopliae by topical, spray, and contact exposure. One week post-exposure, inconsistent mortalities were observed, averaging 30% across all treatment groups and replicates. Microscopic examination of top...

  1. Laboratory mortality and mycosis of adult Curculio caryae (Coleoptera: Curculionidae) following application of Metarhizium anisopliae in the laboratory and field

    USDA-ARS?s Scientific Manuscript database

    The pecan weevil, Curculio caryae, is a key pest of pecans. Our objective was to determine the potential of Metarhizium anisopliae to control emerging C. caryae adults. First, a laboratory test was conducted to compare four Beauveria bassiana strains (Bb GA2, BbLA3, BbMS1, and GHA) and three M. an...

  2. Diatomaceous earth and oil enhance effectiveness of Metarhizium anisopliae against Triatoma infestans.

    PubMed

    Luz, Christian; Rodrigues, Juscelino; Rocha, Luiz F N

    2012-04-01

    Entomopathogenic fungi, especially Metarhizium anisopliae, have potential for integrated control of peridomestic triatomine bugs. However, the high susceptibility of these vectors to fungal infection at elevated ambient humidities decreases in the comparatively dry conditions that often prevail in their microhabitats. A formulation adapted to this target pest that induces high and quick mortality can help to overcome these drawbacks. In the present study diatomaceous earth, which is used against pests of stored grains or as an additive to mycoinsecticides, delayed but did not reduce in vitro germination of M. anisopliae s.l. IP 46 conidia after >24h agitation without affecting viability, and did not hamper the survival of Triatoma infestans nymphs exposed to treated surfaces. The settling behavior of nymphs on a treated surface in choice tests depended on the concentration of diatomaceous earth and ambient light level. Conidia formulated with diatomaceous earth and a vegetable oil synergized the insecticidal effect of the fungus in nymphs, and quickly killed all treated insects, even at 75% relative humidity (LT(90) 8.3 days) where unformulated conidia caused only 25% mortality after a 25 days exposure. The improved performance of a combined oil and desiccant dust formulation of this Metarhizium isolate raises the likelihood for its successful mycoinsecticidal use for triatomine control and, apparently, against other domestic insect pests. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Optimization of compatible non-ionic surfactant for formulation development of hydrophobic conidia of entomopathogenic fungi, Beauveria bassiana (Hypocreales:Cordycipitaceae) and Metarhizium anisopliae Hypocreales:Clavicipita

    USDA-ARS?s Scientific Manuscript database

    Aerial conidia, especially dried conidia of entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae are hydrophobic, and therefore surfactants are needed for developing water-based formulations in laboratory studies, greenhouse bioassays, and field trials as well as commercial product ...

  4. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen).

    PubMed

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W; Zhang, Zehua

    2016-06-22

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca(2+) disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control.

  5. Effectiveness of Metarhizium anisopliae (Deuteromycetes) against Ixodes scapularis (Acari: Ixodidae) engorging on Peromnyscus leucopus.

    PubMed

    Hornbostel, V L; Ostfeld, Richard S; Benjamin, Michael A

    2005-06-01

    With the incidence of Lyme disease increasing throughout the United States, reducing risk of exposure to the disease is of the utmost concern. In the northeastern U.S., the blacklegged tick, Ixodes scapularis, is the primary vector and the white-footed mouse, (Peromyscus leucopus), the primary reservoir for Borrelia burgdorteri, the bacterium causing Lyme disease. Targeting I. scapularis engorging on white-footed mice with an effective biological control agent, such as the fungus Metarhizium anisopliae, could be an effective and relatively safe control technique. In 2002-2003, we performed laboratory and field experiments to determine whether M anisopliae-treated nesting material could effectively control larval I. scapularis ticks engorging on white-footed mice, and therefore reduce the number of infected nymphal I. scapularis questing the following summer. Our laboratory experiment demonstrated a strong negative effect of M. anisopliae-treated nesting material on survival of I. scapularis larvae feeding on P. leucopus, with 75% versus 35% larval mortality in treatment versus control nests. Our field trials caused only modest, localized reductions in nymphal abundance and had no effect on the proportion of nymphal I. scapularis infected with B. burgdorferi. Field results probably could be improved by increasing the density of nestboxes to allow fungal delivery to a higher proportion of the mouse population and by deploying nestboxes in an area with lower mammalian diversity, such as a suburban landscape.

  6. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen)

    PubMed Central

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W.; Zhang, Zehua

    2016-01-01

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca2+ disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control. PMID:27328936

  7. Beauveria bassiana and Metarhizium anisopliae endophytically colonize cassava roots following soil drench inoculation

    PubMed Central

    Greenfield, Melinda; Gómez-Jiménez, María I.; Ortiz, Viviana; Vega, Fernando E.; Kramer, Matthew; Parsa, Soroush

    2016-01-01

    We investigated the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae to determine if endophytic colonization could be achieved in cassava. An inoculation method based on drenching the soil around cassava stem cuttings using conidial suspensions resulted in endophytic colonization of cassava roots by both entomopathogens, though neither was found in the leaves or stems of the treated cassava plants. Both fungal entomopathogens were detected more often in the proximal end of the root than in the distal end. Colonization levels of B. bassiana were higher when plants were sampled at 7–9 days post-inoculation (84%) compared to 47–49 days post-inoculation (40%). In contrast, the colonization levels of M. anisopliae remained constant from 7–9 days post-inoculation (80%) to 47–49 days post-inoculation (80%), which suggests M. anisopliae is better able to persist in the soil, or as an endophyte in cassava roots over time. Differences in colonization success and plant growth were found among the fungal entomopathogen treatments. PMID:27103778

  8. Novel technique for quantifying adhesion of Metarhizium anisopliae conidia to the tick cuticle.

    PubMed

    Ment, Dana; Gindin, Galina; Rot, Asael; Soroker, Victoria; Glazer, Itamar; Barel, Shimon; Samish, Michael

    2010-06-01

    The present study describes an accurate quantitative method for quantifying the adherence of conidia to the arthropod cuticle and the dynamics of conidial germination on the host. The method was developed using conidia of Metarhizium anisopliae var. anisopliae (Metschn.) Sorokin (Hypocreales: Clavicipitaceae) and engorged Rhipicephalus annulatus (Say) (Arachnida: Ixodidae) females and was also verified for M. anisopliae var. acridum Driver et Milner (Hypocreales: Clavicipitaceae) and Alphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae) larvae. This novel method is based on using an organic solvent (dichloromethane [DCM]) to remove the adhered conidia from the tick cuticle, suspending the conidia in a detergent solution, and then counting them using a hemocytometer. To confirm the efficacy of the method, scanning electron microscopy (SEM) was used to observe the conidial adherence to and removal from the tick cuticle. As the concentration of conidia in the suspension increased, there were correlating increases in both the number of conidia adhering to engorged female R. annulatus and tick mortality. However, no correlation was observed between a tick's susceptibility to fungal infection and the amount of adhered conidia. These findings support the commonly accepted understanding of the nature of the adhesion process. The mechanism enabling the removal of the adhered conidia from the host cuticle is discussed.

  9. Biological control of Ixodes ricinus larvae and nymphs with Metarhizium anisopliae blastospores.

    PubMed

    Wassermann, Marion; Selzer, Philipp; Steidle, Johannes L M; Mackenstedt, Ute

    2016-07-01

    The entomopathogenic fungus Metarhizium anisopliae is used as a biological pest control agent against various arthropod species, including ticks. However, the efficacy depends on tick species, tick stage and fungus strain. We studied the effect of M. anisopliae on engorged larvae and nymphs of Ixodes ricinus, the most abundant tick species in Europe, under laboratory and semi-field conditions. A significant reduction of engorged larvae and nymphs could be shown under laboratory as well as under semi-field conditions. Only 3.5% of the larvae treated in the lab and only 18.5% kept under semi-field conditions were able to develop into nymphs compared to the recovered nymphs of the control groups, which were regarded as 100%. Only 7.1% of nymphs were recovered as adult ticks after fungal treatment under semi-field conditions compared to the control (100%). The efficacy of blastospores of M. anisopliae against engorged larvae and nymphs of I. ricinus under semi-field conditions was demonstrated in this study, showing their high potential as a biological control agent of ticks. Further studies will have to investigate the effect of this agent against other stages of I. ricinus as well as other tick species before its value as a biological control agent against ticks can be fully assessed. Copyright © 2016 Elsevier GmbH. All rights reserved.

  10. Effect of Infection by Beauveria bassiana and Metarhizium anisopliae on the Feeding of Uvarovistia zebra

    PubMed Central

    Mohammadbeigi, A.; Port, G.

    2015-01-01

    To identify the susceptibility of long-horned grasshoppers to entomopathogenic fungi, the effect of infection with the fungi Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae) on food consumption by Uvarovistia zebra (Uvarov) (Orthoptera: Tettigoniidae) was investigated. Preliminary results showed that both fungi had a negative effect on food consumption of the insects. For both fungi a significant reduction of food consumption and faeces production by insects were observed between the highest spore concentration (5 × 106 spores/ml) and other treatments. Compared with control insects, the insects treated with 5 × 106 spores/ml of B. bassiana and M. anisopliae showed 60 and 63% reduction in mean food consumption/insect, respectively. The corrected cumulative percent mortality of the insects treated with the highest concentration of B. bassiana and M. anisopliae were 57.7 and 55.5%, respectively. This was the first account of these entomopathogenic fungi being used against a species from this family, therefore based on the results obtained from this research, it could be said that the fungi have pathogenicity effect on U. zebra as a long-horned grasshopper.

  11. Potential nontarget effects of Metarhizium anisopliae (Deuteromycetes) used for biological control of ticks (Acari: Ixodidae)

    USGS Publications Warehouse

    Ginsberg, Howard S.; LeBrun, Roger A.; Heyer, Klaus; Zhioua, Elyes

    2002-01-01

    The potential for nontarget effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin, when used for biological control of ticks, was assessed in laboratory trials. Fungal pathogenicity was studied against convergent ladybird beetles, Hippodamia convergens Guérin-Méneville, house crickets, Acheta domesticus (L.), and the milkweed bugs Oncopeltus fasciatus (Dallas). Fungal spores applied with a spray tower produced significant mortality in H. convergens and A. domesticus, but effects on O. fasciatus were marginal. Placing treated insects with untreated individuals resulted in mortality from horizontal transmission to untreated beetles and crickets, but not milkweed bugs. Spread of fungal infection in the beetles resulted in mortality on days 4–10 after treatment, while in crickets mortality was on day 2 after treatment, suggesting different levels of pathogenicity and possibly different modes of transmission. Therefore, M. anisopliae varies in pathogenicity to different insects. Inundative applications can potentially affect nontarget species, but M. anisopliae is already widely distributed in North America, so applications for tick control generally would not introduce a novel pathogen into the environment. Pathogenicity in lab trials does not, by itself, demonstrate activity under natural conditions, so field trials are needed to confirm these results and to assess methods to minimize nontarget exposure.

  12. The antileukaemic cell cycle regulatory activities of swainsonine purified from Metarhizium anisopliae fermentation broth.

    PubMed

    Singh, Digar; Kaur, Gurvinder

    2014-01-01

    Swainsonine is a Metarhizium secondary metabolite known differentially for its specific mannosidase inhibitory, toxic and therapeutic activities. Here, the standard and purified swainsonine from Metarhizium anisopliae fermentation broth were comparatively evaluated for their in situ antileukaemic activities in human promyelocytic cell line, HL-60. Both the standard (IC50 = 6.96 μM) and purified (IC50 = 9.50 μM) compounds inhibited the leukaemic cell proliferation without inflicting cell membrane disruption at 48 h of post-treatment incubation. The DNA cell cycle analysis showed approximately 48.81% and 60.72% of the treated cells arrested in the synthetic phase (S-phase) at 36 and 48 h, respectively, upon treatment with IC50 concentration of the purified swainsonine. However, only 29.62% of cells were arrested in S-phase with standard swainsonine at 48 h, suggesting the comprehensive action of certain other metabolites sharing the similar paradigm of antiproliferative properties in Metarhizium broth extract.

  13. Field evaluations of simulated aerial sprays of Beauveria bassiana and Metarhizium anisopliae against immature Mormon cricket (Anabrus simples) in newly designed cages

    USDA-ARS?s Scientific Manuscript database

    Three entomopathogenic fungi, Beauveria bassiana Strain GHA, Metarhizium anisopliae Strain F52 and M. anisopliae Strain DWR346 (discovered by Utah State University) were evaluated for their efficacy against Mormon Cricket, Anabrus simplex, in an outdoor cage trial in northeastern Montana. Fungal mat...

  14. Metarhizium anisopliae conidial responses to lipids from tick cuticle and tick mammalian host surface.

    PubMed

    Ment, Dana; Gindin, Galina; Soroker, Victoria; Glazer, Itamar; Rot, Asael; Samish, Michael

    2010-02-01

    Conidial germination and the formation of appressoria are important events in the interactions between entomopathogenic fungi and their arthropod hosts. In this study, we demonstrate the effects of lipids extracted from tick epicuticle and the surface of a mammalian host (calf) on conidial germination and the development of appressoria in two subspecies of Metarhizium anisopliae, M. anisopliae var. anisopliae (M.an.an.-7) and M. anisopliae var. acridum (M.an.ac.-5), which have different levels of virulence toward ticks. Pentane extracts of epicuticles of ticks susceptible and resistant to fungal infection always stimulated the germination of M.an.an.-7 conidia and the development of their appressoria; whereas the effects of dichloromethane (DCM) extracts of tick epicuticle varied depending on the tick. The DCM extracts from most of the tick species and developmental stages stimulated conidial germination and/or the formation of appressoria in M.an.an.-7. However, a DCM extract of lipids from the most resistant tick, engorged Hyalomma excavatum female, inhibited the germination of M.an.an.-7 conidia. Conidia of the non-virulent M.an.ac.-5 did not germinate on agarose amended with any of the examined tick extracts. However, when the tick extracts were placed on bactoagar, conidial germination increased 7- to 8-fold. Extracts from the skin, hair and ear secretions of a calf stimulated conidial germination and the formation of appressoria in M.an.an.-7, but not M.an.ac.-5. This study demonstrates that lipids from tick epicuticles and mammalian skin selectively affect the germination of conidia of entomopathogenic fungi. The effects of these lipids may explain the variability in tick control these fungi provide for different hosts.

  15. Antifungal activity of the termite alkaloid norharmane against the mycelial growth of Metarhizium anisopliae and Aspergillus nomius.

    PubMed

    Chouvenc, Thomas; Su, Nan-Yao; Elliott, Monica I

    2008-11-01

    Antifungal activity of norharmane, a beta-carboline alkaloid found in termites (Isoptera, Rhinotermitidae) was tested against two entomopathogenic fungi, Metarhizium anisopliae and Aspergillus nomius. It was determined that, at physiological concentration (10 microg ml(-1)), norharmane had no significant effect on A. nomius mycelial growth rate but reduced M. anisopliae growth rate by 11.9%. Contrary to previous findings, we suggest that norharmane has a limited role in disease resistance against fungal pathogens in individual subterranean termites, and we discuss the potential role of this chemical at a colony level.

  16. Screening of entomopathogenic Metarhizium anisopliae isolates and proteomic analysis of secretion synthesized in response to cowpea weevil (Callosobruchus maculatus) exoskeleton.

    PubMed

    Murad, André M; Laumann, Raul A; Lima, Thaina de A; Sarmento, Rubia B C; Noronha, Eliane F; Rocha, Thales L; Valadares-Inglis, Maria C; Franco, Octávio L

    2006-01-01

    Cowpea crops are severely attacked by Callosobruchus maculatus, a Coleopteran that at the larval stage penetrates into stored seeds and feeds on cotyledons. Cowpea weevil control could be based in utilization of bacteria and fungi to reduce pest development. Entomopathogenic fungi, such as Metarhizium anisopliae, are able to control insect-pests and are widely applied in biological control. This report evaluated ten M. anisopliae isolates according to their virulence, correlating chitinolytic, proteolytic and alpha-amylolytic activities, as well proteomic analysis by two dimensional gels of fungal secretions in response to an induced medium containing C. maculatus shells, indicating novel biotechnological tools capable of improving cowpea crop resistance.

  17. Differentially-expressed glycoproteins in Locusta migratoria hemolymph infected with Metarhizium anisopliae.

    PubMed

    Wang, Chutao; Cao, Yueqing; Wang, Zhongkang; Yin, Youping; Peng, Guoxiong; Li, Zhenlun; Zhao, Hua; Xia, Yuxian

    2007-11-01

    Glycoproteins play important roles in insect physiology. Infection with pathogen always results in the differential expression of some glycoproteins, which may be involved in host-pathogen interactions. In this report, differentially-expressed glycoproteins from the hemolymph of locusts infected with Metarhizium anisopliae were analyzed by two-dimensional electrophoresis (2-DE) and PDQuest software. The results showed that 13 spots were differentially expressed, of which nine spots were upregulated and four were downregulated. Using MS/MS with de novo sequencing and NCBI database searches, three upregulated proteins were identified as locust transferrin, apolipoprotein precursor, and hexameric storage protein 3. These proteins have been reported to be involved in the insect innate immune response to microbial challenge. Due to the limited available genome information and protein sequences of locusts, the possible functions of the other 10 differentially-expressed spots remain unknown.

  18. Entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana reduce the survival of Xenopsylla brasiliensis larvae (Siphonaptera: Pulicidae).

    PubMed

    Mnyone, Ladslaus L; Ng'habi, Kija R; Mazigo, Humphrey D; Katakweba, Abdul A; Lyimo, Issa N

    2012-09-19

    Entomopathogenic fungi, particularly those belonging to the genera Metarhizium and Beauveria have shown great promise as arthropod vector control tools. These agents, however, have not been evaluated against flea vectors of plague. A 3-h exposure to the fungi coated paper at a concentration of 2 × 108 conidia m-2 infected >90% of flea larvae cadavers in the treatment groups. The infection reduced the survival of larvae that had been exposed to fungus relative to controls. The daily risk of dying was four- and over three-fold greater in larvae exposed to M. anisopliae (HR = 4, p<0.001) and B. bassiana (HR = 3.5, p<0.001) respectively. Both fungi can successfully infect and kill larvae of X. brasiliensis with a pooled median survival time (MST±SE) of 2 ± 0.31 days post-exposure. These findings justify further research to investigate the bio-control potential of entomopathogenic fungi against fleas.

  19. Proteomic analysis of Metarhizium anisopliae secretion in the presence of the insect pest Callosobruchus maculatus.

    PubMed

    Murad, André M; Noronha, Eliane F; Miller, Robert N G; Costa, Fabio T; Pereira, Caroline D; Mehta, Angela; Caldas, Ruy A; Franco, Octávio L

    2008-12-01

    Crop improvement in agriculture generally focuses on yield, seed quality and nutritional characteristics, as opposed to resistance to biotic stresses. Consequently, natural antifeedant toxins are often rare in seed material, with commercial crops being prone to insect pest predation. In the specific case of cowpea (Vigna unguiculata), smallholder cropping is affected by insect pests that reproduce inside the stored seeds. Entomopathogenic organisms can offer an alternative to conventional pesticides for pest control, producing hydrolases that degrade insect exoskeleton. In this study, protein secretions of the ascomycete Metarhizium anisopliae, which conferred bioinsecticidal activity against Callosobruchus maculatus, were characterized via 2D electrophoresis and mass spectrometry. Proteases, reductases and acetyltransferase enzymes were detected. These may be involved in degradation and nutrient uptake from dehydrated C. maculatus. Proteins identified in this work allowed description of metabolic pathways. Their potential applications in biotechnology include both novel compound development and production of genetically modified plants resistant to insect pests.

  20. Heat-stressed Metarhizium anisopliae: viability (in vitro) and virulence (in vivo) assessments against the tick Rhipicephalus sanguineus.

    PubMed

    Alves, Fabrício M; Bernardo, Cíntia C; Paixão, Flávia R S; Barreto, Lucas P; Luz, Christian; Humber, Richard A; Fernandes, Éverton K K

    2017-01-01

    The current study investigated the thermotolerance of Metarhizium anisopliae s.l. conidia from the commercial products Metarril® SP Organic and Metarril® WP. The efficacy of these M. anisopliae formulations against the tick Rhipicephalus sanguineus s.l. was studied in laboratory under optimum or heat-stress conditions. The products were prepared in water [Tween® 80, 0.01 % (v/v)] or pure mineral oil. Conidia from Metarril® SP Organic suspended in water presented markedly delayed germination after heating to constant 40 °C (for 2, 4, or 6 h) compared to conidia suspended in mineral oil. Metarril® SP Organic suspended in oil and exposed to daily cycles of heat-stress (40 °C for 4 h and 25 °C for 19 h for 5 consecutive days) presented relative germination of conidia ranging from 92.8 to 87.2 % from day 1 to day 5, respectively. Conversely, germination of conidia prepared in water ranged from 79.3 to 39.1 % from day 1 to day 5, respectively. Culturability of Metarril® WP decreased from 96 % when conidia were cultured for 30 min prior to heat exposure (40 °C for 4 h) to 9 % when conidia were cultured for 8 h. Tick percent control was distinctly higher when engorged females were treated with oil suspensions rather than water suspensions, even when treated ticks were exposed to heat-stress regimen. Oil-based applications protected fungal conidia against heat-stress. Although Metarril® is not registered for tick control, it may be useful for controlling R. sanguineus, especially if it is prepared in mineral oil.

  1. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

    PubMed Central

    Niassy, Saliou; Subramanian, Sevgan; Ekesi, Sunday; Bargul, Joel L.; Villinger, Jandouwe; Maniania, Nguya K.

    2013-01-01

    Virulence is the primary factor used for selection of entomopathogenic fungi (EPF) for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates. PMID:23936804

  2. Field bioassay of Metarhizium anisopliae strains to control the poultry red mite Dermanyssus gallinae.

    PubMed

    Tavassoli, M; Allymehr, M; Pourseyed, S H; Ownag, A; Bernousi, I; Mardani, K; Ghorbanzadegan, M; Shokrpoor, S

    2011-06-10

    The poultry red mite, Dermanyssus gallinae is one of the most economically deleterious ectoparasite of laying hens worldwide. To evaluate the efficacy of three strains (V245, 3247 and 715C) of entomopathogenic fungus Metarhizium anisopliae with potential as acaricides against D. gallinae, this investigation was carried out in a commercial caged laying poultry farm in Naghedeh, West Azarbaijan of Iran. The parasite infestation already existed in the farm. Sunflower oil suspension of all fungal strains, each in two concentrations (1×10(7) and 1×10(9) conidia/ml) were used separately as spray on hens and cages, and in the control group the cages were only sprayed with sunflower oil and sterile distilled water. For estimating the population rate of mites before and after treatment, special cardboard traps were fixed to cages during a 1-month period. The traps were placed on weeks -1, 0, 1, 2 and 3 and always removed after 1 w. The results showed that the population rates post fungal treatment with the lower concentration were not significantly different compared to the control group. However, the reduction in mite numbers induced by all three strains at the concentration of 1×10(9) conidia/ml was significantly higher than the control (P<0.05). The results revealed that under field conditions, higher concentrations of M. anisopliae will be required for controlling D. gallinae.

  3. Biocontrol of pigeon tick Argas reflexus (Acari: Argasidae) by entomopathogenic fungus Metarhizium Anisopliae (Ascomycota: Hypocreales)

    PubMed Central

    Tavassoli, Mosa; Pourseyed, Seyed Hassan; Ownagh, Abdulghaffar; Bernousi, Iraj; Mardani, Karim

    2011-01-01

    The pigeon tick Argas reflexus is a pathogen-transmitting soft tick that typically feeds on pigeons, but can also attack humans causing local and systemic reactions. Chemical control is made difficult due to environmental contamination and resistance development. As a result, there is much interest in increasing the role of other strategies like biological control. In this study, the efficacy of three strains (V245, 685 and 715C) of entomopathogenic fungus Metarhizium anisopliae for biological control of three life stages of pigeon tick A. reflexus including eggs, larvae, engorged and unfed adults was investigated under laboratory conditions. Five concentrations of different strains of M. anisopliae ranging from 103 to 107 conidia/ml were used. All fungal strains significantly decreased hatchability of A. reflexus eggs. Strain V245 was the most effective strain on the mortality of larval stage with nearly 100% mortality at the lowest concentration (103 conidia/ml) at 10 days post-inoculation. The mortality rate of both engorged and unfed adult ticks were also increased significantly exposed to different conidial concentrations compared to the control groups (P < 0.05) making this fungus a potential biological control agent of pigeon tick reducing the use of chemical acaricides. PMID:24031777

  4. Virulence of Metarhizium anisopliae (Deuteromycotina: Hyphomycetes) on Anastrepha ludens (Diptera: Tephritidae): laboratory and field trials.

    PubMed

    Lezama-Gutiérrez, R; Trujillo-de la Luz, A; Molina-Ochoa, J; Rebolledo-Dominguez, O; Pescador, A R; López-Edwards, M; Aluja, M

    2000-08-01

    Twenty isolates of the fungus Metarhizium anisopliae (Metsch). Sorkin (Ma) were evaluated to determine their virulence against last instar and adult emergence of Mexican fruit fly, Anastrepha ludens (Loew). Larvae were exposed by immersion in a conidial suspension at a concentration of 10(8) UFC/ml under laboratory conditions. Larvae and pupae cumulative mortality rates ranged from 37.9 to 98.75%. Thirteen isolates caused mortality rates > 83.7%, and their LT50 values ranged from 1.8 to 6.2 d. The Ma2, Ma8, and Ma16 isolates were evaluated at seven different concentrations ranging from 10(1) to 10(7) UFC/ml, showing LC50 values from 3.7 to 4.8 x 10(5) UFC/ml. In a field-cage experiment, 200 ml of a conidial suspension of Ma2, at a concentration of 2.5 x 10(6) UFC/ml, was applied on 2,500 cm2 soil surface (2 x 10(5) UFC/cm2). The fungus reduced adult emergence, 22% fewer adults emerging in a sandy loam soil, and 43% fewer in loam soil, compared with the controls. M. anisopliae may offer a preferable alternative to chemicals as a biological control agent against A. ludens.

  5. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    PubMed

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p < or = 0.05) reduced. It was, also, shown that the fungus had ability to adhere to the cuticle and penetrate the integument of the tick. Conidia of the fungus were isolated from their internal tissues. This phenomenon is important in considering fungi as bioinsecticides. Infection of eggs laid by treated engorged female ticks, with the fungus might demonstrate suggesting transovarian transmission. The use of M. anisopliae to control ticks is discussed.

  6. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    PubMed

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (P<0.05); the same occurred during the adult phase. No effect was observed at the larval stage. The pesticides applied to the soil affected the activity of M. anisopliae slightly: only in the dry conidia assay the fungicides chlorothalonyl and tebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  7. Isolation of a nitrogen response regulator gene (nrr1) from Metarhizium anisopliae.

    PubMed

    Screen, S; Bailey, A; Charnley, K; Cooper, R; Clarkson, J

    1998-10-09

    Attempts to improve the effectiveness of entomopathogenic fungi as biological control agents require a clear understanding of the pathogenicity determinants at both the biochemical and molecular level. Proteases play a key role in entomopathogenicity, allowing the fungus to penetrate the insect cuticle and rapidly invade the host. The most extensively studied of these protease activities, PR1A and PR2, are both subject to nitrogen derepression. The Metarhizium anisopliae nrr1 (nitrogen response regulator 1) gene was identified using a PCR-based strategy; it encodes a putative DNA-binding protein with a single zinc finger motif defined by the C-X2-C-X17-C-X2-C sequence. M. anisopliae NRR1 shows a significant sequence similarity to Neurospora crassa NIT2. Sequence analysis identified the presence of two introns, suggesting a greater degree of similarity to N. crassa nit2 than to the areA-like genes that have been identified. However, functional equivalence of nrr1 to areA was demonstrated, by co-transformation and complementation of an A. nidulans areA loss-of-function mutant (areA18 argB2 pabaA1 inoB2) with the M. anisopliae nrr1 gene. The areA-/nrr1+ Aspergillus transformants were able to grow on media with nitrate and glutamate as the sole nitrogen source, whereas the areA- strain is unable to grow under these conditions. The possible relevance of nitrogen regulation to pathogenicity is discussed.

  8. Application of the entomogenous fungus, Metarhizium anisopliae, for leafroller (Cnaphalocrocis medinalis) control and its effect on rice phyllosphere microbial diversity.

    PubMed

    Hong, Mingsheng; Peng, Guoxiong; Keyhani, Nemat O; Xia, Yuxian

    2017-07-10

    Microbial pesticides form critical components of integrated pest management (IPM) practices. Little, however, is known regarding the impacts of these organisms on the indigenous microbial community. We show that Metarhizium anisopliae strain CQMa421 was highly effective in controlling the rice leafroller, Cnaphalocrocis medinalis Guenee. In addition, M. anisopliae distribution and its effects on phyllosphere microbial diversity after application in field trials were investigated. Phylloplane specific distribution of the fungus was observed over time, with more rapid declines of M. anisopliae CFUs (colony-forming units) seen in the top leaf layer as compared to lower layers. Application of the fungus resulted in transient changes in the endogenous microbial diversity with variations seen in the bacterial observed species and Shannon index. Notable increases in both parameters were seen at 6-day post-application of M. anisopliae, although significant variation within sample replicates for bacteria and fungi were noted. Application of M. anisopliae increased the relative distribution of bacterial species implicated in plant growth promotion and organic pollutant degradation, e.g., Methylobacterium, Sphingobium, and Deinococcus. These data show minimal impact of M. anisopliae on endogenous microbial diversity with transient changes in bacterial abundance/diversity that may result in added benefits to crops.

  9. Evaluation of Pathogenicity of the Fungi Metarhizium anisopliae and Beauveria bassiana in Hazelnut Weevil (Curculio nucum L., Coleoptera, Curculionidae) Larvae.

    PubMed

    Cheng, Yunqing; Liu, Ting; Zhao, Yixin; Geng, Wanting; Chen, Longtao; Liu, Jianfeng

    2016-12-01

    The nut weevil (Curculio nucum) is one of the most important and widespread pests in hazelnut orchards. In order to screen entomopathogenic fungal strains with high virulence against C. nucum, the growth rate, sporulation, and cumulative mortality of different Metarhizium anisopliae and Beauveria bassiana strains were investigated, and the process by which M. anisopliae CoM 02 infects C. nucum larvae was observed using scanning electron microscopy. The results indicated that the growth rate and sporulation of different fungal strains significantly differed. Thirteen days after inoculation with M. anisopliae CoM 02, the cumulative mortality of C. nucum larvae reached 100 %, which was considerably higher than that of the other five strains. As the most virulent of the six test strains, the cadaver rate, LT50, and LT90 of M. anisopliae CoM 02 were 93.4 %, 7.05 and 11.90 days, respectively. Analysis of the infection process by scanning electron microscopy showed that the spore attachment, hyphal germination, hyphal rapid growth, and sporulation of M. anisopliae CoM 02 occurred on the 3rd, 5th, 7th, and 11th day after inoculation, respectively, indicating that the infection cycle takes approximately 11 days. This finding suggests that the highly virulent M. anisopliae plays an important role in the biocontrol of C. nucum in China.

  10. Effect of Beauveria bassiana and Metarhizium anisopliae (Deuteromycetes) upon the coffee berry borer (Coleoptera: Scolytidae) under field conditions.

    PubMed

    De la Rosa, W; Alatorre, R; Barrera, J F; Toreillo, C

    2000-10-01

    The effect of three strains of the fungus Beauveria bassiana (Balsamo) Vuillemin and two strains of Metarhizium anisopliae (Metschnikoff) Sorokin upon the coffee berry borer, Hypothenemus hampei (Ferrari), was studied in three coffee farms at different altitudes (450-1,100 m above sea level) in Soconusco, Chiapas, Mexico. The maximum average percentage mycosis varied according to altitude. At 450 m asl (El Rincon) mycosis was 14.3% for B. bassiana and 6.3% for M. anisopliae; at 880 m asl (Santa Anita) mycosis was 40.6% for B. bassiana and 12.6% for M. anisopliae, and at 1,100 m asl (Alpujarras) 33.9% for B. bassiana and 22. 1% for M. anisopliae. The effect of fungal mycosis through time was not significant (P > 0.01) in any of the farms, but there was a significant difference between the strains of the fungus (P < 0.01); the best strains being Bb25 and Ma4 at the lower altitude, Bb26 and Ma4 for the middle altitude and Bb26 and Ma4 at the higher altitude. Environmental factors such as temperature, relative humidity and rain were not correlated with the percentage mycosis caused by B. bassiana and M. anisopliae. However, in the case of B. bassiana there was a significant, positive correlation (P < 0.01) between the infestation levels of the pest and the mycosis response of the entomopathogen.

  11. Horizontal Transmission of Beauveria bassiana (Hypocreales: Cordycipitaceae) and Metarhizium anisopliae (Hypocreales: Clavicipitaceae) in Musca domestica (Diptera: Muscidae).

    PubMed

    Cárcamo, M C; Felchicher, F; Duarte, J P; Bernardi, E; Ribeiro, P B

    2015-08-01

    Beauveria bassiana Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin are fungi with potential for controlling Musca domestica L. However, the impact on this dipteral may vary depending on the fungal isolates and the methodology used. This study evaluated the pathogenicity of direct application and horizontal transmission of B. bassiana (CG240) and M. anisopliae (CG34) on adult M. domestica individuals. The impact of B. bassiana and M. anisopliae on M. domestica was evaluated at the concentrations 2 × 10(4), 2 × 10(5), 2 × 10(6), and 2 × 10(7) conidia/ml. Horizontal transmission was also estimated between sexes at different infection periods of the vector insect. The mortality of adult M. domestica individuals directly infected with B. bassiana was above 90%, and the mortality of those infected with M. anisopliae ranged from 25.50 to 97.78%. Horizontal transmission of B. bassiana caused the death of 100% of individuals, in turn, that of M. anisopliae killed 55% of male and 100% of female individuals. Horizontal transmission of fungi was negatively influenced by time. This study shows the potential of these fungi for controlling M. domestica, both with the direct implementation strategy and horizontal transmission. However, field studies are needed to evaluate the capacity to decrease the M. domestica population using these alternatives.

  12. Dissemination of Metarhizium anisopliae of low and high virulence by mating behavior in Aedes aegypti

    PubMed Central

    2011-01-01

    Background Dengue is a viral disease transmitted by Aedes mosquitoes. It is a threat for public health worldwide and its primary vector Aedes aegypti is becoming resistant to chemical insecticides. These factors have encouraged studies to evaluate entomopathogenic fungi against the vector. Here we evaluated mortality, infection, insemination and fecundity rates in A. aegypti females after infection by autodissemination with two Mexican strains of Metarhizium anisopliae. Methods Two M. anisopliae strains were tested: The Ma-CBG-1 least virulent (lv), and the Ma-CBG-2 highly virulent (hv) strain. The lv was tested as non mosquito-passed (NMP), and mosquito-passed (MP), while the hv was examined only as MP version, therefore including the control four treatments were used. In the first bioassay virulence of fungal strains towards female mosquitoes was determined by indirect exposure for 48 hours to conidia-impregnated paper. In the second bioassay autodissemination of fungal conidia from fungus-contaminated males to females was evaluated. Daily mortality allowed computation of survival curves and calculation of the LT50 by the Kaplan-Meier model. All combinations of fungal sporulation and mating insemination across the four treatments were analyzed by χ2. The mean fecundity was analyzed by ANOVA and means contrasted with the Ryan test. Results Indirect exposure to conidia allowed a faster rate of mortality, but exposure to a fungal-contaminated male was also an effective method of infecting female mosquitoes. All females confined with the hv strain-contaminated male died in fifteen days with a LT50 of 7.57 (± 0.45) where the control was 24.82 (± 0.92). For the lv strain, it was possible to increase fungal virulence by passing the strain through mosquitoes. 85% of females exposed to hv-contaminated males became infected and of them just 10% were inseminated; control insemination was 46%. The hv strain reduced fecundity by up to 99%, and the lv strain caused a 40

  13. Expression of a chitinase gene from Metarhizium anisopliae in tobacco plants confers resistance against Rhizoctonia solani.

    PubMed

    Kern, Marcelo Fernando; Maraschin, Simone de Faria; Vom Endt, Débora; Schrank, Augusto; Vainstein, Marilene Henning; Pasquali, Giancarlo

    2010-04-01

    The chit1 gene from the entomopathogenic fungus Metarhizium anisopliae, encoding the endochitinase CHIT42, was placed under the control of the CaMV 35S promoter, and the resulting construct was transferred to tobacco. Seventeen kanamycin-resistant transgenic lines were recovered, and the presence of the transgene was confirmed by polymerase chain reactions and Southern blot hybridization. The number of chit1 copies was determined to be varying from one to four. Copy number had observable effects neither on plant growth nor development. Substantial heterogeneity concerning production of the recombinant chitinase, and both general and specific chitinolytic activities were detected in leaf extracts from primary transformants. The highest chitinase activities were found in plants harboring two copies of chit1 inserts at different loci. Progeny derived from self-pollination of the primary transgenics revealed a stable inheritance pattern, with transgene segregation following a mendelian dihybrid ratio. Two selected plants expressing high levels of CHIT42 were consistently resistant to the soilborne pathogen Rhizoctonia solani, suggesting a direct relationship between enzyme activity and reduction of foliar area affected by fungal lesions. To date, this is the first report of resistance to fungal attack in plants mediated by a recombinant chitinase from an entomopathogenic and acaricide fungus.

  14. Optimization of different process variables for the production of an indolizidine alkaloid, swainsonine from Metarhizium anisopliae.

    PubMed

    Singh, Digar; Kaur, Gurvinder

    2012-10-01

    Swainsonine is a polyhydroxylated indolizidine alkaloid having anticancer, antimetastatic, antiproliferative and immunomodulatory activities and also potential therapeutic applications against AIDS. In the present study, ten isolates of M. anisopliae were screened and enzyme assayed for the production of swainsonine in different media (Complex oatmeal, Czapekdox media with and without lysine (8% w/v) and Sabouraud dextrose broth (SDB)). Among these strains, ARSEF 1724 (UM8) was found to produce highest amount of swainsonine (1.34 μg/l) after 72 h of incubation under shake flask conditions at 180 rpm and 28 °C in complex oatmeal media. In order to maximize the yield of swainsonine the media composition including macro and micronutrients were optimized. The process variables including the chemical factors like carbon sources, nitrogen sources of both organic and inorganic nature and pH with constant inoculum size (1 × 10(8) spores/ml) were screened using classical one-factor-at-a-time (OFAT) approach to find their optimum levels. The present study shows that the nutrient requirement is specific for each strain of Metarhizium. Oatmeal extract (6%) was found to be the best supporting media along with nitrogen source, glucose (2%) as best carbon source and pH (~5) as the best for swainsonine production.

  15. Entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana reduce the survival of Xenopsylla brasiliensis larvae (Siphonaptera: Pulicidae)

    PubMed Central

    2012-01-01

    Background Entomopathogenic fungi, particularly those belonging to the genera Metarhizium and Beauveria have shown great promise as arthropod vector control tools. These agents, however, have not been evaluated against flea vectors of plague. Findings A 3-h exposure to the fungi coated paper at a concentration of 2 × 108 conidia m-2 infected >90% of flea larvae cadavers in the treatment groups. The infection reduced the survival of larvae that had been exposed to fungus relative to controls. The daily risk of dying was four- and over three-fold greater in larvae exposed to M. anisopliae (HR = 4, p<0.001) and B. bassiana (HR = 3.5, p<0.001) respectively. Both fungi can successfully infect and kill larvae of X. brasiliensis with a pooled median survival time (MST±SE) of 2±0.31 days post-exposure. Conclusion These findings justify further research to investigate the bio-control potential of entomopathogenic fungi against fleas. PMID:22992264

  16. Production of Conidia by the Fungus Metarhizium anisopliae Using Solid-State Fermentation.

    PubMed

    Loera-Corral, Octavio; Porcayo-Loza, Javier; Montesinos-Matias, Roberto; Favela-Torres, Ernesto

    2016-01-01

    This chapter describes the production of conidia by Metarhizium anisopliae using solid-state fermentation. Before production of conidia, procedures for strains conservation, reactivation, and propagation are essential in order to provide genetic stability of the strains. The strain is conserved in freeze-dried vials and then reactivated through insect inoculation. Rice is used as a substrate for the conidia production in two different bioreactors: plastic bags and tubular bioreactor. The CO2 production in the tubular bioreactors is measured with a respirometer; this system allows calculating indirect growth parameters as lag time (tlag) (25-35 h), maximum rate of CO2 production (rCO2 max) (0.5-0.7 mg/gdm h), specific rate of CO2 production (μ) (0.10-0.15 1/h), and final CO2 production (CO2) (100-120 mg/gdm). Conidial yield per gram of dry substrate (gdm) should be above 1 × 10(9) conidia/gdm after 10 days of incubation. Germination and viability of conidia obtained after 10 days of incubation should be above 80 % and 75 %, respectively. Bioassays using of Tenebrio molitor as a host insect should yield a final mortality above 80 %.

  17. Algorithm-based design of synthetic growth media stimulating virulence properties of Metarhizium anisopliae conidia.

    PubMed

    Hutwimmer, S; Wagner, S; Affenzeller, M; Burgstaller, W; Strasser, H

    2008-12-01

    Synthetic media should be designed for the production of Metarhizium anisopliae conidia with improved virulence properties. A genetic algorithm (GA), demonstrated to be suitable for the design of media for spore mass production (Hutwimmer et al. 2008), was utilized for a multi-objective medium design to improve conidia yield and three proposed virulence properties of conidia: C : N ratio, germination speed and amount of spore-bound Pr1 protease. After five iterative optimizations, 52 media were improved over Sabouraud dextrose agar (SDA). Four media exhibited medium performances (a factor derived from the four single optimization variables) of around 0.7; cf. SDA = 0.532; media with enhanced properties were reached for each single optimization variable; Bioassays against Tenebrio larvae indicated also a slight improvement in virulence of conidia from designed media. A degenerated phenotype of the same strain did not exhibit differences in colony appearance, spore characteristics and virulence if grown on designed media. The application of a problem-oriented GA is a practical and rapid method to design media for multi-objective purposes. The applicability of a GA for multi-objective medium design was demonstrated for the cultivation of anamorphic fungi on solid media.

  18. In vivo interactions of entomopathogenic fungi, Beauveria spp. and Metarhizium anisopliae with selected opportunistic soil fungi of sugarcane ecosystem.

    PubMed

    Geetha, N; Preseetha, M; Hari, K; Santhalakshmi, G; Bai, K Subadra

    2012-07-01

    In the present study, the interactions of entomopathogenic fungi viz., Beauveria bassiana, Beauveria brongniartii and Metarhizium anisopliae among themselves and three other opportunistic soil fungi from the sugarcane ecosystem namely, Fusarium saachari, Aspergillus sp. and Penecillium sp. were assayed in vivo against Galleria mellonella larvae. The tested fungi were co-applied on IV instar G. mellonella @ 1 x 10(7) ml(-1), in combinations of two, at the interval of 24 hrs either preceding or succeeding each otherto assess their efficacy and sporulation rates. Results showed that often mortality rates did not correspond to the spore harvest of the mortality agent and presence of other fungus may be antagonistic. The efficacy of B. bassiana (90%) and B. brongniartii (100%) was not enhanced further but was negatively affected in most combinations with other fungi. In case of M. anisopliae compatibility was higher, resulting in higher mortality by application of B. bassiana before (100%) or after (83.3%) M. anisopliae than when it was applied alone (70%). During sporulation, B. bassiana faced the most intense competition from M. anisopliae (2.75 x 10(6) larva(-1)) and enhancement due to F sacchari irrespective of sequence of application. In case of B. brongniartii, sporulation was lowest in the combination of B. brongniartiipreceding M. anisopliae (1.83 x10(6) larva(-1)) and B. brongniartii succeeding B. bassiana (1.58 x 10(6) larva(-1)). Of all fungi tested, except F sacchari (65.33 x 10(6) larva(-1)) all the other species affected sporulation of M. ansiopliae with the least in treatment of B. bassiana application following M. anisopliae. Similar kind of interaction was observed during sporulation of soil fungi when combined with entomopathogenic fungi, though individually they could not cause mortality of larvae.

  19. Susceptibility of Adults of the Cerambycid Beetle Hedypathes betulinus to the Entomopathogenic Fungi Beauveria bassiana, Metarhizium anisopliae, and Purpureocillium Lilacinum

    PubMed Central

    Schapovaloff, M. E.; Alves, L. F. A.; Fanti, A. L.; Alzogaray, R. A.; Lastra, C. C. López

    2014-01-01

    The cerambycid beetle Hedypathes betulinus (Klug) (Coleoptera: Cerambycidae) causes severe damage to yerba mate plants (Ilex paraguariensis (St. Hilaire) (Aquifoliales: Aquifoliaceae)), which results in large losses of production. In this study, the pathogenicity of entomopathogenic fungi of the species Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Hypocreales: Cordycipitaceae), Metarhizium anisopliae sensu lato (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae), and Purpureocillium lilacinum (Thom) Luangsa-ard, Hywel-Jones, Houbraken and Samson (Hypocreales: Ophiocordycipitaceae) on yerba mate were evaluated. Fifteen isolates of B. bassiana, two of M. anisopliae, and seven of P. lilacinum on H. betulinus adults were analyzed under laboratory conditions. The raw mortality rate caused by B. bassiana isolates varied from 51.1 to 86.3%, and their LT50 values varied between 8.7 and 13.6 d. The isolates of M. anisopliae caused 69.6–81.8% mortality, and their LT50 values varied between 7.4 and 7.9 d. In contrast, isolates of P. lilacinum were not pathogenic. M. anisopliae and B. bassiana isolates were pathogenic against H. betulinus adults, suggesting that they may be useful in biological control programs for insect pests of yerba mate. PMID:25368071

  20. Prospects of using Metarhizium anisopliae to check the breeding of insect pest, Oryctes rhinoceros L. in coconut leaf vermicomposting sites.

    PubMed

    Gopal, Murali; Gupta, Alka; Thomas, George V

    2006-10-01

    During vermicomposting of coconut leaves by the earthworm Eudrilus sp., Oryctes rhinoceros L. (rhinoceros beetle), an insect pest of palms, was found to breed in the decomposing organic material. Metarhizium anisopliae var. major was tried as a biocontrol agent for management of this pest. The effect of pathogen at spore loads of 10(3), 10(4) and 10(5) per 10 g of substrate was tested in laboratory on Eudrilus sp. kept with O. rhinoceros grubs and on Eudrilus sp. alone for the pathogenic capability of the fungus on the pest and its possible toxicity towards the vermin. The efficacy of the entomopathogen was also tested in the field in vermicomposting tanks. In laboratory bioassay, 100% mycosis of O. rhinoceros grubs could be obtained while the entomopathogen had no toxic effect on the earthworms. There was a positive change in the number and weight of the earthworms on treatment with M. anisopliae. In the field, application of M. anisopliae reduced O. rhinoceros grubs in the vermicomposting tanks upto an extent of 72%. In conclusion, M. anisopliae could effectively control O. rhinoceros in vermicomposting sites and was non-hazardous to the vermicomposting process as well as the Eudrilus sp.

  1. [Hemocyte characterization of Nasutitermes coxipoensis (Holmgren) (Isoptera: Termitidae) workers and hemocyte evaluation after parasitism by Metarhizium anisopliae].

    PubMed

    Cunha, Franklin M; Wanderley-Teixeira, Valéria; Teixeira, Alvaro A C; Albuquerque, Auristela C; Alves, Luiz C; Lima, Elza A L A

    2009-01-01

    We aimed to characterize the morphology and ultrastructure of hemocytes of Nasutitermes coxipoensis (Holmgren) workers and to quantify the cell types 24 h, 48 h and 72 h after inoculation with Metarhizium anisopliae. Six hemocytes types were identified, plasmatocyte, granulocyte, spherulocyte, prohemocyte, adipohemocyte and eonocytoid Hemocytes did not present any morphological alteration at the several observation periods, but they did have a change in their abundance, as observed for spherulocytes, adipohemocytes and eonocytoids at all intervals, and for plasmatocytes and granulocytes at 48 h after host inoculation. We argue on the possible reasons and implications of the observed changes.

  2. Inhibition of the entomopathogenic fungus Metarhizium anisopliae in vitro by the bed bug defensive secretions (E)-2-hexenal and (E)-2-octenal

    USDA-ARS?s Scientific Manuscript database

    The two major aldehydes (E)-2-hexenal and (E)-2-octenal emitted as defensive secretions by bed bugs Cimex lectularius L. (Hemiptera: Cimicidae), inhibit the in vitro growth of Metarhizium anisopliae (Metsch.) Sokorin (Hypocreales: Clavicipitaceae). These chemicals inhibit fungal growth by direct con...

  3. Agrobacterium-mediated disruption of a nonribosomal peptide synthetase gene in the invertebrate pathogen Metarhizium anisopliae reveals a peptide spore factor

    USDA-ARS?s Scientific Manuscript database

    Numerous secondary metabolites have been isolated from the insect pathogenic fungus Metarhizium anisopliae, but the roles of these compounds as virulence factors in disease development are poorly understood. We targeted for disruption by Agrobacterium tumefaciens-mediated transformation a putative n...

  4. Effect of Metarhizium anisopliae (Ascomycete), Cypermethrin, and D-limonene, alone and combined, on larval mortality of Rhipicephalus sanguineus (Acari: Ixodidae)

    USDA-ARS?s Scientific Manuscript database

    The effect of the fungus Metarhizium anisopliae Ma14 strain, D-limonene and cypermethrin, alone and combined, on the mortality of Rhipicephalus sanguineus larvae was evaluated. Eight groups with 25 tick larvae were inoculated with the fungus, eight groups were treated with cypermethrin, eight groups...

  5. Sweetpotato weevil, Cylas formicarius (Fab.) (Coleoptera: Brentidae) avoids its host plant when a virulent Metarhizium anisopliae isolate is present.

    PubMed

    Dotaona, Ronnie; Wilson, Bree A L; Ash, Gavin J; Holloway, Joanne; Stevens, Mark M

    2017-09-01

    Metarhizium anisopliae has a wide range of coleopteran hosts, including weevils. Some susceptible insects are known to modify their behavior to prevent infection, typically detecting virulent strains by olfaction, and avoiding physical contact with sources of infection. Laboratory olfactometer assays were conducted on the sweetpotato weevil Cylas formicarius to test the hypothesis that insects would avoid a more virulent strain of M. anisopliae when presented with a strain of low virulence or an untreated control. When adult weevils were allowed to choose between paired test arenas containing sweetpotato roots and M. anisopliae isolates on agar cores, weevils avoided arenas with the highly virulent isolate QS155, showing a preference for either roots with uninoculated agar cores or cores with the low virulence isolate QS002-3. When roots or whole sweetpotato plants were inoculated with M. anisopliae, the preferences of weevils remained broadly similar; weevils were repelled by the highly virulent isolate QS155 when tested against either QS002-3 or uninoculated roots and plants, however weevils were not repelled by the low virulence isolate QS002-3 tested against uninoculated controls. When single-sex groups of weevils were tested separately in the olfactometer using uninoculated whole plants and plants treated with isolate QS155, males and females responded similarly and statistically identical preferences were found for the untreated plants. When weevils were released singly at different times of the day the response time for males was significantly shorter in the afternoon compared to the morning. Males were always significantly faster to respond to olfactory stimuli than females. Understanding factors that may lead to avoidance of virulent M. anisopliae strains by C. formicarius will be an essential part of developing an 'attract-and-infect' strategy for the management of C. formicarius. Copyright © 2017. Published by Elsevier Inc.

  6. Isolation of Metarhizium anisopliae carboxypeptidase A with native disulfide bonds from the cytosol of Escherichia coli BL21(DE3)

    PubMed Central

    Austin, Brian P.; Waugh, David S.

    2011-01-01

    The carboxypeptidase A enzyme from Metarhizium anisopliae (MeCPA) has broader specificity than the mammalian A-type carboxypeptidases, making it a more useful reagent for the removal of short affinity tags and disordered residues from the C-termini of recombinant proteins. When secreted from baculovirus-infected insect cells, the yield of pure MeCPA was 0.25 mg per liter of conditioned medium. Here, we describe a procedure for the production of MeCPA in the cytosol of Escherichia coli that yields approximately 0.5 mg of pure enzyme per liter of cell culture. The bacterial system is much easier to scale up and far less expensive than the insect cell system. The expression strategy entails maintaining the proMeCPA zymogen in a soluble state by fusing it to the C-terminus of maltose-binding protein (MBP) while simultaneously overproducing the protein disulfide isomerase DsbC in the cytosol from a separate plasmid. Unexpectedly, we found that the yield of active and properly oxidized MeCPA was highest when coexpressed with DsbC in BL21(DE3) cells that do not also contain mutations in the trxB and gor genes. Moreover, the formation of active MeCPA was only partially dependent on the disulfide-isomerase activity of DsbC. Intriguingly, we observed that most of the active MeCPA was generated after cell lysis and amylose affinity purification of the MBP-proMeCPA fusion protein, during the time that the partially purified protein was held overnight at 4 °C prior to activation with thermolysin. Following removal of the MBP-propeptide by thermolysin digestion, active MeCPA (with a C-terminal polyhistidine tag) was purified to homogeneity by immobilized metal affinity chromatography (IMAC), ion exchange chromatography and gel filtration. PMID:22197595

  7. Commercial formulation of Metarhizium anisopliae for the control of Rhipicephalus microplus in a pen study.

    PubMed

    Camargo, Mariana G; Marciano, Allan F; Sá, Fillipe A; Perinotto, Wendell M S; Quinelato, Simone; Gôlo, Patrícia S; Angelo, Isabele C; Prata, Márcia C A; Bittencourt, Vânia R E P

    2014-09-15

    The present study evaluated, for the first time, the effect of the commercial formulation Metarril(®) SP Organic of Metarhizium anisopliae plus 10% mineral oil to control Rhipicephalus microplus in a pen study. Three groups were formed with six animals each: the first group was exposed to Metarril(®) plus 10% mineral oil and 1% Tween 80; the second group was exposed to sterile distilled water, mineral oil and Tween 80 (oil control group); and the third group received no treatment (control group). The fungal formulation contained 1 × 10(8)conidiaml(-1). Each animal was sprayed with 3L of formulation. Fallen ticks were counted daily and a sample of 20 engorged females per day was incubated for assessment of biological parameters. Throughout the study period, Metarril(®) oil-based formulation showed an efficacy ranging from 19.20% to 67.39% in comparison with the control group; and from 8.18% to 61.38% in comparison with the oil control group. The average efficacy of Metarril(®) oil-based formulation was 47.74% and 40.89% in comparison with control and oil control groups, respectively. Changes in the biological parameters of engorged R. microplus females were observed in the first three days after treatment, with a significant reduction in hatching percentage and egg production index. We concluded that Metarril(®) SP Organic plus 10% mineral oil was efficient against R. microplus in pen studies. However, further in vivo studies are required to increase the efficacy and to establish a protocol for the use of this product in the field against the cattle tick.

  8. Monomorphic subtelomeric DNA in the filamentous fungus, Metarhizium anisopliae,contains a RecQ helicase-like gene.

    PubMed

    Inglis, Peter W; Rigden, Daniel J; Mello, Luciane V; Louis, Edward J; Valadares-Inglis, M Cléria

    2005-08-01

    In most filamentous fungi, telomere-associated sequences (TASs) are polymorphic, and the presence of restriction fragment length polymorphisms (RFLPs) may permit the number of chromosome ends to be estimated from the number of telomeric bands obtained by restriction digestion. Here, we describe strains of Metarhizium, Gliocladium and Paecilomyces species in which only one or a few telomeric bands of unequal intensity are detectable by Southern hybridization, indicating that interchromosomal TAS exchange occurs. We also studied an anomalous strain of Metarhizium anisopliae, which produces polymorphic telomeric bands larger than 8 kb upon digestion of genomic DNA with XhoI. In this case, the first XhoI site in from the chromosome end must lie beyond the presumed monomorphic region. Cloned telomeres from this strain comprise 18-26 TTAGGG repeats, followed at the internal end of the telomere tract by five repeats of the telomere-like sequence TAAACGCTGG. An 8.1-kb TAS clone also contains a gene for a RecQ-like helicase, designated TAH1, suggesting that this TAS is analogous to the Y' elements in yeast and the subtelomeric helicase ORFs of Ustilago maydis (UTASRecQ) and Magnaporthe grisea (TLH1). The TAS in the anomalous strain of M. anisopliae, however, appears distinct from these in that it is found at most telomeres and its predicted protein product possesses a significantly longer N-terminal region in comparison to the M. grisea and U. maydis helicases. Hybridization analyses showed that TAH1 homologues are present in all other anomalous M. anisopliae strains studied, as well as in some other polymorphic strains, where the recQ-like gene also appears to be telomere-associated.

  9. Ultrastructure of Tuta absoluta parasitized eggs and the reproductive potential of females after parasitism by Metarhizium anisopliae.

    PubMed

    Pires, Laurici M; Marques, Edmilson J; Wanderley-Teixeira, Valéria; Teixeira, Alvaro A C; Alves, Luis C; Alves, E Sérgio B

    2009-02-01

    Among the microorganisms used in biological control, the muscadine fungus Metarhizium anisopliae (Metsch.) Sorok. is produced and formulated world wide aiming to control pests from several agricultural crops. This work evaluated effects of M. anisopliae isolate UFRPE-6 on the fecundity and mortality of Tuta absoluta (Lepidoptera: Gelechiidae) females and the mechanism of infection on eggs. The infection of the females by the fungus did not affect their oviposition and fecundity; however it affected the survival with total and confirmed mortality of 54.2% and 37.14%, respectively. The eggs were treated with suspension at concentration of 10(6)conidia/mL. The analysis under scanning electron microscopy showed that conidia germination and penetration processes in the eggs of T. absoluta started within the period of 6h after the inoculation. Several hyphal bodies were observed from 12h and an intense extrusion of the mycelium covering all the external surface of the eggs 72h after inoculation. Despite its moderate activity in adults, the isolate URPE-6 of M. anisopliae showed promising in the control of T. absoluta due to its pathogenicity and virulence to eggs from this pest.

  10. Production and quality of conidia by Metarhizium anisopliae var. lepidiotum: critical oxygen level and period of mycelium competence.

    PubMed

    Garcia-Ortiz, Nohemi; Tlecuitl-Beristain, Saúl; Favela-Torres, Ernesto; Loera, Octavio

    2015-03-01

    Mycoinsecticides application within Integral Pest Management requires high quantities of conidia, with the proper quality and resistance against environmental conditions. Metarhizium anisopliae var. lepidiotum conidia were produced in normal atmospheric conditions (21 % O2) and different concentrations of oxygen pulses (16, 26, 30, and 40 %); conidia obtained under hypoxic conditions showed significantly lower viability, hydrophobicity, and virulence against Tenebrio molitor larvae or mealworm, compared with those obtained under normal atmospheric conditions. Higher concentrations of oxygen (26 and 30 %) improved conidial production. However, when a 30 % oxygen concentration was applied, maximal conidial yields were obtained at earlier times (132 h) relative to 26 % oxygen pulses (156 h); additionally, with 30 % oxygen pulses, conidia thermotolerance was improved, maintaining viability, hydrophobicity, and virulence. Although conidial production was not affected when 40 % oxygen pulses were applied, viability and virulence were diminished in those conidia. In order to find a critical time for mycelia competence to respond to these oxidant conditions, oxygen pulses were first applied either at 36, 48, 60, and 72 h. A critical time of 60 h was determined to be the best time for the M. anisopliae var. lepidiotum mycelia to respond to oxygen pulses in order to increase conidial production and also to maintain the quality features. Therefore, oxygen-enriched (30 %) pulses starting at 60 h are recommended for a high production without the impairment of quality of M. anisopliae var. lepidiotum conidia.

  11. The effect of temperature and relative humidity on the formation of Metarhizium anisopliae chlamydospores in tick eggs.

    PubMed

    Ment, Dana; Gindin, Galina; Glazer, Itamar; Perl, Shmuel; Elad, Daniel; Samish, Michael

    2010-01-01

    The influence of ambient conditions on the development of Metarhizium anisopliae chlamydospores in tick eggs is reported for the first time. The infection of tick eggs by M. anisopliae involves common events, such as adhesion, conidial germination, appressoria formation, invasion, and development within the eggs. However, the final stage of fungal development differs according to the environmental conditions. At high humidity (close to 100%) and moderate temperature (25°C) the fungus emerged from the eggs and formed conidiophores and conidia externally on the dead eggs. Elevating the temperature to 30°C or reducing humidity to 55-75% induced the production of chlamydospores inside the eggs, without conidiogenesis. When eggs with mature chlamydospores were returned to the appropriate conditions (25°C and 100% RH), conidiogenesis was recovered. Formation of chlamydospores, observed by means of histology and TEM, began with the thickening and septation of hyphae. As the chlamydospore wall thickened a new external undulated wall layer appeared. The mature chlamydospore in eggs has an oval shape (5.3 ± 0.9 microm long, 2.5 ± 0.2 microm wide); its wall comprises three distinct layers. The ability of M. anisopliae to produce chlamydospores under harsh conditions is advantageous and should be considered in application.

  12. Assessing the optimal virulence of malaria-targeting mosquito pathogens: a mathematical study of engineered Metarhizium anisopliae.

    PubMed

    Konrad, Bernhard P; Lindstrom, Michael; Gumpinger, Anja; Zhu, Jielin; Coombs, Daniel

    2014-01-08

    Metarhizium anisopliae is a naturally occurring fungal pathogen of mosquitoes. Recently, Metarhizium has been engineered to act against malaria by directly killing the disease agent within mosquito vectors and also effectively blocking onward transmission. It has been proposed that efforts should be made to minimize the virulence of the fungal pathogen, in order to slow the development of resistant mosquitoes following an actual deployment. Two mathematical models were developed and analysed to examine the efficacy of the fungal pathogen. It was found that, in many plausible scenarios, the best effects are achieved with a reduced or minimal pathogen virulence, even if the likelihood of resistance to the fungus is negligible. The results for both models depend on the interplay between two main effects: the ability of the fungus to reduce the mosquito population, and the ability of fungus-infected mosquitoes to compete for resources with non-fungus-infected mosquitoes. The results indicate that there is no obvious choice of virulence for engineered Metarhizium or similar pathogens, and that all available information regarding the population ecology of the combined mosquito-fungus system should be carefully considered. The models provide a basic framework for examination of anti-malarial mosquito pathogens that should be extended and improved as new laboratory and field data become available.

  13. Different Effects of Metarhizium anisopliae Strains IMI330189 and IBC200614 on Enzymes Activities and Hemocytes of Locusta migratoria L.

    PubMed Central

    Cao, Guangchun; Jia, Miao; Zhao, Xia; Wang, Lei; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Zhang, Zehua

    2016-01-01

    Background Metarhizium is an important class of entomopathogenic fungi in the biocontrol of insects, but its virulence is affected by insect immunity. To clarify the mechanism in virulence of Metarhizium, we compared the immunological differences in Locusta migratoria L. when exposed to two strains of Metarhizium anisopliae (Ma). Results The virulence of Ma IMI330189 was significantly higher than that of Ma IBC200614 to locust, and IMI330189 overcame the hemocytes and began destroying the hemocytes of locust at 72 h after spray, while locust is immune to IBC200614. IMI330189 could overcome the humoral immunity of locust by inhibiting the activities of phenol oxidase (PO), esterases, multi-function oxidases (MFOs) and acetylcholinesterases in locust while increasing the activities of glutathione-S-transferases (GSTs), catalase and aryl-acylamidase (AA). However IBC200614 inhibit the activities of GSTs and AA in locust and increase the activities of MFOs, PO, superoxide dismutase, peroxidase and chitinase in locust. The changes of enzymes activities in period of infection showed that the time period between the 2nd and the 5th day after spray is critical in the pathogenic process. Conclusion These results found the phenomenon that Ma initiatively broke host hemocytes, revealed the correlation between the virulence of Ma and the changes of enzymes activities in host induced by Ma, and clarified the critical period in the infection of Ma. So, these results should provide guidance for the construction of efficient biocontrol Ma strains. PMID:27227835

  14. Identification of a hybrid PKS-NRPS required for the biosynthesis of NG-391 in Metarhizium anisopliae var. anisopliae

    USDA-ARS?s Scientific Manuscript database

    A 19,818 kb genomic region harboring six predicted ORFs was identified in M. anisopliae ARSEF 2575. ORF4, putatively encoding a hybrid polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) was targeted using Agrobacterium-mediated gene knockout. Homologous recombinants failed to produce det...

  15. Virulence, horizontal transmission, and sublethal reproductive effects of Metarhizium anisopliae (Anamorphic fungi) on the German cockroach (Blattodea: Blattellidae).

    PubMed

    Quesada-Moraga, E; Santos-Quirós, R; Valverde-García, P; Santiago-Alvarez, C

    2004-09-01

    Virulence of Metarhizium anisopliae (Metschnikoff) Sorokin strain EAMa 01/121-Su against the German Cockroach, Blatella germanica (L.), was determined using four concentrations ranging from 4.2 x 10(6) to 4.2 x 10(9) spores per milliliter. The LD50 value was 1.4 x 10(7) spores per milliliter (56,000 spores per cockroach) and LT50 values were 14.8 days and 5.3 days for 4.2 x 10(8) and 4.2 x 10(9) spores per milliliter, respectively. An experiment was conducted to evaluate whether a fungal transmission could exist among infected and healthy cockroaches. Percentage mortality at a ratio of 1:10 of infected to unexposed cockroaches was 87.5% and LT50 was 12.2 days, which indicated the potential of this strain to be horizontally transmitted and to rapidly spread the infection in the insect population. The effect of a sublethal dose (ca. LD60) of M. anisopliae EAMa 01/121-Su strain, applied topically on German cockroaches, was studied by reciprocal crossing. Othecal production, oothecal hatchability, and nymphal production declined upon exposure to M. anisopliae EAMa 01/121-Su strain. The mean number of oothecae laid by female was progressively and significantly reduced by fungal treatment from second oviposition period onwards. Oothecal hatch of fungally challenged females was reduced by 46-49%, oothecal viability by 48-85%, and nymphal production by 22-35%. Only treated females showed an effect on oothecal production, oothecal hatch, and nymphal production, although oothecal hatch was also governed by treated males at a higher significance level. Our results on virulence and horizontal transmission of fungal conidia of M. anisopliae EAMa 01/121-Su strain and its sublethal reproductive effects on German cockroach females are discussed in terms of its potential to decrease the pest status of B. germanica in the short and long terms.

  16. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle

    PubMed Central

    Erler, Fedai; Ates, A. Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 109 conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m3 of moist soil medium for GR (9 × 108 cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 109 conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo. PMID:25881632

  17. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle.

    PubMed

    Erler, Fedai; Ates, A Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 10(9) conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m(3) of moist soil medium for GR (9 × 10(8) cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 10(9) conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo.

  18. Statistical optimization of process variables for the large-scale production of Metarhizium anisopliae conidiospores in solid-state fermentation.

    PubMed

    Bhanu Prakash, G V S; Padmaja, V; Siva Kiran, R R

    2008-04-01

    Optimization of conidial production was achieved by response surface methodology (RSM), a powerful mathematical approach widely applied in the optimization of fermentation process, using the three substrates; rice, barley and sorghum at variable pH, moisture content and yeast extract concentrations. These three factors were found to be important, affecting Metarhizium anisopliae spore production. A 2(3) full factorial central composite design and RSM were applied to determine the optimal concentration of each variable. A second-order polynomial was determined by the multiple regression analysis of the experimental data. Moisture content of 75.68% for sorghum, 73.21% for barley and 22.34% for rice produced optimal results. Maximal conidial yield was recorded for rice at a pH of 7.01; at 7.06 for sorghum and at 6.76 for barley.

  19. Density, Viability Conidia And Symptoms of Metarhizium anisopliae infection on Oryctes rhinoceros larvae

    NASA Astrophysics Data System (ADS)

    Indriyanti, D. R.; Putri, R. I. P.; Widiyaningrum, P.; Herlina, L.

    2017-04-01

    M. anisopliae is parasitic fungus on insect pests; it is used as a biocontrol agent. M. anisopliae can be propagated on maize or rice substrate. M. anisopliae is currently sold in the form of kaolin powder formulations. Before it is used to check the density, viability and pathogenicity of M. anisopliae. However the problem is the kaolin powder very soft, so it difficult to distinguish between kaolin and conidia. This article gives information on how to calculate conidia density, viability and symptoms of M. anisopliae infection on Oryctes rhinoceros larvae. The study was conducted in the laboratory to determine the density and viability. The pathogenicity testing was done using pots. The Pot is containing soil substrate mixed with M. Anispoliae and ten tails O. Rhinoceros larvae per pot. The results showed that the density of M. anisopliae conidia was 1.81 x 108 conidia mL-1 and the viability was 94% within 24 hours. The larval mortality began to emerge in the 1st week, and all larvae died at the sixth week. The symptom of M. anisopliae infection on Oryctes rhinoceros larvae, there was a black spot on the larval integument. The larvae movements become slow and poor appetite; it will die within 3-7 days. The larvae die hard, and the white hyphae grow on the body surface that turns green.

  20. Cuticle Fatty Acid Composition and Differential Susceptibility of Three Species of Cockroaches to the Entomopathogenic Fungi Metarhizium anisopliae (Ascomycota, Hypocreales).

    PubMed

    Gutierrez, Alejandra C; Gołębiowski, Marek; Pennisi, Mariana; Peterson, Graciela; García, Juan J; Manfrino, Romina G; López Lastra, Claudia C

    2015-04-01

    Differences in free fatty acids (FFAs) chemical composition of insects may be responsible for susceptibility or resistance to fungal infection. Determination of FFAs found in cuticular lipids can effectively contribute to the knowledge concerning insect defense mechanisms. In this study, we have evaluated the susceptibility of three species of cockroaches to the entomopathogenic fungi Metarhizium anisopliae (Metschnikoff) Sorokin by topical application. Mortality due to M. anisopliae was highly significant on adults and nymphs of Blattella germanica L. (Blattodea: Blattellidae). However, mortality was faster in adults than in nymphs. Adults of Blatta orientalis L. (Blattodea: Blattidae) were not susceptible to the fungus, and nymphs of Blaptica dubia Serville (Blattodea: Blaberidae) were more susceptible to the fungus than adults. The composition of cuticular FFAs in the three species of cockroaches was also studied. The analysis indicated that all of the fatty acids were mostly straight-chain, long-chain, saturated or unsaturated. Cuticular lipids of three species of cockroaches contained 19 FFAs, ranging from C14:0 to C24:0. The predominant fatty acids found in the three studied species of cockroaches were oleic, linoleic, palmitic, and stearic acid. Only in adults of Bl. orientalis, myristoleic acid, γ-linolenic acid, arachidic acid, dihomolinoleic acid, and behenic acid were identified. Lignoceric acid was detected only in nymphs of Bl. orientalis. Heneicosylic acid and docosahexaenoic acid were identified in adults of Ba. dubia.

  1. The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

    PubMed

    Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

    2010-03-01

    The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

  2. Identification of genes differentially expressed by Metarhizium anisopliae growing on Locusta migratoria wings using suppression subtractive hybridization.

    PubMed

    Zhang, Chuanbo; Xia, Yuxian; Li, Zhongyuan

    2011-05-01

    Insect-pathogenic fungi penetrate their hosts directly through the cuticle. To better understand this process, we identified genes that were up-regulated by Metarhizium anisopliae germinating and differentiating on Locusta migratoria wings using suppression subtractive hybridization (SSH). A total of 78 unique expressed sequence tags (ESTs) up-regulated more than twofold during fungal growth on locust wings were identified. Among these 78 ESTs, 30 (38.5%) shared significant similarity with NCBI annotated hypothetical proteins, 16 (20.5%) shared low similarity to known or predicted genes, might represent novel genes, and 32 (41.0%) shared significant similarity with known proteins that are involved in various cell and molecular processes such as cell metabolism, protein metabolism, stress response and defense, and cell structure and function. Semi-quantitative RT-PCR analysis of six randomly selected genes confirmed the SSH results, verifying the fidelity of the SSH data. The results of this study provide novel information on genes expressed during early stages of infection with M. anisopliae, and improve current understanding of fungal pathogenesis.

  3. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite Are Compared in a Mouse Model.

    PubMed

    Ward, Marsha D W; Chung, Yong Joo; Copeland, Lisa B; Doerfler, Donald L

    2011-01-01

    Biopesticides can be effective in controlling their target pest. However, research regarding allergenicity and asthma development is limited. We compared the ability of fungal biopesticide Metarhizium anisopliae (MACA) and house dust mite (HDM) extracts to induce allergic responses in BALB/c mice. The extracts were administered by intratracheal aspiration at doubling doses (2.5-80 μg protein) 4X over a four-week period. Three days after the last exposure, serum and bronchoalveolar lavage fluid (BALF) were collected. The extracts' relative allergenicity was evaluated based on response robustness (lowest significant dose response compared to control (0 μg)). MACA induced a more robust serum total IgE response than HDM. However, in the antigen-specific IgE assay, a similar dose of both MACA and HDM was required to achieve the same response level. Our data suggest a threshold dose of MACA for allergy induction and that M. anisopliae may be similar to HDM in allergy induction potential.

  4. New insights into the infection of the American cockroach Periplaneta americana nymphs with Metarhizium anisopliae s.l. (Ascomycota: Hypocreales).

    PubMed

    Gutierrez, A C; Machado, J A R; Hubner-Campos, R; Pennisi, M A; Rodrigues, J; López Lástra, C C; García, J J; Fernandes, É K K; Luz, C

    2016-11-01

    To study the marked resistance of Periplaneta americana to entomopathogenic Metarhizium anisopliae. The low susceptibility of 4th instar nymphs applied topically with conidia seemed to be related to an active removal of conidia by the cockroach and to a disabled or retarded germination and subsequent development of conidia on the cuticle (up to 80% germination in the next 7 days after application). Inhibitions or delays of germination were related to the composition of the epicuticular fatty acids (30·1% w/w oleic, 28·3% w/w linoleic, 24·5% w/w palmitic and 11·7% w/w stearic acid) reported here. Propagules invading the nymphs through the cuticle took at least 3 days to reach the haemocoel, and no propagules were found after day 8 post-treatment. Strain IP 46 infected >50% of nymphs treated with doses ≥2 × 10(4)  hyphal bodies (HB) nymph(-1) and reduced the survival of nymphs ≤50%. Most nymphs (>70%) survived after injection of 6 × 10(3) and 2 × 10(3)  HB nymph(-1) . Findings emphasize a distinct resistance of nymphs of the American cockroach to infections by M. anisopliae. Our findings provide support for the development of biological control of this synanthropic cockroach pest. © 2016 The Society for Applied Microbiology.

  5. Comparative transcriptomic analysis of the heat stress response in the filamentous fungus Metarhizium anisopliae using RNA-Seq.

    PubMed

    Wang, Zhang-Xun; Zhou, Xia-Zhi; Meng, Hui-Min; Liu, Yu-Jun; Zhou, Quan; Huang, Bo

    2014-06-01

    The entomopathogenic fungus Metarhizium anisopliae is widely used for biological control of a variety of insect pests. The effectiveness of the microbial pest control agent, however, is limited by poor thermotolerance. The molecular mechanism underlying the response to heat stress in the conidia of entomopathogenic fungi remains unclear. Here, we conducted high-throughput RNA-Seq to analyze the differential gene expression between control and heat treated conidia of M. anisopliae at the transcriptome level. RNA-Seq analysis generated 6,284,262 and 5,826,934 clean reads in the control and heat treated groups, respectively. A total of 2,722 up-regulated and 788 down-regulated genes, with a cutoff of twofold change, were identified by expression analysis. Among these differentially expressed genes, many were related to metabolic processes, biological regulation, cellular processes and response to stimuli. The majority of genes involved in endocytic pathways, proteosome pathways and regulation of autophagy were up-regulated, while most genes involved in the ribosome pathway were down-regulated. These results suggest that these differentially expressed genes may be involved in the heat stress response in conidia. As expected, significant changes in expression levels of genes encoding heat shock proteins and proteins involved in trehalose accumulation were observed in conditions of heat stress. These results expand our understanding of the molecular mechanisms of the heat stress response of conidia and provide a foundation for future investigations.

  6. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed.

  7. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite Are Compared in a Mouse Model

    PubMed Central

    Ward, Marsha D. W.; Chung, Yong Joo; Copeland, Lisa B.; Doerfler, Donald L.

    2011-01-01

    Biopesticides can be effective in controlling their target pest. However, research regarding allergenicity and asthma development is limited. We compared the ability of fungal biopesticide Metarhizium anisopliae (MACA) and house dust mite (HDM) extracts to induce allergic responses in BALB/c mice. The extracts were administered by intratracheal aspiration at doubling doses (2.5–80 μg protein) 4X over a four-week period. Three days after the last exposure, serum and bronchoalveolar lavage fluid (BALF) were collected. The extracts' relative allergenicity was evaluated based on response robustness (lowest significant dose response compared to control (0 μg)). MACA induced a more robust serum total IgE response than HDM. However, in the antigen-specific IgE assay, a similar dose of both MACA and HDM was required to achieve the same response level. Our data suggest a threshold dose of MACA for allergy induction and that M. anisopliae may be similar to HDM in allergy induction potential. PMID:21785589

  8. Transformation system of Beauveria bassiana and Metarhizium anisopliae using nitrate reductase gene of Aspergillus nidulans.

    PubMed

    Sandhu, S S; Kinghorn, J R; Rajak, R C; Unkles, S E

    2001-07-01

    An heterologous transformation system for entomopathogenic fungi B. bassiana and M. anisopliae was developed based on the use of A. nidulans nitrate reductase gene (niaD). B. bassiana and M. anisopliae niaD stable mutants were selected by treatment of protoplast with ethane methane sulphonate (EMS) and regenerated on chlorate medium. The cloned gene was capable of transforming B. bassiana and M. anisopliae at a frequency of 5.8 to 20 transformants per microg of DNA. Most of them were mitotically stable.

  9. Differential susceptibility of adults and nymphs of Blattella germanica (L.) (Blattodea: Blattellidae) to infection by Metarhizium anisopliae and assessment of delivery strategies.

    PubMed

    Lopes, R B; Alves, S B

    2011-01-01

    Microbial insecticides for cockroach control, such as those containing entomopathogenic fungi, may be an alternative to reduce contamination by chemicals in housing and food storage environments. Virulence of isolate ESALQ1037 belonging to the Metarhizium anisopliae complex against nymphs and adults of Blattella germanica (L.), and its infectivity following exposure of insects to a contaminated surface or to M. anisopliae-bait were determined under laboratory conditions. Estimated LD50 15 d following topical inoculation was 2.69 x 10(5) conidia per adult, whereas for nymphs the maximum mortality was lower than 50%. Baits amended with M. anisopliae conidia had no repellent effect on targets; adult mortality was inferior to 25%, and nymphs were not susceptible. All conidia found in the digestive tract of M. anisopliae-bait fed cockroaches were unviable, and bait-treated insects that succumbed to fungal infection showed a typical mycelial growth on mouthparts and front legs, but not on the hind body parts. As opposed to baits, the use of a M. anisopliae powdery formulation for surface treatment was effective in attaining high mortality rates of B. germanica. Both nymphs and adults were infected when this delivery strategy was used, and mycelia growth occurred all over the body surface. Our results suggest that the development of powders or similar formulations of M. anisopliae to control B. germanica may provide faster and better results than some of the strategies based on baits currently available.

  10. Mutants and isolates of Metarhizium anisopliae are diverse in their relationships between conidial pigmentation and stress tolerance.

    PubMed

    Rangel, Drauzio E N; Butler, Michael J; Torabinejad, Javad; Anderson, Anne J; Braga, Gilberto U L; Day, Alan W; Roberts, Donald W

    2006-11-01

    Conidial pigmentation is involved in protection against heat and UV radiation in several fungal species. In this study, we compare the tolerance of 17 color mutants of wild-type ARSEF 23 plus 13 color mutants of wild-type ARSEF 2575 of Metarhizium anisopliae var. anisopliae to wet-heat and UV-B or simulated-solar radiation. The stress tolerance of each mutant was compared with that of its wild-type parent, and with the most thermo- and UV-tolerant wild-type Metarhizium we have tested to date, M. anisopliae var. acridum (ARSEF 324). The color of each isolate or mutant was identified with the PANTONE Color Standard book [Eiseman, L., Herbert, L., 1990. The PANTONE((R)) Book of Color: over 1000 color standards: color basics and guidelines for design, fashion, furnishing... and more. Harry N. Abrams, Inc., Publishers, New York]. In addition, the pigments of each mutant or wild-type were extracted and the UV absorbances of the extracts compared to the stress tolerance of those isolates; but no relationships were detected. Color mutants of ARSEF 23, in general, were less UV tolerant than their parent wild-type. With ARSEF 23 and its mutants, conidial pigmentation was important to conidial tolerance to UV-B and simulated-solar radiation; but color had less impact on ARSEF 2575 and its mutants. The ARSEF 2575 color mutants were less variable in UV tolerance than those of ARSEF 23, even though very similar colors occurred in the two groups of mutants. When color mutants of ARSEF 23 reverted to wild-type color they recovered wild-type levels of UV tolerance. Results of UV-B and UV-A exposures of wild-types ARSEF 23 and ARSEF 2575 conidia indicated that they are equally tolerant of UV-A, but differ in UV-B-response. For thermotolerance, several mutants were more heat tolerant than their wild-type parents. Accordingly, darker pigmentation of wild-type isolates was not important to protection against heat.

  11. A Field Experiment to Assess the Rate of Infestation in Honey Bee Populations of Two Metarhizium anisopliae Isolates on Varroa destructor (Acari: Mesostigmata)

    PubMed Central

    Pirali-kheirabadi, Khodadad; Teixeira-da-Silva, Jaime A; Razzaghi-Abyaneh, Mehdi; Nazemnia, Mehdi

    2013-01-01

    Background: The protective effect of two isolates of an entomopathogenic fungus, Metarhizium anisopliae (DEMI 002 and Iran 437C) on the adult stage of Varroa destructor was evaluated in comparison with fluvalinate strips in the field. Methods: A total of 12 honey bee colonies were provided from an apiculture farm. The selected hives were divided into 4 groups (3 hives per group). The first group was the control, treated with distilled water. The other two groups were exposed to different fungi (M. anisopliae isolates DEMI 002 and Iran 437C) and the last group was treated with one strip of fluvalinate per colony. The number of fallen mites was counted using sticky traps during a 6-day period, six days before and after treatments. A fungal suspension at a concentration of 5× 106 conidia/mL was sprayed onto the frames and the number of fallen mites was counted. Results: Metarhizium anisopliae DEMI 002 and Iran 437C isolates were as effective (i.e., caused as much mite fall) as the fluvalinate strip in controlling bee colonies than no treatment. Conclusion: Both M. anisopliae isolates are promising candidates as agents in the control of Varroa mites under field conditions. Isolate DEMI 002 can be considered as a possible non-chemical biocontrol agent for controlling bee infestation with V. destructor in the field. In order to substantiate this hypothesis, tests are currently being performed using larger colonies and larger doses than tested in the present study in our beekeeping. PMID:23785691

  12. The extracellular constitutive production of chitin deacetylase in Metarhizium anisopliae: possible edge to entomopathogenic fungi in the biological control of insect pests.

    PubMed

    Nahar, Pallavi; Ghormade, Vandana; Deshpande, Mukund V

    2004-02-01

    The possible contribution of extracellular constitutively produced chitin deacetylase by Metarhizium anisopliae in the process of insect pathogenesis has been evaluated. Chitin deacetylase converts chitin, a beta-1,4-linked N-acetylglucosamine polymer, into its deacetylated form chitosan, a glucosamine polymer. When grown in a yeast extract-peptone medium, M. anisopliae constitutively produced the enzymes protease, lipase, and two chitin-metabolizing enzymes, viz. chitin deacetylase (CDA) and chitosanase. Chitinase activity was induced in chitin-containing medium. Staining of 7.5% native polyacrylamide gels at pH 8.9 revealed CDA activity in three bands. SDS-PAGE showed that the apparent molecular masses of the three isoforms were 70, 37, and 26 kDa, respectively. Solubilized melanin (10microg) inhibited chitinase activity, whereas CDA was unaffected. Following germination of M. anisopliae conidia on isolated Helicoverpa armigera, cuticle revealed the presence of chitosan by staining with 3-methyl-2-benzothiazoline hydrazone. Blue patches of chitosan were observed on cuticle, indicating conversion of chitin to chitosan. Hydrolysis of chitin with constitutively produced enzymes of M. anisopliae suggested that CDA along with chitosanase contributed significantly to chitin hydrolysis. Thus, chitin deacetylase was important in initiating pathogenesis of M. anisopliae softening the insect cuticle to aid mycelial penetration. Evaluation of CDA and chitinase activities in other isolates of Metarhizium showed that those strains had low chitinase activity but high CDA activity. Chemical assays of M. anisopliae cell wall composition revealed the presence of chitosan. CDA may have a dual role in modifying the insect cuticular chitin for easy penetration as well as for altering its own cell walls for defense from insect chitinase.

  13. Secondary metabolite gene clusters in the entomopathogen fungus Metarhizium anisopliae: genome identification and patterns of expression in a cuticle infection model.

    PubMed

    Sbaraini, Nicolau; Guedes, Rafael Lucas Muniz; Andreis, Fábio Carrer; Junges, Ângela; de Morais, Guilherme Loss; Vainstein, Marilene Henning; de Vasconcelos, Ana Tereza Ribeiro; Schrank, Augusto

    2016-10-25

    The described species from the Metarhizium genus are cosmopolitan fungi that infect arthropod hosts. Interestingly, while some species infect a wide range of hosts (host-generalists), other species infect only a few arthropods (host-specialists). This singular evolutionary trait permits unique comparisons to determine how pathogens and virulence determinants emerge. Among the several virulence determinants that have been described, secondary metabolites (SMs) are suggested to play essential roles during fungal infection. Despite progress in the study of pathogen-host relationships, the majority of genes related to SM production in Metarhizium spp. are uncharacterized, and little is known about their genomic organization, expression and regulation. To better understand how infection conditions may affect SM production in Metarhizium anisopliae, we have performed a deep survey and description of SM biosynthetic gene clusters (BGCs) in M. anisopliae, analyzed RNA-seq data from fungi grown on cattle-tick cuticles, evaluated the differential expression of BGCs, and assessed conservation among the Metarhizium genus. Furthermore, our analysis extended to the construction of a phylogeny for the following three BGCs: a tropolone/citrinin-related compound (MaPKS1), a pseurotin-related compound (MaNRPS-PKS2), and a putative helvolic acid (MaTERP1). Among 73 BGCs identified in M. anisopliae, 20 % were up-regulated during initial tick cuticle infection and presumably possess virulence-related roles. These up-regulated BGCs include known clusters, such as destruxin, NG39x and ferricrocin, together with putative helvolic acid and, pseurotin and tropolone/citrinin-related compound clusters as well as uncharacterized clusters. Furthermore, several previously characterized and putative BGCs were silent or down-regulated in initial infection conditions, indicating minor participation over the course of infection. Interestingly, several up-regulated BGCs were not conserved in host

  14. Performance of a Metarhizium anisopliae-treated semiochemical-baited trap in reducing Amblyomma variegatum populations in the field.

    PubMed

    Nchu, F; Maniania, N K; Hassanali, A; Eloff, J N

    2010-05-11

    Experiments were carried out to evaluate the efficacy of Metarhizium anisopliae (Metsch.) Sorok. (Ascomycota: Hypocreales)-treated semiochemical-baited traps for control of Amblyomma variegatum Fabriscius (Acari: Ixodidae) under field conditions. Unfed A. variegatum adults (118) were seeded in each 100-m plot and allowed to acclimatise for 3 days. On the fourth day (Day 4), an emulsifiable formulation of M. anisopliae (consisting of 49.5% sterile distilled water, fungal conidia, 49.5% corn oil and 1% Tween 80) titrated at 10(9)conidia ml(-1) was applied in semiochemical-baited traps (900 cm(2)) which were placed at five spots within the plot. The control and fungal treatments were repeated after 14 and 28 days soon after rotating the traps clockwise (45 degrees ) in order to cover different sections of the plot. In the control plots, emulsifiable formulation without fungus was applied in the semiochemical-baited traps. Six weeks after the initiation of the experiments, five semiochemical-baited traps (untreated) were deployed in each plot for 3 successive days to trap ticks in the treated and control plots. The percentage of ticks recovered in the fungus-treated plots were significantly lower (31.1+/-5.2%) than in the control plots (85.6+/-3%) (P<0.001), which represented a relative tick reduction of 63.7%. Mortality of 93.8+/-2.3% was observed among the ticks that were recovered from the field and maintained in the laboratory for 2 weeks; while only 3.3+/-0.9% died from the control plots. The results of this study open up the possibility of developing an environmentally friendly and low cost application strategy to control Amblyomma ticks. (c) 2010 Elsevier B.V. All rights reserved.

  15. The use of a semiochemical bait to enhance exposure of Amblyomma variegatum (Acari: Ixodidae) to Metarhizium anisopliae (Ascomycota: Hypocreales).

    PubMed

    Nchu, F; Maniania, N K; Touré, A; Hassanali, A; Eloff, J N

    2009-03-23

    Experiments were conducted to explore the use of a semiochemical bait to enhance exposure of Amblyomma variegatum Fabricius (Acari: Ixodidae) to different formulations of the entomopathogenic fungus Metarhizium anisopliae (Metsch.) Sorok. (Ascomycota: Hypocreales). Initially, the relative efficacies of attraction-aggregation-attachment pheromone (AAAP), made up of o-nitrophenol, methyl salicylate and nonanoic acid in the ratio 2:1:8, 1-octen-3-ol and butyric acid, were evaluated in an olfactometer. Only AAAP and 1-octen-3-ol were found to elicit attractive responses to the tick. Simultaneous release of 1-octen-3-ol and AAAP together with CO(2) from a trap in semifield plots attracted up to 94.0+/-6% of adult ticks from a distance of 6m, and up to 24.0+/-5.1% from 8m. Formulations of M. anisopliae (dry powder, oil, and emulsifiable) applied within the trap baited with AAAP, 1-octen-3-ol and CO(2) resulted in high levels of contamination of the ticks attracted to the traps. However, 48h after autoinoculation, 89.1 and 33.3% of conidia were lost in dry powder and oil formulations, respectively. Emulsifiable formulation showed least loss of propagules (17.1%). Samples of ticks attracted to the baited traps were transferred to plastic basins containing grass and maintained for 5 weeks. The experiment was conducted in rainy and dry seasons. Emulsifiable formulation gave the highest relative tick reduction in both seasons: 54.7 and 46.5% in rainy and dry seasons, respectively, followed by oil formulation (32.0 and 23.8%) and powder formulation (38.0 and 24.4%).

  16. Horizontal Transmission of Metarhizium anisopliae in Fruit Flies and Effect of Fungal Infection on Egg Laying and Fertility

    PubMed Central

    Dimbi, Susan; Maniania, Nguya K.; Ekesi, Sunday

    2013-01-01

    Fly-to-fly transmission of conidia of the entomopathogenic fungus Metarhizium anisopliae and the effect of fungal infection on the reproductive potential of females surviving infection were investigated in three fruit fly species, Ceratitis cosyra, C. fasciventris, and C. capitata. The number of conidia picked up by a single fruit fly was determined in C. cosyra. The initial uptake (Day 0) of conidia by a single fly was approx. 1.1 × 106 conidia after exposure to the treated substrate. However, the number of conidia dropped from 7.2 × 105 to 4.1 × 105 conidia after 2 and 8 h post-exposure, respectively. The number of conidia picked up by a single fungus-treated fly (“donor”) varied between 3.8 × 105 and 1.0 × 106 in the three fruit fly species, resulting in 100% mortality 5–6 days post-exposure. When fungus-free flies of both sexes (“recipient” flies) were allowed to mate with “donor” flies, the number of conidia picked up by a single fly varied between 1.0 × 105 and 2.5 × 105, resulting in a mortality of 83–100% in C. capitata, 72–85% in C. cosyra and 71–93% in C. fasciventris 10–15 days post-inoculation. There was an effect of fungal infection on female egg laying in the three species of fruit flies as control flies laid more eggs than fungus-treated females. The percentage reduction in fecundity in flies infected with M. anisopliae was 82, 73 and 37% in C. capitata, C. fasciventris and C. cosyra, respectively. The results are discussed with regard to application in autodissemination techniques. PMID:26464386

  17. Human sera IgE reacts with a Metarhizium anisopliae fungal catalase

    EPA Science Inventory

    Background: Previous studies have demonstrated that Metarhzium anisopliae extract can induce immune responses in a mouse model that are characteristic of human allergic asthma. Objectives: The objective of this study was to identify and characterize the extract proteins t...

  18. Human sera IgE reacts with a Metarhizium anisopliae fungal catalase

    EPA Science Inventory

    Background: Previous studies have demonstrated that Metarhzium anisopliae extract can induce immune responses in a mouse model that are characteristic of human allergic asthma. Objectives: The objective of this study was to identify and characterize the extract proteins t...

  19. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  20. Susceptibility of adult female Aedes aegypti (Diptera: Culicidae) to the entomopathogenic fungus Metarhizium anisopliae is modified following blood feeding.

    PubMed

    Paula, Adriano R; Carolino, Aline T; Silva, Carlos P; Samuels, Richard I

    2011-05-26

    The mosquito Aedes aegypti, vector of dengue fever, is a target for control by entomopathogenic fungi. Recent studies by our group have shown the susceptibility of adult A. aegypti to fungal infection by Metarhizium anisopliae. This fungus is currently being tested under field conditions. However, it is unknown whether blood-fed A. aegypti females are equally susceptible to infection by entomopathogenic fungi as sucrose fed females. Insect populations will be composed of females in a range of nutritional states. The fungus should be equally efficient at reducing survival of insects that rest on fungus impregnated surfaces following a blood meal as those coming into contact with fungi before host feeding. This could be an important factor when considering the behavior of A. aegypti females that can blood feed on multiple hosts over a short time period. Female A. aegypti of the Rockefeller strain and a wild strain were infected with two isolates of the entomopathogenic fungus M. anisopliae (LPP 133 and ESALQ 818) using an indirect contact bioassay at different times following blood feeding. Survival rates were monitored on a daily basis and one-way analysis of variance combined with Duncan's post-hoc test or Log-rank survival curve analysis were used for statistical comparisons of susceptibility to infection. Blood feeding rapidly reduced susceptibility to infection, determined by the difference in survival rates and survival curves, when females were exposed to either of the two M. anisopliae isolates. Following a time lag which probably coincided with digestion of the blood meal (96-120 h post-feeding), host susceptibility to infection returned to pre-blood fed (sucrose fed) levels. Reduced susceptibility of A. aegypti to fungi following a blood meal is of concern. Furthermore, engorged females seeking out intra-domicile resting places post-blood feeding, would be predicted to rest for prolonged periods on fungus impregnated black cloths, thus optimizing infection

  1. Copulation Activity, Sperm Production and Conidia Transfer in Aedes aegypti Males Contaminated by Metarhizium anisopliae: A Biological Control Prospect.

    PubMed

    Garza-Hernández, Javier A; Reyes-Villanueva, Filiberto; Russell, Tanya L; Braks, Marieta A H; Garcia-Munguia, Alberto M; Rodríguez-Pérez, Mario A

    2015-01-01

    Dengue is the most prevalent arboviral disease transmitted by Aedes aegypti worldwide, whose chemical control is difficult, expensive, and of inconsistent efficacy. Releases of Metarhizium anisopliae--exposed Ae. aegypti males to disseminate conidia among female mosquitoes by mating represents a promising biological control approach against this important vector. A better understanding of fungus virulence and impact on reproductive parameters of Ae. aegypti, is need before testing auto-dissemination strategies. Mortality, mating competitiveness, sperm production, and the capacity to auto-disseminate the fungus to females up to the 5 th copulation, were compared between Aedes aegypti males exposed to 5.96 x 10(7) conidia per cm2 of M. anisopliae and uninfected males. Half (50%) of fungus-exposed males (FEMs) died within the first 4 days post-exposure (PE). FEMs required 34% more time to successively copulate with 5 females (165 ± 3 minutes) than uninfected males (109 ± 3 minutes). Additionally, fungus infection reduced the sperm production by 87% at 5 days PE. Some beneficial impacts were observed, FEMs were able to successfully compete with uninfected males in cages, inseminating an equivalent number of females (about 25%). Under semi-field conditions, the ability of FEMs to search for and inseminate females was also equivalent to uninfected males (both inseminating about 40% females); but for the remaining females that were not inseminated, evidence of tarsal contact (transfer of fluorescent dust) was significantly greater in FEMs compared to controls. The estimated conidia load of a female exposed on the 5th copulation was 5,200 mL(-1) which was sufficient to cause mortality. Our study is the first to demonstrate auto-dissemination of M. anisopliae through transfer of fungus from males to female Ae. aegypti during mating under semi-field conditions. Our results suggest that auto-dissemination studies using releases of FEMs inside households could successfully

  2. Autodissemination of the entomopathogenic fungus Metarhizium anisopliae amongst adults of the malaria vector Anopheles gambiae s.s.

    PubMed Central

    Scholte, Ernst-Jan; Knols, Bart GJ; Takken, Willem

    2004-01-01

    Background The entomopathogenic fungus Metarhizium anisopliae is being considered as a biocontrol agent for adult African malaria vectors. In the laboratory, work was carried out to assess whether horizontal transmission of the pathogen can take place during copulation, as this would enhance the impact of the fungus on target populations when compared with insecticides. Methods Virgin female Anopheles gambiae sensu stricto were exposed to conidia whilst resting on fungus-impregnated paper. These females were then placed together for one hour with uncontaminated males in proportions of either 1:1 or 1:10 shortly before the onset of mating activity. Results Males that had acquired fungal infection after mating indicate that passive transfer of the pathogen from infected females does occur, with mean male infection rates between 10.7 ± 3.2% and 33.3 ± 3.8%. The infections caused by horizontal transmission did not result in overall differences in survival between males from test and control groups, but in one of the three experiments the infected males had significantly shorter life spans than uninfected males (P < 0.05). Conclusion This study shows that autodissemination of fungal inoculum between An. gambiae s.s. mosquitoes during mating activity is possible under laboratory conditions. Field studies are required next, to assess the extent to which this phenomenon may augment the primary contamination pathway (i.e. direct contact with fungus-impregnated targets) of vector populations in the field. PMID:15566626

  3. Ethanol production from chitosan by the nematophagous fungus Pochonia chlamydosporia and the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana.

    PubMed

    Aranda-Martinez, Almudena; Naranjo Ortiz, Miguel Ángel; Abihssira García, Isabel Sofía; Zavala-Gonzalez, Ernesto A; Lopez-Llorca, Luis Vicente

    2017-11-01

    Chitin is the second most abundant biopolymer after cellulose and virtually unexplored as raw material for bioethanol production. In this paper, we investigate chitosan, the deacetylated form of chitin which is the main component of shellfish waste, as substrate for bioethanol production by fungi. Fungal parasites of invertebrates such as the nematophagous Pochonia chlamydosporia (Pc) or the entomopathogens Beauveria bassiana (Bb) and Metarhizium anisopliae (Ma) are biocontrol agents of plant parasitic nematodes (eg. Meloidogyne spp.) or insect pests such as the red palm weevil (Rhynchophorus ferrugineus). These fungi degrade chitin-rich barriers for host penetration. We have therefore tested the chitin/chitosanolytic capabilities of Pc, Bb and Ma for generating reducing sugars using chitosan as only nutrient. Among the microorganisms used in this study, Pc is the best chitosan degrader, even under anaerobic conditions. These fungi have alcohol dehydrogenase (ADH) and pyruvate decarboxylase (PDC) encoding genes in their genomes. We have therefore analyzed their ethanol production under anaerobic conditions using chitosan as raw material. P. chlamydosporia is the largest ethanol producer from chitosan. Our studies are a starting point to develop chitin-chitosan based biofuels. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. The physiological effects of multi-walled carbon nanotubes (MWCNTs) on conidia and the development of the entomopathogenic fungus, Metarhizium anisopliae (Metsch.) Sorok.

    PubMed

    Gorczyca, Anna; Kasprowicz, Marek J; Lemek, Tadeusz

    2014-01-01

    The aim of the study was an in vitro evaluation of the effect of MWCNTs on the conidia of two strains of entomopathogenic fungus, Metarhizium anisopliae. The study made use of water suspensions of MWCNTs (concentration ∼ 3 mg·mL(-1)) made from commercial nanotubes and centrifuged. The conidia were placed in contact with nanotubes for 240 h. An assessment of MWCNT influence on conidia was performed after 1, 24, 72 and 240 h and focused on the linear growth of vegetative mycelium derived from these conidia, mycelium sporulation in subcultures and pathogenicity. Using TEM imaging, it was demonstrated that carbon nanotubes are able to damage cell membranes of the examined fungi conidia. However, the absence was noted of a significantly fungistatic effect of both MWCNT suspensions on the examined strains with respect to the physiological features in question. The increase in vegetative mycelium effected by spores after contact with MWCNTs was characterized by a slight modification in relation to the control. There was no strong trend (inhibition - stimulation), in relation to the effect of the tested suspension of carbon nanotubes, on the development of the vegetative mycelium in in vitro culture. Sporulation of the mycelium after completion of the culture only occurred in one case (strain Ma73F and culture of spores after 24-h contact with MWCNTs) significantly more intensely than in the controls. With respect to pathogenicity for test insects compared to the control strain, Ma73F spores grown from the longest contact with nanotubes suspensions performed significantly better. On the basis of the calculated of mycelium index growth rates and the time of death of the test insects (LT50), it was found that the adverse effects of water suspension MWCNTs on the spores of M. anisopliae were applied after a short contact with biological material. This indicates unfavorable physical rather than chemical effects on the tested cell. Over time, nanotube aggregation in water

  5. Evaluation of Metarhizium anisopliae (Metsch) Sorok. to target larvae and adults of Capnodis tenebrionis (L.) (Coleoptera: Buprestidae) in soil and fiber band applications.

    PubMed

    Marannino, Pierdomenico; Santiago-Alvarez, Cándido; de Lillo, Enrico; Quesada-Moraga, Enrique

    2008-03-01

    The aim of this work has been to evaluate in the laboratory the potential of entomopathogenic fungi against adults and larvae of Capnodis tenebrionis (L.) (Coleoptera: Buprestidae) through fiber band application and a potted plant bioassay with soil application, respectively. Our previous findings revealed that Metarhizium anisopliae EAMa 01/58-Su isolate was the most virulent against neonate larvae of the buprestid. In the present work, M. anisopliae EAMa 01/58-Su isolate has been also shown to be highly virulent against adult beetles by immersion in a conidial suspension; thus it was selected to accomplish our objectives. When adult beetles were stimulated to climb 100 x 200 mm non-woven commercial fiber bands impregnated with conidia of M. anisopliae EAMa 01/58-Su isolate, total mortality rates varied from 85.7% to 100.0%; whereas no significant correlation was detected between the time needed to cross the band (mean value 648.7+/-22.4s) and the time of death, with mean average survival time ranging between 10.3 and 16.0 days, compared to 28 days of the controls. Potted seedlings (5-6 months old) of cherry plum (Prunus myrobalana Lois.), a commonly used apricot rootstock, were used to study the efficacy of soil treatment with M. anisopliae EAMa 01/58-Su isolate against neonate C. tenebrionis larvae. The soil inoculation with M. anisopliae EAMa 01/58-Su isolate had a significant effect on the mean number of dead larvae recovered from the roots, with mean mortality ranging from 83.3% to 91.6%; whereas no significant differences were detected between the three fungal doses. In all cases, dead larvae found within roots exhibited external signs of fungal growth. Hence, it may be possible to use M. anisopliae EAMa 01/58-Su isolate in a biocontrol strategy targeting both adults and larvae of C. tenebrionis.

  6. Influence of entomopathogenic fungus, Metarhizium anisopliae, alone and in combination with diatomaceous earth and thiamethoxam on mortality, progeny production, mycosis, and sporulation of the stored grain insect pests.

    PubMed

    Ashraf, Misbah; Farooq, Muhammad; Shakeel, Muhammad; Din, Naima; Hussain, Shahbaz; Saeed, Nadia; Shakeel, Qaiser; Rajput, Nasir Ahmed

    2017-10-10

    The stored grain insects cause great damage to grains under storage conditions. Synthetic insecticides and fumigants are considered as key measures to control these stored grain insect pests. However, the major issue with these chemicals is grain contamination with chemical residues and development of resistance by insect pests to these chemicals. Biological control is considered as a potential alternative to chemical control especially with the use of pathogens, alone or in combination with selective insecticides. The present study was conducted to evaluate the synergism of Metarhizium anisopliae with diatomaceous earth (DE) and thiamethoxam against four insect pests on the stored wheat grains. In the first bioassay, the M. anisopliae was applied at 1.4 × 10(4) and 1.4 × 10(6)conidia/ml alone and in integration with two concentrations (250 and 500 ppm) of tested DE. The tested fungus when combined with DE and thiamethoxam possessed synergistic impact as compared to their individual efficacy. Adult mortality increased with respect to increased exposure interval and doses. In the second bioassay, M. anisopliae was applied at 1.4 × 10(4) conidia/ml individually and in combination with three concentrations (0.50, 0.75, and 1.00 ppm) of thiamethoxam. Results concluded that M. anisopliae integrated with DE and thiamethoxam provides more effective control of stored grain insect pests.

  7. The effect of leaf biopesticide Mirabilis jalapa and fungi Metarhizium anisopliae to immune response and mortality of Spodoptera exigua instar IV

    NASA Astrophysics Data System (ADS)

    Suryani, A. Irma; Anggraeni, Tjandra

    2014-03-01

    Spodoptera exigua is one of insect causing damage in agriculture sector. This insect can be controlled by a natural biopesticide by combining two agents of biological control, biopesticides Mirabilis jalapa and entomopathogenic fungi Metarhizium anisopliae, considered to be virulent toward a wide range of insects. The objective of research was to determine the effect of biopesticides M. jalapa and fungi M. anisopliae against immune system and mortality of S. exigua. This research used a complete randomized block design with five concentrations Mirabilis jalapa and optimum dose of M. anisopliae. A high dose of M. jalapa (0.8% w/v) is the most effective one to decrease total haemocytes especially granulocyt and plasmatocyt (cellular immune) and decrease the concentration of lectin (humoral immune) from S. exigua (p < 0.05). The combination of M. jalapa (0, 8% w/v) and lethal dose of M. anisopliae 2.59 × 107 spore/ml were significant to increase mortality of S. exigua within 48 hours (p < 0.05).

  8. Production of microsclerotia by brazilian strains of metarhizium spp. using submerged liquid culture fermentation

    USDA-ARS?s Scientific Manuscript database

    We investigated the potential production and desiccation tolerance of microsclerotia (MS) by Brazilian strains of Metarhizium. anisopliae [Ma], M. acridum [Mc] and M. robertsii [Mr]. These fungi were grown in a liquid medium containing 16 g carbon l-1 with a carbon:nitrogen ratio of 50:1. One hundre...

  9. Neem oil increases the efficiency of the entomopathogenic fungus Metarhizium anisopliae for the control of Aedes aegypti (Diptera: Culicidae) larvae.

    PubMed

    Gomes, Simone A; Paula, Adriano R; Ribeiro, Anderson; Moraes, Catia O P; Santos, Jonathan W A B; Silva, Carlos P; Samuels, Richard I

    2015-12-30

    Entomopathogenic fungi are potential candidates for use in integrated vector management and many isolates are compatible with synthetic and natural insecticides. Neem oil was tested separately and in combination with the entomopathogenic fungus Metarhizium anisopliae against larvae of the dengue vector Aedes aegypti. Our aim was to increase the effectiveness of the fungus for the control of larval mosquito populations. Commercially available neem oil was used at concentrations ranging from 0.0001 to 1%. Larval survival rates were monitored over a 7 day period following exposure to neem. The virulence of the fungus M. anisopliae was confirmed using five conidial concentrations (1 × 10(5) to 1 × 10(9) conidia mL(-1)) and survival monitored over 7 days. Two concentrations of fungal conidia were then tested together with neem (0.001%). Survival curve comparisons were carried out using the Log-rank test and end-point survival rates were compared using one-way ANOVA. 1% neem was toxic to A. aegypti larvae reducing survival to 18% with S50 of 2 days. Neem had no effect on conidial germination or fungal vegetative growth in vitro. Larval survival rates were reduced to 24% (S50 = 3 days) when using 1 × 10(9) conidia mL(-1). Using 1 × 10(8) conidia mL(-1), 30% survival (S50 = 3 days) was observed. We tested a "sub-lethal" neem concentration (0.001%) together with these concentrations of conidia. For combinations of neem + fungus, the survival rates were significantly lower than the survival rates seen for fungus alone or for neem alone. Using a combination of 1 × 10(7) conidia mL(-1) + neem (0.001%), the survival rates were 36%, whereas exposure to the fungus alone resulted in 74% survival and exposure to neem alone resulted in 78% survival. When using 1 × 10(8) conidia mL(-1), the survival curves were modified, with a combination of the fungus + neem resulting in 12% survival, whilst the fungus alone at this concentration also

  10. Pyrethroid resistance in Anopheles gambiae leads to increased susceptibility to the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana

    PubMed Central

    2010-01-01

    Background Entomopathogenic fungi are being investigated as a new mosquito control tool because insecticide resistance is preventing successful mosquito control in many countries, and new methods are required that can target insecticide-resistant malaria vectors. Although laboratory studies have previously examined the effects of entomopathogenic fungi against adult mosquitoes, most application methods used cannot be readily deployed in the field. Because the fungi are biological organisms it is important to test potential field application methods that will not adversely affect them. The two objectives of this study were to investigate any differences in fungal susceptibility between an insecticide-resistant and insecticide-susceptible strain of Anopheles gambiae sensu stricto, and to test a potential field application method with respect to the viability and virulence of two fungal species Methods Pieces of white polyester netting were dipped in Metarhizium anisopliae ICIPE-30 or Beauveria bassiana IMI391510 mineral oil suspensions. These were kept at 27 ± 1°C, 80 ± 10% RH and the viability of the fungal conidia was recorded at different time points. Tube bioassays were used to infect insecticide-resistant (VKPER) and insecticide-susceptible (SKK) strains of An. gambiae s.s., and survival analysis was used to determine effects of mosquito strain, fungus species or time since fungal treatment of the net. Results The resistant VKPER strain was significantly more susceptible to fungal infection than the insecticide-susceptible SKK strain. Furthermore, B. bassiana was significantly more virulent than M. anisopliae for both mosquito strains, although this may be linked to the different viabilities of these fungal species. The viability of both fungal species decreased significantly one day after application onto polyester netting when compared to the viability of conidia remaining in suspension. Conclusions The insecticide-resistant mosquito strain was susceptible

  11. Effects of temperature and relative humidity on sporulation of Metarhizium anisopliae var. acridum in mycosed cadavers of Schistocerca gregaria.

    PubMed

    Arthurs, S; Thomas, M B

    2001-08-01

    The effects of relative humidity (RH) and temperature on the sporulation of Metarhizium anisopliae var. acridum on mycosed cadavers of desert locust, Schistocerca gregaria, were assessed in the laboratory. Quantitative assessments of conidial production over 10 days under constant conditions showed that sporulation was optimized at RH > 96% and at temperatures between 20 and 30 degrees C. Under both these conditions >10(9) conidia/cadaver were produced. At 25 degrees C, conidial yield was maximized under conditions in which cadavers remained in contact with damp substrate. Relatively little sporulation occurred at 15 degrees C (< 3 x 10(7) conidia/cadaver) and 40 degrees C (< 4 x 10(6) conidia/cadaver) and no sporulation occurred at 10 or 45 degrees C. Following incubation, conidial yield was closely related to the water content of locust cadavers. In separate tests, locust cadavers were incubated for 10 days under diurnally fluctuating temperature and RH that comprised favorable (25 degrees C/100% RH) alternating with unfavorable (40 degrees C/80% RH) conditions for sporulation. In this case, fewer conidia were produced compared with cadavers that were incubated under the favorable conditions for an equal period cumulatively but were not periodically exposed to unfavorable conditions. However, this reduced sporulation observed with the fluctuating condition was not observed when cadavers were similarly incubated under favorable/unfavorable conditions of temperature but were not periodically exposed to the low RH condition. This result implies that sporulation is a dynamic process, dependent not only on periodic exposure to favorable RH but also on the interrelation of this with low RH. Associated tests and the monitoring of changes in cadaver weights imply that the mechanism driving the reduced sporulation under fluctuating RH is the net water balance of cadavers, i.e. the cumulative ability of the fungus/cadaver to adsorb water necessary for sporulation at high

  12. Copulation Activity, Sperm Production and Conidia Transfer in Aedes aegypti Males Contaminated by Metarhizium anisopliae: A Biological Control Prospect

    PubMed Central

    Russell, Tanya L.; Braks, Marieta A. H.

    2015-01-01

    Background Dengue is the most prevalent arboviral disease transmitted by Aedes aegypti worldwide, whose chemical control is difficult, expensive, and of inconsistent efficacy. Releases of Metarhizium anisopliae—exposed Ae. aegypti males to disseminate conidia among female mosquitoes by mating represents a promising biological control approach against this important vector. A better understanding of fungus virulence and impact on reproductive parameters of Ae. aegypti, is need before testing auto-dissemination strategies. Methodology/Principal Findings Mortality, mating competitiveness, sperm production, and the capacity to auto-disseminate the fungus to females up to the 5thcopulation, were compared between Aedes aegypti males exposed to 5.96 x 107 conidia per cm2 of M. anisopliae and uninfected males. Half (50%) of fungus-exposed males (FEMs) died within the first 4 days post-exposure (PE). FEMs required 34% more time to successively copulate with 5 females (165 ± 3 minutes) than uninfected males (109 ± 3 minutes). Additionally, fungus infection reduced the sperm production by 87% at 5 days PE. Some beneficial impacts were observed, FEMs were able to successfully compete with uninfected males in cages, inseminating an equivalent number of females (about 25%). Under semi-field conditions, the ability of FEMs to search for and inseminate females was also equivalent to uninfected males (both inseminating about 40% females); but for the remaining females that were not inseminated, evidence of tarsal contact (transfer of fluorescent dust) was significantly greater in FEMs compared to controls. The estimated conidia load of a female exposed on the 5th copulation was 5,200 mL-1 which was sufficient to cause mortality. Conclusion/Significance Our study is the first to demonstrate auto-dissemination of M. anisopliae through transfer of fungus from males to female Ae. aegypti during mating under semi-field conditions. Our results suggest that auto-dissemination studies

  13. Effects of conidial densities and spray volume of Metarhizium anisopliae and Beauveria bassiana fungal suspensions on conidial viability, droplet size and deposition coverage in bioassay using a novel bioassay spray system

    USDA-ARS?s Scientific Manuscript database

    Experiments were conducted to study the conidial viability during bioassay spray with different suspensions of Metarhizium anisopliae ATCC 62176 and Beauveria bassiana NI8, and to investigate the effects of conidial density and spray volume on the distribution of droplet size and deposit coverage us...

  14. Effectiveness of Bacillus thuringiensis-Transgenic Chickpeas and the Entomopathogenic Fungus Metarhizium anisopliae in Controlling Helicoverpa armigera (Lepidoptera: Noctuidae)▿

    PubMed Central

    Lawo, N. C.; Mahon, R. J.; Milner, R. J.; Sarmah, B. K.; Higgins, T. J. V.; Romeis, J.

    2008-01-01

    The use of genetically modified (Bt) crops expressing lepidopteran-specific Cry proteins derived from the soil bacterium Bacillus thuringiensis is an effective method to control the polyphagous pest Helicoverpa armigera. As H. armigera potentially develops resistance to Cry proteins, Bt crops should be regarded as one tool in integrated pest management. Therefore, they should be compatible with biological control. Bioassays were conducted to understand the interactions between a Cry2Aa-expressing chickpea line, either a susceptible or a Cry2A-resistant H. armigera strain, and the entomopathogenic fungus Metarhizium anisopliae. In a first concentration-response assay, Cry2A-resistant larvae were more tolerant of M. anisopliae than susceptible larvae, while in a second bioassay, the fungus caused similar mortalities in the two strains fed control chickpea leaves. Thus, resistance to Cry2A did not cause any fitness costs that became visible as increased susceptibility to the fungus. On Bt chickpea leaves, susceptible H. armigera larvae were more sensitive to M. anisopliae than on control leaves. It appeared that sublethal damage induced by the B. thuringiensis toxin enhanced the effectiveness of M. anisopliae. For Cry2A-resistant larvae, the mortalities caused by the fungus were similar when they were fed either food source. To examine which strain would be more likely to be exposed to the fungus, their movements on control and Bt chickpea plants were compared. Movement did not appear to differ among larvae on Bt or conventional chickpeas, as indicated by the number of leaflets damaged per leaf. The findings suggest that Bt chickpeas and M. anisopliae are compatible to control H. armigera. PMID:18487396

  15. Infection of malaria (Anopheles gambiae s.s.) and filariasis (Culex quinquefasciatus) vectors with the entomopathogenic fungus Metarhizium anisopliae

    PubMed Central

    Scholte, Ernst-Jan; Njiru, Basilio N; Smallegange, Renate C; Takken, Willem; Knols, Bart GJ

    2003-01-01

    Background Current intra-domiciliary vector control depends on the application of residual insecticides and/or repellents. Although biological control agents have been developed against aquatic mosquito stages, none are available for adults. Following successful use of an entomopathogenic fungus against tsetse flies (Diptera: Glossinidae) we investigated the potency of this fungus as a biological control agent for adult malaria and filariasis vector mosquitoes. Methods In the laboratory, both sexes of Anopheles gambiae sensu stricto and Culex quinquefasciatus were passively contaminated with dry conidia of Metarhizium anisopliae. Pathogenicity of this fungus for An. gambiae was further tested for varying exposure times and different doses of oil-formulated conidia. Results Comparison of Gompertz survival curves and LT50 values for treated and untreated specimens showed that, for both species, infected mosquitoes died significantly earlier (p < 0.0001) than uninfected control groups. No differences in LT50 values were found for different exposure times (24, 48 hrs or continuous exposure) of An. gambiae to dry conidia. Exposure to oil-formulated conidia (doses ranging from 1.6 × 107 to 1.6 × 1010 conidia/m2) gave LT50 values of 9.69 ± 1.24 (lowest dose) to 5.89 ± 0.35 days (highest dose), with infection percentages ranging from 4.4–83.7%. Conclusion Our study marks the first to use an entomopathogenic fungus against adult Afrotropical disease vectors. Given its high pathogenicity for both adult Anopheles and Culex mosquitoes we recommend development of novel targeted indoor application methods for the control of endophagic host-seeking females. PMID:14565851

  16. Infection of malaria (Anopheles gambiae s.s.) and filariasis (Culex quinquefasciatus) vectors with the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Scholte, Ernst-Jan; Njiru, Basilio N; Smallegange, Renate C; Takken, Willem; Knols, Bart G J

    2003-09-15

    Current intra-domiciliary vector control depends on the application of residual insecticides and/or repellents. Although biological control agents have been developed against aquatic mosquito stages, none are available for adults. Following successful use of an entomopathogenic fungus against tsetse flies (Diptera: Glossinidae) we investigated the potency of this fungus as a biological control agent for adult malaria and filariasis vector mosquitoes. In the laboratory, both sexes of Anopheles gambiae sensu stricto and Culex quinquefasciatus were passively contaminated with dry conidia of Metarhizium anisopliae. Pathogenicity of this fungus for An. gambiae was further tested for varying exposure times and different doses of oil-formulated conidia. Comparison of Gompertz survival curves and LT50 values for treated and untreated specimens showed that, for both species, infected mosquitoes died significantly earlier (p < 0.0001) than uninfected control groups. No differences in LT50 values were found for different exposure times (24, 48 hrs or continuous exposure) of An. gambiae to dry conidia. Exposure to oil-formulated conidia (doses ranging from 1.6 x 10(7) to 1.6 x 10(10) conidia/m2) gave LT50 values of 9.69 +/- 1.24 (lowest dose) to 5.89 +/- 0.35 days (highest dose), with infection percentages ranging from 4.4-83.7%. Our study marks the first to use an entomopathogenic fungus against adult Afrotropical disease vectors. Given its high pathogenicity for both adult Anopheles and Culex mosquitoes we recommend development of novel targeted indoor application methods for the control of endophagic host-seeking females.

  17. Laboratory evaluation of the entomopathogenic fungus, Metarhizium anisopliae for the control of the groundnut bruchid, Caryedon serratus on groundnut.

    PubMed

    Ekesi, S; Egwurube, E A.; Akpa, A D.; Onu, I

    2001-10-01

    The pathogenicity of five isolates of Metarhizium anisopliae to adult Caryedon serratus was evaluated in the laboratory. All the isolates tested were virulent to the beetle but pathogenicity varied among the isolates. One isolate, CPD 4 was consistently superior to all other isolates in terms of mortality of the beetle, protection of groundnut pods from damage, reduction in progeny production and repellency to the beetle. At 10 days post-treatment, adult mortality treated with 0.1, 0.5 and 1.0g of dry conidia equivalent to 3.6x10(8), 1.8x10(9) and 3.6x10(9) conidia of isolate CPD 4 per 50g of groundnut pods was 100% which did not differ significantly from pirimiphos-methyl-treated pods at 10ppm. At the lowest dosage of 0.1g of conidia per 50g of pods, damage in pods protected with isolate CPD 4 was 5% which did not differ significantly from the 2% damage in pods protected by pirimiphos-methyl at 10ppm but significantly differed from damage in untreated pods which was 26%. Isolate CPD 4 caused complete reduction in progeny emergence at all dosages tested. It also exhibited some degree of repellency to the beetle with percentage repellency values of between 40-79% at concentrations of 0.1-1.0g of conidia per 50g of groundnut pods. These combined virulence and repellency characteristics of this isolate may increase its protectant potential against C. serratus.

  18. In vitro interaction of Metarhizium anisopliae Ma9236 and Beauveria bassiana Bb9205 with Heterorhabditis bacteriophora HNI0100 for the control of Plutella xylostella.

    PubMed

    Correa-Cuadros, J P; Sáenz-Aponte, A; Rodríguez-Bocanegra, M X

    2016-01-01

    The diamondback moth (Plutella xylostella) is a major pest of broccoli crops in Colombia. To control P. xylostella, we evaluated the interaction of Beauveria bassiana Bb9205 and Metarhizium anisopliae Ma9236 with Heterorhabditis bacteriophora HNI0100 and its bacterial symbiont Photorhabdus luminescens HNI0100. We used antagonism and disk diffusion assays with fungal extracts to test the interaction between symbiotic bacterium and fungi. P. luminescens inhibited the growth of B. bassiana and M. anisopliae up to 40% by the secretion of secondary metabolites, whereas fungal extracts did not inhibit P. luminescens; this explains the in vivo interactions of these biological control agents. To test the interaction between fungi and nematodes, we first inoculated the fungi followed by the nematodes on different days (0, 2, 4, and 6). We identified the type of interaction using the formula by Nishimatsu and Jackson (J Econ Entomol 91:410-418, 1998) and established that on days 0, 2 and 4 there was an antagonistic interaction, while a synergistic interaction occurred on day 6. Therefore, the use of the interaction between H. bacteriophora HNI0100 with M. anisopliae Ma9236 and B. bassiana Bb9205 is an innovative alternative for the control of P. xylostella.

  19. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius.

  20. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. This is an open access paper. We use the Creative Commons Attribution 3.0 license that permits unrestricted use, provided that the paper is properly attributed.

  1. Effect of Metarhizium anisopliae on the Fertility and Fecundity of Two Species of Fruit Flies and Horizontal Transmission of Mycotic Infection

    PubMed Central

    Sookar, P.; Bhagwant, S.; Allymamod, M.N.

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. PMID:25201230

  2. Secretome of the Biocontrol Agent Metarhizium anisopliae Induced by the Cuticle of the Cotton Pest Dysdercus peruvianus Reveals New Insights into Infection

    PubMed Central

    2015-01-01

    Metarhizium anisopliae is an entomopathogenic fungus that has evolved specialized strategies to infect insect hosts. Here we analyzed secreted proteins related to Dysdercus peruvianus infection. Using shotgun proteomics, abundance changes in 71 proteins were identified after exposure to host cuticle. Among these proteins were classical fungal effectors secreted by pathogens to degrade physical barriers and alter host physiology. These include lipolytic enzymes, Pr1A, B, C, I, and J proteases, ROS-related proteins, oxidorreductases, and signaling proteins. Protein interaction networks were generated postulating interesting candidates for further studies, including Pr1C, based on possible functional interactions. On the basis of these results, we propose that M. anisopliae is degrading host components and actively secreting proteins to manage the physiology of the host. Interestingly, the secretion of these factors occurs in the absence of a host response. The findings presented here are an important step in understanding the host–pathogen interaction and developing more efficient biocontrol of D. peruvianus by M. anisopliae. PMID:24702058

  3. Histopathology Caused by the Entomopathogenic Fungi, Beauveria bassiana and Metarhizium anisopliae, in the Adult Planthopper, Peregrinus maidis, a Maize Virus Vector

    PubMed Central

    Toledo, A.V.; de Remes Lenicov, A.M.M.; López Lastra, C.C.

    2010-01-01

    The planthopper Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae) is an important vector of maize viruses in tropical and subtropical areas. Planthoppers are biologically controlled with several species of entomopathogenic fungi that have been isolated from these insect pests of rice in Asia. Beauveria bassiana (Balsamo-Crivelli) Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae) appear to be the most useful against planthoppers because of their ease of mass production, storage, virulence, and application. In the present study, adults of P. maidis infected with B. bassiana and M. anisopliae were observed under light and scanning electron microscopy to characterize morphologically the process of infection and the development of these fungi, prior to and after the death of the host. The hydrophobic conidia of both fungal species were able to attach to all body regions, with a preference for surfaces containing hairs. Few germinated conidia were observed on the insect's body surface at 24, 48, and 72 hr post-inoculation. On the cuticular surface of P. maidis treated with B. bassiana and M. anisopliae, bacillus-like bacteria were observed. These microorganisms could be interacting with fungal conidia, playing a role of antibiosis that will not allow the fungal pathogens to germinate and penetrate. In the colonization events observed in this study, the formation and multiplication of hyphal bodies by both fungal species inside the host's body was noted. The host's whole body was invaded by hyphae between five and six days post-inoculation, and body fat was the most affected tissue. PMID:20578956

  4. Metarhizium anisopliae (Ascomycota: Hypocreales): an effective alternative to chemical acaricides against different developmental stages of fowl tick Argas persicus (Acari: Argasidae).

    PubMed

    Pourseyed, S H; Tavassoli, M; Bernousi, I; Mardani, K

    2010-09-20

    The fowl bloodsucking tick Argas persicus is of great medical and veterinary importance in tropical and subtropical regions because of its role as vector of certain parasitic, bacterial and viral pathogens. A variety of acaricides are used for the control of tick infestation in poultry, resulting in environmental contamination and the development of resistance. In order to develop an alternative control method, the efficacy of three strains (V245, 685 and 715C) of entomopathogenic fungus Metarhizium anisopliae against different life stages of A. persicus including eggs, larvae, unfed and engorged adult females was evaluated under laboratory conditions. Five concentrations of different strains of M. anisopliae ranging from 10(3) to 10(7)conidia/ml were utilized. The effects of fungal strains on egg hatchability and larva and adult female mortality were significant and dose-dependent compared to the control groups (P<0.05). The mortality rates of larvae ranged from 92% to 100% for two different concentrations (10(3) and 10(4)conidia/ml) of M. anisopliae strains. Treated engorged females were more susceptible than the unfed females reaching mortality rate of 100% at the highest concentration (10(7)conidia/ml) at 18 days post-inoculation. Among strains used in this study, V245 was the most virulent strain regarding the LC(50) values for adult females exposed to fungal conidia. The results demonstrate that the application of M. anisopliae as a biocontrol agent is a promising option in reducing the use of chemical acaricides, resulting in benefits to poultry and the environment.

  5. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  6. Interactions between isolates of the entomopathogenic fungus Metarhizium anisopliae and the entomopathogenic nematode Heterorhabditis bacteriophora JPM4 during infection of the sugar cane borer Diatraea saccharalis (Lepidoptera: Pyralidae).

    PubMed

    Acevedo, Juan Pablo Molina; Samuels, Richard Ian; Machado, Inês Ribeiro; Dolinski, Claudia

    2007-10-01

    Interactions between the nematode Heterorhabditis bacteriophora isolate JPM4 and the fungus Metarhizium anisopliae, isolates LPP45 and LPP39, were studied during dual infections of Diatraea saccharalis. Mortality, production of infective juveniles (IJs) and production of conidia were evaluated. A positive effect was demonstrated for host mortality in duel infections of JPM4 and LPP39, causing 100% mortality with LT(50) and LT(95) values of 1.8 and 2.8 days, respectively. Higher values were seen when using the nematode or fungi individually. However, a combination of JPM4+LPP39 caused a significant reduction in IJ production. The results show that faster time to death, a moderately virulent fungal isolate could be combined with the nematode, however at the expense of IJ production.

  7. Construction and preliminary analysis of a normalized cDNA library from Locusta migratoria manilensis topically infected with Metarhizium anisopliae var. acridum.

    PubMed

    Wang, Jie; Xia, Yuxian

    2010-08-01

    The insect immune response to fungal infection is poorly understood at the molecular level. To explore the molecular basis of this process, a novel method to analyze the gene transcripts of insects in response to pathogenic fungus was established. A normalized cDNA library based on the SMART method combined with DSN (duplex-specific nuclease) treatment was constructed using mRNA extracted from the fat body and hemocytes of Locusta migratoria manilensis 6-24h after being topically infected with Metarhizium anisopliae var. acridum. Analysis of 259 unigenes out of 303 sequenced inserts from the cDNA library revealed that the cDNA library was not contaminated with M. anisopliae transcripts and validated the presence of the immune-related genes characterized here. These results suggest that this method overcame the difficulties of contamination from a fungal source in constructing the host cDNA library from mycosed insects and proved that this method is reliable and feasible for investigation of host genes in response to fungal infection. Further studies of the expressed sequence tags from this library will provide insights into the molecular basis of insect immune response to fungal infection.

  8. Field trials using the fungal pathogen, Metarhizium anisopliae (Deuteromycetes: Hyphomycetes) to control the ectoparasitic mite, Varroa destructor (Acari: Varroidae) in honey bee, Apis mellifera (Hymenoptera: Apidae) colonies.

    PubMed

    Kanga, Lambert Houssou Ble; Jones, Walker A; James, Rosalind R

    2003-08-01

    The potential for Metarhizium anisopliae (Metschinkoff) to control the parasitic mite, Varroa destructor (Anderson and Trueman) in honey bee colonies was evaluated in field trials against the miticide, tau-fluvalinate (Apistan). Peak mortality of V. destructor occurred 3-4 d after the conidia were applied; however, the mites were still infected 42 d posttreatments. Two application methods were tested: dusts and strips coated with the fungal conidia, and both methods resulted in successful control of mite populations. The fungal treatments were as effective as the Apistan, at the end of the 42-d period of the experiment. The data suggested that optimum mite control could be achieved when no brood is being produced, or when brood production is low, such as in the early spring or late fall. M. anisopliae was harmless to the honey bees (adult bees, or brood) and colony development was not affected. Mite mortality was highly correlated with mycosis in dead mites collected from sticky traps, indicating that the fungus was infecting and killing the mites. Because workers and drones drift between hives, the adult bees were able to spread the fungus between honey bee colonies in the apiary, a situation that could be beneficial to beekeepers.

  9. Nucleotide excision repair and photoreactivation in the entomopathogenic fungi Beauveria bassiana, Beauveria brongniartii, Beauveria nivea, Metarhizium anisopliae, Paecilomyces farinosus and Verticillium lecanii.

    PubMed

    Chelico, L; Haughian, J L; Khachatourians, G G

    2006-05-01

    To compare the DNA repair capabilities of the entomopathogenic fungus (EPF) bassiana to the EPF Beauveria brongniartii, Beauveria nivea, Metarhizium anisopliae, Paecilomyces farinosus, Verticillium lecanii, and the fungi Aspergillus niger and Neurospora crassa. Germination of B. bassiana conidiospores following ultraviolet (UV) irradiation was used to show that nucleotide excision repair and photoreactivation decrease the post-UV germination delay. These two modes of repair were characterized and compared between the aforementioned EPF, A. niger and N. crassa using a physiological assay where per cent survival post-UV irradiation was scored as colony forming units. The results showed B. bassiana and M. anisopliae are the most UV-tolerant EPF. The DNA repair capabilities indicated that EPF do not have all DNA repair options available to fungi, such as A. niger and N. crassa. A key factor detrimental to the survival of EPF in agro-ecosystems is UV light from solar radiation. The EPF literature pertaining to UV irradiation is varied with respect to methodology, UV source, and dose, which prevented comparisons. Here we have characterized the fungi by a standard method and established the repair capabilities of EPF under optimal conditions.

  10. Increased pathogenicity against coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae) by Metarhizium anisopliae expressing the scorpion toxin (AaIT) gene.

    PubMed

    Pava-Ripoll, Monica; Posada, Francisco J; Momen, Bahram; Wang, Chengshu; St Leger, Raymond

    2008-10-01

    Coffee berry borer (CBB) is the Worlds most devastating coffee pest causing an estimated US$500 million worth of losses annually through damage and control costs. Beauveria bassiana and Metarhizium anisopliae have been employed to control this pest but their low virulence (slow kill and large inoculums) is an important factor constraining their use. M. anisopliae (AaIT-Ma549) has been modified to express the scorpion toxin (AaIT) in insect hemolymph and this greatly increased pathogenicity against Manduca sexta and Aedes aegypti. Here, we demonstrate that AaIT-Ma549 was also dramatically more virulent against CBB, and we provide a much more comprehensive analysis of infection processes and post-mortality development than in the previous research. We evaluated several spore concentrations (10(1) through 10(7)spores/ml) of both the wild type and recombinant strain. At concentrations of 10(1), 10(2) and 10(3)spores/ml, the recombinant strain significantly increased mortality of CBB by 32.2%, 56.6% and 24.6%, respectively. The medial lethal concentration (LC(50)) was reduced 15.7-fold and the average survival time (AST) was reduced by 20.1% to 2.98+/-0.1 days with 10(7)spores/ml. This is the first occasion that an entomopathogenic fungus has been found to kill CBB in less than 3 days. However, AaIT-Ma549 produces significantly fewer spores on cadavers than the parental strain.

  11. Acaricidal activity of Metarhizium anisopliae isolated from paddocks in the Mexican tropics against two populations of the cattle tick Rhipicephalus microplus.

    PubMed

    Fernández-Salas, A; Alonso-Díaz, M A; Alonso-Morales, R A; Lezama-Gutiérrez, R; Rodríguez-Rodríguez, J C; Cervantes-Chávez, J A

    2017-03-01

    The acaricidal effects of 55 strains of Metarhizium anisopliae (Metschnikoff) Sorokin, 1883 (Hypocreales: Clavicipitaceae) isolated from paddocks of cattle farms were evaluated in two Rhipicephalus microplus (Canestrini 1887) (Ixodida: Ixodidae) populations, of which one was multi-resistant and one was susceptible to chemical acaricides. Percentage mortality and reproductive efficiency indices in R. microplus were evaluated by adult immersion tests at a dose of 1 × 10(8) conidia/mL for each fungal strain. Some strains were selected to calculate lethal concentrations to kill 50% (LC50 ) and 99% (LC99 ) of engorged ticks. Strains MaV22, MaV26 and MaV55 induced 100% mortality in R. microplus on day 14. Strains MaV05, MaV09 and MaV22 caused mortality of >90% from day 12 onward in both tick populations. The most effective acaricidal fungal strain, MaV55, inhibited egg laying by 54.86 and 55.86% in acaricide-resistant and -susceptible R. microplus populations, respectively. None of the fungal strains had statistically significant effects on larval hatching. In conclusion, nine strains of M. anisopliae demonstrated high acaricidal effects against R. microplus and reduced its egg laying. No differences in acaricidal effects were observed between the two populations of ticks tested. © 2016 The Royal Entomological Society.

  12. African water storage pots for the delivery of the entomopathogenic fungus Metarhizium anisopliae to the malaria vectors Anopheles gambiae s.s. and Anopheles funestus.

    PubMed

    Farenhorst, Marit; Farina, Daniela; Scholte, Ernst-Jan; Takken, Willem; Hunt, Richard H; Coetzee, Maureen; Knols, Bart G J

    2008-06-01

    We studied the use of African water storage pots for point source application of Metarhizium anisopliae against the malaria vectors Anopheles gambiae s.s. and An. funestus. Clay pots were shown to be attractive resting sites for male and female An. gambiae s.s. and were not repellent after impregnation with fungus. M. anisopliae was highly infective and virulent after spray application inside pots. At a dosage of 4 x 10(10) conidia/m(2), an average of 95 +/- 1.2% of An. gambiae s.s. obtained a fungal infection. A lower dosage of 1 x 10(10) conidia/m(2) infected an average of 91.5 +/- 0.6% of An. gambiae s.s. and 91.8 +/- 1.2% of An. funestus mosquitoes. Fungal infection significantly reduced mosquito longevity, as shown by differences between survival curves and LT(50) values. These pots are suitable for application of entomopathogenic fungi against malaria vectors and their potential for sustainable field implementation is discussed.

  13. Identification of genes differentially expressed in vivo by Metarhizium anisopliae in the hemolymph of Locusta migratoria using suppression-subtractive hybridization.

    PubMed

    Zhang, Chuanbo; Xia, Yuxian

    2009-08-01

    Metarhizium anisopliae is an important insect pathogenic fungus widely used in biological pest control. The aim of this study was to identify genes differentially expressed in vivo by M. anisopliae CQMa102 in the hemolymph of infected Locusta migratoria. Suppression-subtractive hybridization was performed using cDNA generated from hyphal bodies purified from hemolymph and the fungus germinating and differentiating on locust wings. A total of 350/1,600 random clones screened by cDNA array dot blotting were sequenced, resulting in 120 uniquely expressed sequence tags (ESTs) that were up-regulated during colonization of hemolymph. Among these 120 ESTs, 42 (35.0%) had matches in the NR protein database, and 29 (24.2%) were significantly similar to known proteins involved in various cellular processes, including general metabolism, cell wall remodeling, protein synthesis, signal transduction and stress responses. In contrast, the remaining 78 ESTs (65.0%) either had low similarity in the NR database or represented novel genes. Semi-quantitative RT-PCR analysis of five randomly selected genes revealed that all were highly expressed in the host hemolymph. These results provide new insight into the underlying molecular mechanisms of adaptation to host hemolymph and may increase understanding of host-pathogen interactions.

  14. Enhancement of microbial hydroxylation of 13-ethyl-gon-4-ene-3,17-dione by Metarhizium anisopliae using nano-liposome technique.

    PubMed

    Feng, Meiqing; Liao, Ziwei; Han, Lei; Li, Jiyang; Ye, Li

    2014-04-01

    The introduction of 11α-hydroxy to 13-ethyl-gon-4-ene-3,17-dione (GD) by microbial transformation is a key step in the synthesis of oral contraceptive desogestrel, while low substrate solubility and uptake into cells are tough problems influencing biotransformation efficiency greatly. Nano-liposome technique was used in the hydroxylation of GD by Metarhizium anisopliae. The substrate GD was processed to be GD-loaded nano-liposomes (GNLs) with high stability and encapsulation efficiency, and then applied in microbial hydroxylation by M. anisopliae. The results proved that the yield of the main product 11α-hydroxy-13-ethyl-gon-4-ene-3,17-dione (HGD) tripled compared to regular solvent dimethylformamide dispersion method at 2 g/l of substrate feeding concentration, and the HGD conversion rate showed no obvious reduction when the substrate feeding concentration increased from 2 to 6 g/l, which indicated the improvement of GNL addition method on biotransformation. Furthermore, the main byproduct changed from 6β-hydroxy derivative of GD (with similar polarity to HGD) to 6β,11α-dihydroxy derivative, which benefits the following purification of HGD from fermentation broth. These advantages suggest a great potential for the application of nano-liposome technique in microbial steroid transformation.

  15. Influence of Temperature and Relative Humidity on the Insecticidal Efficacy of Metarhizium anisopliae against Larvae of Ephestia kuehniella (Lepidoptera: Pyralidae) on Wheat

    PubMed Central

    Kavallieratos, Nickolas G.; Rumbos, Christos I.; Kontodimas, Demetrius C.

    2017-01-01

    A series of laboratory bioassays were conducted for the evaluation of the insecticidal efficacy of an isolate of Metarhizium anisopliae (Metschnikoff) Sorokin (Ascomycota: Hypocreales) against larvae of the Mediterranean flour moth, Ephestia kuehniella Zeller (Lepidoptera: Pyralidae), under various temperature–relative humidity (r.h.) conditions. The fungus was applied at four doses (0, 8 × 106, 8 × 108, and 8 × 1010 conidia ml−1) on wheat and insect mortality was assessed after exposure of 1, 2, 7, and 14 d. Bioassays were conducted at three temperatures (20, 25, and 30 °C) and two r.h. levels (55 and 75%). Although complete control was not achieved in any case, the fungus provided a considerable level of insect control. Mortality of E. kuehniella larvae on wheat treated with M. anisopliae ranged between 41.1 and 93.3% after 14 d of exposure, whereas the respective mortality levels in control dishes never exceeded 28.3%. The increase of temperature resulted in most cases to higher efficacy, indicating that temperature is an important factor for the performance of the fungus. In contrast, in most cases r.h. did not significantly affect the efficacy of the fungus, at least for the humidity levels tested.

  16. Efficacy of the entomopathogenic fungi Metarhizium anisopliae in the control of infestation by stable flies Stomoxys calcitrans (L.), under natural infestation conditions.

    PubMed

    Cruz-Vazquez, C; Carvajal Márquez, J; Lezama-Gutiérrez, R; Vitela-Mendoza, I; Ramos-Parra, M

    2015-09-15

    The objective of this study was to evaluate the efficacy of an isolate of Metarhizium anisopliae applied by aspersion to control of Stomoxys calcitrans flies in dairy cattle naturally infested. Was applied by aspersion an aqueous formulation of M. anisopliae sensu lato (Ma134), at a concentration of 1×10(8)conidia/ml, four times with seven day intervals, on a group of eight Holstein cows; a control group of eight Holstein cows, received a water solution with Tween 80 (0.1%). The average number of flies per animal was estimated one day before each application, and then daily counts were done in both groups. The effectiveness of the formulation was calculated using the Abbott's formula. At the same time, defensive behaviors of stamp/kicks and tail movements were evaluated daily, estimating relative frequency per hour. The Ma134 formulation had an infestation control efficacy of 73%, taking into consideration the four study weeks. The population reduction effect was observed since the first week post-application (p<0.05), and the effect increased with the subsequent applications. Defensive behaviors were reduced beginning from the first application, reaching a reduction of 66% and 70%, respectively, during the four weeks of study. These results demonstrated the effectiveness of the formulation to control infestation by S. calcitrans, as well as reduce defensive behaviors which involves the infestation.

  17. Production of microsclerotia by Brazilian strains of Metarhizium spp. using submerged liquid culture fermentation.

    PubMed

    Mascarin, Gabriel Moura; Kobori, Nilce Naomi; de Jesus Vital, Rayan Carlos; Jackson, Mark Alan; Quintela, Eliane Dias

    2014-05-01

    We investigated the potential production and desiccation tolerance of microsclerotia (MS) by Brazilian strains of Metarhizium anisopliae (Ma), M. acridum (Mc) and M. robertsii (Mr). These fungi were grown in a liquid medium containing 16 g carbon l⁻¹ with a carbon:nitrogen ratio of 50:1. One hundred milliliters cultures were grown in 250 ml Erlenmeyer flasks in a rotary incubator shaker at 28 °C and 200 rpm for 5 days. Five-day-old MS were harvested, mixed with diatomaceous earth (DE) and air-dried for 2 days at 30 °C. The air-dried MS-DE granular preparations were milled by mortar + pestle and stored in centrifuged tubes at either 26 or -20 °C. Desiccation tolerance and conidia production were assessed for dried MS granules by measuring hyphal germination after incubation for 2 days on water agar plates at 26 °C and for conidia production following 7 days incubation. Yields of MS by all strains of Metarhizium were 6.1-7.3 × 10⁶ l⁻¹ after 3 days growth with maximum MS yields (0.7-1.1 × 10⁷ l⁻¹) after 5 days growth. No differences in biomass accumulation were observed after 3 days growth, whereas Ma-CG168 showed the highest biomass accumulation after 5 days growth. Dried MS-DE preparations of all fungal strains were equally tolerant to desiccation (≥93 % germination) and the highest conidia production was obtained by MS granules of Mc-CG423 (4 × 10⁹ conidia g⁻¹). All MS granules showed similar stability after storage at either 26 or -20 °C for 3.5 months.

  18. Evaluation of Conidia-Dust Formulation of the Entomopathogenic Fungus, Metarhizium anisopliae to Biocontrol the Brown-Banded Cockroach, Supella longipalpa F.

    PubMed Central

    Sharififard, Mona; Mossadegh, Mohammad Saeed; Vazirianzadeh, Babak; Latifi, Seyed Mahmood

    2014-01-01

    Background: The brown-banded cockroach Supella longipalpa (F.) as a mechanical vector of pathogens and source of allergens has recently become widespread in the city of Ahvaz, southwestern Iran. Objectives: This research was done to evaluate the efficacy of a dust-formulation of Metarhizium anisopliae isolate IRAN 437C, as a common entomopathogenous fungus, against S. longipalpa. Materials and Methods: Conidia dust-formulations of M. anisopliae were prepared in proportions of 1%, 5%, 10%, 25%, 50% and 100% with bad wheat flour as the carrier. Cockroaches were exposed to surfaces treated with 1.5 mg/cm2 of the formulations under laboratory and semi-field conditions. Results: Cockroach mortality rates increased and survival times (ST50) decreased with an increased proportion of conidia from 1% to 100% but records taken for mortality and survival time from proportions of 25%, 50% and 100% were not significantly different. The mortality rates reached 100% and 90-100% in adults and nymphs, respectively on the seventh day. The lowest ST50 was related to the proportion of 100% (3 days). Probit analysis indicated LD50 and LD90 values of 1.7 × 106 and 1.7 × 107 conidia/cm2 for adults and these values changed to 4.5 × 106 and 2.9 × 107 for third and fourth instar nymphs at three days post exposure. Proportion of 25% caused mortality rates of 87%, 81% and 73% in adult, adult & nymph and nymph populations, respectively at four days after exposure under room conditions. Conclusions: Conidia dust-formulation of M. anospliae isolate IRAN 437C could present a promising alternative to control the brown-banded cockroach. PMID:25371804

  19. The combination of the entomopathogenic fungus Metarhizium anisopliae with the insecticide Imidacloprid increases virulence against the dengue vector Aedes aegypti (Diptera: Culicidae).

    PubMed

    Paula, Adriano R; Carolino, Aline T; Paula, Cátia O; Samuels, Richard I

    2011-01-25

    Dengue fever transmitted by the mosquito Aedes aegypti, is one of the most rapidly spreading insect borne diseases, stimulating the search for alternatives to current control measures. The dengue vector A. aegypti has received less attention than anophelene species, although more than 2.5 billion people are at risk of infection worldwide. Entomopathogenic fungi are emerging as potential candidates for the control of mosquitoes. Here we continue our studies on the pathogenicity of the entomopathogenic fungus Metarhizium anisopliae against adult A. aegypti females. With the aim of further reducing mean survival times of A. aegypti exposed to fungus impregnated surfaces, a sub-lethal concentration of the neonicotinoid insecticide Imidacloprid (IMI) was added to fungal suspensions. A sub-lethal concentration of IMI that did not significantly alter the daily survival rates or mean survival percentages of mosquitoes was identified to be 0.1 ppm. This sub-lethal concentration was combined with M. anisopliae conidia (1 × 10(9) conidia mL(-1)). Both the combined treatment and the conidia alone were able to reduce the survival of A. aegypti compared with untreated or IMI treated mosquitoes. Importantly, mosquito survival following exposure to the combined treatment for 6 and 12 hrs was significantly reduced when compared with mosquitoes exposed to conidia alone. This is the first time that a combination of an insecticide and an entomopathogenic fungus has been tested against A. aegypti. Firstly, the study showed the potential of IMI as an alternative to the currently employed pyrethroid adulticides. Secondly, as an alternative to applications of high concentrations of chemical insecticides, we suggest that adult A. aegypti could be controlled by surface application of entomopathogenic fungi and that the efficiency of these fungi could be increased by combining the fungi with ultra-low concentrations of insecticides, resulting in higher mortality following relatively short

  20. Efficacy of Metarhizium anisopliae in controlling the two-spotted spider mite Tetranychus urticae on common bean in screenhouse and field experiments.

    PubMed

    Bugeme, David Mugisho; Knapp, Markus; Ekesi, Sunday; Chabi-Olaye, Adenirin; Boga, Hamadi Iddi; Maniania, Nguya Kalemba

    2015-02-01

    The efficacy of aqueous and emulsifiable formulations of the fungus Metarhizium anisopliae isolate ICIPE78 was evaluated on the population density of Tetranychus urticae infesting common bean plants under screenhouse and field conditions. Synthetic acaricide abamectin was included as a check. Bean plants were artificially infested with T. urticae and allowed to multiply. Three treatments were applied in the screenhouse and 1 treatment in field trials. Mite density was recorded 2 d before spraying and weekly postspraying. The number of pods per plant, number of seeds per pod, and the dry weight of seeds per plant were recorded only in the screenhouse trials. In both screenhouse and field trials, fungal formulations applied at the concentration of 10(8) conidia/mL and the acaricide reduced the population density of mites as compared to the controls. There were significant differences in T. urticae population densities between the treatments at the various post-spraying sampling dates. In the screenhouse, the mite densities were near zero from 3-week postspraying in the treated leaves. At 4-week postspraying, there were no more leaves in the untreated control (T1) and in the control water + Silwet-L77 (T2). Fungal formulations were as effective as abamectin in reducing mite densities in both screenhouse and field experiments. There were significant differences in the production parameters during the 2 screenhouse trials, with fungal and abamectin treatments generally having the highest yield. Results of this study underline the potential of the M. anisopliae isolate ICIPE78 as an alternative to acaricides for T. urticae management. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  1. Metachelins, mannosylated and N-oxidized coprogen-type siderophores from Metarhizium robertsii

    USDA-ARS?s Scientific Manuscript database

    Under iron-depleted culture conditions, the entomopathogenic fungus Metarhizium robertsii (Bischoff, Humber, and Rehner) (= M. anisopliae) produces a complex of extracellular siderophores including novel O-glycosylated and/or N-oxidized coprogen-type compounds as well as the known fungal siderophore...

  2. Genome-assisted development of nuclear intergenic sequence markers for entomopathogenic fungi of the Metarhizium anisopliae species complex

    USDA-ARS?s Scientific Manuscript database

    Entomopathogenic fungi in the genus Metarhizium have proven useful for the biological control of economically important pests across the globe. Understanding the true diversity of this group is hampered by convergent morphologies between species. The application of molecular techniques has enabled...

  3. Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae).

    PubMed

    Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I

    2014-04-25

    Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the

  4. Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae)

    PubMed Central

    2014-01-01

    Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of

  5. BmSI-7, a novel subtilisin inhibitor from Boophilus microplus, with activity toward Pr1 proteases from the fungus Metarhizium anisopliae.

    PubMed

    Sasaki, Sergio D; de Lima, Cássia A; Lovato, Diogo V; Juliano, Maria A; Torquato, Ricardo J S; Tanaka, Aparecida S

    2008-02-01

    BmSI-7 and BmSI-6, two Boophilus microplus subtilisin inhibitors (BmSI) were purified and characterized from eggs. The inhibitors isolated by classical purification methods presented molecular masses of 7408 and 7271Da, respectively, by MALDI-TOF-MS. Both BmSI-7 and BmSI-6 inhibited neutrophil elastase (K(i) 0.4 and 0.3nM) and subtilisin A (K(i) 1.4nM for both inhibitors). They also strongly inhibited Pr1 proteases from the fungus Metarhizium anisopliae; BmSI-7 (K(i) 50nM) and BmSI-6 (K(i) 2.2nM). The BmSI-7 full length cDNA was obtained using amino acid sequence information of BmSI-7 peptides generated by proteolytic digestion. BmSI-7 belongs to trypsin inhibitor like cysteine rich domain family (TIL), and it is transcribed in ovary, fat body, gut, salivary gland and haemocytes. BmSI-7 is the first TIL inhibitor described with inhibitory activity toward subtilisin A and Pr1 proteases of entomopathogenic fungi.

  6. Carbon regulation of the cuticle-degrading enzyme PR1 from Metarhizium anisopliae may involve a trans-acting DNA-binding protein CRR1, a functional equivalent of the Aspergillus nidulans CREA protein.

    PubMed

    Screen, S; Bailey, A; Charnley, K; Cooper, R; Clarkson, J

    1997-06-01

    The pr1 gene of the entomopathogenic fungus Metarhizium anisopliae encodes a serine protease that is highly active towards the insect cuticle and whose synthesis is subject to both carbon and nitrogen repression. The pr1 promoter region was sequenced revealing the presence of putative CREA- and AREA-binding sites. In vitro bandshift experiments demonstrated that an Aspergillus nidulans GST-CREA fusion protein was capable of binding to two of the three putative CREA sites. Using a PCR-based strategy the M. anisopliae crr1 gene was identified; it encodes a putative C2H2-type DNA-binding protein with significant sequence similarity to A. nidulans CREA. Complementation experiments with an A. nidulans strain carrying creA204 demonstrated that CRR1 can partially substitute for CREA function.

  7. Effect of Metarhizium anisopliae (Ascomycete), Cypermethrin, and D-Limonene, Alone and Combined, on Larval Mortality of Rhipicephalus sanguineus (Acari: Ixodidae).

    PubMed

    Prado-Rebolledo, Omar Francisco; Molina-Ochoa, Jaime; Lezama-Gutiérrez, Roberto; García-Márquez, Luis Jorge; Minchaca-Llerenas, Yureida B; Morales-Barrera, Eduardo; Tellez, Guillermo; Hargis, Billy; Skoda, Steven R; Foster, John E

    2017-09-01

    The effect of the fungus Metarhizium anisopliae Ma14 strain, D-limonene, and cypermethrin, alone and combined, on the mortality of Rhipicephalus sanguineus Latreille larvae was evaluated. Eight separate groups with 25 tick larvae were inoculated with the fungus, cypermethrin, and D-limonene, and four groups were used as untreated controls. The groups were inoculated with serial dilutions of each treatment material: for example, conidial concentrations were 1 × 101, 1 × 102, 1 × 103, 1 × 104, 1 × 105, 1 × 106, 1 × 107, and 1 × 108. A complete randomized experimental design was used. Significant differences were obtained between fungal concentrations, with larval mortalities ranging from 29 to 100%; the D-limonene concentrations showed significant differences, with mortalities that ranged from 47.9 to 82.6%, and cypermethrin mortalities ranged from 69.9 to 89.9% when each was applied alone. In the combined application, the serial dilution of the Ma14 fungus plus cypermethrin at 0.1% concentration caused mortalities ranging from 92.9 to 100%; the mix of serially diluted Ma14 plus D-limonene at 0.1% caused mortalities from 10.3 to 100%; and the mix consisting of serially diluted D-limonene plus cypermethrin at 0.1% caused mortalities from 7.4 to 35.9%. Further laboratory and field research could show that these materials, alone and in combinations, are useful in future tick management and control programs. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Development of a user-friendly delivery method for the fungus Metarhizium anisopliae to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies.

    PubMed

    Kanga, Lambert H B; Adamczyk, John; Patt, Joseph; Gracia, Carlos; Cascino, John

    2010-12-01

    A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducted in 2006 in Texas using freshly harvested spores indicated that patty blend formulations of 10 g of conidia per hive (applied twice) significantly reduced the numbers of mites per adult bee, mites in sealed brood cells, and residual mites at the end of the 47-day experimental period. Colony development in terms of adult bee populations and brood production also improved. Field trials conducted in 2007 in Florida using less virulent spores produced mixed results. Patty blends of 10 g of conidia per hive (applied twice) were less successful in significantly reducing the number of mites per adult bee. However, hive survivorship and colony strength were improved, and the numbers of residual mites were significantly reduced at the end of the 42-day experimental period. The overall results from 2003 to 2008 field trials indicated that it was critical to have fungal spores with good germination, pathogenicity and virulence. We determined that fungal spores (1 × 10(10) viable spores per gram) with 98% germination and high pathogenicity (95% mite mortality at day 7) provided successful control of mite populations in established honey bee colonies at 10 g of conidia per hive (applied twice). Overall, microbial control of Varroa mite with M. anisopliae is feasible and could be a useful component of an integrated pest management program.

  9. Pathogenicity of entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) isolates to the adult pea leafminer (Diptera: Agromyzidae) and prospects of an autoinoculation device for infection in the field.

    PubMed

    Migiro, L N; Maniania, N K; Chabi-Olaye, A; Vandenberg, J

    2010-04-01

    Seventeen isolates of Metarhizium anisopliae (Metschnikoff) Sorokin and three isolates of Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) were evaluated for their pathogenicity to the adult pea leafminer, Liriomyza huidobrensis (Blanchard) (Diptera: Agromyzidae), in the laboratory. Flies were contaminated with dry conidia through a velvet material wrapped around the inner side of a cylindrical plastic tube. All the isolates were pathogenic to the pea leafminer, causing mortality between 40 and 100% at 5 d after exposure. The lethal time for 50% mortality (LT(50)) ranged from 2.6 to 5.4 d, whereas the LT(90) values varied between 3.2 and 9.1 d depending on the isolate. An autoinoculation device was evaluated in cage field experiments using only one of the virulent isolates, M. anisopliae ICIPE 20. The device was loaded with 2-3 g of dry conidia. Mortality of up to 100% was observed in flies captured from fungus-treated cages held under laboratory conditions. The average number of spores picked up by a single fly visiting the device increased with days after inoculation. One day after the inoculation, adults picked up an average of 4.1 +/- 0.7 x 10(5) conidia and 39.6 +/- 4.0 x 10(5) conidia 5 d after inoculation. Depending on the sampling date, the LT(50) varied between 1.8 and 3.4 d. Results indicate that some isolates of B. bassiana and M. anisopliae are highly pathogenic to L. huidobrensis, suggesting a potential for their use in the control of this pest. They also suggest the possibility of L. huidobrensis suppression with fungi using an autoinoculation device.

  10. UV-B radiation reduces in vitro germination of Metarhizium anisopliae s.l. but does not affect virulence in fungus-treated Aedes aegypti adults and development on dead mosquitoes.

    PubMed

    Falvo, M L; Pereira-Junior, R A; Rodrigues, J; López Lastra, C C; García, J J; Fernandes, É K K; Luz, C

    2016-12-01

    Control of diurnal Aedes aegypti with mycoinsecticides should consider the exposure of fungus-treated adults to sunlight, and especially to UV-B radiation that might affect activity of conidia applied on the mosquito's surface. Germination of Metarhizium anisopliae s.l. IP 46 conidia on SDAY medium was not affected at the lowest level of radiation with UV-B, 0·69 kJ m(-2) , but was retarded and reduced at higher 2·075 and 4·15 kJ m(-2) , and completely inhibited at ≥8·3 kJ m(-2) . In contrast, germination of conidia applied onto fibreglass nettings and exposed from 0 to 16·6 kJ m(-2) did not differ significantly among levels of irradiance exposure and the controls. There was also no significant impact of UV-B up to 16·6 kJ m(-2) on the adulticidal activity of IP 46 and on the subsequent conidiogenesis on cadavers. The Quaite-weighted UV-B irradiance in the laboratory (1152 mW m(-2) ) was higher than the natural sunlight irradiance observed in the city of Goiânia in Central Brazil on midday (706 mW m(-2) in August to 911 mW m(-2) in October 2015). UV-B does not impair the activity of IP 46 conidia applied previously to radiation on A. aegypti adults. Findings contribute to a better understanding of the effectiveness of M. anisopliae against day-active A. aegypti and its potential for biological mosquito control. © 2016 The Society for Applied Microbiology.

  11. Identification of a hybrid PKS-NRPS required for the biosynthesis of NG-391 and NG-393 metabolites in Metarhizium anisopliae

    USDA-ARS?s Scientific Manuscript database

    A 19,818 kb genomic region harboring six predicted ORFs was identified in M. anisopliae ARSEF 2575. The ORF4 CDS, putatively encoding a hybrid polyketide synthase/nonribosomal peptide synthetase (PKS-NRPS) was targeted using Agrobacterium-mediated gene knockout. Homologous, but not heterolog...

  12. Larvicidal and pupicidal properties of Acalypha alnifolia Klein ex willd.(Euphorbiaceae) leaf extract and the microbial insecticide Metarhizium anisopliae (Metsch.) against lymphatic filarial vector, Culex quinquefasciatus Sa

    USDA-ARS?s Scientific Manuscript database

    This study was made to determine the mosquitocidal properties of Acalypha alnifolia leaf extract combined with the use of Metarizhium anisopliae spores for control of the lymphatic filariasis vector Culex quinquefasciatus. The methanolic leaf extract showed larvicidal and pupicidal effects after 24...

  13. Larvicidal and pupicidal properties of Acalypha alnifolia Klein ex Willd. (Euphorbiaceae) leaf extract and the microbial insecticide Metarhizium anisopliae (Metsch.) against lymphatic filarial vector, Culex quinquefasciatus..

    USDA-ARS?s Scientific Manuscript database

    This study was made to determine the mosquitocidal properties of Acalypha alnifolia leaf extract combined with the use of Metarizhium anisopliae spores for control of the lymphatic filariasis vector Culex quinquefasciatus. The methanolic leaf extract showed larvicidal and pupicidal effects after 24...

  14. Biolarvicidal and pupicidal activity of Acalypha alnifolia Klein ex Willd.(Family:Euphorbiaceae) leaf extract and microbial insecticide, Metarhizium anisopliae(Metsch.)against malaria fever mosquito Anopheles stephensi Liston

    USDA-ARS?s Scientific Manuscript database

    This study was made to determine the biological activity of Acalypha alnifolia leaf extract and the microbial insecticide Metarizhium anisopliae against larvae and pupae of the malaria vector Anopheles stephensi. Ethanolic A. alnifolia leaf extract tested against 1st through 4th instars and pupae o...

  15. Characterization of Metarhizium species and varieties based on molecular analysis, heat tolerance and cold activity

    USGS Publications Warehouse

    Fernandes, E.K.K.; Keyser, C.A.; Chong, J.P.; Rangel, D.E.N.; Miller, M.P.; Roberts, D.W.

    2010-01-01

    Aims: The genetic relationships and conidial tolerances to high and low temperatures were determined for isolates of several Metarhizium species and varieties. Methods and Results: Molecular-based techniques [AFLP and rDNA (ITS1, ITS2 and 5??8S) gene sequencing] were used to characterize morphologically identified Metarhizium spp. isolates from a wide range of sources. Conidial suspensions of isolates were exposed to wet heat (45 ?? 0??2??C) and plated on potato dextrose agar plus yeast extract (PDAY) medium. After 8-h exposure, the isolates divided clearly into two groups: (i) all isolates of Metarhizium anisopliae var. anisopliae (Ma-an) and Metarhizium from the flavoviride complex (Mf) had virtually zero conidial relative germination (RG), (ii) Metarhizium anisopliae var. acridum (Ma-ac) isolates demonstrated high heat tolerance (c. 70-100% RG). Conidial suspensions also were plated on PDAY and incubated at 5??C for 15 days, during which time RGs for Ma-an and Ma-ac isolates were virtually zero, whereas the two Mf were highly cold active (100% RG). Conclusions: Heat and cold exposures can be used as rapid tools to tentatively identify some important Metarhizium species and varieties. Significance and Impact of the Study: Identification of Metarhizium spp. currently relies primarily on DNA-based methods; we suggest a simple temperature-based screen to quickly obtain tentative identification of isolates as to species or species complexes. ?? 2009 The Society for Applied Microbiology.

  16. Detection of potentially valuable polymorphisms in four group I intron insertion sites at the 3'-end of the LSU rDNA genes in biocontrol isolates of Metarhizium anisopliae

    PubMed Central

    Márquez, Marcela; Iturriaga, Enrique A; Quesada-Moraga, Enrique; Santiago-Álvarez, Cándido; Monte, Enrique; Hermosa, Rosa

    2006-01-01

    Background The entomopathogenic anamorphic fungus Metarhizum anisopliae is currently used as a biocontrol agent (BCA) of insects. In the present work, we analyzed the sequence data obtained from group I introns in the large subunit (LSU) of rDNA genes with a view to determining the genetic diversity present in an autochthonous collection of twenty-six M. anisopliae isolates selected as BCAs. Results DNA fragments corresponding to the 3'-end of the nuclear LSU rDNA genes of 26 M. anisopliae isolates were amplified by PCR. The amplicon sizes ranged from 0.8 to 3.4-kb. Four intron insertion sites, according to Escherichia coli J01695 numbering, were detected- Ec1921, Ec2066, Ec2449 and Ec2563- after sequencing and analysis of the PCR products. The presence/absence of introns allowed the 26 isolates to be distributed into seven genotypes. Nine of the isolates tested showed no introns, 4 had only one, 3 two, and 10 displayed three introns. The most frequent insertion sites were Ec1921 and Ec2449. Of the 26 isolates, 11 showed insertions at Ec2563 and a 1754-bp sequence was observed in ten of them. The most-parsimonious (MP) tree obtained from parsimony analysis of the introns revealed a main set containing four-groups that corresponded to the four insertion sites. Conclusion Four insertion sites of group I introns in the LSU rDNA genes allowed the establishment of seven genotypes among the twenty-six biocontrol isolates of M. anisopliae. Intron insertions at the Ec2563 site were observed for first time in this species. PMID:16978412

  17. Comparative impact of artificial selection for fungicide resistance on Beauveria bassiana and Metarhizium brunncum

    USDA-ARS?s Scientific Manuscript database

    Hypocreales fungi such as Beauveria bassiana and Metarhizium anisopliae can be negatively affected by fungicides thereby reducing their biocontrol potential. The overall goal of this study was to investigate the impact of artificial selection for fungicide resistance on two commercial entomopathoge...

  18. Metarhizium brunneum Blastospore Pathogenesis in Aedes aegypti Larvae: Attack on Several Fronts Accelerates Mortality.

    PubMed

    Alkhaibari, Abeer M; Carolino, Aline T; Yavasoglu, Sare I; Maffeis, Thierry; Mattoso, Thalles C; Bull, James C; Samuels, Richard I; Butt, Tariq M

    2016-07-01

    Aedes aegypti is the vector of a wide range of diseases (e.g. yellow fever, dengue, Chikungunya and Zika) which impact on over half the world's population. Entomopathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have been found to be highly efficacious in killing mosquito larvae but only now are the underlying mechanisms for pathogenesis being elucidated. Recently it was shown that conidia of M. anisopliae caused stress induced mortality in Ae. aegypti larvae, a different mode of pathogenicity to that normally seen in terrestrial hosts. Blastospores constitute a different form of inoculum produced by this fungus when cultured in liquid media and although blastospores are generally considered to be more virulent than conidia no evidence has been presented to explain why. In our study, using a range of biochemical, molecular and microscopy methods, the infection process of Metarhizium brunneum (formerly M. anisopliae) ARSEF 4556 blastospores was investigated. It appears that the blastospores, unlike conidia, readily adhere to and penetrate mosquito larval cuticle. The blastospores are readily ingested by the larvae but unlike the conidia are able infect the insect through the gut and rapidly invade the haemocoel. The fact that pathogenicity related genes were upregulated in blastospores exposed to larvae prior to invasion, suggests the fungus was detecting host derived cues. Similarly, immune and defence genes were upregulated in the host prior to infection suggesting mosquitoes were also able to detect pathogen-derived cues. The hydrophilic blastospores produce copious mucilage, which probably facilitates adhesion to the host but do not appear to depend on production of Pr1, a cuticle degrading subtilisin protease, for penetration since protease inhibitors did not significantly alter blastospore virulence. The fact the blastospores have multiple routes of entry (cuticle and gut) may explain why this form of the inoculum killed Ae. aegypti larvae

  19. Metarhizium brunneum Blastospore Pathogenesis in Aedes aegypti Larvae: Attack on Several Fronts Accelerates Mortality

    PubMed Central

    Alkhaibari, Abeer M.; Carolino, Aline T.; Yavasoglu, Sare I.; Maffeis, Thierry; Mattoso, Thalles C.; Bull, James C.; Samuels, Richard I.; Butt, Tariq M.

    2016-01-01

    Aedes aegypti is the vector of a wide range of diseases (e.g. yellow fever, dengue, Chikungunya and Zika) which impact on over half the world’s population. Entomopathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have been found to be highly efficacious in killing mosquito larvae but only now are the underlying mechanisms for pathogenesis being elucidated. Recently it was shown that conidia of M. anisopliae caused stress induced mortality in Ae. aegypti larvae, a different mode of pathogenicity to that normally seen in terrestrial hosts. Blastospores constitute a different form of inoculum produced by this fungus when cultured in liquid media and although blastospores are generally considered to be more virulent than conidia no evidence has been presented to explain why. In our study, using a range of biochemical, molecular and microscopy methods, the infection process of Metarhizium brunneum (formerly M. anisopliae) ARSEF 4556 blastospores was investigated. It appears that the blastospores, unlike conidia, readily adhere to and penetrate mosquito larval cuticle. The blastospores are readily ingested by the larvae but unlike the conidia are able infect the insect through the gut and rapidly invade the haemocoel. The fact that pathogenicity related genes were upregulated in blastospores exposed to larvae prior to invasion, suggests the fungus was detecting host derived cues. Similarly, immune and defence genes were upregulated in the host prior to infection suggesting mosquitoes were also able to detect pathogen-derived cues. The hydrophilic blastospores produce copious mucilage, which probably facilitates adhesion to the host but do not appear to depend on production of Pr1, a cuticle degrading subtilisin protease, for penetration since protease inhibitors did not significantly alter blastospore virulence. The fact the blastospores have multiple routes of entry (cuticle and gut) may explain why this form of the inoculum killed Ae. aegypti

  20. Dissolved oxygen levels affect microsclerotia formation by liquid cultures of metarhizium brunneum

    USDA-ARS?s Scientific Manuscript database

    Sclerotia, overwintering propagules formed by some fungi when faced with adverse nutritional or environmental conditions, are composed of melanized hyphal aggregates capable of withstanding desiccation, oxidative stress, and UV radiation. Using liquid culture fermentation, we identified nutritional...

  1. Molecular diversity of the entomopathogenic fungal Metarhizium community within an agroecosystem.

    PubMed

    Steinwender, Bernhardt M; Enkerli, Jürg; Widmer, Franco; Eilenberg, Jørgen; Thorup-Kristensen, Kristian; Meyling, Nicolai V

    2014-11-01

    The entomopathogenic fungal Metarhizium anisopliae lineage harbors cryptic diversity and was recently split into several species. Metarhizium spp. are frequently isolated from soil environments, but the abundance and distribution of the separate species in local communities is still largely unknown. Entomopathogenic isolates of Metarhizium spp. were obtained from 32 bulked soil samples of a single agroecosystem in Denmark using Tenebrio molitor as bait insect. To assess the Metarhizium community in soil from the agricultural field and surrounding hedgerow, 123 isolates were identified by sequence analysis of 5' end of elongation factor 1-α and their genotypic diversity characterized by multilocus simple sequence repeat (SSR) typing. Metarhizium brunneum was most frequent (78.8%) followed by M. robertsii (14.6%), while M. majus and M. flavoviride were infrequent (3.3% each) revealing co-occurrence of at least four Metarhizium species in the soil of the same agroecosystem. Based on SSR fragment length analysis five genotypes of M. brunneum and six genotypes of M. robertsii were identified among the isolates. A single genotype within M. brunneum predominated (72.3% of all genotypes) while the remaining genotypes of M. brunneum and M. robertsii were found at low frequencies throughout the investigated area indicating a diverse Metarhizium community. The results may indicate potentially favorable adaptations of the predominant M. brunneum genotype to the agricultural soil environment. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Fungal tyrosine betaine, a novel secondary metabolite from conidia of entomopathogenic Metarhizium spp. fungi.

    PubMed

    Carollo, Carlos A; Calil, Ana Luiza A; Schiave, Letícia A; Guaratini, Thais; Roberts, Donald W; Lopes, Norberto P; Braga, Gilberto U L

    2010-01-01

    Fungi, including the entomopathogenic deuteromycete Metarhizium anisopliae, produce a wide diversity of secondary metabolites that either can be secreted or stored in specific developmental structures, e.g., conidia. Some secondary metabolites, such as pigments, polyols and mycosporines, are associated with pathogenicity and/or fungal tolerance to several stress-inducing environmental factors, including temperature and solar radiation extremes. Extracts of M. anisopliae var. anisopliae (strain ESALQ-1037) conidia were purified by chromatographic procedures and the isolated compounds analyzed by ¹H and ¹³C nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry. LC-MS analyses were carried out to search for mycosporines (the initial targets), but no compounds of this class were detected. A molecule whose natural occurrence was previously undescribed was identified. It consists of betaine conjugated with tyrosine, and the structure was identified as 2-{[1-carboxy-2-(4-hydroxyphenyl)ethyl]amino}-N,N,N-trimethyl-2-oxoethanammonium. Mannitol was the predominant compound in the alcoholic conidial extract, but no amino acids other than tyrosine were found to be conjugated with betaine in conidia. The fungal tyrosine betaine was detected also in conidial extracts of three other M. anisopliae var. anisopliae (ARSEF 1095, 5626 and 5749) and three M. anisopliae var. acridum isolates (ARSEF 324, 3391 and 7486), but it was not detected in Aspergillus nidulans conidial extract (ATCC 10074).

  3. Development of pilot-scale fermentation and stabilization processes for the production of microsclerotia of the entomopathogenic fungus Metarhizium brunneun strain F52

    USDA-ARS?s Scientific Manuscript database

    Using 100L stirred-tank bioreactors, we evaluated the effect of fermentation parameters and drying protocols on the production and stabilization of microsclerotia (MS) of the entomopathogenic fungus Metarhizium brunneum (formerly M. anisopliae F52). Results showed that stirred-tank bioreactors can ...

  4. Genetic diversity of the fungal pathogen Metarhizium spp., causing epizootics in Chinese burrower bugs in the Jingting Mountains, eastern China.

    PubMed

    Luan, Fenggang; Zhang, Shengli; Wang, Bin; Huang, Bo; Li, Zengzhi

    2013-01-01

    Based on the internal transcribed spacer and inter-simple sequence repeats (ISSR), the phylogenetic relationship and genetic diversity of Metarhizium spp., pathogens found in Chinese burrower bugs, Schiodtella formosana, were analyzed. The results showed that the causative agents of the epizootic green muscardine disease in populations of S. formosana were actually composed of M. anisopliae and its sister species, M. robertsii. The genetic structure of Metarhizium spp. populations were assessed using ten ISSR. A 3D principal component analysis of 51 isolates sampled on different occasions revealed that the Metarhizium spp. populations were temporally heterogeneous. They differentiated into two main clades including over 71 % of all strains causing epizootics, with a similarity of 83 %. The population differentiation was relatively low (G ( ST ), 0.2080), reflecting a large proportion of gene differentiation (79.2 %) within the populations. Further knowledge of the complex species and heterogeneous populations of Metarhizium spp. may be necessary for sustainable control methods of S. formosana.

  5. Specific Diversity of Metarhizium Isolates Infecting Aeneolamia spp. (Hemiptera: Cercopidae) in Sugarcane Plantations.

    PubMed

    Hernández-Domínguez, C; Guzmán-Franco, A W; Carrillo-Benítez, M G; Alatorre-Rosas, R; Rodríguez-Leyva, E; Villanueva-Jiménez, J A

    2016-02-01

    Spittlebugs from the genus Aeneolamia are important pests of sugarcane. Although the use of the entomopathogenic fungus Metarhizum anisopliae s.l. for control of this pest is becoming more common in Mexico, fundamental information regarding M. anisopliae in sugarcane plantations is practically non-existent. Using phylogenetic analysis, we determined the specific diversity of Metarhizium spp. infecting adult spittlebugs in sugarcane plantations from four Mexican states. We obtained 29 isolates of M. anisopliae s.str. Haplotype network analysis revealed the existence of eight haplotypes. Eight selected isolates, representing the four Mexican states, were grown at different temperatures in vitro; isolates from Oaxaca achieved the greatest growth followed by isolates from Veracruz, San Luis Potosi and Tabasco. No relationship was found between in vitro growth and haplotype diversity. Our results represent a significant contribution to the better understanding of the ecology of Metarhizum spp. in the sugarcane agroecosystem.

  6. Resistant ticks inhibit Metarhizium infection prior to haemocoel invasion by reducing fungal viability on the cuticle surface.

    PubMed

    Ment, Dana; Churchill, Alice C L; Gindin, Galina; Belausov, Eduard; Glazer, Itamar; Rehner, Stephen A; Rot, Asael; Donzelli, Bruno G G; Samish, Michael

    2012-06-01

    We studied disease progression of, and host responses to, four species in the Metarhizium anisopliae complex expressing green fluorescent protein (GFP). We compared development and determined their relative levels of virulence against two susceptible arthropods, the cattle tick Rhipicephalus annulatus and the lepidopteran Galleria mellonella, and two resistant ticks, Hyalomma excavatum and Rhipicephalus sanguineus. Metarhizium brunneum Ma7 caused the greatest mortality of R. annulatus, Metarhizium robertsii ARSEF 2575 and Metarhizium pingshaense PPRC51 exhibited intermediate levels of virulence, and Metarhizium majus PPRC27 caused low mortality of cattle ticks. Conidia of all four species germinated on all hosts examined, but on resistant hosts, sustained hyphal growth was inhibited and GFP emission steadily and significantly decreased over time, suggesting a loss of fungal viability. Cuticle penetration was observed only for the three most virulent species infecting susceptible hosts. Cuticles of resistant and susceptible engorged female ticks showed significant increases in red autofluorescence at sites immediately under fungal hyphae. This is the first report (i) of tick mortality occurring after cuticle penetration but prior to haemocoel colonization and (ii) that resistant ticks do not support development of Metarhizium germlings on the outer surface of the cuticle. Whether reduced Metarhizium viability on resistant tick cuticles is due to antibiosis or limited nutrient availability is unknown.

  7. Metachelins, mannosylated and N-oxidized coprogen-type siderophores from Metarhizium robertsii.

    PubMed

    Krasnoff, Stuart B; Keresztes, Ivan; Donzelli, Bruno G G; Gibson, Donna M

    2014-07-25

    Under iron-depleted culture conditions, the entomopathogenic fungus Metarhizium robertsii (Bischoff, Humber, and Rehner) (= M. anisopliae) produces a complex of extracellular siderophores including novel O-glycosylated and N-oxidized coprogen-type compounds as well as the known fungal siderophores N(α)-dimethylcoprogen (NADC) and dimerumic acid (DA). Metachelin A (1), the most abundant component in the M. robertsii siderophore mixture, was characterized as a 1094 Da analogue of NADC that is O-glycosylated by β-mannose at both terminal hydroxyl groups and N-oxidized at the dimethylated α-nitrogen. The mixture also contained a 1078 Da analogue, metachelin B (2), which lacks the N-oxide modification. Also characterized were the aglycone of 1, i.e., the N-oxide of NADC (3), and the monomannoside of DA (6). N-Oxide and O-glycosyl substituents are unprecedented among microbial siderophores. At high ESIMS source energy and at room temperature in DMSO, 1 underwent Cope elimination, resulting in loss of the N(α)-dimethyl group and dehydration of the α-β bond. High-resolution ESIMS data confirmed that all tri- and dihydroxamate siderophores (1-6) complex with trivalent Fe, Al, and Ga. In a chrome azurol S assay, all of the M. robertsii siderophores showed iron-binding activity roughly equivalent to that of desferrioxamine B.

  8. Imbibitional damage in conidia of the entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, and Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    When dried organisms are immersed in water, rapid imbibition may cause severe damage to plasma membranes; in unicellular organisms, such damage is usually lethal. This study investigated effects of pre-immersion moisture levels and immersion temperature on imbibitional damage in three insect pathoge...

  9. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics

    USDA-ARS?s Scientific Manuscript database

    The genus Metarhizium traditionally refers to green-spored asexual insect pathogenic fungi. Through culturing and molecular methods, Metarhizium has been linked to Metacordyceps sexual states. Historically, fungal nomenclature has allowed separate names for the different life-stages of pleomorphic...

  10. Clavicipitaceous entomopathogens: New species of Metarhizium and a new genus Nigelia

    USDA-ARS?s Scientific Manuscript database

    In several surveys in the tropical forests in Thailand, specimens that looked morphologically similar to Metarhizium martialis and Cordyceps variegata, as well as Metarhizium species were collected and cultured in vitro. A combined phylogeny of several genes including the small (18S) and large (28S)...

  11. Biocontrol of the Brown-Banded Cockroach, Supella longipalpa F. (Blattaria: Blattellidae), with Entomopathogenic Fungus, Metharhizium anisopliae

    PubMed Central

    Sharififard, Mona; Mossadegh, Mohammad Saeed; Vazirianzadeh, Babak; Latifi, Seyed Mahmood

    2016-01-01

    Background: Considering to the high distribution of cockroaches as urban pests, the efficacy of different formulations of Metarhizium anisopliae strain Iran 437C were assessed against the brown-banded cockroach, Supella longipalpa F. under laboratory and field conditions. Methods: Metarhizium anisopliae isolates were screened with immersing adults of the brown-banded cockroachs in aqueous suspension of 108 conidia ml−1 followed by surface or bait treated with different doses of the most virulent isolate against the nymphs. Then formulations of conidia oil-in-water were examined versus cockroach nymphs using different plant oils and paraffin. Then they were evaluated and compared with aqueous suspension and control group. On a large-scale, the sunflower oil-in-water formulation of conidia was sprayed at houses using a hand sprayer. Results: Metarhizium anisopliae IRAN 437C was the most virulent isolate against the brown-banded cockroach, causing 100% mortality in adults at seven days post-exposure. Inoculated bait with this isolate was not enough pathogenic against the cockroach even at two weeks after treatment. Treated surface with conidia as aqueous suspension or oil-in-water formulation was more effective than the bait formulation against the cockroach caused 39.4–97.2% mortality compared with 2.5% mortality in control group after two days. Spraying the conidia formulated with sunflower oil was an effective formulation causing 76.1% reduction in the cockroach density on the third day post treatment in the houses. Conclusion: The oil-in-water formulation of M. anisopliae IRAN 437C could be recommended as a promising alternative for cockroach control. PMID:27308292

  12. Interactions of Metarhizium anisoplae and tree-based mulches in repellence and mycoses against Coptotermes formosanus (Isoptera: Rhinotermitidae).

    PubMed

    Sun, Jian-Zhong; Fuxa, James R; Richter, Arthur; Ring, Dennis

    2008-06-01

    The use of mulch in urban landscapes has increased in the United States for the past decade. Tree-based organic mulches can supply Coptotermes formosanus Shiraki with food, moisture, and shelter. The current research contributes to mulch management technology in termite control. A choice test arena was designed to determine the repellence and mortality caused by commercial mulches treated with different concentrations of the fungus Metarhizium anisopliae (Metschnikoff) against C. formosanus. Each of six tree-based mulches (pine bark, pine straw, bald cypress, eucalyptus, water oak, and melaleuca) was coated with six conidial concentrations ranging from 1 x 10(3) to 1 x 10(8) conidia/ml. The foragers of C. formosanus were repelled significantly by the fungal-treated mulch substrates; the proportion of termites on fungal-treated mulch was usually <20% during the 28-d test. By day 28, >99% of the termites were killed in test arenas containing a chamber with mulch treated with 10(7) or 10(8) conidia/ml. M. anisopliae significantly reduced mulch consumption by 34-71%. Mulch consumption by the termites was negatively correlated with fungal concentration, and the type of mulch also affected consumption. The differences in termite foraging activities, mortality, and food consumption among mulches were usually confounded by differences in fungal concentrations of M. anisopliae. The results indicate that repellence and virulence of M. anisopliae conidia should significantly reduce the suitability of these six mulches as a habitat for C. formosanus.

  13. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics.

    PubMed

    Kepler, Ryan M; Humber, Richard A; Bischoff, Joseph F; Rehner, Stephen A

    2014-01-01

    The genus Metarhizium historically refers to green-spored asexual insect pathogenic fungi. Through culturing and molecular methods, Metarhizium has been linked to Metacordyceps sexual states. Historically fungal nomenclature has allowed separate names for the different life stages of pleomorphic fungi. However, with the move to one name for one fungus regardless of life stage, there is a need to determine which name is correct. For Metarhizium the situation is complicated by the fact that Metacordyceps sexual states are interspersed among additional asexual genera, including Pochonia, Nomuraea and Paecilomyces. Metarhizium has priority as the earliest available name, but delimiting the boundaries of this genus remains problematic. To clarify relationships among these taxa we have obtained representative material for each genus and established a molecular dataset of the protein-coding genes BTUB, RPB1, RPB2 and TEF. The resulting phylogeny supports Metarhizium combining the majority of species recognized in Metacordyceps as well as the green-spored Nomuraea species and those in the more recently described genus Chamaeleomyces. Pochonia is polyphyletic, and we restrict the definition of this genus to those species forming a monophyletic clade with P. chlamydosporia, and the excluded species are transferred to Metapochonia gen. nov. It is our hope that this unified concept of sexual and asexual states in Metarhizium will foster advances in communication and understanding the unique ecologies of the associated species. © 2014 by The Mycological Society of America.

  14. Multiplexed microsatellite markers for seven Metarhizium species

    USDA-ARS?s Scientific Manuscript database

    Cross-species transferability of 41 previously published simple sequence repeat (SSR) markers was assessed for 11 species of the entomopathogenic fungus Metarhizium. A collection of 65 Metarhizium isolates including all 54 used in a recent phylogenetic revision of the genus were characterized. Betwe...

  15. New insecticidal antibiotics, hydroxyfungerins A and B, produced by Metarhizium sp. FKI-1079.

    PubMed

    Uchida, Ryuji; Imasato, Rie; Yamaguchi, Yuichi; Masuma, Rokuro; Shiomi, Kazuro; Tomoda, Hiroshi; Omura, Satoshi

    2005-12-01

    New insecticidal antibiotics designated hydroxyfungerins A and B were isolated from the culture broth of a fungal strain Metarhizium sp. FKI-1079 together with a known compound, fungerin. The structures of hydroxyfungerins A and B were elucidated by spectroscopic studies including various NMR experiments. Hydroxyfungerins A and B showed growth inhibitory activity against brine shrimps, Artemia salina.

  16. Identification of Metarhizium anisopliae transcripts expressed during the fungus- insect interaction

    USDA-ARS?s Scientific Manuscript database

    The identification of genes contributing to the establishment and disease progression of entomopathogenic fungi within their insect hosts has been conducted to date largely using in vitro systems mimicking specific phases of the infection. We are exploring the use of in vivo techniques to identify f...

  17. Storage conditions affect speed of germination in Beauveria bassiana and Metarhizium anisopliae conidia

    USDA-ARS?s Scientific Manuscript database

    The retention of high viability during storage is essential for effectiveness and thus market acceptance of fungus-based biopesticides. The length of adequate shelf-lives for mycoinsecticides is controversial, with proposed requirements varying from a few weeks to 18 months. Shelf-life determination...

  18. THE IDENTIFICATION AND CHARACTERIZATION OF AN LGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    Molds are ubiquitous components of the indoor environment and have been associated with exacerbation of asthma as well as a number of other health effects. Their contribution to the induction of allergic asthma is less certain. Previously, we have shown that BALB/c mice exposed...

  19. Synergistic effect of dual imidacloprid-Metarhizium anisopliae applications against Asian longhorned beetles (Anoplophora glabripennis)

    Treesearch

    Todd A. Ugine; Calum W. Russell; Ann E. Hajek

    2011-01-01

    Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae), a longhorned beetle species native to Asia, has been introduced into several North American and European cities. Currently, eradication and preventive measures are limited to identifying and destroying infested trees and protecting uninfested trees with trunk or soil-injections of the...

  20. THE IDENTIFICATION AND CHARACTERIZATION OF AN LGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    Molds are ubiquitous components of the indoor environment and have been associated with exacerbation of asthma as well as a number of other health effects. Their contribution to the induction of allergic asthma is less certain. Previously, we have shown that BALB/c mice exposed...

  1. Species Diversity and Population Dynamics of Entomopathogenic Fungal Species in the Genus Metarhizium-a Spatiotemporal Study.

    PubMed

    Hernández-Domínguez, Carmela; Guzmán-Franco, Ariel W

    2017-01-26

    We studied the species diversity and population genetic structure of isolates of fungi from the entomopathogenic genus Metarhizium that had been isolated from sugarcane crops and surrounding grass. Soil and leaf samples were taken on four sampling occasions over 13 months (October 2014-October 2015). Isolations were made using the Galleria mellonella baiting method and selective media. Phylogenetic placement of isolates was done by sequencing a fragment of the 5' of the elongation factor 1-α gene (EF1-α). Population genetic structure was determined by analysing this sequence information using AMOVA and Haplotype network analyses. Genotypic diversity was studied using microsatellite genotyping. The most abundant species was M. anisopliae s.s. (80 isolates), then M. pingshaense (three isolates), and M. guizhouense (one isolate). More than 50% of the genetic variation was explained by the time the samples were collected regardless of plant host association. Some haplotypes were found on the first sampling date and then not found on subsequent sampling dates, while other haplotypes were found initially, disappeared, but then found again on the last sampling date. To the best of our knowledge, this is the first report of the population genetic structure of M. anisopliae species in time and space. The effect of abiotic factors is discussed.

  2. Mrt, a gene unique to fungi, encodes an oligosaccharide transporter and facilitates rhizosphere competency in Metarhizium robertsii.

    PubMed

    Fang, Weiguo; St Leger, Raymond J

    2010-11-01

    The symbiotic associations between rhizospheric fungi and plants have enormous environmental impact. Fungi are crucial to plant health as antagonists of pathogens and herbivores and facilitate the uptake of soil nutrients. However, little is known about the plant products obtained by fungi in exchange or how they are transported through the symbiotic interface. Here, we demonstrate that sucrose and raffinose family oligosaccharides in root exudates are important for rhizosphere competence in the insect pathogen Metarhizium robertsii (formerly known as Metarhizium anisopliae). We identified mutants in the Metarhizium raffinose transporter (Mrt) gene of M. robertsii that grew poorly in root exudate and were greatly reduced in rhizosphere competence on grass roots. Studies on sugar uptake, including competition assays, revealed that MRT was a sucrose and galactoside transporter. Disrupting MRT resulted in greatly reduced or no growth on sucrose and galactosides but did not affect growth on monosaccharides or oligosaccharides composed entirely of glucose subunits. Consistent with this, expression of Mrt is exclusively up-regulated by galactosides and sucrose. Expressing a green fluorescent protein gene under the control of the Mrt promoter confirmed that MRT was expressed by germlings in the vicinity of grass roots but not in surrounding bulk soil. Disrupting Mrt did not reduce virulence to insects, demonstrating that Mrt is exclusively involved in M. robertsii's interactions with plants. To our knowledge, MRT is the first oligosaccharide transporter identified and characterized in a fungus and is unique to filamentous fungi, but homologous genes in Magnaporthe, Ustilago, Aspergillus, Fusarium, Epichloe, and Penicillium species indicate that oligosaccharide transport is of widespread significance.

  3. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIEA

    EPA Science Inventory

    The goal of this project is the identification and characterization of allergens from the fungus M. Anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaerosol contamination. One of ...

  4. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIEA

    EPA Science Inventory

    The goal of this project is the identification and characterization of allergens from the fungus M. Anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaerosol contamination. One of ...

  5. Production of Destruxins from Metarhizium spp. Fungi in Artificial Medium and in Endophytically Colonized Cowpea Plants

    PubMed Central

    Golo, Patrícia S.; Gardner, Dale R.; Grilley, Michelle M.; Takemoto, Jon Y.; Krasnoff, Stuart B.; Pires, Marcus S.; Fernandes, Éverton K. K.; Bittencourt, Vânia R. E. P.; Roberts, Donald W.

    2014-01-01

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E produced by these same isolates in submerged (shaken) cultures. Eight of the isolates (ARSEF 324, 724, 760, 1448, 1882, 1883, 3479, and 3918) did not produce DTXs A, B, or E during the five days of submerged culture. DTXs were first detected in culture medium at 2–3 days in submerged culture. Galleria mellonella and Tenebrio molitor showed considerable variation in their susceptibility to the Metarhizium isolates. The concentration of DTXs produced in vitro did not correlate with percent or speed of insect kill. We established endophytic associations of M. robertsii and M. acridum isolates in Vigna unguiculata (cowpeas) and Cucumis sativus (cucumber) plants. DTXs were detected in cowpeas colonized by M. robertsii ARSEF 2575 12 days after fungal inoculation, but DTXs were not detected in cucumber. This is the first instance of DTXs detected in plants endophytically colonized by M. robertsii. This finding has implications for new approaches to fungus-based biological control of pest arthropods. PMID:25127450

  6. Phylogenetic diversity of Brazilian Metarhizium associated with sugarcane agriculture

    USDA-ARS?s Scientific Manuscript database

    Biological control of spittlebug with Metarhizium in sugarcane is an example of the successful application of sustainable pest management in Brazil. However little is known about the richness, distribution and ecology of Metarhizium species in the agroecosystems and natural environments of Brazil. W...

  7. Insertion of an Esterase Gene into a Specific Locust Pathogen (Metarhizium acridum) Enables It to Infect Caterpillars

    PubMed Central

    Wang, Sibao; Fang, Weiguo; Wang, Chengshu; St. Leger, Raymond J.

    2011-01-01

    An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae) as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta) cuticle, M. robertsii up-regulates a gene (Mest1) that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta), while virulence to grasshoppers (Melanoplus femurrubrum) was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene. PMID:21731492

  8. Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum) enables it to infect caterpillars.

    PubMed

    Wang, Sibao; Fang, Weiguo; Wang, Chengshu; St Leger, Raymond J

    2011-06-01

    An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae) as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta) cuticle, M. robertsii up-regulates a gene (Mest1) that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta), while virulence to grasshoppers (Melanoplus femurrubrum) was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

  9. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite are Compared in a Mouse Model

    EPA Science Inventory

    Biopesticides can be effective in controlling their target pest. However, research regarding mammalian health impacts of these agents has focused on toxicity and pathogenicity, with limited research regarding allergenicity and asthma development. We compared the ability of funga...

  10. MALDI-TOF mass spectrometry applied to identifying species of insect-pathogenic fungi from the Metarhizium anisopliae complex

    USDA-ARS?s Scientific Manuscript database

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has proven to be a powerful tool for taxonomic resolution of microorganisms. In this proof-of-concept study, we assessed the effectiveness of this technique to track the current gene sequence-based phylogenet...

  11. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite are Compared in a Mouse Model

    EPA Science Inventory

    Biopesticides can be effective in controlling their target pest. However, research regarding mammalian health impacts of these agents has focused on toxicity and pathogenicity, with limited research regarding allergenicity and asthma development. We compared the ability of funga...

  12. Independent origins of diploidy in Metarhizium.

    PubMed

    Kepler, Ryan Michael; Chen, Yuan; Kilcrease, James; Shao, Jonathan; Rehner, Stephen A

    2016-09-12

    In fungi, stable diploid genome arrangements are rare. Here we present evidence from nuclear intergenic DNA sequencing, microsatellite genotyping, and configuration of the mating-type locus to demonstrate two independent origins of persistent diploid genome organization in the Metarhizium majus species complex. Most taxa in the complex are genotypically haploid, with individual isolates consistently displaying a single allele across all nuclear loci, as well as having a single mating-type locus. In contrast, individuals of M. majus and the clade designated here MGT1 are shown to be diploid, based on a consistent finding of heterozygosity and the presence of both MAT1 and MAT2 mating-type loci. In single locus phylogenies, nuclear intergenic alleles of M. majus and MGT1 each form monophyletic groups, indicating that diploidy in both taxa likely originated by the union of conspecific individuals. Sequence divergence in the APN2/MAT1-1-3 and APN2/MAT2-1 intergenic spacers indicate the two MAT loci are physically separated in the genomes of both diploid taxa, although the linkage relationship of the MAT loci to one another is unknown. The presence of both mating genes in a single nucleus suggests these diploid genomes may represent a mating event that failed to complete meiosis. Whether or not these isolates are able to complete the sexual cycle under any conditions and form ascospores remains an open question.

  13. Metacridamides A and B from the biocontrol fungus metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

  14. Unveiling the biosynthetic puzzle of destruxins in Metarhizium species

    PubMed Central

    Wang, Bing; Kang, Qianjin; Lu, Yuzhen; Bai, Linquan; Wang, Chengshu

    2012-01-01

    Insect pathogenic fungi produce a plethora of insecticidally and pharmaceutically active compounds, including 39 cyclohexadepsipeptide destruxins (dtxs). Even though dtxs were first discovered more than 50 y ago, the genes responsible for their biosynthesis were unknown until this study. Based on our comparative genomic information and targeted gene disruptions, we report the gene cluster for dtx biosynthesis in the insect pathogen Metarhizium robertsii. The nonribosomal peptide synthetase DtxS1 has six adenylation domains, two of which are capable of selecting different amino acids to synthesize dtx B and its analogs. The cytochrome P450 enzyme DtxS2 converts dtx B into other dtxs by a chain of reactions, each producing a new derivative. The aldo-keto reductase DtxS3 and aspartic acid decarboxylase DtxS4 are responsible for the conversion and provision of the first and last substrates for the dtx assembly line, respectively. Insect bioassays showed that dtxs could suppress both cellular and humoral immune responses thereby assisting fungal propagation in insects. The differing abilities of Metarhizium species to produce toxins is dependent on the presence of the dtxS1 gene. The toxigenic species are capable of killing multiple orders of insects, whereas the nontoxigenic Metarhizium spp. have narrow host ranges. Thus, the acquisition or retention of the dtx biosynthesis gene cluster in Metarhizium lineages has been coordinated with the evolution of fungal host specificity. The data from this study will facilitate the development of dtxs as bioinsecticides or pharmaceuticals. PMID:22232661

  15. Molecular genetics of secondary chemistry in Metarhizium fungi

    USDA-ARS?s Scientific Manuscript database

    As with many microbes, entomopathogenic fungi from the genus Metarhizium produce a plethora of small molecule metabolites, often referred to as secondary metabolites. Although these intriguing compounds are a conspicuous feature of the biology of the producing fungi, their roles in pathogenicity and...

  16. Identification of Molecular Variants in Mitochondrial DNAs of Members of the Genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium.

    PubMed

    Hegedus, D D; Khachatourians, G G

    1993-12-01

    A set of five mitochondrial (mt) probes derived from a strain of Beauveria bassiana was used to evaluate the similarity of mtDNAs from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. The probes and genes encoded for (shown in parentheses) were pBbmtE2 (NADI, ATP6), pBbmtE3 (ATP6, small rRNA [srRNA]), pBbmtE4 (srRNA, CO3, NAD6), pBbSE1 (NAD6, tRNA, large rRNA [lrRNA]), and pBbXS1 (lrRNA). The probes produced identical hybridization patterns in EcoRI-digested DNA from nearly all isolates of B. bassiana and Beauveria caledonica. Similar patterns were also observed with Beauveria densa. The isolates of B. caledonica and B. densa DNAs could be differentiated from each other and from B. bassiana on the basis of a HindIII digestion and probing with pBbmtE3. Probe pBbmtE2 produced either a 5.0-kb or a 4.1-kb band in all of the B. bassiana isolates. This observation was used to categorize the mtDNA of B. bassiana into two types, designated A and B. Hybridization of the five probes produced distinct banding patterns in Beauveria brongniartii, Tolypocladium cylindrosporum, Tolypocladium nivea, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus. Hybridizations carried out with multiple probes simultaneously present produced unique patterns which characterized the B. bassiana group from all other fungi tested. These results are discussed in terms of how mtDNA polymorphisms in B. bassiana may relate to natural population structures, mt transmission in deuteromycetes, and the use of mtDNA polymorphisms in structural analysis of mtDNA.

  17. Identification of Molecular Variants in Mitochondrial DNAs of Members of the Genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium

    PubMed Central

    Hegedus, Dwayne D.; Khachatourians, George G.

    1993-01-01

    A set of five mitochondrial (mt) probes derived from a strain of Beauveria bassiana was used to evaluate the similarity of mtDNAs from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. The probes and genes encoded for (shown in parentheses) were pBbmtE2 (NADI, ATP6), pBbmtE3 (ATP6, small rRNA [srRNA]), pBbmtE4 (srRNA, CO3, NAD6), pBbSE1 (NAD6, tRNAVal, Ile, Ser, Trp, Pro, large rRNA [lrRNA]), and pBbXS1 (lrRNA). The probes produced identical hybridization patterns in EcoRI-digested DNA from nearly all isolates of B. bassiana and Beauveria caledonica. Similar patterns were also observed with Beauveria densa. The isolates of B. caledonica and B. densa DNAs could be differentiated from each other and from B. bassiana on the basis of a HindIII digestion and probing with pBbmtE3. Probe pBbmtE2 produced either a 5.0-kb or a 4.1-kb band in all of the B. bassiana isolates. This observation was used to categorize the mtDNA of B. bassiana into two types, designated A and B. Hybridization of the five probes produced distinct banding patterns in Beauveria brongniartii, Tolypocladium cylindrosporum, Tolypocladium nivea, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus. Hybridizations carried out with multiple probes simultaneously present produced unique patterns which characterized the B. bassiana group from all other fungi tested. These results are discussed in terms of how mtDNA polymorphisms in B. bassiana may relate to natural population structures, mt transmission in deuteromycetes, and the use of mtDNA polymorphisms in structural analysis of mtDNA. Images PMID:16349124

  18. Agrobacterium-Mediated Co-transformation of Multiple Genes in Metarhizium robertsii

    PubMed Central

    Bidochka, Michael J.

    2017-01-01

    Fungi of the Metarhizium genus are a very versatile model for understanding pathogenicity in insects and their symbiotic relationship with plants. To establish a co-transformation system for the transformation of multiple M. robertsii genes using Agrobacterium tumefaciens, we evaluated whether the antibiotic nourseothricin has the same marker selection efficiency as phosphinothricin using separate vectors. Subsequently, in the two vectors containing the nourseothricin and phosphinothricin resistance cassettes were inserted eGFP and mCherry expression cassettes, respectively. These new vectors were then introduced independently into A. tumefaciens and used to transform M. robertsii either in independent events or in one single co-transformation event using an equimolar mixture of A. tumefaciens cultures. The number of transformants obtained by co-transformation was similar to that obtained by the individual transformation events. This method provides an additional strategy for the simultaneous insertion of multiple genes into M. robertsii. PMID:28781540

  19. Production of destruxins from metarhizium spp. fungi in artificial medium and in endophytically colonized cowpea plants

    USDA-ARS?s Scientific Manuscript database

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E prod...

  20. Production of destruxins from Metarhizium spp. fungi in artificial medium and in endophytically colonized Cowpea Plants

    USDA-ARS?s Scientific Manuscript database

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E prod...

  1. Ametryn removal by Metarhizium brunneum: Biodegradation pathway proposal and metabolic background revealed.

    PubMed

    Szewczyk, Rafał; Kuśmierska, Anna; Bernat, Przemysław

    2017-10-03

    Ametryn is a representative of a class of s-triazine herbicides absorbed by plant roots and leaves and characterized as a photosynthesis inhibitor. It is still in use in some countries in the farming of pineapples, soybean, corn, cotton, sugar cane or bananas; however, due to the adverse effects of s-triazine herbicides on living organisms use of these pesticides in the European Union has been banned. In the current study, we characterized the biodegradation of ametryn (100 mg L(-1)) by entomopathogenic fungal cosmopolite Metarhizium brunneum. Ametryn significantly inhibited the growth and glucose uptake in fungal cultures. The concentration of the xenobiotic drops to 87.75 mg L(-1) at the end of culturing and the biodegradation process leads to formation of four metabolites: 2-hydroxy atrazine, ethyl hydroxylated ametryn, S-demethylated ametryn and deethylametryn. Inhibited growth is reflected in the metabolomics data, where significant differences in concentrations of L-proline, gamma-aminobutyric acid, L-glutamine, 4-hydroxyproline, L-glutamic acid, ornithine and L-arginine were observed in the presence of the xenobiotic when compared to control cultures. The metabolomics data demonstrated that the presence of ametryn in the fungal culture induced oxidative stress and serious disruptions of the carbon and nitrogen metabolism. Our results provide deeper insights into the microorganism strategy for xenobiotic biodegradation which may result in future enhancements to ametryn removal by the tested strain. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Metabolic Conservation and Diversification of Metarhizium Species Correlate with Fungal Host-Specificity

    PubMed Central

    Xu, Yong-Jiang; Luo, Feifei; Li, Bing; Shang, Yanfang; Wang, Chengshu

    2016-01-01

    The ascomycete genus Metarhizium contains several species of insect pathogenic fungi ranging from specialists with narrow host ranges to generalists that can infect diverse invertebrates. Genetic and metabolic conservations and diversifications of Metarhizium species are not well understood. In this study, using the genome information of seven Metarhizium species, we performed a comparative analysis of gene clusters involved in secondary metabolisms (SMs) in these species. The results revealed that the generalist species contain more SM gene clusters than the specialists, and that both conserved and divergent evolutions may have occurred in SM genes during fungal speciation. In particular, the loss/gain events, as well as gene mutagenesis, are evident for the gene cluster responsible for the biosynthesis of non-ribosomal cyclopeptide destruxins. The presence of conserved SM gene clusters in Metarhizium and other divergently evolved insect pathogenic fungi implies their link to fungal entomopathogenicity. Mass spectrometry based metabolomic analyses were also conducted to investigate the chemical diversities of seven Metarhizium species. Consistent with the evolutionary relationships of SM genes among the seven species, significant differences are observed in fungal metabolic profiles, whether the same or different metabolites are produced in different species. Clustering analysis based on the metabolome data revealed that Metarhizium species could be grouped based on their association to fungal host specificity. Our metabolomics-based methods also facilitate the identification of bioactive metabolites that have not been reported previously in Metarhizium. The results of this study will benefit future investigations of the chemical biology of insect-fungal interactions. PMID:28018335

  3. Evaluation of Metarhizium brunneum F52 (Hypocreales: Clavicipitaceae) for control of Japanese beetle larvae in turfgrass

    USDA-ARS?s Scientific Manuscript database

    Experimental and commercial preparations of Metarhizium brunneum strain F52 were evaluated for control of Japanese beetle Popillia japonica Newman (Coleoptera: Scarbaeidae) larvae (white grubs) in the laboratory and under field conditions. Experimental preparations consisted of granule and liquid f...

  4. Evaluating the virulence and longevity of non-woven fiber bands impregnated with Metarhizium anisopliae against the Asian longhorned beetle, Anoplophora glabripennis (Coleoptera: Cerambycidae)

    Treesearch

    Ryan P. Shanley; Melody Keena; Micheal M. Wheeler; Jarrod Leland; Ann E. Hajek

    2009-01-01

    Fiber bands impregnated with entomopathogenic fungi (=fungal bands) provide an effective method for controlling the invasive Asian longhorned beetle, Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae). In this study we investigated the effective longevity of fungal bands for use against A. glabripennis, using...

  5. Use of the entomopathogenic fungi Metarhizium anisopliae, Cordyceps bassiana and Isaria fumosorosea to control Diaphorina citri (Hemiptera: Psylidae) in Persian lime under field conditions

    USDA-ARS?s Scientific Manuscript database

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), is a destructive insect pest in the citriculture, because it is an efficient vector of the proteobacteria, ‘Candidatus Liberibacter asiaticus’ (Las), ‘Ca. L. Africanus’ (Laf), and ‘Ca. L. Americanus’ (Lam). These bacteria c...

  6. Multilocus sequence typing of Metarhizium anisopliae var acridum isolates as microbial agents for locust and grasshopper control. Genbank Accession numbers FJ787311 to FJ787325

    USDA-ARS?s Scientific Manuscript database

    A growing interest in the biological control of locusts and grasshoppers (Acrididae) has led to the development of biopesticides based on naturally occurring pathogens which offers an environmentally safe alternative to chemical pesticides. However, the fungal strains which are being sought for biop...

  7. Field Applications of Entomopathogenic Fungi Beauveria bassiana (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae F52 (Hypocreales: Nectriaceae) for the Control of Ixodes scapularis (Acari: Ixodidae)

    USDA-ARS?s Scientific Manuscript database

    Two commercial formulations of Beauveria bassiana (Balsamo-Crivelli) Vuillemin were applied to residential sites in Old Lyme, Connecticut for the control of nymphs of the blacklegged tick, Ixodes scapularis in 1999 and 2000. The pyrethroid bifenthrin was applied to other homes for comparison with B....

  8. [Fungus, Metarrhizium anisopliae, as a possible regulator of the number of horseflies].

    PubMed

    Saubenova, O G

    1976-01-01

    In water bodies of the flood-plains of the Ili and Turgen rivers (Alma-Ata district) there were found larvae of Tabanus autumnalis infected with the fungus Metarrhizium anisopliae. Experiments on the infection of T. autumnalis with this fungus yielded 100% mortality of larvae and adult insects. The possibility of creation of an artificial infection nidus under natural conditions was established.

  9. Influence of substrate and relative humidity on the efficacy of three entomopathogenic fungi for the hide beetle, Dermestes maculatus

    USDA-ARS?s Scientific Manuscript database

    Dermestes maculatus is carrion feeder that is also a pest of poultry houses, museums, silkworm culture, and many stored foods. The Hypocreales, Beauveria bassiana, Metarhizium anisopliae, and Isaria fumosorosea, were tested for efficacy against D. maculatus larvae on concrete, plastic, leather, and ...

  10. Laboratory bioassays and field-cage trials of Metarhizium spp. isolates with field-collected Mormon crickets (Anabrus simplex)

    USDA-ARS?s Scientific Manuscript database

    The Mormon cricket, Anabrus simplex, is an important pest in the western United States. This study evaluates the virulence of 32 isolates of Metarhizium towards field-collected Mormon crickets. Additionally, several isolates were tested in outdoor field-cage studies. All 32 Metarhizium isolates were...

  11. Metarhizium robertsii Produces an Extracellular Invertase (MrINV) That Plays a Pivotal Role in Rhizospheric Interactions and Root Colonization

    PubMed Central

    Liao, Xinggang; Fang, Weiguo; Lin, Liangcai; Lu, Hsiao-Ling; Leger, Raymond J. St.

    2013-01-01

    As well as killing pest insects, the rhizosphere competent insect-pathogenic fungus Metarhizium robertsii also boosts plant growth by providing nitrogenous nutrients and increasing resistance to plant pathogens. Plant roots secrete abundant nutrients but little is known about their utilization by Metarhizium spp. and the mechanistic basis of Metarhizium-plant associations. We report here that M. robertsii produces an extracellular invertase (MrInv) on plant roots. Deletion of MrInv (⊿MrInv) reduced M. robertsii growth on sucrose and rhizospheric exudates but increased colonization of Panicum virgatum and Arabidopsis thaliana roots. This could be accounted for by a reduction in carbon catabolite repression in ⊿MrInv increasing production of plant cell wall-degrading depolymerases. A non-rhizosphere competent scarab beetle specialist Metarhizium majus lacks invertase which suggests that rhizospheric competence may be related to the sugar metabolism of different Metarhizium species. PMID:24205119

  12. Metarhizium robertsii produces an extracellular invertase (MrINV) that plays a pivotal role in rhizospheric interactions and root colonization.

    PubMed

    Liao, Xinggang; Fang, Weiguo; Lin, Liangcai; Lu, Hsiao-Ling; St Leger, Raymond J

    2013-01-01

    As well as killing pest insects, the rhizosphere competent insect-pathogenic fungus Metarhizium robertsii also boosts plant growth by providing nitrogenous nutrients and increasing resistance to plant pathogens. Plant roots secrete abundant nutrients but little is known about their utilization by Metarhizium spp. and the mechanistic basis of Metarhizium-plant associations. We report here that M. robertsii produces an extracellular invertase (MrInv) on plant roots. Deletion of MrInv (ΔMrInv) reduced M. robertsii growth on sucrose and rhizospheric exudates but increased colonization of Panicum virgatum and Arabidopsis thaliana roots. This could be accounted for by a reduction in carbon catabolite repression in ΔMrInv increasing production of plant cell wall-degrading depolymerases. A non-rhizosphere competent scarab beetle specialist Metarhizium majus lacks invertase which suggests that rhizospheric competence may be related to the sugar metabolism of different Metarhizium species.

  13. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract.

  14. Genetic basis of destruxin production in the entomopathogen Metarhizium robertsii.

    PubMed

    Giuliano Garisto Donzelli, Bruno; Krasnoff, Stuart B; Moon, Yong-Sun; Sun-Moon, Yong; Churchill, Alice C L; Gibson, Donna M

    2012-04-01

    Destruxins are among the most exhaustively researched secondary metabolites of entomopathogenic fungi, yet definitive evidence for their roles in pathogenicity and virulence has yet to be shown. To establish the genetic bases for the biosynthesis of this family of depsipeptides, we identified a 23,792-bp gene in Metarhizium robertsii ARSEF 2575 containing six complete nonribosomal peptide synthetase modules, with an N-methyltransferase domain in each of the last two modules. This domain arrangement is consistent with the positioning of the adjacent amino acids N-methyl-L: -valine and N-methyl-L: -alanine within the depsipeptide structure of destruxin. DXS expression levels in vitro and in vivo exhibited comparable patterns, beginning at low levels during the early growth phases and increasing with time. Targeted gene knockout using Agrobacterium-mediated transformation produced mutants that failed to synthesize destruxins, in comparison with wild type and ectopic control strains, indicating the involvement of this gene in destruxin biosynthesis. The destruxin synthetase (DXS) disruption mutant was as virulent as the control strain when conidial inoculum was topically applied to larvae of Spodoptera exigua, Galleria mellonella, and Tenebrio molitor indicating that destruxins are dispensable for virulence in these insect hosts. The DXS mutants exhibited no other detectable changes in morphology and development.

  15. An in vivo transcriptome for entomopathogenic fungus Metarhizium robertsii ARSEF 2575

    USDA-ARS?s Scientific Manuscript database

    Molecular mechanisms underlying the pathogenic process of the insect pathogen Metarhizium robertsii ARSEF 2575 in its host are only partially understood. To probe the transcriptional responses of the fungus during the interaction with insects, we have developed a method to specifically recover patho...

  16. Ovicidal activity of Metarhizium brunneum (Mb F52) on dengue fever vector, Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    The ovicidal activity of Metarhizium brunneum F52 (Mb F52) grown from granules was evaluated against Aedes aegypti eggs over time. Survival of larvae from treated eggs was significantly less when compared with untreated eggs at 7, 10 and 14 days post treatment. Only 27 % of treated eggs produced vi...

  17. Metarhizium microsclerotia and hydrogel versus hydromulch: testing fungal formulations against Asian longhorned beetles

    USDA-ARS?s Scientific Manuscript database

    The efficacy of microsclerotia of Metarhizium brunneum (Petch) (Hypocreales: Clavicipitaceae) strain F52 (ARSEF 7711) was tested using samples that had been exposed on forest trees, allowing time for conidia to be produced. An aqueous mixture of microsclerotial granules (61.3% of dry mass), a straw ...

  18. Metacridamides A and B, bioactive macrocycles from conidia of the entomopathogenic fungus Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. Its conidia produce two novel 17-membered macrocycles, metacridamides A (1) and B (2), which consist of a Phe unit condensed with a nonaketide....

  19. Efficient dibutyltin (DBT) elimination by the microscopic fungus Metarhizium robertsii under conditions of intensive aeration and ascorbic acid supplementation.

    PubMed

    Siewiera, Paulina; Różalska, Sylwia; Bernat, Przemysław

    2017-03-27

    Dibutyltin (DBT) is an environmental pollutant characterized by immunotoxic, neurotoxic, and pro-oxidant properties. In this study, an attempt was made to enhance DBT elimination by the Metarhizium robertsii strain. We observed enhanced fungal growth in the bioreactor (pO2 ≥ 20%) compared to flask cultures (μ max increased from 0.061 to 0.086 h(-1)). Moreover, under aerated conditions, M. robertsii mycelium with "hairy" morphology biodegraded DBT (20 mg l(-1)) 10-fold faster in the bioreactor than in the flask cultures. Monobutyltin (MBT) and a hydroxylated derivative of MBT (OHBuSnH2) were detected as by-products of dibutyltin debutylation. Simultaneous usage of glucose and butyltins indicates the comatabolic nature of monobutyltin and dibutyltin removal. In order to protect fungal cells from oxidative stress caused by DBT presence, vitamin C (20 mg l(-1)) was applied. Supplementation with ascorbic acid (AA) resulted in a 3-fold acceleration of MBT removal during the first 7 h of incubation. Using the HPLC-MS/MS technique, a quantitative analysis of malondialdehyde (MDA), a marker of oxidative stress, was performed. In the AA presence, a decrease in the MDA amount (about 45%) was observed compared to the case with fungal cells exposed to DBT alone.

  20. Microsclerotia of Metarhizium brunneum F52 applied in hydromulch for control of Asian longhorned beetles (Coleoptera: Cerambycidae)

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Metarhizium brunneum (Petch), strain F52 (Hypocreales: Clavicipitaceae) is able to produce environmentally persistent microsclerotia. Incorporating these desiccation-tolerant M. brunneum F52 microsclerotia (Mb MS) granules into hydromulch [a mixture of water + wheat straw...

  1. Evaluating different carriers of Metarhizium brunneum F52 microsclerotia for control of adult Asian longhorned beetles (Coleoptera: Cerambycidae)

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia (MS) of Metarhizium brunneum strain F52 (Hypocreales: Clavicipitaceae), were processed as granules using three carriers: kaolin clay, microcrystalline cellulose (MCC) or diatomaceous earth (DE). In a series of experiments aimed at comparing viable conidial production and subsequent pe...

  2. Virulence of Mexican isolates of entomopathogenic fungi upon Rhipicephalus-Boophilus microplus larvae and the efficacy of conidia formulations to reduce larval tick density under field conditions

    USDA-ARS?s Scientific Manuscript database

    The first objective was laboratory evaluation of the virulence of 53 Mexican isolates of fungi against larvae of Rhipicephalus (Boophilus) microplus. Thirty three isolates of Metarhizium anisopliae var. anisopliae (Metschnickoff) Sorokin (Hypocreales: Clavicipitaceae) and 20 isolates of Isaria (Paec...

  3. The high osmotic response and cell wall integrity pathways cooperate to regulate morphology, microsclerotia development, and virulence in Metarhizium rileyi

    PubMed Central

    Song, Zhangyong; Zhong, Qiang; Yin, Youping; Shen, Ling; Li, Yan; Wang, Zhongkang

    2016-01-01

    Microsclerotia (MS) formation was successfully induced in Metarhizium rileyi under changing liquid culture conditions. Mitogen-activated protein kinases (MAPKs) play important roles in fungal development and in coordinating many stress responses. To investigate how M. rileyi transduces growth stress and regulates MS differentiation, we characterized the roles of two MAPKs, Hog1- and Slt2-type orthologues, in M. rileyi. Compared with the wild-type strain, the deletion mutants of Mrhog1 (ΔMrhog1) and Mrslt2 (ΔMrslt2) delayed germination and vegetative growth, displayed sensitivities to various stress, and produced morphologically abnormal clones. The ΔMrhog1 and ΔMrslt2 mutants significantly reduced conidial (42–99%) and MS (96–99%) yields. A transcriptional analysis showed that the two MAPKs regulate MS development in a cooperative manner. Insect bioassays revealed that ΔMrhog1 and ΔMrslt2 had decreased virulence levels in topical (36–56%) and injection (78–93%) bioassays. Our results confirmed the roles of MrHog1 and MrSlt2 in sensing growth-related stress and in regulating MS differentiation. PMID:27941838

  4. Comparative impact of artificial selection for fungicide resistance on Beauveria bassiana and Metarhizium brunneum.

    PubMed

    Shapiro-Ilan, David I; Reilly, Charles C; Hotchkiss, Michael W

    2011-02-01

    Hypocreales fungi such as Beauveria bassiana (Balsamo) Vuillemin and Metarhizium brunneum Petch can be negatively affected by fungicides thereby reducing their biocontrol potential. In a previous study, we demonstrated enhanced fungicide resistance in B. bassiana through artificial selection. However, it is not clear if the enhanced resistance was because of improved germination, vegetative growth, or both. Additionally, the enhanced fungicide resistance has only been demonstrated in B. bassiana, and therefore it is of interest to investigate the potential to enhance resistance in other fungi. Thus, the objectives in this study were to determine the potential to enhance fungicide resistance in M. brunneum through artificial selection, and investigate if selection is based on germination, vegetative growth, or both in B. bassiana and M. brunneum. Selection for resistance to fenbuconazole, and triphenyltin hydroxide was assessed through inhibition evaluations on solid media, and germination and mycelial growth in liquid media. Increased resistance after selection was observed for all fungicide-fungus combinations on solid and or liquid media. Selection resulted in increased resistance to fenbuconazole in both fungi in solid and liquid media; in liquid culture fungicide resistance in B. bassiana was manifested by increased germination and mycelial growth, whereas in M. brunneum fungicide resistance concerned only mycelial growth. Selection for resistance to triphenyltin hydroxide varied in the different media. For B. bassiana, triphenyltin hydroxide resistance was enhanced on solid media but not in liquid, whereas enhanced resistance of M. brunneum was detected in both media. Fungicide sensitivity and selection potential differs based on the medium and fungal species. Selection for fungicide resistance, had negative effects on other beneficial traits when fungicide pressure was removed, for example, some selected populations showed decreased germination or growth

  5. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system.

    PubMed

    Kepler, Ryan M; Ugine, Todd A; Maul, Jude E; Cavigelli, Michel A; Rehner, Stephen A

    2015-08-01

    Fungi in the genus Metarhizium are insect pathogens able to function in other niches, including soil and plant rhizosphere habitats. In agroecosystems, cropping and tillage practices influence soil fungal communities with unknown effects on the distribution of Metarhizium, whose presence can reduce populations of crop pests. We report results from a selective media survey of Metarhizium in soils sampled from a long-term experimental farming project in the mid-Atlantic region. Field plots under soybean cultivation produced higher numbers of Metarhizium colony-forming units (cfu) than corn or alfalfa. Plots managed organically and via chisel-till harboured higher numbers of Metarhizium cfu than no-till plots. Sequence typing of Metarhizium isolates revealed four species, with M. robertsii and M. brunneum predominating. The M. brunneum population was essentially fixed for a single clone as determined by multilocus microsatellite genotyping. In contrast, M. robertsii was found to contain significant diversity, with the majority of isolates distributed between two principal clades. Evidence for recombination was observed only in the most abundant clade. These findings illuminate multiple levels of Metarhizium diversity that can be used to inform strategies by which soil Metarhizium populations may be manipulated to exert downward pressure on pest insects and promote plant health.

  6. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex

    USDA-ARS?s Scientific Manuscript database

    A wild, forest-dwelling cockroach from the subfamily Ectobiidae (order Blattodea) in a nature reserve in Cavalcante, in the state of Goias, Brazil, was found to be infected by a new, genetically distinct species in the Metarhizium flavoviride species complex that we describe here as Metarhizium blat...

  7. Resistant ticks inhibit Metarhizium infection prior to hemocoel invasion by reducing fungal viability on the cuticle surface

    USDA-ARS?s Scientific Manuscript database

    We studied disease progression of, and host responses to, four species in the M. anisopliae complex expressing green fluorescent protein (GFP). We compared development and determined their relative levels of virulence against two susceptible arthropods, the cattle tick Rhipicephalus annulatus and th...

  8. Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps)

    PubMed Central

    Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2016-01-01

    ABSTRACT Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride. According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity. PMID:28003420

  9. Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps).

    PubMed

    Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2017-03-01

    Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity.

  10. Culture.

    PubMed

    Smith, Timothy B; Rodríguez, Melanie Domenech; Bernal, Guillermo

    2011-02-01

    This article summarizes the definitions, means, and research of adapting psychotherapy to clients' cultural backgrounds. We begin by reviewing the prevailing definitions of cultural adaptation and providing a clinical example. We present an original meta-analysis of 65 experimental and quasi-experimental studies involving 8,620 participants. The omnibus effect size of d = .46 indicates that treatments specifically adapted for clients of color were moderately more effective with that clientele than traditional treatments. The most effective treatments tended to be those with greater numbers of cultural adaptations. Mental health services targeted to a specific cultural group were several times more effective than those provided to clients from a variety of cultural backgrounds. We recommend a series of research-supported therapeutic practices that account for clients' culture, with culture-specific treatments being more effective than generally culture-sensitive treatments. © 2010 Wiley Periodicals, Inc.

  11. Conidial production, persistence and pathogenicity of hydromulch formulations of Metarhizium brunneum F52 microsclerotia under forest conditions

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia granules of Metarhizium brunneum Petch strain F52 (Hypocreales: Clavicipitaceae) in hydromulch (water, wheat straw, and tackifier) were sprayed onto bark or wood samples during two spray trials in 2013 and six spray trials in 2014. Microsclerotial granules in hydromulch continued to p...

  12. Effect of fermentation media on the production, efficacy and storage stability of Metarhizium brunneum microsclerotia formulated as a prototype granule

    USDA-ARS?s Scientific Manuscript database

    New liquid fermentation techniques for the production of the bioinsecticidal fungus Metarhizium brunneum strain F-52 have resulted in the formation of microsclerotia (MS), a compact, melonized-hyphal structure capable of surviving desiccation and formulation as dry granules. When rehydrated, these M...

  13. Specific diversity of the entomopathogenic fungi Beauveria and Metarhizium in Mexican agricultural soils.

    PubMed

    Pérez-González, Víctor H; Guzmán-Franco, Ariel W; Alatorre-Rosas, Raquel; Hernández-López, Jorge; Hernández-López, Antonio; Carrillo-Benítez, María G; Baverstock, Jason

    2014-06-01

    Prior knowledge of the local population structure of entomopathogenic fungi is considered an important requisite when developing microbial control strategies against major pests of crops such as white grubs. An extensive survey in the estate of Guanajuato, one of the main agricultural regions of Mexico, was carried out to determine the abundance and diversity of entomopathogenic fungi in soil. Soil collected from 11 locations was baited for entomopathogenic fungi using Galleria mellonella. In addition, all isolates were morphologically identified and selected isolates of Beauveria and Metarhizium isolates identified using Bloc and ITS or Elongation Factor 1-α and ITS sequence information respectively. Genotypic diversity was then studied using microsatellite genotyping. The proportion of isolates belonging to each genus varied amongst all locations. The species Beauveria bassiana, B. pseudobassiana and Metarhizium robertsii were found, with B. bassiana being the most abundant and widely distributed. Microsatellite genotyping showed that the 36 B. bassiana isolates were grouped in 29 unique haplotypes, but with no separation according to geographical origin.

  14. Dosage response mortality of Japanese beetle, masked chafer, and June beetle (Coleoptera: Scarabaeidae) adults when exposed to experimental and commercially available granules containing Metarhizium brunneum

    USDA-ARS?s Scientific Manuscript database

    Adult beetles of three different white grub species, Japanese beetle, Popillia japonica, June beetle, Phyllophaga spp., and masked chafer, Cyclocephala spp. were exposed to experimental and commercially available granules containing Metarhizium brunneum (Petch) strain F52, to determine susceptibilit...

  15. Biocontrol Potential of Siderophore Producing Heavy Metal Resistant Alcaligenes sp. and Pseudomonas aeruginosa RZS3 vis-à-vis Organophosphorus Fungicide.

    PubMed

    Sayyed, R Z; Patel, P R

    2011-07-01

    In present study in vitro phytopathogen suppression activity of siderophoregenic preparations of Ni and Mn resistant Alcaligenes sp. STC1 and Pseudomonas aeruginosa RZS3 SH-94B isolated from soil were found superior over the chemical pesticide. Siderophore rich culture broth and siderophore rich supernatant exerted antifungal activity against Aspergillus niger NCIM 1025, Aspergillus flavus NCIM 650, Fusarium oxysporum NCIM 1281, Alternaria alternata ARI 715, Cercospora arachichola, Metarhizium anisopliae NCIM 1311 and Pseudomonas solanacerum NCIM 5103. Siderophore rich broth and supernatant exhibited potent antifungal activity vis-à-vis oraganophosphorus chemical fungicide; kitazine. The minimum fungicidal concentration required was 25 μl for Aspergillus niger, Aspergillus flavus, Fusarium oxysporum, Cercospora arachichola, Metarhizium anisopliae, Pseudomonas solanacerum and 75 μl for A. alternata.

  16. Culture.

    ERIC Educational Resources Information Center

    1997

    Twelve conference papers on cultural aspects of second language instruction include: "Towards True Multiculturalism: Ideas for Teachers" (Brian McVeigh); Comparing Cultures Through Critical Thinking: Development and Interpretations of Meaningful Observations" (Laurel D. Kamada); "Authority and Individualism in Japan and the…

  17. UV-B radiation-related effects on conidial inactivation and virulence against Ceratitis capitata (Wiedemann) (Diptera; Tephritidae) of phylloplane and soil Metarhizium sp. strains.

    PubMed

    Fernández-Bravo, María; Flores-León, Alejandro; Calero-López, Salvador; Gutiérrez-Sánchez, Fernando; Valverde-García, Pablo; Quesada-Moraga, Enrique

    2017-09-01

    Recent studies have demonstrated the presence of Metarhizium species on the epigeal areas of weeds and woody plants in various Mediterranean ecosystems, and the question arises whether isolates from the phylloplane, which experiences greater exposure to environmental UV-B radiation than soil isolates do, could have better UV-B radiation tolerance. The in vitro response of 18 Metarhizium strains isolated from phylloplane and soil of several Mediterranean ecosystems to UV-B radiation and the in vitro and in vivo effects of UV-B radiation on the viability and virulence of a selected M. brunneum strain against C. capitata were determined. The conidial germination, culturability and colony growth of these strains exposed to 1200mWm(-2) for 2, 4 or 6h were evaluated. Germination rates below 30% and poor conidia recovery rates were observed for all strains. However, no relationship between the Metarhizium species or isolation habitat and the effect of UV-B radiation was found. Strain EAMa 01/58-Su, which showed a high tolerance to UV-B inactivation in terms of relative germination, was subsequently selected to investigate the UV-B related effects on virulence toward C. capitata adults. In a series of bioassays, the virulence and viability was determined using pure dry conidia, which were irradiated with 1200mWm(-2) for 6h prior or after adult flies were inoculated, which resulted in a significant 84.7-86.4% decrease in conidial viability but only a slightly significant reduction of virulence, with 100.0% and 91.4% adult mortality rates and 4.6 and 5.9days average survival time for the no UV-B and UV-B treatments, respectively. A second series of experiments was performed to determine whether the UV-B effects on strain EAMa 01/58-Su were dose- or exposure time-dependent. Adult flies were inoculated with five doses (1.0×10(4)-1.0×10(8)conidiaml(-1)) and then irradiated at 1200mWm(-2) for 6h, and similar LC50 values, 3.8×10(7) and 4.3×10(7)conidiaml(-1), were determined

  18. Exposure of Metarhizium acridum mycelium to light induces tolerance to UV-B radiation.

    PubMed

    Brancini, Guilherme T P; Rangel, Drauzio E N; Braga, Gilberto Ú L

    2016-03-01

    Metarhizium acridum is an entomopathogenic fungus commonly used as a bioinsecticide. The conidium is the fungal stage normally employed as field inoculum in biological control programs and must survive under field conditions such as high ultraviolet-B (UV-B) exposure. Light, which is an important stimulus for many fungi, has been shown to induce the production of M. robertsii conidia with increased stress tolerance. Here we show that a two-hour exposure to white or blue/UV-A light of fast-growing mycelium induces tolerance to subsequent UV-B irradiation. Red light, however, does not have the same effect. In addition, we established that this induction can take place with as little as 1 min of white-light exposure. This brief illumination scheme could be relevant in future studies of M. acridum photobiology and for the production of UV-B resistant mycelium used in mycelium-based formulations for biological control.

  19. A strong promoter, PMagpd, provides a tool for high gene expression in entomopathogenic fungus, Metarhizium acridum.

    PubMed

    Cao, Yueqing; Jiao, Run; Xia, Yuxian

    2012-03-01

    A glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter (PMagpd) was obtained from Metarhizium acridum and its active region analyzed by 5'-deletion strategy using β-glucuronidase (GUS) as a reporter. Sequence analysis revealed that typical regulatory elements of PMagpd were included in the 1.7 kb region upstream of the start codon of the Magpd gene. Deletion of the region from -1,691 bp to -1,463 bp, where the gpd box is harbored, did not significantly affect the PMagpd activity. Deletions of the regions upstream of -946 bp and upstream of -684 bp caused a major decrease of GUS activity. Compared with PgpdA (2.2 kb) in Aspergillus nidulans, PMagpd (1.4 kb) had a shorter sequence and significantly higher activity in M. acridum. This study provides an applicable promoter for over-expression of target genes in M. acridum.

  20. Insecticidal Activity of a Destruxin-Containing Extract of Metarhizium brunneum Against Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Lozano-Tovar, M D; Garrido-Jurado, I; Lafont, F; Quesada-Moraga, E

    2015-04-01

    Tephritid fruit flies are major pests that limit fruit production around the world; they cause important damages, increasing directly and indirectly annual costs, and their management is predominately based on the use of chemical insecticides. This research investigated the insecticidal activity of the crude extract obtained of Metarhizium brunneum Petch EAMb 09/01-Su strain and its capacity to secrete secondary metabolites including destruxins (dtx). Dtx A and A2 had insecticidal activity against Ceratitis capitata (Wiedemann) when administered per os. The crude extract of seven Metarhizium and one Beauveria isolates were evaluated per os against medfly adults. The crude extracts of the isolate EAMb 09/01-Su resulted in mortality ranging between 95 and 100% at 48 h. The high-pressure liquid chromatography profile showed two active peaks (F5B and F6 subfractions) related with dtx A2 and dtx A, which caused 70 and 100% mortality on C. capitata at 48 h postfeeding, respectively. The LC50 was 104.92 ppm of dtx A, contained in the F6 subfraction, and the LT50 was 4.16 h at a concentration of 400 ppm of dtx A contained in the F6 subfraction. Moreover, the average survival time of adults exposed to this subfraction was 12.6 h with only 1 h of exposure. The insecticide metabolites of the F6 subfraction of the EAMb 09/01-Su isolate retained >90% of its insecticidal activity after exposure to 60°C for 2 h and 120°C for 20 min. These results highlight the potential of this strain as a source of new insecticidal compounds of natural origin for fruit fly control.

  1. Variability in the insect and plant adhesins, Mad1 and Mad2, within the fungal genus metarhizium suggest plant adaptation as an evolutionary force.

    PubMed

    Wyrebek, Michael; Bidochka, Michael J

    2013-01-01

    Several species of the insect pathogenic fungus Metarhizium are associated with certain plant types and genome analyses suggested a bifunctional lifestyle; as an insect pathogen and as a plant symbiont. Here we wanted to explore whether there was more variation in genes devoted to plant association (Mad2) or to insect association (Mad1) overall in the genus Metarhizium. Greater divergence within the genus Metarhizium in one of these genes may provide evidence for whether host insect or plant is a driving force in adaptation and evolution in the genus Metarhizium. We compared differences in variation in the insect adhesin gene, Mad1, which enables attachment to insect cuticle, and the plant adhesin gene, Mad2, which enables attachment to plants. Overall variation for the Mad1 promoter region (7.1%), Mad1 open reading frame (6.7%), and Mad2 open reading frame (7.4%) were similar, while it was higher in the Mad2 promoter region (9.9%). Analysis of the transcriptional elements within the Mad2 promoter region revealed variable STRE, PDS, degenerative TATA box, and TATA box-like regions, while this level of variation was not found for Mad1. Sequences were also phylogenetically compared to EF-1α, which is used for species identification, in 14 isolates representing 7 different species in the genus Metarhizium. Phylogenetic analysis demonstrated that the Mad2 phylogeny is more congruent with 5' EF-1α than Mad1. This would suggest that Mad2 has diverged among Metarhizium lineages, contributing to clade- and species-specific variation, while it appears that Mad1 has been largely conserved. While other abiotic and biotic factors cannot be excluded in contributing to divergence, these results suggest that plant relationships, rather than insect host, have been a major driving factor in the divergence of the genus Metarhizium.

  2. Cultural

    Treesearch

    Wilbur F. LaPage

    1971-01-01

    A critical look at outdoor recreation research and some underlying premises. The author focuses on the concept of culture as communication and how it influences our perception of problems and our search for solutions. Both outdoor recreation and science are viewed as subcultures that have their own bodies of mythology, making recreation problems more difficult to...

  3. Explaining mycoinsecticide activity: poor performance of spray and bait formulations of Beauveria bassiana and Metarhizium brunneum against Mormon cricket in field cage studies

    USDA-ARS?s Scientific Manuscript database

    Our objectives were threefold: (1) to evaluate B. bassiana GHA and M. anisopliae F52 for potential use against Mormon cricket (Anabrus simplex Haldeman); (2) to compare spray and bait formulations of each fungus against immature and adult Mormon cricket; and (3) to understand the effect of optimal a...

  4. Wright-Giemsa staining to observe phagocytes in Locusta migratoria infected with Metarhizium acridum.

    PubMed

    Yu, Ying; Cao, Yueqing; Xia, Yuxian; Liu, Feihong

    2016-09-01

    Hemocytes are the first line of defense in the invertebrate immune system. Understanding their roles in cellular immunity is important for developing more efficient mycoinsecticides. However, the exact classification of hemocytes has been inconsistent and the various types of phagocytes in Locusta migratoria are poorly defined. Herein, the Wright-Giemsa staining method and microscopy were employed to characterize the hemocytes of L. migratoria following infection by Metarhizium acridum. Hemocytes were classified into four types, including granulocytes, plasmatocytes, prohemocytes, and oenocytoids, based on size, morphology, and dye-staining properties. Each type of hemocyte was classified into several subtypes according to different ultrastructural features. At least four subtypes of granulocytes or plasmatocytes, including small-nucleus plasmatocytes, basophil vacuolated plasmatocytes, homogeneous plasmatocytes, and eosinophilic granulocytes, carried out phagocytosis. The percentage of total phagocytes increased two days after infection by M. acridum, then gradually declined during the next two days, and then increased sharply again at the fifth day. Our data suggested that plasmatocytes and granulocytes may be the major phagocytes that protect against invasion by a fungal pathogen in L. migratoria. Total hemocytes in locusts significantly increased in the initial days after infection and decreased in the late period of infection compared to controls. In the hemocoel, hyphal bodies were recognized, enwrapped, and digested by the phagocytes. Then, the broken hyphal pieces were packaged as vesicles to be secreted from the cell. Moreover, locusts might have a sensitive and efficient cellular immune system that can regulate phagocyte differentiation and proliferation before fungi colonize the host hemolymph.

  5. MrSkn7 Controls Sporulation, Cell Wall Integrity, Autolysis, and Virulence in Metarhizium robertsii

    PubMed Central

    Shang, Yanfang; Chen, Peilin; Chen, Yixiong; Lu, Yuzhen

    2015-01-01

    Two-component signaling pathways generally include sensor histidine kinases and response regulators. We identified an ortholog of the response regulator protein Skn7 in the insect-pathogenic fungus Metarhizium robertsii, which we named MrSkn7. Gene deletion assays and functional characterizations indicated that MrSkn7 functions as a transcription factor. The MrSkn7 null mutant of M. robertsii lost the ability to sporulate and had defects in cell wall biosynthesis but was not sensitive to oxidative and osmotic stresses compared to the wild type. However, the mutant was able to produce spores under salt stress. Insect bioassays using these spores showed that the virulence of the mutant was significantly impaired compared to that of the wild type due to the failures to form the infection structure appressorium and evade host immunity. In particular, deletion of MrSkn7 triggered cell autolysis with typical features such as cell vacuolization, downregulation of repressor genes, and upregulation of autolysis-related genes such as extracellular chitinases and proteases. Promoter binding assays confirmed that MrSkn7 could directly or indirectly control different putative target genes. Taken together, the results of this study help us understand the functional divergence of Skn7 orthologs as well as the mechanisms underlying the development and control of virulence in insect-pathogenic fungi. PMID:25710964

  6. Genome-wide identification of pathogenicity, conidiation and colony sectorization genes in Metarhizium robertsii.

    PubMed

    Zeng, Guohong; Chen, Xiaoxuan; Zhang, Xing; Zhang, Qiangqiang; Xu, Chuan; Mi, Wubin; Guo, Na; Zhao, Hong; You, Yue; Dryburgh, Farah-Jade; Bidochka, Michael J; St Leger, Raymond J; Zhang, Lei; Fang, Weiguo

    2017-04-26

    Metarhizium robertsii occupies a wide array of ecological niches and has diverse lifestyle options (saprophyte, insect pathogen and plant symbiont), that renders it an unusually effective model for studying genetic mechanisms for fungal adaptation. Here over 20,000 M. robertsii T-DNA mutants were screened in order to elucidate genetic mechanism by which M. robertsii replicates and persists in diverse niches. About 287 conidiation, colony sectorization or pathogenicity loci, many of which have not been reported in other fungi were identified. By analysing a series of conidial pigmentation mutants, a new fungal pigmentation gene cluster, which contains Mr-Pks1, Mr-EthD and Mlac1 was identified. A conserved conidiation regulatory pathway containing Mr-BrlA, Mr-AbaA and Mr-WetA regulates expression of these pigmentation genes. During conidiation Mr-BlrA up-regulates Mr-AbaA, which in turn controls Mr-WetA. It was found that Hog1-MAPK regulates fungal conidiation by controlling the conidiation regulatory pathway, and that all three pigmentation genes exercise feedback regulation of conidiation. This work provided the foundation for deeper understanding of the genetic processes behind M. robertsii adaptive phenotypes, and advances our insights into conidiation and pigmentation in this fungus. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. New natural products isolated from Metarhizium robertsii ARSEF 23 by chemical screening and identification of the gene cluster through engineered biosynthesis in Aspergillus nidulans A1145.

    PubMed

    Kato, Hiroki; Tsunematsu, Yuta; Yamamoto, Tsuyoshi; Namiki, Takuya; Kishimoto, Shinji; Noguchi, Hiroshi; Watanabe, Kenji

    2016-07-01

    To rapidly identify novel natural products and their associated biosynthetic genes from underutilized and genetically difficult-to-manipulate microbes, we developed a method that uses (1) chemical screening to isolate novel microbial secondary metabolites, (2) bioinformatic analyses to identify a potential biosynthetic gene cluster and (3) heterologous expression of the genes in a convenient host to confirm the identity of the gene cluster and the proposed biosynthetic mechanism. The chemical screen was achieved by searching known natural product databases with data from liquid chromatographic and high-resolution mass spectrometric analyses collected on the extract from a target microbe culture. Using this method, we were able to isolate two new meroterpenes, subglutinols C (1) and D (2), from an entomopathogenic filamentous fungus Metarhizium robertsii ARSEF 23. Bioinformatics analysis of the genome allowed us to identify a gene cluster likely to be responsible for the formation of subglutinols. Heterologous expression of three genes from the gene cluster encoding a polyketide synthase, a prenyltransferase and a geranylgeranyl pyrophosphate synthase in Aspergillus nidulans A1145 afforded an α-pyrone-fused uncyclized diterpene, the expected intermediate of the subglutinol biosynthesis, thereby confirming the gene cluster to be responsible for the subglutinol biosynthesis. These results indicate the usefulness of our methodology in isolating new natural products and identifying their associated biosynthetic gene cluster from microbes that are not amenable to genetic manipulation. Our method should facilitate the natural product discovery efforts by expediting the identification of new secondary metabolites and their associated biosynthetic genes from a wider source of microbes.

  8. A proteomic approach to identifying proteins differentially expressed in conidia and mycelium of the entomopathogenic fungus Metarhizium acridum.

    PubMed

    Barros, Bruno H R; da Silva, Sérgio H; dos ReisMarques, Everaldo Dos Reis; Rosa, José C; Yatsuda, Ana Patrícia; Roberts, Donald W; Braga, Gilberto U L

    2010-07-01

    Metarhizium spp. is an important worldwide group of entomopathogenic fungi used as an interesting alternative to chemical insecticides in programs of agricultural pest and disease vector control. Metarhizium conidia are important in fungal propagation and also are responsible for host infection. Despite their importance, several aspects of conidial biology, including their proteome, are still unknown. We have established conidial and mycelial proteome reference maps for Metarhizium acridum using two-dimensional gel electrophoresis (2-DE) and matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF MS). In all, 1130±102 and 1200±97 protein spots were detected in ungerminated conidia and fast-growing mycelia, respectively. Comparison of the two protein-expression profiles reveled that only 35% of the protein spots were common to both developmental stages. Out of 94 2-DE protein spots (65 from conidia, 25 from mycelia and two common to both) analyzed using mass spectrometry, seven proteins from conidia, 15 from mycelia and one common to both stages were identified. The identified protein spots exclusive to conidia contained sequences similar to known fungal stress-protector proteins (such as heat shock proteins (HSP) and 6-phosphogluconate dehydrogenase) plus the fungal allergen Alt a 7, actin and the enzyme cobalamin-independent methionine synthase. The identified protein spots exclusive to mycelia included proteins involved in several cell housekeeping biological processes. Three proteins (HSP 90, 6-phosphogluconate dehydrogenase and allergen Alt a 7) were present in spots in conidial and mycelial gels, but they differed in their locations on the two gels.

  9. Metarhizium pingshaense applied as a seed treatment induces fungal infection in larvae of the white grub Anomala cincta.

    PubMed

    Peña-Peña, A J; Santillán-Galicia, M T; Hernández-López, J; Guzmán-Franco, A W

    2015-09-01

    Metarhizium pingshaense has potential as a control agent of the white grub Anomala cincta. We compared its ability to cause infection when applied as a seed treatment or directly to the compost around the plant roots. Although the greatest infection (93%) occured in the direct inoculation treatment, 50% of larvae still became infected by M. pingshaense applied as a seed treatment. The fungus persisted in the compost and also colonised the roots of the developing maize plants endophytically. More research is required but seed treatments with M. pingshaense have potential as cost-effective control options for A. cincta.

  10. Impact of metarhizium brunneum petch clavicipitaceae (Hypocreales) on pre-imaginal Rhagoletis indifferens (Diptera: Tephritidae) within and on the surface of orchard soil

    USDA-ARS?s Scientific Manuscript database

    When last instar laboratory-reared Rhagoletis indifferens were allowed to pupate within non-sterile orchard soil containing Metarhizium brunneum isolate F52 conidia, a dose related proportion died from developmental abnormalities and mycosis. Similarly, when last instar larvae entered soil that was ...

  11. Impact of Metarhizium brunneum (Hypocreales: Clavicipitaceae) on pre-imaginal Rhagoletis indifferens (Diptera: Tephritidae) within and on the surface of orchard soil

    USDA-ARS?s Scientific Manuscript database

    When last instar laboratory-reared Rhagoletis indifferens (Cherry Fruit Fly) were allowed to pupate within non-sterile orchard soil containing incorporated Metarhizium brunneum isolate F52 conidia, a dose-related proportion died from developmental abnormalities and mycosis. Similarly, when prepupal ...

  12. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system

    USDA-ARS?s Scientific Manuscript database

    Fungi in the genus Metarhizium are facultative pathogens of insects with the capacity to function in other niches, including soil and plant rhizosphere habitats. In agroecosystems, cropping and tillage practices heavily influence soil fungal communities with unknown effects on the distribution of M...

  13. Development of a user-friendly delivery method for the fungus Metarhizium anisopliac to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies

    USDA-ARS?s Scientific Manuscript database

    A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducte...

  14. Simulated aerial sprays for field cage evaluation of Beauveria bassiana and Metarhizium brunneum (Ascomycetes: Hypocreales) against Anabrus simplex (Orthoptera: Tettigoniidae) in Montana

    USDA-ARS?s Scientific Manuscript database

    Field efficacy of the entomopathogenic Ascomycete Beauveria bassiana strain GHA and Metarhizium brunneum strain F52 was evaluated against nymphs of the Mormon cricket, Anabrus simplex. Fungi were applied with a new apparatus that allows simulated aerial sprays to 0.1m2 areas in the field. The Mormon...

  15. Differential Pathogenicity of Metarhizium Blastospores and Conidia Against Larvae of Three Mosquito Species.

    PubMed

    Alkhaibari, A M; Carolino, A T; Bull, J C; Samuels, R I; Butt, T M

    2017-05-01

    Biorational insecticides are being increasingly used in integrated pest management programs. In laboratory bioassays, the pathogenicity of blastospores and conidia of the entomopathogenic fungus Metarhizium brunneum ARSEF 4556 was evaluated against larvae of three mosquito species. Three propagule concentrations (1 × 106, 1 × 107, and 1 × 108 spores ml - 1) were used in the bioassays. Results showed that Aedes aegypti had lower survival rates when exposed to blastospores than when exposed to conidia, whereas the converse was true for Culex quinquefasciatus larvae. Anopheles stephensi larvae survival rates were similar when exposed to blastospores and conidia, except at the higher doses, where blastospores were more virulent. Several assays showed little difference in mortalities when using either 1 × 107 or 1 × 108 spores ml - 1, suggesting a threshold above which no higher control levels or economic benefit would be achieved. When tested at the lowest dose, the LT50 of Cx. quinquefasciatus using blastospores, wet conidia, and dry conidia was 3.2, 1.9, and 4.4 d, respectively. The LT50 of Ae. aegypti using blastospores, wet conidia, and dry conidia was 1.3, 3.3, and 6.2 d, respectively. The LT50 of An. stephensi using blastospores, wet conidia, and dry conidia was 2.0, 1.9, and 2.1 d, respectively. These observations suggest that for optimized control, two different formulations of the fungus may be needed when treating areas where there are mixed populations of Aedes, Anopheles, and Culex. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Genetic diversity and population structure of the Chinese Fungus Metarhizium rileyi causing green muscardine in silkworm.

    PubMed

    Zhang, Shengli; Chen, Xue; Luan, Fenggang; He, Lingmin; Pu, Shunchang; Li, Zengzhi

    2016-10-01

    Green muscardine caused by Metarhizium rileyi affects sericulture, and is typically enzootic and occurs frequently at low incidence. We collected 152 M. rileyi isolates from silkworm cadavers in eight sericulture areas in seven provinces of China, and four strains from other Lepidoptera larvae in Qianshan(QS) County, Anhui province. Nine microsatellite inter-simple sequence repeat (ISSR) primers produced 91 distinct and reproducible bands, revealing a high level (90.11%) of DNA polymorphism. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) cluster analysis divided the populations into four groups, with isolates from Qianshan County forming a single branch. All the 156 M. rileyi isolates were heterogenic and polyphyletic and did not displayed typical regional distribution except strains from Qianshan country. PCA analysis of the nine populations of M. rileyi revealed similar phylogenies among accessions. Genetic differentiation index (Gst) among eight enzootic populations was 0.3789 and gene flow (Nm) was 0.4098, suggesting the low gene flow maintained a high degree of differentiation. Gst between the enzootic population of Qianshan County and other seven populations exceeded the threshold of severe differentiation, with moderate differentiation between the remaining seven enzootic populations. Analysis of molecular variance (AMOVA) showed most ISSR variation (61%) among isolates occurred within populations. No significant correlation was observed between geographical and genetic distance. According to cluster analysis based on single enzootic population, every enzootic population showed dominance, namely mainly constituted of strains with high genetic similarity. These data indicated that the green muscardine in each local silkworm population was predominantly caused by a native group of M. rileyi. Furthermore, Gst and Nm of M. rileyi from silkworm and other Lepidoptera larvae in Qianshan County were 0.1174 and 1.8791, respectively, suggesting strains

  17. Liquid Culture Production of Fungal Microsclerotia.

    PubMed

    Jackson, Mark A; Payne, Angela R

    2016-01-01

    Fungal microsclerotia ("small" sclerotia) are compact hyphal aggregates, typically 50-600 μm in diameter, that are formed under unfavorable nutritional and/or environmental conditions. These structures are often melanized and desiccated to some degree containing endogenous nutritional reserves for use when favorable conditions return. Many fungi, mostly plant pathogens, produce microsclerotia as a survival structure. Liquid culture methods have been developed for producing microsclerotia of the Ascomycota Metarhizium spp, Colletotrichum truncatum, Mycoleptodiscus terrestris, and Trichoderma spp. While these fungi have varying culture conditions that optimize microsclerotia production, all share common nutritional and environmental requirements for microsclerotia formation. Described are the general liquid culture techniques, media components, and harvesting and drying methods necessary to produce stable microsclerotial granules of these fungi.

  18. Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.

    PubMed

    Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo

    2017-04-01

    RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer (M. robertsiidcl1 [Mrdcl1] and Mrdcl2) and Argonaute (Mrago1 and Mrago2) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δdcl2 and Δago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δdcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δdcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δdcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsiiIMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role in regulating

  19. A high-throughput gene disruption methodology for the entomopathogenic fungus Metarhizium robertsii.

    PubMed

    Xu, Chuan; Zhang, Xing; Qian, Ying; Chen, Xiaoxuan; Liu, Ran; Zeng, Guohong; Zhao, Hong; Fang, Weiguo

    2014-01-01

    Systematic gene disruption is a direct way to interrogate a fungal genome to functionally characterize the full suite of genes involved in various biological processes. Metarhizium robertsii is extraordinarily versatile, and it is a pathogen of arthropods, a saprophyte and a beneficial colonizer of rhizospheres. Thus, M. robertsii can be used as a representative to simultaneously study several major lifestyles that are not shared by the "model" fungi Saccharomyces cerevisiae and Neurospora crassa; a systematic genetic analysis of M. robertsii will benefit studies in other fungi. In order to systematically disrupt genes in M. robertsii, we developed a high-throughput gene disruption methodology, which includes two technologies. One is the modified OSCAR-based, high-throughput construction of gene disruption plasmids. This technology involves two donor plasmids (pA-Bar-OSCAR with the herbicide resistance genes Bar and pA-Sur-OSCAR with another herbicide resistance gene Sur) and a recipient binary plasmid pPK2-OSCAR-GFP that was produced by replacing the Bar cassette in pPK2-bar-GFP with a ccdB cassette and recombination recognition sites. Using this technology, a gene disruption plasmid can be constructed in one cloning step in two days. The other is a highly efficient gene disruption technology based on homologous recombination using a Ku70 deletion mutant (ΔMrKu70) as the recipient strain. The deletion of MrKu70, a gene encoding a key component involved in nonhomologous end-joining DNA repair in fungi, dramatically increases the gene disruption efficiency. The frequency of disrupting the conidiation-associated gene Cag8 in ΔMrKu70 was 93% compared to 7% in the wild-type strain. Since ΔMrKu70 is not different from the wild-type strain in development, pathogenicity and tolerance to various abiotic stresses, it can be used as a recipient strain for a systematic gene disruption project to characterize the whole suite of genes involved in the biological processes of

  20. Behavioral and electrophysiological responses of Coptotermes formosanus Shiraki towards entomopathogenic fungal volatiles

    USDA-ARS?s Scientific Manuscript database

    Termites adjust their response to entomopathogenic fungi according to the profile of the fungal volatile organic compounds (VOCs). This study first demonstrated the pathogenicity of Metarhizium anisopliae, Beauveria bassiana and Isaria fumosorosea (=Paecilomyces fumosoroseus) towards the Formosan s...

  1. DIFFERENTIAL ALLERGIC AND NEUROTROPHIN RESPONSES TO FUNGAL COMPONENT EXTRACTS IN BALB/C MICE

    EPA Science Inventory

    Metarhizium anisopliae mycelium (MYC), conidia (CON) and inducible protease (IND) extracts were combined to produce the antigen MACA to screen for allergenic potential. Involuntary aspiration (IA) exposure to MACA in BALB/c mice has caused immune, inflammatory and physiological ...

  2. Isolation of endosymbionts from Ipomoea carnea and Swainsona canescens that produce swainsonine

    USDA-ARS?s Scientific Manuscript database

    Fungi including Metarhizium anisopliae (Clavicipitaceae), Rhizoctonia leguminicola (Ceratobasidiaceae), and Undifilum (Pleosporaceae), an endophyte found in the plant genera Astragalus and Oxytropis (Fabaceae) have been reported to be responsible for the production of swainsonine. Based upon the ass...

  3. DIFFERENTIAL ALLERGIC AND NEUROTROPHIN RESPONSES TO FUNGAL COMPONENT EXTRACTS IN BALB/C MICE

    EPA Science Inventory

    Metarhizium anisopliae mycelium (MYC), conidia (CON) and inducible protease (IND) extracts were combined to produce the antigen MACA to screen for allergenic potential. Involuntary aspiration (IA) exposure to MACA in BALB/c mice has caused immune, inflammatory and physiological ...

  4. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex.

    PubMed

    Montalva, Cristian; Collier, Karin; Rocha, Luiz Fernando Nunes; Inglis, Peter Ward; Lopes, Rogério Biaggioni; Luz, Christian; Humber, Richard A

    2016-05-01

    A wild, forest-dwelling cockroach from the subfamily Ectobiidae (order Blattodea) in a nature reserve in Cavalcante, in the state of Goiás, Brazil, was found to be infected by a new, genetically distinct species in the Metarhizium flavoviride species complex that we describe here as Metarhizium blattodeae. The status of this fungus as a new species is supported by both multigenic sequence comparisons and protein profiles generated by MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. This is one of the first reports of a naturally occurring fungal pathogen affecting any sylvatic (forest-dwelling) cockroach from any part of the world. M. blattodeae caused up to 96 % mortality of Periplaneta americana nymphs (a serious peridomestic cockroach species) after 10 d. Published by Elsevier Ltd.

  5. Effect of certain entomopathogenic fungi on oxidative stress and mortality of Periplaneta americana.

    PubMed

    Chaurasia, Abhilasha; Lone, Yaqoob; Wani, Owais; Gupta, U S

    2016-02-01

    The present paper reports the effects of Metarhizium anisopliae, Isaria fumosoroseus and Hirsutella thompsonaii on Periplaneta americana. I. fumosoroseus and H. thompsonaii were cultured at 28±1°C on potato carrot agar and M. anisopliae was cultured at 28±1°C on potato dextrose agar for 14days. Conidial suspensions of fungi were given to cockroaches through different routes. M. anisopliae shows high virulence against adult cockroaches and mortality ranges from 38.65% to 78.36% after 48h. I. fumosoroseus and H. thompsonii show less virulence compared to M. anisopliae. We also investigated the effect of these three fungi on the activity of lactate dehydrogenase, lipid peroxidation and catalase in different tissues of the insect to gain an understanding of the different target site. The result suggested that the activity of lactate dehydrogenase, catalase and level of malondialdehyde varies in different organs and through different routes of exposure. Based on mortality percentages, all tested fungi had high potentials for biocontrol agents against P. americana. Our study reveals for the first time that I. fumosoroseus and H. thompsonaii fungal infections initiate oxidative stress in the midgut, fat body, whole body and hemolymph of cockroach thereby suggesting them to be the target organs for oxidative damage.

  6. Efficacy of spray applications of entomopathogenic fungi against western flower thrips infesting greenhouse impatiens under variable moisture conditions

    USDA-ARS?s Scientific Manuscript database

    Efficacy tests of three entomopathogenic fungi (Beauveria bassiana strain GHA, Metarhizium brunneum strain F52, and Metarhizium anisopliae s.l. strain ESC-1) were conducted against thrips infesting greenhouse crops of single impatiens under variable moisture conditions. Fungal conidia suspended in 0...

  7. Expression of scorpion toxin LqhIT2 increases the virulence of Metarhizium acridum towards Locusta migratoria manilensis.

    PubMed

    Peng, Guoxiong; Xia, Yuxian

    2014-11-01

    LqhIT2 is an insect-specific neurotoxin from the venom of scorpion. In this study, the LqhIT2 gene was introduced into the entomopathogenic fungus, Metarhizium acridum. The virulence of the genetically modified strain MaLqhIT2 was then evaluated against locusts (Locusta migratoria manilensis). Compared with the wild-type strain, the median lethal cell density (LC50) for MaLqhIT2 was a 22.6-fold lower, and the median times to death (LT50) for MaLqhIT2 were reduced by 30.3 and 29.6 %, respectively, after topical inoculation and injection. MaLqhIT2 also grew significantly faster in the hemolymph than wild-type strain. There were no significant differences in germination, appressorium formation and sporulation in locust carcasses between the MaLqhIT2 and wild-type strain. These results indicate that LqhIT2 increased the virulence of M. acridum towards locusts by shortening the in vivo infection period, without affecting cuticle penetration or conidia formation in the carcasses. LqhIT2 thus shows considerable potential for increasing fungal virulence against locusts.

  8. Immune-physiological aspects of synergy between avermectins and the entomopathogenic fungus Metarhizium robertsii in Colorado potato beetle larvae.

    PubMed

    Tomilova, Oksana G; Kryukov, Vadim Yu; Duisembekov, Bahytzhan A; Yaroslavtseva, Olga N; Tyurin, Maksim V; Kryukova, Natalia A; Skorokhod, Valery; Dubovskiy, Ivan M; Glupov, Viktor V

    2016-10-01

    The interaction between the entomopathogenic fungus Metarhizium robertsii and natural avermectin metabolites of the actinomycete Streptomyces avermitilis were investigated on Colorado potato beetle larvae. A synergy in the mortality of larvae was detected after simultaneous treatment with half-lethal doses of avermectins (commercial name actarophit) 0.005% and fungus (5×10(5)conidia/ml). The treatment with avermectins led to rapid fungal colonization of the hemolymph. The defense strategies of insects infected by fungus and treated with avermectins and untreated insects were compared to investigate the mechanisms of this synergy. We have shown an increase in hemocytes, especially immunocompetent cells - plasmatocytes and granular cells in the initial stages of mycosis (third day post inoculation). In contrast, avermectins suppressed cellular immunity in hemolymph. Specifically, avermectins dramatically decreased the count of granular cells in larvae infected and uninfected with fungus. Apoptosis inducement and hemocyte necrosis under the influence of avermectins has been shown in vitro as one of the possible reasons for hemocyte mortality. In addition, avermectins enhanced the activity of phenoloxidases in integuments and hemolymph and increased the activity of glutathione-S-transferases activity in the fat body and hemolymph of infected and uninfected larvae, thereby intensifying the development of fungal infection by M. robertsii in Colorado potato beetle larvae. The combination of fungal infection and avermectins constitutes a new perspective for developing multicomponent bioinsecticides. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. The MrCYP52 Cytochrome P450 Monoxygenase Gene of Metarhizium robertsii Is Important for Utilizing Insect Epicuticular Hydrocarbons

    PubMed Central

    Lin, Liangcai; Fang, Weiguo; Liao, Xinggang; Wang, Fengqing; Wei, Dongzhi; St. Leger, Raymond J.

    2011-01-01

    Fungal pathogens of plants and insects infect their hosts by direct penetration of the cuticle. Plant and insect cuticles are covered by a hydrocarbon-rich waxy outer layer that represents the first barrier against infection. However, the fungal genes that underlie insect waxy layer degradation have received little attention. Here we characterize the single cytochrome P450 monoxygenase family 52 (MrCYP52) gene of the insect pathogen Metarhizium robertsii, and demonstrate that it encodes an enzyme required for efficient utilization of host hydrocarbons. Expressing a green florescent protein gene under control of the MrCYP52 promoter confirmed that MrCYP52 is up regulated on insect cuticle as well as by artificial media containing decane (C10), extracted cuticle hydrocarbons, and to a lesser extent long chain alkanes. Disrupting MrCYP52 resulted in reduced growth on epicuticular hydrocarbons and delayed developmental processes on insect cuticle, including germination and production of appressoria (infection structures). Extraction of alkanes from cuticle prevented induction of MrCYP52 and reduced growth. Insect bioassays against caterpillars (Galleria mellonella) confirmed that disruption of MrCYP52 significantly reduces virulence. However, MrCYP52 was dispensable for normal germination and appressorial formation in vitro when the fungus was supplied with nitrogenous nutrients. We conclude therefore that MrCYP52 mediates degradation of epicuticular hydrocarbons and these are an important nutrient source, but not a source of chemical signals that trigger infection processes. PMID:22194968

  10. The Bax inhibitor MrBI-1 regulates heat tolerance, apoptotic-like cell death, and virulence in Metarhizium robertsii

    PubMed Central

    Chen, Yixiong; Duan, Zhibing; Chen, Peilin; Shang, Yanfang; Wang, Chengshu

    2015-01-01

    Bax inhibitor 1 (BI-1) is a highly conserved protein originally identified as a suppressor of the proapoptotic protein Bax to inhibit cell death in animals and plants. The orthologs of BI-1 are widely distributed in filamentous fungi but their functions remain largely unknown. Herein, we report the identification and characterizations of MrBI-1, an ortholog of BI-1, in the entomopathogenic fungus Metarhizium robertsii. First, we found that MrBI-1 could partially rescue mammalian Bax-induced cell death in yeast. Deletion of MrBI-1 impaired fungal development, virulence and heat tolerance in M. robertsii. We also demonstrated that inactivation of MrBI-1 reduced fungal resistance to farnesol but not to hydrogen peroxide, suggesting that MrBI-1 contributes to antiapoptotic-like cell death via the endoplasmic reticulum stress-signaling pathway rather than the classical mitochondrium-dependent pathway. In particular, we found that unlike the observations in yeasts and plants, expression of mammalian Bax did not lead to a lethal effect in M. robertsii; however, it did aggravate the fungal apoptotic effect of farnesol. The results of this study advance our understanding of BI-1-like protein functions in filamentous fungi. PMID:26023866

  11. The Bax inhibitor MrBI-1 regulates heat tolerance, apoptotic-like cell death, and virulence in Metarhizium robertsii.

    PubMed

    Chen, Yixiong; Duan, Zhibing; Chen, Peilin; Shang, Yanfang; Wang, Chengshu

    2015-05-29

    Bax inhibitor 1 (BI-1) is a highly conserved protein originally identified as a suppressor of the proapoptotic protein Bax to inhibit cell death in animals and plants. The orthologs of BI-1 are widely distributed in filamentous fungi but their functions remain largely unknown. Herein, we report the identification and characterizations of MrBI-1, an ortholog of BI-1, in the entomopathogenic fungus Metarhizium robertsii. First, we found that MrBI-1 could partially rescue mammalian Bax-induced cell death in yeast. Deletion of MrBI-1 impaired fungal development, virulence and heat tolerance in M. robertsii. We also demonstrated that inactivation of MrBI-1 reduced fungal resistance to farnesol but not to hydrogen peroxide, suggesting that MrBI-1 contributes to antiapoptotic-like cell death via the endoplasmic reticulum stress-signaling pathway rather than the classical mitochondrium-dependent pathway. In particular, we found that unlike the observations in yeasts and plants, expression of mammalian Bax did not lead to a lethal effect in M. robertsii; however, it did aggravate the fungal apoptotic effect of farnesol. The results of this study advance our understanding of BI-1-like protein functions in filamentous fungi.

  12. Glycerol-3-Phosphate Acyltransferase Contributes to Triacylglycerol Biosynthesis, Lipid Droplet Formation, and Host Invasion in Metarhizium robertsii

    PubMed Central

    Gao, Qiang; Shang, Yanfang; Huang, Wei

    2013-01-01

    Enzymes involved in the triacylglycerol (TAG) biosynthesis have been well studied in the model organisms of yeasts and animals. Among these, the isoforms of glycerol-3-phosphate acyltransferase (GPAT) redundantly catalyze the first and rate-limiting step in glycerolipid synthesis. Here, we report the functions of mrGAT, a GPAT ortholog, in an insect-pathogenic fungus, Metarhizium robertsii. Unlike in yeasts and animals, a single copy of the mrGAT gene is present in the fungal genome and the gene deletion mutant is viable. Compared to the wild type and the gene-rescued mutant, the ΔmrGAT mutant demonstrated reduced abilities to produce conidia and synthesize TAG, glycerol, and total lipids. More importantly, we found that mrGAT is localized to the endoplasmic reticulum and directly linked to the formation of lipid droplets (LDs) in fungal cells. Insect bioassay results showed that mrGAT is required for full fungal virulence by aiding fungal penetration of host cuticles. Data from this study not only advance our understanding of GPAT functions in fungi but also suggest that filamentous fungi such as M. robertsii can serve as a good model to elucidate the role of the glycerol phosphate pathway in fungal physiology, particularly to determine the mechanistic connection of GPAT to LD formation. PMID:24077712

  13. Microsclerotia of Metarhizium brunneum F52 Applied in Hydromulch for Control of Asian Longhorned Beetles (Coleoptera: Cerambycidae).

    PubMed

    Goble, Tarryn A; Hajek, Ann E; Jackson, Mark A; Gardescu, Sana

    2015-04-01

    The entomopathogenic fungus Metarhizium brunneum (Petch) strain F52 (Hypocreales: Clavicipitaceae) is able to produce environmentally persistent microsclerotia (hyphal aggregates). Microsclerotia of strain F52 produced as granules and incorporated into hydromulch (hydro-seeding straw, water, and a natural glue) provides a novel mycoinsecticide that could be sprayed onto urban, forest, or orchard trees. We tested this formulation against adult Asian longhorned beetles (Anoplophora glabripennis (Motschulsky)) using three substrates (moistened bark, dry bark, absorbent bench liner) sprayed with a low rate (9 microsclerotia granules/cm2) of hydromulch. Median survival times of beetles continuously exposed to sprayed moist bark or absorbent liner were 17.5 and 19.5 d, respectively. Beetles exposed to sprayed dry bark, which had a lower measured water activity, lived significantly longer. When moist bark pieces were sprayed with increased rates of microsclerotia granules in hydromulch, 50% died by 12.5 d at the highest application rate, significantly sooner than beetles exposed to lower application rates (16.5-17.5 d). To measure fecundity effects, hydromulch with or without microsclerotia was sprayed onto small logs and pairs of beetles were exposed for a 2-wk oviposition period in containers with 98 or 66% relative humidity. At 98% humidity, oviposition in the logs was highest for controls (18.3±1.4 viable offspring per female) versus 3.9±0.8 for beetles exposed to microsclerotia. At 66% humidity, fecundities of controls and beetles exposed to microsclerotia were not significantly different. This article presents the first evaluation of M. brunneum microsclerotia in hydromulch applied for control of an arboreal insect pest. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Metabolomics Reveals the Heterogeneous Secretome of Two Entomopathogenic Fungi to Ex Vivo Cultured Insect Tissues

    PubMed Central

    de Bekker, Charissa; Smith, Philip B.; Patterson, Andrew D.; Hughes, David P.

    2013-01-01

    Fungal entomopathogens rely on cellular heterogeneity during the different stages of insect host infection. Their pathogenicity is exhibited through the secretion of secondary metabolites, which implies that the infection life history of this group of environmentally important fungi can be revealed using metabolomics. Here metabolomic analysis in combination with ex vivo insect tissue culturing shows that two generalist isolates of the genus Metarhizium and Beauveria, commonly used as biological pesticides, employ significantly different arrays of secondary metabolites during infectious and saprophytic growth. It also reveals that both fungi exhibit tissue specific strategies by a distinguishable metabolite secretion on the insect tissues tested in this study. In addition to showing the important heterogeneous nature of these two entomopathogens, this study also resulted in the discovery of several novel destruxins and beauverolides that have not been described before, most likely because previous surveys did not use insect tissues as a culturing system. While Beauveria secreted these cyclic depsipeptides when encountering live insect tissues, Metarhizium employed them primarily on dead tissue. This implies that, while these fungi employ comparable strategies when it comes to entomopathogenesis, there are most certainly significant differences at the molecular level that deserve to be studied. PMID:23940603

  15. On-host control of the brown dog tick Rhipicephalus sanguineus Latreille (Acari: Ixodidae) by Metarhizium brunneum (Hypocreales: Clavicipitaceae).

    PubMed

    Rot, A; Gindin, G; Ment, D; Mishoutchenko, A; Glazer, I; Samish, M

    2013-03-31

    Ticks are obligatory blood-sucking arthropods. Their life cycle includes a relatively short period of feeding on a vertebrate host and a long off-host period spent in the upper layer of the soil. Entomopathogenic fungi are known to be highly effective tick pathogens and the on-host application of these fungi may be a promising economic approach for tick control. In this study, we evaluated the tick control provided by spraying Metarhizium brunneum onto the tick's vertebrate host, specifically gerbils (Meriones tristrami) and rabbits (Oryctolagus cuniculus). The efficacy of the fungal treatment was not limited to a direct effect on the mortality of feeding ticks, but continued during molting (off host) and, in the case of female ticks, the treatment reduced the production of eggs and their hatching rate. The direct control of the on-host stages was relatively low (from 19 to 38%); whereas the effects of the applied fungus on subsequent tick development reduced the yield of the following engorged stages up to 30-63%. Engorged females that dropped from rabbits sprayed with M. brunneum laid 21.5% fewer eggs than the control females. Moreover, these ticks transmitted conidia by contact to the eggs which they laid, resulting a 3-fold reduction in the rate of hatching relative to the control. Based on theoretical cumulative calculations, these results suggest that if the progeny of each unfed stage feed on fungus-sprayed hosts, there will be a 92% reduction in the tick population within one generation. Two spray formulations, one based on mineral oil and another based on a starch-sucrose mixture, significantly enhanced on-host tick control, in comparison with an unformulated conidial suspension. The reduction in the number of nymphs that fed on the treated host and later developed into unfed adults was 54.9% for unformulated conidia, 70.4% for the oil formulation and 86.4% for the starch-sucrose formulation. Increasing the environmental humidity around the gerbils while

  16. Calcium gluconate as cross-linker improves survival and shelf life of encapsulated and dried Metarhizium brunneum and Saccharomyces cerevisiae for the application as biological control agents.

    PubMed

    Humbert, Pascal; Przyklenk, Michael; Vemmer, Marina; Patel, Anant V

    2017-02-01

    Calcium chloride (CC) is the most common cross-linker for the encapsulation of biocontrol microorganisms in alginate beads. The aim of this study was to evaluate if calcium gluconate (CG) can replace CC as cross-linker and at the same time improve viability after drying and rehydration, hygroscopic properties, shelf life and nutrient supply. Hence, the biocontrol fungi Metarhizium brunneum and Saccharomyces cerevisiae were encapsulated in Ca-alginate beads supplemented with starch. Beads were dried and maximum survival was found in beads cross-linked with CG. Beads prepared with CG showed lower hygroscopic properties, but a higher shelf life for encapsulated fungi. Moreover, we demonstrated that gluconate has a nutritive effect on encapsulated fungi, leading to increased mycelium growth of M. brunneum and to enhanced CO2 release from beads containing Saccharomyces cerevisiae. The application of CG as cross-linker will pave the way towards increasing drying survival and shelf life of various, especially drying-sensitive microbes.

  17. Fungal dermatitis, glossitis and disseminated visceral mycosis caused by different Metarhizium granulomatis genotypes in veiled chameleons (Chamaeleo calyptratus) and first isolation in healthy lizards.

    PubMed

    Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2017-08-01

    Metarhizium (M.) granulomatis (formerly Chamaeleomyces granulomatis) invariably causes fatal fungal glossitis and systemic mycosis in veiled chameleons (Chamaeleo calyptratus). Isolation of M. granulomatis in other lizards thus far has not been described. The aim of this study therefore was to obtain information on the presence of M. granulomatis in reptiles kept as pets, and to examine whether there was an association between specific genotypes and clinical/pathological outcomes. Besides 18S ribosomal (r) DNA (SSU) and internal transcribed spacer1-5.8S (ITS1-5.8S) rDNA, a fragment of the large subunit of the 28S rDNA (LSU), including the domains 1 (D1) and D2, were sequenced for identification of the fungus and phylogenetic analysis. Metarhizium granulomatis was isolated from 23 veiled chameleons, two panther chameleons (Furcifer pardalis) and one central bearded dragon (Pogona vitticeps). Only the veiled chameleons revealed corresponding pathological findings in the form of glossal hemorrhage, granulomatous glossitis, pharyngitis, dermatitis and/or visceral mycosis. The infection site correlated to survival times of infected veiled chameleons. Combined long-term treatment with terbinafine and nystatin based on susceptibility testing may be helpful for prevention of disease and visceral spreading of the fungus, but elimination of the fungal pathogen or successful treatment of diseased veiled chameleons have not been achieved yet. Sequencing of the ribosomal genes yielded five different genotypes, with genotype A being strongly correlated with dermatitis, and remaining genotypes with pharyngitis and glossitis. However, disseminated visceral mycosis developed irrespective of the genotypes. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Development of transgenic fungi that kill human malaria parasites in mosquitoes.

    PubMed

    Fang, Weiguo; Vega-Rodríguez, Joel; Ghosh, Anil K; Jacobs-Lorena, Marcelo; Kang, Angray; St Leger, Raymond J

    2011-02-25

    Metarhizium anisopliae infects mosquitoes through the cuticle and proliferates in the hemolymph. To allow M. anisopliae to combat malaria in mosquitoes with advanced malaria infections, we produced recombinant strains expressing molecules that target sporozoites as they travel through the hemolymph to the salivary glands. Eleven days after a Plasmodium-infected blood meal, mosquitoes were treated with M. anisopliae expressing salivary gland and midgut peptide 1 (SM1), which blocks attachment of sporozoites to salivary glands; a single-chain antibody that agglutinates sporozoites; or scorpine, which is an antimicrobial toxin. These reduced sporozoite counts by 71%, 85%, and 90%, respectively. M. anisopliae expressing scorpine and an [SM1](8):scorpine fusion protein reduced sporozoite counts by 98%, suggesting that Metarhizium-mediated inhibition of Plasmodium development could be a powerful weapon for combating malaria.

  19. Potential of Tenebrio molitor (Coleoptera: Tenebrionidae) as a bioassay probe for Metarhizium brunneum (Hypocreales: Clavicipitaceae) activity against Ixodes scapularis (Acari: Ixodidae).

    PubMed

    Bharadwaj, Anuja; Stafford, Kirby C

    2011-12-01

    The yellow mealworm, Tenebrio molitor L., has been used to indicate qualitatively the presence of entomopathogenic fungi in the soil or as a model for evaluating stress and other factors on fungal activity. Although this beetle appears highly susceptible to many of these fungi, little quantitative information is available on the sensitivity of T. molitor to a specific fungus and, therefore, fungal presence or as an indicator for pathogenicity to other species. The purpose of this study was to establish the suitability of T. molitor larvae as a bioassay probe for Metarhizium brunneum for comparison against the blacklegged tick, Ixodes scapularis. Nine concentrations of M. brunneum strain F52 ranging from 1.0 x 10(1) to 8.4 x 10(8) conidial/ml were simultaneously tested against T. molitor larvae and I. scapularis adults. Larvae of yellow mealworm were less sensitive to M. brunneum than I. scapularis adults (LC50's 4.4 x 10(7) and 1.7 x 10(5) conidia/ml, respectively, 4-wk post-treatment). The greater sensitivity of I. scapularis to the fungus suggests that the detection of fungal mycosis in mealworms would indicate sufficient inoculum to be pathogenic to I. scapularis and make this insect a suitable probe for evaluation of the presence and activity of M. brunneum against the blacklegged tick in field applications.

  20. Basic Leucine Zipper (bZIP) Domain Transcription Factor MBZ1 Regulates Cell Wall Integrity, Spore Adherence, and Virulence in Metarhizium robertsii *

    PubMed Central

    Huang, Wei; Shang, Yanfang; Chen, Peilin; Cen, Kai; Wang, Chengshu

    2015-01-01

    Transcription factors (TFs) containing the basic leucine zipper (bZIP) domain are widely distributed in eukaryotes and display an array of distinct functions. In this study, a bZIP-type TF gene (MBZ1) was deleted and functionally characterized in the insect pathogenic fungus Metarhizium robertsii. The deletion mutant (ΔMBZ1) showed defects in cell wall integrity, adhesion to hydrophobic surfaces, and topical infection of insects. Relative to the WT, ΔMBZ1 was also impaired in growth and conidiogenesis. Examination of putative target gene expression indicated that the genes involved in chitin biosynthesis were differentially transcribed in ΔMBZ1 compared with the WT, which led to the accumulation of a higher level of chitin in mutant cell walls. MBZ1 exhibited negative regulation of subtilisin proteases, but positive control of an adhesin gene, which is consistent with the observation of effects on cell autolysis and a reduction in spore adherence to hydrophobic surfaces in ΔMBZ1. Promoter binding assays indicated that MBZ1 can bind to different target genes and suggested the possibility of heterodimer formation to increase the diversity of the MBZ1 regulatory network. The results of this study advance our understanding of the divergence of bZIP-type TFs at both intra- and interspecific levels. PMID:25673695

  1. Interactions of two insect pathogens, Paranosema locustae (Protista: Microsporidia) and Metarhizium acridum (Fungi: Hypocreales), during a mixed infection of Locusta migratoria (Insecta: Orthoptera) nymphs.

    PubMed

    Tokarev, Yuri S; Levchenko, Maxim V; Naumov, Anton M; Senderskiy, Igor V; Lednev, Georgiy R

    2011-02-01

    Locusta migratoria nymphs were fed Paranosema locustae spores and/or surface-treated with Metarhizium acridum 3 (assay 1), 6 (assay 2) or 9 days (assay 3) post microsporidia application (p.m.a.). These three dates corresponded to the key phases of P. locustae development: (a) mass proliferation, (b) transition to sporogenesis and (c) onset of spore maturation, respectively. As a result, locust mortality due to mixed treatment increased slower, equally and faster, as compared to mortality expected from the combination of two pathogens in assays 1-3, respectively. However, a statistically significant difference in survival times was observed only in assay 3, indicating that only at the phase of spore maturation microsporidia drastically increase locust susceptibility to fungal infection. Analysis of perished nymphs showed that fungal treatment 3 days p.m.a. impeded development of microsporidia. Fungal sporulation on locust cadavers was not affected by co-occurring microsporidiosis. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. A bifunctional catalase-peroxidase, MakatG1, contributes to virulence of Metarhizium acridum by overcoming oxidative stress on the host insect cuticle.

    PubMed

    Li, Guohong; Fan, Anni; Peng, Guoxiong; Keyhani, Nemat O; Xin, Jiankang; Cao, Yueqing; Xia, Yuxian

    2017-09-19

    Microbial pathogens are exposed to damaging reactive oxygen species (ROS) produced from a variety of sources including chemical reactions due to exposure to stress (UV, heat) or by hosts as a defense response. Here we demonstrate that a bifunctional catalase-peroxidase, MakatG1, in the locust-specific fungal pathogen, Metarhizium acridum, functions as a ROS detoxification mechanism during host cuticle penetration. MakatG1 expression was highly induced during on-cuticle appressoria development as compared to vegetative (mycelia) growth or during in vivo growth in the insect hemocoel. A MakatG1 deletion mutant strain (ΔMakatG1) showed decreased catalase and peroxidase activities and significantly increased susceptibility to oxidative (H2 O2 and menadione) and UV stress as compared to wild type and complemented strains. Insect bioassays revealed significantly reduced virulence of the ΔMakatG1 mutant when topically inoculated, but no impairment when the insect cuticle was bypassed. Germination and appressoria formation rates for the ΔMakatG1 mutant were decreased on locust wings and quinone/phenolic compounds derived from locust wings, but were not affected on plastic surfaces compared with the wild type strain. These data indicate that MakatG1 plays a pivotal role in penetration, reacting to and detoxifying specific cuticular compounds present on the host cuticle during the early stages of fungal infection. This article is protected by copyright. All rights reserved. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Basic leucine zipper (bZIP) domain transcription factor MBZ1 regulates cell wall integrity, spore adherence, and virulence in Metarhizium robertsii.

    PubMed

    Huang, Wei; Shang, Yanfang; Chen, Peilin; Cen, Kai; Wang, Chengshu

    2015-03-27

    Transcription factors (TFs) containing the basic leucine zipper (bZIP) domain are widely distributed in eukaryotes and display an array of distinct functions. In this study, a bZIP-type TF gene (MBZ1) was deleted and functionally characterized in the insect pathogenic fungus Metarhizium robertsii. The deletion mutant (ΔMBZ1) showed defects in cell wall integrity, adhesion to hydrophobic surfaces, and topical infection of insects. Relative to the WT, ΔMBZ1 was also impaired in growth and conidiogenesis. Examination of putative target gene expression indicated that the genes involved in chitin biosynthesis were differentially transcribed in ΔMBZ1 compared with the WT, which led to the accumulation of a higher level of chitin in mutant cell walls. MBZ1 exhibited negative regulation of subtilisin proteases, but positive control of an adhesin gene, which is consistent with the observation of effects on cell autolysis and a reduction in spore adherence to hydrophobic surfaces in ΔMBZ1. Promoter binding assays indicated that MBZ1 can bind to different target genes and suggested the possibility of heterodimer formation to increase the diversity of the MBZ1 regulatory network. The results of this study advance our understanding of the divergence of bZIP-type TFs at both intra- and interspecific levels. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. [Natural ocurrence of entomopathogenic fungi in soils cultivated with Paraguay tea (Ilex paraguariensis St. Hil.) in Misiones, Argentina].

    PubMed

    Schapovaloff, María E; Angeli Alves, Luis F; Urrutia, María I; López Lastra, Claudia C

    2015-01-01

    This study aimed to morphologically isolate, identify and characterize entomopathogenic fungi present in soils cultivated with Paraguay tea (Ilex paraguariensis). A survey of native entomopathogenic fungi was conducted from 40 soil samples grown with Paraguay tea in the province of Misiones, Argentina, from May 2008 to June 2010. The soil dilution plate methodology on selective culture media was used to isolate microorganisms. Taxonomic identification was performed using macroscopic and microscopic characters and specific keys. Twenty nine strains, belonging to the species Beauveria bassiana (n = 17), Metarhizium anisopliae (n = 2) and Purpureocillium lilacinum (n = 10) were isolated and identified. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Characterization of a hydrophobin of the ascomycete Paecilomyces farinosus.

    PubMed

    Lunkenbein, Stefan; Takenberg, Meike; Nimtz, Manfred; Berger, Ralf G

    2011-08-01

    The entomopathogenic ascomycete Paecilomyces farinosus (alternative name Isaria farinosa) synthesized a hydrophobin, irrespective of being grown in submerged or surface culture. The protein was extracted using trifluoroacetic acid and purified using preparative HPLC and SDS-PAGE. Partial sequences were obtained using ESI-MS/MS. The peptides were used as a start to apply a 'template switching oligo' protocol to elucidate the complete open reading frame of P. farinosus hydrophobin 1 (pfah1). The deduced protein sequence comprised 107 amino acids (10.7 kDa) including a 16 amino acid long hydrophobic signal peptide, showed a calculated pI of 4.56, and was interrupted by one intron. Phylogenetic analyses revealed relationships to hydrophobins of the ascomycetes Magnaporthe grisea and Metarhizium anisopliae. Based on solubility, hydropathy pattern and phylogeny PfaH1 was assigned to the class Ia hydrophobins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Volatile organic compounds emitted by filamentous fungi isolated from flooded homes after Hurricane Sandy show toxicity in a Drosophila bioassay.

    PubMed

    Zhao, G; Yin, G; Inamdar, A A; Luo, J; Zhang, N; Yang, I; Buckley, B; Bennett, J W

    2016-10-17

    Superstorm Sandy provided an opportunity to study filamentous fungi (molds) associated with winter storm damage. We collected 36 morphologically distinct fungal isolates from flooded buildings. By combining traditional morphological and cultural characters with an analysis of ITS sequences (the fungal DNA barcode), we identified 24 fungal species that belong to eight genera: Penicillium (11 species), Fusarium (four species), Aspergillus (three species), Trichoderma (two species), and one species each of Metarhizium, Mucor, Pestalotiopsis, and Umbelopsis. Then, we used a Drosophila larval assay to assess possible toxicity of volatile organic compounds (VOCs) emitted by these molds. When cultured in a shared atmosphere with growing cultures of molds isolated after Hurricane Sandy, larval toxicity ranged from 15 to 80%. VOCs from Aspergillus niger 129B were the most toxic yielding 80% mortality to Drosophila after 12 days. The VOCs from Trichoderma longibrachiatum 117, Mucor racemosus 138a, and Metarhizium anisopliae 124 were relatively non-toxigenic. A preliminary analysis of VOCs was conducted using solid-phase microextraction-gas chromatography-mass spectrometry from two of the most toxic, two of the least toxic, and two species of intermediate toxicity. The more toxic molds produced higher concentrations of 1-octen-3-ol, 3-octanone, 3-octanol, 2-octen-1-ol, and 2-nonanone; while the less toxic molds produced more 3-methyl-1-butanol and 2-methyl-1-propanol, or an overall lower amount of volatiles. Our data support the hypothesis that at certain concentrations, some VOCs emitted by indoor molds are toxigenic.

  7. Dosage Response Mortality of Japanese Beetle, Masked Chafer, and June Beetle (Coleoptera: Scarabaeidae) Adults When Exposed to Experimental and Commercially Available Granules Containing Metarhizium brunneum.

    PubMed

    Behle, Robert W; Goett, Erica J

    2016-05-01

    Field-collected adults of three genera of turf-infesting scarabs, Japanese beetle (Popillia japonica Newman), June beetles (Phyllophaga spp.), and masked chafers (Cyclocephala spp.), were exposed to experimental and commercial granule formulations of the entomopathogenic fungus Metarhizium brunneum (Petch) strain F52 to determine their relative susceptibility. Experimental granules contained microsclerotia produced by liquid fermentation with the ability to produce fresh conidia when rehydrated and commercial granules were Met 52 granular bioinsecticide. All three groups of scarab adults showed a positive dosage response to the fungus when exposed in cups of potting mix treated with the granules. LC50 values for microsclerotia granules were 1.9 × 10(7), 7.1 × 10(6), and 3.2 × 10(6) conidia cup(-1) for P. japonica, Phyllophaga spp., and Cyclocephala spp., respectively. LC50 values for Met 52 granules were 5.9 × 10(7), 5.1 × 10(7), and 7.6 × 10(6) conidia cup(-1), respectively. The experimental granules containing microsclerotia show promise as a viable commercial control agent. They can be produced using lower cost fermentation methods and applied at lower dosages (97 g for 100 m(2) as opposed to 489 g per 100 m(2) for Met 52). If M. brunneum is applied to control the aforementioned white grubs, our data indicate the potential for the adult beetles to also be infected as they enter the soil to lay eggs.

  8. Directed evolution of a filamentous fungus for thermotolerance

    PubMed Central

    de Crecy, Eudes; Jaronski, Stefan; Lyons, Benjamin; Lyons, Thomas J; Keyhani, Nemat O

    2009-01-01

    Background Filamentous fungi are the most widely used eukaryotic biocatalysts in industrial and chemical applications. Consequently, there is tremendous interest in methodology that can use the power of genetics to develop strains with improved performance. For example, Metarhizium anisopliae is a broad host range entomopathogenic fungus currently under intensive investigation as a biologically based alternative to chemical pesticides. However, it use is limited by the relatively low tolerance of this species to abiotic stresses such as heat, with most strains displaying little to no growth between 35–37°C. In this study, we used a newly developed automated continuous culture method called the Evolugator™, which takes advantage of a natural selection-adaptation strategy, to select for thermotolerant variants of M. anisopliae strain 2575 displaying robust growth at 37°C. Results Over a 4 month time course, 22 cycles of growth and dilution were used to select 2 thermotolerant variants of M. anisopliae. Both variants displayed robust growth at 36.5°C, whereas only one was able to grow at 37°C. Insect bioassays using Melanoplus sanguinipes (grasshoppers) were also performed to determine if thermotolerant variants of M. anisopliae retained entomopathogenicity. Assays confirmed that thermotolerant variants were, indeed, entomopathogenic, albeit with complex alterations in virulence parameters such as lethal dose responses (LD50) and median survival times (ST50). Conclusion We report the experimental evolution of a filamentous fungus via the novel application of a powerful new continuous culture device. This is the first example of using continuous culture to select for complex phenotypes such as thermotolerance. Temperature adapted variants of the insect-pathogenic, filamentous fungus M. anisopliae were isolated and demonstrated to show vigorous growth at a temperature that is inhibitory for the parent strain. Insect virulence assays confirmed that pathogenicity

  9. Comparison of the effect of the chosen species of saprotrophic fungi on the development of Toxocara canis and Ascaris suum eggs.

    PubMed

    Mazurkiewicz-Zapałowicz, Kinga; Jaborowska-Jarmoluk, Magdalena; Kołodziejczyk, Lidia; Kuźna-Grygiel, Wanda

    2014-01-01

    The study aim was to compare the antagonistic interaction between saprotrophic soil fungi and embryonic development of geohelminths Toxocara canis and Ascaris suum. The experimental cultures were fertilized eggs of T.canis and A. suum incubated together with mycelium of strains: Fusarium culmorum, Metarhizium anisopliae,Paecilomyces fumosoroseus, Trichoderma viride and Trichothecium roseum. In the control cultures the eggs of both nematode species were incubated without fungi. The experiment was conducted at temp. 26°C for 60 days. Compared with the control, all of the tested species of fungi significantly extended the embryonic development of both T. canis and A. suum. Most inhibitory effect on the rate of embryonic development of T. canis and A. suum had three fungal species: P. fumosoreus, M. anisopliae and T. viride. Compared with the control, on the 60th day of incubation in the presence of each of the tested fungal species, a larger percentage (p<0.05) of morphological abnormalities was stated in developing embryos of T. canis (49–69%) than in A. suum (15.1–67.7%). Among the examined fungal species, only incubation with P. fumosoroseus resulted in significantly greater (p<0.05) incidence of embryonic malformations(embryopathies) in T. canis, as compared with A. suum. Also the percentage of dead larvae of T. canis in the control and in cultures with fungi (12% and 100%, respectively) was significantly higher in comparison with A. suum (0.5% and 10.3–36%, respectively). The highest percentage of non-viable larvae of A. suum was found in the presence of P.fumosoroseus, and the lowest in the presence of M. anisopliae. Findings may indicate that T. canis eggs are more sensitive to antagonistic interaction of the examined fungal strains than A. suum eggs.

  10. Root environment is a key determinant of fungal entomopathogen endophytism following seed treatment in the common bean, Phaseolus vulgaris

    USDA-ARS?s Scientific Manuscript database

    The common bean is the most important food legume in the world. We examined the potential of the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae applied as seed treatments for their endophytic establishment in the common bean. Endophytic colonization in sterile sand:peat average...

  11. Integrated control of sugarbeet root maggot by using resistant germplasm, an insect pathogen, and an insecticidal seed treatment

    USDA-ARS?s Scientific Manuscript database

    This investigation was carried out during the 2014 growing season to evaluate the following for SBRM management in the Red River Valley growing area: 1) a granular formulation of the fungal insect pathogen, Metarhizium anisopliae (Metschnikoff) Sorokin strain MA1200; 2) an experimental SBRM-resistan...

  12. Relationship of black vine weevil egg density and damage to two cranberry cultivars

    USDA-ARS?s Scientific Manuscript database

    Field and laboratory trials compared Metarhizium anisopliae and Steinernema kraussei to imidacloprid for black vine weevil (BVW), Otiorhynchus sulcatus, larval control in cranberry. Two field sites were treated in fall of 2009 and soil samples collected during 2009 and 2010 to assess treatment effic...

  13. Directed Evolution of a Filamentous Fungus for Thermotolerance

    USDA-ARS?s Scientific Manuscript database

    Filamentous fungi represent the most widely used eukaryotic biocatalysts in industrial and chemical applications. Metarhizium anisopliae is a broad-host-range entomopathogenic fungus currently under intensive investigation as a biologically based alternative to chemical pesticides. One of the most p...

  14. Effects of single and combined applications of entomopathogenic fungi and nematodes against Rhynchophorus ferrugineus (Olivier)

    USDA-ARS?s Scientific Manuscript database

    This study was carried out to investigate the insecticidal properties of Beauveria bassiana and Metarhizium anisopliae, and Heterorhabditis bacteriophora Poinar for their virulence against 2nd, 4th and 6th instar larvae of Rhynchophorus ferrugineus (Olivier). Both fungi were either applied alone or ...

  15. CATALASE FROM A FUNGAL MICROBIAL PESTICIDE INDUCES A UNIQUE IGE RESPONSE.

    EPA Science Inventory

    BALB/c mice exposed by involuntary aspiration to Metarhizium anisopliae extract (MACA), a microbial pesticide, have shown responses characteristic of human allergic lung disease/asthma. IgE-binding proteins have been identified in MACA by Western blot analysis, 2-dimensio...

  16. Molecular characterization and pathogenicity of fungal isolates for use against the small hive beetle (Aethina tumida)

    USDA-ARS?s Scientific Manuscript database

    The analysis of DNA sequences from fungal pathogens obtained from cadavers of the small hive beetle (SHB) collected from several apiaries in Florida revealed a mixture of saprobes and two potential primary entomopathogens, Metarhizium anisopliae and Beauveria bassiana. Spray tower bioassays indicate...

  17. Entomopathogenic Fungi (Hypocreales) for Control of Potato Psyllid

    USDA-ARS?s Scientific Manuscript database

    Laboratory and field trials of the four isolates of entomopathogenic fungi, Isaria fumosorosea and Metarhizium anisopliae were conducted to evaluate their potential for control of the potato psyllid. In the laboratory, 2 ml aqueous suspension of 107conidia/ml in a of each isolate applied in a Potte...

  18. CATALASE FROM A FUNGAL MICROBIAL PESTICIDE INDUCES A UNIQUE IGE RESPONSE.

    EPA Science Inventory

    BALB/c mice exposed by involuntary aspiration to Metarhizium anisopliae extract (MACA), a microbial pesticide, have shown responses characteristic of human allergic lung disease/asthma. IgE-binding proteins have been identified in MACA by Western blot analysis, 2-dimensio...

  19. Mass production of entomopathogenic hypocreales

    USDA-ARS?s Scientific Manuscript database

    The Hypocreales, Beauveria bassiana, Metarhizium anisopliae sensu lato, Isaria fumosorosea and I. farinosus, and Nomuraea rileyi, have become important insect control agents in recent times and consequently subjects of much scientific study and development. Mass production of infective stages is imp...

  20. Efficacy of entomopathogenic fungi in suppressing pecan weevil, Curculio caryae (Coleoptera: Curculionidae) in commercial pecan orchards

    USDA-ARS?s Scientific Manuscript database

    The pecan weevil, Curculio caryae (Horn), is a key pest of pecans. Here we report the efficacy of entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae applied to trees in grower orchards at three locations. In Fort Valley, Georgia, treatments included B. bassiana applied to the tru...

  1. Abundance of soil-borne entomopathogenic fungi in organic and conventional fields in the Midwestern USA with an emphasis on the effect of herbicides and fungicides on fungal persistence

    USDA-ARS?s Scientific Manuscript database

    Naturally-occurring entomopathogenic fungi provide a valued service of killing agricultural pests and subduing pest outbreaks. Species such as Beauveria bassiana and Metarhizium anisopliae have been researched in many experiments and have proven to be effective pathogens. This research will focus ...

  2. Urine Culture

    MedlinePlus

    ... Urinalysis ; Blood Culture ; Susceptibility Testing ; Bacterial Wound Culture ; Gram Stain ; Urine Protein All content on Lab Tests ... growing at high colony counts is considered a positive urine culture. For clean catch samples that have ...

  3. Urine culture

    MedlinePlus

    Culture and sensitivity - urine ... when urinating. You also may have a urine culture after you have been treated for an infection. ... when bacteria or yeast are found in the culture. This likely means that you have a urinary ...

  4. Safeguards Culture

    SciTech Connect

    Frazar, Sarah L.; Mladineo, Stephen V.

    2012-07-01

    The concepts of nuclear safety and security culture are well established; however, a common understanding of safeguards culture is not internationally recognized. Supported by the National Nuclear Security Administration, the authors prepared this report, an analysis of the concept of safeguards culture, and gauged its value to the safeguards community. The authors explored distinctions between safeguards culture, safeguards compliance, and safeguards performance, and evaluated synergies and differences between safeguards culture and safety/security culture. The report concludes with suggested next steps.

  5. Efficacy of entomopathogenic hypocrealean fungi against Periplaneta americana.

    PubMed

    Hubner-Campos, Rayssa Fátima; Leles, Renan Nunes; Rodrigues, Juscelino; Luz, Christian

    2013-12-01

    The American cockroach Periplaneta americana, one of the worlds' most important urban insect pests was tested with entomopathogenic fungi. Most promising Metarhizium anisopliae, Metarhizium robertsii and Beauveria bassiana killed nymphs (≥ 81.7% mortality, 25 days after treatment), and these fungi developed on all dead insects. Other fungi tested were less virulent (Metarhizium frigidum and Purpureocillium lilacinum) or avirulent (Isaria cateniobliqua, Isaria farinosa, Simplicillium lanosoniveum, Sporothrix insectorum and Tolypocladium cylindrosporum). Intrageneric and intraspecific variability of fungal activity was detected. Adults were highly susceptible, and oothecae proved to be more resistant than nymphs and adults to infection with M. anisopliae IP 46. Findings of the study underscore the potential of fungi as biocontrol agents against this pest.

  6. Development of a population-based threshold model of conidial germination for analysing the effects of physiological manipulation on the stress tolerance and infectivity of insect pathogenic fungi.

    PubMed

    Andersen, M; Magan, N; Mead, A; Chandler, D

    2006-09-01

    Entomopathogenic fungi are being used as biocontrol agents of insect pests, but their efficacy can be poor in environments where water availability is reduced. In this study, the potential to improve biocontrol by physiologically manipulating fungal inoculum was investigated. Cultures of Beauveria bassiana, Lecanicillium muscarium, Lecanicillium longisporum, Metarhizium anisopliae and Paecilomyces fumosoroseus were manipulated by growing them under conditions of water stress, which produced conidia with increased concentrations of erythritol. The time-course of germination of conidia at different water activities (water activity, aw) was described using a generalized linear model, and in most cases reducing the water activity of the germination medium delayed the onset of germination without affecting the distribution of germination times. The germination of M. anisopliae, L. muscarium, L. longisporum and P. fumosoroseus was accelerated over a range of aw levels as a result of physiological manipulation. However, the relationship between the effect of physiological manipulation on germination and the osmolyte content of conidia varied according to fungal species. There was a linear relationship between germination rate, expressed as the reciprocal of germination time, and aw of the germination medium, but there was no significant effect of fungal species or physiological manipulation on the aw threshold for germination. In bioassays with M. anisopliae, physiologically manipulated conidia germinated more rapidly on the surface of an insect host, the melon cotton aphid Aphis gossypii, and fungal virulence was increased even when relative humidity was reduced after an initial high period. It is concluded that physiological manipulation may lead to improvements in biocontrol in the field, but choice of fungal species/isolate will be critical. In addition, the population-based threshold model used in this study, which considered germination in terms of physiological

  7. Cultural psychology.

    PubMed

    Heine, Steven J; Ruby, Matthew B

    2010-03-01

    Humans are a cultural species, constantly navigating a complex web of culturally bound practices, norms, and worldviews. This article provides a brief overview of the relatively young field of cultural psychology, which investigates the many ways psychology and culture interweave with one another. Highlighting the cultural nature of the human species, it draws upon research on cultural evolution, enculturation, and developmental processes. This review further summarizes a number of cultural differences in how people perceive the self, and the behavioral consequences that follow from these differences, in the domains of internal and external attribution styles, motivations for self-enhancement, approach/avoidance, primary and secondary control, as well as motivations for distinctiveness and conformity. Additionally, the review discusses research on the intersection of culture and emotion, as well as cultural differences in cognition, perception, and reasoning. Copyright © 2010 John Wiley & Sons, Ltd. For further resources related to this article, please visit the WIREs website. Copyright © 2010 John Wiley & Sons, Ltd.

  8. Cultural Neuroscience

    PubMed Central

    Ames, Daniel L.; Fiske, Susan T.

    2013-01-01

    Cultural neuroscience issues from the apparently incompatible combination of neuroscience and cultural psychology. A brief literature sampling suggests, instead, several preliminary topics that demonstrate proof of possibilities: cultural differences in both lower-level processes (e.g. perception, number representation) and higher-order processes (e.g. inferring others’ emotions, contemplating the self) are beginning to shed new light on both culture and cognition. Candidates for future cultural neuroscience research include cultural variations in the default (resting) network, which may be social; regulation and inhibition of feelings, thoughts, and actions; prejudice and dehumanization; and neural signatures of fundamental warmth and competence judgments. PMID:23874143

  9. Bile culture

    MedlinePlus

    ... these risks. Alternative Names Culture - bile Images Bile culture References Hall GS, Woods GL. Medical bacteriology. In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 22nd ed. Philadelphia, PA: Elsevier ...

  10. Esophageal culture

    MedlinePlus

    Culture - esophageal ... There, it is placed in a special dish (culture) and watched for the growth of bacteria, fungi, ... and Fordtran's Gastrointestinal and Liver Disease Pathophysiology/Diagnosis/Management . 10th ed. Philadelphia, PA: Elsevier Saunders; 2016:chap ...

  11. Bronchoscopic culture

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003748.htm Bronchoscopic culture To use the sharing features on this page, please enable JavaScript. Bronchoscopic culture is a laboratory exam to check a piece ...

  12. Throat Culture

    MedlinePlus

    ... products and services. Advertising & Sponsorship: Policy | Opportunities Throat Culture Share this page: Was this page helpful? Collecting | ... treatment | Getting results | see BLOOD SAMPLE Collecting A culture is a test that is often used to ...

  13. Endocervical culture

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003754.htm Endocervical culture To use the sharing features on this page, please enable JavaScript. Endocervical culture is a laboratory test that helps identify infection ...

  14. Culturing Protozoa.

    ERIC Educational Resources Information Center

    Stevenson, Paul

    1980-01-01

    Compares various nutrient media, growth conditions, and stock solutions used in culturing protozoa. A hay infusion in Chalkey's solution maintained at a stable temperature is recommended for producing the most dense and diverse cultures. (WB)

  15. Culturing Protozoa.

    ERIC Educational Resources Information Center

    Stevenson, Paul

    1980-01-01

    Compares various nutrient media, growth conditions, and stock solutions used in culturing protozoa. A hay infusion in Chalkey's solution maintained at a stable temperature is recommended for producing the most dense and diverse cultures. (WB)

  16. Beyond Culture.

    ERIC Educational Resources Information Center

    Barron, Daniel D.

    1993-01-01

    Discusses the lack of literature relating to cultural differences and school library media programs and reviews the book "Beyond Culture" by Edward T. Hall. Highlights include the population/environment crisis, cultural literacy, the use of technology, and Marshall McLuhan's idea of the global village. (LRW)

  17. Culture evolves

    PubMed Central

    Whiten, Andrew; Hinde, Robert A.; Laland, Kevin N.; Stringer, Christopher B.

    2011-01-01

    Culture pervades human lives and has allowed our species to create niches all around the world and its oceans, in ways quite unlike any other primate. Indeed, our cultural nature appears so distinctive that it is often thought to separate humanity from the rest of nature and the Darwinian forces that shape it. A contrary view arises through the recent discoveries of a diverse range of disciplines, here brought together to illustrate the scope of a burgeoning field of cultural evolution and to facilitate cross-disciplinary fertilization. Each approach emphasizes important linkages between culture and evolutionary biology rather than quarantining one from the other. Recent studies reveal that processes important in cultural transmission are more widespread and significant across the animal kingdom than earlier recognized, with important implications for evolutionary theory. Recent archaeological discoveries have pushed back the origins of human culture to much more ancient times than traditionally thought. These developments suggest previously unidentified continuities between animal and human culture. A third new array of discoveries concerns the later diversification of human cultures, where the operations of Darwinian-like processes are identified, in part, through scientific methods borrowed from biology. Finally, surprising discoveries have been made about the imprint of cultural evolution in the predispositions of human minds for cultural transmission. PMID:21357216

  18. Culture evolves.

    PubMed

    Whiten, Andrew; Hinde, Robert A; Laland, Kevin N; Stringer, Christopher B

    2011-04-12

    Culture pervades human lives and has allowed our species to create niches all around the world and its oceans, in ways quite unlike any other primate. Indeed, our cultural nature appears so distinctive that it is often thought to separate humanity from the rest of nature and the Darwinian forces that shape it. A contrary view arises through the recent discoveries of a diverse range of disciplines, here brought together to illustrate the scope of a burgeoning field of cultural evolution and to facilitate cross-disciplinary fertilization. Each approach emphasizes important linkages between culture and evolutionary biology rather than quarantining one from the other. Recent studies reveal that processes important in cultural transmission are more widespread and significant across the animal kingdom than earlier recognized, with important implications for evolutionary theory. Recent archaeological discoveries have pushed back the origins of human culture to much more ancient times than traditionally thought. These developments suggest previously unidentified continuities between animal and human culture. A third new array of discoveries concerns the later diversification of human cultures, where the operations of Darwinian-like processes are identified, in part, through scientific methods borrowed from biology. Finally, surprising discoveries have been made about the imprint of cultural evolution in the predispositions of human minds for cultural transmission.

  19. Nasopharyngeal culture

    MedlinePlus

    Culture - nasopharyngeal; Swab for respiratory viruses; Swab for staph carriage ... The test identifies viruses and bacteria that cause upper respiratory ... Staphylococcus aureus Methicillin-resistant Staphylococcus ...

  20. Skin or nail culture

    MedlinePlus

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  1. Cultures Matter

    ERIC Educational Resources Information Center

    Foster, Charles R.

    2007-01-01

    In this article, the author shares his belief that, in the interactions between teachers and learners, it is not just culture that matters, but the encounter of the cultures that shape who they are, what they believe, and how they practice those beliefs in their relationships with each other and the world around them. When teachers teach they…

  2. Cultural Communications.

    ERIC Educational Resources Information Center

    Armas, Jose

    It is too often taken for granted that the communication process with culturally different children takes place as readily as it might with children from Anglo cultures. Most teachers receive training in verbal and formal communication skills; children come to school with nonverbal and informal communication skills. This initially can create…

  3. Ryukyuan Culture.

    ERIC Educational Resources Information Center

    Trafton, Terry

    The Ryukyu Islands of Japan, of which Okinawa is the best known, possess a lengthy history and a sophisticated cultural background, an exploration of which helps to shed light on this area and on mainland Japan. This document is an exposition of Ryukuan culture. Divided into eight sections, the areas covered include: (1) Historical perspective;…

  4. Ryukyuan Culture.

    ERIC Educational Resources Information Center

    Trafton, Terry

    The Ryukyu Islands of Japan, of which Okinawa is the best known, possess a lengthy history and a sophisticated cultural background, an exploration of which helps to shed light on this area and on mainland Japan. This document is an exposition of Ryukuan culture. Divided into eight sections, the areas covered include: (1) Historical perspective;…

  5. Cultural issues.

    PubMed

    Crowe, C C

    1995-08-01

    Central Australian Aborigines have a wide variety of medical illnesses which differ in incidence and severity from elsewhere in Australia. Coinciding with this are a range of cultural considerations that directly affect the management of these conditions. This article is an attempt to relate some of these cultural considerations to explain the outcome of these illnesses in the Aboriginal population.

  6. Cultural History and Cultural Materialism.

    ERIC Educational Resources Information Center

    Berman, Ronald

    1990-01-01

    Historicism critiques cultural history and cultural materialism as a methodology for literary analysis. Questions the finality of interpretation, how original values change, and whether dramatic history implies actual history. Using Shakespearean plays, analyzes the power and politics of a play in relation to its audience; posits that cultural…

  7. Fecal culture

    MedlinePlus

    ... fecal culture is a lab test to find organisms in the stool (feces) that can cause gastrointestinal ... Results There are no abnormal bacteria or other organisms in the sample. Talk to your provider about ...

  8. Blood culture

    MedlinePlus

    Culture - blood ... A blood sample is needed . The site where blood will be drawn is first cleaned with an antiseptic such ... organism from the skin getting into (contaminating) the blood sample and causing a false-positive result (see ...

  9. Paramilitary Culture.

    ERIC Educational Resources Information Center

    Gibson, James William

    1989-01-01

    Identifies the movie, "Rambo," and "Soldier of Fortune" magazine as artifacts of "paramilitary culture." Contends that they are a social phenomenon which helps legitimate the United States government's rapid escalation of military forces. (MS)

  10. Culture perspectives.

    PubMed

    Locsin, Rozzano C

    2002-10-01

    All cultures have had means and techniques that express their immediate aims. The thing that interests me is that today, painters do not have to go to a subject matter outside of themselves. They work from a different source. They work from within. It seems to me that the modern artist cannot express this age, the airplane, the atom bomb, the radio, in the old form of the Renaissance or of any of the old cultures.

  11. Diversity and genetic population structure of fungal pathogens infecting white grub larvae in agricultural soils.

    PubMed

    Carrillo-Benítez, María G; Guzmán-Franco, Ariel W; Alatorre-Rosas, Raquel; Enríquez-Vara, Jhony N

    2013-02-01

    White grub larvae are important soil-dwelling pests in many regions of Mexico as they attack many important crops such as maize. The use of synthetic chemicals is currently the main control strategy, but they are not always effective; thus, other alternatives are needed. Microbial control using entomopathogenic fungi represents an important alternative strategy, and species within the genera Beauveria and Metarhizium are considered amongst the most promising candidates. Seventeen Beauveria spp. and two Metarhizium spp. isolates were obtained in surveys of white grub larvae from different regions of Guanajuato, Mexico. All isolates were capable of infecting healthy larvae of the white grub Phyllophaga polyphilla in laboratory assays, but mortality never exceeded 50 %. Isolates were identified using morphological and molecular methods. Based on elongation factor1-α and ITS partial gene sequence data, all Beauveria isolates were identified as Beauveria pseudobassiana. Elongation factor1-α and β-tubulin sequence data identified the Metarhizium isolates to be Metarhizium pingshaense. In contrast, three additional Metarhizium isolates obtained the previous year in the same region were identified as M. pingshaense, Metarhizium anisopliae and Metarhizium robertsii. Microsatellite genotyping showed that all B. pseudobassiana isolates were the same haplotype. Enterobacterial Repetitive Intergenic Consensus fingerprinting information confirmed no significant variation amongst the B. pseudobassiana isolates. The ecological role of these isolates and their impact on white grub larvae populations are discussed.

  12. Culturally Responsive Teaching: Understanding Disability Culture

    ERIC Educational Resources Information Center

    Darrow, Alice-Ann

    2013-01-01

    To be culturally responsive teachers, we must first have an understanding of other cultures and how students from these cultures differ from one another. As we consider the many cultures represented in our classrooms, we might also consider students with disabilities as a cultural group. Within any main culture are subgroups differentiated by…

  13. Let your enemy do the work: within-host interactions between two fungal parasites of leaf-cutting ants.

    PubMed

    Hughes, W O H; Boomsma, J J

    2004-02-07

    Within-host competition is an important factor in host-parasite relationships, yet most studies consider interactions involving only single parasite species. We investigated the interaction between a virulent obligate entomopathogenic fungus, Metarhizium anisopliae var. anisopliae, and a normally avirulent, opportunistic fungal pathogen, Aspergillus flavus, in their leaf-cutting ant host, Acromyrmex echinatior. Surprisingly, the latter normally out-competed the former in mixed infections and had enhanced fitness relative to when infecting in isolation. The result is most probably due to Metarhizium inhibiting the host's immune defences, which would otherwise normally prevent infections by Aspergillus. With the host defences negated by the virulent parasite, the avirulent parasite was then able to out-compete its competitor. This result is strikingly similar to that seen in immunocompromised vertebrate hosts and indicates that avirulent parasites may play a more important role in host life histories than is generally realized.

  14. Hydroponic Culture

    ERIC Educational Resources Information Center

    Steucek, G. L.; Yurkiewicz, W. J.

    1973-01-01

    Describes a hydroponic culture technique suitable for student exercises in biology. This technique of growing plants in nutrient solutions enhances plant growth, and is an excellent way to obtain intact plants with root systems free of soil or other particulate matter. (JR)

  15. Culture Shock

    ERIC Educational Resources Information Center

    Brown, Angela Khristin

    2013-01-01

    The migration of blacks in North America through slavery became united. The population of blacks past downs a tradition of artist through art to native born citizens. The art tradition involved telling stories to each generation in black families. The black culture elevated by tradition created hope to determine their personal freedom to escape…

  16. Black Culture

    ERIC Educational Resources Information Center

    Brown, Angela Khristin

    2013-01-01

    The migration of blacks in North America through slavery became united. The population of blacks passed down a tradition of artist through art to native born citizens. The art tradition involved telling stories to each generation in black families. The black culture elevated by tradition created hope to determine their personal freedom to escape…

  17. Cultural Concerns.

    ERIC Educational Resources Information Center

    1998

    This document contains four papers from a symposium on cultural concerns in human resource development (HRD). "Race, Gender, and Mentoring Patterns" (Linda M. Hite) examines mentoring patterns and opportunities among black female professionals and reports results reinforcing the need for increased availability of same-sex, same-race mentors in…

  18. Hydroponic Culture

    ERIC Educational Resources Information Center

    Steucek, G. L.; Yurkiewicz, W. J.

    1973-01-01

    Describes a hydroponic culture technique suitable for student exercises in biology. This technique of growing plants in nutrient solutions enhances plant growth, and is an excellent way to obtain intact plants with root systems free of soil or other particulate matter. (JR)

  19. Cultural Themes.

    ERIC Educational Resources Information Center

    Roy, Loriene, Comp.

    Part of a larger report on the Four Directions Project, an American Indian technology innovation project, this section includes 10 "pathfinders" to locating information on Native American cultural themes. The pathfinders were designed by students in the Graduate School of Library and Information Science at the University of Texas at…

  20. Bacterial Wound Culture

    MedlinePlus

    ... Wound Culture Formal name: Culture, wound Related tests: Gram Stain , Susceptibility Testing , Blood Culture , Urine Culture , AFB Testing , ... wound culture is primarily used, along with a Gram stain and other tests, to help determine whether a ...

  1. Culture Theory and American Cultural Geography.

    ERIC Educational Resources Information Center

    Hickey, John J.

    This paper addresses three questions related to cultural geography--(1) do cultural geographers have a serious interest in culture theory? (2) is there some indication in the ways in which cultural geographers have traditionally approached their subject which has given rise to an apparent lack of concern with the implications of culture theory?…

  2. [Selection of isolates of entomopathogenic fungi for controlling Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and their compatibility with insecticides used in tomato crop].

    PubMed

    Pires, Lauricí M; Marques, Edmilson J; Oliveira, José V de; Alves, Sérgio B

    2010-01-01

    The activity of Metarhizium anisopliae and Beauveria bassiana towards eggs and larvae of Tuta absoluta (Meyrick) was evaluated. Our data showed that the isolates were pathogenic to both developmental stages tested and the eggs were more susceptible than the 1st instars. The isolates URPE-6 and URPE-19 of M. anisopliae were more pathogenic to eggs and larvae, respectively. The compatibility of these two isolates with the insecticides chlorfenapyr, spinosad, indoxacarb, abamectin, and neem were evaluated. Spinosad and indoxacarb were compatible with the two M. anisopliae isolates in all tested concentrations. At the average recommended concentration, chlorfenapyr was compatible to URPE-6 and abamectin to UFPE-19. The use of entomopathogenic fungi associated with compatible insecticides may be a useful alternative to control T. absoluta.

  3. Advances in cell culture

    SciTech Connect

    Maramorosch, K. )

    1987-01-01

    This book presents papers on advances in cell culture. Topics covered include: Genetic changes in the influenza viruses during growth in cultured cells; The biochemistry and genetics of mosquito cells in culture; and Tree tissue culture applications.

  4. Opening the Culture Door.

    ERIC Educational Resources Information Center

    Kaiser, Barbara; Rasminsky, Judy Sklar

    2003-01-01

    Asserts that child care providers must collaborate with children's families in order to better understand their culture and their child, and to successfully deal with challenging behavior issues. Addresses: (1) culture definition; (2) culture and identity; (3) cultural differences; (4) seeing culture; (5) child care and school culture; (6) moving…

  5. Deaf Culture Working.

    ERIC Educational Resources Information Center

    Stokoe, William C.

    1995-01-01

    Suggests how insights from Paul Bohannon's book, "How Culture Works" (1995), could be used to address such questions as, "How do deaf people learn their culture?" and "How do deaf children learn (what) culture?" Bohannon's idea of cultural dynamics is applied to deaf culture to trace how that culture evolved, how it…

  6. Deaf Culture Working.

    ERIC Educational Resources Information Center

    Stokoe, William C.

    1995-01-01

    Suggests how insights from Paul Bohannon's book, "How Culture Works" (1995), could be used to address such questions as, "How do deaf people learn their culture?" and "How do deaf children learn (what) culture?" Bohannon's idea of cultural dynamics is applied to deaf culture to trace how that culture evolved, how it…

  7. Comparative genome analysis of entomopathogenic fungi reveals a complex set of secreted proteins.

    PubMed

    Staats, Charley Christian; Junges, Angela; Guedes, Rafael Lucas Muniz; Thompson, Claudia Elizabeth; de Morais, Guilherme Loss; Boldo, Juliano Tomazzoni; de Almeida, Luiz Gonzaga Paula; Andreis, Fábio Carrer; Gerber, Alexandra Lehmkuhl; Sbaraini, Nicolau; da Paixão, Rana Louise de Andrade; Broetto, Leonardo; Landell, Melissa; Santi, Lucélia; Beys-da-Silva, Walter Orlando; Silveira, Carolina Pereira; Serrano, Thaiane Rispoli; de Oliveira, Eder Silva; Kmetzsch, Lívia; Vainstein, Marilene Henning; de Vasconcelos, Ana Tereza Ribeiro; Schrank, Augusto

    2014-09-29

    Metarhizium anisopliae is an entomopathogenic fungus used in the biological control of some agricultural insect pests, and efforts are underway to use this fungus in the control of insect-borne human diseases. A large repertoire of proteins must be secreted by M. anisopliae to cope with the various available nutrients as this fungus switches through different lifestyles, i.e., from a saprophytic, to an infectious, to a plant endophytic stage. To further evaluate the predicted secretome of M. anisopliae, we employed genomic and transcriptomic analyses, coupled with phylogenomic analysis, focusing on the identification and characterization of secreted proteins. We determined the M. anisopliae E6 genome sequence and compared this sequence to other entomopathogenic fungi genomes. A robust pipeline was generated to evaluate the predicted secretomes of M. anisopliae and 15 other filamentous fungi, leading to the identification of a core of secreted proteins. Transcriptomic analysis using the tick Rhipicephalus microplus cuticle as an infection model during two periods of infection (48 and 144 h) allowed the identification of several differentially expressed genes. This analysis concluded that a large proportion of the predicted secretome coding genes contained altered transcript levels in the conditions analyzed in this study. In addition, some specific secreted proteins from Metarhizium have an evolutionary history similar to orthologs found in Beauveria/Cordyceps. This similarity suggests that a set of secreted proteins has evolved to participate in entomopathogenicity. The data presented represents an important step to the characterization of the role of secreted proteins in the virulence and pathogenicity of M. anisopliae.

  8. Marketing across Cultures: Tools for Cultural Assessment.

    ERIC Educational Resources Information Center

    Raffield, Barney T., III

    The concept of cultural universals, the basic needs shared by people around the world, is a critical concept in assessing the impact of culture on decisions about the international marketing of goods and services. In most cases, international marketers have little need to understand all the ways in which their culture differs from the culture of…

  9. Academic Culture and Campus Culture of Universities

    ERIC Educational Resources Information Center

    Shen, Xi; Tian, Xianghong

    2012-01-01

    Academic culture of universities mainly consists of academic outlooks, academic spirits, academic ethics and academic environments. Campus culture in a university is characterized by individuality, academic feature, opening, leading, variety and creativity. The academic culture enhances the construction of campus culture. The campus culture…

  10. Variability in the production of extracellular enzymes by entomopathogenic fungi grown on different substrates

    PubMed Central

    Fernandes, Elio Gomes; Valério, Henrique Maia; Feltrin, Thaisa; Van Der Sand, Sueli Teresinha

    2012-01-01

    Entomopathogenic fungi are important controllers of pest-insects populations in agricultural production systems and in natural environment. These fungi have enzymatic machinery which involve since the recognition and adherence of spores in their hosts culminating with infection and death of these insects. The main objective of this study was to analyzed extracellular enzyme production of the fungi strains Beauveria bassiana, Metarhizium anisopliae and Paecilomyces sp when cultured on substrates. These fungi were grown in minimal media containing specific substrates for the analysis of different enzymes such as amylases, cellulases, esterases, lipases, proteases (gelatin and caseinase), pectinases and cuticles of Musca domestica larvae and adults. All the assays were performed with and without the presence of dextrose in the culture media. The quantification of enzyme activity was performed by the ratio of halo / colony (H/C) and the results subjected to variance analysis level of 5% (ANOVA) followed by post-Tukey test. All strains were positive for lipase and also they showed a high significant enzyme production for gelatin at concentrations of 4 and 1%. B. bassiana and Paecilomyces sp. were positive for amylase, pectinase and caseinase, and only Paecilomyces sp. showed cellulase activity. PMID:24031896

  11. Cultural Humility and Hospital Safety Culture.

    PubMed

    Hook, Joshua N; Boan, David; Davis, Don E; Aten, Jamie D; Ruiz, John M; Maryon, Thomas

    2016-12-01

    Hospital safety culture is an integral part of providing high quality care for patients, as well as promoting a safe and healthy environment for healthcare workers. In this article, we explore the extent to which cultural humility, which involves openness to cultural diverse individuals and groups, is related to hospital safety culture. A sample of 2011 hospital employees from four hospitals completed measures of organizational cultural humility and hospital safety culture. Higher perceptions of organizational cultural humility were associated with higher levels of general perceptions of hospital safety, as well as more positive ratings on non-punitive response to error (i.e., mistakes of staff are not held against them), handoffs and transitions, and organizational learning. The cultural humility of one's organization may be an important factor to help improve hospital safety culture. We conclude by discussing potential directions for future research.

  12. Culture Theory in Geography.

    ERIC Educational Resources Information Center

    Hickey, John J.

    The current debates about cultural geography fall into three categories: (1) arguments for the convergence of cultural and spatial geography; (2) arguments against current reports of the disappearance of culture as a result of increased cultural divergence; and (3) attempts at the reconstruction of culture theory to conform with generally valid…

  13. Culture ou Intercultures (Culture or Intercultural).

    ERIC Educational Resources Information Center

    Steele, Ross

    1996-01-01

    While planet Earth endeavors to transmit information instantaneously, cultural misunderstanding interferes with communication more than any language barrier. The article urges teachers of French to be cognizant of their role as cultural mediators. (Author/CK)

  14. Culture contre Universite (Culture against University).

    ERIC Educational Resources Information Center

    Fumaroli, Marc

    1992-01-01

    France's cultural policy since the 1950s is criticized as having more of a leisure and recreational focus than being truly encouraging of French culture and intellect. Politics and economics are seen as inappropriate policy motivators. (MSE)

  15. Culture, Cultural Conflicts, and Work Performance.

    ERIC Educational Resources Information Center

    Baker, Gus; Garcia, Jesus

    1987-01-01

    Discusses problems associated with integrating culturally different workers into an existing work force and suggests possible management solutions. Case studies and a table comparing different cultural values among Mexican Americans, Blacks, Orientals, and American Indians are included. (LRW)

  16. Revisiting cultural awareness and cultural relevancy.

    PubMed

    Abi-Hashem, Naji

    2015-10-01

    Comments on the original article by Christopher et al. (see record 2014-20055-001) regarding critical cultural awareness. The more insights and exploration of the meaning and influence of culture we receive, the better. There is no single treatment of any personal or collective culture(s) that can be inherently complete or totally exhaustive. New hermeneutics and skills are always needed, appreciated, and refreshing.

  17. Cultural Understanding Through Cross-Cultural Analysis.

    ERIC Educational Resources Information Center

    Briere, Jean-Francois

    1986-01-01

    A college course used an explicit intercultural approach and collective research activities to compare French and American cultures and to examine the reasons for cultural attitudes and culture conflict. Class assignments dealt with contrastive analyses of American and French institutions like advertising, cinema, feminism, etc. (MSE)

  18. Dehistoricized Cultural Identity and Cultural Othering

    ERIC Educational Resources Information Center

    Weiguo, Qu

    2013-01-01

    The assumption that each culture has its own distinctive identity has been generally accepted in the discussion of cultural identities. Quite often identity formation is not perceived as a dynamic and interactive ongoing process that engages other cultures and involves change in its responses to different challenges at different times. I will…

  19. Dehistoricized Cultural Identity and Cultural Othering

    ERIC Educational Resources Information Center

    Weiguo, Qu

    2013-01-01

    The assumption that each culture has its own distinctive identity has been generally accepted in the discussion of cultural identities. Quite often identity formation is not perceived as a dynamic and interactive ongoing process that engages other cultures and involves change in its responses to different challenges at different times. I will…

  20. Blood Culture (For Parents)

    MedlinePlus

    ... Kids to Be Smart About Social Media Blood Culture KidsHealth > For Parents > Blood Culture Print A A ... adjust the treatment choice. Why Do a Blood Culture? During some illnesses, certain infection-causing bacteria and ...

  1. Routine sputum culture

    MedlinePlus

    Sputum culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria ... Chernecky CC, Berger BJ. Culture, routine. In: Chernecky CC, Berger BJ, ... . 6th ed. Philadelphia, PA: Elsevier Saunders; 2013:409- ...

  2. Lymph node culture

    MedlinePlus

    Culture - lymph node ... or viruses grow. This process is called a culture. Sometimes, special stains are also used to identify specific cells or microorganisms before culture results are available. If needle aspiration does not ...

  3. Animal culture: chimpanzee conformity?

    PubMed

    van Schaik, Carel P

    2012-05-22

    Culture-like phenomena in wild animals have received much attention, but how good is the evidence and how similar are they to human culture? New data on chimpanzees suggest their culture may even have an element of conformity.

  4. Migration, cultural bereavement and cultural identity

    PubMed Central

    BHUGRA, DINESH; BECKER, MATTHEW A

    2005-01-01

    Migration has contributed to the richness in diversity of cultures, ethnicities and races in developed countries. Individuals who migrate experience multiple stresses that can impact their mental well being, including the loss of cultural norms, religious customs, and social support systems, adjustment to a new culture and changes in identity and concept of self. Indeed, the rates of mental illness are increased in some migrant groups. Mental health practitioners need to be attuned to the unique stresses and cultural aspects that affect immigrants and refugees in order to best address the needs of this increasing and vulnerable population. This paper will review the concepts of migration, cultural bereavement and cultural identity, and explore the interrelationship between these three aspects of the migrant's experience and cultural congruity. The complex interplay of the migration process, cultural bereavement, cultural identity, and cultural congruity, along with biological, psychological and social factors, is hypothesized as playing a major role in the increased rates of mental illness in affected migrant groups. PMID:16633496

  5. Many Forms of Culture

    ERIC Educational Resources Information Center

    Cohen, Adam B.

    2009-01-01

    Psychologists interested in culture have focused primarily on East-West differences in individualism-collectivism, or independent-interdependent self-construal. As important as this dimension is, there are many other forms of culture with many dimensions of cultural variability. Selecting from among the many understudied cultures in psychology,…

  6. Understanding Organizational Culture.

    ERIC Educational Resources Information Center

    Burkhart, Jennifer

    This guide, which is intended for workplace education providers, defines organizational culture, reviews selected techniques for reading a company's culture, and presents examples of ways in which organizations' culture can affect workplace education programs. An organization's culture is determined by: recognizing the company's philosophy…

  7. Popular Culture and Curricula.

    ERIC Educational Resources Information Center

    Browne, Ray B., Ed.; Ambrosetti, Ronald J., Ed.

    The seven essays in this publication, including four read at the fall 1969 American Studies Association meeting, attempt to present both the nature of popular culture study and a guide for teachers of popular culture courses. Papers are (1) "Popular Culture: Notes toward a Definition" by Ray B. Browne; (2) "Can Popular Culture Save American…

  8. Deaf Culture and Literacy.

    ERIC Educational Resources Information Center

    Padden, Carol; Ramsey, Claire

    1993-01-01

    Issues in deaf culture and literacy are addressed, including literacy versus reading and writing, the nature of deaf culture, the relationship between culture (particularly deaf culture) and literacy, the relationship between literacy and face-to-face communication, and application of theory to practice. (DB)

  9. Deaf Culture and Literacy.

    ERIC Educational Resources Information Center

    Padden, Carol; Ramsey, Claire

    1993-01-01

    Issues in deaf culture and literacy are addressed, including literacy versus reading and writing, the nature of deaf culture, the relationship between culture (particularly deaf culture) and literacy, the relationship between literacy and face-to-face communication, and application of theory to practice. (DB)

  10. Teaching Language, Learning Culture.

    ERIC Educational Resources Information Center

    Swiderski, Richard M.

    A discussion of language focuses on the relationship between language learning and culture learning. The first four chapters look at the cultural context of language learning, particularly in the language classroom. The second part examines culture learning through language teaching. The first chapter discusses lexical culture, or the vocabulary…

  11. Aging in culture.

    PubMed

    Fung, Helene H

    2013-06-01

    This article reviews the empirical studies that test socioemotional aging across cultures. The review focuses on comparisons between Western (mostly North Americans and Germans) and Eastern cultures (mostly Chinese) in areas including age-related personality, social relationships, and cognition. Based on the review, I argue that aging is a meaning-making process. Individuals from each cultural context internalize cultural values with age. These internalized cultural values become goals that guide adult development. When individuals from different cultures each pursue their own goals with age, cultural differences in socioemotional aging occur.

  12. Cultural Approaches to Parenting

    PubMed Central

    Bornstein, Marc H.

    2012-01-01

    SYNOPSIS This article first introduces some main ideas behind culture and parenting and next addresses philosophical rationales and methodological considerations central to cultural approaches to parenting, including a brief account of a cross-cultural study of parenting. It then focuses on universals, specifics, and distinctions between form (behavior) and function (meaning) in parenting as embedded in culture. The article concludes by pointing to social policy implications as well as future directions prompted by a cultural approach to parenting. PMID:22962544

  13. Cultural Molding: A Modular Approach. Cultural Anthropology.

    ERIC Educational Resources Information Center

    Kassebaum, Peter

    Designed for use as supplementary instructional material in a cultural anthropology course, this learning module introduces the student to cultural molding, the idea that most human behavior can be traced to enculturation and exposure rather than to a socio-biological explanation of human behavior. Following a brief description of socialization,…

  14. Invited Comments: National Culture and Teaching Culture.

    ERIC Educational Resources Information Center

    Anderson-Levitt, Kathryn M.

    1987-01-01

    Comments on the cross-cultural research reported in the two preceding articles on comparisons of a German and American school and Dutch and Israeli teachers. Supports cross-national comparisons of school culture as an enlightening element of school reform. (LHW)

  15. Cultural Activation of Consumers.

    PubMed

    Siegel, Carole E; Reid-Rose, Lenora; Joseph, Adriana M; Hernandez, Jennifer C; Haugland, Gary

    2016-02-01

    This column discusses "cultural activation," defined as a consumer's recognition of the importance of providing cultural information to providers about cultural affiliations, challenges, views about, and attitudes toward behavioral health and general medical health care, as well as the consumer's confidence in his or her ability to provide this information. An aid to activation, "Cultural Activation Prompts," and a scale that measures a consumer's level of activation, the Cultural Activation Measurement Scale, are described. Suggestions are made about ways to introduce cultural activation as a component of usual care.

  16. Cerebrospinal fluid culture

    MedlinePlus

    ... Alternative Names Culture - CSF; Spinal fluid culture; CSF ... In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 23d ed. Philadelphia, PA: Elsevier; ...

  17. Blood Culture Test

    MedlinePlus

    ... Complete Blood Count , Urine Culture , Bacterial Wound Culture , Gram Stain , CSF Analysis , Fungal Tests , Susceptibility Testing At a ... Other related tests that may be performed include: Gram stain —a relatively quick test used to detect and ...

  18. Cross-Cultural Nongeneralizations.

    ERIC Educational Resources Information Center

    Patton, Michael Quinn

    1985-01-01

    This synthesis of the previous articles concludes that cultural considerations are important for effective evaluation practice. Culturally sensitive and situationally responsive evaluation practices can contribute to international understanding. (BS)

  19. Culture and social class.

    PubMed

    Miyamoto, Yuri

    2017-08-08

    A large body of research in Western cultures has demonstrated the psychological and health effects of social class. This review outlines a cultural psychological approach to social stratification by comparing psychological and health manifestations of social class across Western and East Asian cultures. These comparisons suggest that cultural meaning systems shape how people make meaning and respond to material/structural conditions associated with social class, thereby leading to culturally divergent manifestations of social class. Specifically, unlike their counterparts in Western cultures, individuals of high social class in East Asian cultures tend to show high conformity and other-orientated psychological attributes. In addition, cultures differ in how social class impacts health (i.e. on which bases, through which pathways, and to what extent). Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Urine culture - catheterized specimen

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003752.htm Urine culture - catheterized specimen To use the sharing features on this page, please enable JavaScript. Catheterized specimen urine culture is a laboratory test that looks for germs ...

  1. Pericardial fluid culture

    MedlinePlus

    ... medlineplus.gov/ency/article/003720.htm Pericardial fluid culture To use the sharing features on this page, please enable JavaScript. Pericardial fluid culture is a test performed on a sample of ...

  2. Culture in the Classroom

    ERIC Educational Resources Information Center

    Medin, Douglas L.; Bang, Megan

    2014-01-01

    Culture plays a large but often unnoticeable role in what we teach and how we teach children. We are a country of immense diversity, but in classrooms the dominant European-American culture has become the language of learning.

  3. Culture in the Classroom

    ERIC Educational Resources Information Center

    Medin, Douglas L.; Bang, Megan

    2014-01-01

    Culture plays a large but often unnoticeable role in what we teach and how we teach children. We are a country of immense diversity, but in classrooms the dominant European-American culture has become the language of learning.

  4. Cultural Communication and Transmission

    ERIC Educational Resources Information Center

    Tschumi, R.

    1973-01-01

    Part of a larger work, of which the French version, Theorie de la Culture'' (Theory of Culture), is to be published first; shorter version read at the International Federation for Modern Languages and Literatures Congress, Cambridge, England, 1972. (RS)

  5. Urethral discharge culture

    MedlinePlus

    ... medlineplus.gov/ency/article/003750.htm Urethral discharge culture To use the sharing features on this page, please enable JavaScript. Urethral discharge culture is a laboratory test done on men and ...

  6. Culture and Achievement Motivation

    ERIC Educational Resources Information Center

    Maehr, Martin L.

    1974-01-01

    A framework is suggested for the cross-cultural study of motivation that stresses the importance of contextual conditions in eliciting achievement motivation and emphasizes cultural relativity in the definition of the concept. (EH)

  7. Bile culture (image)

    MedlinePlus

    ... tract. A specimen of bile is placed in culture media and observed for growth of microorganisms. If there ... no infection. If there is growth in the culture media, the growth is then isolated and identified to ...

  8. Armenian Cultural Astronomy

    NASA Astrophysics Data System (ADS)

    Farmanyan, S. V.; Mickaelian, A. M.

    2015-07-01

    Cultural Astronomy is the reflection of sky events in various fields of nations' culture. In foreign literature this field is also called "Astronomy in Culture" or "Astronomy and Culture". Cultural astronomy is the set of interdisciplinary fields studying the astronomical systems of current or ancient societies and cultures. It is manifested in Religion, Mythology, Folklore, Poetry, Art, Linguistics and other fields. In recent years, considerable attention has been paid to this sphere, particularly international organizations were established, conferences are held and journals are published. Armenia is also rich in cultural astronomy. The present paper focuses on Armenian archaeoastronomy and cultural astronomy, including many creations related to astronomical knowledge; calendars, rock art, mythology, etc. On the other hand, this subject is rather poorly developed in Armenia; there are only individual studies on various related issues (especially many studies related to Anania Shirakatsi) but not coordinated actions to manage this important field of investigation.

  9. Cultural changes in aerospace

    NASA Technical Reports Server (NTRS)

    Strobl, Bill

    1991-01-01

    Cultural changes; people and jobs; examples of cultural changes required; advanced launch system (ALS) philosophy; ALS operability capabilities; and ALS operability in design are outlined. This presentation is represented by viewgraphs.

  10. Culture-negative endocarditis

    MedlinePlus

    ... inflammation of the lining of one or more heart valves, but no endocarditis-causing germs can be found ... the heart, where they can settle on damaged heart valves. Alternative Names Endocarditis (culture-negative) Images Culture-negative ...

  11. Developing Soldier Cultural Competency

    DTIC Science & Technology

    2006-03-03

    heavily on small patrols establishing personal relationships with the local populace -- understanding the culture is a key to success. The commander...the world, a Soldier’s cultural misstep can quickly turn a local , simple cultural misunderstanding into a situation with strategic implications -- “the...means for developing a Soldier’s cultural awareness is decentralized to local commanders. When assigned to a command overseas, Soldiers typically

  12. Culture & Cognition Laboratory

    DTIC Science & Technology

    2011-05-01

    the teams. Key: Bulgaria (b), The Netherlands (d), Norway-senior age (n), Norway-junior age (j), Sweden ( s ), & the United States (u), Mixed culture (m...what degree are not well understood. Considerable distance on many cultural dimensions can exist between strong friends and allies. Also, some of the... cultural dimensions . Team cultural diversity was indexed using the population standard deviation of the four team-members’s scores on a particular

  13. Asthma, culture, and cultural analysis: continuing challenges.

    PubMed

    Fortun, Mike; Fortun, Kim; Costelloe-Kuehn, Brandon; Saheb, Tahereh; Price, Daniel; Kenner, Alison; Crowder, Jerome

    2014-01-01

    Recent research indicates that asthma is more complicated than already recognized, requiring a multilateral approach of study in order to better understand its many facets. Apart from being a health problem, asthma is seen as a knowledge problem, and as we argue here, a cultural problem. Employing cultural analysis we outline ways to challenge conventional ideas and practices about asthma by considering how culture shapes asthma experience, diagnosis, management, research, and politics. Finally, we discuss the value of viewing asthma through multiple lenses, and how such "explanatory pluralism" advances transdisciplinary approaches to asthma.

  14. Culture Differences and English Teaching

    ERIC Educational Resources Information Center

    Wang, Jin

    2011-01-01

    Language is a part of culture, and plays a very important role in the development of the culture. Some sociologists consider it as the keystone of culture. They believe, without language, culture would not be available. At the same time, language is influenced and shaped by culture, it reflects culture. Therefore, culture plays a very important…

  15. Cultur(ally) Jammed: Culture Jams as a Form of Culturally Responsive Teaching

    ERIC Educational Resources Information Center

    Martinez, Ulyssa

    2012-01-01

    Does the person become the name or does the name become the person? This question was asked by a participant of my culture jam entitled, "What's my name?" In this culture jam, I asked people to discern the name of a person based solely on their appearance and a list of possible names below their picture. This article aims to show how culture jams…

  16. The University Culture

    ERIC Educational Resources Information Center

    Simplicio, Joseph

    2012-01-01

    In this article the author discusses the role university culture can play on a campus and how it can impact policy and practice. The article explores how a university's history, values, and vision form its culture and how this culture in turn affects its stability and continuity. The article discusses how newcomers within the university are…

  17. Anaerobic thermophilic culture

    DOEpatents

    Ljungdahl, Lars G.; Wiegel, Jurgen K. W.

    1981-01-01

    A newly discovered thermophilic anaerobe is described that was isolated in a biologically pure culture and designated Thermoanaerobacter ethanolicus ATCC 3/550. T. Ethanolicus is cultured in aqueous nutrient medium under anaerobic, thermophilic conditions and is used in a novel process for producing ethanol by subjecting carbohydrates, particularly the saccharides, to fermentation action of the new microorganism in a biologically pure culture.

  18. Problems Confronting Visual Culture

    ERIC Educational Resources Information Center

    Efland, Arthur D.

    2005-01-01

    A new movement has appeared recommending, in part, that the field of art education should lessen its traditional ties to drawing, painting, and the study of masterpieces to become the study of visual culture. Visual cultural study refers to an all-encompassing category of cultural practice that includes the fine arts but also deals with the study…

  19. A Cultural Classroom Library

    ERIC Educational Resources Information Center

    Lawrence, Maria

    2007-01-01

    Native American and other cultural stories provide students with a broader perspective on the world. In addition, cultural stories connect science content and knowledge about the world to cultural interpretations and people's life ways. By implementing the ideas suggested in this article, you can select books that both enrich your science library…

  20. OVERCOMING CULTURAL BARRIERS.

    ERIC Educational Resources Information Center

    BARRUTIA, RICHARD

    THE RELATIONSHIP OF LANGUAGE DEVELOPMENT TO CULTURAL BARRIERS AND THE TEACHING OF FOREIGN LANGUAGES IS DISCUSSED IN THIS ARTICLE. VARIOUS VIEWS OF THE MEANING OF CULTURE ARE MENTIONED IN ORDER TO SINGLE OUT ANTHROPOLOGICAL CULTURE AS A MAIN FOCAL POINT. INTERCULTURAL DIFFERENCES ARE SPELLED OUT WITH EXAMPLES OF LINGUISTIC BARRIERS, AND…

  1. Cultural Exploration through Mapping

    ERIC Educational Resources Information Center

    Schall, Janine M.

    2010-01-01

    Increasing diversity in the United States means that all students must understand multiple cultural perspectives and identities. Educators need to facilitate learning engagements that highlight the complexities of culture and cultural identity, going beyond surface characteristics such as foods, holidays, and clothing that are often the focus in…

  2. Europeana: Think Culture

    ERIC Educational Resources Information Center

    Kail, Candice

    2011-01-01

    Europeana: Think Culture (http://www.europeana.eu) is a wonderful cultural repository. It includes more than 15 million items (images, text, audio, and video) from 1,500 European institutions. Europeana provides access to an abundance of cultural and heritage information and knowledge. Because Europeana has partnered with and brought together so…

  3. The Two Cultures Revisited.

    ERIC Educational Resources Information Center

    Hultberg, John

    1997-01-01

    Addresses the work of British writer, C. P. Snow, and examines the differences in scientific and literary cultures. Discusses post-World War II professionalization of science and the rebellious literary culture; the scientific revolution; the lack of communication between the two cultures; the generalization of science through sociology; the need…

  4. Cultural Concepts of Giftedness

    ERIC Educational Resources Information Center

    Sternberg, Robert J.

    2007-01-01

    Different cultures have different conceptions of what it means to be gifted. But in identifying children as gifted, we often use only our own conception, ignoring the cultural context in which the children grew up. Such identification is inadequate and fails to do justice to the richness of the world's cultures. It also misses children who are…

  5. Teaching Culture through Advertising.

    ERIC Educational Resources Information Center

    Stock, Janet C.

    Some of the literature on the role of teaching culture in second language instruction is reviewed, with some emphasis on the work of Ortunio and the Kluckholn model of French culture. One instructor's use of French print and television advertising to teach French culture is described. Values such as intellectuality, traditionalism, and patriotism…

  6. Peritoneal fluid culture

    MedlinePlus

    Culture - peritoneal fluid ... sent to the laboratory for Gram stain and culture. The sample is checked to see if bacteria ... The peritoneal fluid culture may be negative, even if you have ... diagnosis of peritonitis is based on other factors, in addition ...

  7. Cultural Exploration through Mapping

    ERIC Educational Resources Information Center

    Schall, Janine M.

    2010-01-01

    Increasing diversity in the United States means that all students must understand multiple cultural perspectives and identities. Educators need to facilitate learning engagements that highlight the complexities of culture and cultural identity, going beyond surface characteristics such as foods, holidays, and clothing that are often the focus in…

  8. Problems Confronting Visual Culture

    ERIC Educational Resources Information Center

    Efland, Arthur D.

    2005-01-01

    A new movement has appeared recommending, in part, that the field of art education should lessen its traditional ties to drawing, painting, and the study of masterpieces to become the study of visual culture. Visual cultural study refers to an all-encompassing category of cultural practice that includes the fine arts but also deals with the study…

  9. Why Teach Visual Culture?

    ERIC Educational Resources Information Center

    Passmore, Kaye

    2007-01-01

    Visual culture is a hot topic in art education right now as some teachers are dedicated to teaching it and others are adamant that it has no place in a traditional art class. Visual culture, the author asserts, can include just about anything that is visually represented. Although people often think of visual culture as contemporary visuals such…

  10. Deaf Culture. PEPNet Tipsheet

    ERIC Educational Resources Information Center

    Siple, Linda; Greer, Leslie; Holcomb, Barbra Ray

    2004-01-01

    It often comes as a surprise to people that many deaf people refer to themselves as being members of Deaf culture. The American Deaf culture is a unique linguistic minority that uses American Sign Language (ASL) as its primary mode of communication. This tipsheet provides a description of Deaf culture and suggestions for effective communication.

  11. Bridges: Literature across Cultures.

    ERIC Educational Resources Information Center

    Muller, Gilbert H., Comp.; Williams, John A., Comp.

    This anthology of literature from the many American cultures as well as cultures around the world is intended for use in today's college composition and introductory literature courses. Offering a blend of classic favorites and selections from other cultures, the anthology contains some 300 stories, poems, and plays from the six habitable…

  12. Safeguards Culture: Lessons Learned

    SciTech Connect

    Frazar, Sarah L.; Mladineo, Stephen V.

    2010-06-01

    Today, safeguards culture can be a useful tool for measuring nonproliferation postures, but so far its impact on the international safeguards regime has been underappreciated. There is no agreed upon definition for safeguards culture nor agreement on how it should be measured. This paper argues that safeguards culture as an indicator of a country’s nonproliferation posture can be a useful tool.

  13. How Culture Misdirects Multiculturalism.

    ERIC Educational Resources Information Center

    Wax, Murray L.

    In the ongoing debate over whether or what sort of multiculturalism should be provided by schools, the origin, evolution, and rhetorical function of the basic term "culture" have been unwisely neglected. The 19th century notion of "culture" implied a process of growth and development, of culturing an organism, or of the human organism becoming…

  14. Cultural Arts Handbook.

    ERIC Educational Resources Information Center

    Pistone, Kathleen A.

    The handbook presents activities to aid elementary school classroom teachers as they develop and implement cultural arts lessons. A cultural arts program is interpreted as a way to help students develop perceptual awareness, build a basic vocabulary in some art cultural form, evaluate their own works of art, appreciate creative expressions, and…

  15. Europeana: Think Culture

    ERIC Educational Resources Information Center

    Kail, Candice

    2011-01-01

    Europeana: Think Culture (http://www.europeana.eu) is a wonderful cultural repository. It includes more than 15 million items (images, text, audio, and video) from 1,500 European institutions. Europeana provides access to an abundance of cultural and heritage information and knowledge. Because Europeana has partnered with and brought together so…

  16. Resolving conflicting safety cultures

    SciTech Connect

    Slider, J.E. ); Patterson, M. )

    1993-01-01

    Several nuclear power plant sites have been wounded in the crossfire between two distinct corporate cultures. The traditional utility culture lies on one side and that of the nuclear navy on the other. The two corporate cultures lead to different perceptions of [open quotes]safety culture.[close quotes] This clash of safety cultures obscures a very important point about nuclear plant operations: Safety depends on organizational learning. Organizational learning provides the foundation for a perception of safety culture that transcends the conflict between utility and nuclear navy cultures. Corporate culture may be defined as the knowledge, attitudes, and beliefs shared by employees of a given company. Safety culture is the part of corporate culture concerning shared attitudes and beliefs affecting individual or public safety. If the safety culture promotes behaviors that lead to greater safety, employees will tend to [open quotes]do the right thing[close quotes] even when circumstances and formal guidance alone do not ensure that actions will be correct. Safety culture has become particularly important to nuclear plant owners and regulators as they have sought to establish and maintain a high level of safety in today's plants.

  17. Principals as Cultural Leaders

    ERIC Educational Resources Information Center

    Louis, Karen Seashore; Wahlstrom, Kyla

    2011-01-01

    Principals have a strong role to play in forming school cultures that encourage change. Changing a school's culture requires shared or distributed leadership and instructional leadership. A multiyear study found that three elements are necessary for a school culture that stimulates teachers to improve their instruction: 1) Teachers and…

  18. Resource Guide: Cultural Resilience.

    ERIC Educational Resources Information Center

    Strand, Joyce A.; Peacock, Robert

    2003-01-01

    Offers resources for the study of cultural resilience. This term, used in American Indian culture theory, suggests that traditional culture can help to overcome oppression, abuse, poverty, and other social ills. Offers annotated reference to 19 books, articles, Internet sites, and other publications. (NB)

  19. Cultur(ally) Jammed: Culture Jams as a Form of Culturally Responsive Teaching

    ERIC Educational Resources Information Center

    Martinez, Ulyssa

    2012-01-01

    Does the person become the name or does the name become the person? This question was asked by a participant of my culture jam entitled, "What's my name?" In this culture jam, I asked people to discern the name of a person based solely on their appearance and a list of possible names below their picture. This article aims to show how culture jams…

  20. Teaching Language, Teaching Culture.

    ERIC Educational Resources Information Center

    Liddicoat, Anthony J., Ed.; Crozet, Chantal, Ed.

    1997-01-01

    Essays and research reports on the relationship between teaching second languages and teaching culture include: "Teaching Culture as an Integrated Part of Language Teaching: An Introduction" (Chantal Crozet, Anthony J. Liddicoat); "Primary Socialization and Cultural Factors in Second Language Learning: Wending Our Way through Semi-Charted…

  1. What Kind of Culture?

    ERIC Educational Resources Information Center

    Knoll, Samson B.

    The question of what should be taught as the cultural component of language instruction is discussed, with special reference to German. A present-directed humanism is urged, with emphasis on the relevance and immediacy of cultural materials. Mistaken and irrelevant directions in the teaching of German culture are discussed in some detail; similar…

  2. Deaf Culture. PEPNet Tipsheet

    ERIC Educational Resources Information Center

    Siple, Linda; Greer, Leslie; Holcomb, Barbra Ray

    2004-01-01

    It often comes as a surprise to people that many deaf people refer to themselves as being members of Deaf culture. The American Deaf culture is a unique linguistic minority that uses American Sign Language (ASL) as its primary mode of communication. This tipsheet provides a description of Deaf culture and suggestions for effective communication.

  3. Why Teach Visual Culture?

    ERIC Educational Resources Information Center

    Passmore, Kaye

    2007-01-01

    Visual culture is a hot topic in art education right now as some teachers are dedicated to teaching it and others are adamant that it has no place in a traditional art class. Visual culture, the author asserts, can include just about anything that is visually represented. Although people often think of visual culture as contemporary visuals such…

  4. Cultural Arts Handbook.

    ERIC Educational Resources Information Center

    Pistone, Kathleen A.

    The handbook presents activities to aid elementary school classroom teachers as they develop and implement cultural arts lessons. A cultural arts program is interpreted as a way to help students develop perceptual awareness, build a basic vocabulary in some art cultural form, evaluate their own works of art, appreciate creative expressions, and…

  5. Cultural Knowledge in Translation.

    ERIC Educational Resources Information Center

    Olk, Harald

    2003-01-01

    Describes a study exploring the influence of cultural knowledge on the translation performance of German students of English. Found that the students often lacked sufficient knowledge about British culture to deal with widely-used cultural concepts. Findings suggest that factual reference sources have an important role to play in translation…

  6. The University Culture

    ERIC Educational Resources Information Center

    Simplicio, Joseph

    2012-01-01

    In this article the author discusses the role university culture can play on a campus and how it can impact policy and practice. The article explores how a university's history, values, and vision form its culture and how this culture in turn affects its stability and continuity. The article discusses how newcomers within the university are…

  7. Culture-sensitive psychotraumatology.

    PubMed

    Schnyder, Ulrich; Bryant, Richard A; Ehlers, Anke; Foa, Edna B; Hasan, Aram; Mwiti, Gladys; Kristensen, Christian H; Neuner, Frank; Oe, Misari; Yule, William

    2016-01-01

    Although there is some evidence of the posttraumatic stress disorder (PTSD) construct's cross cultural validity, trauma-related disorders may vary across cultures, and the same may be true for treatments that address such conditions. Experienced therapists tailor psychotherapy to each patient's particular situation, to the nature of the patient's psychopathology, to the stage of therapy, and so on. In addition, culture-sensitive psychotherapists try to understand how culture enhances the meaning of their patient's life history, the cultural components of their illness and help-seeking behaviors, as well as their expectations with regard to treatment. We cannot take for granted that all treatment-seeking trauma survivors speak our language or share our cultural values. Therefore, we need to increase our cultural competencies. The authors of this article are clinicians and/or researchers from across the globe, working with trauma survivors in various settings. Each author focused on one or more specific cultural aspects of working with trauma survivors and highlighted the following aspects. As a result of culture-specific individual and collective meanings linked to trauma and trauma-related disorders survivors may be exposed to (self-)stigma in the aftermath of trauma. Patients who are reluctant to talk about their traumatic experiences may instead be willing to write or use other ways of accessing the painful memories such as drawing. In other cultures, community and family cohesion are crucial elements of recovery. While awareness of culture-specific aspects is important, we also need to beware of premature cultural stereotyping. When disseminating empirically supported psychotherapies for PTSD across cultures, a number of additional challenges need to be taken into account: many low and middle income countries have very limited resources available and suffer from a poor health infrastructure. In summary, culture-sensitive psychotraumatology means assuming an

  8. Culture shock and travelers.

    PubMed

    Stewart, L; Leggat, P A

    1998-06-01

    As travel has become easier and more affordable, the number of people traveling has risen sharply. People travel for many and varied reasons, from the business person on an overseas assignment to backpackers seeking new and exotic destinations. Others may take up residence in different regions, states or countries for family, business or political reasons. Other people are fleeing religious or political persecution. Wherever they go and for whatever reason they go, people take their culture with them. Culture, like language, is acquired innately in early childhood and is then reinforced through formal and complex informal social education into adulthood. Culture provides a framework for interpersonal and social interactions. Therefore, the contact with a new culture is often not the exciting or pleasurable experience anticipated. When immersed in a different culture, people no longer know how to act when faced with disparate value systems. Contact with the unfamiliar culture can lead to anxiety, stress, mental illness and, in extreme cases, physical illness and suicide. "Culture shock" is a term coined by the anthropologist Oberg. It is the shock of the new. It implies that the experience of the new culture is an unpleasant surprise or shock, partly because it is unexpected and partly because it can lead to a negative evaluation of one's own culture. It is also known as cross-cultural adjustment, being that period of anxiety and confusion experienced when entering a new culture. It affects people intellectually, emotionally, behaviorally and physically and is characterized by symptoms of psychological distress. Culture shock affects both adults and children. In travelers or workers who have prolonged sojourns in foreign countries, culture shock may occur not only as they enter the new culture, but also may occur on their return to their original culture. Children may also experience readjustment problems after returning from leading sheltered lives in expatriate

  9. Cultural aspects of suicide.

    PubMed

    Maharajh, Hari D; Abdool, Petal S

    2005-09-08

    Undefined cultural factors cannot be dismissed and significantly contribute to the worldwide incidence of death by suicide. Culture is an all embracing term and defines the relationship of an individual to his environment. This study seeks to investigate the effect of culture on suicide both regionally and internationally. Culture-bound syndrome with suicidal behaviours specific to a particular culture or geographical region are discussed. Opinions are divided as to the status of religious martyrs. The law itself is silent on many aspects of suicidal behaviour and despite decriminalization of suicide as self-murder, the latter remains on the statutes of many developing countries. The Caribbean region is of concern due to its steady rise in mean suicide rate, especially in Trinidad and Tobago where socio-cultural factors are instrumental in influencing suicidal behaviour. These include transgenerational cultural conflicts, psycho-social problems, media exposure, unemployment, social distress, religion and family structure. The methods used are attributed to accessibility and lethality. Ingestion of poisonous substances is most popular followed by hanging. The gender differences seen with regard to suicidality can also be attributed to gender related psychopathology and psychosocial differences in help-seeking behaviour. These are influenced by the cultural environment to which the individual is exposed. Culture provides coping strategies to individuals; as civilization advances many of these coping mechanisms are lost unclothing the genetic predisposition of vulnerable groups. In the management of suicidal behaviour, a system of therapeutic re-culturation is needed with an emphasis on relevant culture- based therapies.

  10. Indian culture and psychiatry

    PubMed Central

    Gautam, Shiv; Jain, Nikhil

    2010-01-01

    ‘Culture’ is an abstraction, reflecting the total way of life of a society. Culture uniquely influences mental health of people living in a given society. Similarity in thinking and understanding of mental health across the ancient cultures has been observed. Studies which relate to the demographic factors, cultural factors influencing presentation of illness, diagnosis of the illness-culture bound syndromes and influence of the cultural factors and the belief system on psychopathology, stigma and discrimination towards the patient have been reviewed. An attempt has been made to critically look at the research on culture and psychiatry in different areas. There is a need for culturally oriented modules of non-pharmacological management. PMID:21836701

  11. Uyghur food culture.

    PubMed

    Ayoufu, Ayixiamuguli; Yang, Degang; Yimit, Dilshat

    2017-01-01

    Uyghur food culture has a long history. It is rich in resources, with the strong characteristics of being "green" and healthy, and having high nutritional value. We analyze the development and current status of Uyghur food culture, and explore the value of developing this food culture's resources. Traditional Uyghur food culture formed with influences from many ethnic groups, and has evolved into an intangible element of cultural heritage. It has several components with different healthy and therapeutic functions and is widely utilized in local communities. Overall, Uyghur food is rich in nutrients and beneficial for health. We propose strategies to address issues associated with Uyghur food culture and cultural resources, and specific measures for the development of these resources.

  12. Cultural effects on mindreading.

    PubMed

    Perez-Zapata, Daniel; Slaughter, Virginia; Henry, Julie D

    2016-01-01

    People from other cultural backgrounds sometimes seem inscrutable. We identified a potential cause of this phenomenon in two experiments demonstrating that adults' mental state inferences are influenced by the cultural identity of the target. We adapted White, Hill, Happé, and Frith's (2009) Strange Stories to create matched intra-cultural and cross-cultural mindreading and control conditions. Experiment 1 showed that Australian participants were faster to respond and received higher scores in the intra-cultural mindreading condition relative to the cross-cultural mindreading condition, but performance in the control conditions was equivalent. Experiment 2 replicated this pattern in independent samples of Australian and Chilean participants. These findings have important implications for cross-cultural communication and understanding. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Safeguards Culture: Lessons Learned

    SciTech Connect

    Mladineo, Stephen V.

    2009-05-27

    Abstract: At the 2005 INMM/ESARDA Workshop in Santa Fe, New Mexico, I presented a paper entitled “Changing the Safeguards Culture: Broader Perspectives and Challenges.” That paper described a set of theoretical models that can be used as a basis for evaluating changes to safeguards culture. This paper builds on that theoretical discussion to address practical methods for influencing culture. It takes lessons from methods used to influence change in safety culture and security culture, and examines the applicability of these lessons to changing safeguards culture. Paper: At the 2005 INMM/ESARDA Workshop on “Changing the Safeguards Culture: Broader Perspectives and Challenges,” in Santa Fe, New Mexico, I presented a paper entitled “Changing the Safeguards Culture: Broader Perspectives and Challenges.” That paper, coauthored by Karyn R. Durbin and Andrew Van Duzer, described a set of theoretical models that can be used as a basis for evaluating changes to safeguards culture. This paper updates that theoretical discussion, and seeks to address practical methods for influencing culture. It takes lessons from methods used to influence change in safety culture and security culture, and examines the applicability of these lessons to changing safeguards culture. Implicit in this discussion is an understanding that improving a culture is not an end in itself, but is one method of improving the underlying discipline, that is safety, security, or safeguards. Culture can be defined as a way of life, or general customs and beliefs of a particular group of people at a particular time. There are internationally accepted definitions of safety culture and nuclear security culture. As yet, there is no official agreed upon definition of safeguards culture. At the end of the paper I will propose my definition. At the Santa Fe Workshop the summary by the Co-Chairs of Working Group 1, “The Further Evolution of Safeguards,” noted: “It is clear that ‘safeguards culture

  14. Cross-Cultural Impression Management: A Cultural Knowledge Audit Model

    ERIC Educational Resources Information Center

    Spong, Abigail; Kamau, Caroline

    2012-01-01

    Purpose: Many people moving into a new culture for work or study do so without prior cross-cultural training, yet successful cultural adaptation has important ramifications. The purpose of this paper is to focus on cross-cultural impression management as an element of cultural adaptation. Does cultural adaptation begin by paying strong attention…

  15. Cross-Cultural Impression Management: A Cultural Knowledge Audit Model

    ERIC Educational Resources Information Center

    Spong, Abigail; Kamau, Caroline

    2012-01-01

    Purpose: Many people moving into a new culture for work or study do so without prior cross-cultural training, yet successful cultural adaptation has important ramifications. The purpose of this paper is to focus on cross-cultural impression management as an element of cultural adaptation. Does cultural adaptation begin by paying strong attention…

  16. Culture-sensitive psychotraumatology

    PubMed Central

    Schnyder, Ulrich; Bryant, Richard A.; Ehlers, Anke; Foa, Edna B.; Hasan, Aram; Mwiti, Gladys; Kristensen, Christian H.; Neuner, Frank; Oe, Misari; Yule, William

    2016-01-01

    Background Although there is some evidence of the posttraumatic stress disorder (PTSD) construct's cross cultural validity, trauma-related disorders may vary across cultures, and the same may be true for treatments that address such conditions. Experienced therapists tailor psychotherapy to each patient's particular situation, to the nature of the patient's psychopathology, to the stage of therapy, and so on. In addition, culture-sensitive psychotherapists try to understand how culture enhances the meaning of their patient's life history, the cultural components of their illness and help-seeking behaviors, as well as their expectations with regard to treatment. We cannot take for granted that all treatment-seeking trauma survivors speak our language or share our cultural values. Therefore, we need to increase our cultural competencies. Methods The authors of this article are clinicians and/or researchers from across the globe, working with trauma survivors in various settings. Each author focused on one or more specific cultural aspects of working with trauma survivors and highlighted the following aspects. Results As a result of culture-specific individual and collective meanings linked to trauma and trauma-related disorders survivors may be exposed to (self-)stigma in the aftermath of trauma. Patients who are reluctant to talk about their traumatic experiences may instead be willing to write or use other ways of accessing the painful memories such as drawing. In other cultures, community and family cohesion are crucial elements of recovery. While awareness of culture-specific aspects is important, we also need to beware of premature cultural stereotyping. When disseminating empirically supported psychotherapies for PTSD across cultures, a number of additional challenges need to be taken into account: many low and middle income countries have very limited resources available and suffer from a poor health infrastructure. Conclusions In summary, culture

  17. Astronomy in Culture

    NASA Astrophysics Data System (ADS)

    Stavinschi, M.

    2010-07-01

    Which is more appropriate? “Astronomy in culture,” or “Astronomy and culture,” or “Culture without astronomy?” These are only few variants, each with its own sense. I guess the last question is the most pertinent. Does culture really exist without astronomy? The existence and evolution of the human civilization answer NO! But what “culture” means? When we are thinking of a culture (the Hellenistic one, for instance), we mean a set of customs, artistic, religious, intellectual manifestations that differentiate one group or society from another. On the other hand, we often use the notion of culture in a different sense: shared beliefs, ways of regarding and doing, which orient more or less consciously the behavior of an individual or a group. An example would be the laic culture. Moreover, the set of knowledge acquired in one or several domains also constitutes a culture, for instance the scientific culture of an individual or a group. Finally, the set of cultures is nothing else but the civilization. Now, if we come back in time into the history of civilization, we find a permanent component, which was never missing and often played a decisive part in its evolution: the Astronomy.

  18. Culture and Psychiatric Diagnosis

    PubMed Central

    Lewis-Fernández, Roberto; Aggarwal, Neil Krishan

    2015-01-01

    Since the publication of DSM-IV in 1994, a number of components related to psychiatric diagnosis have come under criticism for their inaccuracies and inadequacies. Neurobiologists and anthropologists have particularly criticized the rigidity of DSM-IV diagnostic criteria that appear to exclude whole classes of alternate illness presentations as well as the lack of attention in contemporary psychiatric nosology to the role of contextual factors in the emergence and characteristics of psychopathology. Experts in culture and mental health have responded to these criticisms by revising the very process of diagnosis for DSM-5. Specifically, the DSM-5 Cultural Issues Subgroup has recommended that concepts of culture be included more prominently in several areas: an introductory chapter on Cultural Aspects of Psychiatric Diagnosis –composed of a conceptual introduction, a revised Outline for Cultural Formulation, a Cultural Formulation Interview that operationalizes this Outline, and a glossary on cultural concepts of distress—as well as material directly related to culture that is incorporated into the description of each disorder. This chapter surveys these recommendations to demonstrate how culture and context interact with psychiatric diagnosis at multiple levels. A greater appreciation of the interplay between culture, context, and biology can help clinicians improve diagnostic and treatment planning. PMID:23816860

  19. Culture and psychiatric diagnosis.

    PubMed

    Lewis-Fernández, Roberto; Aggarwal, Neil Krishan

    2013-01-01

    Since the publication of DSM-IV in 1994, neurobiologists and anthropologists have criticized the rigidity of its diagnostic criteria that appear to exclude whole classes of alternate illness presentations, as well as the lack of attention in contemporary psychiatric nosology to the role of contextual factors in the emergence and characteristics of psychopathology. Experts in culture and mental health have responded to these criticisms by revising the very process of diagnosis for DSM-5. Specifically, the DSM-5 Cultural Issues Subgroup has recommended that concepts of culture be included more prominently in several areas: an introductory chapter on Cultural Aspects of Psychiatric Diagnosis - composed of a conceptual introduction, a revised Outline for Cultural Formulation, a Cultural Formulation Interview that operationalizes this Outline, and a glossary on cultural concepts of distress - as well as material directly related to culture that is incorporated into the description of each disorder. This chapter surveys these recommendations to demonstrate how culture and context interact with psychiatric diagnosis at multiple levels. A greater appreciation of the interplay between culture, context, and biology can help clinicians improve diagnostic and treatment planning. Copyright © 2013 APA*

  20. Microbial diversity and dynamics during the production of May bryndza cheese.

    PubMed

    Pangallo, Domenico; Saková, Nikoleta; Koreňová, Janka; Puškárová, Andrea; Kraková, Lucia; Valík, Lubomír; Kuchta, Tomáš

    2014-01-17

    paradoxus. The diversity of yeasts and fungi encompassed Alternaria alternata, "Ascomycete sp.", Aspergillus fumigatus, Beauveria brongniartii, Candida xylopsoci, C. inconspicua, Cladosporium cladosporioides, Debaromyces hansenii, Fomes fomentarius, Galactomyces candidus, Gymnoascus reesii, Chaetomium globosum, Kluyveromyces marxianus, Metarhizium anisopliae, Penicillium aurantiogriseum, P. camemberti, P. freii, P. polonicum, P. viridicatum, Pichia kudriavzevii, Sordaria alcina, Trichosporon lactis and Yarrowia lipolytica.

  1. Culture in Foreign Language Teaching

    ERIC Educational Resources Information Center

    Kramsch, Claire

    2013-01-01

    In foreign language education, the teaching of culture remains a hotly debated issue. What is culture? What is its relation to language? Which and whose culture should be taught? What role should the learners' culture play in the acquisition of knowledge of the target culture? How can we avoid essentializing cultures and teaching stereotypes? And…

  2. Ethics, evolution and culture.

    PubMed

    Mesoudi, Alex; Danielson, Peter

    2008-08-01

    Recent work in the fields of evolutionary ethics and moral psychology appears to be converging on a single empirically- and evolutionary-based science of morality or ethics. To date, however, these fields have failed to provide an adequate conceptualisation of how culture affects the content and distribution of moral norms. This is particularly important for a large class of moral norms relating to rapidly changing technological or social environments, such as norms regarding the acceptability of genetically modified organisms. Here we suggest that a science of morality/ethics can benefit from adopting a cultural evolution or gene-culture coevolution approach, which treats culture as a second, separate evolutionary system that acts in parallel to biological/genetic evolution. This cultural evolution approach brings with it a set of established theoretical concepts (e.g. different cultural transmission mechanisms) and empirical methods (e.g. evolutionary game theory) that can significantly improve our understanding of human morality.

  3. Nature/culture/seawater.

    PubMed

    Helmreich, Stefan

    2011-01-01

    Seawater has occupied an ambiguous place in anthropological categories of "nature" and "culture." Seawater as nature appears as potentiality of form and uncontainable flux; it moves faster than culture - with culture frequently figured through land-based metaphors - even as culture seeks to channel water's (nature's) flow. Seawater as culture manifests as a medium of pleasure, sustenance, travel, disaster. I argue that, although seawater's qualities in early anthropology were portrayed impressionistically, today technical, scientific descriptions of water's form prevail. For example, processes of globalization - which may also be called "oceanization" - are often described as "currents," "flows," and "circulations." Examining sea-set ethnography, maritime anthropologies, and contemporary social theory, I propose that seawater has operated as a “theory machine” for generating insights about human cultural organization. I develop this argument with ethnography from the Sargasso Sea and in the Sea Islands. I conclude with a critique of appeals to water's form in social theory.

  4. Culturally sensitive assessment.

    PubMed

    Edwards, C P; Kumru, A

    1999-04-01

    Issues of cultural interaction and culturally sensitive assessment and treatment of young children have become prominent in recent years for mental health professionals, for reasons having to do with changing demographics, public values, and professional vision. "Culture" refers to the sociocultural adaptation of design for living shared by people as members of a community. Mental health professionals who work with culturally diverse populations need to become culturally self-aware and find abstract and experiential ways to build a useful body of professional knowledge concerning childrearing and discipline practices, health and illness beliefs, communication styles, and expectations about family or professional relations or other group interactions. They also need to learn how to work effectively in intercultural teams, use families as partners and resources, train and work with interpreters, and select and use formal and nonformal assessment procedures in appropriate, culturally sensitive ways.

  5. Culture and math.

    PubMed

    Tcheang, Lili

    2014-01-01

    Cultural differences have been shown across a number of different cognitive domains from vision, language, and music. Mathematical cognition is another domain that is an integral part of modern society and because there are a fixed number of ways in which many math operations can be performed, it is also an apposite tool for cultural comparisons. This discussion examines the literature on mathematical processing in accordance with culture, summarizing the brain regions involved across various mathematical tasks. In doing so, we provide a clear picture of the anatomical similarities and differences between cultures when performing different math tasks. This information is useful to explore the possibility of enhancement of mathematical skills, where different strategies may be applicable in accordance with culture. It also contributes to the evolutionary development of different math skills and the growing theory that anatomical and behavioral studies must account for the cultural identity of their sample.

  6. Culture, ethnicity, and paranoia.

    PubMed

    Sen, P; Chowdhury, A N

    2006-06-01

    This paper defines concepts of culture, ethnicity, and paranoia. It then explores the relationship between culture and ethnicity and the development of paranoia both in mental health settings and in the wider world. The importance of cultural awareness training while dealing with an ethnic population in any multicultural setting is emphasized. When exploring paranoia, proper exploration of its genesis is essential to distinguish between pathological and nonpathological paranoia.

  7. Cultural relativity and poverty.

    PubMed

    Martin, M E; Henry, M

    1989-03-01

    The nurse who practices from a perspective of cultural relativity attempts to understand client behaviors within the context of the clients' culture. Viewing customs (behaviors) as a reflection of client beliefs and values can enhance the nurse's effectiveness with clients in poverty. This paper presents a case study in which a culturally relativistic perspective was used to assess and intervene with a family living in poverty.

  8. Darwinism and cultural change.

    PubMed

    Godfrey-Smith, Peter

    2012-08-05

    Evolutionary models of cultural change have acquired an important role in attempts to explain the course of human evolution, especially our specialization in knowledge-gathering and intelligent control of environments. In both biological and cultural change, different patterns of explanation become relevant at different 'grains' of analysis and in contexts associated with different explanatory targets. Existing treatments of the evolutionary approach to culture, both positive and negative, underestimate the importance of these distinctions. Close attention to grain of analysis motivates distinctions between three possible modes of cultural evolution, each associated with different empirical assumptions and explanatory roles.

  9. Cultivating Cultural Appreciation.

    ERIC Educational Resources Information Center

    Esprivalo, Pamela Sue; Forney, Scott

    2001-01-01

    Presents an activity that addresses cultural differences and diversity through ethnobotany. Offers a multicultural framework designed to develop concepts about plant characteristics and taxonomy. (ASK)

  10. Darwinism and cultural change

    PubMed Central

    Godfrey-Smith, Peter

    2012-01-01

    Evolutionary models of cultural change have acquired an important role in attempts to explain the course of human evolution, especially our specialization in knowledge-gathering and intelligent control of environments. In both biological and cultural change, different patterns of explanation become relevant at different ‘grains’ of analysis and in contexts associated with different explanatory targets. Existing treatments of the evolutionary approach to culture, both positive and negative, underestimate the importance of these distinctions. Close attention to grain of analysis motivates distinctions between three possible modes of cultural evolution, each associated with different empirical assumptions and explanatory roles. PMID:22734059

  11. Cultivating Cultural Appreciation.

    ERIC Educational Resources Information Center

    Esprivalo, Pamela Sue; Forney, Scott

    2001-01-01

    Presents an activity that addresses cultural differences and diversity through ethnobotany. Offers a multicultural framework designed to develop concepts about plant characteristics and taxonomy. (ASK)

  12. Do invertebrates have culture?

    PubMed

    Danchin, Etienne; Blanchet, Simon; Mery, Frédérick; Wagner, Richard H

    2010-07-01

    A recent paper in Current Biology1 showed for the first time that female invertebrates (Drosophila melanogaster) can perform mate choice copying. Here, we discuss how female mating preferences in this species may be transmitted culturally. If culture occurs in invertebrates, it may be a relatively ancient evolutionary process that may have contributed to the evolution of many different taxa. This would considerably broaden the taxonomic range of cultural processes and suggest the need to include cultural inheritance in all animals into the general theory of evolution.2-4.

  13. Runaway cultural niche construction

    PubMed Central

    Rendell, Luke; Fogarty, Laurel; Laland, Kevin N.

    2011-01-01

    Cultural niche construction is a uniquely potent source of selection on human populations, and a major cause of recent human evolution. Previous theoretical analyses have not, however, explored the local effects of cultural niche construction. Here, we use spatially explicit coevolutionary models to investigate how cultural processes could drive selection on human genes by modifying local resources. We show that cultural learning, expressed in local niche construction, can trigger a process with dynamics that resemble runaway sexual selection. Under a broad range of conditions, cultural niche-constructing practices generate selection for gene-based traits and hitchhike to fixation through the build up of statistical associations between practice and trait. This process can occur even when the cultural practice is costly, or is subject to counteracting transmission biases, or the genetic trait is selected against. Under some conditions a secondary hitchhiking occurs, through which genetic variants that enhance the capability for cultural learning are also favoured by similar dynamics. We suggest that runaway cultural niche construction could have played an important role in human evolution, helping to explain why humans are simultaneously the species with the largest relative brain size, the most potent capacity for niche construction and the greatest reliance on culture. PMID:21320897

  14. Anorexia nervosa and culture.

    PubMed

    Simpson, K J

    2002-02-01

    Anorexia nervosa is currently considered a disorder confined to Western culture. Its recent identification in non-Western societies and different subcultures within the Western world has provoked a theory that Western cultural ideals of slimness and beauty have infiltrated these societies. The biomedical definition of anorexia nervosa emphasizes fat-phobia in the presentation of anorexia nervosa. However, evidence exists that suggests anorexia nevosa can exist without the Western fear of fatness and that this culturally biased view of anorexia nervosa may obscure health care professionals' understanding of a patient's own cultural reasons for self-starvation, and even hinder their recovery.

  15. Influence of plant culture conditions on efficacy of foliar applications of entomopathogenic fungi against western flower thrips

    USDA-ARS?s Scientific Manuscript database

    A series of greenhouse tests was conducted to assess the efficacy of foliar applications of two commercially available entomopathogenic fungi, Beauveria bassiana strain GHA and Metarhizium brunneum strain F52, against western flower thrips infesting potted impatiens grown with subirrigation. Unformu...

  16. Cultural change that sticks.

    PubMed

    Katzenbach, Jon R; Steffen, Ilona; Kronley, Caroline

    2012-01-01

    When a major change initiative runs aground, leaders often blame their company's culture for pushing it off course. They try to forge ahead by overhauling the culture--a tactic that tends to fizzle, fail, or backfire. Most cultures are too well entrenched to be jettisoned. The secret is to stop fighting your culture--and to work with and within it, until it evolves in the right direction. Today's best-performing companies, such as Southwest Airlines, Apple, and the Four Seasons, understand this, say the authors, three consultants from Booz & Company. These organizations follow five principles for making the most of their cultures: 1. Match strategy to culture. Culture trumps strategy every time, no matter how brilliant the plan, so the two need to be in alignment. 2. Focus on a few critical shifts in behavior. Wholesale change is hard; choose your battles wisely. 3. Honor the strengths of the existing culture. Every culture is the product of good intentions and has strengths; put them to use. 4. Integrate formal and informal interventions. Don't just implement new rules and processes; identify "influencers" who can bring other employees along. 5. Measure and monitor cultural evolution. Otherwise you can't identify backsliding or correct course. When the leaders of Aetna applied these rules while implementing a new strategy in the early 2000s, they reinvigorated the company's ailing culture and restored employee pride. That shift was reflected in the business results, as Aetna went from a $300 million loss to a $1.7 billion gain.

  17. Cultural Perspective on African American Culture

    ERIC Educational Resources Information Center

    Brown, Angela Khristin

    2013-01-01

    The migration of blacks in North America through slavery became united. The population of blacks passed down a tradition of artist through art to native born citizens. The art tradition involved telling stories to each generation in black families. The black culture elevated by tradition created hope to determine their personal freedom to escape…

  18. Cultural Legacies: Operationalizing Chicano Cultural Values.

    ERIC Educational Resources Information Center

    Ordaz, Maricela; Anda, Diane de

    1996-01-01

    Survey of 41 Chicanos and 39 whites ages 18-80 found that despite effects of acculturation, Chicanos held educational and developmental values and beliefs consistent with ancient Nahuatl (Aztec) society, an indigenous Mexican culture. Suggests a need to examine social service delivery systems to determine whether assumptions and procedures are…

  19. Cultural Legacies: Operationalizing Chicano Cultural Values.

    ERIC Educational Resources Information Center

    Ordaz, Maricela; Anda, Diane de

    1996-01-01

    Survey of 41 Chicanos and 39 whites ages 18-80 found that despite effects of acculturation, Chicanos held educational and developmental values and beliefs consistent with ancient Nahuatl (Aztec) society, an indigenous Mexican culture. Suggests a need to examine social service delivery systems to determine whether assumptions and procedures are…

  20. Cultural macroevolution matters.

    PubMed

    Gray, Russell D; Watts, Joseph

    2017-07-24

    Evolutionary thinking can be applied to both cultural microevolution and macroevolution. However, much of the current literature focuses on cultural microevolution. In this article, we argue that the growing availability of large cross-cultural datasets facilitates the use of computational methods derived from evolutionary biology to answer broad-scale questions about the major transitions in human social organization. Biological methods can be extended to human cultural evolution. We illustrate this argument with examples drawn from our recent work on the roles of Big Gods and ritual human sacrifice in the evolution of large, stratified societies. These analyses show that, although the presence of Big Gods is correlated with the evolution of political complexity, in Austronesian cultures at least, they do not play a causal role in ratcheting up political complexity. In contrast, ritual human sacrifice does play a causal role in promoting and sustaining the evolution of stratified societies by maintaining and legitimizing the power of elites. We briefly discuss some common objections to the application of phylogenetic modeling to cultural evolution and argue that the use of these methods does not require a commitment to either gene-like cultural inheritance or to the view that cultures are like vertebrate species. We conclude that the careful application of these methods can substantially enhance the prospects of an evolutionary science of human history.