Monte Carlo approaches to sampling forested tracts with lines or points
Harry T. Valentine; Jeffrey H. Gove; Timothy G. Gregoire
2001-01-01
Several line- and point-based sampling methods can be employed to estimate the aggregate dimensions of trees standing on a forested tract or pieces of coarse woody debris lying on the forest floor. Line methods include line intersect sampling, horizontal line sampling, and transect relascope sampling; point methods include variable- and fixed-radius plot sampling, and...
Method and system for laser-based formation of micro-shapes in surfaces of optical elements
Bass, Isaac Louis; Guss, Gabriel Mark
2013-03-05
A method of forming a surface feature extending into a sample includes providing a laser operable to emit an output beam and modulating the output beam to form a pulse train having a plurality of pulses. The method also includes a) directing the pulse train along an optical path intersecting an exposed portion of the sample at a position i and b) focusing a first portion of the plurality of pulses to impinge on the sample at the position i. Each of the plurality of pulses is characterized by a spot size at the sample. The method further includes c) ablating at least a portion of the sample at the position i to form a portion of the surface feature and d) incrementing counter i. The method includes e) repeating steps a) through d) to form the surface feature. The sample is free of a rim surrounding the surface feature.
Combinatorial Screening Of Inorganic And Organometallic Materials
Li, Yi , Li, Jing , Britton, Ted W.
2002-06-25
A method for differentiating and enumerating nucleated red blood cells in a blood sample is described. The method includes the steps of lysing red blood cells of a blood sample with a lytic reagent, measuring nucleated blood cells by DC impedance measurement in a non-focused flow aperture, differentiating nucleated red blood cells from other cell types, and reporting nucleated red blood cells in the blood sample. The method further includes subtracting nucleated red blood cells and other interference materials from the count of remaining blood cells, and reporting a corrected white blood cell count of the blood sample. Additionally, the method further includes measuring spectrophotometric absorbance of the sample mixture at a predetermined wavelength of a hemoglobin chromogen formed upon lysing the blood sample, and reporting hemoglobin concentration of the blood sample.
Protocol for Detection of Yersinia pestis in Environmental ...
Methods Report This is the first ever open-access and detailed protocol available to all government departments and agencies, and their contractors to detect Yersinia pestis, the pathogen that causes plague, from multiple environmental sample types including water. Each analytical method includes sample processing procedure for each sample type in a step-by-step manner. It includes real-time PCR, traditional microbiological culture, and the Rapid Viability PCR (RV-PCR) analytical methods. For large volume water samples it also includes an ultra-filtration-based sample concentration procedure. Because of such a non-restrictive availability of this protocol to all government departments and agencies, and their contractors, the nation will now have increased laboratory capacity to analyze large number of samples during a wide-area plague incident.
Log sampling methods and software for stand and landscape analyses.
Lisa J. Bate; Torolf R. Torgersen; Michael J. Wisdom; Edward O. Garton; Shawn C. Clabough
2008-01-01
We describe methods for efficient, accurate sampling of logs at landscape and stand scales to estimate density, total length, cover, volume, and weight. Our methods focus on optimizing the sampling effort by choosing an appropriate sampling method and transect length for specific forest conditions and objectives. Sampling methods include the line-intersect method and...
Sampling Methods in Cardiovascular Nursing Research: An Overview.
Kandola, Damanpreet; Banner, Davina; O'Keefe-McCarthy, Sheila; Jassal, Debbie
2014-01-01
Cardiovascular nursing research covers a wide array of topics from health services to psychosocial patient experiences. The selection of specific participant samples is an important part of the research design and process. The sampling strategy employed is of utmost importance to ensure that a representative sample of participants is chosen. There are two main categories of sampling methods: probability and non-probability. Probability sampling is the random selection of elements from the population, where each element of the population has an equal and independent chance of being included in the sample. There are five main types of probability sampling including simple random sampling, systematic sampling, stratified sampling, cluster sampling, and multi-stage sampling. Non-probability sampling methods are those in which elements are chosen through non-random methods for inclusion into the research study and include convenience sampling, purposive sampling, and snowball sampling. Each approach offers distinct advantages and disadvantages and must be considered critically. In this research column, we provide an introduction to these key sampling techniques and draw on examples from the cardiovascular research. Understanding the differences in sampling techniques may aid nurses in effective appraisal of research literature and provide a reference pointfor nurses who engage in cardiovascular research.
[Recent advances in sample preparation methods of plant hormones].
Wu, Qian; Wang, Lus; Wu, Dapeng; Duan, Chunfeng; Guan, Yafeng
2014-04-01
Plant hormones are a group of naturally occurring trace substances which play a crucial role in controlling the plant development, growth and environment response. With the development of the chromatography and mass spectroscopy technique, chromatographic analytical method has become a widely used way for plant hormone analysis. Among the steps of chromatographic analysis, sample preparation is undoubtedly the most vital one. Thus, a highly selective and efficient sample preparation method is critical for accurate identification and quantification of phytohormones. For the three major kinds of plant hormones including acidic plant hormones & basic plant hormones, brassinosteroids and plant polypeptides, the sample preparation methods are reviewed in sequence especially the recently developed methods. The review includes novel methods, devices, extractive materials and derivative reagents for sample preparation of phytohormones analysis. Especially, some related works of our group are included. At last, the future developments in this field are also prospected.
Contrast enhanced spectroscopic optical coherence tomography
NASA Technical Reports Server (NTRS)
Xu, Chenyang (Inventor); Boppart, Stephen A. (Inventor)
2010-01-01
A method of forming an image of a sample includes performing SOCT on a sample. The sample may include a contrast agent, which may include an absorbing agent and/or a scattering agent. A method of forming an image of tissue may include selecting a contrast agent, delivering the contrast agent to the tissue, acquiring SOCT data from the tissue, and converting the SOCT data into an image. The contributions to the SOCT data of an absorbing agent and a scattering agent in a sample may be quantified separately.
Systems and methods for sample analysis
Cooks, Robert Graham; Li, Guangtao; Li, Xin; Ouyang, Zheng
2015-01-13
The invention generally relates to systems and methods for sample analysis. In certain embodiments, the invention provides a system for analyzing a sample that includes a probe including a material connected to a high voltage source, a device for generating a heated gas, and a mass analyzer.
Chen, Yibin; Chen, Jiaxi; Chen, Xuan; Wang, Min; Wang, Wei
2015-01-01
A new method of uniform sampling is evaluated in this paper. The items and indexes were adopted to evaluate the rationality of the uniform sampling. The evaluation items included convenience of operation, uniformity of sampling site distribution, and accuracy and precision of measured results. The evaluation indexes included operational complexity, occupation rate of sampling site in a row and column, relative accuracy of pill weight, and relative deviation of pill weight. They were obtained from three kinds of drugs with different shape and size by four kinds of sampling methods. Gray correlation analysis was adopted to make the comprehensive evaluation by comparing it with the standard method. The experimental results showed that the convenience of uniform sampling method was 1 (100%), odds ratio of occupation rate in a row and column was infinity, relative accuracy was 99.50-99.89%, reproducibility RSD was 0.45-0.89%, and weighted incidence degree exceeded the standard method. Hence, the uniform sampling method was easy to operate, and the selected samples were distributed uniformly. The experimental results demonstrated that the uniform sampling method has good accuracy and reproducibility, which can be put into use in drugs analysis.
Apparatus and method for radioactive waste screening
Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy
2012-09-04
An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.
System and method for assaying radiation
DiPrete, David P; Whiteside, Tad; Pak, Donald J; DiPrete, Cecilia C
2013-11-12
A system for assaying radiation includes a sample holder configured to hold a liquid scintillation solution. A photomultiplier receives light from the liquid scintillation solution and generates a signal reflective of the light. A control circuit biases the photomultiplier and receives the signal from the photomultiplier reflective of the light. A light impermeable casing surrounds the sample holder, photomultiplier, and control circuit. A method for assaying radiation includes placing a sample in a liquid scintillation solution, placing the liquid scintillation solution in a sample holder, and placing the sample holder inside a light impermeable casing. The method further includes positioning a photomultiplier inside the light impermeable casing and supplying power to a control circuit inside the light impermeable casing.
Mixture and method for simulating soiling and weathering of surfaces
Sleiman, Mohamad; Kirchstetter, Thomas; Destaillats, Hugo; Levinson, Ronnen; Berdahl, Paul; Akbari, Hashem
2018-01-02
This disclosure provides systems, methods, and apparatus related to simulated soiling and weathering of materials. In one aspect, a soiling mixture may include an aqueous suspension of various amounts of salt, soot, dust, and humic acid. In another aspect, a method may include weathering a sample of material in a first exposure of the sample to ultraviolet light, water vapor, and elevated temperatures, depositing a soiling mixture on the sample, and weathering the sample in a second exposure of the sample to ultraviolet light, water vapor, and elevated temperatures.
Apel, William A.; Thompson, Vicki S; Lacey, Jeffrey A.; Gentillon, Cynthia A.
2016-08-09
A method for determining a plurality of proteins for discriminating and positively identifying an individual based from a biological sample. The method may include profiling a biological sample from a plurality of individuals against a protein array including a plurality of proteins. The protein array may include proteins attached to a support in a preselected pattern such that locations of the proteins are known. The biological sample may be contacted with the protein array such that a portion of antibodies in the biological sample reacts with and binds to the proteins forming immune complexes. A statistical analysis method, such as discriminant analysis, may be performed to determine discriminating proteins for distinguishing individuals. Proteins of interest may be used to form a protein array. Such a protein array may be used, for example, to compare a forensic sample from an unknown source with a sample from a known source.
Thompson, Vicki S; Lacey, Jeffrey A; Gentillon, Cynthia A; Apel, William A
2015-03-03
A method for determining a plurality of proteins for discriminating and positively identifying an individual based from a biological sample. The method may include profiling a biological sample from a plurality of individuals against a protein array including a plurality of proteins. The protein array may include proteins attached to a support in a preselected pattern such that locations of the proteins are known. The biological sample may be contacted with the protein array such that a portion of antibodies in the biological sample reacts with and binds to the proteins forming immune complexes. A statistical analysis method, such as discriminant analysis, may be performed to determine discriminating proteins for distinguishing individuals. Proteins of interest may be used to form a protein array. Such a protein array may be used, for example, to compare a forensic sample from an unknown source with a sample from a known source.
Floating Ultrasonic Transducer Inspection System and Method for Nondestructive Evaluation
NASA Technical Reports Server (NTRS)
Johnston, Patrick H. (Inventor); Zalameda, Joseph N. (Inventor)
2016-01-01
A method for inspecting a structural sample using ultrasonic energy includes positioning an ultrasonic transducer adjacent to a surface of the sample, and then transmitting ultrasonic energy into the sample. Force pulses are applied to the transducer concurrently with transmission of the ultrasonic energy. A host machine processes ultrasonic return pulses from an ultrasonic pulser/receiver to quantify attenuation of the ultrasonic energy within the sample. The host machine detects a defect in the sample using the quantified level of attenuation. The method may include positioning a dry couplant between an ultrasonic transducer and the surface. A system includes an actuator, an ultrasonic transducer, a dry couplant between the transducer the sample, a scanning device that moves the actuator and transducer, and a measurement system having a pulsed actuator power supply, an ultrasonic pulser/receiver, and a host machine that executes the above method.
Methyl-CpG island-associated genome signature tags
Dunn, John J
2014-05-20
Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.
Amonette, James E.; Autrey, S. Thomas; Foster-Mills, Nancy S.
2006-02-14
Methods and apparatus for simultaneous or sequential, rapid analysis of multiple samples by photoacoustic spectroscopy are disclosed. Particularly, a photoacoustic spectroscopy sample array vessel including a vessel body having multiple sample cells connected thereto is disclosed. At least one acoustic detector is acoustically positioned near the sample cells. Methods for analyzing the multiple samples in the sample array vessels using photoacoustic spectroscopy are provided.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
An evaluation of methods for estimating decadal stream loads
NASA Astrophysics Data System (ADS)
Lee, Casey J.; Hirsch, Robert M.; Schwarz, Gregory E.; Holtschlag, David J.; Preston, Stephen D.; Crawford, Charles G.; Vecchia, Aldo V.
2016-11-01
Effective management of water resources requires accurate information on the mass, or load of water-quality constituents transported from upstream watersheds to downstream receiving waters. Despite this need, no single method has been shown to consistently provide accurate load estimates among different water-quality constituents, sampling sites, and sampling regimes. We evaluate the accuracy of several load estimation methods across a broad range of sampling and environmental conditions. This analysis uses random sub-samples drawn from temporally-dense data sets of total nitrogen, total phosphorus, nitrate, and suspended-sediment concentration, and includes measurements of specific conductance which was used as a surrogate for dissolved solids concentration. Methods considered include linear interpolation and ratio estimators, regression-based methods historically employed by the U.S. Geological Survey, and newer flexible techniques including Weighted Regressions on Time, Season, and Discharge (WRTDS) and a generalized non-linear additive model. No single method is identified to have the greatest accuracy across all constituents, sites, and sampling scenarios. Most methods provide accurate estimates of specific conductance (used as a surrogate for total dissolved solids or specific major ions) and total nitrogen - lower accuracy is observed for the estimation of nitrate, total phosphorus and suspended sediment loads. Methods that allow for flexibility in the relation between concentration and flow conditions, specifically Beale's ratio estimator and WRTDS, exhibit greater estimation accuracy and lower bias. Evaluation of methods across simulated sampling scenarios indicate that (1) high-flow sampling is necessary to produce accurate load estimates, (2) extrapolation of sample data through time or across more extreme flow conditions reduces load estimate accuracy, and (3) WRTDS and methods that use a Kalman filter or smoothing to correct for departures between individual modeled and observed values benefit most from more frequent water-quality sampling.
An evaluation of methods for estimating decadal stream loads
Lee, Casey; Hirsch, Robert M.; Schwarz, Gregory E.; Holtschlag, David J.; Preston, Stephen D.; Crawford, Charles G.; Vecchia, Aldo V.
2016-01-01
Effective management of water resources requires accurate information on the mass, or load of water-quality constituents transported from upstream watersheds to downstream receiving waters. Despite this need, no single method has been shown to consistently provide accurate load estimates among different water-quality constituents, sampling sites, and sampling regimes. We evaluate the accuracy of several load estimation methods across a broad range of sampling and environmental conditions. This analysis uses random sub-samples drawn from temporally-dense data sets of total nitrogen, total phosphorus, nitrate, and suspended-sediment concentration, and includes measurements of specific conductance which was used as a surrogate for dissolved solids concentration. Methods considered include linear interpolation and ratio estimators, regression-based methods historically employed by the U.S. Geological Survey, and newer flexible techniques including Weighted Regressions on Time, Season, and Discharge (WRTDS) and a generalized non-linear additive model. No single method is identified to have the greatest accuracy across all constituents, sites, and sampling scenarios. Most methods provide accurate estimates of specific conductance (used as a surrogate for total dissolved solids or specific major ions) and total nitrogen – lower accuracy is observed for the estimation of nitrate, total phosphorus and suspended sediment loads. Methods that allow for flexibility in the relation between concentration and flow conditions, specifically Beale’s ratio estimator and WRTDS, exhibit greater estimation accuracy and lower bias. Evaluation of methods across simulated sampling scenarios indicate that (1) high-flow sampling is necessary to produce accurate load estimates, (2) extrapolation of sample data through time or across more extreme flow conditions reduces load estimate accuracy, and (3) WRTDS and methods that use a Kalman filter or smoothing to correct for departures between individual modeled and observed values benefit most from more frequent water-quality sampling.
Amonette, James E.; Autrey, S. Thomas; Foster-Mills, Nancy S.; Green, David
2005-03-29
Methods and apparatus for analysis of multiple samples by photoacoustic spectroscopy are disclosed. Particularly, a photoacoustic spectroscopy sample array vessel including a vessel body having multiple sample cells connected thereto is disclosed. At least one acoustic detector is acoustically coupled with the vessel body. Methods for analyzing the multiple samples in the sample array vessels using photoacoustic spectroscopy are provided.
Unconstrained Enhanced Sampling for Free Energy Calculations of Biomolecules: A Review
Miao, Yinglong; McCammon, J. Andrew
2016-01-01
Free energy calculations are central to understanding the structure, dynamics and function of biomolecules. Yet insufficient sampling of biomolecular configurations is often regarded as one of the main sources of error. Many enhanced sampling techniques have been developed to address this issue. Notably, enhanced sampling methods based on biasing collective variables (CVs), including the widely used umbrella sampling, adaptive biasing force and metadynamics, have been discussed in a recent excellent review (Abrams and Bussi, Entropy, 2014). Here, we aim to review enhanced sampling methods that do not require predefined system-dependent CVs for biomolecular simulations and as such do not suffer from the hidden energy barrier problem as encountered in the CV-biasing methods. These methods include, but are not limited to, replica exchange/parallel tempering, self-guided molecular/Langevin dynamics, essential energy space random walk and accelerated molecular dynamics. While it is overwhelming to describe all details of each method, we provide a summary of the methods along with the applications and offer our perspectives. We conclude with challenges and prospects of the unconstrained enhanced sampling methods for accurate biomolecular free energy calculations. PMID:27453631
Unconstrained Enhanced Sampling for Free Energy Calculations of Biomolecules: A Review.
Miao, Yinglong; McCammon, J Andrew
Free energy calculations are central to understanding the structure, dynamics and function of biomolecules. Yet insufficient sampling of biomolecular configurations is often regarded as one of the main sources of error. Many enhanced sampling techniques have been developed to address this issue. Notably, enhanced sampling methods based on biasing collective variables (CVs), including the widely used umbrella sampling, adaptive biasing force and metadynamics, have been discussed in a recent excellent review (Abrams and Bussi, Entropy, 2014). Here, we aim to review enhanced sampling methods that do not require predefined system-dependent CVs for biomolecular simulations and as such do not suffer from the hidden energy barrier problem as encountered in the CV-biasing methods. These methods include, but are not limited to, replica exchange/parallel tempering, self-guided molecular/Langevin dynamics, essential energy space random walk and accelerated molecular dynamics. While it is overwhelming to describe all details of each method, we provide a summary of the methods along with the applications and offer our perspectives. We conclude with challenges and prospects of the unconstrained enhanced sampling methods for accurate biomolecular free energy calculations.
Bannerman, J A; Costamagna, A C; McCornack, B P; Ragsdale, D W
2015-06-01
Generalist natural enemies play an important role in controlling soybean aphid, Aphis glycines (Hemiptera: Aphididae), in North America. Several sampling methods are used to monitor natural enemy populations in soybean, but there has been little work investigating their relative bias, precision, and efficiency. We compare five sampling methods: quadrats, whole-plant counts, sweep-netting, walking transects, and yellow sticky cards to determine the most practical methods for sampling the three most prominent species, which included Harmonia axyridis (Pallas), Coccinella septempunctata L. (Coleoptera: Coccinellidae), and Orius insidiosus (Say) (Hemiptera: Anthocoridae). We show an important time by sampling method interaction indicated by diverging community similarities within and between sampling methods as the growing season progressed. Similarly, correlations between sampling methods for the three most abundant species over multiple time periods indicated differences in relative bias between sampling methods and suggests that bias is not consistent throughout the growing season, particularly for sticky cards and whole-plant samples. Furthermore, we show that sticky cards produce strongly biased capture rates relative to the other four sampling methods. Precision and efficiency differed between sampling methods and sticky cards produced the most precise (but highly biased) results for adult natural enemies, while walking transects and whole-plant counts were the most efficient methods for detecting coccinellids and O. insidiosus, respectively. Based on bias, precision, and efficiency considerations, the most practical sampling methods for monitoring in soybean include walking transects for coccinellid detection and whole-plant counts for detection of small predators like O. insidiosus. Sweep-netting and quadrat samples are also useful for some applications, when efficiency is not paramount. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Alternative sample sizes for verification dose experiments and dose audits
NASA Astrophysics Data System (ADS)
Taylor, W. A.; Hansen, J. M.
1999-01-01
ISO 11137 (1995), "Sterilization of Health Care Products—Requirements for Validation and Routine Control—Radiation Sterilization", provides sampling plans for performing initial verification dose experiments and quarterly dose audits. Alternative sampling plans are presented which provide equivalent protection. These sampling plans can significantly reduce the cost of testing. These alternative sampling plans have been included in a draft ISO Technical Report (type 2). This paper examines the rational behind the proposed alternative sampling plans. The protection provided by the current verification and audit sampling plans is first examined. Then methods for identifying equivalent plans are highlighted. Finally, methods for comparing the cost associated with the different plans are provided. This paper includes additional guidance for selecting between the original and alternative sampling plans not included in the technical report.
Rapid fusion method for the determination of Pu, Np, and Am in large soil samples
Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; ...
2015-02-14
A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measuredmore » using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.« less
Resampling methods in Microsoft Excel® for estimating reference intervals
Theodorsson, Elvar
2015-01-01
Computer- intensive resampling/bootstrap methods are feasible when calculating reference intervals from non-Gaussian or small reference samples. Microsoft Excel® in version 2010 or later includes natural functions, which lend themselves well to this purpose including recommended interpolation procedures for estimating 2.5 and 97.5 percentiles. The purpose of this paper is to introduce the reader to resampling estimation techniques in general and in using Microsoft Excel® 2010 for the purpose of estimating reference intervals in particular. Parametric methods are preferable to resampling methods when the distributions of observations in the reference samples is Gaussian or can transformed to that distribution even when the number of reference samples is less than 120. Resampling methods are appropriate when the distribution of data from the reference samples is non-Gaussian and in case the number of reference individuals and corresponding samples are in the order of 40. At least 500-1000 random samples with replacement should be taken from the results of measurement of the reference samples. PMID:26527366
Resampling methods in Microsoft Excel® for estimating reference intervals.
Theodorsson, Elvar
2015-01-01
Computer-intensive resampling/bootstrap methods are feasible when calculating reference intervals from non-Gaussian or small reference samples. Microsoft Excel® in version 2010 or later includes natural functions, which lend themselves well to this purpose including recommended interpolation procedures for estimating 2.5 and 97.5 percentiles. The purpose of this paper is to introduce the reader to resampling estimation techniques in general and in using Microsoft Excel® 2010 for the purpose of estimating reference intervals in particular. Parametric methods are preferable to resampling methods when the distributions of observations in the reference samples is Gaussian or can transformed to that distribution even when the number of reference samples is less than 120. Resampling methods are appropriate when the distribution of data from the reference samples is non-Gaussian and in case the number of reference individuals and corresponding samples are in the order of 40. At least 500-1000 random samples with replacement should be taken from the results of measurement of the reference samples.
Houts, Carrie R; Edwards, Michael C; Wirth, R J; Deal, Linda S
2016-11-01
There has been a notable increase in the advocacy of using small-sample designs as an initial quantitative assessment of item and scale performance during the scale development process. This is particularly true in the development of clinical outcome assessments (COAs), where Rasch analysis has been advanced as an appropriate statistical tool for evaluating the developing COAs using a small sample. We review the benefits such methods are purported to offer from both a practical and statistical standpoint and detail several problematic areas, including both practical and statistical theory concerns, with respect to the use of quantitative methods, including Rasch-consistent methods, with small samples. The feasibility of obtaining accurate information and the potential negative impacts of misusing large-sample statistical methods with small samples during COA development are discussed.
Apparatus and method for handheld sampling
Staab, Torsten A.
2005-09-20
The present invention includes an apparatus, and corresponding method, for taking a sample. The apparatus is built around a frame designed to be held in at least one hand. A sample media is used to secure the sample. A sample media adapter for securing the sample media is operated by a trigger mechanism connectively attached within the frame to the sample media adapter.
Kazmerski, Lawrence L.
1990-01-01
A Method and apparatus for differential spectroscopic atomic-imaging is disclosed for spatial resolution and imaging for display not only individual atoms on a sample surface, but also bonding and the specific atomic species in such bond. The apparatus includes a scanning tunneling microscope (STM) that is modified to include photon biasing, preferably a tuneable laser, modulating electronic surface biasing for the sample, and temperature biasing, preferably a vibration-free refrigerated sample mounting stage. Computer control and data processing and visual display components are also included. The method includes modulating the electronic bias voltage with and without selected photon wavelengths and frequency biasing under a stabilizing (usually cold) bias temperature to detect bonding and specific atomic species in the bonds as the STM rasters the sample. This data is processed along with atomic spatial topography data obtained from the STM raster scan to create a real-time visual image of the atoms on the sample surface.
Configurations and calibration methods for passive sampling techniques.
Ouyang, Gangfeng; Pawliszyn, Janusz
2007-10-19
Passive sampling technology has developed very quickly in the past 15 years, and is widely used for the monitoring of pollutants in different environments. The design and quantification of passive sampling devices require an appropriate calibration method. Current calibration methods that exist for passive sampling, including equilibrium extraction, linear uptake, and kinetic calibration, are presented in this review. A number of state-of-the-art passive sampling devices that can be used for aqueous and air monitoring are introduced according to their calibration methods.
Soil separator and sampler and method of sampling
O'Brien, Barry H [Idaho Falls, ID; Ritter, Paul D [Idaho Falls, ID
2010-02-16
A soil sampler includes a fluidized bed for receiving a soil sample. The fluidized bed may be in communication with a vacuum for drawing air through the fluidized bed and suspending particulate matter of the soil sample in the air. In a method of sampling, the air may be drawn across a filter, separating the particulate matter. Optionally, a baffle or a cyclone may be included within the fluidized bed for disentrainment, or dedusting, so only the finest particulate matter, including asbestos, will be trapped on the filter. The filter may be removable, and may be tested to determine the content of asbestos and other hazardous particulate matter in the soil sample.
Mixed Methods Sampling: A Typology with Examples
ERIC Educational Resources Information Center
Teddlie, Charles; Yu, Fen
2007-01-01
This article presents a discussion of mixed methods (MM) sampling techniques. MM sampling involves combining well-established qualitative and quantitative techniques in creative ways to answer research questions posed by MM research designs. Several issues germane to MM sampling are presented including the differences between probability and…
Preview of the NASA NNWG NDE Sample Preparation Handbook
NASA Technical Reports Server (NTRS)
2010-01-01
This viewgraph presents a step-by-step how-to fabrication documentation of every kind of sample that is fabricated for MSFC by UA Huntsville, including photos and illustrations. The tabulation of what kind of samples are being fabricated for what NDE method, detailed instructions/documentation of the inclusion/creation of defects, detailed specifications for materials, processes, and equipment, case histories and/or experiences with the different fabrication methods and defect inclusion techniques, discussion of pitfalls and difficulties associated with sample fabrication and defect inclusion techniques, and a discussion of why certain fabrication techniques are needed as related to the specific NDE methods are included in this presentation.
A Comparison of Two Sampling Strategies to Assess Discomycete Diversity in Wet Tropical Forests
SHARON A. CANTRELL
2004-01-01
Most of the fungal diversity studies that have used a systematic collecting scheme have not included the discomycetes, so optimal sampling methods are not available for this group. In this study, I tested two sampling methods at each sites in the Caribbean National Forest, Puerto Rico and Ebano Verde Reserve, Dominican Republic. For a plot-based sampling method, 10 Ã...
Stark, Peter C [Los Alamos, NM; Zurek, Eduardo [Barranquilla, CO; Wheat, Jeffrey V [Fort Walton Beach, FL; Dunbar, John M [Santa Fe, NM; Olivares, Jose A [Los Alamos, NM; Garcia-Rubio, Luis H [Temple Terrace, FL; Ward, Michael D [Los Alamos, NM
2011-07-26
There is provided a method and device for remote sampling, preparation and optical interrogation of a sample using light scattering and light absorption methods. The portable device is a filtration-based device that removes interfering background particle material from the sample matrix by segregating or filtering the chosen analyte from the sample solution or matrix while allowing the interfering background particles to be pumped out of the device. The segregated analyte is then suspended in a diluent for analysis. The device is capable of calculating an initial concentration of the analyte, as well as diluting the analyte such that reliable optical measurements can be made. Suitable analytes include cells, microorganisms, bioparticles, pathogens and diseases. Sample matrixes include biological fluids such as blood and urine, as well as environmental samples including waste water.
Field efficiency and bias of snag inventory methods
Robert S. Kenning; Mark J. Ducey; John C. Brissette; Jeffery H. Gove
2005-01-01
Snags and cavity trees are important components of forests, but can be difficult to inventory precisely and are not always included in inventories because of limited resources. We tested the application of N-tree distance sampling as a time-saving snag sampling method and compared N-tree distance sampling to fixed-area sampling and modified horizontal line sampling in...
Sampling Operations on Big Data
2015-11-29
gories. These include edge sampling methods where edges are selected by a predetermined criteria; snowball sampling methods where algorithms start... Sampling Operations on Big Data Vijay Gadepally, Taylor Herr, Luke Johnson, Lauren Milechin, Maja Milosavljevic, Benjamin A. Miller Lincoln...process and disseminate information for discovery and exploration under real-time constraints. Common signal processing operations such as sampling and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, L.D.
1986-01-01
This paper is an overview of sampling methods being recommended to EPA regulatory programs, to EPA engineering research and development projects, and to interested parties in the industrial community. The methods discussed are generally applicable to both incineration and processes closely related to incineration (e.g., co-firing of waste in industrial boilers, and burning of contaminated heating oil). Although methods for inorganic hazardous compounds are very briefly outlined, the primary emphasis of the paper is on organic compounds that are likely to be chosen as principal organic hazardous constituents (POHCs) for a trial burn. Methods receiving major attention include: the Modifiedmore » Method 5 Train (MM5) which includes an XAD-2 sorbent module, the Source Assessment Sampling System (SASS), the recently developed Volatile Organic Sampling Train (VOST), and assorted containers such as glass bulbs and plastic bags.« less
Methods for determination of inorganic substances in water and fluvial sediments
Fishman, Marvin J.; Friedman, Linda C.
1989-01-01
Chapter Al of the laboratory manual contains methods used by the U.S. Geological Survey to analyze samples of water, suspended sediments, and bottom material for their content of inorganic constituents. Included are methods for determining the concentration of dissolved constituents in water, the total recoverable and total of constituents in water-suspended sediment samples, and the recoverable and total concentrations of constituents in samples of bottom material. The introduction to the manual includes essential definitions and a brief discussion of the use of significant figures in calculating and reporting analytical results. Quality control in the water-analysis laboratory is discussed, including the accuracy and precision of analyses, the use of standard-reference water samples, and the operation of an effective quality-assurance program. Methods for sample preparation and pretreatment are given also. A brief discussion of the principles of the analytical techniques involved and their particular application to water and sediment analysis is presented. The analytical methods of these techniques are arranged alphabetically by constituent. For each method, the general topics covered are the application, the principle of the method, the interferences, the apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data, when available. More than 126 methods are given for the determination of 70 inorganic constituents and physical properties of water, suspended sediment, and bottom material.
Methods for determination of inorganic substances in water and fluvial sediments
Fishman, Marvin J.; Friedman, Linda C.
1985-01-01
Chapter Al of the laboratory manual contains methods used by the Geological Survey to analyze samples of water, suspended sediments, and bottom material for their content of inorganic constituents. Included are methods for determining the concentration of dissolved constituents in water, total recoverable and total of constituents in water-suspended sediment samples, and recoverable and total concentrations of constituents in samples of bottom material. Essential definitions are included in the introduction to the manual, along with a brief discussion of the use of significant figures in calculating and reporting analytical results. Quality control in the water-analysis laboratory is discussed, including accuracy and precision of analyses, the use of standard reference water samples, and the operation of an effective quality assurance program. Methods for sample preparation and pretreatment are given also.A brief discussion of the principles of the analytical techniques involved and their particular application to water and sediment analysis is presented. The analytical methods involving these techniques are arranged alphabetically according to constituent. For each method given, the general topics covered are application, principle of the method, interferences, apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data, when available. More than 125 methods are given for the determination of 70 different inorganic constituents and physical properties of water, suspended sediment, and bottom material.
A Ricin Forensic Profiling Approach Based on a Complex Set of Biomarkers
Fredriksson, Sten-Ake; Wunschel, David S.; Lindstrom, Susanne Wiklund; ...
2018-03-28
A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1 – PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods andmore » robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved.« less
A Ricin Forensic Profiling Approach Based on a Complex Set of Biomarkers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fredriksson, Sten-Ake; Wunschel, David S.; Lindstrom, Susanne Wiklund
A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1 – PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods andmore » robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved.« less
Method and apparatus for measuring nuclear magnetic properties
Weitekamp, D.P.; Bielecki, A.; Zax, D.B.; Zilm, K.W.; Pines, A.
1987-12-01
A method for studying the chemical and structural characteristics of materials is disclosed. The method includes placement of a sample material in a high strength polarizing magnetic field to order the sample nuclei. The condition used to order the sample is then removed abruptly and the ordering of the sample allowed to evolve for a time interval. At the end of the time interval, the ordering of the sample is measured by conventional nuclear magnetic resonance techniques. 5 figs.
Method and apparatus for measuring nuclear magnetic properties
Weitekamp, Daniel P.; Bielecki, Anthony; Zax, David B.; Zilm, Kurt W.; Pines, Alexander
1987-01-01
A method for studying the chemical and structural characteristics of materials is disclosed. The method includes placement of a sample material in a high strength polarizing magnetic field to order the sample nucleii. The condition used to order the sample is then removed abruptly and the ordering of the sample allowed to evolve for a time interval. At the end of the time interval, the ordering of the sample is measured by conventional nuclear magnetic resonance techniques.
System and method for assaying a radionuclide
Cadieux, James R; King, III, George S; Fugate, Glenn A
2014-12-23
A system for assaying a radionuclide includes a liquid scintillation detector, an analyzer connected to the liquid scintillation detector, and a delay circuit connected to the analyzer. A gamma detector and a multi-channel analyzer are connected to the delay circuit and the gamma detector. The multi-channel analyzer produces a signal reflective of the radionuclide in the sample. A method for assaying a radionuclide includes selecting a sample, detecting alpha or beta emissions from the sample with a liquid scintillation detector, producing a first signal reflective of the alpha or beta emissions, and delaying the first signal a predetermined time. The method further includes detecting gamma emissions from the sample, producing a second signal reflective of the gamma emissions, and combining the delayed first signal with the second signal to produce a third signal reflective of the radionuclide.
Jesse, Stephen [Knoxville, TN; Geohegan, David B [Knoxville, TN; Guillorn, Michael [Brooktondale, NY
2009-02-17
Methods and apparatus are described for SEM imaging and measuring electronic transport in nanocomposites based on electric field induced contrast. A method includes mounting a sample onto a sample holder, the sample including a sample material; wire bonding leads from the sample holder onto the sample; placing the sample holder in a vacuum chamber of a scanning electron microscope; connecting leads from the sample holder to a power source located outside the vacuum chamber; controlling secondary electron emission from the sample by applying a predetermined voltage to the sample through the leads; and generating an image of the secondary electron emission from the sample. An apparatus includes a sample holder for a scanning electron microscope having an electrical interconnect and leads on top of the sample holder electrically connected to the electrical interconnect; a power source and a controller connected to the electrical interconnect for applying voltage to the sample holder to control the secondary electron emission from a sample mounted on the sample holder; and a computer coupled to a secondary electron detector to generate images of the secondary electron emission from the sample.
Containers and systems for the measurement of radioactive gases and related methods
Mann, Nicholas R; Watrous, Matthew G; Oertel, Christopher P; McGrath, Christopher A
2017-06-20
Containers for a fluid sample containing a radionuclide for measurement of radiation from the radionuclide include an outer shell having one or more ports between an interior and an exterior of the outer shell, and an inner shell secured to the outer shell. The inner shell includes a detector receptacle sized for at least partial insertion into the outer shell. The inner shell and outer shell together at least partially define a fluid sample space. The outer shell and inner shell are configured for maintaining an operating pressure within the fluid sample space of at least about 1000 psi. Systems for measuring radioactivity in a fluid include such a container and a radiation detector received at least partially within the detector receptacle. Methods of measuring radioactivity in a fluid sample include maintaining a pressure of a fluid sample within a Marinelli-type container at least at about 1000 psi.
Filter for on-line air monitor unaffected by radon progeny and method of using same
Phillips, Terrance D.; Edwards, Howard D.
1999-01-01
An apparatus for testing air having contaminants and radon progeny therein. The apparatus includes a sampling box having an inlet for receiving the air and an outlet for discharging the air. The sampling box includes a filter made of a plate of sintered stainless steel. The filter traps the contaminants, yet allows at least a portion of the radon progeny to pass therethrough. A method of testing air having contaminants and radon progeny therein. The method includes providing a testing apparatus that has a sampling box with an inlet for receiving the air and an outlet for discharging the air, and has a sintered stainless steel filter disposed within said sampling box; drawing air from a source into the sampling box using a vacuum pump; passing the air through the filter; monitoring the contaminants trapped by the filter; and providing an alarm when a selected level of contaminants is reached. The filter traps the contaminants, yet allows at least a portion of the radon progeny to pass therethrough.
Lysimeter methods and apparatus
Clark, Don T.; Erickson, Eugene E.; Casper, William L.; Everett, David M.; Hubbell, Joel M.; Sisson, James B.
2004-12-07
A suction lysimeter for sampling subsurface liquids includes a lysimeter casing having a drive portion, a reservoir portion, and a tip portion, the tip portion including a membrane through which subsurface liquids may be sampled; a fluid conduit coupled in fluid flowing relation relative to the membrane, and which in operation facilitates the delivery of the sampled subsurface liquids from the membrane to the reservoir portion; and a plurality of tubes coupled in fluid flowing relation relative to the reservoir portion, the tubes in operation facilitating delivery of the sampled subsurface liquids from the reservoir portion for testing. A method of sampling subsurface liquids comprises using this lysimeter.
Van Berkel, Gary J.
2015-10-06
A system and method for analyzing a chemical composition of a specimen are described. The system can include at least one pin; a sampling device configured to contact a liquid with a specimen on the at least one pin to form a testing solution; and a stepper mechanism configured to move the at least one pin and the sampling device relative to one another. The system can also include an analytical instrument for determining a chemical composition of the specimen from the testing solution. In particular, the systems and methods described herein enable chemical analysis of specimens, such as tissue, to be evaluated in a manner that the spatial-resolution is limited by the size of the pins used to obtain tissue samples, not the size of the sampling device used to solubilize the samples coupled to the pins.
[Sampling methods for PM2.5 from stationary sources: a review].
Jiang, Jing-Kun; Deng, Jian-Guo; Li, Zhen; Li, Xing-Hua; Duan, Lei; Hao, Ji-Ming
2014-05-01
The new China national ambient air quality standard has been published in 2012 and will be implemented in 2016. To meet the requirements in this new standard, monitoring and controlling PM2,,5 emission from stationary sources are very important. However, so far there is no national standard method on sampling PM2.5 from stationary sources. Different sampling methods for PM2.5 from stationary sources and relevant international standards were reviewed in this study. It includes the methods for PM2.5 sampling in flue gas and the methods for PM2.5 sampling after dilution. Both advantages and disadvantages of these sampling methods were discussed. For environmental management, the method for PM2.5 sampling in flue gas such as impactor and virtual impactor was suggested as a standard to determine filterable PM2.5. To evaluate environmental and health effects of PM2.5 from stationary sources, standard dilution method for sampling of total PM2.5 should be established.
Levels of polychlorinated biphenyls (PCBs) in caulk and window glazing material samples from older buildings were determined, using a method developed for this purpose. This method was evaluated by analyzing a combination of 47 samples of caulk, glazing materials, including quali...
Zaugg, Steven D.; Phillips, Patrick J.; Smith, Steven G.
2014-01-01
Research on the effects of exposure of stream biota to complex mixtures of pharmaceuticals and other organic compounds associated with wastewater requires the development of additional analytical capabilities for these compounds in water samples. Two gas chromatography/mass spectrometry (GC/MS) analytical methods used at the U.S. Geological Survey National Water Quality Laboratory (NWQL) to analyze organic compounds associated with wastewater were adapted to include additional pharmaceutical and other organic compounds beginning in 2009. This report includes a description of method performance for 42 additional compounds for the filtered-water method (hereafter referred to as the filtered method) and 46 additional compounds for the unfiltered-water method (hereafter referred to as the unfiltered method). The method performance for the filtered method described in this report has been published for seven of these compounds; however, the addition of several other compounds to the filtered method and the addition of the compounds to the unfiltered method resulted in the need to document method performance for both of the modified methods. Most of these added compounds are pharmaceuticals or pharmaceutical degradates, although two nonpharmaceutical compounds are included in each method. The main pharmaceutical compound classes added to the two modified methods include muscle relaxants, opiates, analgesics, and sedatives. These types of compounds were added to the original filtered and unfiltered methods largely in response to the tentative identification of a wide range of pharmaceutical and other organic compounds in samples collected from wastewater-treatment plants. Filtered water samples are extracted by vacuum through disposable solid-phase cartridges that contain modified polystyrene-divinylbenzene resin. Unfiltered samples are extracted by using continuous liquid-liquid extraction with dichloromethane. The compounds of interest for filtered and unfiltered sample types were determined by use of the capillary-column gas chromatography/mass spectrometry. The performance of each method was assessed by using data on recoveries of compounds in fortified surface-water, wastewater, and reagent-water samples. These experiments (referred to as spike experiments) consist of fortifying (or spiking) samples with known amounts of target analytes. Surface-water-spike experiments were performed by using samples obtained from a stream in Colorado (unfiltered method) and a stream in New York (filtered method). Wastewater spike experiments for both the filtered and unfiltered methods were performed by using a treated wastewater obtained from a single wastewater treatment plant in New York. Surface water and wastewater spike experiments were fortified at both low and high concentrations and termed low- and high-level spikes, respectively. Reagent water spikes were assessed in three ways: (1) set spikes, (2) a low-concentration fortification experiment, and (3) a high-concentration fortification experiment. Set spike samples have been determined since 2009, and consist of analysis of fortified reagent water for target compounds included for each group of 10 to18 environmental samples analyzed at the NWQL. The low-concentration and high-concentration reagent spike experiments, by contrast, represent a one-time assessment of method performance. For each spike experiment, mean recoveries ranging from 60 to 130 percent indicate low bias, and relative standard deviations (RSDs) less than ( Of the compounds included in the filtered method, 21 had mean recoveries ranging from 63 to 129 percent for the low-level and high-level surface-water spikes, and had low ()132 percent]. For wastewater spikes, 24 of the compounds included in the filtered method had recoveries ranging from 61 to 130 percent for the low-level and high-level spikes. RSDs were 130 percent) or variable recoveries (RSDs >30 percent) for low-level wastewater spikes, or low recoveries ( Of the compounds included in the unfiltered method, 17 had mean spike recoveries ranging from 74 to 129 percent and RSDs ranging from 5 to 25 percent for low-level and high-level surface water spikes. The remaining compounds had poor mean recoveries (130 percent), or high RSDs (>29 percent) for these spikes. For wastewater, 14 of the compounds included in the unfiltered method had mean recoveries ranging from 62 to 127 percent and RSDs 130 percent), or low mean recoveries (33 percent) for the low-level wastewater spikes. Of the compounds found in wastewater, 24 had mean set spike recoveries ranging from 64 to 104 percent and RSDs Separate method detection limits (MDLs) were computed for surface water and wastewater for both the filtered and unfiltered methods. Filtered method MDLs ranged from 0.007 to 0.14 microgram per liter (μg/L) for the surface water matrix and from 0.004 to 0.62 μg/L for the wastewater matrix. Unfiltered method MDLs ranged from 0.014 to 0.33 μg/L for the surface water matrix and from 0.008 to 0.36 μg/L for the wastewater matrix.
[The research protocol III. Study population].
Arias-Gómez, Jesús; Villasís-Keever, Miguel Ángel; Miranda-Novales, María Guadalupe
2016-01-01
The study population is defined as a set of cases, determined, limited, and accessible, that will constitute the subjects for the selection of the sample, and must fulfill several characteristics and distinct criteria. The objectives of this manuscript are focused on specifying each one of the elements required to make the selection of the participants of a research project, during the elaboration of the protocol, including the concepts of study population, sample, selection criteria and sampling methods. After delineating the study population, the researcher must specify the criteria that each participant has to comply. The criteria that include the specific characteristics are denominated selection or eligibility criteria. These criteria are inclusion, exclusion and elimination, and will delineate the eligible population. The sampling methods are divided in two large groups: 1) probabilistic or random sampling and 2) non-probabilistic sampling. The difference lies in the employment of statistical methods to select the subjects. In every research, it is necessary to establish at the beginning the specific number of participants to be included to achieve the objectives of the study. This number is the sample size, and can be calculated or estimated with mathematical formulas and statistic software.
A ricin forensic profiling approach based on a complex set of biomarkers.
Fredriksson, Sten-Åke; Wunschel, David S; Lindström, Susanne Wiklund; Nilsson, Calle; Wahl, Karen; Åstot, Crister
2018-08-15
A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1-PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods and robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved. Copyright © 2018 Elsevier B.V. All rights reserved.
Wallace, F Morgan; DiCosimo, Deana; Farnum, Andrew; Tice, George; Andaloro, Bridget; Davis, Eugene; Burns, Frank R
2011-01-01
In 2010, the BAX System PCR assay for Salmonella was modified to include a hot start functionality designed to keep the reaction enzyme inactive until PCR begins. To validate the assay's Official Methods of Analysis status to include this procedure modification, an evaluation was conducted on four food types that were simultaneously analyzed with the BAX System and either the U.S. Food and Drug Administration's Bacteriological Analytical Manual or the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook reference method for detecting Salmonella. Identical performance between the BAX System method and the reference methods was observed. Additionally, lysates were analyzed using both the BAX System Classic and BAX System Q7 instruments with identical results using both platforms for all samples tested. Of the 100 samples analyzed, 34 samples were positive for both the BAX System and reference methods, and 66 samples were negative by both the BAX System and reference methods, demonstrating 100% correlation. No instrument platform variation was observed. Additional inclusivity and exclusivity testing using the modified test kit demonstrated the test kit to be 100% accurate in evaluation of test panels of 352 Salmonella strains and 46 non-Salmonella strains.
Hladik, Michelle; McWayne, Megan M.
2012-01-01
A method for the determination of 119 pesticides in environmental sediment samples is described. The method was developed by the U.S. Geological Survey (USGS) in support of the National Water Quality Assessment (NAWQA) Program. The pesticides included in this method were chosen through prior prioritization. Herbicides, insecticides, and fungicides along with degradates are included in this method and span a variety of chemical classes including, but not limited to, chloroacetanilides, organochlorines, organophosphates, pyrethroids, triazines, and triazoles. Sediment samples are extracted by using an accelerated solvent extraction system (ASE®, and the compounds of interest are separated from co-extracted matrix interferences (including sulfur) by passing the extracts through high performance liquid chromatography (HPLC) with gel-permeation chromatography (GPC) along with the use of either stacked graphitized carbon and alumina solid-phase extraction (SPE) cartridges or packed Florisil®. Chromatographic separation, detection, and quantification of the pesticides from the sediment-sample extracts are done by using gas chromatography with mass spectrometry (GC/MS). Recoveries in test sediment samples fortified at 10 micrograms per kilogram (μg/kg) dry weight ranged from 75 to 102 percent; relative standard deviations ranged from 3 to 13 percent. Method detection limits (MDLs), calculated by using U.S. Environmental Protection Agency procedures (40 CFR 136, Appendix B), ranged from 0.6 to 3.4 μg/kg dry weight.
Systems and Methods for Correcting Optical Reflectance Measurements
NASA Technical Reports Server (NTRS)
Yang, Ye (Inventor); Shear, Michael A. (Inventor); Soller, Babs R. (Inventor); Soyemi, Olusola O. (Inventor)
2014-01-01
We disclose measurement systems and methods for measuring analytes in target regions of samples that also include features overlying the target regions. The systems include: (a) a light source; (b) a detection system; (c) a set of at least first, second, and third light ports which transmit light from the light source to a sample and receive and direct light reflected from the sample to the detection system, generating a first set of data including information corresponding to both an internal target within the sample and features overlying the internal target, and a second set of data including information corresponding to features overlying the internal target; and (d) a processor configured to remove information characteristic of the overlying features from the first set of data using the first and second sets of data to produce corrected information representing the internal target.
Systems and methods for correcting optical reflectance measurements
NASA Technical Reports Server (NTRS)
Yang, Ye (Inventor); Soller, Babs R. (Inventor); Soyemi, Olusola O. (Inventor); Shear, Michael A. (Inventor)
2009-01-01
We disclose measurement systems and methods for measuring analytes in target regions of samples that also include features overlying the target regions. The systems include: (a) a light source; (b) a detection system; (c) a set of at least first, second, and third light ports which transmit light from the light source to a sample and receive and direct light reflected from the sample to the detection system, generating a first set of data including information corresponding to both an internal target within the sample and features overlying the internal target, and a second set of data including information corresponding to features overlying the internal target; and (d) a processor configured to remove information characteristic of the overlying features from the first set of data using the first and second sets of data to produce corrected information representing the internal target.
Wilderness ecology: a method of sampling and summarizing data for plant community classification.
Lewis F. Ohmann; Robert R. Ream
1971-01-01
Presents a flexible sampling scheme that researchers and land managers may use in surveying and classifying plant communities of forest lands. Includes methods, data sheets, and computer summarization printouts.
COST-EFFECTIVE SAMPLING FOR SPATIALLY DISTRIBUTED PHENOMENA
Various measures of sampling plan cost and loss are developed and analyzed as they relate to a variety of multidisciplinary sampling techniques. The sampling choices examined include methods from design-based sampling, model-based sampling, and geostatistics. Graphs and tables ar...
Developments in Sampling and Analysis Instrumentation for Stationary Sources
ERIC Educational Resources Information Center
Nader, John S.
1973-01-01
Instrumentation for the measurement of pollutant emissions is considered including sample-site selection, sample transport, sample treatment, sample analysis, and data reduction, display, and interpretation. Measurement approaches discussed involve sample extraction from within the stack and electro-optical methods. (BL)
Analysis of Environmental Contamination resulting from ...
Catastrophic incidents can generate a large number of samples with analytically diverse types including forensic, clinical, environmental, food, and others. Environmental samples include water, wastewater, soil, air, urban building and infrastructure materials, and surface residue. Such samples may arise not only from contamination from the incident but also from the multitude of activities surrounding the response to the incident, including decontamination. This document summarizes a range of activities to help build laboratory capability in preparation for analysis following a catastrophic incident, including selection and development of fit-for-purpose analytical methods for chemical, biological, and radiological contaminants. Fit-for-purpose methods are those which have been selected to meet project specific data quality objectives. For example, methods could be fit for screening contamination in the early phases of investigation of contamination incidents because they are rapid and easily implemented, but those same methods may not be fit for the purpose of remediating the environment to safe levels when a more sensitive method is required. While the exact data quality objectives defining fitness-for-purpose can vary with each incident, a governing principle of the method selection and development process for environmental remediation and recovery is based on achieving high throughput while maintaining high quality analytical results. This paper illu
Systems and methods for laser assisted sample transfer to solution for chemical analysis
Van Berkel, Gary J.; Kertesz, Vilmos; Ovchinnikova, Olga S.
2014-06-03
Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.
Systems and methods for laser assisted sample transfer to solution for chemical analysis
Van Berkel, Gary J.; Kertesz, Vilmos; Ovchinnikova, Olga S.
2015-09-29
Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.
Systems and methods for laser assisted sample transfer to solution for chemical analysis
Van Berkel, Gary J; Kertesz, Vilmos; Ovchinnikova, Olga S
2013-08-27
Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.
Introduction to Field Water-Quality Methods for the Collection of Metals - 2007 Project Summary
Allen, Monica L.
2008-01-01
The U.S. Geological Survey (USGS), Region VI of the U.S. Environmental Protection Agency (USEPA), and the Osage Nation presented three 3-day workshops, in June-August 2007, entitled ?Introduction to Field Water-Quality Methods for the Collection of Metals.? The purpose of the workshops was to provide instruction to tribes within USEPA Region VI on various USGS surface-water measurement methods and water-quality sampling protocols for the collection of surface-water samples for metals analysis. Workshop attendees included members from over 22 tribes and pueblos. USGS instructors came from Oklahoma, New Mexico, and Georgia. Workshops were held in eastern and south-central Oklahoma and New Mexico and covered many topics including presampling preparation, water-quality monitors, and sampling for metals in surface water. Attendees spent one full classroom day learning the field methods used by the USGS Water Resources Discipline and learning about the complexity of obtaining valid water-quality and quality-assurance data. Lectures included (1) a description of metal contamination sources in surface water; (2) introduction on how to select field sites, equipment, and laboratories for sample analysis; (3) collection of sediment in surface water; and (4) utilization of proper protocol and methodology for sampling metals in surface water. Attendees also were provided USGS sampling equipment for use during the field portion of the class so they had actual ?hands-on? experience to take back to their own organizations. The final 2 days of the workshop consisted of field demonstrations of current USGS water-quality sample-collection methods. The hands-on training ensured that attendees were exposed to and experienced proper sampling procedures. Attendees learned integrated-flow techniques during sample collection, field-property documentation, and discharge measurements and calculations. They also used enclosed chambers for sample processing and collected quality-assurance samples to verify their techniques. Benefits of integrated water-quality sample-collection methods are varied. Tribal environmental programs now have the ability to collect data that are comparable across watersheds. The use of consistent sample collection, manipulation, and storage techniques will provide consistent quality data that will enhance the understanding of local water resources. The improved data quality also will help the USEPA better document the condition of the region?s water. Ultimately, these workshops equipped tribes to use uniform sampling methods and to provide consistent quality data that are comparable across the region.
Flow injection trace gas analysis method for on-site determination of organoarsenicals
Aldstadt, III, Joseph H.
1997-01-01
A method for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere.
Area X-ray or UV camera system for high-intensity beams
Chapman, Henry N.; Bajt, Sasa; Spiller, Eberhard A.; Hau-Riege, Stefan , Marchesini, Stefano
2010-03-02
A system in one embodiment includes a source for directing a beam of radiation at a sample; a multilayer mirror having a face oriented at an angle of less than 90 degrees from an axis of the beam from the source, the mirror reflecting at least a portion of the radiation after the beam encounters a sample; and a pixellated detector for detecting radiation reflected by the mirror. A method in a further embodiment includes directing a beam of radiation at a sample; reflecting at least some of the radiation diffracted by the sample; not reflecting at least a majority of the radiation that is not diffracted by the sample; and detecting at least some of the reflected radiation. A method in yet another embodiment includes directing a beam of radiation at a sample; reflecting at least some of the radiation diffracted by the sample using a multilayer mirror; and detecting at least some of the reflected radiation.
Improved lossless intra coding for H.264/MPEG-4 AVC.
Lee, Yung-Lyul; Han, Ki-Hun; Sullivan, Gary J
2006-09-01
A new lossless intra coding method based on sample-by-sample differential pulse code modulation (DPCM) is presented as an enhancement of the H.264/MPEG-4 AVC standard. The H.264/AVC design includes a multidirectional spatial prediction method to reduce spatial redundancy by using neighboring samples as a prediction for the samples in a block of data to be encoded. In the new lossless intra coding method, the spatial prediction is performed based on samplewise DPCM instead of in the block-based manner used in the current H.264/AVC standard, while the block structure is retained for the residual difference entropy coding process. We show that the new method, based on samplewise DPCM, does not have a major complexity penalty, despite its apparent pipeline dependencies. Experiments show that the new lossless intra coding method reduces the bit rate by approximately 12% in comparison with the lossless intra coding method previously included in the H.264/AVC standard. As a result, the new method is currently being adopted into the H.264/AVC standard in a new enhancement project.
Methods for producing silicon carbide architectural preforms
NASA Technical Reports Server (NTRS)
DiCarlo, James A. (Inventor); Yun, Hee (Inventor)
2010-01-01
Methods are disclosed for producing architectural preforms and high-temperature composite structures containing high-strength ceramic fibers with reduced preforming stresses within each fiber, with an in-situ grown coating on each fiber surface, with reduced boron within the bulk of each fiber, and with improved tensile creep and rupture resistance properties for each fiber. The methods include the steps of preparing an original sample of a preform formed from a pre-selected high-strength silicon carbide ceramic fiber type, placing the original sample in a processing furnace under a pre-selected preforming stress state and thermally treating the sample in the processing furnace at a pre-selected processing temperature and hold time in a processing gas having a pre-selected composition, pressure, and flow rate. For the high-temperature composite structures, the method includes additional steps of depositing a thin interphase coating on the surface of each fiber and forming a ceramic or carbon-based matrix within the sample.
McGarvey, Daniel J.; Falke, Jeffrey A.; Li, Hiram W.; Li, Judith; Hauer, F. Richard; Lamberti, G.A.
2017-01-01
Methods to sample fishes in stream ecosystems and to analyze the raw data, focusing primarily on assemblage-level (all fish species combined) analyses, are presented in this chapter. We begin with guidance on sample site selection, permitting for fish collection, and information-gathering steps to be completed prior to conducting fieldwork. Basic sampling methods (visual surveying, electrofishing, and seining) are presented with specific instructions for estimating population sizes via visual, capture-recapture, and depletion surveys, in addition to new guidance on environmental DNA (eDNA) methods. Steps to process fish specimens in the field including the use of anesthesia and preservation of whole specimens or tissue samples (for genetic or stable isotope analysis) are also presented. Data analysis methods include characterization of size-structure within populations, estimation of species richness and diversity, and application of fish functional traits. We conclude with three advanced topics in assemblage-level analysis: multidimensional scaling (MDS), ecological networks, and loop analysis.
Haglund, Jr., Richard F.; Ermer, David R.; Baltz-Knorr, Michelle Lee
2004-11-30
A system and method for desorption and ionization of analytes in an ablation medium. In one embodiment, the method includes the steps of preparing a sample having analytes in a medium including at least one component, freezing the sample at a sufficiently low temperature so that at least part of the sample has a phase transition, and irradiating the frozen sample with short-pulse radiation to cause medium ablation and desorption and ionization of the analytes. The method further includes the steps of selecting a resonant vibrational mode of at least one component of the medium and selecting an energy source tuned to emit radiation substantially at the wavelength of the selected resonant vibrational mode. The medium is an electrophoresis medium having polyacrylamide. In one embodiment, the energy source is a laser, where the laser can be a free electron laser tunable to generate short-pulse radiation. Alternatively, the laser can be a solid state laser tunable to generate short-pulse radiation. The laser can emit light at various ranges of wavelength.
Classical methods and modern analysis for studying fungal diversity
John Paul Schmit
2005-01-01
In this chapter, we examine the use of classical methods to study fungal diversity. Classical methods rely on the direct observation of fungi, rather than sampling fungal DNA. We summarize a wide variety of classical methods, including direct sampling of fungal fruiting bodies, incubation of substrata in moist chambers, culturing of endophytes, and particle plating. We...
Classical Methods and Modern Analysis for Studying Fungal Diversity
J. P. Schmit; D. J. Lodge
2005-01-01
In this chapter, we examine the use of classical methods to study fungal diversity. Classical methods rely on the direct observation of fungi, rather than sampling fungal DNA. We summarize a wide variety of classical methods, including direct sampling of fungal fruiting bodies, incubation of substrata in moist chambers, culturing of endophytes, and particle plating. We...
Finck, Rachel; Lui-Deguzman, Carrie; Teng, Shih-Mao; Davis, Rebecca; Yuan, Shan
2013-04-01
Titration is a semiquantitative method used to estimate red blood cell (RBC) alloantibody reactivity. The conventional tube test (CTT) technique is the traditional method for performing titration studies. The gel microcolumn assay (GMA) is also a sensitive method to detect RBC alloantibodies. The aim of this study was to compare a GMA with the CTT technique in the performance of Rh and K alloantibody titration. Patient serum samples that contained an RBC alloantibody with a singular specificity were identified by routine blood bank workflow. Parallel titration studies were performed on these samples by both the CTT method and a GMA (ID-Micro Typing System anti-IgG gel card, Micro Typing Systems, Inc., an Ortho-Clinical Diagnostics Company). Forty-eight samples were included, including 11 anti-D, five anti-c, 13 anti-E, one anti-C, three anti-e, and 15 anti-K. Overall, the two methods generated identical results in 21 of 48 samples. For 42 samples (87.5%) the two methods generated results that were within one serial dilution, and for the remaining six samples, results were within two dilutions. GMA systems may perform comparably to the CTT in titrating alloantibodies to Rh and Kell antigens. © 2012 American Association of Blood Banks.
Volatile organic compounds: sampling methods and their worldwide profile in ambient air.
Kumar, Anuj; Víden, Ivan
2007-08-01
The atmosphere is a particularly difficult analytical system because of the very low levels of substances to be analysed, sharp variations in pollutant levels with time and location, differences in wind, temperature and humidity. This makes the selection of an efficient sampling technique for air analysis a key step to reliable results. Generally, methods for volatile organic compounds sampling include collection of the whole air or preconcentration of samples on adsorbents. All the methods vary from each other according to the sampling technique, type of sorbent, method of extraction and identification technique. In this review paper we discuss various important aspects for sampling of volatile organic compounds by the widely used and advanced sampling methods. Characteristics of various adsorbents used for VOCs sampling are also described. Furthermore, this paper makes an effort to comprehensively review the concentration levels of volatile organic compounds along with the methodology used for analysis, in major cities of the world.
Total Arsenic, Cadmium, and Lead Determination in Brazilian Rice Samples Using ICP-MS
Buzzo, Márcia Liane; de Arauz, Luciana Juncioni; Carvalho, Maria de Fátima Henriques; Arakaki, Edna Emy Kumagai; Matsuzaki, Richard; Tiglea, Paulo
2016-01-01
This study is aimed at investigating a suitable method for rice sample preparation as well as validating and applying the method for monitoring the concentration of total arsenic, cadmium, and lead in rice by using Inductively Coupled Plasma Mass Spectrometry (ICP-MS). Various rice sample preparation procedures were evaluated. The analytical method was validated by measuring several parameters including limit of detection (LOD), limit of quantification (LOQ), linearity, relative bias, and repeatability. Regarding the sample preparation, recoveries of spiked samples were within the acceptable range from 89.3 to 98.2% for muffle furnace, 94.2 to 103.3% for heating block, 81.0 to 115.0% for hot plate, and 92.8 to 108.2% for microwave. Validation parameters showed that the method fits for its purpose, being the total arsenic, cadmium, and lead within the Brazilian Legislation limits. The method was applied for analyzing 37 rice samples (including polished, brown, and parboiled), consumed by the Brazilian population. The total arsenic, cadmium, and lead contents were lower than the established legislative values, except for total arsenic in one brown rice sample. This study indicated the need to establish monitoring programs for emphasizing the study on this type of cereal, aiming at promoting the Public Health. PMID:27766178
Method Development in Forensic Toxicology.
Peters, Frank T; Wissenbach, Dirk K; Busardo, Francesco Paolo; Marchei, Emilia; Pichini, Simona
2017-01-01
In the field of forensic toxicology, the quality of analytical methods is of great importance to ensure the reliability of results and to avoid unjustified legal consequences. A key to high quality analytical methods is a thorough method development. The presented article will provide an overview on the process of developing methods for forensic applications. This includes the definition of the method's purpose (e.g. qualitative vs quantitative) and the analytes to be included, choosing an appropriate sample matrix, setting up separation and detection systems as well as establishing a versatile sample preparation. Method development is concluded by an optimization process after which the new method is subject to method validation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Hubbell, Joel M.; Sisson, James B.
2003-08-26
A method of retrieving a liquid sample comprises providing a portable lysimeter including a semi-permeable membrane and a chamber in fluid communication with the semi-permeable membrane; making a hole at a site from which a liquid sample is desired; evacuating the chamber by applying a vacuum to the chamber; lowering the portable lysimeter into the hole; obtaining a sample in the chamber; and retrieving the lysimeter from the bore; wherein it is not necessary to backfill the bore. A portable lysimeter includes a semi-permeable member and a chamber in fluid communication with the semi-permeable membrane.
On wiping the interior walls of 37-mm closed-face cassettes: an OSHA perspective.
Hendricks, Warren; Stones, Fern; Lillquist, Dean
2009-12-01
As early as 1976, Occupational Safety and Health Administration (OSHA) methods for analyzing metal samples collected using 37-mm polystyrene closed-face cassettes specified that any loose dust be transferred from the cassette to the digestion vessel, that the cassette be rinsed, and that, if necessary, the cassette be wiped out to help ensure that all particles that enter the cassette are included along with the filter as part of the sample for analysis. OSHA analytical methods for metal analysis were recently revised to explicitly require cassette wiping for all metal samples. This change was based on policy that any material entering the collection device constitutes part of the sample and on OSHA Salt Lake Technical Center research showing that invisible residue on the cassette walls can significantly contribute to the total sample results reported. OSHA procedures are consistent with guidance given in the NIOSH Manual of Analytical Methods. This guidance concludes that internal deposits in sampling cassettes should be included in the analysis and that one way to accomplish this would be to wipe or wash the internal surfaces of the cassette and include the material along with the filter for analysis.
SAMPLING LARGE RIVERS FOR ALGAE, BENTHIC MACROINVERTEBRATES AND FISH
Multiple projects are currently underway to increase our understanding of the effects of different sampling methods and designs used for the biological assessment and monitoring of large (boatable) rivers. Studies include methods used to assess fish, benthic macroinvertebrates, ...
Ha, Ji Won; Hahn, Jong Hoon
2017-02-01
Acupuncture sample injection is a simple method to deliver well-defined nanoliter-scale sample plugs in PDMS microfluidic channels. This acupuncture injection method in microchip CE has several advantages, including minimization of sample consumption, the capability of serial injections of different sample solutions into the same microchannel, and the capability of injecting sample plugs into any desired position of a microchannel. Herein, we demonstrate that the simple and cost-effective acupuncture sample injection method can be used for PDMS microchip-based field amplified sample stacking in the most simplified straight channel by applying a single potential. We achieved the increase in electropherogram signals for the case of sample stacking. Furthermore, we present that microchip CGE of ΦX174 DNA-HaeⅢ digest can be performed with the acupuncture injection method on a glass microchip while minimizing sample loss and voltage control hardware. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Laboratory theory and methods for sediment analysis
Guy, Harold P.
1969-01-01
The diverse character of fluvial sediments makes the choice of laboratory analysis somewhat arbitrary and the pressing of sediment samples difficult. This report presents some theories and methods used by the Water Resources Division for analysis of fluvial sediments to determine the concentration of suspended-sediment samples and the particle-size distribution of both suspended-sediment and bed-material samples. Other analyses related to these determinations may include particle shape, mineral content, and specific gravity, the organic matter and dissolved solids of samples, and the specific weight of soils. The merits and techniques of both the evaporation and filtration methods for concentration analysis are discussed. Methods used for particle-size analysis of suspended-sediment samples may include the sieve pipet, the VA tube-pipet, or the BW tube-VA tube depending on the equipment available, the concentration and approximate size of sediment in the sample, and the settling medium used. The choice of method for most bed-material samples is usually limited to procedures suitable for sand or to some type of visual analysis for large sizes. Several tested forms are presented to help insure a well-ordered system in the laboratory to handle the samples, to help determine the kind of analysis required for each, to conduct the required processes, and to assist in the required computations. Use of the manual should further 'standardize' methods of fluvial sediment analysis among the many laboratories and thereby help to achieve uniformity and precision of the data.
Why minimally invasive skin sampling techniques? A bright scientific future.
Wang, Christina Y; Maibach, Howard I
2011-03-01
There is increasing interest in minimally invasive skin sampling techniques to assay markers of molecular biology and biochemical processes. This overview examines methodology strengths and limitations, and exciting developments pending in the scientific community. Publications were searched via PubMed, the U.S. Patent and Trademark Office Website, the DermTech Website and the CuDerm Website. The keywords used were noninvasive skin sampling, skin stripping, skin taping, detergent method, ring method, mechanical scrub, reverse iontophoresis, glucose monitoring, buccal smear, hair root sampling, mRNA, DNA, RNA, and amino acid. There is strong interest in finding methods to access internal biochemical, molecular, and genetic processes through noninvasive and minimally invasive external means. Minimally invasive techniques include the widely used skin tape stripping, the abrasion method that includes scraping and detergent, and reverse iontophoresis. The first 2 methods harvest largely the stratum corneum. Hair root sampling (material deeper than the epidermis), buccal smear, shave biopsy, punch biopsy, and suction blistering are also methods used to obtain cellular material for analysis, but involve some degree of increased invasiveness and thus are only briefly mentioned. Existing and new sampling methods are being refined and validated, offering exciting, different noninvasive means of quickly and efficiently obtaining molecular material with which to monitor bodily functions and responses, assess drug levels, and follow disease processes without subjecting patients to unnecessary discomfort and risk.
Impact of Processing Method on Recovery of Bacteria from Wipes Used in Biological Surface Sampling
Olson, Nathan D.; Filliben, James J.; Morrow, Jayne B.
2012-01-01
Environmental sampling for microbiological contaminants is a key component of hygiene monitoring and risk characterization practices utilized across diverse fields of application. However, confidence in surface sampling results, both in the field and in controlled laboratory studies, has been undermined by large variation in sampling performance results. Sources of variation include controlled parameters, such as sampling materials and processing methods, which often differ among studies, as well as random and systematic errors; however, the relative contributions of these factors remain unclear. The objective of this study was to determine the relative impacts of sample processing methods, including extraction solution and physical dissociation method (vortexing and sonication), on recovery of Gram-positive (Bacillus cereus) and Gram-negative (Burkholderia thailandensis and Escherichia coli) bacteria from directly inoculated wipes. This work showed that target organism had the largest impact on extraction efficiency and recovery precision, as measured by traditional colony counts. The physical dissociation method (PDM) had negligible impact, while the effect of the extraction solution was organism dependent. Overall, however, extraction of organisms from wipes using phosphate-buffered saline with 0.04% Tween 80 (PBST) resulted in the highest mean recovery across all three organisms. The results from this study contribute to a better understanding of the factors that influence sampling performance, which is critical to the development of efficient and reliable sampling methodologies relevant to public health and biodefense. PMID:22706055
Incipient fire detection system
Brooks, Jr., William K.
1999-01-01
A method and apparatus for an incipient fire detection system that receives gaseous samples and measures the light absorption spectrum of the mixture of gases evolving from heated combustibles includes a detector for receiving gaseous samples and subjecting the samples to spectroscopy and determining wavelengths of absorption of the gaseous samples. The wavelengths of absorption of the gaseous samples are compared to predetermined absorption wavelengths. A warning signal is generated whenever the wavelengths of absorption of the gaseous samples correspond to the predetermined absorption wavelengths. The method includes receiving gaseous samples, subjecting the samples to light spectroscopy, determining wavelengths of absorption of the gaseous samples, comparing the wavelengths of absorption of the gaseous samples to predetermined absorption wavelengths and generating a warning signal whenever the wavelengths of absorption of the gaseous samples correspond to the predetermined absorption wavelengths. In an alternate embodiment, the apparatus includes a series of channels fluidically connected to a plurality of remote locations. A pump is connected to the channels for drawing gaseous samples into the channels. A detector is connected to the channels for receiving the drawn gaseous samples and subjecting the samples to spectroscopy. The wavelengths of absorption are determined and compared to predetermined absorption wavelengths is provided. A warning signal is generated whenever the wavelengths correspond.
Method and apparatus configured for identification of a material
Slater, John M.; Crawford, Thomas M.
2000-01-01
The present invention includes an apparatus configured for identification of a material, and methods of identifying a material. One embodiment of the invention provides an apparatus including a first region configured to receive a first sample, the first region being configured to output a first spectrum corresponding to the first sample and responsive to exposure of the first sample to radiation; a modulator configured to modulate the first spectrum according to a first frequency; a second region configured to receive a second sample, the second region being configured to output a second spectrum corresponding to the second sample and responsive to exposure of the second sample to the modulated first spectrum; and a detector configured to detect the second spectrum having a second frequency greater than the first frequency.
Neutron activation analysis of certified samples by the absolute method
NASA Astrophysics Data System (ADS)
Kadem, F.; Belouadah, N.; Idiri, Z.
2015-07-01
The nuclear reactions analysis technique is mainly based on the relative method or the use of activation cross sections. In order to validate nuclear data for the calculated cross section evaluated from systematic studies, we used the neutron activation analysis technique (NAA) to determine the various constituent concentrations of certified samples for animal blood, milk and hay. In this analysis, the absolute method is used. The neutron activation technique involves irradiating the sample and subsequently performing a measurement of the activity of the sample. The fundamental equation of the activation connects several physical parameters including the cross section that is essential for the quantitative determination of the different elements composing the sample without resorting to the use of standard sample. Called the absolute method, it allows a measurement as accurate as the relative method. The results obtained by the absolute method showed that the values are as precise as the relative method requiring the use of standard sample for each element to be quantified.
Measurement of wood/plant cell or composite material attributes with computer assisted tomography
West, Darrell C.; Paulus, Michael J.; Tuskan, Gerald A.; Wimmer, Rupert
2004-06-08
A method for obtaining wood-cell attributes from cellulose containing samples includes the steps of radiating a cellulose containing sample with a beam of radiation. Radiation attenuation information is collected from radiation which passes through the sample. The source is rotated relative to the sample and the radiation and collecting steps repeated. A projected image of the sample is formed from the collected radiation attenuation information, the projected image including resolvable features of the cellulose containing sample. Cell wall thickness, cell diameter (length) and cell vacoule diameter can be determined. A system for obtaining physical measures from cellulose containing samples includes a radiation source, a radiation detector, and structure for rotating the source relative to said sample. The system forms an image of the sample from the radiation attenuation information, the image including resolvable features of the sample.
Lesot, Philippe; Kazimierczuk, Krzysztof; Trébosc, Julien; Amoureux, Jean-Paul; Lafon, Olivier
2015-11-01
Unique information about the atom-level structure and dynamics of solids and mesophases can be obtained by the use of multidimensional nuclear magnetic resonance (NMR) experiments. Nevertheless, the acquisition of these experiments often requires long acquisition times. We review here alternative sampling methods, which have been proposed to circumvent this issue in the case of solids and mesophases. Compared to the spectra of solutions, those of solids and mesophases present some specificities because they usually display lower signal-to-noise ratios, non-Lorentzian line shapes, lower spectral resolutions and wider spectral widths. We highlight herein the advantages and limitations of these alternative sampling methods. A first route to accelerate the acquisition time of multidimensional NMR spectra consists in the use of sparse sampling schemes, such as truncated, radial or random sampling ones. These sparsely sampled datasets are generally processed by reconstruction methods differing from the Discrete Fourier Transform (DFT). A host of non-DFT methods have been applied for solids and mesophases, including the G-matrix Fourier transform, the linear least-square procedures, the covariance transform, the maximum entropy and the compressed sensing. A second class of alternative sampling consists in departing from the Jeener paradigm for multidimensional NMR experiments. These non-Jeener methods include Hadamard spectroscopy as well as spatial or orientational encoding of the evolution frequencies. The increasing number of high field NMR magnets and the development of techniques to enhance NMR sensitivity will contribute to widen the use of these alternative sampling methods for the study of solids and mesophases in the coming years. Copyright © 2015 John Wiley & Sons, Ltd.
40 CFR Appendix A-7 to Part 60 - Test Methods 19 through 25E
Code of Federal Regulations, 2014 CFR
2014-07-01
... %O include the unavailable hydrogen and oxygen in the form of H2O.) 12.3.2.2 Use applicable sampling... are used during the averaging period. 12.5.2.1 Solid Fossil (Including Waste) Fuel/Sampling and... of the standards) on a dry basis for each gross sample. 12.5.2.2 Liquid Fossil Fuel-Sampling and...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valdez, Carlos A.; Vu, Alexander K.
Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.
Comparison of electrical conductivity calculation methods for natural waters
McCleskey, R. Blaine; Nordstrom, D. Kirk; Ryan, Joseph N.
2012-01-01
The capability of eleven methods to calculate the electrical conductivity of a wide range of natural waters from their chemical composition was investigated. A brief summary of each method is presented including equations to calculate the conductivities of individual ions, the ions incorporated, and the method's limitations. The ability of each method to reliably predict the conductivity depends on the ions included, effective accounting of ion pairing, and the accuracy of the equation used to estimate the ionic conductivities. The performances of the methods were evaluated by calculating the conductivity of 33 environmentally important electrolyte solutions, 41 U.S. Geological Survey standard reference water samples, and 1593 natural water samples. The natural waters tested include acid mine waters, geothermal waters, seawater, dilute mountain waters, and river water impacted by municipal waste water. The three most recent conductivity methods predict the conductivity of natural waters better than other methods. Two of the recent methods can be used to reliably calculate the conductivity for samples with pH values greater than about 3 and temperatures between 0 and 40°C. One method is applicable to a variety of natural water types with a range of pH from 1 to 10, temperature from 0 to 95°C, and ionic strength up to 1 m.
Dobecki, Marek
2012-01-01
This paper reviews the requirements for measurement methods of chemical agents in the air at workstations. European standards, which have a status of Polish standards, comprise some requirements and information on sampling strategy, measuring techniques, type of samplers, sampling pumps and methods of occupational exposure evaluation at a given technological process. Measurement methods, including air sampling and analytical procedure in a laboratory, should be appropriately validated before intended use. In the validation process, selected methods are tested and budget of uncertainty is set up. The validation procedure that should be implemented in the laboratory together with suitable statistical tools and major components of uncertainity to be taken into consideration, were presented in this paper. Methods of quality control, including sampling and laboratory analyses were discussed. Relative expanded uncertainty for each measurement expressed as a percentage, should not exceed the limit of values set depending on the type of occupational exposure (short-term or long-term) and the magnitude of exposure to chemical agents in the work environment.
Extraction of organic contaminants from marine sediments and tissues using microwave energy.
Jayaraman, S; Pruell, R J; McKinney, R
2001-07-01
In this study, we compared microwave solvent extraction (MSE) to conventional methods for extracting organic contaminants from marine sediments and tissues with high and varying moisture content. The organic contaminants measured were polychlorinated biphenyl (PCB) congeners, chlorinated pesticides, and polycyclic aromatic hydrocarbons (PAHs). Initial experiments were conducted on dry standard reference materials (SRMs) and field collected marine sediments. Moisture content in samples greatly influenced the recovery of the analytes of interest. When wet sediments were included in a sample batch, low recoveries were often encountered in other samples in the batch, including the dry SRM. Experiments were conducted to test the effect of standardizing the moisture content in all samples in a batch prior to extraction. SRM1941a (marine sediment). SRM1974a (mussel tissue), as well as QA96SED6 (marine sediment), and QA96TIS7 (marine tissue), both from 1996 NIST Intercalibration Exercise were extracted using microwave and conventional methods. Moisture levels were adjusted in SRMs to match those of marine sediment and tissue samples before microwave extraction. The results demonstrated that it is crucial to standardize the moisture content in all samples, including dry reference material to ensure good recovery of organic contaminants. MSE yielded equivalent or superior recoveries compared to conventional methods for the majority of the compounds evaluated. The advantages of MSE over conventional methods are reduced solvent usage, higher sample throughput and the elimination of halogenated solvent usage.
Vu, Kim-Nhien; Gilbert, Guillaume; Chalut, Marianne; Chagnon, Miguel; Chartrand, Gabriel; Tang, An
2016-05-01
To assess the agreement between published magnetic resonance imaging (MRI)-based regions of interest (ROI) sampling methods using liver mean proton density fat fraction (PDFF) as the reference standard. This retrospective, internal review board-approved study was conducted in 35 patients with type 2 diabetes. Liver PDFF was measured by magnetic resonance spectroscopy (MRS) using a stimulated-echo acquisition mode sequence and MRI using a multiecho spoiled gradient-recalled echo sequence at 3.0T. ROI sampling methods reported in the literature were reproduced and liver mean PDFF obtained by whole-liver segmentation was used as the reference standard. Intraclass correlation coefficients (ICCs), Bland-Altman analysis, repeated-measures analysis of variance (ANOVA), and paired t-tests were performed. ICC between MRS and MRI-PDFF was 0.916. Bland-Altman analysis showed excellent intermethod agreement with a bias of -1.5 ± 2.8%. The repeated-measures ANOVA found no systematic variation of PDFF among the nine liver segments. The correlation between liver mean PDFF and ROI sampling methods was very good to excellent (0.873 to 0.975). Paired t-tests revealed significant differences (P < 0.05) with ROI sampling methods that exclusively or predominantly sampled the right lobe. Significant correlations with mean PDFF were found with sampling methods that included higher number of segments, total area equal or larger than 5 cm(2) , or sampled both lobes (P = 0.001, 0.023, and 0.002, respectively). MRI-PDFF quantification methods should sample each liver segment in both lobes and include a total surface area equal or larger than 5 cm(2) to provide a close estimate of the liver mean PDFF. © 2015 Wiley Periodicals, Inc.
Sampling techniques for thrips (Thysanoptera: Thripidae) in preflowering tomato.
Joost, P Houston; Riley, David G
2004-08-01
Sampling techniques for thrips (Thysanoptera: Thripidae) were compared in preflowering tomato plants at the Coastal Plain Experiment Station in Tifton, GA, in 2000 and 2003, to determine the most effective method of determining abundance of thrips on tomato foliage early in the growing season. Three relative sampling techniques, including a standard insect aspirator, a 946-ml beat cup, and an insect vacuum device, were compared for accuracy to an absolute method and to themselves for precision and efficiency of sampling thrips. Thrips counts of all relative sampling methods were highly correlated (R > 0.92) to the absolute method. The aspirator method was the most accurate compared with the absolute sample according to regression analysis in 2000. In 2003, all sampling methods were considered accurate according to Dunnett's test, but thrips numbers were lower and sample variation was greater than in 2000. In 2000, the beat cup method had the lowest relative variation (RV) or best precision, at 1 and 8 d after transplant (DAT). Only the beat cup method had RV values <25 for all sampling dates. In 2003, the beat cup method had the lowest RV value at 15 and 21 DAT. The beat cup method also was the most efficient method for all sample dates in both years. Frankliniella fusca (Pergande) was the most abundant thrips species on the foliage of preflowering tomato in both years of study at this location. Overall, the best thrips sampling technique tested was the beat cup method in terms of precision and sampling efficiency.
Flow injection trace gas analysis method for on-site determination of organoarsenicals
Aldstadt, J.H. III
1997-06-24
A method is described for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere. 2 figs.
Phillips, Patrick J.; Smith, Steven G.; Kolpin, Dana W.; Zaugg, Steven D.; Buxton, Herbert T.; Furlong, Edward T.
2010-01-01
Abstract Wastewater-treatment-plant (WWTP) effluents are a demonstrated source of pharmaceuticals to the environment. During 2004-09, a study was conducted to identify pharmaceutical compounds in effluents from WWTPs (including two that receive substantial discharges from pharmaceutical formulation facilities), streamwater, and reservoirs. The methods used to determine and quantify concentrations of seven pharmaceuticals are described. In addition, the report includes information on pharmaceuticals formulated or potentially formulated at the two pharmaceutical formulation facilities that provide substantial discharge to two of the WWTPs, and potential limitations to these data are discussed. The analytical methods used to provide data on the seven pharmaceuticals (including opioids, muscle relaxants, and other pharmaceuticals) in filtered water samples also are described. Data are provided on method performance, including spike data, method detection limit results, and an estimation of precision. Quality-assurance data for sample collection and handling are included. Quantitative data are presented for the seven pharmaceuticals in water samples collected at WWTP discharge points, from streams, and at reservoirs. Occurrence data also are provided for 19 pharmaceuticals that were qualitatively identified. Flow data at selected WWTP and streams are presented. Between 2004-09, 35-38 effluent samples were collected from each of three WWTPs in New York and analyzed for seven pharmaceuticals. Two WWTPs (NY2 and NY3) receive substantial inflows (greater than 20 percent of plant flow) from pharmaceutical formulation facilities (PFF) and one (NY1) receives no PFF flow. Samples of effluents from 23 WWTPs across the United States were analyzed once for these pharmaceuticals as part of a national survey. Maximum pharmaceutical effluent concentrations for the national survey and NY1 effluent samples were generally less than 1 ug/L. Four pharmaceuticals (methadone, oxycodone, butalbital and metaxalone) in samples of NY3 effluent had median concentrations ranging from 3.4 to greater than 400 ug/L. Maximum concentrations of oxycodone (1,700 ug/L) and metaxalone (3,800 ug/L) in samples from NY3 effluent exceeded 1,000 ug/L. Three pharmaceuticals (butalbital, carisoprodol, and oxycodone) in samples of NY2 effluent had median concentrations ranging from 2 to 11 ug/L. These findings suggest that current 2 manufacturing practices at these PFFs can result in pharmaceutical concentrations from 10 to 1,000 times higher than those typically found in WWTP effluents.
NASA Technical Reports Server (NTRS)
Pearson, Richard (Inventor); Lynch, Dana H. (Inventor); Gunter, William D. (Inventor)
1995-01-01
A method and apparatus for passing light bundles through a multiple pass sampling cell is disclosed. The multiple pass sampling cell includes a sampling chamber having first and second ends positioned along a longitudinal axis of the sampling cell. The sampling cell further includes an entrance opening, located adjacent the first end of the sampling cell at a first azimuthal angular position. The entrance opening permits a light bundle to pass into the sampling cell. The sampling cell also includes an exit opening at a second azimuthal angular position. The light exit permits a light bundle to pass out of the sampling cell after the light bundle has followed a predetermined path.
TRW RECOMMENDATIONS FOR THE SAMPLING AND ANALYSIS OF INDOOR RESIDENTIAL DUST FOR THE IEUBK MODEL
The purpose of this guidance document is to recommend methods for collecting and analyzing residential dust lead data specifically for use in the IEUBK model. A discussion of other dust sampling methods is also included.
Nuclear radiation cleanup and uranium prospecting
Mariella, Jr., Raymond P.; Dardenne, Yves M.
2016-02-02
Apparatus, systems, and methods for nuclear radiation cleanup and uranium prospecting include the steps of identifying an area; collecting samples; sample preparation; identification, assay, and analysis; and relating the samples to the area.
Nuclear radiation cleanup and uranium prospecting
Mariella, Jr., Raymond P.; Dardenne, Yves M.
2017-01-03
Apparatus, systems, and methods for nuclear radiation cleanup and uranium prospecting include the steps of identifying an area; collecting samples; sample preparation; identification, assay, and analysis; and relating the samples to the area.
Preparation of bone samples in the Gliwice Radiocarbon Laboratory for AMS radiocarbon dating.
Piotrowska, N; Goslar, T
2002-12-01
In the Gliwice Radiocarbon Laboratory, a system for preparation of samples for AMS dating has been built. At first it was used to produce graphite targets from plant macrofossils and sediments. In this study we extended its capabilities with the preparation of bones. We dealt with 3 methods; the first was the classical Longin method of collagen extraction, the second one included additional treatment of powdered bone in alkali solution, while in the third one carboxyl carbon was separated from amino acids obtained after hydrolysis of protein. The suitability of the methods was tested on 2 bone samples. Most of our samples gave ages > 40 kyr BP, suggesting good performance of the adapted methods, except for one sample prepared with simple Longin method. For routine preparation of bones we chose the Longin method with additional alkali treatment.
Decker, David L; Lyles, Brad F; Purcell, Richard G; Hershey, Ronald Lee
2014-05-20
An apparatus and method for supporting a tubing bundle during installation or removal. The apparatus includes a clamp for securing the tubing bundle to an external wireline. The method includes deploying the tubing bundle and wireline together, The tubing bundle is periodically secured to the wireline using a clamp.
Extending the solvent-free MALDI sample preparation method.
Hanton, Scott D; Parees, David M
2005-01-01
Matrix-assisted laser desorption/ionization (MALDI) mass spectrometry is an important technique to characterize many different materials, including synthetic polymers. MALDI mass spectral data can be used to determine the polymer average molecular weights, repeat units, and end groups. One of the key issues in traditional MALDI sample preparation is making good solutions of the analyte and the matrix. Solvent-free sample preparation methods have been developed to address these issues. Previous results of solvent-free or dry prepared samples show some advantages over traditional wet sample preparation methods. Although the results of the published solvent-free sample preparation methods produced excellent mass spectra, we found the method to be very time-consuming, with significant tool cleaning, which presents a significant possibility of cross contamination. To address these issues, we developed an extension of the solvent-free method that replaces the mortar and pestle grinding with ball milling the sample in a glass vial with two small steel balls. This new method generates mass spectra with equal quality of the previous methods, but has significant advantages in productivity, eliminates cross contamination, and is applicable to liquid and soft or waxy analytes.
Quantitative method of determining beryllium or a compound thereof in a sample
McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.
2006-10-31
A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.
Quantitative method of determining beryllium or a compound thereof in a sample
McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.
2010-08-24
A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.
Biofilm monitoring coupon system and method of use
NASA Technical Reports Server (NTRS)
Sauer, Richard L. (Inventor); Flanagan, David T. (Inventor)
1991-01-01
An apparatus and method is disclosed for biofilm monitoring of a water distribution system which includes the mounting of at least one fitting in a wall port of a manifold in the water distribution system with a passage through the fitting in communication. The insertion of a biofilm sampling member is through the fitting with planar sampling surfaces of different surface treatment provided on linearly arrayed sample coupons of the sampling member disposed in the flow stream in edge-on parallel relation to the direction of the flow stream of the manifold under fluid-tight sealed conditions. The sampling member is adapted to be aseptically removed from or inserted in the fitting and manifold under a positive pressure condition and the fitting passage sealed immediately thereafter by appropriate closure means so as to preclude contamination of the water distribution system through the fitting. The apparatus includes means for clamping the sampling member and for establishing electrical continuity between the sampling surfaces and the system for minimizing electropotential effects. The apparatus may also include a plurality of fittings and sampling members mounted on the manifold to permit extraction of the sampling members in a timed sequence throughout the monitoring period.
Apparatus and method for the characterization of respirable aerosols
Clark, Douglas K.; Hodges, Bradley W.; Bush, Jesse D.; Mishima, Jofu
2016-05-31
An apparatus for the characterization of respirable aerosols, including: a burn chamber configured to selectively contain a sample that is selectively heated to generate an aerosol; a heating assembly disposed within the burn chamber adjacent to the sample; and a sampling segment coupled to the burn chamber and configured to collect the aerosol such that it may be analyzed. The apparatus also includes an optional sight window disposed in a wall of the burn chamber such that the sample may be viewed during heating. Optionally, the sample includes one of a Lanthanide, an Actinide, and a Transition metal.
Estimating the circuit delay of FPGA with a transfer learning method
NASA Astrophysics Data System (ADS)
Cui, Xiuhai; Liu, Datong; Peng, Yu; Peng, Xiyuan
2017-10-01
With the increase of FPGA (Field Programmable Gate Array, FPGA) functionality, FPGA has become an on-chip system platform. Due to increase the complexity of FPGA, estimating the delay of FPGA is a very challenge work. To solve the problems, we propose a transfer learning estimation delay (TLED) method to simplify the delay estimation of different speed grade FPGA. In fact, the same style different speed grade FPGA comes from the same process and layout. The delay has some correlation among different speed grade FPGA. Therefore, one kind of speed grade FPGA is chosen as a basic training sample in this paper. Other training samples of different speed grade can get from the basic training samples through of transfer learning. At the same time, we also select a few target FPGA samples as training samples. A general predictive model is trained by these samples. Thus one kind of estimation model is used to estimate different speed grade FPGA circuit delay. The framework of TRED includes three phases: 1) Building a basic circuit delay library which includes multipliers, adders, shifters, and so on. These circuits are used to train and build the predictive model. 2) By contrasting experiments among different algorithms, the forest random algorithm is selected to train predictive model. 3) The target circuit delay is predicted by the predictive model. The Artix-7, Kintex-7, and Virtex-7 are selected to do experiments. Each of them includes -1, -2, -2l, and -3 different speed grade. The experiments show the delay estimation accuracy score is more than 92% with the TLED method. This result shows that the TLED method is a feasible delay assessment method, especially in the high-level synthesis stage of FPGA tool, which is an efficient and effective delay assessment method.
Assembly for collecting samples for purposes of identification or analysis and method of use
Thompson, Cyril V [Knoxville, TN; Smith, Rob R [Knoxville, TN
2010-02-02
An assembly and an associated method for collecting a sample of material desired to be characterized with diagnostic equipment includes or utilizes an elongated member having a proximal end with which the assembly is manipulated by a user and a distal end. In addition, a collection tip which is capable of being placed into contact with the material to be characterized is supported upon the distal end. The collection tip includes a body of chemically-inert porous material for binding a sample of material when the tip is placed into contact with the material and thereby holds the sample of material for subsequent introduction to the diagnostic equipment.
Sample preparation for the analysis of isoflavones from soybeans and soy foods.
Rostagno, M A; Villares, A; Guillamón, E; García-Lafuente, A; Martínez, J A
2009-01-02
This manuscript provides a review of the actual state and the most recent advances as well as current trends and future prospects in sample preparation and analysis for the quantification of isoflavones from soybeans and soy foods. Individual steps of the procedures used in sample preparation, including sample conservation, extraction techniques and methods, and post-extraction treatment procedures are discussed. The most commonly used methods for extraction of isoflavones with both conventional and "modern" techniques are examined in detail. These modern techniques include ultrasound-assisted extraction, pressurized liquid extraction, supercritical fluid extraction and microwave-assisted extraction. Other aspects such as stability during extraction and analysis by high performance liquid chromatography are also covered.
ERIC Educational Resources Information Center
Anderson, J. M.
1978-01-01
A method is described for preparing large gelatine-embedded soil sections for ecological studies. Sampling methods reduce structural disturbance of the samples to a minimum and include freezing the samples in the field to kill soil invertebrates in their natural microhabitats. Projects are suggested for upper secondary school students. (Author/BB)
Quantitative detection of pathogens in centrifugal microfluidic disks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon
A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Steger, J.L.; Bursey, J.T.; Merrill, R.G.
1999-03-01
This report presents the results of laboratory studies to develop and evaluate a method for the sampling and analysis of phosgene from stationary sources of air emissions using diethylamine (DEA) in toluene as the collection media. The method extracts stack gas from emission sources and stabilizes the reactive gas for subsequent analysis. DEA was evaluated both in a benchtop study and in a laboratory train spiking study. This report includes results for both the benchtop study and the train spiking study. Benchtop studies to evaluate the suitability of DEA for collecting and analyzing phosgene investigated five variables: storage time, DEAmore » concentration, moisture/pH, phosgene concentration, and sample storage temperature. Prototype sampling train studies were performed to determine if the benchtop chemical studies were transferable to a Modified Method 5 sampling train collecting phosgene in the presence of clean air mixed with typical stack gas components. Four conditions, which varied the moisture and phosgene spike were evaluated in triplicate. In addition to research results, the report includes a detailed draft method for sampling and analysis of phosgene from stationary source emissions.« less
Mode synthesizing atomic force microscopy and mode-synthesizing sensing
Passian, Ali; Thundat, Thomas George; Tetard, Laurene
2013-05-17
A method of analyzing a sample that includes applying a first set of energies at a first set of frequencies to a sample and applying, simultaneously with the applying the first set of energies, a second set of energies at a second set of frequencies, wherein the first set of energies and the second set of energies form a multi-mode coupling. The method further includes detecting an effect of the multi-mode coupling.
Mode-synthesizing atomic force microscopy and mode-synthesizing sensing
Passain, Ali; Thundat, Thomas George; Tetard, Laurene
2014-07-22
A method of analyzing a sample that includes applying a first set of energies at a first set of frequencies to a sample and applying, simultaneously with the applying the first set of energies, a second set of energies at a second set of frequencies, wherein the first set of energies and the second set of energies form a multi-mode coupling. The method further includes detecting an effect of the multi-mode coupling.
Hubbell, Joel M.; Sisson, James B.
2001-01-01
A method of determining matric potential of a sample, the method comprising placing the sample in a container, the container having an opening; and contacting the sample with a tensiometer via the opening. An apparatus for determining matric potential of a sample, the apparatus comprising a housing configured to receive a sample; a portable matric potential sensing device extending into the housing and having a porous member; and a wall closing the housing to insulate the sample and at least a portion of the matric potential sensing device including the porous member.
Method of plasma etching Ga-based compound semiconductors
Qiu, Weibin; Goddard, Lynford L.
2012-12-25
A method of plasma etching Ga-based compound semiconductors includes providing a process chamber and a source electrode adjacent to the process chamber. The process chamber contains a sample comprising a Ga-based compound semiconductor. The sample is in contact with a platen which is electrically connected to a first power supply, and the source electrode is electrically connected to a second power supply. The method includes flowing SiCl.sub.4 gas into the chamber, flowing Ar gas into the chamber, and flowing H.sub.2 gas into the chamber. RF power is supplied independently to the source electrode and the platen. A plasma is generated based on the gases in the process chamber, and regions of a surface of the sample adjacent to one or more masked portions of the surface are etched to create a substantially smooth etched surface including features having substantially vertical walls beneath the masked portions.
Connor, Thomas H; Smith, Jerome P
2016-09-01
At the present time, the method of choice to determine surface contamination of the workplace with antineoplastic and other hazardous drugs is surface wipe sampling and subsequent sample analysis with a variety of analytical techniques. The purpose of this article is to review current methodology for determining the level of surface contamination with hazardous drugs in healthcare settings and to discuss recent advances in this area. In addition it will provide some guidance for conducting surface wipe sampling and sample analysis for these drugs in healthcare settings. Published studies on the use of wipe sampling to measure hazardous drugs on surfaces in healthcare settings drugs were reviewed. These studies include the use of well-documented chromatographic techniques for sample analysis in addition to newly evolving technology that provides rapid analysis of specific antineoplastic. Methodology for the analysis of surface wipe samples for hazardous drugs are reviewed, including the purposes, technical factors, sampling strategy, materials required, and limitations. The use of lateral flow immunoassay (LFIA) and fluorescence covalent microbead immunosorbent assay (FCMIA) for surface wipe sample evaluation is also discussed. Current recommendations are that all healthc a re settings where antineoplastic and other hazardous drugs are handled include surface wipe sampling as part of a comprehensive hazardous drug-safe handling program. Surface wipe sampling may be used as a method to characterize potential occupational dermal exposure risk and to evaluate the effectiveness of implemented controls and the overall safety program. New technology, although currently limited in scope, may make wipe sampling for hazardous drugs more routine, less costly, and provide a shorter response time than classical analytical techniques now in use.
Mabood, Fazal; Abbas, Ghulam; Jabeen, Farah; Naureen, Zakira; Al-Harrasi, Ahmed; Hamaed, Ahmad M; Hussain, Javid; Al-Nabhani, Mahmood; Al Shukaili, Maryam S; Khan, Alamgir; Manzoor, Suryyia
2018-03-01
Cows' butterfat may be adulterated with animal fat materials like tallow which causes increased serum cholesterol and triglycerides levels upon consumption. There is no reliable technique to detect and quantify tallow adulteration in butter samples in a feasible way. In this study a highly sensitive near-infrared (NIR) spectroscopy combined with chemometric methods was developed to detect as well as quantify the level of tallow adulterant in clarified butter samples. For this investigation the pure clarified butter samples were intentionally adulterated with tallow at the following percentage levels: 1%, 3%, 5%, 7%, 9%, 11%, 13%, 15%, 17% and 20% (wt/wt). Altogether 99 clarified butter samples were used including nine pure samples (un-adulterated clarified butter) and 90 clarified butter samples adulterated with tallow. Each sample was analysed by using NIR spectroscopy in the reflection mode in the range 10,000-4000 cm -1 , at 2 cm -1 resolution and using the transflectance sample accessory which provided a total path length of 0.5 mm. Chemometric models including principal components analysis (PCA), partial least-squares discriminant analysis (PLSDA), and partial least-squares regressions (PLSR) were applied for statistical treatment of the obtained NIR spectral data. The PLSDA model was employed to differentiate pure butter samples from those adulterated with tallow. The employed model was then externally cross-validated by using a test set which included 30% of the total butter samples. The excellent performance of the model was proved by the low RMSEP value of 1.537% and the high correlation factor of 0.95. This newly developed method is robust, non-destructive, highly sensitive, and economical with very minor sample preparation and good ability to quantify less than 1.5% of tallow adulteration in clarified butter samples.
NASA Technical Reports Server (NTRS)
Yun, Hee-Mann (Inventor); DiCarlo, James A. (Inventor)
2014-01-01
Methods are disclosed for producing architectural preforms and high-temperature composite structures containing high-strength ceramic fibers with reduced preforming stresses within each fiber, with an in-situ grown coating on each fiber surface, with reduced boron within the bulk of each fiber, and with improved tensile creep and rupture resistance properties tier each fiber. The methods include the steps of preparing an original sample of a preform formed from a pre-selected high-strength silicon carbide ceramic fiber type, placing the original sample in a processing furnace under a pre-selected preforming stress state and thermally treating the sample in the processing furnace at a pre-selected processing temperature and hold time in a processing gas having a pre-selected composition, pressure, and flow rate. For the high-temperature composite structures, the method includes additional steps of depositing a thin interphase coating on the surface of each fiber and forming a ceramic or carbon-based matrix within the sample.
Suyemoto, M M; Barnes, H J; Borst, L B
2017-03-01
Pathogenic strains of Enterococcus cecorum (EC) expressing multidrug resistance have emerged. In National Antimicrobial Resistance Monitoring System (NARMS) data, EC is rarely recovered from chickens. Two NARMS methodologies (FDA and USDA) were compared with standard culture (SC) techniques for recovery of EC. NARMS methods failed to detect EC in 58 caecal samples, 20 chicken breast or six whole broiler samples. EC was recovered from 1 of 38 (2·6%) and 2 of 38 (5·2%) preharvest spinal lesions (USDA and FDA method, respectively). In contrast, using the SC method, EC was recovered from 44 of 53 (83%) caecal samples, all 38 (100%) spinal lesions, 14 of 20 (70%) chicken breast samples, and all three spinal lesions identified in whole carcasses. Compared with other Enterococcus spp., EC isolates had a higher prevalence of resistance to macrolides. The NARMS methods significantly affected recovery of enterococcal species other than EC. When the postharvest FDA method was applied to preharvest caecal samples, isolates of Enterococcus faecium were preferentially recovered. All 11 E. faecium isolates were multidrug resistant, including resistance to penicillin, daptomycin and linezolid. These findings confirm that current methodologies may not accurately identify the amount and range of antimicrobial resistance of enterococci from chicken sources. Enterococci are an important reservoir for antimicrobial resistance. This study demonstrates how current culture methods underreport resistance to macrolides in enterococci by selecting against strains of Enterococcus cecorum in pre- and postharvest chicken. Further, the application of postharvest surveillance methods to preharvest samples resulted in selective recovery of Enterococcus faecium over Enterococcus faecalis. Isolates of E. faecium recovered exhibited multidrug resistance including penicillin, daptomycin and linezolid resistance. These findings suggest that culture methodology significantly impacts the range and amount of antimicrobial resistance detected in enterococci isolated from chicken. © 2016 The Society for Applied Microbiology.
NASA Astrophysics Data System (ADS)
Erener, Arzu; Sivas, A. Abdullah; Selcuk-Kestel, A. Sevtap; Düzgün, H. Sebnem
2017-07-01
All of the quantitative landslide susceptibility mapping (QLSM) methods requires two basic data types, namely, landslide inventory and factors that influence landslide occurrence (landslide influencing factors, LIF). Depending on type of landslides, nature of triggers and LIF, accuracy of the QLSM methods differs. Moreover, how to balance the number of 0 (nonoccurrence) and 1 (occurrence) in the training set obtained from the landslide inventory and how to select which one of the 1's and 0's to be included in QLSM models play critical role in the accuracy of the QLSM. Although performance of various QLSM methods is largely investigated in the literature, the challenge of training set construction is not adequately investigated for the QLSM methods. In order to tackle this challenge, in this study three different training set selection strategies along with the original data set is used for testing the performance of three different regression methods namely Logistic Regression (LR), Bayesian Logistic Regression (BLR) and Fuzzy Logistic Regression (FLR). The first sampling strategy is proportional random sampling (PRS), which takes into account a weighted selection of landslide occurrences in the sample set. The second method, namely non-selective nearby sampling (NNS), includes randomly selected sites and their surrounding neighboring points at certain preselected distances to include the impact of clustering. Selective nearby sampling (SNS) is the third method, which concentrates on the group of 1's and their surrounding neighborhood. A randomly selected group of landslide sites and their neighborhood are considered in the analyses similar to NNS parameters. It is found that LR-PRS, FLR-PRS and BLR-Whole Data set-ups, with order, yield the best fits among the other alternatives. The results indicate that in QLSM based on regression models, avoidance of spatial correlation in the data set is critical for the model's performance.
Hanifian, Shahram; Khani, Sajjad
2012-04-02
To determine the prevalence of virulent Yersinia enterocolitica, 554 samples consisting of 354 bulk raw milks and 200 traditional cheeses were collected from different parts of Eastern-Azerbaijan province, during a 23-month period from 2008 to 2010. The occurrence of virulent strains of Y. enterocolitica in samples enriched in peptone sorbitol bile broth (PSBB) was evaluated via the detection of attachment invasion locus (ail) gene by PCR. The viability of virulent Y. enterocolitica in the PCR-positive samples was tested using conventional culture method and the isolates were confirmed by the second-phase ail-PCR. According to the results, 8.66% of total samples including 7.62% of bulk raw milks and 10.5% of raw milk cheeses were found ail-positive by PCR method; subsequently Y. enterocolitica was isolated by the culture method and confirmed by the second phase ail-PCR in 2.88% of total samples including 2.26% of raw milks and 4% of cheese samples. It was concluded that, a sample enrichment followed by ail-PCR was more sensitive and robust to detect and distinguish the virulent strains of Y. enterocolitica compared to the conventional culture method. Copyright © 2012 Elsevier B.V. All rights reserved.
Fishman, M. J.
1993-01-01
Methods to be used to analyze samples of water, suspended sediment and bottom material for their content of inorganic and organic constituents are presented. Technology continually changes, and so this laboratory manual includes new and revised methods for determining the concentration of dissolved constituents in water, whole water recoverable constituents in water-suspended sediment samples, and recoverable concentration of constit- uents in bottom material. For each method, the general topics covered are the application, the principle of the method, interferences, the apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data. Included in this manual are 30 methods.
Zhang, Zhe; Schindler, Christina E. M.; Lange, Oliver F.; Zacharias, Martin
2015-01-01
The high-resolution refinement of docked protein-protein complexes can provide valuable structural and mechanistic insight into protein complex formation complementing experiment. Monte Carlo (MC) based approaches are frequently applied to sample putative interaction geometries of proteins including also possible conformational changes of the binding partners. In order to explore efficiency improvements of the MC sampling, several enhanced sampling techniques, including temperature or Hamiltonian replica exchange and well-tempered ensemble approaches, have been combined with the MC method and were evaluated on 20 protein complexes using unbound partner structures. The well-tempered ensemble method combined with a 2-dimensional temperature and Hamiltonian replica exchange scheme (WTE-H-REMC) was identified as the most efficient search strategy. Comparison with prolonged MC searches indicates that the WTE-H-REMC approach requires approximately 5 times fewer MC steps to identify near native docking geometries compared to conventional MC searches. PMID:26053419
Nessen, Merel A; van der Zwaan, Dennis J; Grevers, Sander; Dalebout, Hans; Staats, Martijn; Kok, Esther; Palmblad, Magnus
2016-05-11
Proteomics methodology has seen increased application in food authentication, including tandem mass spectrometry of targeted species-specific peptides in raw, processed, or mixed food products. We have previously described an alternative principle that uses untargeted data acquisition and spectral library matching, essentially spectral counting, to compare and identify samples without the need for genomic sequence information in food species populations. Here, we present an interlaboratory comparison demonstrating how a method based on this principle performs in a realistic context. We also increasingly challenge the method by using data from different types of mass spectrometers, by trying to distinguish closely related and commercially important flatfish, and by analyzing heavily contaminated samples. The method was found to be robust in different laboratories, and 94-97% of the analyzed samples were correctly identified, including all processed and contaminated samples.
On the Exploitation of Sensitivity Derivatives for Improving Sampling Methods
NASA Technical Reports Server (NTRS)
Cao, Yanzhao; Hussaini, M. Yousuff; Zang, Thomas A.
2003-01-01
Many application codes, such as finite-element structural analyses and computational fluid dynamics codes, are capable of producing many sensitivity derivatives at a small fraction of the cost of the underlying analysis. This paper describes a simple variance reduction method that exploits such inexpensive sensitivity derivatives to increase the accuracy of sampling methods. Three examples, including a finite-element structural analysis of an aircraft wing, are provided that illustrate an order of magnitude improvement in accuracy for both Monte Carlo and stratified sampling schemes.
Beknazarova, Meruyert; Millsteed, Shelby; Robertson, Gemma; Whiley, Harriet; Ross, Kirstin
2017-06-09
Strongyloides stercoralis is a gastrointestinal parasitic nematode with a life cycle that includes free-living and parasitic forms. For both clinical (diagnostic) and environmental evaluation, it is important that we can detect Strongyloides spp. in both human and non-human fecal samples. Real-time PCR is the most feasible method for detecting the parasite in both clinical and environmental samples that have been preserved. However, one of the biggest challenges with PCR detection is DNA degradation during the postage time from rural and remote areas to the laboratory. This study included a laboratory assessment and field validation of DESS (dimethyl sulfoxide, disodium EDTA, and saturated NaCl) preservation of Strongyloides spp. DNA in fecal samples. The laboratory study investigated the capacity of 1:1 and 1:3 sample to DESS ratios to preserve Strongyloides ratti in spike canine feces. It was found that both ratios of DESS significantly prevented DNA degradation compared to the untreated sample. This method was then validated by applying it to the field-collected canine feces and detecting Strongyloides DNA using PCR. A total of 37 canine feces samples were collected and preserved in the 1:3 ratio (sample: DESS) and of these, 17 were positive for Strongyloides spp. The study shows that both 1:1 and 1:3 sample to DESS ratios were able to preserve the Strongyloides spp. DNA in canine feces samples stored at room temperature for up to 56 days. This DESS preservation method presents the most applicable and feasible method for the Strongyloides DNA preservation in field-collected feces.
Cross-Domain Semi-Supervised Learning Using Feature Formulation.
Xingquan Zhu
2011-12-01
Semi-Supervised Learning (SSL) traditionally makes use of unlabeled samples by including them into the training set through an automated labeling process. Such a primitive Semi-Supervised Learning (pSSL) approach suffers from a number of disadvantages including false labeling and incapable of utilizing out-of-domain samples. In this paper, we propose a formative Semi-Supervised Learning (fSSL) framework which explores hidden features between labeled and unlabeled samples to achieve semi-supervised learning. fSSL regards that both labeled and unlabeled samples are generated from some hidden concepts with labeling information partially observable for some samples. The key of the fSSL is to recover the hidden concepts, and take them as new features to link labeled and unlabeled samples for semi-supervised learning. Because unlabeled samples are only used to generate new features, but not to be explicitly included in the training set like pSSL does, fSSL overcomes the inherent disadvantages of the traditional pSSL methods, especially for samples not within the same domain as the labeled instances. Experimental results and comparisons demonstrate that fSSL significantly outperforms pSSL-based methods for both within-domain and cross-domain semi-supervised learning.
The Mass Spectrometric Ortho Effect Studied for All 209 PCB Congeners
A method for the determination of polychlorinated biphenyls (PCBs) in caulk was developed; with application to a set of caulk and window glazing material samples. This method was evaluated by analyzing a combination of 47 samples of caulk, glazing materials, and including quality...
Evaluation of seven aquatic sampling methods for amphibians and other aquatic fauna
Gunzburger, M.S.
2007-01-01
To design effective and efficient research and monitoring programs researchers must have a thorough understanding of the capabilities and limitations of their sampling methods. Few direct comparative studies exist for aquatic sampling methods for amphibians. The objective of this study was to simultaneously employ seven aquatic sampling methods in 10 wetlands to compare amphibian species richness and number of individuals detected with each method. Four sampling methods allowed counts of individuals (metal dipnet, D-frame dipnet, box trap, crayfish trap), whereas the other three methods allowed detection of species (visual encounter, aural, and froglogger). Amphibian species richness was greatest with froglogger, box trap, and aural samples. For anuran species, the sampling methods by which each life stage was detected was related to relative length of larval and breeding periods and tadpole size. Detection probability of amphibians varied across sampling methods. Box trap sampling resulted in the most precise amphibian count, but the precision of all four count-based methods was low (coefficient of variation > 145 for all methods). The efficacy of the four count sampling methods at sampling fish and aquatic invertebrates was also analyzed because these predatory taxa are known to be important predictors of amphibian habitat distribution. Species richness and counts were similar for fish with the four methods, whereas invertebrate species richness and counts were greatest in box traps. An effective wetland amphibian monitoring program in the southeastern United States should include multiple sampling methods to obtain the most accurate assessment of species community composition at each site. The combined use of frogloggers, crayfish traps, and dipnets may be the most efficient and effective amphibian monitoring protocol. ?? 2007 Brill Academic Publishers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagnik, Gargey B.
The main goal of the presented research is development of nanoparticle based matrix-assisted laser desorption ionization-mass spectrometry (MALDI-MS). This dissertation includes the application of previously developed data acquisition methods, development of novel sample preparation methods, application and comparison of novel nanoparticle matrices, and comparison of two nanoparticle matrix application methods for MALDI-MS and MALDI-MS imaging.
SERS diagnostic platforms, methods and systems microarrays, biosensors and biochips
Vo-Dinh, Tuan [Knoxville, TN
2007-09-11
A Raman integrated sensor system for the detection of targets including biotargets includes at least one sampling platform, at least one receptor probe disposed on the sampling platform, and an integrated circuit detector system communicably connected to the receptor. The sampling platform is preferably a Raman active surface-enhanced scattering (SERS) platform, wherein the Raman sensor is a SERS sensor. The receptors can include at least one protein receptor and at least one nucleic acid receptor.
Jin, Jae Hwa; Kim, Junho; Lee, Jeong-Yil; Oh, Young Min
2016-07-22
One of the main interests in petroleum geology and reservoir engineering is to quantify the porosity of reservoir beds as accurately as possible. A variety of direct measurements, including methods of mercury intrusion, helium injection and petrographic image analysis, have been developed; however, their application frequently yields equivocal results because these methods are different in theoretical bases, means of measurement, and causes of measurement errors. Here, we present a set of porosities measured in Berea Sandstone samples by the multiple methods, in particular with adoption of a new method using computed tomography and reference samples. The multiple porosimetric data show a marked correlativeness among different methods, suggesting that these methods are compatible with each other. The new method of reference-sample-guided computed tomography is more effective than the previous methods when the accompanied merits such as experimental conveniences are taken into account.
Jin, Jae Hwa; Kim, Junho; Lee, Jeong-Yil; Oh, Young Min
2016-01-01
One of the main interests in petroleum geology and reservoir engineering is to quantify the porosity of reservoir beds as accurately as possible. A variety of direct measurements, including methods of mercury intrusion, helium injection and petrographic image analysis, have been developed; however, their application frequently yields equivocal results because these methods are different in theoretical bases, means of measurement, and causes of measurement errors. Here, we present a set of porosities measured in Berea Sandstone samples by the multiple methods, in particular with adoption of a new method using computed tomography and reference samples. The multiple porosimetric data show a marked correlativeness among different methods, suggesting that these methods are compatible with each other. The new method of reference-sample-guided computed tomography is more effective than the previous methods when the accompanied merits such as experimental conveniences are taken into account. PMID:27445105
Bird, Susan M.; Fram, Miranda S.; Crepeau, Kathryn L.
2003-01-01
An analytical method has been developed for the determination of dissolved organic carbon concentration in water samples. This method includes the results of the tests used to validate the method and the quality-control practices used for dissolved organic carbon analysis. Prior to analysis, water samples are filtered to remove suspended particulate matter. A Shimadzu TOC-5000A Total Organic Carbon Analyzer in the nonpurgeable organic carbon mode is used to analyze the samples by high temperature catalytic oxidation. The analysis usually is completed within 48 hours of sample collection. The laboratory reporting level is 0.22 milligrams per liter.
Critical length sampling: a method to estimate the volume of downed coarse woody debris
G& #246; ran St& #229; hl; Jeffrey H. Gove; Michael S. Williams; Mark J. Ducey
2010-01-01
In this paper, critical length sampling for estimating the volume of downed coarse woody debris is presented. Using this method, the volume of downed wood in a stand can be estimated by summing the critical lengths of down logs included in a sample obtained using a relascope or wedge prism; typically, the instrument should be tilted 90° from its usual...
Quantitative determination of atmospheric hydroperoxyl radical
Springston, Stephen R.; Lloyd, Judith; Zheng, Jun
2007-10-23
A method for the quantitative determination of atmospheric hydroperoxyl radical comprising: (a) contacting a liquid phase atmospheric sample with a chemiluminescent compound which luminesces on contact with hydroperoxyl radical; (b) determining luminescence intensity from the liquid phase atmospheric sample; and (c) comparing said luminescence intensity from the liquid phase atmospheric sample to a standard luminescence intensity for hydroperoxyl radical. An apparatus for automating the method is also included.
Rodríguez, Roberto A; Love, David C; Stewart, Jill R; Tajuba, Julianne; Knee, Jacqueline; Dickerson, Jerold W; Webster, Laura F; Sobsey, Mark D
2012-04-01
Methods for detection of two fecal indicator viruses, F+ and somatic coliphages, were evaluated for application to recreational marine water. Marine water samples were collected during the summer of 2007 in Southern California, United States from transects along Avalon Beach (n=186 samples) and Doheny Beach (n=101 samples). Coliphage detection methods included EPA method 1601 - two-step enrichment (ENR), EPA method 1602 - single agar layer (SAL), and variations of ENR. Variations included comparison of two incubation times (overnight and 5-h incubation) and two final detection steps (lysis zone assay and a rapid latex agglutination assay). A greater number of samples were positive for somatic and F+ coliphages by ENR than by SAL (p<0.01). The standard ENR with overnight incubation and detection by lysis zone assay was the most sensitive method for the detection of F+ and somatic coliphages from marine water, although the method takes up to three days to obtain results. A rapid 5-h enrichment version of ENR also performed well, with more positive samples than SAL, and could be performed in roughly 24h. Latex agglutination-based detection methods require the least amount of time to perform, although the sensitivity was less than lysis zone-based detection methods. Rapid culture-based enrichment of coliphages in marine water may be possible by further optimizing culture-based methods for saline water conditions to generate higher viral titers than currently available, as well as increasing the sensitivity of latex agglutination detection methods. Copyright © 2012 Elsevier B.V. All rights reserved.
Characterization of rock thermal conductivity by high-resolution optical scanning
Popov, Y.A.; Pribnow, D.F.C.; Sass, J.H.; Williams, C.F.; Burkhardt, H.
1999-01-01
We compared thress laboratory methods for thermal conductivity measurements: divided-bar, line-source and optical scanning. These methods are widely used in geothermal and petrophysical studies, particularly as applied to research on cores from deep scientific boreholes. The relatively new optical scanning method has recently been perfected and applied to geophysical problems. A comparison among these methods for determining the thermal conductivity tensor for anisotropic rocks is based on a representative collection of 80 crystalline rock samples from the KTB continental deep borehole (Germany). Despite substantial thermal inhomogeneity of rock thermal conductivity (up to 40-50% variation) and high anisotropy (with ratios of principal values attaining 2 and more), the results of measurements agree very well among the different methods. The discrepancy for measurements along the foliation is negligible (<1%). The component of thermal conductivity normal to the foliation reveals somewhat larger differences (3-4%). Optical scanning allowed us to characterize the thermal inhomogeneity of rocks and to identify a three-dimensional anisotropy in thermal conductivity of some gneiss samples. The merits of optical scanning include minor random errors (1.6%), the ability to record the variation of thermal conductivity along the sample, the ability to sample deeply using a slow scanning rate, freedom from constraints for sample size and shape, and quality of mechanical treatment of the sample surface, a contactless mode of measurement, high speed of operation, and the ability to measure on a cylindrical sample surface. More traditional methods remain superior for characterizing bulk conductivity at elevated temperature.Three laboratory methods including divided-bar, line-source and optical scanning are widely applied in geothermal and petrophysical studies. In this study, these three methods were compared for determining the thermal conductivity tensor for anisotropic rocks. For this study, a representative collection of 80 crystalline rock samples from the KTB continental deep borehole was used. Despite substantial thermal inhomogeneity of rock thermal conductivity and high anisotropy, measurement results were in excellent agreement among the three methods.
Systems and methods for self-synchronized digital sampling
NASA Technical Reports Server (NTRS)
Samson, Jr., John R. (Inventor)
2008-01-01
Systems and methods for self-synchronized data sampling are provided. In one embodiment, a system for capturing synchronous data samples is provided. The system includes an analog to digital converter adapted to capture signals from one or more sensors and convert the signals into a stream of digital data samples at a sampling frequency determined by a sampling control signal; and a synchronizer coupled to the analog to digital converter and adapted to receive a rotational frequency signal from a rotating machine, wherein the synchronizer is further adapted to generate the sampling control signal, and wherein the sampling control signal is based on the rotational frequency signal.
Laboratories measuring target chemical, radiochemical, pathogens, and biotoxin analytes in environmental samples can use this online query tool to identify analytical methods included in EPA's Selected Analytical Methods for Environmental Remediation
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
NASA Technical Reports Server (NTRS)
Kim, Hyun Jung; Choi, Sang H.; Bae, Hyung-Bin; Lee, Tae Woo
2012-01-01
The National Aeronautics and Space Administration-invented X-ray diffraction (XRD) methods, including the total defect density measurement method and the spatial wafer mapping method, have confirmed super hetero epitaxy growth for rhombohedral single crystalline silicon germanium (Si1-xGex) on a c-plane sapphire substrate. However, the XRD method cannot observe the surface morphology or roughness because of the method s limited resolution. Therefore the authors used transmission electron microscopy (TEM) with samples prepared in two ways, the focused ion beam (FIB) method and the tripod method to study the structure between Si1-xGex and sapphire substrate and Si1?xGex itself. The sample preparation for TEM should be as fast as possible so that the sample should contain few or no artifacts induced by the preparation. The standard sample preparation method of mechanical polishing often requires a relatively long ion milling time (several hours), which increases the probability of inducing defects into the sample. The TEM sampling of the Si1-xGex on sapphire is also difficult because of the sapphire s high hardness and mechanical instability. The FIB method and the tripod method eliminate both problems when performing a cross-section TEM sampling of Si1-xGex on c-plane sapphire, which shows the surface morphology, the interface between film and substrate, and the crystal structure of the film. This paper explains the FIB sampling method and the tripod sampling method, and why sampling Si1-xGex, on a sapphire substrate with TEM, is necessary.
Universal nucleic acids sample preparation method for cells, spores and their mixture
Bavykin, Sergei [Darien, IL
2011-01-18
The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.
Magnuson, Matthew; Campisano, Romy; Griggs, John; Fitz-James, Schatzi; Hall, Kathy; Mapp, Latisha; Mullins, Marissa; Nichols, Tonya; Shah, Sanjiv; Silvestri, Erin; Smith, Terry; Willison, Stuart; Ernst, Hiba
2014-11-01
Catastrophic incidents can generate a large number of samples of analytically diverse types, including forensic, clinical, environmental, food, and others. Environmental samples include water, wastewater, soil, air, urban building and infrastructure materials, and surface residue. Such samples may arise not only from contamination from the incident but also from the multitude of activities surrounding the response to the incident, including decontamination. This document summarizes a range of activities to help build laboratory capability in preparation for sample analysis following a catastrophic incident, including selection and development of fit-for-purpose analytical methods for chemical, biological, and radiological contaminants. Fit-for-purpose methods are those which have been selected to meet project specific data quality objectives. For example, methods could be fit for screening contamination in the early phases of investigation of contamination incidents because they are rapid and easily implemented, but those same methods may not be fit for the purpose of remediating the environment to acceptable levels when a more sensitive method is required. While the exact data quality objectives defining fitness-for-purpose can vary with each incident, a governing principle of the method selection and development process for environmental remediation and recovery is based on achieving high throughput while maintaining high quality analytical results. This paper illustrates the result of applying this principle, in the form of a compendium of analytical methods for contaminants of interest. The compendium is based on experience with actual incidents, where appropriate and available. This paper also discusses efforts aimed at adaptation of existing methods to increase fitness-for-purpose and development of innovative methods when necessary. The contaminants of interest are primarily those potentially released through catastrophes resulting from malicious activity. However, the same techniques discussed could also have application to catastrophes resulting from other incidents, such as natural disasters or industrial accidents. Further, the high sample throughput enabled by the techniques discussed could be employed for conventional environmental studies and compliance monitoring, potentially decreasing costs and/or increasing the quantity of data available to decision-makers. Published by Elsevier Ltd.
Cruz, Mutya; Wang, Miao; Frisch-Daiello, Jessica; Han, Xianlin
2016-07-01
Extraction of lipids from biological samples is a critical step in lipidomics, especially for shotgun lipidomics where lipid extracts are directly infused into a mass spectrometer. The butanol-methanol (BUME) extraction method was originally developed to extract lipids from plasma samples with 1 % acetic acid. Considering some lipids are sensitive to acidic environments, we modified this protocol by replacing acetic acid with lithium chloride solution and extended the modified extraction to tissue samples. Although no significant reduction of plasmalogen levels in the acidic BUME extracts of rat heart samples was found, the modified method was established to extract various tissue samples, including rat liver, heart, and plasma. Essentially identical profiles of the majority of lipid classes were obtained from the extracts of the modified BUME and traditional Bligh-Dyer methods. However, it was found that neither the original, nor the modified BUME method was suitable for 4-hydroxyalkenal species measurement in biological samples.
Cruz, Mutya; Wang, Miao; Frisch-Daiello, Jessica; Han, Xianlin
2016-01-01
Extraction of lipids from biological samples is a critical step in lipidomics, especially for shotgun lipidomics where lipid extracts are directly infused into a mass spectrometer. The butanol-methanol (BUME) extraction method was originally developed to extract lipids from plasma samples with 1% acetic acid. Considering some lipids are sensitive to acidic environments, we modified this protocol by replacing acetic acid with lithium chloride solution and extended the modified extraction to tissue samples. Although no significant reduction of plasmalogen levels in the acidic BUME extracts of rat heart samples was found, the modified method was established to extract various tissue samples, including rat liver, heart, and plasma. Essentially identical profiles of the majority of lipid classes were obtained from the extracts of the modified BUME and traditional Bligh-Dyer methods. However, it was found that neither the original, nor the modified BUME method was suitable for 4-hydroxyalkenal species measurement in biological samples. PMID:27245345
Method and apparatus for testing surface characteristics of a material
NASA Technical Reports Server (NTRS)
Johnson, David L. (Inventor); Kersker, Karl D. (Inventor); Stratton, Troy C. (Inventor); Richardson, David E. (Inventor)
2006-01-01
A method, apparatus and system for testing characteristics of a material sample is provided. The system includes an apparatus configured to house the material test sample while defining a sealed volume against a surface of the material test sample. A source of pressurized fluid is in communication with, and configured to pressurize, the sealed volume. A load applying apparatus is configured to apply a defined load to the material sample while the sealed volume is monitored for leakage of the pressurized fluid. Thus, the inducement of surface defects such as microcracking and crazing may be detected and their effects analyzed for a given material. The material test samples may include laminar structures formed of, for example, carbon cloth phenolic, glass cloth phenolic, silica cloth phenolic materials or carbon-carbon materials. In one embodiment the system may be configured to analyze the material test sample while an across-ply loading is applied thereto.
MEASUREMENT OF FINE PARTICULATE MATTER (NONVOLATILE AND SEMIVOLATILE FRACTIONS) IN FRESNO, CA
Semi-volatile material, including ammonium nitrate and semi-volatile organic material, is often not measured by traditionally used sampling methods including the FRM and the R&P TEOM Monitor. An intensive sampling campaign was performed at the EPA Fresno, CA Supersite during D...
Production and distribution of dilute species in semiconducting materials
James, Ralph B.; Camarda, Giuseppe; Bolotnikov, Aleksey E.; Hossain, Anwar; Yang, Ge; Kim, Kihyun
2016-09-06
Technologies are described effective to implement systems and methods of producing a material. The methods comprise receiving a tertiary semiconductor sample with a dilute species. The sample has two ends. The first end of the sample includes a first concentration of the dilute species lower than a second concentration of the dilute species in the second end of the sample. The method further comprises heating the sample in a chamber. The chamber has a first zone and a second zone. The first zone having a first temperature higher than a second temperature in the second zone. The sample is orientated such that the first end is in the first zone and the second end is in the second zone.
Comparison of preprocessing methods and storage times for touch DNA samples
Dong, Hui; Wang, Jing; Zhang, Tao; Ge, Jian-ye; Dong, Ying-qiang; Sun, Qi-fan; Liu, Chao; Li, Cai-xia
2017-01-01
Aim To select appropriate preprocessing methods for different substrates by comparing the effects of four different preprocessing methods on touch DNA samples and to determine the effect of various storage times on the results of touch DNA sample analysis. Method Hand touch DNA samples were used to investigate the detection and inspection results of DNA on different substrates. Four preprocessing methods, including the direct cutting method, stubbing procedure, double swab technique, and vacuum cleaner method, were used in this study. DNA was extracted from mock samples with four different preprocessing methods. The best preprocess protocol determined from the study was further used to compare performance after various storage times. DNA extracted from all samples was quantified and amplified using standard procedures. Results The amounts of DNA and the number of alleles detected on the porous substrates were greater than those on the non-porous substrates. The performances of the four preprocessing methods varied with different substrates. The direct cutting method displayed advantages for porous substrates, and the vacuum cleaner method was advantageous for non-porous substrates. No significant degradation trend was observed as the storage times increased. Conclusion Different substrates require the use of different preprocessing method in order to obtain the highest DNA amount and allele number from touch DNA samples. This study provides a theoretical basis for explorations of touch DNA samples and may be used as a reference when dealing with touch DNA samples in case work. PMID:28252870
Anderson, Annette Carola; Hellwig, Elmar; Vespermann, Robin; Wittmer, Annette; Schmid, Michael; Karygianni, Lamprini; Al-Ahmad, Ali
2012-01-01
Persistence of microorganisms or reinfections are the main reasons for failure of root canal therapy. Very few studies to date have included culture-independent methods to assess the microbiota, including non-cultivable microorganisms. The aim of this study was to combine culture methods with culture-independent cloning methods to analyze the microbial flora of root-filled teeth with periradicular lesions. Twenty-one samples from previously root-filled teeth were collected from patients with periradicular lesions. Microorganisms were cultivated, isolated and biochemically identified. In addition, ribosomal DNA of bacteria, fungi and archaea derived from the same samples was amplified and the PCR products were used to construct clone libraries. DNA of selected clones was sequenced and microbial species were identified, comparing the sequences with public databases. Microorganisms were found in 12 samples with culture-dependent and -independent methods combined. The number of bacterial species ranged from 1 to 12 in one sample. The majority of the 26 taxa belonged to the phylum Firmicutes (14 taxa), followed by Actinobacteria, Proteobacteria and Bacteroidetes. One sample was positive for fungi, and archaea could not be detected. The results obtained with both methods differed. The cloning technique detected several as-yet-uncultivated taxa. Using a combination of both methods 13 taxa were detected that had not been found in root-filled teeth so far. Enterococcus faecalis was only detected in two samples using culture methods. Combining the culture-dependent and –independent approaches revealed new candidate endodontic pathogens and a high diversity of the microbial flora in root-filled teeth with periradicular lesions. Both methods yielded differing results, emphasizing the benefit of combined methods for the detection of the actual microbial diversity in apical periodontitis. PMID:23152922
300 Area TEDF NPDES Permit Compliance Monitoring Plan
DOE Office of Scientific and Technical Information (OSTI.GOV)
Loll, C.M.
1994-10-13
This monitoring plan describes the activities and methods that will be employed at the 300 Area Treated Effluent Disposal Facility (TEDF) in order to ensure compliance with the National Discharge Elimination System (NPDES) permit. Included in this document are a brief description of the project, the specifics of the sampling effort, including the physical location and frequency of sampling, the support required for sampling, and the Quality Assurance (QA) protocols to be followed in the sampling procedures.
Method for using polarization gating to measure a scattering sample
Baba, Justin S.
2015-08-04
Described herein are systems, devices, and methods facilitating optical characterization of scattering samples. A polarized optical beam can be directed to pass through a sample to be tested. The optical beam exiting the sample can then be analyzed to determine its degree of polarization, from which other properties of the sample can be determined. In some cases, an apparatus can include a source of an optical beam, an input polarizer, a sample, an output polarizer, and a photodetector. In some cases, a signal from a photodetector can be processed through attenuation, variable offset, and variable gain.
Al-Sammak, Maitham Ahmed; Hoagland, Kyle D; Snow, Daniel D; Cassada, David
2013-12-15
Blue-green algae, also known as cyanobacteria, can produce several different groups of toxins in the environment including hepatotoxins (microcystins), neurotoxic non-protein amino acids β-methylamino-l-alanine (BMAA), and 2,4-diaminobutyric (DABA), as well as the bicyclic amine alkaloid anatoxin-a. Few studies have addressed the methods necessary for an accurate determination of cyanotoxins in environmental samples, and none have been published that can detect these cyanotoxins together in a single sample. Cyanotoxins occur in a wide range of environmental samples including water, fish, and aquatic plant samples. Using polymeric cation exchange solid phase extraction (SPE) coupled with liquid chromatography and fluorescence detection (HPLC/FD), and liquid chromatography ion trap tandem mass spectrometry (LC/MS/MS), these compounds can for the first time be simultaneously quantified in a variety of environmental sample types. The extraction method for biological samples can distinguish bound and free cyanotoxins. Detection limits for water ranged from 5 to 7 μg/L using HPLC/FD, while detection limits for and LC/MS were in the range of 0.8-3.2 μg/L. Copyright © 2013 Elsevier Ltd. All rights reserved.
Apparatus and methods for manipulation and optimization of biological systems
NASA Technical Reports Server (NTRS)
Sun, Ren (Inventor); Ho, Chih-Ming (Inventor); Wong, Pak Kin (Inventor); Yu, Fuqu (Inventor)
2012-01-01
The invention provides systems and methods for manipulating, e.g., optimizing and controlling, biological systems, e.g., for eliciting a more desired biological response of biological sample, such as a tissue, organ, and/or a cell. In one aspect, systems and methods of the invention operate by efficiently searching through a large parametric space of stimuli and system parameters to manipulate, control, and optimize the response of biological samples sustained in the system, e.g., a bioreactor. In alternative aspects, systems include a device for sustaining cells or tissue samples, one or more actuators for stimulating the samples via biochemical, electromagnetic, thermal, mechanical, and/or optical stimulation, one or more sensors for measuring a biological response signal of the samples resulting from the stimulation of the sample. In one aspect, the systems and methods of the invention use at least one optimization algorithm to modify the actuator's control inputs for stimulation, responsive to the sensor's output of response signals. The compositions and methods of the invention can be used, e.g., to for systems optimization of any biological manufacturing or experimental system, e.g., bioreactors for proteins, e.g., therapeutic proteins, polypeptides or peptides for vaccines, and the like, small molecules (e.g., antibiotics), polysaccharides, lipids, and the like. Another use of the apparatus and methods includes combination drug therapy, e.g. optimal drug cocktail, directed cell proliferations and differentiations, e.g. in tissue engineering, e.g. neural progenitor cells differentiation, and discovery of key parameters in complex biological systems.
Synchronizing data from irregularly sampled sensors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Uluyol, Onder
A system and method include receiving a set of sampled measurements for each of multiple sensors, wherein the sampled measurements are at irregular intervals or different rates, re-sampling the sampled measurements of each of the multiple sensors at a higher rate than one of the sensor's set of sampled measurements, and synchronizing the sampled measurements of each of the multiple sensors.
Zhang, Chun-Yun; Hu, Hui-Chao; Chai, Xin-Sheng; Pan, Lei; Xiao, Xian-Ming
2014-02-07
In this paper, we present a novel method for determining the maximal amount of ethane, a minor gas species, adsorbed in a shale sample. The method is based on the time-dependent release of ethane from shale samples measured by headspace gas chromatography (HS-GC). The study includes a mathematical model for fitting the experimental data, calculating the maximal amount gas adsorbed, and predicting results at other temperatures. The method is a more efficient alternative to the isothermal adsorption method that is in widespread use today. Copyright © 2013 Elsevier B.V. All rights reserved.
Jacobs, Jon M.; Burnum-Johnson, Kristin E.; Baker, Erin M.; Smith, Richard D.; Gritsenko, Marina A.; Orton, Daniel
2017-05-16
Methods and systems for diagnosing or prognosing liver fibrosis in a subject are provided. In some examples, such methods and systems can include detecting liver fibrosis-related molecules in a sample obtained from the subject, comparing expression of the molecules in the sample to controls representing expression values expected in a subject who does not have liver fibrosis or who has non-progressing fibrosis, and diagnosing or prognosing liver fibrosis in the subject when differential expression of the molecules between the sample and the controls is detected. Kits for the diagnosis or prognosis of liver fibrosis in a subject are also provided which include reagents for detecting liver fibrosis related molecules.
Jacobs, Jon M.; Burnum-Johnson, Kristin E.; Baker, Erin M.; Smith, Richard D.; Gritsenko, Marina A.; Orton, Daniel
2015-09-15
Methods and systems for diagnosing or prognosing liver fibrosis in a subject are provided. In some examples, such methods and systems can include detecting liver fibrosis-related molecules in a sample obtained from the subject, comparing expression of the molecules in the sample to controls representing expression values expected in a subject who does not have liver fibrosis or who has non-progressing fibrosis, and diagnosing or prognosing liver fibrosis in the subject when differential expression of the molecules between the sample and the controls is detected. Kits for the diagnosis or prognosis of liver fibrosis in a subject are also provided which include reagents for detecting liver fibrosis related molecules.
Microfluidic device and method for focusing, segmenting, and dispensing of a fluid stream
Jacobson, Stephen C [Knoxville, TN; Ramsey, J Michael [Knoxville, TN
2008-09-09
A microfluidic device and method for forming and dispensing minute volume segments of a material are described. In accordance with the present invention, a microfluidic device and method are provided for spatially confining the material in a focusing element. The device is also adapted for segmenting the confined material into minute volume segments, and dispensing a volume segment to a waste or collection channel. The device further includes means for driving the respective streams of sample and focusing fluids through respective channels into a chamber, such that the focusing fluid streams spatially confine the sample material. The device may also include additional means for driving a minute volume segment of the spatially confined sample material into a collection channel in fluid communication with the waste reservoir.
Evaluation of respondent-driven sampling.
McCreesh, Nicky; Frost, Simon D W; Seeley, Janet; Katongole, Joseph; Tarsh, Matilda N; Ndunguse, Richard; Jichi, Fatima; Lunel, Natasha L; Maher, Dermot; Johnston, Lisa G; Sonnenberg, Pam; Copas, Andrew J; Hayes, Richard J; White, Richard G
2012-01-01
Respondent-driven sampling is a novel variant of link-tracing sampling for estimating the characteristics of hard-to-reach groups, such as HIV prevalence in sex workers. Despite its use by leading health organizations, the performance of this method in realistic situations is still largely unknown. We evaluated respondent-driven sampling by comparing estimates from a respondent-driven sampling survey with total population data. Total population data on age, tribe, religion, socioeconomic status, sexual activity, and HIV status were available on a population of 2402 male household heads from an open cohort in rural Uganda. A respondent-driven sampling (RDS) survey was carried out in this population, using current methods of sampling (RDS sample) and statistical inference (RDS estimates). Analyses were carried out for the full RDS sample and then repeated for the first 250 recruits (small sample). We recruited 927 household heads. Full and small RDS samples were largely representative of the total population, but both samples underrepresented men who were younger, of higher socioeconomic status, and with unknown sexual activity and HIV status. Respondent-driven sampling statistical inference methods failed to reduce these biases. Only 31%-37% (depending on method and sample size) of RDS estimates were closer to the true population proportions than the RDS sample proportions. Only 50%-74% of respondent-driven sampling bootstrap 95% confidence intervals included the population proportion. Respondent-driven sampling produced a generally representative sample of this well-connected nonhidden population. However, current respondent-driven sampling inference methods failed to reduce bias when it occurred. Whether the data required to remove bias and measure precision can be collected in a respondent-driven sampling survey is unresolved. Respondent-driven sampling should be regarded as a (potentially superior) form of convenience sampling method, and caution is required when interpreting findings based on the sampling method.
Laboratories measuring target biotoxin analytes in environmental samples can use this online query tool to identify analytical methods included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery for select biotoxins.
Harwood, Valerie J; Boehm, Alexandria B; Sassoubre, Lauren M; Vijayavel, Kannappan; Stewart, Jill R; Fong, Theng-Theng; Caprais, Marie-Paule; Converse, Reagan R; Diston, David; Ebdon, James; Fuhrman, Jed A; Gourmelon, Michele; Gentry-Shields, Jennifer; Griffith, John F; Kashian, Donna R; Noble, Rachel T; Taylor, Huw; Wicki, Melanie
2013-11-15
An inter-laboratory study of the accuracy of microbial source tracking (MST) methods was conducted using challenge fecal and sewage samples that were spiked into artificial freshwater and provided as unknowns (blind test samples) to the laboratories. The results of the Source Identification Protocol Project (SIPP) are presented in a series of papers that cover 41 MST methods. This contribution details the results of the virus and bacteriophage methods targeting human fecal or sewage contamination. Human viruses used as source identifiers included adenoviruses (HAdV), enteroviruses (EV), norovirus Groups I and II (NoVI and NoVII), and polyomaviruses (HPyVs). Bacteriophages were also employed, including somatic coliphages and F-specific RNA bacteriophages (FRNAPH) as general indicators of fecal contamination. Bacteriophage methods targeting human fecal sources included genotyping of FRNAPH isolates and plaque formation on bacterial hosts Enterococcus faecium MB-55, Bacteroides HB-73 and Bacteroides GB-124. The use of small sample volumes (≤50 ml) resulted in relatively insensitive theoretical limits of detection (10-50 gene copies or plaques × 50 ml(-1)) which, coupled with low virus concentrations in samples, resulted in high false-negative rates, low sensitivity, and low negative predictive values. On the other hand, the specificity of the human virus methods was generally close to 100% and positive predictive values were ∼40-70% with the exception of NoVs, which were not detected. The bacteriophage methods were generally much less specific toward human sewage than virus methods, although FRNAPH II genotyping was relatively successful, with 18% sensitivity and 85% specificity. While the specificity of the human virus methods engenders great confidence in a positive result, better concentration methods and larger sample volumes must be utilized for greater accuracy of negative results, i.e. the prediction that a human contamination source is absent. Copyright © 2013 Elsevier Ltd. All rights reserved.
Automated MALDI matrix deposition method with inkjet printing for imaging mass spectrometry.
Baluya, Dodge L; Garrett, Timothy J; Yost, Richard A
2007-09-01
Careful matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is critical for producing reproducible analyte ion signals. Traditional methods for matrix deposition are often considered an art rather than a science, with significant sample-to-sample variability. Here we report an automated method for matrix deposition, employing a desktop inkjet printer (<$200) with 5760 x 1440 dpi resolution and a six-channel piezoelectric head that delivers 3 pL/drop. The inkjet printer tray, designed to hold CDs and DVDs, was modified to hold microscope slides. Empty ink cartridges were filled with MALDI matrix solutions, including DHB in methanol/water (70:30) at concentrations up to 40 mg/mL. Various samples (including rat brain tissue sections and standards of small drug molecules) were prepared using three deposition methods (electrospray, airbrush, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed that matrix crystals were formed evenly across the sample. There was minimal background signal after storing the matrix in the cartridges over a 6-month period. Overall, the mass spectral images gathered from inkjet-printed tissue specimens were of better quality and more reproducible than from specimens prepared by the electrospray and airbrush methods.
Jannink, I; Bennen, J N; Blaauw, J; van Diest, P J; Baak, J P
1995-01-01
This study compares the influence of two different nuclear sampling methods on the prognostic value of assessments of mean and standard deviation of nuclear area (MNA, SDNA) in 191 consecutive invasive breast cancer patients with long term follow up. The first sampling method used was 'at convenience' sampling (ACS); the second, systematic random sampling (SRS). Both sampling methods were tested with a sample size of 50 nuclei (ACS-50 and SRS-50). To determine whether, besides the sampling methods, sample size had impact on prognostic value as well, the SRS method was also tested using a sample size of 100 nuclei (SRS-100). SDNA values were systematically lower for ACS, obviously due to (unconsciously) not including small and large nuclei. Testing prognostic value of a series of cut off points, MNA and SDNA values assessed by the SRS method were prognostically significantly stronger than the values obtained by the ACS method. This was confirmed in Cox regression analysis. For the MNA, the Mantel-Cox p-values from SRS-50 and SRS-100 measurements were not significantly different. However, for the SDNA, SRS-100 yielded significantly lower p-values than SRS-50. In conclusion, compared with the 'at convenience' nuclear sampling method, systematic random sampling of nuclei is not only superior with respect to reproducibility of results, but also provides a better prognostic value in patients with invasive breast cancer.
Swezey, Robert; Shinn, Walter; Green, Carol; Drover, David R.; Hammer, Gregory B.; Schulman, Scott R.; Zajicek, Anne; Jett, David A.; Boss, Gerry R.
2013-01-01
Most hospital laboratories do not measure blood cyanide concentrations, and samples must be sent to reference laboratories. A simple method is needed for measuring cyanide in hospitals. The authors previously developed a method to quantify cyanide based on the high binding affinity of the vitamin B12 analog, cobinamide, for cyanide and a major spectral change observed for cyanide-bound cobinamide. This method is now validated in human blood, and the findings include a mean inter-assay accuracy of 99.1%, precision of 8.75% and a lower limit of quantification of 3.27 µM cyanide. The method was applied to blood samples from children treated with sodium nitroprusside and it yielded measurable results in 88 of 172 samples (51%), whereas the reference laboratory yielded results in only 19 samples (11%). In all 19 samples, the cobinamide-based method also yielded measurable results. The two methods showed reasonable agreement when analyzed by linear regression, but not when analyzed by a standard error of the estimate or paired t-test. Differences in results between the two methods may be because samples were assayed at different times on different sample types. The cobinamide-based method is applicable to human blood, and can be used in hospital laboratories and emergency rooms. PMID:23653045
Detecting low levels of radionuclides in fluids
Patch, Keith D.; Morgan, Dean T.
2000-01-01
An apparatus and method for detecting low levels of one or more radionuclides in a fluid sample uses a substrate that includes an ion exchange resin or other sorbent material to collect the radionuclides. A collecting apparatus includes a collecting chamber that exposes the substrate to a measured amount of the fluid sample such that radionuclides in the fluid sample are collected by the ion exchange resin. A drying apparatus, which can include a drying chamber, then dries the substrate. A measuring apparatus measures emissions from radionuclides collected on the substrate. The substrate is positioned in a measuring chamber proximate to a detector, which provides a signal in response to emissions from the radionuclides. Other analysis methods can be used to detect non-radioactive analytes, which can be collected with other types of sorbent materials.
Lassahn, Gordon D.; Lancaster, Gregory D.; Apel, William A.; Thompson, Vicki S.
2013-01-08
Image portion identification methods, image parsing methods, image parsing systems, and articles of manufacture are described. According to one embodiment, an image portion identification method includes accessing data regarding an image depicting a plurality of biological substrates corresponding to at least one biological sample and indicating presence of at least one biological indicator within the biological sample and, using processing circuitry, automatically identifying a portion of the image depicting one of the biological substrates but not others of the biological substrates.
Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples
Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.
2015-02-14
Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, withmore » total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 ºC in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.« less
Batt, Angela L; Furlong, Edward T; Mash, Heath E; Glassmeyer, Susan T; Kolpin, Dana W
2017-02-01
A national-scale survey of 247 contaminants of emerging concern (CECs), including organic and inorganic chemical compounds, and microbial contaminants, was conducted in source and treated drinking water samples from 25 treatment plants across the United States. Multiple methods were used to determine these CECs, including six analytical methods to measure 174 pharmaceuticals, personal care products, and pesticides. A three-component quality assurance/quality control (QA/QC) program was designed for the subset of 174 CECs which allowed us to assess and compare performances of the methods used. The three components included: 1) a common field QA/QC protocol and sample design, 2) individual investigator-developed method-specific QA/QC protocols, and 3) a suite of 46 method comparison analytes that were determined in two or more analytical methods. Overall method performance for the 174 organic chemical CECs was assessed by comparing spiked recoveries in reagent, source, and treated water over a two-year period. In addition to the 247 CECs reported in the larger drinking water study, another 48 pharmaceutical compounds measured did not consistently meet predetermined quality standards. Methodologies that did not seem suitable for these analytes are overviewed. The need to exclude analytes based on method performance demonstrates the importance of additional QA/QC protocols. Published by Elsevier B.V.
Least squares polynomial chaos expansion: A review of sampling strategies
NASA Astrophysics Data System (ADS)
Hadigol, Mohammad; Doostan, Alireza
2018-04-01
As non-institutive polynomial chaos expansion (PCE) techniques have gained growing popularity among researchers, we here provide a comprehensive review of major sampling strategies for the least squares based PCE. Traditional sampling methods, such as Monte Carlo, Latin hypercube, quasi-Monte Carlo, optimal design of experiments (ODE), Gaussian quadratures, as well as more recent techniques, such as coherence-optimal and randomized quadratures are discussed. We also propose a hybrid sampling method, dubbed alphabetic-coherence-optimal, that employs the so-called alphabetic optimality criteria used in the context of ODE in conjunction with coherence-optimal samples. A comparison between the empirical performance of the selected sampling methods applied to three numerical examples, including high-order PCE's, high-dimensional problems, and low oversampling ratios, is presented to provide a road map for practitioners seeking the most suitable sampling technique for a problem at hand. We observed that the alphabetic-coherence-optimal technique outperforms other sampling methods, specially when high-order ODE are employed and/or the oversampling ratio is low.
Laser excited confocal microscope fluorescence scanner and method
Mathies, Richard A.; Peck, Konan
1992-01-01
A fluorescent scanner for scanning the fluorescence from a fluorescence labeled separated sample on a sample carrier including a confocal microscope for illuminating a predetermined volume of the sample carrier and/or receiving and processing fluorescence emissions from said volume to provide a display of the separated sample.
High heating rate thermal desorption for molecular surface sampling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ovchinnikova, Olga S.; Van Berkel, Gary J.
2016-03-29
A method for analyzing a sample having at least one analyte includes the step of heating the sample at a rate of at least 10.sup.6 K/s to thermally desorb at least one analyte from the sample. The desorbed analyte is collected. The analyte can then be analyzed.
Martins, Angélica Rocha; Talhavini, Márcio; Vieira, Maurício Leite; Zacca, Jorge Jardim; Braga, Jez Willian Batista
2017-08-15
The discrimination of whisky brands and counterfeit identification were performed by UV-Vis spectroscopy combined with partial least squares for discriminant analysis (PLS-DA). In the proposed method all spectra were obtained with no sample preparation. The discrimination models were built with the employment of seven whisky brands: Red Label, Black Label, White Horse, Chivas Regal (12years), Ballantine's Finest, Old Parr and Natu Nobilis. The method was validated with an independent test set of authentic samples belonging to the seven selected brands and another eleven brands not included in the training samples. Furthermore, seventy-three counterfeit samples were also used to validate the method. Results showed correct classification rates for genuine and false samples over 98.6% and 93.1%, respectively, indicating that the method can be helpful for the forensic analysis of whisky samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sampling methods for terrestrial amphibians and reptiles.
Paul Stephen Corn; R. Bruce Bury
1990-01-01
Methods described for sampling amphibians and reptiles in Douglas-fir forests in the Pacific Northwest include pitfall trapping, time-constrained collecting, and surveys of coarse woody debris. The herpetofauna of this region differ in breeding and nonbreeding habitats and vagility, so that no single technique is sufficient for a community study. A combination of...
An investigation on the intra-sample distribution of cotton color by using image analysis
USDA-ARS?s Scientific Manuscript database
The colorimeter principle is widely used to measure cotton color. This method provides the sample’s color grade; but the result does not include information about the color distribution and any variation within the sample. We conducted an investigation that used image analysis method to study the ...
NASA Astrophysics Data System (ADS)
Zhang, Linna; Sun, Meixiu; Wang, Zhennan; Li, Hongxiao; Li, Yingxin; Li, Gang; Lin, Ling
2017-09-01
The inspection and identification of whole blood are crucially significant for import-export ports and inspection and quarantine departments. In our previous research, we proved Near-Infrared diffuse transmitted spectroscopy method was potential for noninvasively identifying three blood species, including macaque, human and mouse, with samples measured in the cuvettes. However, in open sampling cases, inspectors may be endangered by virulence factors in blood samples. In this paper, we explored the noncontact measurement for classification, with blood samples measured in the vacuum blood vessels. Spatially resolved near-infrared spectroscopy was used to improve the prediction accuracy. Results showed that the prediction accuracy of the model built with nine detection points was more than 90% in identification between all five species, including chicken, goat, macaque, pig and rat, far better than the performance of the model built with single-point spectra. The results fully supported the idea that spatially resolved near-infrared spectroscopy method can improve the prediction ability, and demonstrated the feasibility of this method for noncontact blood species identification in practical applications.
40 CFR Appendix A-7 to Part 60 - Test Methods 19 through 25E
Code of Federal Regulations, 2010 CFR
2010-07-01
... equations for Fw if %H and %O include the unavailable hydrogen and oxygen in the form of H2O.) 12.3.2.2Use... during the averaging period. 12.5.2.1Solid Fossil (Including Waste) Fuel/Sampling and Analysis. Note: For... for each gross sample. 12.5.2.2Liquid Fossil Fuel-Sampling and Analysis. See Note under Section 12.5.2...
40 CFR Appendix A-7 to Part 60 - Test Methods 19 through 25E
Code of Federal Regulations, 2012 CFR
2012-07-01
... equations for Fw if %H and %O include the unavailable hydrogen and oxygen in the form of H2O.) 12.3.2.2Use... during the averaging period. 12.5.2.1Solid Fossil (Including Waste) Fuel/Sampling and Analysis. Note: For... basis for each gross sample. 12.5.2.2Liquid Fossil Fuel-Sampling and Analysis. See Note under Section 12...
40 CFR Appendix A-7 to Part 60 - Test Methods 19 through 25E
Code of Federal Regulations, 2013 CFR
2013-07-01
... equations for Fw if %H and %O include the unavailable hydrogen and oxygen in the form of H2O.) 12.3.2.2Use... during the averaging period. 12.5.2.1Solid Fossil (Including Waste) Fuel/Sampling and Analysis. Note: For... basis for each gross sample. 12.5.2.2Liquid Fossil Fuel-Sampling and Analysis. See Note under Section 12...
40 CFR Appendix A-7 to Part 60 - Test Methods 19 through 25E
Code of Federal Regulations, 2011 CFR
2011-07-01
... equations for Fw if %H and %O include the unavailable hydrogen and oxygen in the form of H2O.) 12.3.2.2Use... during the averaging period. 12.5.2.1Solid Fossil (Including Waste) Fuel/Sampling and Analysis. Note: For... for each gross sample. 12.5.2.2Liquid Fossil Fuel-Sampling and Analysis. See Note under Section 12.5.2...
Drummond, A; Rodrigo, A G
2000-12-01
Reconstruction of evolutionary relationships from noncontemporaneous molecular samples provides a new challenge for phylogenetic reconstruction methods. With recent biotechnological advances there has been an increase in molecular sequencing throughput, and the potential to obtain serial samples of sequences from populations, including rapidly evolving pathogens, is fast being realized. A new method called the serial-sample unweighted pair grouping method with arithmetic means (sUPGMA) is presented that reconstructs a genealogy or phylogeny of sequences sampled serially in time using a matrix of pairwise distances. The resulting tree depicts the terminal lineages of each sample ending at a different level consistent with the sample's temporal order. Since sUPGMA is a variant of UPGMA, it will perform best when sequences have evolved at a constant rate (i.e., according to a molecular clock). On simulated data, this new method performs better than standard cluster analysis under a variety of longitudinal sampling strategies. Serial-sample UPGMA is particularly useful for analysis of longitudinal samples of viruses and bacteria, as well as ancient DNA samples, with the minimal requirement that samples of sequences be ordered in time.
Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng
2010-04-15
In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.
Popic, Tony J; Davila, Yvonne C; Wardle, Glenda M
2013-01-01
Methods for sampling ecological assemblages strive to be efficient, repeatable, and representative. Unknowingly, common methods may be limited in terms of revealing species function and so of less value for comparative studies. The global decline in pollination services has stimulated surveys of flower-visiting invertebrates, using pan traps and net sampling. We explore the relative merits of these two methods in terms of species discovery, quantifying abundance, function, and composition, and responses of species to changing floral resources. Using a spatially-nested design we sampled across a 5000 km(2) area of arid grasslands, including 432 hours of net sampling and 1296 pan trap-days, between June 2010 and July 2011. Net sampling yielded 22% more species and 30% higher abundance than pan traps, and better reflected the spatio-temporal variation of floral resources. Species composition differed significantly between methods; from 436 total species, 25% were sampled by both methods, 50% only by nets, and the remaining 25% only by pans. Apart from being less comprehensive, if pan traps do not sample flower-visitors, the link to pollination is questionable. By contrast, net sampling functionally linked species to pollination through behavioural observations of flower-visitation interaction frequency. Netted specimens are also necessary for evidence of pollen transport. Benefits of net-based sampling outweighed minor differences in overall sampling effort. As pan traps and net sampling methods are not equivalent for sampling invertebrate-flower interactions, we recommend net sampling of invertebrate pollinator assemblages, especially if datasets are intended to document declines in pollination and guide measures to retain this important ecosystem service.
Popic, Tony J.; Davila, Yvonne C.; Wardle, Glenda M.
2013-01-01
Methods for sampling ecological assemblages strive to be efficient, repeatable, and representative. Unknowingly, common methods may be limited in terms of revealing species function and so of less value for comparative studies. The global decline in pollination services has stimulated surveys of flower-visiting invertebrates, using pan traps and net sampling. We explore the relative merits of these two methods in terms of species discovery, quantifying abundance, function, and composition, and responses of species to changing floral resources. Using a spatially-nested design we sampled across a 5000 km2 area of arid grasslands, including 432 hours of net sampling and 1296 pan trap-days, between June 2010 and July 2011. Net sampling yielded 22% more species and 30% higher abundance than pan traps, and better reflected the spatio-temporal variation of floral resources. Species composition differed significantly between methods; from 436 total species, 25% were sampled by both methods, 50% only by nets, and the remaining 25% only by pans. Apart from being less comprehensive, if pan traps do not sample flower-visitors, the link to pollination is questionable. By contrast, net sampling functionally linked species to pollination through behavioural observations of flower-visitation interaction frequency. Netted specimens are also necessary for evidence of pollen transport. Benefits of net-based sampling outweighed minor differences in overall sampling effort. As pan traps and net sampling methods are not equivalent for sampling invertebrate-flower interactions, we recommend net sampling of invertebrate pollinator assemblages, especially if datasets are intended to document declines in pollination and guide measures to retain this important ecosystem service. PMID:23799127
Method for measuring recovery of catalytic elements from fuel cells
Shore, Lawrence [Edison, NJ; Matlin, Ramail [Berkeley, NJ
2011-03-08
A method is provided for measuring the concentration of a catalytic clement in a fuel cell powder. The method includes depositing on a porous substrate at least one layer of a powder mixture comprising the fuel cell powder and an internal standard material, ablating a sample of the powder mixture using a laser, and vaporizing the sample using an inductively coupled plasma. A normalized concentration of catalytic element in the sample is determined by quantifying the intensity of a first signal correlated to the amount of catalytic element in the sample, quantifying the intensity of a second signal correlated to the amount of internal standard material in the sample, and using a ratio of the first signal intensity to the second signal intensity to cancel out the effects of sample size.
Evaluation of Respondent-Driven Sampling
McCreesh, Nicky; Frost, Simon; Seeley, Janet; Katongole, Joseph; Tarsh, Matilda Ndagire; Ndunguse, Richard; Jichi, Fatima; Lunel, Natasha L; Maher, Dermot; Johnston, Lisa G; Sonnenberg, Pam; Copas, Andrew J; Hayes, Richard J; White, Richard G
2012-01-01
Background Respondent-driven sampling is a novel variant of link-tracing sampling for estimating the characteristics of hard-to-reach groups, such as HIV prevalence in sex-workers. Despite its use by leading health organizations, the performance of this method in realistic situations is still largely unknown. We evaluated respondent-driven sampling by comparing estimates from a respondent-driven sampling survey with total-population data. Methods Total-population data on age, tribe, religion, socioeconomic status, sexual activity and HIV status were available on a population of 2402 male household-heads from an open cohort in rural Uganda. A respondent-driven sampling (RDS) survey was carried out in this population, employing current methods of sampling (RDS sample) and statistical inference (RDS estimates). Analyses were carried out for the full RDS sample and then repeated for the first 250 recruits (small sample). Results We recruited 927 household-heads. Full and small RDS samples were largely representative of the total population, but both samples under-represented men who were younger, of higher socioeconomic status, and with unknown sexual activity and HIV status. Respondent-driven-sampling statistical-inference methods failed to reduce these biases. Only 31%-37% (depending on method and sample size) of RDS estimates were closer to the true population proportions than the RDS sample proportions. Only 50%-74% of respondent-driven-sampling bootstrap 95% confidence intervals included the population proportion. Conclusions Respondent-driven sampling produced a generally representative sample of this well-connected non-hidden population. However, current respondent-driven-sampling inference methods failed to reduce bias when it occurred. Whether the data required to remove bias and measure precision can be collected in a respondent-driven sampling survey is unresolved. Respondent-driven sampling should be regarded as a (potentially superior) form of convenience-sampling method, and caution is required when interpreting findings based on the sampling method. PMID:22157309
[Research status and prospects of DNA test on difficult specimens].
Dang, Hua-Wei; Mao, Jiong; Wang, Hui; Huang, Jiang-Ping; Bai, Xiao-Gang
2012-02-01
This paper reviews the advances of DNA detection on three types of difficult biological specimens including degraded samples, trace evidences and mixed samples. The source of different samples, processing methods and announcements were analyzed. New methods such as mitochondrial test system, changing the original experimental conditions, low-volume PCR amplification and new technologies such as whole genome amplification techniques, laser capture micro-dissection, and mini-STR technology in recent years are introduced.
Ball assisted device for analytical surface sampling
ElNaggar, Mariam S; Van Berkel, Gary J; Covey, Thomas R
2015-11-03
A system for sampling a surface includes a sampling probe having a housing and a socket, and a rolling sampling sphere within the socket. The housing has a sampling fluid supply conduit and a sampling fluid exhaust conduit. The sampling fluid supply conduit supplies sampling fluid to the sampling sphere. The sampling fluid exhaust conduit has an inlet opening for receiving sampling fluid carried from the surface by the sampling sphere. A surface sampling probe and a method for sampling a surface are also disclosed.
Falcone, Denise; Spee, Pieter; van de Kerkhof, Peter C M; van Erp, Piet E J
2017-10-02
Interleukin-1α (IL-1α) and its receptor antagonist IL-1RA play a pivotal role in skin homeostasis and disease. Although the use of biopsies to sample these cytokines from human skin is widely employed in dermatological practice, knowledge about less invasive, in vivo sampling methods is scarce. The aim of this study was to provide an overview of such methods by systematically reviewing studies in Medline, EMBASE, Web of Science and Cochrane Library using combinations of the terms "IL-1α", IL-1RA", "skin", "human", including all possible synonyms. Quality was assessed using the STrengthening the Reporting of OBservational studies in Epidemiology (STROBE) checklist. The search, performed on 14 October 2016, revealed 10 different sampling methods, with varying degrees of invasiveness and wide application spectrum, including assessment of both normal and diseased skin, from several body sites. The possibility to sample quantifiable amounts of cytokines from human skin with no or minimal discomfort holds promise for linking clinical outcomes to molecular profiles of skin inflammation.
High-temperature strain cell for tomographic imaging
MacDowell, Alastair A.; Nasiatka, James; Haboub, Abdel; Ritchie, Robert O.; Bale, Hrishikesh A.
2015-06-16
This disclosure provides systems, methods, and apparatus related to the high temperature mechanical testing of materials. In one aspect, a method includes providing an apparatus. The apparatus may include a chamber. The chamber may comprise a top portion and a bottom portion, with the top portion and the bottom portion each joined to a window material. A first cooled fixture and a second cooled fixture may be mounted to the chamber and configured to hold the sample in the chamber. A plurality of heating lamps may be mounted to the chamber and positioned to heat the sample. The sample may be placed in the first and the second cooled fixtures. The sample may be heated to a specific temperature using the heating lamps. Radiation may be directed though the window material, the radiation thereafter interacting with the sample and exiting the chamber through the window material.
Carbon storage and sequestration by trees in VIT University campus
NASA Astrophysics Data System (ADS)
Saral, A. Mary; SteffySelcia, S.; Devi, Keerthana
2017-11-01
The present study addresses carbon storage and sequestration by trees grown in VIT University campus, Vellore. Approximately twenty trees were selected from Woodstockarea. The above ground biomass and below ground biomass were calculated. The above ground biomass includes non-destructive anddestructive sampling. The Non-destructive method includes the measurement of height of thetree and diameter of the tree. The height of the tree is calculated using Total Station instrument and diameter is calculated using measuring tape. In the destructive method the weight of samples (leaves) and sub-samples (fruits, flowers) of the tree were considered. To calculate the belowground biomass soil samples are taken and analyzed. The results obtained were used to predict the carbon storage. It was found that out of twenty tree samples Millingtonia hortensis which is commonly known as Cork tree possess maximum carbon storage (14.342kg/tree) and carbon sequestration (52.583kg/tree) respectively.
Brady, Amie M.G.; Bushon, Rebecca N.; Bertke, Erin E.
2009-01-01
Water quality at beaches is monitored for fecal indicator bacteria by traditional, culture-based methods that can take 18 to 24 hours to obtain results. A rapid detection method that provides estimated concentrations of fecal indicator bacteria within 1 hour from the start of sample processing would allow beach managers to post advisories or close the beach when the conditions are actually considered unsafe instead of a day later, when conditions may have changed. A rapid method that couples immunomagnetic separation with adenosine triphosphate detection (IMS/ATP rapid method) was evaluated through monitoring of Escherichia coli (E. coli) at three Lake Erie beaches in Ohio (Edgewater and Villa Angela in Cleveland and Huntington in Bay Village). Beach water samples were collected between 4 and 5 days per week during the recreational seasons (May through September) of 2006 and 2007. Composite samples were created in the lab from two point samples collected at each beach and were shown to be comparable substitutes for analysis of two individual samples. E. coli concentrations in composite samples, as determined by the culture-based method, ranged from 4 to 24,000 colony-forming units per 100 milliliters during this study across all beaches. Turbidity also was measured for each sample and ranged from 0.8 to 260 neophelometric turbidity ratio units. Environmental variables were noted at the time of sampling, including number of birds at the beach and wave height. Rainfall amounts were measured at National Weather Service stations at local airports. Turbidity, rainfall, and wave height were significantly related to the culture-based method results each year and for both years combined at each beach. The number of birds at the beach was significantly related to the culture-based method results only at Edgewater during 2006 and during both years combined. Results of the IMS/ATP method were compared to results of the culture-based method for samples by year for each beach. The IMS/ATP method underwent several changes and refinements during the first year, including changes in reagents and antibodies and alterations to the method protocol. Because of the changes in the method, results from the two years of study could not be combined. Kendall's tau correlation coefficients for relations between the IMS/ATP and culture-based methods were significant except for samples collected during 2006 at Edgewater and for samples collected during 2007 at Villa Angela. Further, relations were stronger for samples collected in 2006 than for those collected in 2007, except at Edgewater where the reverse was observed. The 2007 dataset was examined to identify possible reasons for the observed difference in significance of relations by year. By dividing the 2007 data set into groups as a function of sampling date, relations (Kendall's tau) between methods were observed to be stronger for samples collected earlier in the season than for those collected later in the season. At Edgewater and Villa Angela, there were more birds at the beach at time of sampling later in the season compared to earlier in the season. (The number of birds was not examined at Huntington.) Also, more wet days (when rainfall during the 24 hours prior to sampling was greater than 0.05 inch) were sampled later in the season compared to earlier in the season. Differences in the dominant fecal source may explain the change in the relations between the culture-based and IMS/ATP methods.
IMPROVED METHOD FOR THE STORAGE OF GROUND WATER SAMPLES CONTAINING VOLATILE ORGANIC ANALYTES
The sorption of volatile organic analytes from water samples by the Teflon septum surface used with standard glass 40-ml sample collection vials was investigated. Analytes tested included alkanes, isoalkanes, olefins, cycloalkanes, a cycloalkene, monoaromatics, a polynuclear arom...
Analytical study of comet nucleus samples
NASA Technical Reports Server (NTRS)
Albee, A. L.
1989-01-01
Analytical procedures for studying and handling frozen (130 K) core samples of comet nuclei are discussed. These methods include neutron activation analysis, x ray fluorescent analysis and high resolution mass spectroscopy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
The bibliography contains citations concerning chemiluminescence assays. The citations include sample system design, sample collection, measurement techniques, and sensitivity of the instrumentation. Applications in high altitude air pollution studies are emphasized. (Contains 50-250 citations and includes a subject term index and title list.) (Copyright NERAC, Inc. 1995)
Ristić-Djurović, Jasna L; Ćirković, Saša; Mladenović, Pavle; Romčević, Nebojša; Trbovich, Alexander M
2018-04-01
A rough estimate indicated that use of samples of size not larger than ten is not uncommon in biomedical research and that many of such studies are limited to strong effects due to sample sizes smaller than six. For data collected from biomedical experiments it is also often unknown if mathematical requirements incorporated in the sample comparison methods are satisfied. Computer simulated experiments were used to examine performance of methods for qualitative sample comparison and its dependence on the effectiveness of exposure, effect intensity, distribution of studied parameter values in the population, and sample size. The Type I and Type II errors, their average, as well as the maximal errors were considered. The sample size 9 and the t-test method with p = 5% ensured error smaller than 5% even for weak effects. For sample sizes 6-8 the same method enabled detection of weak effects with errors smaller than 20%. If the sample sizes were 3-5, weak effects could not be detected with an acceptable error; however, the smallest maximal error in the most general case that includes weak effects is granted by the standard error of the mean method. The increase of sample size from 5 to 9 led to seven times more accurate detection of weak effects. Strong effects were detected regardless of the sample size and method used. The minimal recommended sample size for biomedical experiments is 9. Use of smaller sizes and the method of their comparison should be justified by the objective of the experiment. Copyright © 2018 Elsevier B.V. All rights reserved.
Methods for collection and analysis of aquatic biological and microbiological samples
Greeson, Phillip E.; Ehlke, T.A.; Irwin, G.A.; Lium, B.W.; Slack, K.V.
1977-01-01
Chapter A4 contains methods used by the U.S. Geological Survey to collect, preserve, and analyze waters to determine their biological and microbiological properties. Part 1 discusses biological sampling and sampling statistics. The statistical procedures are accompanied by examples. Part 2 consists of detailed descriptions of more than 45 individual methods, including those for bacteria, phytoplankton, zooplankton, seston, periphyton, macrophytes, benthic invertebrates, fish and other vertebrates, cellular contents, productivity, and bioassays. Each method is summarized, and the application, interferences, apparatus, reagents, collection, analysis, calculations, reporting of results, precision and references are given. Part 3 consists of a glossary. Part 4 is a list of taxonomic references.
The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis
Carranza-Rodríguez, Cristina; Pérez-Arellano, José Luis; Vicente, Belén; López-Abán, Julio; Muro, Antonio
2015-01-01
Background Urogenital schistosomiasis due to Schistosoma haematobium is a serious underestimated public health problem affecting 112 million people - particularly in sub-Saharan Africa. Microscopic examination of urine samples to detect parasite eggs still remains as definitive diagnosis. This work was focussed on developing a novel loop-mediated isothermal amplification (LAMP) assay for detection of S. haematobium DNA in human urine samples as a high-throughput, simple, accurate and affordable diagnostic tool to use in diagnosis of urogenital schistosomiasis. Methodology/Principal Findings A LAMP assay targeting a species specific sequence of S. haematobium ribosomal intergenic spacer was designed. The effectiveness of our LAMP was assessed in a number of patients´ urine samples with microscopy confirmed S. haematobium infection. For potentially large-scale application in field conditions, different DNA extraction methods, including a commercial kit, a modified NaOH extraction method and a rapid heating method were tested using small volumes of urine fractions (whole urine, supernatants and pellets). The heating of pellets from clinical samples was the most efficient method to obtain good-quality DNA detectable by LAMP. The detection limit of our LAMP was 1 fg/µL of S. haematobium DNA in urine samples. When testing all patients´ urine samples included in our study, diagnostic parameters for sensitivity and specificity were calculated for LAMP assay, 100% sensitivity (95% CI: 81.32%-100%) and 86.67% specificity (95% CI: 75.40%-94.05%), and also for microscopy detection of eggs in urine samples, 69.23% sensitivity (95% CI: 48.21% -85.63%) and 100% specificity (95% CI: 93.08%-100%). Conclusions/Significance We have developed and evaluated, for the first time, a LAMP assay for detection of S. haematobium DNA in heated pellets from patients´ urine samples using no complicated requirement procedure for DNA extraction. The procedure has been named the Rapid-Heat LAMPellet method and has the potential to be developed further as a field diagnostic tool for use in urogenital schistosomiasis-endemic areas. PMID:26230990
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
This report provides a detailed summary of the activities carried out to sample groundwater at Waste Area Grouping (WAG) 6. The analytical results for samples collected during Phase 1, Activity 2 of the WAG 6 Resource Conservation and Recovery Act Facility Investigation (RFI) are also presented. In addition, analytical results for Phase 1, activity sampling events for which data were not previously reported are included in this TM. A summary of the groundwater sampling activities of WAG 6, to date, are given in the Introduction. The Methodology section describes the sampling procedures and analytical parameters. Six attachments are included. Attachmentsmore » 1 and 2 provide analytical results for selected RFI groundwater samples and ORNL sampling event. Attachment 3 provides a summary of the contaminants detected in each well sampled for all sampling events conducted at WAG 6. Bechtel National Inc. (BNI)/IT Corporation Contract Laboratory (IT) RFI analytical methods and detection limits are given in Attachment 4. Attachment 5 provides the Oak Ridge National Laboratory (ORNL)/Analytical Chemistry Division (ACD) analytical methods and detection limits and Resource Conservation and Recovery Act (RCRA) quarterly compliance monitoring (1988--1989). Attachment 6 provides ORNL/ACD groundwater analytical methods and detection limits (for the 1990 RCRA semi-annual compliance monitoring).« less
NASA Astrophysics Data System (ADS)
Sung, S.; Kim, H. G.; Lee, D. K.; Park, J. H.; Mo, Y.; Kil, S.; Park, C.
2016-12-01
The impact of climate change has been observed throughout the globe. The ecosystem experiences rapid changes such as vegetation shift, species extinction. In these context, Species Distribution Model (SDM) is one of the popular method to project impact of climate change on the ecosystem. SDM basically based on the niche of certain species with means to run SDM present point data is essential to find biological niche of species. To run SDM for plants, there are certain considerations on the characteristics of vegetation. Normally, to make vegetation data in large area, remote sensing techniques are used. In other words, the exact point of presence data has high uncertainties as we select presence data set from polygons and raster dataset. Thus, sampling methods for modeling vegetation presence data should be carefully selected. In this study, we used three different sampling methods for selection of presence data of vegetation: Random sampling, Stratified sampling and Site index based sampling. We used one of the R package BIOMOD2 to access uncertainty from modeling. At the same time, we included BioCLIM variables and other environmental variables as input data. As a result of this study, despite of differences among the 10 SDMs, the sampling methods showed differences in ROC values, random sampling methods showed the lowest ROC value while site index based sampling methods showed the highest ROC value. As a result of this study the uncertainties from presence data sampling methods and SDM can be quantified.
Meghdadi, Hossein; Khosravi, Azar D.; Ghadiri, Ata A.; Sina, Amir H.; Alami, Ameneh
2015-01-01
Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39–31.27% for rpoB-PCR, 36.44–60.83% for IS6110- PCR, 75.29–92.93% for nested-rpoB PCR, and 87.98–99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15–100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results. PMID:26191059
Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh
2015-01-01
Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15-100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results.
Nelson, Jennifer Clark; Marsh, Tracey; Lumley, Thomas; Larson, Eric B; Jackson, Lisa A; Jackson, Michael L
2013-08-01
Estimates of treatment effectiveness in epidemiologic studies using large observational health care databases may be biased owing to inaccurate or incomplete information on important confounders. Study methods that collect and incorporate more comprehensive confounder data on a validation cohort may reduce confounding bias. We applied two such methods, namely imputation and reweighting, to Group Health administrative data (full sample) supplemented by more detailed confounder data from the Adult Changes in Thought study (validation sample). We used influenza vaccination effectiveness (with an unexposed comparator group) as an example and evaluated each method's ability to reduce bias using the control time period before influenza circulation. Both methods reduced, but did not completely eliminate, the bias compared with traditional effectiveness estimates that do not use the validation sample confounders. Although these results support the use of validation sampling methods to improve the accuracy of comparative effectiveness findings from health care database studies, they also illustrate that the success of such methods depends on many factors, including the ability to measure important confounders in a representative and large enough validation sample, the comparability of the full sample and validation sample, and the accuracy with which the data can be imputed or reweighted using the additional validation sample information. Copyright © 2013 Elsevier Inc. All rights reserved.
Azzouz, Abdelmonaim; Jurado-Sánchez, Beatriz; Souhail, Badredine; Ballesteros, Evaristo
2011-05-11
This paper reports a systematic approach to the development of a method that combines continuous solid-phase extraction and gas chromatography-mass spectrometry for the simultaneous determination of 20 pharmacologically active substances including antibacterials (chloramphenicol, florfenicol, pyrimethamine, thiamphenicol), nonsteroideal anti-inflammatories (diclofenac, flunixin, ibuprofen, ketoprofen, naproxen, mefenamic acid, niflumic acid, phenylbutazone), antiseptic (triclosan), antiepileptic (carbamazepine), lipid regulator (clofibric acid), β-blockers (metoprolol, propranolol), and hormones (17α-ethinylestradiol, estrone, 17β-estradiol) in milk samples. The sample preparation procedure involves deproteination of the milk, followed by sample enrichment and cleanup by continuous solid-phase extraction. The proposed method provides a linear response over the range of 0.6-5000 ng/kg and features limits of detection from 0.2 to 1.2 ng/kg depending on the particular analyte. The method was successfully applied to the determination of pharmacologically active substance residues in food samples including whole, raw, half-skim, skim, and powdered milk from different sources (cow, goat, and human breast).
Sparse feature learning for instrument identification: Effects of sampling and pooling methods.
Han, Yoonchang; Lee, Subin; Nam, Juhan; Lee, Kyogu
2016-05-01
Feature learning for music applications has recently received considerable attention from many researchers. This paper reports on the sparse feature learning algorithm for musical instrument identification, and in particular, focuses on the effects of the frame sampling techniques for dictionary learning and the pooling methods for feature aggregation. To this end, two frame sampling techniques are examined that are fixed and proportional random sampling. Furthermore, the effect of using onset frame was analyzed for both of proposed sampling methods. Regarding summarization of the feature activation, a standard deviation pooling method is used and compared with the commonly used max- and average-pooling techniques. Using more than 47 000 recordings of 24 instruments from various performers, playing styles, and dynamics, a number of tuning parameters are experimented including the analysis frame size, the dictionary size, and the type of frequency scaling as well as the different sampling and pooling methods. The results show that the combination of proportional sampling and standard deviation pooling achieve the best overall performance of 95.62% while the optimal parameter set varies among the instrument classes.
Power calculation for overall hypothesis testing with high-dimensional commensurate outcomes.
Chi, Yueh-Yun; Gribbin, Matthew J; Johnson, Jacqueline L; Muller, Keith E
2014-02-28
The complexity of system biology means that any metabolic, genetic, or proteomic pathway typically includes so many components (e.g., molecules) that statistical methods specialized for overall testing of high-dimensional and commensurate outcomes are required. While many overall tests have been proposed, very few have power and sample size methods. We develop accurate power and sample size methods and software to facilitate study planning for high-dimensional pathway analysis. With an account of any complex correlation structure between high-dimensional outcomes, the new methods allow power calculation even when the sample size is less than the number of variables. We derive the exact (finite-sample) and approximate non-null distributions of the 'univariate' approach to repeated measures test statistic, as well as power-equivalent scenarios useful to generalize our numerical evaluations. Extensive simulations of group comparisons support the accuracy of the approximations even when the ratio of number of variables to sample size is large. We derive a minimum set of constants and parameters sufficient and practical for power calculation. Using the new methods and specifying the minimum set to determine power for a study of metabolic consequences of vitamin B6 deficiency helps illustrate the practical value of the new results. Free software implementing the power and sample size methods applies to a wide range of designs, including one group pre-intervention and post-intervention comparisons, multiple parallel group comparisons with one-way or factorial designs, and the adjustment and evaluation of covariate effects. Copyright © 2013 John Wiley & Sons, Ltd.
UPLC-MS/MS determination of ptaquiloside and pterosin B in preserved natural water.
Clauson-Kaas, Frederik; Hansen, Hans Christian Bruun; Strobel, Bjarne W
2016-11-01
The naturally occurring carcinogen ptaquiloside and its degradation product pterosin B are found in water leaching from bracken stands. The objective of this work is to present a new sample preservation method and a fast UPLC-MS/MS method for quantification of ptaquiloside and pterosin B in environmental water samples, employing a novel internal standard. A faster, reliable, and efficient method was developed for isolation of high purity ptaquiloside and pterosin B from plant material for use as analytical standards, with purity verified by 1 H-NMR. The chemical analysis was performed by cleanup and preconcentration of samples with solid phase extraction, before analyte quantification with UPLC-MS/MS. By including gradient elution and optimizing the liquid chromatography mobile phase buffer system, a total run cycle of 5 min was achieved, with method detection limits, including preconcentration, of 8 and 4 ng/L for ptaquiloside and pterosin B, respectively. The use of loganin as internal standard improved repeatability of the determination of both analytes, though it could not be employed for sample preparation. Buffering raw water samples in situ with ammonium acetate to pH ∼5.5 decisively increased sample integrity at realistic transportation and storing conditions prior to extraction. Groundwater samples collected in November 2015 at the shallow water table below a Danish bracken stand were preserved and analyzed using the above methods, and PTA concentrations of 3.8 ± 0.24 μg/L (±sd, n = 3) were found, much higher than previously reported. Graphical abstract Workflow overview of ptaquiloside determination.
An inexpensive and portable microvolumeter for rapid evaluation of biological samples.
Douglass, John K; Wcislo, William T
2010-08-01
We describe an improved microvolumeter (MVM) for rapidly measuring volumes of small biological samples, including live zooplankton, embryos, and small animals and organs. Portability and low cost make this instrument suitable for widespread use, including at remote field sites. Beginning with Archimedes' principle, which states that immersing an arbitrarily shaped sample in a fluid-filled container displaces an equivalent volume, we identified procedures that maximize measurement accuracy and repeatability across a broad range of absolute volumes. Crucial steps include matching the overall configuration to the size of the sample, using reflected light to monitor fluid levels precisely, and accounting for evaporation during measurements. The resulting precision is at least 100 times higher than in previous displacement-based methods. Volumes are obtained much faster than by traditional histological or confocal methods and without shrinkage artifacts due to fixation or dehydration. Calibrations using volume standards confirmed accurate measurements of volumes as small as 0.06 microL. We validated the feasibility of evaluating soft-tissue samples by comparing volumes of freshly dissected ant brains measured with the MVM and by confocal reconstruction.
Ramírez, Juan Carlos; Cura, Carolina Inés; Moreira, Otacilio da Cruz; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Guedes, Paulo Marcos da Matta; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Galvão, Lúcia Maria da Cunha; da Câmara, Antonia Cláudia Jácome; Espinoza, Bertha; de Noya, Belkisyole Alarcón; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G.
2015-01-01
An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. PMID:26320872
Laser excited confocal microscope fluorescence scanner and method
Mathies, R.A.; Peck, K.
1992-02-25
A fluorescent scanner is designed for scanning the fluorescence from a fluorescence labeled separated sample on a sample carrier. The scanner includes a confocal microscope for illuminating a predetermined volume of the sample carrier and/or receiving and processing fluorescence emissions from the volume to provide a display of the separated sample. 8 figs.
Determining the Population Size of Pond Phytoplankton.
ERIC Educational Resources Information Center
Hummer, Paul J.
1980-01-01
Discusses methods for determining the population size of pond phytoplankton, including water sampling techniques, laboratory analysis of samples, and additional studies worthy of investigation in class or as individual projects. (CS)
Verma, Dave K; Shaw, Don S; Shaw, M Lorraine; Julian, Jim A; McCollin, Shari-Ann; des Tombe, Karen
2006-02-01
This article summarizes an assessment of air sampling and analytical methods for both oil and water-based metalworking fluids (MWFs). Three hundred and seventy-four long-term area and personal airborne samples were collected at four plants using total (closed-face) aerosol samplers and thoracic samplers. A direct-reading device (DustTrak) was also used. The processes sampled include steel tube making, automotive component manufacturing, and small part manufacturing in a machine shop. The American Society for Testing and Materials (ASTM) Method PS42-97 of analysis was evaluated in the laboratory. This evaluation included sample recovery, determination of detection limits, and stability of samples during storage. Results of the laboratory validation showed (a) the sample recovery to be about 87%, (b) the detection limit to be 35 microg, and (c) sample stability during storage at room temperature to decline rapidly within a few days. To minimize sample loss, the samples should be stored in a freezer and analyzed within a week. The ASTM method should be the preferred method for assessing metalworking fluids (MWFs). The ratio of thoracic aerosol to total aerosol ranged from 0.6 to 0.7. A similar relationship was found between the thoracic extractable aerosol and total extractable aerosol. The DustTrak, with 10-microm sampling head, was useful in pinpointing the areas of potential exposure. MWF exposure at the four plants ranged from 0.04 to 3.84 mg/m3 with the geometric mean ranging between 0.22 to 0.59 mg/m3. Based on this data and the assumption of log normality, MWF exposures are expected to exceed the National Institute for Occupational Safety and Health recommended exposure limit of 0.5 mg/m3 as total mass and 0.4 mg/m3 as thoracic mass about 38% of the time. In addition to controlling airborne MWF exposure, full protection of workers would require the institution of programs for fluid management and dermal exposure prevention.
Zhang, Lida; Sun, Da-Wen; Zhang, Zhihang
2017-03-24
Moisture sorption isotherm is commonly determined by saturated salt slurry method, which has defects of long time cost, cumbersome labor, and microbial deterioration of samples. Thus, a novel method, a w measurement (AWM) method, has been developed to overcome these drawbacks. Fundamentals and applications of this fast method have been introduced with respects to its typical operational steps, a variety of equipment set-ups and applied samples. The resultant rapidness and reliability have been evaluated by comparing with conventional methods. This review also discussed factors impairing measurement precision and accuracy, including inappropriate choice of predryingwetting techniques and unachieved moisture uniformity in samples due to inadequate time. This analysis and corresponding suggestions can facilitate improved AWM method with more satisfying accuracy and time cost.
Comprehensive comparative analysis of 5'-end RNA-sequencing methods.
Adiconis, Xian; Haber, Adam L; Simmons, Sean K; Levy Moonshine, Ami; Ji, Zhe; Busby, Michele A; Shi, Xi; Jacques, Justin; Lancaster, Madeline A; Pan, Jen Q; Regev, Aviv; Levin, Joshua Z
2018-06-04
Specialized RNA-seq methods are required to identify the 5' ends of transcripts, which are critical for studies of gene regulation, but these methods have not been systematically benchmarked. We directly compared six such methods, including the performance of five methods on a single human cellular RNA sample and a new spike-in RNA assay that helps circumvent challenges resulting from uncertainties in annotation and RNA processing. We found that the 'cap analysis of gene expression' (CAGE) method performed best for mRNA and that most of its unannotated peaks were supported by evidence from other genomic methods. We applied CAGE to eight brain-related samples and determined sample-specific transcription start site (TSS) usage, as well as a transcriptome-wide shift in TSS usage between fetal and adult brain.
[Comparison of the Conventional Centrifuged and Filtrated Preparations in Urine Cytology].
Sekita, Nobuyuki; Shimosakai, Hirofumi; Nishikawa, Rika; Sato, Hiroaki; Kouno, Hiroyoshi; Fujimura, Masaaki; Mikami, Kazuo
2016-03-01
The urine cytology test is one of the most important tools for the diagnosis of malignant urinary tract tumors. This test is also of great value for predicting malignancy. However, the sensitivity of this test is not high enough to screen for malignant cells. In our laboratory, we were able to attain a high sensitivity of urine cytology tests after changing the preparation method of urine samples. The differences in the cytodiagnosis between the two methods are discussed here. From January 2012 to June 2013, 2,031 urine samples were prepared using the conventional centrifuge method (C method) ; and from September 2013 to March 2015, 2,453 urine samples were prepared using the filtration method (F method) for the cytology test. When the samples included in category 4 or 5, were defined as cytological positive, the sensitivities of this test with samples prepared using the F method were significantly high compared with samples prepared using the C method (72% vs 28%, p<0.001). The number of cells on the glass slides prepared by the F method was significantly higher than that of the samples prepared by the C method (p<0.001). After introduction of the F method, the number of f alse negative cases was decreased in the urine cytology test because a larger number of cells was seen and easily detected as atypical or malignant epithelial cells. Therefore, this method has a higher sensitivity than the conventional C method as the sensitivity of urine cytology tests relies partially on the number of cells visualized in the prepared samples.
Dobhal, S; Zhang, G; Rohla, C; Smith, M W; Ma, L M
2014-10-01
PCR is widely used in the routine detection of foodborne human pathogens; however, challenges remain in overcoming PCR inhibitors present in some sample matrices. The objective of this study was to develop a simple, sensitive, cost-effective and rapid method for processing large numbers of environmental and pecan samples for Salmonella detection. This study was also aimed at validation of a new protocol for the detection of Salmonella from in-shell pecans. Different DNA template preparation methods, including direct boiling, prespin, multiple washing and commercial DNA extraction kits, were evaluated with pure cultures of Salmonella Typhimurium and with enriched soil, cattle feces and in-shell pecan each spiked individually with Salmonella Typhimurium. PCR detection of Salmonella was conducted using invA and 16S rRNA gene (internal amplification control) specific primers. The effect of amplification facilitators, including bovine serum albumin (BSA), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) and gelatin on PCR sensitivity, was also evaluated. Conducting a prespin of sample matrices in combination with the addition of 0·4% (w/v) BSA and 1% (w/v) PVP in PCR mix was the simplest, most rapid, cost-effective and sensitive method for PCR detection of Salmonella, with up to 40 CFU Salmonella per reaction detectable in the presence of over 10(9 ) CFU ml(-1) of background micro-organisms from enriched feces soil or pecan samples. The developed method is rapid, cost-effective and sensitive for detection of Salmonella from different matrices. This study provides a method with broad applicability for PCR detection of Salmonella in complex sample matrices. This method has a potential for its application in different research arenas and diagnostic laboratories. © 2014 The Society for Applied Microbiology.
Wohlsen, T; Bates, J; Vesey, G; Robinson, W A; Katouli, M
2006-04-01
To use BioBall cultures as a precise reference standard to evaluate methods for enumeration of Escherichia coli and other coliform bacteria in water samples. Eight methods were evaluated including membrane filtration, standard plate count (pour and spread plate methods), defined substrate technology methods (Colilert and Colisure), the most probable number method and the Petrifilm disposable plate method. Escherichia coli and Enterobacter aerogenes BioBall cultures containing 30 organisms each were used. All tests were performed using 10 replicates. The mean recovery of both bacteria varied with the different methods employed. The best and most consistent results were obtained with Petrifilm and the pour plate method. Other methods either yielded a low recovery or showed significantly high variability between replicates. The BioBall is a very suitable quality control tool for evaluating the efficiency of methods for bacterial enumeration in water samples.
Predicting Word Maturity from Frequency and Semantic Diversity: A Computational Study
ERIC Educational Resources Information Center
Jorge-Botana, Guillermo; Olmos, Ricardo; Sanjosé, Vicente
2017-01-01
Semantic word representation changes over different ages of childhood until it reaches its adult form. One method to formally model this change is the word maturity paradigm. This method uses a text sample for each age, including adult age, and transforms the samples into a semantic space by means of Latent Semantic Analysis. The representation of…
US EPA SW-846 methods have typically relied on dual column gas chromatography coupled with electron capture detection (GC-ECD) for analysis of low concentrations of organochlorine pesticides, including toxaphene, in environmental samples. Toxaphene is one of the most widely appl...
Rapid method to determine 226Ra in steel samples
Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; ...
2017-09-22
The rapid measurement of 226Ra in steel samples is very important in the event of a radiological emergency. 226Ra (T 1/2 = 1600 y) is a natural radionuclide present in the environment and a highly toxic alpha-emitter. Due to its long life and tendency to concentrate in bones, 226Ra ingestion or inhalation can lead to significant committed dose to individuals. A new method for the determination of 226Ra in steel samples has been developed at the Savannah River Environmental Laboratory. The new method employs a rugged acid digestion method that includes hydrofluoric acid, followed by a single precipitation step tomore » rapidly preconcentrate the radium and remove most of the dissolved steel sample matrix. Radium is then separated using a combination of cation exchange and extraction chromatography, and 226Ra is measured by alpha spectrometry. This approach has a sample preparation time of ~ 8 h for steel samples, has a very high tracer yield (> 88%), and removes interferences effectively. A 133Ba yield tracer is used so that samples can be counted immediately following the separation method, avoiding lengthy ingrowth times that are required in other methods.« less
Rapid method to determine 226Ra in steel samples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.
The rapid measurement of 226Ra in steel samples is very important in the event of a radiological emergency. 226Ra (T 1/2 = 1600 y) is a natural radionuclide present in the environment and a highly toxic alpha-emitter. Due to its long life and tendency to concentrate in bones, 226Ra ingestion or inhalation can lead to significant committed dose to individuals. A new method for the determination of 226Ra in steel samples has been developed at the Savannah River Environmental Laboratory. The new method employs a rugged acid digestion method that includes hydrofluoric acid, followed by a single precipitation step tomore » rapidly preconcentrate the radium and remove most of the dissolved steel sample matrix. Radium is then separated using a combination of cation exchange and extraction chromatography, and 226Ra is measured by alpha spectrometry. This approach has a sample preparation time of ~ 8 h for steel samples, has a very high tracer yield (> 88%), and removes interferences effectively. A 133Ba yield tracer is used so that samples can be counted immediately following the separation method, avoiding lengthy ingrowth times that are required in other methods.« less
Paar, Jack; Doolittle, Mark M; Varma, Manju; Siefring, Shawn; Oshima, Kevin; Haugland, Richard A
2015-05-01
A method, incorporating recently improved reverse transcriptase-PCR primer/probe assays and including controls for detecting interferences in RNA recovery and analysis, was developed for the direct, culture-independent detection of genetic markers from FRNA coliphage genogroups I, II & IV in water samples. Results were obtained from an initial evaluation of the performance of this method in analyses of waste water, ambient surface water and stormwater drain and outfall samples from predominantly urban locations. The evaluation also included a comparison of the occurrence of the FRNA genetic markers with genetic markers from general and human-related bacterial fecal indicators determined by current or pending EPA-validated qPCR methods. Strong associations were observed between the occurrence of the putatively human related FRNA genogroup II marker and the densities of the bacterial markers in the stormwater drain and outfall samples. However fewer samples were positive for FRNA coliphage compared to either the general bacterial fecal indicator or the human-related bacterial fecal indicator markers particularly for ambient water samples. Together, these methods show promise as complementary tools for the identification of contaminated storm water drainage systems as well as the determination of human and non-human sources of contamination. Published by Elsevier B.V.
Performing skin microbiome research: A method to the madness
Kong, Heidi H.; Andersson, Björn; Clavel, Thomas; Common, John E.; Jackson, Scott A.; Olson, Nathan D.; Segre, Julia A.; Traidl-Hoffmann, Claudia
2017-01-01
Growing interest in microbial contributions to human health and disease has increasingly led investigators to examine the microbiome in both healthy skin and cutaneous disorders, including acne, psoriasis and atopic dermatitis. The need for common language, effective study design, and validated methods are critical for high-quality, standardized research. Features, unique to skin, pose particular challenges when conducting microbiome research. This review discusses microbiome research standards and highlights important factors to consider, including clinical study design, skin sampling, sample processing, DNA sequencing, control inclusion, and data analysis. PMID:28063650
Clark, Don T.; Erickson, Eugene E.; Casper, William L.; Everett, David M.; Hubbell, Joel M.; Sisson, James B.
2005-09-06
A suction lysimeter for sampling subsurface liquids includes a lysimeter casing having a drive portion, a reservoir portion, and a tip portion, the tip portion including a membrane through which subsurface liquids may be sampled; a fluid conduit coupled in fluid flowing relation relative to the membrane, and which in operation facilitates the delivery of the sampled subsurface liquids from the membrane to the reservoir portion; and a plurality of tubes coupled in fluid flowing relation relative to the reservoir portion, the tubes in operation facilitating delivery of the sampled subsurface liquids from the reservoir portion for testing. A method of sampling subsurface liquids comprises using this lysimeter.
Automated MALDI Matrix Coating System for Multiple Tissue Samples for Imaging Mass Spectrometry
NASA Astrophysics Data System (ADS)
Mounfield, William P.; Garrett, Timothy J.
2012-03-01
Uniform matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is key for reproducible analyte ion signals. Current methods often result in nonhomogenous matrix deposition, and take time and effort to produce acceptable ion signals. Here we describe a fully-automated method for matrix deposition using an enclosed spray chamber and spray nozzle for matrix solution delivery. A commercial air-atomizing spray nozzle was modified and combined with solenoid controlled valves and a Programmable Logic Controller (PLC) to control and deliver the matrix solution. A spray chamber was employed to contain the nozzle, sample, and atomized matrix solution stream, and to prevent any interference from outside conditions as well as allow complete control of the sample environment. A gravity cup was filled with MALDI matrix solutions, including DHB in chloroform/methanol (50:50) at concentrations up to 60 mg/mL. Various samples (including rat brain tissue sections) were prepared using two deposition methods (spray chamber, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed a uniform coating of matrix crystals across the sample. Overall, the mass spectral images gathered from tissues coated using the spray chamber system were of better quality and more reproducible than from tissue specimens prepared by the inkjet deposition method.
Automated MALDI matrix coating system for multiple tissue samples for imaging mass spectrometry.
Mounfield, William P; Garrett, Timothy J
2012-03-01
Uniform matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is key for reproducible analyte ion signals. Current methods often result in nonhomogenous matrix deposition, and take time and effort to produce acceptable ion signals. Here we describe a fully-automated method for matrix deposition using an enclosed spray chamber and spray nozzle for matrix solution delivery. A commercial air-atomizing spray nozzle was modified and combined with solenoid controlled valves and a Programmable Logic Controller (PLC) to control and deliver the matrix solution. A spray chamber was employed to contain the nozzle, sample, and atomized matrix solution stream, and to prevent any interference from outside conditions as well as allow complete control of the sample environment. A gravity cup was filled with MALDI matrix solutions, including DHB in chloroform/methanol (50:50) at concentrations up to 60 mg/mL. Various samples (including rat brain tissue sections) were prepared using two deposition methods (spray chamber, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed a uniform coating of matrix crystals across the sample. Overall, the mass spectral images gathered from tissues coated using the spray chamber system were of better quality and more reproducible than from tissue specimens prepared by the inkjet deposition method.
Occurrence of invertebrates at 38 stream sites in the Mississippi Embayment study unit, 1996-99
Caskey, Brian J.; Justus, B.G.; Zappia, Humbert
2002-01-01
A total of 88 invertebrate species and 178 genera representing 59 families, 8 orders, 6 classes, and 3 phyla was identified at 38 stream sites in the Mississippi Embayment Study Unit from 1996 through 1999 as part of the National Water-Quality Assessment Program. Sites were selected based on land use within the drainage basins and the availability of long-term streamflow data. Invertebrates were sampled as part of an overall sampling design to provide information related to the status and trends in water quality in the Mississippi Embayment Study Unit, which includes parts of Arkansas, Kentucky, Louisiana, Mississippi, Missouri, and Tennessee. Invertebrate sampling and processing was conducted using nationally standardized techniques developed for the National Water-Quality Assessment Program. These techniques included both a semi-quantitative method, which targeted habitats where invertebrate diversity is expected to be highest, and a qualitative multihabitat method, which samples all available habitat types possible within a sampling reach. All invertebrate samples were shipped to the USGS National Water-Quality Laboratory (NWQL) where they were processed. Of the 365 taxa identified, 156 were identified with the semi-quantitative method that involved sampling a known quantity of what was expected to be the richest habitat, woody debris. The qualitative method, which involved sampling all available habitats, identified 345 taxa The number of organisms identified in the semi-quantitative samples ranged from 74 to 3,295, whereas the number of taxa identified ranged from 9 to 54. The number of organisms identified in the qualitative samples ranged from 42 to 29,634, whereas the number of taxa ranged from 18 to 81. From all the organisms identified, chironomid taxa were the most frequently identified, and plecopteran taxa were among the least frequently identified.
Ho, Steven Sai Hang; Yu, Jian Zhen
2004-02-01
The standard method for the determination of gaseous carbonyls is to collect carbonyls onto 2,4-dinitrophenyl hydrazine (DNPH) coated solid sorbent followed by solvent extraction of the solid sorbent and analysis of the derivatives using high-pressure liquid chromatography (HPLC). This paper describes a newly developed approach that involves collection of the carbonyls onto pentafluorophenyl hydrazine (PFPH) coated solid sorbents followed by thermal desorption and gas chromatographic (GC) analysis of the PFPH derivatives with mass spectrometric (MS) detection. Sampling tubes loaded with 510 nmol of PFPH on Tenax sorbent effectively collect gaseous carbonyls, including formaldehyde, acetaldehyde, propanal, butanal, heptanal, octanal, acrolein, 2-furfural, benzaldehyde, p-tolualdehyde, glyoxal, and methylglyoxal, at a flow rate of at least up to 100 mL/min. All of the tested carbonyls are shown to have method detection limits (MDLs) of subnanomoles per sampling tube, corresponding to air concentrations of <0.3 ppbv for a sampled volume of 24 L. These limits are 2-12 times lower than those that can be obtained using the DNPH/HPLC method. The improvement of MDLs is especially pronounced for carbonyls larger than formaldehyde and acetaldehyde. The PFPH/GC method also offers better peak separation and more sensitive and specific detection through the use of MS detection. Comparison studies on ambient samples and kitchen exhaust samples have demonstrated that the two methods do not yield systematic differences in concentrations of the carbonyls that are above their respective MDLs in both methods, including formaldehyde, acetaldehyde, acrolein, and butanal. The lower MDLs afforded by the PFPH/ GC method also enable the determination of a few more carbonyls in both applications.
Turner, Terry D.; Beller, Laurence S.; Clark, Michael L.; Klingler, Kerry M.
1997-01-01
A method of processing a test sample to concentrate an analyte in the sample from a solvent in the sample includes: a) boiling the test sample containing the analyte and solvent in a boiling chamber to a temperature greater than or equal to the solvent boiling temperature and less than the analyte boiling temperature to form a rising sample vapor mixture; b) passing the sample vapor mixture from the boiling chamber to an elongated primary separation tube, the separation tube having internal sidewalls and a longitudinal axis, the longitudinal axis being angled between vertical and horizontal and thus having an upper region and a lower region; c) collecting the physically transported liquid analyte on the internal sidewalls of the separation tube; and d) flowing the collected analyte along the angled internal sidewalls of the separation tube to and pass the separation tube lower region. The invention also includes passing a turbulence inducing wave through a vapor mixture to separate physically transported liquid second material from vaporized first material. Apparatus are also disclosed for effecting separations. Further disclosed is a fluidically powered liquid test sample withdrawal apparatus for withdrawing a liquid test sample from a test sample container and for cleaning the test sample container.
Turner, T.D.; Beller, L.S.; Clark, M.L.; Klingler, K.M.
1997-10-14
A method of processing a test sample to concentrate an analyte in the sample from a solvent in the sample includes: (a) boiling the test sample containing the analyte and solvent in a boiling chamber to a temperature greater than or equal to the solvent boiling temperature and less than the analyte boiling temperature to form a rising sample vapor mixture; (b) passing the sample vapor mixture from the boiling chamber to an elongated primary separation tube, the separation tube having internal sidewalls and a longitudinal axis, the longitudinal axis being angled between vertical and horizontal and thus having an upper region and a lower region; (c) collecting the physically transported liquid analyte on the internal sidewalls of the separation tube; and (d) flowing the collected analyte along the angled internal sidewalls of the separation tube to and pass the separation tube lower region. The invention also includes passing a turbulence inducing wave through a vapor mixture to separate physically transported liquid second material from vaporized first material. Apparatus is also disclosed for effecting separations. Further disclosed is a fluidically powered liquid test sample withdrawal apparatus for withdrawing a liquid test sample from a test sample container and for cleaning the test sample container. 8 figs.
A LITERATURE REVIEW OF WIPE SAMPLING METHODS ...
Wipe sampling is an important technique for the estimation of contaminant deposition in buildings, homes, or outdoor surfaces as a source of possible human exposure. Numerousmethods of wipe sampling exist, and each method has its own specification for the type of wipe, wetting solvent, and determinative step to be used, depending upon the contaminant of concern. The objective of this report is to concisely summarize the findings of a literature review that was conducted to identify the state-of-the-art wipe sampling techniques for a target list of compounds. This report describes the methods used to perform the literature review; a brief review of wipe sampling techniques in general; an analysis of physical and chemical properties of each target analyte; an analysis of wipe sampling techniques for the target analyte list; and asummary of the wipe sampling techniques for the target analyte list, including existing data gaps. In general, no overwhelming consensus can be drawn from the current literature on how to collect a wipe sample for the chemical warfare agents, organophosphate pesticides, and other toxic industrial chemicals of interest to this study. Different methods, media, and wetting solvents have been recommended and used by various groups and different studies. For many of the compounds of interest, no specific wipe sampling methodology has been established for their collection. Before a wipe sampling method (or methods) can be established for the co
Surface sampling concentration and reaction probe with controller to adjust sampling position
Van Berkel, Gary J.; ElNaggar, Mariam S.
2016-07-19
A method of analyzing a chemical composition of a specimen is described. The method can include providing a probe comprising an outer capillary tube and an inner capillary tube disposed co-axially within the outer capillary tube, where the inner and outer capillary tubes define a solvent capillary and a sampling capillary in fluid communication with one another at a distal end of the probe; contacting a target site on a surface of a specimen with a solvent in fluid communication with the probe; maintaining a plug volume proximate a solvent-specimen interface, wherein the plug volume is in fluid communication with the probe; draining plug sampling fluid from the plug volume through the sampling capillary; and analyzing a chemical composition of the plug sampling fluid with an analytical instrument. A system for performing the method is also described.
Pontoni, Ludovico; Panico, Antonio; Matanò, Alessia; van Hullebusch, Eric D; Fabbricino, Massimiliano; Esposito, Giovanni; Pirozzi, Francesco
2017-12-06
A novel modification of the sample preparation procedure for the Folin-Ciocalteu colorimetric assay for the determination of total phenolic compounds in natural solid and semisolid organic materials (e.g., foods, organic solid waste, soils, plant tissues, agricultural residues, manure) is proposed. In this method, the sample is prepared by adding sodium sulfate as a solid diluting agent before homogenization. The method allows for the determination of total phenols (TP) in samples with high solids contents, and it provides good accuracy and reproducibility. Additionally, this method permits analyses of significant amounts of sample, which reduces problems related to heterogeneity. We applied this method to phenols-rich lignocellulosic and humic-like solids and semisolid samples, including rice straw (RS), peat-rich soil (PS), and food waste (FW). The TP concentrations measured with the solid dilution (SD) preparation were substantially higher (increases of 41.4%, 15.5%, and 59.4% in RS, PS and FW, respectively) than those obtained with the traditional method (solids suspended in water). These results showed that the traditional method underestimates the phenolic contents in the studied solids.
Olstein, Alan; Griffith, Leena; Feirtag, Joellen; Pearson, Nicole
2013-01-01
The Paradigm Diagnostics Salmonella Indicator Broth (PDX-SIB) is intended as a single-step selective enrichment indicator broth to be used as a simple screening test for the presence of Salmonella spp. in environmental samples. This method permits the end user to avoid multistep sample processing to identify presumptively positive samples, as exemplified by standard U.S. reference methods. PDX-SIB permits the outgrowth of Salmonella while inhibiting the growth of competitive Gram-negative and -positive microflora. Growth of Salmonella-positive cultures results in a visual color change of the medium from purple to yellow when the sample is grown at 37 +/- 1 degree C. Performance of PDX-SIB has been evaluated in five different categories: inclusivity-exclusivity, methods comparison, ruggedness, lot-to-lot variability, and shelf stability. The inclusivity panel included 100 different Salmonella serovars, 98 of which were SIB-positive during the 30 to 48 h incubation period. The exclusivity panel included 33 different non-Salmonella microorganisms, 31 of which were SIB-negative during the incubation period. Methods comparison studies included four different surfaces: S. Newport on plastic, S. Anatum on sealed concrete, S. Abaetetuba on ceramic tile, and S. Typhimurium in the presence of 1 log excess of Citrobacter freundii. Results of the methods comparison studies demonstrated no statistical difference between the SIB method and the U.S. Food and Drug Administration-Bacteriological Analytical Manual reference method, as measured by the Mantel-Haenszel Chi-square test. Ruggedness studies demonstrated little variation in test results when SIB incubation temperatures were varied over a 34-40 degrees C range. Lot-to-lot consistency results suggest no detectable differences in manufactured goods using two reference Salmonella serovars and one non-Salmonella microorganism.
1999-01-01
contaminating the surface. Research efforts to develop an improved sampling method have previously been limited to deposits made from solutions of explosives...explosive per fingerprint calculated in this way has too much variation to allow determination of sampling efficiency or to use this method to prepare...crystals is put into suspension, the actual amount is determined by usual methods including high-performance liquid chromatography (HPLC), gas
Rapid thermal processing by stamping
Stradins, Pauls; Wang, Qi
2013-03-05
A rapid thermal processing device and methods are provided for thermal processing of samples such as semiconductor wafers. The device has components including a stamp (35) having a stamping surface and a heater or cooler (40) to bring it to a selected processing temperature, a sample holder (20) for holding a sample (10) in position for intimate contact with the stamping surface; and positioning components (25) for moving the stamping surface and the stamp (35) in and away from intimate, substantially non-pressured contact. Methods for using and making such devices are also provided. These devices and methods allow inexpensive, efficient, easily controllable thermal processing.
Probabilistic inference using linear Gaussian importance sampling for hybrid Bayesian networks
NASA Astrophysics Data System (ADS)
Sun, Wei; Chang, K. C.
2005-05-01
Probabilistic inference for Bayesian networks is in general NP-hard using either exact algorithms or approximate methods. However, for very complex networks, only the approximate methods such as stochastic sampling could be used to provide a solution given any time constraint. There are several simulation methods currently available. They include logic sampling (the first proposed stochastic method for Bayesian networks, the likelihood weighting algorithm) the most commonly used simulation method because of its simplicity and efficiency, the Markov blanket scoring method, and the importance sampling algorithm. In this paper, we first briefly review and compare these available simulation methods, then we propose an improved importance sampling algorithm called linear Gaussian importance sampling algorithm for general hybrid model (LGIS). LGIS is aimed for hybrid Bayesian networks consisting of both discrete and continuous random variables with arbitrary distributions. It uses linear function and Gaussian additive noise to approximate the true conditional probability distribution for continuous variable given both its parents and evidence in a Bayesian network. One of the most important features of the newly developed method is that it can adaptively learn the optimal important function from the previous samples. We test the inference performance of LGIS using a 16-node linear Gaussian model and a 6-node general hybrid model. The performance comparison with other well-known methods such as Junction tree (JT) and likelihood weighting (LW) shows that LGIS-GHM is very promising.
Jiménez-Díaz, I; Vela-Soria, F; Rodríguez-Gómez, R; Zafra-Gómez, A; Ballesteros, O; Navalón, A
2015-09-10
In the present work, a review of the analytical methods developed in the last 15 years for the determination of endocrine disrupting chemicals (EDCs) in human samples related with children, including placenta, cord blood, amniotic fluid, maternal blood, maternal urine and breast milk, is proposed. Children are highly vulnerable to toxic chemicals in the environment. Among these environmental contaminants to which children are at risk of exposure are EDCs -substances able to alter the normal hormone function of wildlife and humans-. The work focuses mainly on sample preparation and instrumental techniques used for the detection and quantification of the analytes. The sample preparation techniques include, not only liquid-liquid extraction (LLE) and solid-phase extraction (SPE), but also modern microextraction techniques such as extraction with molecular imprinted polymers (MIPs), stir-bar sorptive extraction (SBSE), hollow-fiber liquid-phase microextraction (HF-LPME), dispersive liquid-liquid microextraction (DLLME), matrix solid phase dispersion (MSPD) or ultrasound-assisted extraction (UAE), which are becoming alternatives in the analysis of human samples. Most studies focus on minimizing the number of steps and using the lowest solvent amounts in the sample treatment. The usual instrumental techniques employed include liquid chromatography (LC), gas chromatography (GC) mainly coupled to tandem mass spectrometry. Multiresidue methods are being developed for the determination of several families of EDCs with one extraction step and limited sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
Robertson, Eric P [Idaho Falls, ID; Christiansen, Richard L [Littleton, CO
2007-05-29
A method of optically determining a change in magnitude of at least one dimensional characteristic of a sample in response to a selected chamber environment. A magnitude of at least one dimension of the at least one sample may be optically determined subsequent to altering the at least one environmental condition within the chamber. A maximum change in dimension of the at least one sample may be predicted. A dimensional measurement apparatus for indicating a change in at least one dimension of at least one sample. The dimensional measurement apparatus may include a housing with a chamber configured for accommodating pressure changes and an optical perception device for measuring a dimension of at least one sample disposed in the chamber. Methods of simulating injection of a gas into a subterranean formation, injecting gas into a subterranean formation, and producing methane from a coal bed are also disclosed.
Robertson, Eric P; Christiansen, Richard L.
2007-10-23
A method of optically determining a change in magnitude of at least one dimensional characteristic of a sample in response to a selected chamber environment. A magnitude of at least one dimension of the at least one sample may be optically determined subsequent to altering the at least one environmental condition within the chamber. A maximum change in dimension of the at least one sample may be predicted. A dimensional measurement apparatus for indicating a change in at least one dimension of at least one sample. The dimensional measurement apparatus may include a housing with a chamber configured for accommodating pressure changes and an optical perception device for measuring a dimension of at least one sample disposed in the chamber. Methods of simulating injection of a gas into a subterranean formation, injecting gas into a subterranean formation, and producing methane from a coal bed are also disclosed.
Hybrid Gibbs Sampling and MCMC for CMB Analysis at Small Angular Scales
NASA Technical Reports Server (NTRS)
Jewell, Jeffrey B.; Eriksen, H. K.; Wandelt, B. D.; Gorski, K. M.; Huey, G.; O'Dwyer, I. J.; Dickinson, C.; Banday, A. J.; Lawrence, C. R.
2008-01-01
A) Gibbs Sampling has now been validated as an efficient, statistically exact, and practically useful method for "low-L" (as demonstrated on WMAP temperature polarization data). B) We are extending Gibbs sampling to directly propagate uncertainties in both foreground and instrument models to total uncertainty in cosmological parameters for the entire range of angular scales relevant for Planck. C) Made possible by inclusion of foreground model parameters in Gibbs sampling and hybrid MCMC and Gibbs sampling for the low signal to noise (high-L) regime. D) Future items to be included in the Bayesian framework include: 1) Integration with Hybrid Likelihood (or posterior) code for cosmological parameters; 2) Include other uncertainties in instrumental systematics? (I.e. beam uncertainties, noise estimation, calibration errors, other).
Peck, Michael W.; Plowman, June; Aldus, Clare F.; Wyatt, Gary M.; Penaloza Izurieta, Walter; Stringer, Sandra C.; Barker, Gary C.
2010-01-01
The highly potent botulinum neurotoxins are responsible for botulism, a severe neuroparalytic disease. Strains of nonproteolytic Clostridium botulinum form neurotoxins of types B, E, and F and are the main hazard associated with minimally heated refrigerated foods. Recent developments in quantitative microbiological risk assessment (QMRA) and food safety objectives (FSO) have made food safety more quantitative and include, as inputs, probability distributions for the contamination of food materials and foods. A new method that combines a selective enrichment culture with multiplex PCR has been developed and validated to enumerate specifically the spores of nonproteolytic C. botulinum. Key features of this new method include the following: (i) it is specific for nonproteolytic C. botulinum (and does not detect proteolytic C. botulinum), (ii) the detection limit has been determined for each food tested (using carefully structured control samples), and (iii) a low detection limit has been achieved by the use of selective enrichment and large test samples. The method has been used to enumerate spores of nonproteolytic C. botulinum in 637 samples of 19 food materials included in pasta-based minimally heated refrigerated foods and in 7 complete foods. A total of 32 samples (5 egg pastas and 27 scallops) contained spores of nonproteolytic C. botulinum type B or F. The majority of samples contained <100 spores/kg, but one sample of scallops contained 444 spores/kg. Nonproteolytic C. botulinum type E was not detected. Importantly, for QMRA and FSO, the construction of probability distributions will enable the frequency of packs containing particular levels of contamination to be determined. PMID:20709854
Peck, Michael W; Plowman, June; Aldus, Clare F; Wyatt, Gary M; Izurieta, Walter Penaloza; Stringer, Sandra C; Barker, Gary C
2010-10-01
The highly potent botulinum neurotoxins are responsible for botulism, a severe neuroparalytic disease. Strains of nonproteolytic Clostridium botulinum form neurotoxins of types B, E, and F and are the main hazard associated with minimally heated refrigerated foods. Recent developments in quantitative microbiological risk assessment (QMRA) and food safety objectives (FSO) have made food safety more quantitative and include, as inputs, probability distributions for the contamination of food materials and foods. A new method that combines a selective enrichment culture with multiplex PCR has been developed and validated to enumerate specifically the spores of nonproteolytic C. botulinum. Key features of this new method include the following: (i) it is specific for nonproteolytic C. botulinum (and does not detect proteolytic C. botulinum), (ii) the detection limit has been determined for each food tested (using carefully structured control samples), and (iii) a low detection limit has been achieved by the use of selective enrichment and large test samples. The method has been used to enumerate spores of nonproteolytic C. botulinum in 637 samples of 19 food materials included in pasta-based minimally heated refrigerated foods and in 7 complete foods. A total of 32 samples (5 egg pastas and 27 scallops) contained spores of nonproteolytic C. botulinum type B or F. The majority of samples contained <100 spores/kg, but one sample of scallops contained 444 spores/kg. Nonproteolytic C. botulinum type E was not detected. Importantly, for QMRA and FSO, the construction of probability distributions will enable the frequency of packs containing particular levels of contamination to be determined.
McDade, Thomas W; Williams, Sharon; Snodgrass, J Josh
2007-11-01
Logistical constraints associated with the collection and analysis of biological samples in community-based settings have been a significant impediment to integrative, multilevel bio-demographic and biobehavioral research. However recent methodological developments have overcome many of these constraints and have also expanded the options for incorporating biomarkers into population-based health research in international as well as domestic contexts. In particular using dried blood spot (DBS) samples-drops of whole blood collected on filter paper from a simple finger prick-provides a minimally invasive method for collecting blood samples in nonclinical settings. After a brief discussion of biomarkers more generally, we review procedures for collecting, handling, and analyzing DBS samples. Advantages of using DBS samples-compared with venipuncture include the relative ease and low cost of sample collection, transport, and storage. Disadvantages include requirements for assay development and validation as well as the relatively small volumes of sample. We present the results of a comprehensive literature review of published protocols for analysis of DBS samples, and we provide more detailed analysis of protocols for 45 analytes likely to be of particular relevance to population-level health research. Our objective is to provide investigators with the information they need to make informed decisions regarding the appropriateness of blood spot methods for their research interests.
COMPARISON OF SAMPLING TECHNIQUES USED IN STUDYING LEPIDOPTERA POPULATION DYNAMICS
Four methods (light traps, foliage samples, canvas bands, and gypsy moth egg mass surveys) that are used to study the population dynamics of foliage-feeding Lepidoptera were compared for 10 species, including gypsy moth, Lymantria dispar L. Samples were collected weekly at 12 sit...
Effectiveness of sampling methods employed for Acanthamoeba keratitis diagnosis by culture.
Muiño, Laura; Rodrigo, Donoso; Villegas, Rodrigo; Romero, Pablo; Peredo, Daniel E; Vargas, Rafael A; Liempi, Daniela; Osuna, Antonio; Jercic, María Isabel
2018-06-18
This retrospective, observational study was designed to evaluate the effectiveness of the sampling methods commonly used for the collection of corneal scrapes for the diagnosis of Acanthamoeba keratitis (AK) by culture, in terms of their ability to provide a positive result. A total of 553 samples from 380 patients with suspected AK received at the Parasitology Section of the Public Health Institute of Chile, between January 2005 and December 2015, were evaluated. A logistic regression model was used to determine the correlation between the culture outcome (positive or negative) and the method for sample collection. The year of sample collection was also included in the analysis as a confounding variable. Three hundred and sixty-five samples (27%) from 122 patients (32.1%) were positive by culture. The distribution of sample types was as follows: 142 corneal scrapes collected using a modified bezel needle (a novel method developed by a team of Chilean corneologists), 176 corneal scrapes obtained using a scalpel, 50 corneal biopsies, 30 corneal swabs, and 155 non-biological materials including contact lens and its paraphernalia. Biopsy provided the highest likelihood ratio for a positive result by culture (1.89), followed by non-biological materials (1.10) and corneal scrapes obtained using a modified needle (1.00). The lowest likelihood ratio was estimated for corneal scrapes obtained using a scalpel (0.88) and cotton swabs (0.78). Apart from biopsy, optimum corneal samples for the improved diagnosis of AK can be obtained using a modified bezel needle instead of a scalpel, while cotton swabs are not recommended.
Wan, Xiaohua; Katchalski, Tsvi; Churas, Christopher; Ghosh, Sreya; Phan, Sebastien; Lawrence, Albert; Hao, Yu; Zhou, Ziying; Chen, Ruijuan; Chen, Yu; Zhang, Fa; Ellisman, Mark H
2017-05-01
Because of the significance of electron microscope tomography in the investigation of biological structure at nanometer scales, ongoing improvement efforts have been continuous over recent years. This is particularly true in the case of software developments. Nevertheless, verification of improvements delivered by new algorithms and software remains difficult. Current analysis tools do not provide adaptable and consistent methods for quality assessment. This is particularly true with images of biological samples, due to image complexity, variability, low contrast and noise. We report an electron tomography (ET) simulator with accurate ray optics modeling of image formation that includes curvilinear trajectories through the sample, warping of the sample and noise. As a demonstration of the utility of our approach, we have concentrated on providing verification of the class of reconstruction methods applicable to wide field images of stained plastic-embedded samples. Accordingly, we have also constructed digital phantoms derived from serial block face scanning electron microscope images. These phantoms are also easily modified to include alignment features to test alignment algorithms. The combination of more realistic phantoms with more faithful simulations facilitates objective comparison of acquisition parameters, alignment and reconstruction algorithms and their range of applicability. With proper phantoms, this approach can also be modified to include more complex optical models, including distance-dependent blurring and phase contrast functions, such as may occur in cryotomography. Copyright © 2017 Elsevier Inc. All rights reserved.
Method of analysis of asbestiform minerals by thermoluminescence
Fisher, Gerald L.; Bradley, Edward W.
1980-01-01
A method for the qualitative and quantitative analysis of asbestiform minerals, including the steps of subjecting a sample to be analyzed to the thermoluminescent analysis, annealing the sample, subjecting the sample to ionizing radiation, and subjecting the sample to a second thermoluminescent analysis. Glow curves are derived from the two thermoluminescent analyses and their shapes then compared to established glow curves of known asbestiform minerals to identify the type of asbestiform in the sample. Also, during at least one of the analyses, the thermoluminescent response for each sample is integrated during a linear heating period of the analysis in order to derive the total thermoluminescence per milligram of sample. This total is a measure of the quantity of asbestiform in the sample and may also be used to identify the source of the sample.
Joint Inference of Population Assignment and Demographic History
Choi, Sang Chul; Hey, Jody
2011-01-01
A new approach to assigning individuals to populations using genetic data is described. Most existing methods work by maximizing Hardy–Weinberg and linkage equilibrium within populations, neither of which will apply for many demographic histories. By including a demographic model, within a likelihood framework based on coalescent theory, we can jointly study demographic history and population assignment. Genealogies and population assignments are sampled from a posterior distribution using a general isolation-with-migration model for multiple populations. A measure of partition distance between assignments facilitates not only the summary of a posterior sample of assignments, but also the estimation of the posterior density for the demographic history. It is shown that joint estimates of assignment and demographic history are possible, including estimation of population phylogeny for samples from three populations. The new method is compared to results of a widely used assignment method, using simulated and published empirical data sets. PMID:21775468
Apparatus and system for multivariate spectral analysis
Keenan, Michael R.; Kotula, Paul G.
2003-06-24
An apparatus and system for determining the properties of a sample from measured spectral data collected from the sample by performing a method of multivariate spectral analysis. The method can include: generating a two-dimensional matrix A containing measured spectral data; providing a weighted spectral data matrix D by performing a weighting operation on matrix A; factoring D into the product of two matrices, C and S.sup.T, by performing a constrained alternating least-squares analysis of D=CS.sup.T, where C is a concentration intensity matrix and S is a spectral shapes matrix; unweighting C and S by applying the inverse of the weighting used previously; and determining the properties of the sample by inspecting C and S. This method can be used by a spectrum analyzer to process X-ray spectral data generated by a spectral analysis system that can include a Scanning Electron Microscope (SEM) with an Energy Dispersive Detector and Pulse Height Analyzer.
Nondestructive nanostraw intracellular sampling for longitudinal cell monitoring
Cao, Yuhong; Chen, Haodong; Birey, Fikri; Leal-Ortiz, Sergio A.; Han, Crystal M.; Santiago, Juan G.; Paşca, Sergiu P.; Wu, Joseph C.; Melosh, Nicholas A.
2017-01-01
Here, we report a method for time-resolved, longitudinal extraction and quantitative measurement of intracellular proteins and mRNA from a variety of cell types. Cytosolic contents were repeatedly sampled from the same cell or population of cells for more than 5 d through a cell-culture substrate, incorporating hollow 150-nm-diameter nanostraws (NS) within a defined sampling region. Once extracted, the cellular contents were analyzed with conventional methods, including fluorescence, enzymatic assays (ELISA), and quantitative real-time PCR. This process was nondestructive with >95% cell viability after sampling, enabling long-term analysis. It is important to note that the measured quantities from the cell extract were found to constitute a statistically significant representation of the actual contents within the cells. Of 48 mRNA sequences analyzed from a population of cardiomyocytes derived from human induced pluripotent stem cells (hiPSC-CMs), 41 were accurately quantified. The NS platform samples from a select subpopulation of cells within a larger culture, allowing native cell-to-cell contact and communication even during vigorous activity such as cardiomyocyte beating. This platform was applied both to cell lines and to primary cells, including CHO cells, hiPSC-CMs, and human astrocytes derived in 3D cortical spheroids. By tracking the same cell or group of cells over time, this method offers an avenue to understand dynamic cell behavior, including processes such as induced pluripotency and differentiation. PMID:28223521
Herath, Damayanthi; Tang, Sen-Lin; Tandon, Kshitij; Ackland, David; Halgamuge, Saman Kumara
2017-12-28
In metagenomics, the separation of nucleotide sequences belonging to an individual or closely matched populations is termed binning. Binning helps the evaluation of underlying microbial population structure as well as the recovery of individual genomes from a sample of uncultivable microbial organisms. Both supervised and unsupervised learning methods have been employed in binning; however, characterizing a metagenomic sample containing multiple strains remains a significant challenge. In this study, we designed and implemented a new workflow, Coverage and composition based binning of Metagenomes (CoMet), for binning contigs in a single metagenomic sample. CoMet utilizes coverage values and the compositional features of metagenomic contigs. The binning strategy in CoMet includes the initial grouping of contigs in guanine-cytosine (GC) content-coverage space and refinement of bins in tetranucleotide frequencies space in a purely unsupervised manner. With CoMet, the clustering algorithm DBSCAN is employed for binning contigs. The performances of CoMet were compared against four existing approaches for binning a single metagenomic sample, including MaxBin, Metawatt, MyCC (default) and MyCC (coverage) using multiple datasets including a sample comprised of multiple strains. Binning methods based on both compositional features and coverages of contigs had higher performances than the method which is based only on compositional features of contigs. CoMet yielded higher or comparable precision in comparison to the existing binning methods on benchmark datasets of varying complexities. MyCC (coverage) had the highest ranking score in F1-score. However, the performances of CoMet were higher than MyCC (coverage) on the dataset containing multiple strains. Furthermore, CoMet recovered contigs of more species and was 18 - 39% higher in precision than the compared existing methods in discriminating species from the sample of multiple strains. CoMet resulted in higher precision than MyCC (default) and MyCC (coverage) on a real metagenome. The approach proposed with CoMet for binning contigs, improves the precision of binning while characterizing more species in a single metagenomic sample and in a sample containing multiple strains. The F1-scores obtained from different binning strategies vary with different datasets; however, CoMet yields the highest F1-score with a sample comprised of multiple strains.
A comparison of five sampling techniques to estimate surface fuel loading in montane forests
Pamela G. Sikkink; Robert E. Keane
2008-01-01
Designing a fuel-sampling program that accurately and efficiently assesses fuel load at relevant spatial scales requires knowledge of each sample method's strengths and weaknesses.We obtained loading values for six fuel components using five fuel load sampling techniques at five locations in western Montana, USA. The techniques included fixed-area plots, planar...
Arnold, Mark E; Mueller-Doblies, Doris; Gosling, Rebecca J; Martelli, Francesca; Davies, Robert H
2015-01-01
Reports of Salmonella in ducks in the UK currently rely upon voluntary submissions from the industry, and as there is no harmonized statutory monitoring and control programme, it is difficult to compare data from different years in order to evaluate any trends in Salmonella prevalence in relation to sampling methodology. Therefore, the aim of this project was to assess the sensitivity of a selection of environmental sampling methods, including the sampling of faeces, dust and water troughs or bowls for the detection of Salmonella in duck flocks, and a range of sampling methods were applied to 67 duck flocks. Bayesian methods in the absence of a gold standard were used to provide estimates of the sensitivity of each of the sampling methods relative to the within-flock prevalence. There was a large influence of the within-flock prevalence on the sensitivity of all sample types, with sensitivity reducing as the within-flock prevalence reduced. Boot swabs (individual and pool of four), swabs of faecally contaminated areas and whole house hand-held fabric swabs showed the overall highest sensitivity for low-prevalence flocks and are recommended for use to detect Salmonella in duck flocks. The sample type with the highest proportion positive was a pool of four hair nets used as boot swabs, but this was not the most sensitive sample for low-prevalence flocks. All the environmental sampling types (faeces swabs, litter pinches, drag swabs, water trough samples and dust) had higher sensitivity than individual faeces sampling. None of the methods consistently identified all the positive flocks, and at least 10 samples would be required for even the most sensitive method (pool of four boot swabs) to detect a 5% prevalence. The sampling of dust had a low sensitivity and is not recommended for ducks.
A self-sampling method to obtain large volumes of undiluted cervicovaginal secretions.
Boskey, Elizabeth R; Moench, Thomas R; Hees, Paul S; Cone, Richard A
2003-02-01
Studies of vaginal physiology and pathophysiology sometime require larger volumes of undiluted cervicovaginal secretions than can be obtained by current methods. A convenient method for self-sampling these secretions outside a clinical setting can facilitate such studies of reproductive health. The goal was to develop a vaginal self-sampling method for collecting large volumes of undiluted cervicovaginal secretions. A menstrual collection device (the Instead cup) was inserted briefly into the vagina to collect secretions that were then retrieved from the cup by centrifugation in a 50-ml conical tube. All 16 women asked to perform this procedure found it feasible and acceptable. Among 27 samples, an average of 0.5 g of secretions (range, 0.1-1.5 g) was collected. This is a rapid and convenient self-sampling method for obtaining relatively large volumes of undiluted cervicovaginal secretions. It should prove suitable for a wide range of assays, including those involving sexually transmitted diseases, microbicides, vaginal physiology, immunology, and pathophysiology.
Devices, systems, and methods for conducting sandwich assays using sedimentation
Schaff, Ulrich Y; Sommer, Gregory J; Singh, Anup K; Hatch, Anson V
2015-02-03
Embodiments of the present invention are directed toward devices, systems, and method for conducting sandwich assays using sedimentation. In one example, a method includes generating complexes on a plurality of beads in a fluid sample, individual ones of the complexes comprising a capture agent, a target analyte, and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transporting occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.
DNA-PCR analysis of bloodstains sampled by the polyvinyl-alcohol method.
Schyma, C; Huckenbeck, W; Bonte, W
1999-01-01
Among the usual techniques of sampling gunshot residues (GSR), the polyvinyl-alcohol method (PVAL) includes the advantage of embedding all particles, foreign bodies and stains on the surface of the shooter's hand in exact and reproducible topographic localization. The aim of the present study on ten persons killed by firearms was to check the possibility of DNA-PCR typing of blood traces embedded in the PVAL gloves in a second step following GSR analysis. The results of these examinations verify that the PVAL technique does not include factors that inhibit successful PCR typing. Thus the PVAL method can be recommended as a combination technique to secure and preserve inorganic and biological traces at the same time.
Sparse sampling and reconstruction for electron and scanning probe microscope imaging
Anderson, Hyrum; Helms, Jovana; Wheeler, Jason W.; Larson, Kurt W.; Rohrer, Brandon R.
2015-07-28
Systems and methods for conducting electron or scanning probe microscopy are provided herein. In a general embodiment, the systems and methods for conducting electron or scanning probe microscopy with an undersampled data set include: driving an electron beam or probe to scan across a sample and visit a subset of pixel locations of the sample that are randomly or pseudo-randomly designated; determining actual pixel locations on the sample that are visited by the electron beam or probe; and processing data collected by detectors from the visits of the electron beam or probe at the actual pixel locations and recovering a reconstructed image of the sample.
Near real time vapor detection and enhancement using aerosol adsorption
Novick, Vincent J.; Johnson, Stanley A.
1999-01-01
A vapor sample detection method where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample.
Near real time vapor detection and enhancement using aerosol adsorption
Novick, V.J.; Johnson, S.A.
1999-08-03
A vapor sample detection method is described where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample. 13 figs.
Baranowska, Irena; Wojciechowska, Iwona; Solarz, Natalia; Krutysza, Ewa
2014-01-01
This paper reports the development of a method for simultaneously determining five preservatives in cosmetics, cleaning agents and pharmaceuticals by fast liquid chromatography. Methylisothiazolinone, methylchloroisothiazolinone, benzyl alcohol, sodium benzoate and methylparaben were separated on a Chromolith Fast Gradient reversed-phase 18e column using gradient elution with acetonitrile and a 0.1% aqueous solution of formic acid, with a run time of 3 min. The preparation of solid and liquid samples included ultrasonic extraction with methanol with recoveries ranging from 69 to 119%. The developed method was used to analyze samples of cosmetics (66 samples), cleaning agents (five samples) and pharmaceutical industry products (17 samples).
Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies.
Song, Se Jin; Amir, Amnon; Metcalf, Jessica L; Amato, Katherine R; Xu, Zhenjiang Zech; Humphrey, Greg; Knight, Rob
2016-01-01
Immediate freezing at -20°C or below has been considered the gold standard for microbiome preservation, yet this approach is not feasible for many field studies, ranging from anthropology to wildlife conservation. Here we tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including such types of variation as freeze-thaw cycles and the high temperature fluctuations often encountered under field conditions. We found that three of the methods-95% ethanol, FTA cards, and the OMNIgene Gut kit-can preserve samples sufficiently well at ambient temperatures such that differences at 8 weeks are comparable to differences among technical replicates. However, even the worst methods, including those with no fixative, were able to reveal microbiome differences between species at 8 weeks and between individuals after a week, allowing meta-analyses of samples collected using various methods when the effect of interest is expected to be larger than interindividual variation (although use of a single method within a study is strongly recommended to reduce batch effects). Encouragingly for FTA cards, the differences caused by this method are systematic and can be detrended. As in other studies, we strongly caution against the use of 70% ethanol. The results, spanning 15 individuals and over 1,200 samples, provide our most comprehensive view to date of storage effects on stool and provide a paradigm for the future studies of other sample types that will be required to provide a global view of microbial diversity and its interaction among humans, animals, and the environment. IMPORTANCE Our study, spanning 15 individuals and over 1,200 samples, provides our most comprehensive view to date of storage and stabilization effects on stool. We tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including the types of variation often encountered under field conditions, such as freeze-thaw cycles and high temperature fluctuations. We show that several cost-effective methods provide excellent microbiome stability out to 8 weeks, opening up a range of field studies with humans and wildlife that would otherwise be cost-prohibitive.
HPLC analysis and standardization of Brahmi vati – An Ayurvedic poly-herbal formulation
Mishra, Amrita; Mishra, Arun K.; Tiwari, Om Prakash; Jha, Shivesh
2013-01-01
Objectives The aim of the present study was to standardize Brahmi vati (BV) by simultaneous quantitative estimation of Bacoside A3 and Piperine adopting HPLC–UV method. BV very important Ayurvedic polyherbo formulation used to treat epilepsy and mental disorders containing thirty eight ingredients including Bacopa monnieri L. and Piper longum L. Materials and methods An HPLC–UV method was developed for the standardization of BV in light of simultaneous quantitative estimation of Bacoside A3 and Piperine, the major constituents of B. monnieri L. and P. longum L. respectively. The developed method was validated on parameters including linearity, precision, accuracy and robustness. Results The HPLC analysis showed significant increase in amount of Bacoside A3 and Piperine in the in-house sample of BV when compared with all three different marketed samples of the same. Results showed variations in the amount of Bacoside A3 and Piperine in different samples which indicate non-uniformity in their quality which will lead to difference in their therapeutic effects. Conclusion The outcome of the present investigation underlines the importance of standardization of Ayurvedic formulations. The developed method may be further used to standardize other samples of BV or other formulations containing Bacoside A3 and Piperine. PMID:24396246
Izco, J M; Tormo, M; Harris, A; Tong, P S; Jimenez-Flores, R
2003-01-01
Quantification of phosphate and citrate compounds is very important because their distribution between soluble and colloidal phases of milk and their interactions with milk proteins influence the stability and some functional properties of dairy products. The aim of this work was to optimize and validate a capillary electrophoresis method for the rapid determination of these compounds in milk. Various parameters affecting analysis have been optimized, including type, composition, and pH of the electrolyte, and sample extraction. Ethanol, acetonitrile, sulfuric acid, water at 50 degrees C or at room temperature were tested as sample buffers (SB). Water at room temperature yielded the best overall results and was chosen for further validation. The extraction time was checked and could be shortened to less than 1 min. Also, sample preparation was simplified to pipet 12 microl of milk into 1 ml of water containing 20 ppm of tartaric acid as an internal standard. The linearity of the method was excellent (R2 > 0.999) with CV values of response factors <3%. The detection limits for phosphate and citrate were 5.1 and 2.4 nM, respectively. The accuracy of the method was calculated for each compound (103.2 and 100.3%). In addition, citrate and phosphate content of several commercial milk samples were analyzed by this method, and the results deviated less than 5% from values obtained when analyzing the samples by official methods. To study the versatility of the technique, other dairy productssuch as cream cheese, yogurt, or Cheddar cheese were analyzed and accuracy was similar to milk in all products tested. The procedure is rapid and offers a very fast and simple sample preparation. Once the sample has arrived at the laboratory, less than 5 min (including handling, preparation, running, integration, and quantification) are necessary to determine the concentration of citric acid and inorganic phosphate. Because of the speed and accuracy of this method, it is promising as an analytical quantitative testing technique.
Zhang, Yaohai; Zhang, Xuelian; Jiao, Bining
2014-09-15
Dispersive liquid-liquid microextraction (DLLME) sample preparation and the quick, easy, cheap, effective, rugged and safe (QuEChERS) method combined with DLLME were developed and compared for the analysis of ten pyrethroids in various fruit juices using gas chromatography-electron capture detection (GC-ECD). QuEChERS-DLLME method has found its widespread applications to all the fruit juices including those samples with more complex matrices (orange, lemon, kiwi and mango) while DLLME was confined to the fruit juices with simpler matrices (apple, pear, grape and peach). The two methods provided acceptable recoveries and repeatability. In addition, the applicabilities of two methods were demonstrated with the real samples and further confirmed by gas chromatography-mass spectrometry (GC-MS). Copyright © 2014. Published by Elsevier Ltd.
Grabowska-Polanowska, Beata; Miarka, Przemysław; Skowron, Monika; Sułowicz, Joanna; Wojtyna, Katarzyna; Moskal, Karolina; Śliwka, Ireneusz
2017-10-01
The studies on volatile organic compounds emitted from skin are an interest for chemists, biologists and physicians due to their role in development of different scientific areas, including medical diagnostics, forensic medicine and the perfume design. This paper presents a proposal of two sampling methods applied to skin odor collection: the first one uses a bag of cellulose film, the second one, using cellulose sachets filled with active carbon. Volatile organic compounds were adsorbed on carbon sorbent, removed via thermal desorption and analyzed using gas chromatograph with mass spectrometer. The first sampling method allowed identification of more compounds (52) comparing to the second one (30). Quantitative analyses for acetone, butanal, pentanal and hexanal were done. The skin odor sampling method using a bag of cellulose film, allowed the identification of many more compounds when compared with the method using a sachet filled with active carbon.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wunschel, David S.; Kreuzer-Martin, Helen W.; Antolick, Kathryn C.
2009-12-01
This report describes method development and preliminary evaluation for analyzing castor samples for signatures of purifying ricin. Ricin purification from the source castor seeds is essentially a problem of protein purification using common biochemical methods. Indications of protein purification will likely manifest themselves as removal of the non-protein fractions of the seed. Two major, non-protein, types of biochemical constituents in the seed are the castor oil and various carbohydrates. The oil comprises roughly half the seed weight while the carbohydrate component comprises roughly half of the remaining “mash” left after oil and hull removal. Different castor oil and carbohydrate componentsmore » can serve as indicators of specific toxin processing steps. Ricinoleic acid is a relatively unique fatty acid in nature and is the most abundant component of castor oil. The loss of ricinoleic acid indicates a step to remove oil from the seeds. The relative amounts of carbohydrates and carbohydrate-like compounds, including arabinose, xylose, myo-inositol fucose, rhamnose, glucosamine and mannose detected in the sample can also indicate specific processing steps. For instance, the differential loss of arabinose relative to mannose and N-acetyl glucosamine indicates enrichment for the protein fraction of the seed using protein precipitation. The methods developed in this project center on fatty acid and carbohydrate extraction from castor samples followed by derivatization to permit analysis by gas chromatography-mass spectrometry (GC-MS). Method descriptions herein include: the source and preparation of castor materials used for method evaluation, the equipment and description of procedure required for chemical derivatization, and the instrument parameters used in the analysis. Two types of derivatization methods describe analysis of carbohydrates and one procedure for analysis of fatty acids. Two types of GC-MS analysis is included in the method development, one employing a quadrupole MS system for compound identification and an isotope ratio MS for measuring the stable isotope ratios of deuterium and hydrogen (D/H) in fatty acids. Finally, the method for analyzing the compound abundance data is included. This study indicates that removal of ricinoleic acid is a conserved consequence of each processing step we tested. Furthermore, the stable isotope D/H ratio of ricinoleic acid distinguished between two of the three castor seed sources. Concentrations of arabinose, xylose, mannose, glucosamine and myo-inositol differentiated between crude or acetone extracted samples and samples produced by protein precipitation. Taken together these data illustrate the ability to distinguish between processes used to purify a ricin sample as well as potentially the source seeds.« less
John C. Byrne
1993-01-01
Methods for solving some recurring problems of maintaining a permanent plot data base for growth and yield reseuch are described. These methods include documenting data from diverse sampling designs, changing sampling designs, changing field procedures, and coordinating activities in the plots with the land management agency. Managing a permanent plot data base (...
NMR system and method having a permanent magnet providing a rotating magnetic field
Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA
2009-05-19
Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.
This compendium contains seven SOPs developed by Food and Drug Administration (FDA) laboratories for methods of analyzing trace metals in dietary samples collected using Total Diet study procedures. The SOPs include the following: (1) Quality Control for Analysis of NHEXAS Food o...
HPLC analysis and standardization of Brahmi vati - An Ayurvedic poly-herbal formulation.
Mishra, Amrita; Mishra, Arun K; Tiwari, Om Prakash; Jha, Shivesh
2013-09-01
The aim of the present study was to standardize Brahmi vati (BV) by simultaneous quantitative estimation of Bacoside A3 and Piperine adopting HPLC-UV method. BV very important Ayurvedic polyherbo formulation used to treat epilepsy and mental disorders containing thirty eight ingredients including Bacopa monnieri L. and Piper longum L. An HPLC-UV method was developed for the standardization of BV in light of simultaneous quantitative estimation of Bacoside A3 and Piperine, the major constituents of B. monnieri L. and P. longum L. respectively. The developed method was validated on parameters including linearity, precision, accuracy and robustness. The HPLC analysis showed significant increase in amount of Bacoside A3 and Piperine in the in-house sample of BV when compared with all three different marketed samples of the same. Results showed variations in the amount of Bacoside A3 and Piperine in different samples which indicate non-uniformity in their quality which will lead to difference in their therapeutic effects. The outcome of the present investigation underlines the importance of standardization of Ayurvedic formulations. The developed method may be further used to standardize other samples of BV or other formulations containing Bacoside A3 and Piperine.
Alizadeh, Taher; Ganjali, Mohammad Reza; Rafiei, Faride
2017-06-29
In this study an innovative method was introduced for selective and precise determination of urea in various real samples including urine, blood serum, soil and water. The method was based on the square wave voltammetry determination of an electroactive product, generated during diacetylmonoxime reaction with urea. A carbon paste electrode, modified with multi-walled carbon nanotubes (MWCNTs) was found to be an appropriate electrochemical transducer for recording of the electrochemical signal. It was found that the chemical reaction conditions influenced the analytical signal directly. The calibration graph of the method was linear in the range of 1 × 10 -7 - 1 × 10 -2 mol L -1 . The detection limit was calculated to be 52 nmol L -1 . Relative standard error of the method was also calculated to be 3.9% (n = 3). The developed determination procedure was applied for urea determination in various real samples including soil, urine, plasma and water samples. Copyright © 2017 Elsevier B.V. All rights reserved.
Methods and kits for predicting a response to an erythropoietic agent
Merchant, Michael L.; Klein, Jon B.; Brier, Michael E.; Gaweda, Adam E.
2015-06-16
Methods for predicting a response to an erythropoietic agent in a subject include providing a biological sample from the subject, and determining an amount in the sample of at least one peptide selected from the group consisting of SEQ ID NOS: 1-17. If there is a measurable difference in the amount of the at least one peptide in the sample, when compared to a control level of the same peptide, the subject is then predicted to have a good response or a poor response to the erythropoietic agent. Kits for predicting a response to an erythropoietic agent are further provided and include one or more antibodies, or fragments thereof, that specifically recognize a peptide of SEQ ID NOS: 1-17.
Apparatus, system, and method for laser-induced breakdown spectroscopy
Effenberger, Jr., Andrew J; Scott, Jill R; McJunkin, Timothy R
2014-11-18
In laser-induced breakdown spectroscopy (LIBS), an apparatus includes a pulsed laser configured to generate a pulsed laser signal toward a sample, a constructive interference object and an optical element, each located in a path of light from the sample. The constructive interference object is configured to generate constructive interference patterns of the light. The optical element is configured to disperse the light. A LIBS system includes a first and a second optical element, and a data acquisition module. The data acquisition module is configured to determine an isotope measurement based, at least in part, on light received by an image sensor from the first and second optical elements. A method for performing LIBS includes generating a pulsed laser on a sample to generate light from a plasma, generating constructive interference patterns of the light, and dispersing the light into a plurality of wavelengths.
Nelson, Jennifer C.; Marsh, Tracey; Lumley, Thomas; Larson, Eric B.; Jackson, Lisa A.; Jackson, Michael
2014-01-01
Objective Estimates of treatment effectiveness in epidemiologic studies using large observational health care databases may be biased due to inaccurate or incomplete information on important confounders. Study methods that collect and incorporate more comprehensive confounder data on a validation cohort may reduce confounding bias. Study Design and Setting We applied two such methods, imputation and reweighting, to Group Health administrative data (full sample) supplemented by more detailed confounder data from the Adult Changes in Thought study (validation sample). We used influenza vaccination effectiveness (with an unexposed comparator group) as an example and evaluated each method’s ability to reduce bias using the control time period prior to influenza circulation. Results Both methods reduced, but did not completely eliminate, the bias compared with traditional effectiveness estimates that do not utilize the validation sample confounders. Conclusion Although these results support the use of validation sampling methods to improve the accuracy of comparative effectiveness findings from healthcare database studies, they also illustrate that the success of such methods depends on many factors, including the ability to measure important confounders in a representative and large enough validation sample, the comparability of the full sample and validation sample, and the accuracy with which data can be imputed or reweighted using the additional validation sample information. PMID:23849144
Adsorptive Stripping Voltammetry of Environmental Indicators: Determination of Zinc in Algae
ERIC Educational Resources Information Center
Collado-Sanchez, C.; Hernandez-Brito, J. J.; Perez-Pena, J.; Torres-Padron, M. E.; Gelado-Caballero, M. D.
2005-01-01
A method for sample preparation and for the determination of average zinc content in algae using adsorptive stripping voltammetry are described. The students gain important didactic advantages through metal determination in environmental matrices, which include carrying out clean protocols for sampling and handling, and digesting samples using…
USDA-ARS?s Scientific Manuscript database
Introduction: Salmonella and Campylobacter contamination of broiler carcass skin increases during feather removal. There are several methods for sampling carcasses including sponging or swabbing of skin surface and skin excision. It is unclear whether sponge sampling is adequate to remove bacteri...
USDA-ARS?s Scientific Manuscript database
Introduction: Salmonella and Campylobacter contamination of broiler carcass skin increases during feather removal. There are several methods for sampling carcasses including sponging or swabbing of skin surface and skin excision. It is unclear whether sponge sampling is adequate to remove bacteria f...
A method for analysing small samples of floral pollen for free and protein-bound amino acids.
Stabler, Daniel; Power, Eileen F; Borland, Anne M; Barnes, Jeremy D; Wright, Geraldine A
2018-02-01
Pollen provides floral visitors with essential nutrients including proteins, lipids, vitamins and minerals. As an important nutrient resource for pollinators, including honeybees and bumblebees, pollen quality is of growing interest in assessing available nutrition to foraging bees. To date, quantifying the protein-bound amino acids in pollen has been difficult and methods rely on large amounts of pollen, typically more than 1 g. More usual is to estimate a crude protein value based on the nitrogen content of pollen, however, such methods provide no information on the distribution of essential and non-essential amino acids constituting the proteins.Here, we describe a method of microwave-assisted acid hydrolysis using low amounts of pollen that allows exploration of amino acid composition, quantified using ultra high performance liquid chromatography (UHPLC), and a back calculation to estimate the crude protein content of pollen.Reliable analysis of protein-bound and free amino acids as well as an estimation of crude protein concentration was obtained from pollen samples as low as 1 mg. Greater variation in both protein-bound and free amino acids was found in pollen sample sizes <1 mg. Due to the variability in recovery of amino acids in smaller sample sizes, we suggest a correction factor to apply to specific sample sizes of pollen in order to estimate total crude protein content.The method described in this paper will allow researchers to explore the composition of amino acids in pollen and will aid research assessing the available nutrition to pollinating animals. This method will be particularly useful in assaying the pollen of wild plants, from which it is difficult to obtain large sample weights.
Száková, J; Tlustos, P; Goessler, W; Frková, Z; Najmanová, J
2009-12-30
The effect of soil extraction procedures and/or sample pretreatment (drying, freezing of the soil sample) on the extractability of arsenic and its compounds was tested. In the first part, five extraction procedures were compared with following order of extractable arsenic portions: 2M HNO(3)>0.43 M CH(3)COOH>or=0.05 M EDTA>or=Mehlich III (0.2M CH(3)COOH+0.25 M NH(4)NO(3)+0.013 M HNO(3)+0.015 M NH(4)F+0.001 M EDTA) extraction>water). Additionally, two methods of soil solution sampling were compared, centrifugation of saturated soil and the use of suction cups. The results showed that different sample pretreatments including soil solution sampling could lead to different absolute values of mobile arsenic content in soils. However, the interpretation of the data can lead to similar conclusions as apparent from the comparison of the soil solution sampling methods (r=0.79). For determination of arsenic compounds mild extraction procedures (0.05 M (NH(4))(2)SO(4), 0.01 M CaCl(2), and water) and soil solution sampling using suction cups were compared. Regarding the real soil conditions the extraction of fresh samples and/or in situ collection of soil solution are preferred among the sample pretreatments and/or soil extraction procedures. However, chemical stabilization of the solutions should be allowed and included in the analytical procedures for determination of individual arsenic compounds.
Homeland Security Research Improves the Nation's Ability to ...
Technical Brief Homeland Security (HS) Research develops data, tools, and technologies to minimize the impact of accidents, natural disasters, terrorist attacks, and other incidents that can result in toxic chemical, biological or radiological (CBR) contamination. HS Research develops ways to detect contamination, sampling strategies, sampling and analytical methods, cleanup methods, waste management approaches, exposure assessment methods, and decision support tools (including water system models). These contributions improve EPA’s response to a broad range of environmental disasters.
Sun, Yangbo; Chen, Long; Huang, Bisheng; Chen, Keli
2017-07-01
As a mineral, the traditional Chinese medicine calamine has a similar shape to many other minerals. Investigations of commercially available calamine samples have shown that there are many fake and inferior calamine goods sold on the market. The conventional identification method for calamine is complicated, therefore as a result of the large scale of calamine samples, a rapid identification method is needed. To establish a qualitative model using near-infrared (NIR) spectroscopy for rapid identification of various calamine samples, large quantities of calamine samples including crude products, counterfeits and processed products were collected and correctly identified using the physicochemical and powder X-ray diffraction method. The NIR spectroscopy method was used to analyze these samples by combining the multi-reference correlation coefficient (MRCC) method and the error back propagation artificial neural network algorithm (BP-ANN), so as to realize the qualitative identification of calamine samples. The accuracy rate of the model based on NIR and MRCC methods was 85%; in addition, the model, which took comprehensive multiple factors into consideration, can be used to identify crude calamine products, its counterfeits and processed products. Furthermore, by in-putting the correlation coefficients of multiple references as the spectral feature data of samples into BP-ANN, a BP-ANN model of qualitative identification was established, of which the accuracy rate was increased to 95%. The MRCC method can be used as a NIR-based method in the process of BP-ANN modeling.
Exploring the acceptability of human papillomavirus self-sampling among Muslim immigrant women.
Lofters, Aisha K; Vahabi, Mandana; Fardad, Mitra; Raza, Afrah
2017-01-01
With appropriate screening (ie, the Papanicolaou [Pap] test), cervical cancer is highly preventable, and high-income countries, including Canada, have observed significant decreases in cervical cancer mortality. However, certain subgroups, including immigrants from countries with large Muslim populations, experience disparities in cervical cancer screening. Little is known about the acceptability of human papillomavirus (HPV) self-sampling as a screening strategy among Muslim immigrant women in Canada. This study assessed cervical cancer screening practices, knowledge and attitudes, and acceptability of HPV self-sampling among Muslim immigrant women. A convenience sample of 30 women was recruited over a 3-month period (June-August 2015) in the Greater Toronto Area. All women were between 21 and 69 years old, foreign-born, and self-identified as Muslim, and had good knowledge of English. Data were collected through a self-completed questionnaire. More than half of the participants falsely indicated that Pap tests may cause cervical infection, and 46.7% indicated that the test is an intrusion on privacy. The majority of women reported that they would be willing to try HPV self-sampling, and more than half would prefer this method to provider-administered sampling methods. Barriers to self-sampling included confidence in the ability to perform the test and perceived cost, and facilitators included convenience and privacy being preserved. The results demonstrate that HPV self-sampling may provide a favorable alternative model of care to the traditional provider-administered Pap testing. These findings add important information to the literature related to promoting cancer screening among women who are under or never screened for cervical cancer.
Urban Land Cover Mapping Accuracy Assessment - A Cost-benefit Analysis Approach
NASA Astrophysics Data System (ADS)
Xiao, T.
2012-12-01
One of the most important components in urban land cover mapping is mapping accuracy assessment. Many statistical models have been developed to help design simple schemes based on both accuracy and confidence levels. It is intuitive that an increased number of samples increases the accuracy as well as the cost of an assessment. Understanding cost and sampling size is crucial in implementing efficient and effective of field data collection. Few studies have included a cost calculation component as part of the assessment. In this study, a cost-benefit sampling analysis model was created by combining sample size design and sampling cost calculation. The sampling cost included transportation cost, field data collection cost, and laboratory data analysis cost. Simple Random Sampling (SRS) and Modified Systematic Sampling (MSS) methods were used to design sample locations and to extract land cover data in ArcGIS. High resolution land cover data layers of Denver, CO and Sacramento, CA, street networks, and parcel GIS data layers were used in this study to test and verify the model. The relationship between the cost and accuracy was used to determine the effectiveness of each sample method. The results of this study can be applied to other environmental studies that require spatial sampling.
Selected Analytical Methods for Environmental Remediation and Recovery (SAM) - Home
The SAM Home page provides access to all information provided in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM), and includes a query function allowing users to search methods by analyte, sample type and instrumentation.
Method for measuring lead concentrations in blood
Nogar, Nicholas S.
2001-01-01
Method for measuring lead concentrations in blood. The present invention includes the use of resonant laser ablation to analyze .ltoreq.1 .mu.L (or equivalent mass) samples of blood for lead content. A typical finger prick, for example, yields about 10 .mu.L. Solid samples may also readily be analyzed by resonant laser ablation. The sample is placed on a lead-free, electrically conducting substrate and irradiated with a single, focused laser beam which simultaneously vaporizes, atomizes, and resonantly ionizes an analyte of interest in a sample. The ions are then sorted, collected and detected using a mass spectrometer.
Spectroscopic diagnostics for bacteria in biologic sample
El-Sayed, Mostafa A.; El-Sayed, Ivan H.
2002-01-01
A method to analyze and diagnose specific bacteria in a biologic sample using spectroscopy is disclosed. The method includes obtaining the spectra of a biologic sample of a non-infected patient for use as a reference, subtracting the reference from the spectra of an infected sample, and comparing the fingerprint regions of the resulting differential spectrum with reference spectra of bacteria in saline. Using this diagnostic technique, specific bacteria can be identified sooner and without culturing, bacteria-specific antibiotics can be prescribed sooner, resulting in decreased likelihood of antibiotic resistance and an overall reduction of medical costs.
Desmarchelier, Aurélien; Anizan, Sébastien; Minh Tien, Mai; Savoy, Marie-Claude; Bion, Cindy
2018-04-01
An LC-MS/MS method is presented for screening five tetracyclines and their epimers in a broad range of food products. The scope of matrices includes meat-, fish-, seafood-based products, various dairy ingredients, infant formulae and fats. The method principle is based on a liquid-liquid extraction with aqueous ethylenediaminetetraacetic acid (EDTA) and acetonitrile followed by a freezing step to promote phase separation at low temperature. After defatting with hexane, sample extracts were evaporated and reconstituted before injection onto the LC-MS/MS system. The addition of oxalic acid in the aqueous mobile phase was mandatory to maintain good peak shape and sensitivity over the run. The screening is based upon a double preparation of each sample, one 'as such' and a second one with the analytes spiked in the sample, in order to mitigate the risk of false negative response. The method was validated according to the European Community Reference Laboratories Residues Guidelines. A total of 93 samples were included in the validation by two independent laboratories giving both false-negative and false-positive rates at 0% for all compounds. Over the last two years, 2600 samples were analysed routinely and only one chicken sample was found above the regulatory limit.
Measuring solids concentration in stormwater runoff: comparison of analytical methods.
Clark, Shirley E; Siu, Christina Y S
2008-01-15
Stormwater suspended solids typically are quantified using one of two methods: aliquot/subsample analysis (total suspended solids [TSS]) or whole-sample analysis (suspended solids concentration [SSC]). Interproject comparisons are difficult because of inconsistencies in the methods and in their application. To address this concern, the suspended solids content has been measured using both methodologies in many current projects, but the question remains about how to compare these values with historical water-quality data where the analytical methodology is unknown. This research was undertaken to determine the effect of analytical methodology on the relationship between these two methods of determination of the suspended solids concentration, including the effect of aliquot selection/collection method and of particle size distribution (PSD). The results showed that SSC was best able to represent the known sample concentration and that the results were independent of the sample's PSD. Correlations between the results and the known sample concentration could be established for TSS samples, but they were highly dependent on the sample's PSD and on the aliquot collection technique. These results emphasize the need to report not only the analytical method but also the particle size information on the solids in stormwater runoff.
NASA Astrophysics Data System (ADS)
Hu, Jiexiang; Zhou, Qi; Jiang, Ping; Shao, Xinyu; Xie, Tingli
2018-01-01
Variable-fidelity (VF) modelling methods have been widely used in complex engineering system design to mitigate the computational burden. Building a VF model generally includes two parts: design of experiments and metamodel construction. In this article, an adaptive sampling method based on improved hierarchical kriging (ASM-IHK) is proposed to refine the improved VF model. First, an improved hierarchical kriging model is developed as the metamodel, in which the low-fidelity model is varied through a polynomial response surface function to capture the characteristics of a high-fidelity model. Secondly, to reduce local approximation errors, an active learning strategy based on a sequential sampling method is introduced to make full use of the already required information on the current sampling points and to guide the sampling process of the high-fidelity model. Finally, two numerical examples and the modelling of the aerodynamic coefficient for an aircraft are provided to demonstrate the approximation capability of the proposed approach, as well as three other metamodelling methods and two sequential sampling methods. The results show that ASM-IHK provides a more accurate metamodel at the same simulation cost, which is very important in metamodel-based engineering design problems.
Alum, Absar; Rock, Channah; Abbaszadegan, Morteza
2014-01-01
For land application, biosolids are classified as Class A or Class B based on the levels of bacterial, viral, and helminths pathogens in residual biosolids. The current EPA methods for the detection of these groups of pathogens in biosolids include discrete steps. Therefore, a separate sample is processed independently to quantify the number of each group of the pathogens in biosolids. The aim of the study was to develop a unified method for simultaneous processing of a single biosolids sample to recover bacterial, viral, and helminths pathogens. At the first stage for developing a simultaneous method, nine eluents were compared for their efficiency to recover viruses from a 100 gm spiked biosolids sample. In the second stage, the three top performing eluents were thoroughly evaluated for the recovery of bacteria, viruses, and helminthes. For all three groups of pathogens, the glycine-based eluent provided higher recovery than the beef extract-based eluent. Additional experiments were performed to optimize performance of glycine-based eluent under various procedural factors such as, solids to eluent ratio, stir time, and centrifugation conditions. Last, the new method was directly compared with the EPA methods for the recovery of the three groups of pathogens spiked in duplicate samples of biosolids collected from different sources. For viruses, the new method yielded up to 10% higher recoveries than the EPA method. For bacteria and helminths, recoveries were 74% and 83% by the new method compared to 34% and 68% by the EPA method, respectively. The unified sample processing method significantly reduces the time required for processing biosolids samples for different groups of pathogens; it is less impacted by the intrinsic variability of samples, while providing higher yields (P = 0.05) and greater consistency than the current EPA methods.
Contaminants of emerging concern in the lower Stillaguamish River Basin, Washington, 2008-11
Wagner, Richard J.; Moran, Patrick W.; Zaugg, Steven D.; Sevigny, Jennifer M.; Pope, Judy M.
2014-01-01
A series of discrete water-quality samples were collected in the lower Stillaguamish River Basin near the city of Arlington, Washington, through a partnership with the Stillaguamish Tribe of Indians. These samples included surface waters of the Stillaguamish River, adjacent tributary streams, and paired inflow and outflow sampling at three wastewater treatment plants in the lower river basin. Chemical analysis of these samples focused on chemicals of emerging concern, including wastewater compounds, human-health pharmaceuticals, steroidal hormones, and halogenated organic compounds on solids and sediment. This report presents the methods used and data results from the chemical analysis of these samples
Spötl, Christoph
2005-09-01
The stable carbon isotopic composition of dissolved inorganic carbon (delta13C(DIC)) is traditionally determined using either direct precipitation or gas evolution methods in conjunction with offline gas preparation and measurement in a dual-inlet isotope ratio mass spectrometer. A gas evolution method based on continuous-flow technology is described here, which is easy to use and robust. Water samples (100-1500 microl depending on the carbonate alkalinity) are injected into He-filled autosampler vials in the field and analysed on an automated continuous-flow gas preparation system interfaced to an isotope ratio mass spectrometer. Sample analysis time including online preparation is 10 min and overall precision is 0.1 per thousand. This method is thus fast and can easily be automated for handling large sample batches.
NASA Astrophysics Data System (ADS)
Chapon, Arnaud; Pigrée, Gilbert; Putmans, Valérie; Rogel, Gwendal
Search for low-energy β contaminations in industrial environments requires using Liquid Scintillation Counting. This indirect measurement method supposes a fine control from sampling to measurement itself. Thus, in this paper, we focus on the definition of a measurement method, as generic as possible, for both smears and aqueous samples' characterization. That includes choice of consumables, sampling methods, optimization of counting parameters and definition of energy windows, using the maximization of a Figure of Merit. Detection limits are then calculated considering these optimized parameters. For this purpose, we used PerkinElmer Tri-Carb counters. Nevertheless, except those relative to some parameters specific to PerkinElmer, most of the results presented here can be extended to other counters.
Formal Functional Test Designs: Bridging the Gap Between Test Requirements and Test Specifications
NASA Technical Reports Server (NTRS)
Hops, Jonathan
1993-01-01
This presentation describes the testing life cycle, the purpose of the test design phase, and test design methods and gives an example application. Also included is a description of Test Representation Language (TRL), a summary of the language, and an example of an application of TRL. A sample test requirement and sample test design are included.
A guide to the use of distance sampling to estimate abundance of Karner blue butterflies
Grundel, Ralph
2015-01-01
This guide is intended to describe the use of distance sampling as a method for evaluating the abundance of Karner blue butterflies at a location. Other methods for evaluating abundance exist, including mark-release-recapture and index counts derived from Pollard-Yates surveys, for example. Although this guide is not intended to be a detailed comparison of the pros and cons of each type of method, there are important preliminary considerations to think about before selecting any method for evaluating the abundance of Karner blue butterflies.
Microfluidics apparatus and methods for use thereof
Peeters, John P.; Wiggins, Thomas; Ghosh, Madhushree; Bottomley, Lawrence A.; Seminara, Salvatore; Hu, Zhiyu; Seeley, Timothy; Kossek, Sebastian
2005-08-09
A microfluidics device includes a plurality of interaction cells and fluid control means including i) means for providing to the interaction cells a preparation fluid, and ii) means for providing to the interaction cells a sample fluid, wherein each interaction cell receives a different sample fluid. A plurality of microcantilevers may be disposed in each of the interaction cells, wherein each of the plurality of microcantilevers configured to deflect in response to an interaction involving a component of the sample fluid.
Nanoparticle-based gas sensors and methods of using the same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mickelson, William; Zettl, Alex
Gas sensors are provided. The gas sensors include a gas sensing element having metal oxide nanoparticles and a thin-film heating element. Systems that include the gas sensors, as well as methods of using the gas sensors, are also provided. Embodiments of the present disclosure find use in a variety of different applications, including detecting whether an analyte is present in a gaseous sample.
Survey of South African fruit juices using a fast screening HILIC-MS method.
Stander, Marietjie A; Kühn, Wernich; Hiten, Nicholas F
2013-01-01
Adulteration of fruit juices--by the addition of sugar or other less expensive fruit juices as well as preservatives, artificial sweeteners and colours--was tested for by using a developed screening method. The method employs hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS) using electrospray ionisation in the negative mode and ultraviolet light detection. Different fruit juices can be differentiated by the content of marker compounds like sorbitol, certain phenolic molecules and their saccharide profile. This method was used to test 46 fruit juice samples from the retail market as well as 12 control samples. The study focused on the main types of fruit juices consumed on the South African market including apple, orange, grape and blends of these juices with other fruits like mango, pear and guava. Overall, the 46 samples tested mostly agreed with label claims. One grape juice sample was adulterated, probably with apple juice. Natamycin above the legal limits was found in two samples. In addition, two samples contained natamycin and one sample benzoate without it being indicated on the label. The method is well suited as a quick screening method for fruit juice adulteration and if used routinely would reduce fruit juice adulteration without the cost of the current array of tests needed for authenticity testing.
Development and validation of an HPLC–MS/MS method to determine clopidogrel in human plasma
Liu, Gangyi; Dong, Chunxia; Shen, Weiwei; Lu, Xiaopei; Zhang, Mengqi; Gui, Yuzhou; Zhou, Qinyi; Yu, Chen
2015-01-01
A quantitative method for clopidogrel using online-SPE tandem LC–MS/MS was developed and fully validated according to the well-established FDA guidelines. The method achieves adequate sensitivity for pharmacokinetic studies, with lower limit of quantifications (LLOQs) as low as 10 pg/mL. Chromatographic separations were performed on reversed phase columns Kromasil Eternity-2.5-C18-UHPLC for both methods. Positive electrospray ionization in multiple reaction monitoring (MRM) mode was employed for signal detection and a deuterated analogue (clopidogrel-d4) was used as internal standard (IS). Adjustments in sample preparation, including introduction of an online-SPE system proved to be the most effective method to solve the analyte back-conversion in clinical samples. Pooled clinical samples (two levels) were prepared and successfully used as real-sample quality control (QC) in the validation of back-conversion testing under different conditions. The result showed that the real samples were stable in room temperature for 24 h. Linearity, precision, extraction recovery, matrix effect on spiked QC samples and stability tests on both spiked QCs and real sample QCs stored in different conditions met the acceptance criteria. This online-SPE method was successfully applied to a bioequivalence study of 75 mg single dose clopidogrel tablets in 48 healthy male subjects. PMID:26904399
Localized surface plasmon resonance mercury detection system and methods
James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.
2016-03-22
A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.
Arrayed Micro-Ring Spectrometer System and Method of Use
NASA Technical Reports Server (NTRS)
Choi, Sang H. (Inventor); Park, Yeonjoon (Inventor); King, Glen C. (Inventor); Elliott, James R. (Inventor)
2012-01-01
A spectrometer system includes an array of micro-zone plates (MZP) each having coaxially-aligned ring gratings, a sample plate for supporting and illuminating a sample, and an array of photon detectors for measuring a spectral characteristic of the predetermined wavelength. The sample plate emits an evanescent wave in response to incident light, which excites molecules of the sample to thereby cause an emission of secondary photons. A method of detecting the intensity of a selected wavelength of incident light includes directing the incident light onto an array of MZP, diffracting a selected wavelength of the incident light onto a target focal point using the array of MZP, and detecting the intensity of the selected portion using an array of photon detectors. An electro-optic layer positioned adjacent to the array of MZP may be excited via an applied voltage to select the wavelength of the incident light.
NASA Technical Reports Server (NTRS)
Whiitson, Peggy A. (Inventor); Clift, Vaughan L. (Inventor)
1999-01-01
The present invention provides a method and apparatus for separating a blood sample having a volume of up to about 20 milliliters into cellular and acellular fractions. The apparatus includes a housing divided by a fibrous filter into a blood sample collection chamber having a volume of at least about 1 milliliter and a serum sample collection chamber. The fibrous filter has a pore size of less than about 3 microns, and is coated with a mixture including between about 1-40 wt/vol % mannitol and between about 0.1-15 wt/vol % of plasma fraction protein (or an animal or vegetable equivalent thereof). The coating causes the cellular fraction to be trapped by the small pores, leaving the cellular fraction intact on the fibrous filter while the acellular fraction passes through the filter for collection in unaltered form from the serum sample collection chamber.
Method for the detection of nitro-containing compositions using ultraviolet photolysis
Reagen, William K.; Lancaster, Gregory D.; Partin, Judy K.; Moore, Glenn A.
2000-01-01
A method for detecting nitro-containing compositions (e.g. nitrate/nitrite materials) in water samples and on solid substrates. In a water sample, ultraviolet light is applied to the sample so that dissolved nitro compositions therein will photolytically dissociate into gaseous nitrogen oxides (NO.sub.2(g) and/or NO.sub.(g)). A carrier gas is then introduced into the sample to generate a gaseous stream which includes the carrier gas combined with any gaseous nitrogen oxides. The carrier gas is thereafter directed into a detector. To detect nitro-compositions on solid substrates, ultraviolet light is applied thereto. A detector is then used to detect any gaseous nitrogen oxides which are photolytically generated during ultraviolet illumination. An optional carrier gas may be applied to the substrate during illumination to produce a gaseous stream which includes the carrier gas and any gaseous nitrogen oxides. The gaseous stream is then supplied to the detector.
Conaway, Christopher; Thordsen, James J.; Manning, Michael A.; Cook, Paul J.; Trautz, Robert C.; Thomas, Burt; Kharaka, Yousif K.
2016-01-01
The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a characterization well in the Citronelle Oil Field, Alabama, as part of the Southeast Regional Carbon Sequestration Partnership (SECARB) Phase III Anthropogenic Test, which is an integrated carbon capture and storage project. In this study, formation water and gas samples were obtained from well D-9-8 #2 at Citronelle using gas lift, electric submersible pump, U-tube, and a downhole vacuum sampler (VS) and subjected to both field and laboratory analyses. Field chemical analyses included electrical conductivity, dissolved sulfide concentration, alkalinity, and pH; laboratory analyses included major, minor and trace elements, dissolved carbon, volatile fatty acids, free and dissolved gas species. The formation water obtained from this well is a Na–Ca–Cl-type brine with a salinity of about 200,000 mg/L total dissolved solids. Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity. There was little gas in samples, and gas composition results were strongly influenced by sampling methods. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the VS and U-tube system performing most favorably in this aspect.
Sample detection and analysis techniques for electrophoretic separation
NASA Technical Reports Server (NTRS)
Falb, R. D.; Hughes, K. E.; Powell, T. R.
1975-01-01
Methods for detecting and analyzing biological agents suitable for space flight operations were studied primarily by literature searches which were conducted of cell separation techniques. Detection methods discussed include: photometrometric, electric, radiometric, micrometry, ultrasonic, microscopic, and photographic. A bibliography, and a directory of vendors are included along with an index of commercial hardware.
Laboratory maintenance of Treponema denticola.
Fenno, J Christopher
2005-10-01
This unit describes the methods, media, and equipment necessary for routine laboratory culture and handling of the anaerobic oral spirochete Treponema denticola. Topics discussed include nutrient requirements, recommended media formulations, and expected growth kinetics, as well as methods and equipment necessary to maintain anaerobic conditions. An additional protocol on isolation of T. denticola from clinical samples is included.
ERIC Educational Resources Information Center
Tipton, Elizabeth; Fellers, Lauren; Caverly, Sarah; Vaden-Kiernan, Michael; Borman, Geoffrey; Sullivan, Kate; Ruiz de Castilla, Veronica
2016-01-01
Recently, statisticians have begun developing methods to improve the generalizability of results from large-scale experiments in education. This work has included the development of methods for improved site selection when random sampling is infeasible, including the use of stratification and targeted recruitment strategies. This article provides…
Cromwell, Elizabeth A; Ngondi, Jeremiah; McFarland, Deborah; King, Jonathan D; Emerson, Paul M
2012-10-01
In the context of trachoma control, population coverage with mass drug administration (MDA) using antibiotics is measured using routine data. Due to the limitations of administrative records as well as the potential for bias from incomplete or incorrect records, a literature review of coverage survey methods applied in neglected tropical disease control programmes and immunisation outreach was conducted to inform the design of coverage surveys for trachoma control. Several methods were identified, including the '30 × 7' survey method for the Expanded Programme on Immunization (EPI 30×7), other cluster random sampling (CRS) methods, lot quality assurance sampling (LQAS), purposive sampling and routine data. When compared against one another, the EPI and other CRS methods produced similar population coverage estimates, whilst LQAS, purposive sampling and use of administrative data did not generate estimates consistent with CRS. In conclusion, CRS methods present a consistent approach for MDA coverage surveys despite different methods of household selection. They merit use until standard guidelines are available. CRS methods should be used to verify population coverage derived from LQAS, purposive sampling methods and administrative reports. Copyright © 2012 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.
NATIONAL RESPONSE TEAM TECHNICAL ASSISTANCE ...
This document provides technical information on a wide range of activities to aid in response to intentional release of anthrax in urban environments. It includes initial actions when a potential release is discovered, health and safety issues for responders, sampling and analysis methods, decontamination technologies, decontamination waste disposal, and communication with public. This document provides technical information on a wide range of activities to aid in response to intentional release of anthrax in urban environments. It includes initial actions when a potential release is discovered, health and safety issues for responders, sampling and analysis methods, decontamination technologies, decontamination waste disposal, and communication with public.
NASA Astrophysics Data System (ADS)
Kuo, C.; Hsu, B.; Shen, T.; Tseng, S.; Tsai, J.; Huang, K.; Kao, P.; Chen, J.
2013-12-01
Salmonella spp. is a common water-borne pathogens and its genus comprises more than 2,500 serotypes. Major pathogenic genotypes which cause typhoid fever, enteritis and other intestinal-type diseases are S. Typhimurium, S. Enteritidis, S. Stanley, S. Agona, S.Albany, S. Schwarzengrund, S. Newport, S. Choleraesuis, and S. Derby. Hence, the identification of the serotypes of Salmonella spp. is important. In the present study, the analytical procedures include direct concentration method, non-selective pre-enrichment method and selective enrichment method of Salmonella spp.. Both selective enrichment method and cultured bacteria were detected with specific primers of Salmonella spp. by polymerase chain reaction (PCR). At last, the serotypes of Salmonella were confirmed by using MLST (multilocus sequence typing) with aroC, dnaN, hemD, hisD, purE, sucA, thrA housekeeping genes to identify the strains of positive samples. This study contains 121 samples from three different types of water sources including the drinking water (51), streams (45), and swine wastewater (25). Thirteen samples with positive invA gene are separated from culture method. The strains of these positive samples which identified from MLST method are S. Albany, S. Typhimurium, S. Newport, S. Bareilly, and S. Derby. Some of the serotypes, S. Albany, S. Typhimurium and S. Newport, are highly pathogenic which correlated to human diarrhea. In our results, MLST is a useful method to identify the strains of Salmonella spp.. Keywords: Salmonella, PCR, MLST.
Woo, Kang-Lyung
2005-01-01
Low molecular weight alcohols including fusel oil were determined using diethyl ether extraction and capillary gas chromatography. Twelve kinds of alcohols were successfully resolved on the HP-FFAP (polyethylene glycol) capillary column. The diethyl ether extraction method was very useful for the analysis of alcohols in alcoholic beverages and biological samples with excellent cleanliness of the resulting chromatograms and high sensitivity compared to the direct injection method. Calibration graphs for all standard alcohols showed good linearity in the concentration range used, 0.001-2% (w/v) for all alcohols. Salting out effects were significant (p < 0.01) for the low molecular weight alcohols methanol, isopropanol, propanol, 2-butanol, n-butanol and ethanol, but not for the relatively high molecular weight alcohols amyl alcohol, isoamyl alcohol, and heptanol. The coefficients of variation of the relative molar responses were less than 5% for all of the alcohols. The limits of detection and quantitation were 1-5 and 10-60 microg/L for the diethyl ether extraction method, and 10-50 and 100-350 microg/L for the direct injection method, respectively. The retention times and relative retention times of standard alcohols were significantly shifted in the direct injection method when the injection volumes were changed, even with the same analysis conditions, but they were not influenced in the diethyl ether extraction method. The recoveries by the diethyl ether extraction method were greater than 95% for all samples and greater than 97% for biological samples.
The importance of quality control in validating concentrations ...
A national-scale survey of 247 contaminants of emerging concern (CECs), including organic and inorganic chemical compounds, and microbial contaminants, was conducted in source and treated drinking water samples from 25 treatment plants across the United States. Multiple methods were used to determine these CECs, including six analytical methods to measure 174 pharmaceuticals, personal care products, and pesticides. A three-component quality assurance/quality control (QA/QC) program was designed for the subset of 174 CECs which allowed us to assess and compare performances of the methods used. The three components included: 1) a common field QA/QC protocol and sample design, 2) individual investigator-developed method-specific QA/QC protocols, and 3) a suite of 46 method comparison analytes that were determined in two or more analytical methods. Overall method performance for the 174 organic chemical CECs was assessed by comparing spiked recoveries in reagent, source, and treated water over a two-year period. In addition to the 247 CECs reported in the larger drinking water study, another 48 pharmaceutical compounds measured did not consistently meet predetermined quality standards. Methodologies that did not seem suitable for these analytes are overviewed. The need to exclude analytes based on method performance demonstrates the importance of additional QA/QC protocols. This paper compares the method performance of six analytical methods used to measure 174 emer
Code of Federal Regulations, 2013 CFR
2013-10-01
... include definitions of injury, guidance on determining pathways, and testing and sampling methods. These methods are to be used to determine both the pathways through which resources have been exposed to oil or...
Code of Federal Regulations, 2014 CFR
2014-10-01
... include definitions of injury, guidance on determining pathways, and testing and sampling methods. These methods are to be used to determine both the pathways through which resources have been exposed to oil or...
Code of Federal Regulations, 2011 CFR
2011-10-01
... include definitions of injury, guidance on determining pathways, and testing and sampling methods. These methods are to be used to determine both the pathways through which resources have been exposed to oil or...
Code of Federal Regulations, 2010 CFR
2010-10-01
... include definitions of injury, guidance on determining pathways, and testing and sampling methods. These methods are to be used to determine both the pathways through which resources have been exposed to oil or...
Code of Federal Regulations, 2012 CFR
2012-10-01
... include definitions of injury, guidance on determining pathways, and testing and sampling methods. These methods are to be used to determine both the pathways through which resources have been exposed to oil or...
Goodman, Laura B; McDonough, Patrick L; Anderson, Renee R; Franklin-Guild, Rebecca J; Ryan, James R; Perkins, Gillian A; Thachil, Anil J; Glaser, Amy L; Thompson, Belinda S
2017-11-01
Rapid screening for enteric bacterial pathogens in clinical environments is essential for biosecurity. Salmonella found in veterinary hospitals, particularly Salmonella enterica serovar Dublin, can pose unique challenges for culture and testing because of its poor growth. Multiple Salmonella serovars including Dublin are emerging threats to public health given increasing prevalence and antimicrobial resistance. We adapted an automated food testing method to veterinary samples and evaluated the performance of the method in a variety of matrices including environmental samples ( n = 81), tissues ( n = 52), feces ( n = 148), and feed ( n = 29). A commercial kit was chosen as the basis for this approach in view of extensive performance characterizations published by multiple independent organizations. A workflow was established for efficiently and accurately testing veterinary matrices and environmental samples by use of real-time PCR after selective enrichment in Rappaport-Vassiliadis soya (RVS) medium. Using this method, the detection limit for S. Dublin improved by 100-fold over subculture on selective agars (eosin-methylene blue, brilliant green, and xylose-lysine-deoxycholate). Overall, the procedure was effective in detecting Salmonella spp. and provided next-day results.
Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies
Amir, Amnon; Metcalf, Jessica L.; Amato, Katherine R.; Xu, Zhenjiang Zech; Humphrey, Greg
2016-01-01
ABSTRACT Immediate freezing at −20°C or below has been considered the gold standard for microbiome preservation, yet this approach is not feasible for many field studies, ranging from anthropology to wildlife conservation. Here we tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including such types of variation as freeze-thaw cycles and the high temperature fluctuations often encountered under field conditions. We found that three of the methods—95% ethanol, FTA cards, and the OMNIgene Gut kit—can preserve samples sufficiently well at ambient temperatures such that differences at 8 weeks are comparable to differences among technical replicates. However, even the worst methods, including those with no fixative, were able to reveal microbiome differences between species at 8 weeks and between individuals after a week, allowing meta-analyses of samples collected using various methods when the effect of interest is expected to be larger than interindividual variation (although use of a single method within a study is strongly recommended to reduce batch effects). Encouragingly for FTA cards, the differences caused by this method are systematic and can be detrended. As in other studies, we strongly caution against the use of 70% ethanol. The results, spanning 15 individuals and over 1,200 samples, provide our most comprehensive view to date of storage effects on stool and provide a paradigm for the future studies of other sample types that will be required to provide a global view of microbial diversity and its interaction among humans, animals, and the environment. IMPORTANCE Our study, spanning 15 individuals and over 1,200 samples, provides our most comprehensive view to date of storage and stabilization effects on stool. We tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including the types of variation often encountered under field conditions, such as freeze-thaw cycles and high temperature fluctuations. We show that several cost-effective methods provide excellent microbiome stability out to 8 weeks, opening up a range of field studies with humans and wildlife that would otherwise be cost-prohibitive. PMID:27822526
40 CFR 60.715 - Test methods and procedures.
Code of Federal Regulations, 2010 CFR
2010-07-01
... base film (i.e., the sample shall include any dilution solvent or other VOC added during the... for gas analysis. (f) Method 4 is used for stack gas moisture. (g) Methods 2, 2A, 2C, 2D, 3, and 4...
LARGE RIVER ASSESSMENT METHODS FOR BENTHIC MACROINVERTEBRATES AND FISH
Multiple projects are currently underway to increase our understanding of the varying results of different sampling methods and designs used for the biological assessment and monitoring of large (boatable) rivers. Studies include methods used to assess fish, benthic macroinverte...
CRITERIA FOR EVALUATION OF PROPOSED PROTOZOAN DETECTION METHODS
There has been a proliferation of techniques and methods reported for analysis of water samples to determine the presence of the protozoan pathogens Cryptosporidium parvum and Giardia lamblia. Many of the proposed methods are presented as complete procedures, which include sampli...
CRITERIA FOR EVALUATION OF PROPOSED PROTOZOAN DETECTION METHODS.
There has been a proliferation of techniques and methods reported for analysis of water samples to determine the presence of the protozoan pathogens Cryptosporidium parvum and Giardia lamblia. Many of the proposed methods are presented as complete procedures, which include sampli...
EPA's methods for analyzing PFAS in environmental media are in various stages of development. This fact sheet summarizes EPA's analytical methods development for groundwater, surface water, wastewater, and solids, including soils, sediments, and biosolids
Microcoulometric measurement of water in minerals
Cremer, M.; Elsheimer, H.N.; Escher, E.E.
1972-01-01
A DuPont Moisture Analyzer is used in a microcoulometric method for determining water in minerals. Certain modifications, which include the heating of the sample outside the instrument, protect the system from acid gases and insure the conversion of all hydrogen to water vapor. Moisture analyzer data are compared to concurrent data obtained by a modified Penfield method. In general, there is a positive bias of from 0.1 to 0.2% in the moisture analyzer results and a similarity of bias in minerals of the same kind. Inhomogeneity, sample size, and moisture pick-up are invoked to explain deviations. The method is particularly applicable to small samples. ?? 1972.
Surface sampling concentration and reaction probe
Van Berkel, Gary J; Elnaggar, Mariam S
2013-07-16
A method of analyzing a chemical composition of a specimen is described. The method can include providing a probe comprising an outer capillary tube and an inner capillary tube disposed co-axially within the outer capillary tube, where the inner and outer capillary tubes define a solvent capillary and a sampling capillary in fluid communication with one another at a distal end of the probe; contacting a target site on a surface of a specimen with a solvent in fluid communication with the probe; maintaining a plug volume proximate a solvent-specimen interface, wherein the plug volume is in fluid communication with the probe; draining plug sampling fluid from the plug volume through the sampling capillary; and analyzing a chemical composition of the plug sampling fluid with an analytical instrument. A system for performing the method is also described.
Chen, Xiaoyuan; Wai, Chien M.; Fisher, Darrell R.
2000-01-01
The invention pertains to compounds for binding lanthanide ions and actinide ions. The invention further pertains to compounds for binding radionuclides, and to methods of making radionuclide complexes. Also, the invention pertains to methods of extracting radionuclides. Additionally, the invention pertains to methods of delivering radionuclides to target locations. In one aspect, the invention includes a compound comprising: a) a calix[n]arene group, wherein n is an integer greater than 3, the calix[n]arene group comprising an upper rim and a lower rim; b) at least one ionizable group attached to the lower rim; and c) an ion selected from the group consisting of lanthanide and actinide elements bound to the ionizable group. In another aspect, the invention includes a method of extracting a radionuclide, comprising: a) providing a sample comprising a radionuclide; b) providing a calix[n]arene compound in contact with the sample, wherein n is an integer greater than 3; and c) extracting radionuclide from the sample into the calix[n]arene compound. In yet another aspect, the invention includes a method of delivering a radionuclide to a target location, comprising: a) providing a calix[n]arene compound, wherein n is an integer greater than 3, the calix[n]arene compound comprising at least one ionizable group; b) providing a radionuclide bound to the calix[n]arene compound; and c) providing an antibody attached to the calix[n]arene compound, the antibody being specific for a material found at the target location.
Silva, Nuno Miguel; Rio, Jeremy; Currat, Mathias
2017-12-15
Recent advances in sequencing technologies have allowed for the retrieval of ancient DNA data (aDNA) from skeletal remains, providing direct genetic snapshots from diverse periods of human prehistory. Comparing samples taken in the same region but at different times, hereafter called "serial samples", may indicate whether there is continuity in the peopling history of that area or whether an immigration of a genetically different population has occurred between the two sampling times. However, the exploration of genetic relationships between serial samples generally ignores their geographical locations and the spatiotemporal dynamics of populations. Here, we present a new coalescent-based, spatially explicit modelling approach to investigate population continuity using aDNA, which includes two fundamental elements neglected in previous methods: population structure and migration. The approach also considers the extensive temporal and geographical variance that is commonly found in aDNA population samples. We first showed that our spatially explicit approach is more conservative than the previous (panmictic) approach and should be preferred to test for population continuity, especially when small and isolated populations are considered. We then applied our method to two mitochondrial datasets from Germany and France, both including modern and ancient lineages dating from the early Neolithic. The results clearly reject population continuity for the maternal line over the last 7500 years for the German dataset but not for the French dataset, suggesting regional heterogeneity in post-Neolithic migratory processes. Here, we demonstrate the benefits of using a spatially explicit method when investigating population continuity with aDNA. It constitutes an improvement over panmictic methods by considering the spatiotemporal dynamics of genetic lineages and the precise location of ancient samples. The method can be used to investigate population continuity between any pair of serial samples (ancient-ancient or ancient-modern) and to investigate more complex evolutionary scenarios. Although we based our study on mitochondrial DNA sequences, diploid molecular markers of different types (DNA, SNP, STR) can also be simulated with our approach. It thus constitutes a promising tool for the analysis of the numerous aDNA datasets being produced, including genome wide data, in humans but also in many other species.
Determination of polarimetric parameters of honey by near-infrared transflectance spectroscopy.
García-Alvarez, M; Ceresuela, S; Huidobro, J F; Hermida, M; Rodríguez-Otero, J L
2002-01-30
NIR transflectance spectroscopy was used to determine polarimetric parameters (direct polarization, polarization after inversion, specific rotation in dry matter, and polarization due to nonmonosaccharides) and sucrose in honey. In total, 156 honey samples were collected during 1992 (45 samples), 1995 (56 samples), and 1996 (55 samples). Samples were analyzed by NIR spectroscopy and polarimetric methods. Calibration (118 samples) and validation (38 samples) sets were made up; honeys from the three years were included in both sets. Calibrations were performed by modified partial least-squares regression and scatter correction by standard normal variation and detrend methods. For direct polarization, polarization after inversion, specific rotation in dry matter, and polarization due to nonmonosaccharides, good statistics (bias, SEV, and R(2)) were obtained for the validation set, and no statistically (p = 0.05) significant differences were found between instrumental and polarimetric methods for these parameters. Statistical data for sucrose were not as good as those of the other parameters. Therefore, NIR spectroscopy is not an effective method for quantitative analysis of sucrose in these honey samples. However, NIR spectroscopy may be an acceptable method for semiquantitative evaluation of sucrose for honeys, such as those in our study, containing up to 3% of sucrose. Further work is necessary to validate the uncertainty at higher levels.
Creating ensembles of decision trees through sampling
Kamath, Chandrika; Cantu-Paz, Erick
2005-08-30
A system for decision tree ensembles that includes a module to read the data, a module to sort the data, a module to evaluate a potential split of the data according to some criterion using a random sample of the data, a module to split the data, and a module to combine multiple decision trees in ensembles. The decision tree method is based on statistical sampling techniques and includes the steps of reading the data; sorting the data; evaluating a potential split according to some criterion using a random sample of the data, splitting the data, and combining multiple decision trees in ensembles.
Chen, I-Jen; Foloppe, Nicolas
2013-12-15
Computational conformational sampling underpins much of molecular modeling and design in pharmaceutical work. The sampling of smaller drug-like compounds has been an active area of research. However, few studies have tested in details the sampling of larger more flexible compounds, which are also relevant to drug discovery, including therapeutic peptides, macrocycles, and inhibitors of protein-protein interactions. Here, we investigate extensively mainstream conformational sampling methods on three carefully curated compound sets, namely the 'Drug-like', larger 'Flexible', and 'Macrocycle' compounds. These test molecules are chemically diverse with reliable X-ray protein-bound bioactive structures. The compared sampling methods include Stochastic Search and the recent LowModeMD from MOE, all the low-mode based approaches from MacroModel, and MD/LLMOD recently developed for macrocycles. In addition to default settings, key parameters of the sampling protocols were explored. The performance of the computational protocols was assessed via (i) the reproduction of the X-ray bioactive structures, (ii) the size, coverage and diversity of the output conformational ensembles, (iii) the compactness/extendedness of the conformers, and (iv) the ability to locate the global energy minimum. The influence of the stochastic nature of the searches on the results was also examined. Much better results were obtained by adopting search parameters enhanced over the default settings, while maintaining computational tractability. In MOE, the recent LowModeMD emerged as the method of choice. Mixed torsional/low-mode from MacroModel performed as well as LowModeMD, and MD/LLMOD performed well for macrocycles. The low-mode based approaches yielded very encouraging results with the flexible and macrocycle sets. Thus, one can productively tackle the computational conformational search of larger flexible compounds for drug discovery, including macrocycles. Copyright © 2013 Elsevier Ltd. All rights reserved.
Determination of micro amounts of iron, aluminum, and alkaline earth metals in silicon carbide
NASA Technical Reports Server (NTRS)
Hirata, H.; Arai, M.
1978-01-01
A colorimetric method for analysis of micro components in silicon carbide used as the raw material for varistors is described. The microcomponents analyzed included iron soluble in hydrochloric acid, iron, aluminum, calcium and magnesium. Samples were analyzed by the method, and the results for iron and aluminum agreed well with the N.B.S. standard values and the values obtained by the other company. The method can therefore be applied to the analysis of actual samples.
Structural system reliability calculation using a probabilistic fault tree analysis method
NASA Technical Reports Server (NTRS)
Torng, T. Y.; Wu, Y.-T.; Millwater, H. R.
1992-01-01
The development of a new probabilistic fault tree analysis (PFTA) method for calculating structural system reliability is summarized. The proposed PFTA procedure includes: developing a fault tree to represent the complex structural system, constructing an approximation function for each bottom event, determining a dominant sampling sequence for all bottom events, and calculating the system reliability using an adaptive importance sampling method. PFTA is suitable for complicated structural problems that require computer-intensive computer calculations. A computer program has been developed to implement the PFTA.
Santos, Frédéric; Guyomarc'h, Pierre; Bruzek, Jaroslav
2014-12-01
Accuracy of identification tools in forensic anthropology primarily rely upon the variations inherent in the data upon which they are built. Sex determination methods based on craniometrics are widely used and known to be specific to several factors (e.g. sample distribution, population, age, secular trends, measurement technique, etc.). The goal of this study is to discuss the potential variations linked to the statistical treatment of the data. Traditional craniometrics of four samples extracted from documented osteological collections (from Portugal, France, the U.S.A., and Thailand) were used to test three different classification methods: linear discriminant analysis (LDA), logistic regression (LR), and support vector machines (SVM). The Portuguese sample was set as a training model on which the other samples were applied in order to assess the validity and reliability of the different models. The tests were performed using different parameters: some included the selection of the best predictors; some included a strict decision threshold (sex assessed only if the related posterior probability was high, including the notion of indeterminate result); and some used an unbalanced sex-ratio. Results indicated that LR tends to perform slightly better than the other techniques and offers a better selection of predictors. Also, the use of a decision threshold (i.e. p>0.95) is essential to ensure an acceptable reliability of sex determination methods based on craniometrics. Although the Portuguese, French, and American samples share a similar sexual dimorphism, application of Western models on the Thai sample (that displayed a lower degree of dimorphism) was unsuccessful. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
ERIC Educational Resources Information Center
Sherma, Joseph
1989-01-01
This review is devoted to methods for the determination of residues of pesticides and some related industrial chemicals. Topics include: residue methods, sampling, chromatography, organochlorine pesticides, organophosphorus pesticides, carbamate insecticides, herbicides, fungicides, pyrethrins, fumigants, and related chemicals. (MVL)
Use of Language Sample Analysis by School-Based SLPs: Results of a Nationwide Survey
ERIC Educational Resources Information Center
Pavelko, Stacey L.; Owens, Robert E., Jr.; Ireland, Marie; Hahs-Vaughn, Debbie L.
2016-01-01
Purpose: This article examines use of language sample analysis (LSA) by school-based speech-language pathologists (SLPs), including characteristics of language samples, methods of transcription and analysis, barriers to LSA use, and factors affecting LSA use, such as American Speech-Language-Hearing Association certification, number of years'…
Sample processing approach for detection of ricin in surface samples.
Kane, Staci; Shah, Sanjiv; Erler, Anne Marie; Alfaro, Teneile
2017-12-01
With several ricin contamination incidents reported over the past decade, rapid and accurate methods are needed for environmental sample analysis, especially after decontamination. A sample processing method was developed for common surface sampling devices to improve the limit of detection and avoid false negative/positive results for ricin analysis. Potential assay interferents from the sample matrix (bleach residue, sample material, wetting buffer), including reference dust, were tested using a Time-Resolved Fluorescence (TRF) immunoassay. Test results suggested that the sample matrix did not cause the elevated background fluorescence sometimes observed when analyzing post-bleach decontamination samples from ricin incidents. Furthermore, sample particulates (80mg/mL Arizona Test Dust) did not enhance background fluorescence or interfere with ricin detection by TRF. These results suggested that high background fluorescence in this immunoassay could be due to labeled antibody quality and/or quantity issues. Centrifugal ultrafiltration devices were evaluated for ricin concentration as a part of sample processing. Up to 30-fold concentration of ricin was observed by the devices, which serve to remove soluble interferents and could function as the front-end sample processing step to other ricin analytical methods. The procedure has the potential to be used with a broader range of environmental sample types and with other potential interferences and to be followed by other ricin analytical methods, although additional verification studies would be required. Published by Elsevier B.V.
Classical least squares multivariate spectral analysis
Haaland, David M.
2002-01-01
An improved classical least squares multivariate spectral analysis method that adds spectral shapes describing non-calibrated components and system effects (other than baseline corrections) present in the analyzed mixture to the prediction phase of the method. These improvements decrease or eliminate many of the restrictions to the CLS-type methods and greatly extend their capabilities, accuracy, and precision. One new application of PACLS includes the ability to accurately predict unknown sample concentrations when new unmodeled spectral components are present in the unknown samples. Other applications of PACLS include the incorporation of spectrometer drift into the quantitative multivariate model and the maintenance of a calibration on a drifting spectrometer. Finally, the ability of PACLS to transfer a multivariate model between spectrometers is demonstrated.
Devices, systems, and methods for detecting nucleic acids using sedimentation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory J.
Embodiments of the present invention are directed toward devices, systems, and method for conducting nucleic acid purification and quantification using sedimentation. In one example, a method includes generating complexes which bind to a plurality of beads in a fluid sample, individual ones of the complexes comprising a nucleic acid molecule such as DNA or RNA and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transportingmore » occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.« less
Method of performing sugar dehydration and catalyst treatment
Hu, Jianli [Kennewick, WA; Holladay, Johnathan E [Kennewick, WA; Zhang, Xinjie [Burlington, MA; Wang, Yong [Richland, WA
2010-06-01
The invention includes a method of treating a solid acid catalyst. After exposing the catalyst to a mixture containing a sugar alcohol, the catalyst is washed with an organic solvent and is then exposed to a second reaction mixture. The invention includes a process for production of anhydrosugar alcohol. A solid acid catalyst is provided to convert sugar alcohol in a first sample to an anhydrosugar alcohol. The catalyst is then washed with an organic solvent and is subsequently utilized to expose a second sample. The invention includes a method for selective production of an anhydrosugar. A solid acid catalyst is provided within a reactor and anhydrosugar alcohol is formed by flowing a starting sugar alcohol into the reactor. The acid catalyst is then exposed to an organic solvent which allows a greater amount of additional anhydrosugar to be produced than would occur without exposing the acid catalyst to the organic solvent.
Porosimetry as an effective method of fuel cell investigation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kazarinov, V.E.
1996-04-01
A porosimetric method is described for the investigation of all kinds of porous materials including soft or frail materials and powders. The method is well suited for the investigation of electrodes in fuel cells and batteries. The method is nondestructive and allows for repeated measurements on the same sample.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hsiao, H.H.; Lai, C.C.; Chu, H.W.
A new method for on-line monitoring of total hydrocarbons and non-methane hydrocarbons in stack gas simultaneously was developed in this study. Based on the principle of on-line GC/FID, the method was developed and can be considered as a new modification of the Method 25 and 25A of US EPA. Major advantages of the method included (1) capability of distinguishing methane as Method 25; (2) near-real-time results; (3) broad species coverage; (4) monitoring methane in straightforward manner; (5) low operation and maintenance costs. In the proposed method, test samples were continuously pumped from detection sources and loaded with a two-loop samplingmore » valve. The samples were then injected into two GC columns-empty and molecular sieve columns. The empty column was used for detection of THC, and the molecular sieve column was for methane. The detector in this GC was FID. NMHC concentration was obtained by subtracting methane from THC. The tests were carried out to measure the THC and methane in waste gas in various industries, including surface coating, semiconductor manufacturing, synthetic leather industries. Recovery rates of THC in the samples were between 86% to 114% for about 100 m of transfer line of samples. For the standard gas, the recovery rate was about 101%, 6.6 % of measurement precision, and 88%--114% of accuracy. The results showed the promising and reliable measurement of the test method for THC and methane in waste gas.« less
Preliminary evaluation of a gel tube agglutination major cross-match method in dogs.
Villarnovo, Dania; Burton, Shelley A; Horney, Barbara S; MacKenzie, Allan L; Vanderstichel, Raphaël
2016-09-01
A major cross-match gel tube test is available for use in dogs yet has not been clinically evaluated. This study compared cross-match results obtained using the gel tube and the standard tube methods for canine samples. Study 1 included 107 canine sample donor-recipient pairings cross-match tested with the RapidVet-H method gel tube test and compared results with the standard tube method. Additionally, 120 pairings using pooled sera containing anti-canine erythrocyte antibody at various concentrations were tested with leftover blood from a hospital population to assess sensitivity and specificity of the gel tube method in comparison with the standard method. The gel tube method had a good relative specificity of 96.1% in detecting lack of agglutination (compatibility) compared to the standard tube method. Agreement between the 2 methods was moderate. Nine of 107 pairings showed agglutination/incompatibility on either test, too few to allow reliable calculation of relative sensitivity. Fifty percent of the gel tube method results were difficult to interpret due to sample spreading in the reaction and/or negative control tubes. The RapidVet-H method agreed with the standard cross-match method on compatible samples, but detected incompatibility in some sample pairs that were compatible with the standard method. Evaluation using larger numbers of incompatible pairings is needed to assess diagnostic utility. The gel tube method results were difficult to categorize due to sample spreading. Weak agglutination reactions or other factors such as centrifuge model may be responsible. © 2016 American Society for Veterinary Clinical Pathology.
Microfluidic device and method for focusing, segmenting, and dispensing of a fluid stream
Jacobson, Stephen C.; Ramsey, J. Michael
2004-09-14
A microfluidic device for forming and/or dispensing minute volume segments of a material is described. In accordance with one aspect of the present invention, a microfluidic device and method is provided for spatially confining the material in a focusing element. The device is also capable of segmenting the confined material into minute volume segments, and dispensing a volume segment to a waste or collection channel. The device further includes means for driving the respective streams of sample and focusing fluids through respective channels into a chamber, such that the focusing fluid streams spatially confine the sample material. The device may also include additional means for driving a minute volume segment of the spatially confined sample material into a collection channel in fluid communication with the waste reservoir.
Flexible sampling large-scale social networks by self-adjustable random walk
NASA Astrophysics Data System (ADS)
Xu, Xiao-Ke; Zhu, Jonathan J. H.
2016-12-01
Online social networks (OSNs) have become an increasingly attractive gold mine for academic and commercial researchers. However, research on OSNs faces a number of difficult challenges. One bottleneck lies in the massive quantity and often unavailability of OSN population data. Sampling perhaps becomes the only feasible solution to the problems. How to draw samples that can represent the underlying OSNs has remained a formidable task because of a number of conceptual and methodological reasons. Especially, most of the empirically-driven studies on network sampling are confined to simulated data or sub-graph data, which are fundamentally different from real and complete-graph OSNs. In the current study, we propose a flexible sampling method, called Self-Adjustable Random Walk (SARW), and test it against with the population data of a real large-scale OSN. We evaluate the strengths of the sampling method in comparison with four prevailing methods, including uniform, breadth-first search (BFS), random walk (RW), and revised RW (i.e., MHRW) sampling. We try to mix both induced-edge and external-edge information of sampled nodes together in the same sampling process. Our results show that the SARW sampling method has been able to generate unbiased samples of OSNs with maximal precision and minimal cost. The study is helpful for the practice of OSN research by providing a highly needed sampling tools, for the methodological development of large-scale network sampling by comparative evaluations of existing sampling methods, and for the theoretical understanding of human networks by highlighting discrepancies and contradictions between existing knowledge/assumptions of large-scale real OSN data.
Evaluating Composite Sampling Methods of Bacillus Spores at Low Concentrations
Hess, Becky M.; Amidan, Brett G.; Anderson, Kevin K.; Hutchison, Janine R.
2016-01-01
Restoring all facility operations after the 2001 Amerithrax attacks took years to complete, highlighting the need to reduce remediation time. Some of the most time intensive tasks were environmental sampling and sample analyses. Composite sampling allows disparate samples to be combined, with only a single analysis needed, making it a promising method to reduce response times. We developed a statistical experimental design to test three different composite sampling methods: 1) single medium single pass composite (SM-SPC): a single cellulose sponge samples multiple coupons with a single pass across each coupon; 2) single medium multi-pass composite: a single cellulose sponge samples multiple coupons with multiple passes across each coupon (SM-MPC); and 3) multi-medium post-sample composite (MM-MPC): a single cellulose sponge samples a single surface, and then multiple sponges are combined during sample extraction. Five spore concentrations of Bacillus atrophaeus Nakamura spores were tested; concentrations ranged from 5 to 100 CFU/coupon (0.00775 to 0.155 CFU/cm2). Study variables included four clean surface materials (stainless steel, vinyl tile, ceramic tile, and painted dry wallboard) and three grime coated/dirty materials (stainless steel, vinyl tile, and ceramic tile). Analysis of variance for the clean study showed two significant factors: composite method (p< 0.0001) and coupon material (p = 0.0006). Recovery efficiency (RE) was higher overall using the MM-MPC method compared to the SM-SPC and SM-MPC methods. RE with the MM-MPC method for concentrations tested (10 to 100 CFU/coupon) was similar for ceramic tile, dry wall, and stainless steel for clean materials. RE was lowest for vinyl tile with both composite methods. Statistical tests for the dirty study showed RE was significantly higher for vinyl and stainless steel materials, but lower for ceramic tile. These results suggest post-sample compositing can be used to reduce sample analysis time when responding to a Bacillus anthracis contamination event of clean or dirty surfaces. PMID:27736999
Evaluating Composite Sampling Methods of Bacillus Spores at Low Concentrations.
Hess, Becky M; Amidan, Brett G; Anderson, Kevin K; Hutchison, Janine R
2016-01-01
Restoring all facility operations after the 2001 Amerithrax attacks took years to complete, highlighting the need to reduce remediation time. Some of the most time intensive tasks were environmental sampling and sample analyses. Composite sampling allows disparate samples to be combined, with only a single analysis needed, making it a promising method to reduce response times. We developed a statistical experimental design to test three different composite sampling methods: 1) single medium single pass composite (SM-SPC): a single cellulose sponge samples multiple coupons with a single pass across each coupon; 2) single medium multi-pass composite: a single cellulose sponge samples multiple coupons with multiple passes across each coupon (SM-MPC); and 3) multi-medium post-sample composite (MM-MPC): a single cellulose sponge samples a single surface, and then multiple sponges are combined during sample extraction. Five spore concentrations of Bacillus atrophaeus Nakamura spores were tested; concentrations ranged from 5 to 100 CFU/coupon (0.00775 to 0.155 CFU/cm2). Study variables included four clean surface materials (stainless steel, vinyl tile, ceramic tile, and painted dry wallboard) and three grime coated/dirty materials (stainless steel, vinyl tile, and ceramic tile). Analysis of variance for the clean study showed two significant factors: composite method (p< 0.0001) and coupon material (p = 0.0006). Recovery efficiency (RE) was higher overall using the MM-MPC method compared to the SM-SPC and SM-MPC methods. RE with the MM-MPC method for concentrations tested (10 to 100 CFU/coupon) was similar for ceramic tile, dry wall, and stainless steel for clean materials. RE was lowest for vinyl tile with both composite methods. Statistical tests for the dirty study showed RE was significantly higher for vinyl and stainless steel materials, but lower for ceramic tile. These results suggest post-sample compositing can be used to reduce sample analysis time when responding to a Bacillus anthracis contamination event of clean or dirty surfaces.
Synthesis of macroporous structures
Stein, Andreas; Holland, Brian T.; Blanford, Christopher F.; Yan, Hongwei
2004-01-20
The present application discloses a method of forming an inorganic macroporous material. In some embodiments, the method includes: providing a sample of organic polymer particles having a particle size distribution of no greater than about 10%; forming a colloidal crystal template of the sample of organic polymer particles, the colloidal crystal template including a plurality of organic polymer particles and interstitial spaces therebetween; adding an inorganic precursor composition including a noncolloidal inorganic precursor to the colloidal crystal template such that the precursor composition permeates the interstitial spaces between the organic polymer particles; converting the noncolloidal inorganic precursor to a hardened inorganic framework; and removing the colloidal crystal template from the hardened inorganic framework to form a macroporous material. Inorganic macroporous materials are also disclosed.
Tallman, Sean D; Winburn, Allysha P
2015-09-01
Ancestry assessment from the postcranial skeleton presents a significant challenge to forensic anthropologists. However, metric dimensions of the femur subtrochanteric region are believed to distinguish between individuals of Asian and non-Asian descent. This study tests the discriminatory power of subtrochanteric shape using modern samples of 128 Thai and 77 White American males. Results indicate that the samples' platymeric index distributions are significantly different (p≤0.001), with the Thai platymeric index range generally lower and the White American range generally higher. While the application of ancestry assessment methods developed from Native American subtrochanteric data results in low correct classification rates for the Thai sample (50.8-57.8%), adapting these methods to the current samples leads to better classification. The Thai data may be more useful in forensic analysis than previously published subtrochanteric data derived from Native American samples. Adapting methods to include appropriate geographic and contemporaneous populations increases the accuracy of femur subtrochanteric ancestry methods. © 2015 American Academy of Forensic Sciences.
Kalivas, John H; Georgiou, Constantinos A; Moira, Marianna; Tsafaras, Ilias; Petrakis, Eleftherios A; Mousdis, George A
2014-04-01
Quantitative analysis of food adulterants is an important health and economic issue that needs to be fast and simple. Spectroscopy has significantly reduced analysis time. However, still needed are preparations of analyte calibration samples matrix matched to prediction samples which can be laborious and costly. Reported in this paper is the application of a newly developed pure component Tikhonov regularization (PCTR) process that does not require laboratory prepared or reference analysis methods, and hence, is a greener calibration method. The PCTR method requires an analyte pure component spectrum and non-analyte spectra. As a food analysis example, synchronous fluorescence spectra of extra virgin olive oil samples adulterated with sunflower oil is used. Results are shown to be better than those obtained using ridge regression with reference calibration samples. The flexibility of PCTR allows including reference samples and is generic for use with other instrumental methods and food products. Copyright © 2013 Elsevier Ltd. All rights reserved.
Vakh, Christina; Evdokimova, Ekaterina; Pochivalov, Aleksei; Moskvin, Leonid; Bulatov, Andrey
2017-12-15
An easily performed fully automated and miniaturized flow injection chemiluminescence (CL) method for determination of phenols in smoked food samples has been proposed. This method includes the ultrasound assisted solid-liquid extraction coupled with gas-diffusion separation of phenols from smoked food sample and analytes absorption into a NaOH solution in a specially designed gas-diffusion cell. The flow system was designed to focus on automation and miniaturization with minimal sample and reagent consumption by inexpensive instrumentation. The luminol - N-bromosuccinimide system in an alkaline medium was used for the CL determination of phenols. The limit of detection of the proposed procedure was 3·10 -8 ·molL -1 (0.01mgkg -1 ) in terms of phenol. The presented method demonstrated to be a good tool for easy, rapid and cost-effective point-of-need screening phenols in smoked food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
Unequal cluster sizes in stepped-wedge cluster randomised trials: a systematic review
Morris, Tom; Gray, Laura
2017-01-01
Objectives To investigate the extent to which cluster sizes vary in stepped-wedge cluster randomised trials (SW-CRT) and whether any variability is accounted for during the sample size calculation and analysis of these trials. Setting Any, not limited to healthcare settings. Participants Any taking part in an SW-CRT published up to March 2016. Primary and secondary outcome measures The primary outcome is the variability in cluster sizes, measured by the coefficient of variation (CV) in cluster size. Secondary outcomes include the difference between the cluster sizes assumed during the sample size calculation and those observed during the trial, any reported variability in cluster sizes and whether the methods of sample size calculation and methods of analysis accounted for any variability in cluster sizes. Results Of the 101 included SW-CRTs, 48% mentioned that the included clusters were known to vary in size, yet only 13% of these accounted for this during the calculation of the sample size. However, 69% of the trials did use a method of analysis appropriate for when clusters vary in size. Full trial reports were available for 53 trials. The CV was calculated for 23 of these: the median CV was 0.41 (IQR: 0.22–0.52). Actual cluster sizes could be compared with those assumed during the sample size calculation for 14 (26%) of the trial reports; the cluster sizes were between 29% and 480% of that which had been assumed. Conclusions Cluster sizes often vary in SW-CRTs. Reporting of SW-CRTs also remains suboptimal. The effect of unequal cluster sizes on the statistical power of SW-CRTs needs further exploration and methods appropriate to studies with unequal cluster sizes need to be employed. PMID:29146637
Bushman, Lane R; Kiser, Jennifer J; Rower, Joseph E; Klein, Brandon; Zheng, Jia-Hua; Ray, Michelle L; Anderson, Peter L
2011-09-10
An ultra-sensitive liquid chromatography tandem mass spectrometry (LC-MS/MS) assay was developed and validated to facilitate the assessment of clinical pharmacokinetics of nucleotide analogs from lysed intracellular matrix. The method utilized a strong anion exchange isolation of mono-(MP), di-(DP), and tri-phosphates (TP) from intracellular matrix. Each fraction was then dephosphorylated to the parent moiety yielding a molar equivalent to the original nucleotide analog intracellular concentration. The analytical portion of the methodology was optimized in specific nucleoside analog centric modes (i.e. tenofovir (TFV) centric, zidovudine (ZDV) centric), which included desalting/concentration by solid phase extraction and detection by LC-MS/MS. Nucleotide analog MP-, DP-, and TP-determined on the TFV centric mode of analysis include TFV, lamivudine (3TC), and emtricitibine (FTC). The quantifiable linear range for TFV was 2.5-2000 fmol/sample, and that for 3TC/FTC was 0.1 200 pmol/sample. Nucleoside analog MP-, DP-, and TP-determined on the ZDV centric mode of analysis included 3TC and ZDV. The quantifiable linear range for 3TC was 0.1 100 pmol/sample, and 5-2000 fmol/sample for ZDV. Stable labeled isotopic internal standards facilitated accuracy and precision in alternative cell matrices, which supported the intended use of the method for MP, DP, and TP determinations in various cell types. The method was successfully applied to clinical research samples generating novel intracellular information for TFV, FTC, ZDV, and 3TC nucleotides. This document outlines method development, validation, and application to clinical research. Copyright © 2011 Elsevier B.V. All rights reserved.
Nicholls, Colin I.
1992-07-14
An on-line product sampling apparatus and method for measuring product samples from a product stream (12) in a flow line (14) having a sampling aperture (11), includes a sampling tube (18) for containing product samples removed from flow line (14). A piston (22) removes product samples from the product stream (12) through the sampling aperture (11) and returns samples to product stream (12). A sensor (20) communicates with sample tube (18), and senses physical properties of samples while the samples are within sample tube (18). In one embodiment, sensor (20) comprises a hydrogen transient nuclear magnetic resonance sensor for measuring physical properties of hydrogen molecules.
Ottaway, Josh; Farrell, Jeremy A; Kalivas, John H
2013-02-05
An essential part to calibration is establishing the analyte calibration reference samples. These samples must characterize the sample matrix and measurement conditions (chemical, physical, instrumental, and environmental) of any sample to be predicted. Calibration usually requires measuring spectra for numerous reference samples in addition to determining the corresponding analyte reference values. Both tasks are typically time-consuming and costly. This paper reports on a method named pure component Tikhonov regularization (PCTR) that does not require laboratory prepared or determined reference values. Instead, an analyte pure component spectrum is used in conjunction with nonanalyte spectra for calibration. Nonanalyte spectra can be from different sources including pure component interference samples, blanks, and constant analyte samples. The approach is also applicable to calibration maintenance when the analyte pure component spectrum is measured in one set of conditions and nonanalyte spectra are measured in new conditions. The PCTR method balances the trade-offs between calibration model shrinkage and the degree of orthogonality to the nonanalyte content (model direction) in order to obtain accurate predictions. Using visible and near-infrared (NIR) spectral data sets, the PCTR results are comparable to those obtained using ridge regression (RR) with reference calibration sets. The flexibility of PCTR also allows including reference samples if such samples are available.
Boiano, J M; Wallace, M E; Sieber, W K; Groff, J H; Wang, J; Ashley, K
2000-08-01
A field study was conducted with the goal of comparing the performance of three recently developed or modified sampling and analytical methods for the determination of airborne hexavalent chromium (Cr(VI)). The study was carried out in a hard chrome electroplating facility and in a jet engine manufacturing facility where airborne Cr(VI) was expected to be present. The analytical methods evaluated included two laboratory-based procedures (OSHA Method ID-215 and NIOSH Method 7605) and a field-portable method (NIOSH Method 7703). These three methods employ an identical sampling methodology: collection of Cr(VI)-containing aerosol on a polyvinyl chloride (PVC) filter housed in a sampling cassette, which is connected to a personal sampling pump calibrated at an appropriate flow rate. The basis of the analytical methods for all three methods involves extraction of the PVC filter in alkaline buffer solution, chemical isolation of the Cr(VI) ion, complexation of the Cr(VI) ion with 1,5-diphenylcarbazide, and spectrometric measurement of the violet chromium diphenylcarbazone complex at 540 nm. However, there are notable specific differences within the sample preparation procedures used in three methods. To assess the comparability of the three measurement protocols, a total of 20 side-by-side air samples were collected, equally divided between a chromic acid electroplating operation and a spray paint operation where water soluble forms of Cr(VI) were used. A range of Cr(VI) concentrations from 0.6 to 960 microg m(-3), with Cr(VI) mass loadings ranging from 0.4 to 32 microg, was measured at the two operations. The equivalence of the means of the log-transformed Cr(VI) concentrations obtained from the different analytical methods was compared. Based on analysis of variance (ANOVA) results, no statistically significant differences were observed between mean values measured using each of the three methods. Small but statistically significant differences were observed between results obtained from performance evaluation samples for the NIOSH field method and the OSHA laboratory method.
NASA Astrophysics Data System (ADS)
Liu, Xiao-Ming; Jiang, Jun; Hong, Ling; Tang, Dafeng
In this paper, a new method of Generalized Cell Mapping with Sampling-Adaptive Interpolation (GCMSAI) is presented in order to enhance the efficiency of the computation of one-step probability transition matrix of the Generalized Cell Mapping method (GCM). Integrations with one mapping step are replaced by sampling-adaptive interpolations of third order. An explicit formula of interpolation error is derived for a sampling-adaptive control to switch on integrations for the accuracy of computations with GCMSAI. By applying the proposed method to a two-dimensional forced damped pendulum system, global bifurcations are investigated with observations of boundary metamorphoses including full to partial and partial to partial as well as the birth of fully Wada boundary. Moreover GCMSAI requires a computational time of one thirtieth up to one fiftieth compared to that of the previous GCM.
Unutkan, Tugçe; Bakirdere, Sezgin; Keyf, Seyfullah
2018-01-01
A highly sensitive analytical HPLC-UV method was developed for the determination of amoxicillin in drugs and wastewater samples at a single wavelength (230 nm). In order to substantially predict the in vivo behavior of amoxicillin, drug samples were subjected to simulated gastric conditions. The calibration plot of the method was linear from 0.050 to 500 mg L-1 with a correlation coefficient of 0.9999. The limit of detection and limit of quantitation were found to be 16 and 54 μg L-1, respectively. The percentage recovery of amoxicillin in wastewater was found to be 97.0 ± 1.6%. The method was successfully applied for the qualitative and quantitative determination of amoxicillin in drug samples including tablets and suspensions. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Gan, Yanjun; Duan, Qingyun; Gong, Wei; ...
2014-01-01
Sensitivity analysis (SA) is a commonly used approach for identifying important parameters that dominate model behaviors. We use a newly developed software package, a Problem Solving environment for Uncertainty Analysis and Design Exploration (PSUADE), to evaluate the effectiveness and efficiency of ten widely used SA methods, including seven qualitative and three quantitative ones. All SA methods are tested using a variety of sampling techniques to screen out the most sensitive (i.e., important) parameters from the insensitive ones. The Sacramento Soil Moisture Accounting (SAC-SMA) model, which has thirteen tunable parameters, is used for illustration. The South Branch Potomac River basin nearmore » Springfield, West Virginia in the U.S. is chosen as the study area. The key findings from this study are: (1) For qualitative SA methods, Correlation Analysis (CA), Regression Analysis (RA), and Gaussian Process (GP) screening methods are shown to be not effective in this example. Morris One-At-a-Time (MOAT) screening is the most efficient, needing only 280 samples to identify the most important parameters, but it is the least robust method. Multivariate Adaptive Regression Splines (MARS), Delta Test (DT) and Sum-Of-Trees (SOT) screening methods need about 400–600 samples for the same purpose. Monte Carlo (MC), Orthogonal Array (OA) and Orthogonal Array based Latin Hypercube (OALH) are appropriate sampling techniques for them; (2) For quantitative SA methods, at least 2777 samples are needed for Fourier Amplitude Sensitivity Test (FAST) to identity parameter main effect. McKay method needs about 360 samples to evaluate the main effect, more than 1000 samples to assess the two-way interaction effect. OALH and LPτ (LPTAU) sampling techniques are more appropriate for McKay method. For the Sobol' method, the minimum samples needed are 1050 to compute the first-order and total sensitivity indices correctly. These comparisons show that qualitative SA methods are more efficient but less accurate and robust than quantitative ones.« less
Comparisons of NDT Methods to Inspect Cork and Cork filled Epoxy Bands
NASA Technical Reports Server (NTRS)
Lingbloom, Mike
2007-01-01
Sheet cork and cork filled epoxy provide external insulation for the Reusable Solid Rocket Motor (RSRM) on the Nation's Space Transportation System (STS). Interest in the reliability of the external insulation bonds has increased since the Columbia incident. A non-destructive test (NDT) method that will provide the best inspection for these bonds has been under evaluation. Electronic Shearography has been selected as the primary NDT method for inspection of these bond lines in the RSRM production flow. ATK Launch Systems Group has purchased an electronic shearography system that includes a vacuum chamber that is used for evaluation of test parts and custom vacuum windows for inspection of full-scale motors. Although the electronic shearography technology has been selected as the primary method for inspection of the external bonds, other technologies that exist continue to be investigated. The NASA/Marshall Space Flight Center (MSFC) NDT department has inspected several samples for comparison with electronic shearography with various inspections systems in their laboratory. The systems that were evaluated are X-ray backscatter, terahertz imaging, and microwave imaging. The samples tested have some programmed flaws as well as some flaws that occurred naturally during the sample making process. These samples provide sufficient flaw variation for the evaluation of the different inspection systems. This paper will describe and compare the basic functionality, test method and test results including dissection for each inspection technology.
Evaluation of an inhouse rapid ELISA test for detection of giardia in domestic sheep (Ovis aries).
Wilson, Jolaine M; Hankenson, F Claire
2010-11-01
Sheep (Ovis aries) are increasingly used at our institution as models of human disease. Within the research environment, routine husbandry and handling of sheep has potential for transmission of zoonotic agents, including Giardia. The prevalence of Giardia in sheep may approach 68%. Classic diagnostic testing involves microscopic examination for fecal cysts or trophozoites; however, limitations of microscopy include time, labor, and potential false-negative results due to intermittent shedding. We wished to determine whether a commercial rapid ELISA used for Giardia detection in dogs and cats could be used in sheep. Fecal samples collected from sheep (n = 93) were tested with a combination of 6 methods: reference laboratory fecal flotation, reference laboratory ELISA, inhouse fecal flotation, and commercially available tests (enzyme immunoassay, direct fluorescence antibody assay, and rapid ELISA). Prevalence of Giardia infection in facility sheep was 11.8% (11 of 93 animals). Of the 11 samples considered positive, 3 were confirmed by multiple testing methods, and 5 were positive by microscopy alone. Inhouse fecal flotation for 8 samples was positive on only 1 of 2 consecutive testing days. The rapid ELISA test exhibited 0% sensitivity for sheep giardiasis. Overall, the examined methods had low sensitivities and low positive predictive values. Despite limitations, microscopic analysis of repeat fecal samples remained the most accurate diagnostic method for ovine giardiasis among the methods tested.
Simultaneous Speciation of Arsenic, Selenium, and Chromium by HPLC-ICP-MS
Wolf, Ruth E.; Morman, Suzette A.; Morrison, Jean M.; Lamothe, Paul J.
2008-01-01
An adaptation of an analytical method developed for chromium speciation has been utilized for the simultaneous determination of As(III), As(V), Se(IV), Se(VI), Cr(III), and Cr(VI) species using high performance liquid chromatography (HPLC) separation with ICP-MS detection. Reduction of interferences for the determination of As, Se, and Cr by ICP-MS is a major consideration for this method. Toward this end, a Dynamic Reaction Cell (DRC) ICP-MS system was used to detect the species eluted from the chromatographic column. A variety of reaction cell gases and conditions may be utilized, and the advantages and limitations of the gases tested to date will be presented and discussed. The separation and detection of the As, Se, and Cr species of interest can be achieved using the same chromatographic conditions in less than 2 minutes by complexing the Cr(III) with EDTA prior to injection on the HPLC column. Practical aspects of simultaneous speciation analysis will be presented and discussed, including issues with HPLC sample vial contamination, standard and sample contamination, species stability, and considerations regarding sample collection and preservation methods. The results of testing to determine the method's robustness to common concomitant element and anion effects will also be discussed. Finally, results will be presented using the method for the analysis of a variety of environmental and geological samples including waters, soil leachates and simulated bio-fluid leachates.
Ferrer, Imma; Thurman, E Michael
2012-10-12
A straightforward methodology for the chromatographic separation and accurate mass identification of 100 pharmaceuticals including some of their degradation products was developed using liquid chromatography/quadrupole time-of-flight mass spectrometry (LC/Q-TOF-MS). A table compiling the protonated or deprotonated exact masses for all compounds, as well as the exact mass of several fragment ions obtained by MS-MS is included. Excellent chromatographic separation was achieved by using 3.5 μm particle size columns and a slow and generic 30-min gradient. Isobaric and isomeric compounds (same nominal mass and same exact mass, respectively) were distinguished by various methods, including chromatography separation, MS-MS fragmentation, and isotopic signal identification. Method reporting limits of detection ranged from 1 to 1000 ng/L, after solid-phase extraction of 100mL aqueous samples. The methodology was successfully applied to the analysis of surface water impacted by wastewater effluent by identifying many of the pharmaceuticals and metabolites included in the list. Examples are given for some of the most unusual findings in environmental samples. This paper is meant to serve as a guide for those doing analysis of pharmaceuticals in environmental samples, by providing exact mass measurements of several well known, as well as newly identified and environmentally relevant pharmaceuticals in water samples. Copyright © 2012 Elsevier B.V. All rights reserved.
[Extraction method suitable for detection of unheated crustaceans including cephalothorax by ELISA].
Shibahara, Yusuke; Yamada, Itta; Uesaka, Yoshihiko; Uneo, Noriko; Abe, Akihisa; Ohashi, Eiji; Shiomi, Kazuo
2009-08-01
When unheated whole samples of crustaceans (shrimp, prawn and crab) were analyzed with our ELISA kit (FA test EIA-Crustacean 'Nissui') using anti-tropomyosin antibodies, a remarkable reduction in reactivity was recognized. This reduction in activity was found to be due to the digestion of tropomyosin during the extraction process by proteases contained in cephalothorax. To avoid the digestion of tropomyosin by proteases, we developed an extraction method (heating method) suitable for the detection of tropomyosin in unheated crustaceans including cephalothorax. Experiments with unheated whole samples of various species of crustaceans confirmed that the heating method greatly improved the low reactivity in the standard method; the heating method gave extraction efficiencies of as high as 93-107%. Various processed crustaceans with cephalothorax, such as dry products (unheated or weakly heated products) and pickles in soy sauce (unheated products), that showed low reactivity with the standard method were confirmed to give superior results with the heating method. These results indicated that the developed heating method is suitable for detecting unheated crustaceans with cephalothorax by means of the ELISA kit.
Valls-Cantenys, Carme; Scheurer, Marco; Iglesias, Mònica; Sacher, Frank; Brauch, Heinz-Jürgen; Salvadó, Victoria
2016-09-01
A sensitive, multi-residue method using solid-phase extraction followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) was developed to determine a representative group of 35 analytes, including corrosion inhibitors, pesticides and pharmaceuticals such as analgesic and anti-inflammatory drugs, five iodinated contrast media, β-blockers and some of their metabolites and transformation products in water samples. Few other methods are capable of determining such a broad range of contrast media together with other analytes. We studied the parameters affecting the extraction of the target analytes, including sorbent selection and extraction conditions, their chromatographic separation (mobile phase composition and column) and detection conditions using two ionisation sources: electrospray ionisation (ESI) and atmospheric pressure chemical ionisation (APCI). In order to correct matrix effects, a total of 20 surrogate/internal standards were used. ESI was found to have better sensitivity than APCI. Recoveries ranging from 79 to 134 % for tap water and 66 to 144 % for surface water were obtained. Intra-day precision, calculated as relative standard deviation, was below 34 % for tap water and below 21 % for surface water, groundwater and effluent wastewater. Method quantification limits (MQL) were in the low ng L(-1) range, except for the contrast agents iomeprol, amidotrizoic acid and iohexol (22, 25.5 and 17.9 ng L(-1), respectively). Finally, the method was applied to the analysis of 56 real water samples as part of the validation procedure. All of the compounds were detected in at least some of the water samples analysed. Graphical Abstract Multi-residue method for the determination of micropollutants including pharmaceuticals, iodinated contrast media and pesticides in waters by LC-MS/MS.
On the use of transition matrix methods with extended ensembles.
Escobedo, Fernando A; Abreu, Charlles R A
2006-03-14
Different extended ensemble schemes for non-Boltzmann sampling (NBS) of a selected reaction coordinate lambda were formulated so that they employ (i) "variable" sampling window schemes (that include the "successive umbrella sampling" method) to comprehensibly explore the lambda domain and (ii) transition matrix methods to iteratively obtain the underlying free-energy eta landscape (or "importance" weights) associated with lambda. The connection between "acceptance ratio" and transition matrix methods was first established to form the basis of the approach for estimating eta(lambda). The validity and performance of the different NBS schemes were then assessed using as lambda coordinate the configurational energy of the Lennard-Jones fluid. For the cases studied, it was found that the convergence rate in the estimation of eta is little affected by the use of data from high-order transitions, while it is noticeably improved by the use of a broader window of sampling in the variable window methods. Finally, it is shown how an "elastic" window of sampling can be used to effectively enact (nonuniform) preferential sampling over the lambda domain, and how to stitch the weights from separate one-dimensional NBS runs to produce a eta surface over a two-dimensional domain.
Patterson, Fiona; Lievens, Filip; Kerrin, Máire; Munro, Neil; Irish, Bill
2013-01-01
Background The selection methodology for UK general practice is designed to accommodate several thousand applicants per year and targets six core attributes identified in a multi-method job-analysis study Aim To evaluate the predictive validity of selection methods for entry into postgraduate training, comprising a clinical problem-solving test, a situational judgement test, and a selection centre. Design and setting A three-part longitudinal predictive validity study of selection into training for UK general practice. Method In sample 1, participants were junior doctors applying for training in general practice (n = 6824). In sample 2, participants were GP registrars 1 year into training (n = 196). In sample 3, participants were GP registrars sitting the licensing examination after 3 years, at the end of training (n = 2292). The outcome measures include: assessor ratings of performance in a selection centre comprising job simulation exercises (sample 1); supervisor ratings of trainee job performance 1 year into training (sample 2); and licensing examination results, including an applied knowledge examination and a 12-station clinical skills objective structured clinical examination (OSCE; sample 3). Results Performance ratings at selection predicted subsequent supervisor ratings of job performance 1 year later. Selection results also significantly predicted performance on both the clinical skills OSCE and applied knowledge examination for licensing at the end of training. Conclusion In combination, these longitudinal findings provide good evidence of the predictive validity of the selection methods, and are the first reported for entry into postgraduate training. Results show that the best predictor of work performance and training outcomes is a combination of a clinical problem-solving test, a situational judgement test, and a selection centre. Implications for selection methods for all postgraduate specialties are considered. PMID:24267856
Segmental analysis of amphetamines in hair using a sensitive UHPLC-MS/MS method.
Jakobsson, Gerd; Kronstrand, Robert
2014-06-01
A sensitive and robust ultra high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method was developed and validated for quantification of amphetamine, methamphetamine, 3,4-methylenedioxyamphetamine and 3,4-methylenedioxy methamphetamine in hair samples. Segmented hair (10 mg) was incubated in 2M sodium hydroxide (80°C, 10 min) before liquid-liquid extraction with isooctane followed by centrifugation and evaporation of the organic phase to dryness. The residue was reconstituted in methanol:formate buffer pH 3 (20:80). The total run time was 4 min and after optimization of UHPLC-MS/MS-parameters validation included selectivity, matrix effects, recovery, process efficiency, calibration model and range, lower limit of quantification, precision and bias. The calibration curve ranged from 0.02 to 12.5 ng/mg, and the recovery was between 62 and 83%. During validation the bias was less than ±7% and the imprecision was less than 5% for all analytes. In routine analysis, fortified control samples demonstrated an imprecision <13% and control samples made from authentic hair demonstrated an imprecision <26%. The method was applied to samples from a controlled study of amphetamine intake as well as forensic hair samples previously analyzed with an ultra high performance liquid chromatography time of flight mass spectrometry (UHPLC-TOF-MS) screening method. The proposed method was suitable for quantification of these drugs in forensic cases including violent crimes, autopsy cases, drug testing and re-granting of driving licences. This study also demonstrated that if hair samples are divided into several short segments, the time point for intake of a small dose of amphetamine can be estimated, which might be useful when drug facilitated crimes are investigated. Copyright © 2014 John Wiley & Sons, Ltd.
Anis, Eman; Hawkins, Ian K; Ilha, Marcia R S; Woldemeskel, Moges W; Saliki, Jeremiah T; Wilkes, Rebecca P
2018-07-01
The laboratory diagnosis of infectious diseases, especially those caused by mixed infections, is challenging. Routinely, it requires submission of multiple samples to separate laboratories. Advances in next-generation sequencing (NGS) have provided the opportunity for development of a comprehensive method to identify infectious agents. This study describes the use of target-specific primers for PCR-mediated amplification with the NGS technology in which pathogen genomic regions of interest are enriched and selectively sequenced from clinical samples. In the study, 198 primers were designed to target 43 common bovine and small-ruminant bacterial, fungal, viral, and parasitic pathogens, and a bioinformatics tool was specifically constructed for the detection of targeted pathogens. The primers were confirmed to detect the intended pathogens by testing reference strains and isolates. The method was then validated using 60 clinical samples (including tissues, feces, and milk) that were also tested with other routine diagnostic techniques. The detection limits of the targeted NGS method were evaluated using 10 representative pathogens that were also tested by quantitative PCR (qPCR), and the NGS method was able to detect the organisms from samples with qPCR threshold cycle ( C T ) values in the 30s. The method was successful for the detection of multiple pathogens in the clinical samples, including some additional pathogens missed by the routine techniques because the specific tests needed for the particular organisms were not performed. The results demonstrate the feasibility of the approach and indicate that it is possible to incorporate NGS as a diagnostic tool in a cost-effective manner into a veterinary diagnostic laboratory. Copyright © 2018 Anis et al.
Use of thermal neutron reflection method for chemical analysis of bulk samples
NASA Astrophysics Data System (ADS)
Papp, A.; Csikai, J.
2014-09-01
Microscopic, σβ, and macroscopic, Σβ, reflection cross-sections of thermal neutrons averaged over bulk samples as a function of thickness (z) are given. The σβ values are additive even for bulk samples in the z=0.5-8 cm interval and so the σβmol(z) function could be given for hydrogenous substances, including some illicit drugs, explosives and hiding materials of ~1000 cm3 dimensions. The calculated excess counts agree with the measured R(z) values. For the identification of concealed objects and chemical analysis of bulky samples, different neutron methods need to be used simultaneously.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gates, B. C.; Olson, H. H.; Schuit, G. C.A.
1983-08-22
A new method of structural analysis is applied to a group of hydroliquefied coal samples. The method uses elemental analysis and NMR data to estimate the concentrations of functional groups in the samples. The samples include oil and asphaltene fractions obtained in a series of hydroliquefaction experiments, and a set of 9 fractions separated from a coal-derived oil. The structural characterization of these samples demonstrates that estimates of functional group concentrations can be used to provide detailed structural profiles of complex mixtures and to obtain limited information about reaction pathways. 11 references, 1 figure, 7 tables.
Method and apparatus for adjustably induced biaxial strain
Vestel, Michael J.; Oshatz, Daryl Patrick
2006-05-16
An apparatus comprising a shape memory alloy is configured as a ring shaped sample holder for a transmission electron microscope and imparts uniform biaxial strain on a thin film mounted within. The sample holder responds to a change in temperature by changing the inner diameter, which imparts biaxial strain. In other embodiments, the sample holder is configured to change the inner diameter and change the strain on a thin film reversibly and repeatedly. In further embodiments, the sample holder is non circular. In still further embodiments, the apparatus is configured as a prime mover of a reversible radial actuator. Methods for making and using the apparatus are included in other embodiments.
An Improved Experiment to Illustrate the Effect of Electronegativity on Chemical Shift.
ERIC Educational Resources Information Center
Boggess, Robert K.
1988-01-01
Describes a method for using nuclear magnetic resonance to observe the effect of electronegativity on the chemical shift of protons in similar compounds. Suggests the use of 1,3-dihalopropanes as samples. Includes sample questions. (MVL)
Snyder-Mackler, Noah; Majoros, William H.; Yuan, Michael L.; Shaver, Amanda O.; Gordon, Jacob B.; Kopp, Gisela H.; Schlebusch, Stephen A.; Wall, Jeffrey D.; Alberts, Susan C.; Mukherjee, Sayan; Zhou, Xiang; Tung, Jenny
2016-01-01
Research on the genetics of natural populations was revolutionized in the 1990s by methods for genotyping noninvasively collected samples. However, these methods have remained largely unchanged for the past 20 years and lag far behind the genomics era. To close this gap, here we report an optimized laboratory protocol for genome-wide capture of endogenous DNA from noninvasively collected samples, coupled with a novel computational approach to reconstruct pedigree links from the resulting low-coverage data. We validated both methods using fecal samples from 62 wild baboons, including 48 from an independently constructed extended pedigree. We enriched fecal-derived DNA samples up to 40-fold for endogenous baboon DNA and reconstructed near-perfect pedigree relationships even with extremely low-coverage sequencing. We anticipate that these methods will be broadly applicable to the many research systems for which only noninvasive samples are available. The lab protocol and software (“WHODAD”) are freely available at www.tung-lab.org/protocols-and-software.html and www.xzlab.org/software.html, respectively. PMID:27098910
Puchyr, R F; Bass, D A; Gajewski, R; Calvin, M; Marquardt, W; Urek, K; Druyan, M E; Quig, D
1998-06-01
The preparation of hair for the determination of elements is a critical component of the analysis procedure. Open-beaker, closed-vessel microwave, and flowthrough microwave digestion are methods that have been used for sample preparation and are discussed. A new digestion method for use with inductively coupled plasma-mass spectrometry (ICP-MS) has been developed. The method uses 0.2 g of hair and 3 mL of concentrated nitric acid in an atmospheric pressure-low-temperature microwave digestion (APLTMD) system. This preparation method is useful in handling a large numbers of samples per day and may be adapted to hair sample weights ranging from 0.08 to 0.3 g. After digestion, samples are analyzed by ICP-MS to determine the concentration of Li, Be, B, Na, Mg, Al, P, S, K, Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ge, As, Se, Rb, Sr, Zr, Mo, Pd, Ag, Cd, Sn, Sb, I, Cs, Ba, Pt, Au, Hg, Tl, Pb, Bi, Th, and U. Benefits of the APLTMD include reduced contamination and sample handling, and increased precision, reliability, and sample throughput.
Woolfenden, Elizabeth
2010-04-16
Sorbent tubes/traps are widely used in combination with gas chromatographic (GC) analytical methods to monitor the vapour-phase fraction of organic compounds in air. Target compounds range in volatility from acetylene and freons to phthalates and PCBs and include apolar, polar and reactive species. Airborne vapour concentrations will vary depending on the nature of the location, nearby pollution sources, weather conditions, etc. Levels can range from low percent concentrations in stack and vent emissions to low part per trillion (ppt) levels in ultra-clean outdoor locations. Hundreds, even thousands of different compounds may be present in any given atmosphere. GC is commonly used in combination with mass spectrometry (MS) detection especially for environmental monitoring or for screening uncharacterised workplace atmospheres. Given the complexity and variability of organic vapours in air, no one sampling approach suits every monitoring scenario. A variety of different sampling strategies and sorbent media have been developed to address specific applications. Key sorbent-based examples include: active (pumped) sampling onto tubes packed with one or more sorbents held at ambient temperature; diffusive (passive) sampling onto sorbent tubes/cartridges; on-line sampling of air/gas streams into cooled sorbent traps; and transfer of air samples from containers (canisters, Tedlar) bags, etc.) into cooled sorbent focusing traps. Whichever sampling approach is selected, subsequent analysis almost always involves either solvent extraction or thermal desorption (TD) prior to GC(/MS) analysis. The overall performance of the air monitoring method will depend heavily on appropriate selection of key sampling and analytical parameters. This comprehensive review of air monitoring using sorbent tubes/traps is divided into 2 parts. (1) Sorbent-based air sampling option. (2) Sorbent selection and other aspects of optimizing sorbent-based air monitoring methods. The paper presents current state-of-the-art and recent developments in relevant areas such as sorbent research, sampler design, enhanced approaches to analytical quality assurance and on-tube derivatisation. Copyright 2009 Elsevier B.V. All rights reserved.
The experience sampling method: Investigating students' affective experience
NASA Astrophysics Data System (ADS)
Nissen, Jayson M.; Stetzer, MacKenzie R.; Shemwell, Jonathan T.
2013-01-01
Improving non-cognitive outcomes such as attitudes, efficacy, and persistence in physics courses is an important goal of physics education. This investigation implemented an in-the-moment surveying technique called the Experience Sampling Method (ESM) [1] to measure students' affective experience in physics. Measurements included: self-efficacy, cognitive efficiency, activation, intrinsic motivation, and affect. Data are presented that show contrasts in students' experiences (e.g., in physics vs. non-physics courses).
High temperature flow-through device for rapid solubilization and analysis
West, Jason A. A. [Castro Valley, CA; Hukari, Kyle W [San Ramon, CA; Patel, Kamlesh D [Dublin, CA; Peterson, Kenneth A [Albuquerque, NM; Renzi, Ronald F [Tracy, CA
2009-09-22
Devices and methods for thermally lysing of biological material, for example vegetative bacterial cells and bacterial spores, are provided. Hot solution methods for solubilizing bacterial spores are described. Systems for direct analysis are disclosed including thermal lysers coupled to sample preparation stations. Integrated systems capable of performing sample lysis, labeling and protein fingerprint analysis of biological material, for example, vegetative bacterial cells, bacterial spores and viruses are provided.
High temperature flow-through device for rapid solubilization and analysis
West, Jason A. A.; Hukari, Kyle W.; Patel, Kamlesh D.; Peterson, Kenneth A.; Renzi, Ronald F.
2013-04-23
Devices and methods for thermally lysing of biological material, for example vegetative bacterial cells and bacterial spores, are provided. Hot solution methods for solubilizing bacterial spores are described. Systems for direct analysis are disclosed including thermal lysers coupled to sample preparation stations. Integrated systems capable of performing sample lysis, labeling and protein fingerprint analysis of biological material, for example, vegetative bacterial cells, bacterial spores and viruses are provided.
Aubert, D; Villena, I
2009-03-01
Water is a vehicle for disseminating human and veterinary toxoplasmosis due to oocyst contamination. Several outbreaks of toxoplasmosis throughout the world have been related to contaminated drinking water. We have developed a method for the detection of Toxoplasma gondii oocysts in water and we propose a strategy for the detection of multiple waterborne parasites, including Cryptosporidium spp. and Giardia. Water samples were filtered to recover Toxoplasma oocysts and, after the detection of Cryptosporidium oocysts and Giardia cysts by immunofluorescence, as recommended by French norm procedure NF T 90-455, the samples were purified on a sucrose density gradient. Detection of Toxoplasma was based on PCR amplification and mouse inoculation to determine the presence and infectivity of recovered oocysts. After experimental seeding assays, we determined that the PCR assay was more sensitive than the bioassay. This strategy was then applied to 482 environmental water samples collected since 2001. We detected Toxoplasma DNA in 37 environmental samples (7.7%), including public drinking water; however, none of them were positive by bioassay. This strategy efficiently detects Toxoplasma oocysts in water and may be suitable as a public health sentinel method. Alternative methods can be used in conjunction with this one to determine the infectivity of parasites that were detected by molecular methods.
Łojewska, J.; Rabin, I.; Pawcenis, D.; Bagniuk, J.; Aksamit-Koperska, M. A.; Sitarz, M.; Missori, M.; Krutzsch, M.
2017-01-01
Ancient papyri are a written heritage of culture that flourished more than 3000 years ago in Egypt. One of the most significant collections in the world is housed in the Egyptian Museum and Papyrus Collection in Berlin, from where the samples for our investigation come. The papyrologists, curators and conservators of such collections search intensely for the analytical detail that would allow ancient papyri to be distinguished from modern fabrications, in order to detect possible forgeries, assess papyrus deterioration state, and improve the design of storage conditions and conservation methods. This has become the aim of our investigation. The samples were studied by a number of methods, including spectroscopic (FTIR, fluorescent-FS, Raman) diffractional (XRD) and chromatographic (size exclusion chromatography-SEC), selected in order to determine degradation parameters: overall oxidation of lignocellulosic material, degree of polymerization and crystallinity of cellulose. The results were correlated with those obtained from carefully selected model samples including modern papyri and paper of different composition aged at elevated temperature in humid air. The methods were classified in the order SEC > FS > FTIR > XRD, based on their effectiveness in discriminating the state of papyri degradation. However, the most trustworthy evaluation of the age of papyri samples should rely on several methods. PMID:28382971
Łojewska, J; Rabin, I; Pawcenis, D; Bagniuk, J; Aksamit-Koperska, M A; Sitarz, M; Missori, M; Krutzsch, M
2017-04-06
Ancient papyri are a written heritage of culture that flourished more than 3000 years ago in Egypt. One of the most significant collections in the world is housed in the Egyptian Museum and Papyrus Collection in Berlin, from where the samples for our investigation come. The papyrologists, curators and conservators of such collections search intensely for the analytical detail that would allow ancient papyri to be distinguished from modern fabrications, in order to detect possible forgeries, assess papyrus deterioration state, and improve the design of storage conditions and conservation methods. This has become the aim of our investigation. The samples were studied by a number of methods, including spectroscopic (FTIR, fluorescent-FS, Raman) diffractional (XRD) and chromatographic (size exclusion chromatography-SEC), selected in order to determine degradation parameters: overall oxidation of lignocellulosic material, degree of polymerization and crystallinity of cellulose. The results were correlated with those obtained from carefully selected model samples including modern papyri and paper of different composition aged at elevated temperature in humid air. The methods were classified in the order SEC > FS > FTIR > XRD, based on their effectiveness in discriminating the state of papyri degradation. However, the most trustworthy evaluation of the age of papyri samples should rely on several methods.
Characteristics of Qualitative Descriptive Studies: A Systematic Review
Kim, Hyejin; Sefcik, Justine S.; Bradway, Christine
2016-01-01
Qualitative description (QD) is a term that is widely used to describe qualitative studies of health care and nursing-related phenomena. However, limited discussions regarding QD are found in the existing literature. In this systematic review, we identified characteristics of methods and findings reported in research articles published in 2014 whose authors identified the work as QD. After searching and screening, data were extracted from the sample of 55 QD articles and examined to characterize research objectives, design justification, theoretical/philosophical frameworks, sampling and sample size, data collection and sources, data analysis, and presentation of findings. In this review, three primary findings were identified. First, despite inconsistencies, most articles included characteristics consistent with limited, available QD definitions and descriptions. Next, flexibility or variability of methods was common and desirable for obtaining rich data and achieving understanding of a phenomenon. Finally, justification for how a QD approach was chosen and why it would be an appropriate fit for a particular study was limited in the sample and, therefore, in need of increased attention. Based on these findings, recommendations include encouragement to researchers to provide as many details as possible regarding the methods of their QD study so that readers can determine whether the methods used were reasonable and effective in producing useful findings. PMID:27686751
Tamburini, Elena; Vincenzi, Fabio; Costa, Stefania; Mantovi, Paolo; Pedrini, Paola; Castaldelli, Giuseppe
2017-10-17
Near-Infrared Spectroscopy is a cost-effective and environmentally friendly technique that could represent an alternative to conventional soil analysis methods, including total organic carbon (TOC). Soil fertility and quality are usually measured by traditional methods that involve the use of hazardous and strong chemicals. The effects of physical soil characteristics, such as moisture content and particle size, on spectral signals could be of great interest in order to understand and optimize prediction capability and set up a robust and reliable calibration model, with the future perspective of being applied in the field. Spectra of 46 soil samples were collected. Soil samples were divided into three data sets: unprocessed, only dried and dried, ground and sieved, in order to evaluate the effects of moisture and particle size on spectral signals. Both separate and combined normalization methods including standard normal variate (SNV), multiplicative scatter correction (MSC) and normalization by closure (NCL), as well as smoothing using first and second derivatives (DV1 and DV2), were applied to a total of seven cases. Pretreatments for model optimization were designed and compared for each data set. The best combination of pretreatments was achieved by applying SNV and DV2 on partial least squares (PLS) modelling. There were no significant differences between the predictions using the three different data sets ( p < 0.05). Finally, a unique database including all three data sets was built to include all the sources of sample variability that were tested and used for final prediction. External validation of TOC was carried out on 16 unknown soil samples to evaluate the predictive ability of the final combined calibration model. Hence, we demonstrate that sample preprocessing has minor influence on the quality of near infrared spectroscopy (NIR) predictions, laying the ground for a direct and fast in situ application of the method. Data can be acquired outside the laboratory since the method is simple and does not need more than a simple band ratio of the spectra.
DEVELOPMENT AND APPLICATION OF METHODS TO ASSESS HUMAN EXPOSURE TO PESTICIDES
Note: this task is schedule to end September 2003. Two tasks will take its place: method development for emerging pesticides including chiral chemistry applications, and in-house laboratory operations. Field sampling methods are covered under a new task proposed this year.
<...
SEMI-VOLATILE SECONDARY AEROSOLS IN URBAN ATMOSPHERES: MEETING A MEASURED CHALLENGE
This presentation compares the results from various particle measurement methods as they relate to semi-volatile secondary aerosols in urban atmospheres. The methods include the PM2.5 Federal Reference Method; Particle Concentrator - BYU Organic Sampling System (PC-BOSS); the Re...
Communication: Multiple atomistic force fields in a single enhanced sampling simulation
NASA Astrophysics Data System (ADS)
Hoang Viet, Man; Derreumaux, Philippe; Nguyen, Phuong H.
2015-07-01
The main concerns of biomolecular dynamics simulations are the convergence of the conformational sampling and the dependence of the results on the force fields. While the first issue can be addressed by employing enhanced sampling techniques such as simulated tempering or replica exchange molecular dynamics, repeating these simulations with different force fields is very time consuming. Here, we propose an automatic method that includes different force fields into a single advanced sampling simulation. Conformational sampling using three all-atom force fields is enhanced by simulated tempering and by formulating the weight parameters of the simulated tempering method in terms of the energy fluctuations, the system is able to perform random walk in both temperature and force field spaces. The method is first demonstrated on a 1D system and then validated by the folding of the 10-residue chignolin peptide in explicit water.
This data set contains the method performance results. This includes field blanks, method blanks, duplicate samples, analytical duplicates, matrix spikes, and surrogate recovery standards.
The Children’s Total Exposure to Persistent Pesticides and Other Persistent Pollutant (...
Pendleton, G.W.; Ralph, C. John; Sauer, John R.; Droege, Sam
1995-01-01
Many factors affect the use of point counts for monitoring bird populations, including sampling strategies, variation in detection rates, and independence of sample points. The most commonly used sampling plans are stratified sampling, cluster sampling, and systematic sampling. Each of these might be most useful for different objectives or field situations. Variation in detection probabilities and lack of independence among sample points can bias estimates and measures of precision. All of these factors should be con-sidered when using point count methods.
Cleveland, Danielle; Brumbaugh, William G.; MacDonald, Donald D.
2017-01-01
Evaluations of sediment quality conditions are commonly conducted using whole-sediment chemistry analyses but can be enhanced by evaluating multiple lines of evidence, including measures of the bioavailable forms of contaminants. In particular, porewater chemistry data provide information that is directly relevant for interpreting sediment toxicity data. Various methods for sampling porewater for trace metals and dissolved organic carbon (DOC), which is an important moderator of metal bioavailability, have been employed. The present study compares the peeper, push point, centrifugation, and diffusive gradients in thin films (DGT) methods for the quantification of 6 metals and DOC. The methods were evaluated at low and high concentrations of metals in 3 sediments having different concentrations of total organic carbon and acid volatile sulfide and different particle-size distributions. At low metal concentrations, centrifugation and push point sampling resulted in up to 100 times higher concentrations of metals and DOC in porewater compared with peepers and DGTs. At elevated metal levels, the measured concentrations were in better agreement among the 4 sampling techniques. The results indicate that there can be marked differences among operationally different porewater sampling methods, and it is unclear if there is a definitive best method for sampling metals and DOC in porewater.
Bhaskar, Anand; Wang, Y X Rachel; Song, Yun S
2015-02-01
With the recent increase in study sample sizes in human genetics, there has been growing interest in inferring historical population demography from genomic variation data. Here, we present an efficient inference method that can scale up to very large samples, with tens or hundreds of thousands of individuals. Specifically, by utilizing analytic results on the expected frequency spectrum under the coalescent and by leveraging the technique of automatic differentiation, which allows us to compute gradients exactly, we develop a very efficient algorithm to infer piecewise-exponential models of the historical effective population size from the distribution of sample allele frequencies. Our method is orders of magnitude faster than previous demographic inference methods based on the frequency spectrum. In addition to inferring demography, our method can also accurately estimate locus-specific mutation rates. We perform extensive validation of our method on simulated data and show that it can accurately infer multiple recent epochs of rapid exponential growth, a signal that is difficult to pick up with small sample sizes. Lastly, we use our method to analyze data from recent sequencing studies, including a large-sample exome-sequencing data set of tens of thousands of individuals assayed at a few hundred genic regions. © 2015 Bhaskar et al.; Published by Cold Spring Harbor Laboratory Press.
Reduction of aflatoxin in rice by different cooking methods.
Sani, Ali Mohamadi; Azizi, Eisa Gholampour; Salehi, Esmaeel Ataye; Rahimi, Khadije
2014-07-01
Rice (Oryza sativa Linn) is one of the basic diets in the north of Iran. The aim of present study was to detect total aflatoxin (AFT) in domestic and imported rice in Amol (in the north of Iran) and to evaluate the effect of different cooking methods on the levels of the toxin. For this purpose, 42 rice samples were collected from retail stores. The raw samples were analysed by enzyme-linked immunosorbent assay (ELISA) technique for toxin assessment and then submitted to two different cooking methods including traditional local method and in rice cooker. After treatment, AFT was determined. Results show that the average concentration of AFT in domestic and imported samples was 1.08 ± 0.02 and 1.89 ± 0.87 ppb, respectively, which is lower than national and European Union standards. The highest AFT reduction (24.8%) was observed when rice samples were cooked by rice cooker but the difference with local method was not statistically significant (p > 0.05). © The Author(s) 2012.
Avila, Mónica; Zougagh, Mohammed; Escarpa, Alberto; Ríos, Angel
2009-10-23
A new, simple and versatile method is presented for the determination of different concentration levels of alkenylbenzenes (eugenol, isoeugenol, eugenol methyl ether, myristicin, anethole and estragole) and the related flavour compounds (coumarin and pulegone) in food samples. The method involves the use of a stationary phase (capillary column) for the enrichment with appropriate elution. After the sample had completely passed through the capillary column the eluent was changed and the separation/detection was achieved. Excellent linearity was obtained under the proposed conditions for a direct determination method and a method including on-line preconcentration. The limits of detection were in the ranges 97-148 and 9.5-14.2 ng/mL, respectively. Evidence for a matrix effect was not found and recoveries between 92 and 110% were obtained. The precision of the method, expressed as relative standard deviation values, was below 5% in all cases. The applicability of this methodology was tested by analyzing synthetic and real food samples.
Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang
2015-01-05
The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection.
Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang
2015-01-01
The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection. PMID:25556930
Methods for collection and analysis of aquatic biological and microbiological samples
Britton, L.J.; Greeson, P.E.
1988-01-01
Chapter A4, methods for collection and analyses of aquatic biological and microbiological samples, contains methods used by the U.S. Geological Survey to collect, preserve, and analyze waters to determine their biological and microbiological properties. Part 1 consists of detailed descriptions of more than 45 individual methods, including those for bacteria, phytoplankton, zooplankton, seston, periphyton, macrophytes, benthic invertebrates, fish and other vertebrates, cellular contents, productivity and bioassay. Each method is summarized, and the applications, interferences, apparatus, reagents, analyses, calculations, reporting of results, precisions, and references are given. Part 2 consists of a glossary. Part 3 is a list of taxonomic references. (USGS)
Dietary Behaviors of a Racially and Ethnically Diverse Sample of Overweight and Obese Californians
ERIC Educational Resources Information Center
Sorkin, Dara H.; Billimek, John
2012-01-01
Objectives: To examine racial/ethnic differences in the dietary behaviors of overweight or obese adults using the 2007 California Health Interview Survey. Method: Data were obtained from the 2007 California Health Interview Survey, a population-based sample of noninstitutionalized adults in California. The sample included 26,721 adults aged 18…
Assessing the Alcohol-BMI Relationship in a US National Sample of College Students
ERIC Educational Resources Information Center
Barry, Adam E.; Piazza-Gardner, Anna K.; Holton, M. Kim
2015-01-01
Objective: This study sought to assess the body mass index (BMI)-alcohol relationship among a US national sample of college students. Design: Secondary data analysis using the Fall 2011 National College Health Assessment (NCHA). Setting: A total of 44 US higher education institutions. Methods: Participants included a national sample of college…
Asymptotic confidence intervals for the Pearson correlation via skewness and kurtosis.
Bishara, Anthony J; Li, Jiexiang; Nash, Thomas
2018-02-01
When bivariate normality is violated, the default confidence interval of the Pearson correlation can be inaccurate. Two new methods were developed based on the asymptotic sampling distribution of Fisher's z' under the general case where bivariate normality need not be assumed. In Monte Carlo simulations, the most successful of these methods relied on the (Vale & Maurelli, 1983, Psychometrika, 48, 465) family to approximate a distribution via the marginal skewness and kurtosis of the sample data. In Simulation 1, this method provided more accurate confidence intervals of the correlation in non-normal data, at least as compared to no adjustment of the Fisher z' interval, or to adjustment via the sample joint moments. In Simulation 2, this approximate distribution method performed favourably relative to common non-parametric bootstrap methods, but its performance was mixed relative to an observed imposed bootstrap and two other robust methods (PM1 and HC4). No method was completely satisfactory. An advantage of the approximate distribution method, though, is that it can be implemented even without access to raw data if sample skewness and kurtosis are reported, making the method particularly useful for meta-analysis. Supporting information includes R code. © 2017 The British Psychological Society.
NASA Technical Reports Server (NTRS)
Jahnsen, Vilhelm J. (Inventor); Campen, Jr., Charles F. (Inventor)
1980-01-01
A sample processor and method for the automatic extraction of families of compounds, known as extracts, from liquid and/or homogenized solid samples are disclosed. The sample processor includes a tube support structure which supports a plurality of extraction tubes, each containing a sample from which families of compounds are to be extracted. The support structure is moveable automatically with respect to one or more extraction stations, so that as each tube is at each station a solvent system, consisting of a solvent and reagents, is introduced therein. As a result an extract is automatically extracted from the tube. The sample processor includes an arrangement for directing the different extracts from each tube to different containers, or to direct similar extracts from different tubes to the same utilization device.
DiMichele, Daniel L; Spradley, M Katherine
2012-09-10
Reliable methods for sex estimation during the development of a biological profile are important to the forensic community in instances when the common skeletal elements used to assess sex are absent or damaged. Sex estimation from the calcaneus has potentially significant importance for the forensic community. Specifically, measurements of the calcaneus provide an additional reliable method for sex estimation via discriminant function analysis based on a North American forensic population. Research on a modern American sample was chosen in order to develop up-to-date population specific discriminant functions for sex estimation. The current study addresses this matter, building upon previous research and introduces a new measurement, posterior circumference that promises to advance the accuracy of use of this single, highly resistant bone in future instances of sex determination from partial skeletal remains. Data were collected from The William Bass Skeletal Collection, housed at The University of Tennessee. Sample size includes 320 adult individuals born between the years 1900 and 1985. The sample was comprised of 136 females and 184 males. Skeletons used for measurements were confined to those with fused diaphyses showing no signs of pathology or damage that may have altered measurements, and that also had accompanying records that included information on ancestry, age, and sex. Measurements collected and analyzed include maximum length, load-arm length, load-arm width, and posterior circumference. The sample was used to compute a discriminant function, based on all four variables, and was performed in SAS 9.1.3. The discriminant function obtained an overall cross-validated classification rate of 86.69%. Females were classified correctly in 88.64% of the cases and males were correctly classified in 84.75% of the cases. Due to the increasing heterogeneity of current populations further discussion on this topic will include the importance that the re-evaluation of past studies has on modern forensic populations. Due to secular and micro evolutionary changes among populations, the near future must include additional methods being updated, and new methods being examined, both which should cover a wide population spectrum. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Atkinson, David A.
2002-01-01
Methods and apparatus for ion mobility spectrometry and analyte detection and identification verification system are disclosed. The apparatus is configured to be used in an ion mobility spectrometer and includes a plurality of reactant reservoirs configured to contain a plurality of reactants which can be reacted with the sample to form adducts having varying ion mobilities. A carrier fluid, such as air or nitrogen, is used to carry the sample into the spectrometer. The plurality of reactants are configured to be selectively added to the carrier stream by use inlet and outlet manifolds in communication with the reagent reservoirs, the reservoirs being selectively isolatable by valves. The invention further includes a spectrometer having the reagent system described. In the method, a first reactant is used with the sample. Following a positive result, a second reactant is used to determine whether a predicted response occurs. The occurrence of the second predicted response tends to verify the existence of a component of interest within the sample. A third reactant can also be used to provide further verification of the existence of a component of interest. A library can be established of known responses of compounds of interest with various reactants and the results of a specific multi-reactant survey of a sample can be compared against the library to determine whether a component detected in the sample is likely to be a specific component of interest.
Liang, L; Lazoff, S; Chan, C; Horvat, M; Woods, J S
1998-11-01
A method for trace determination of total arsenic in ambient waters is described. Arsenic is separated on-line from a large volume water sample by hydride generation and purging, pre-collected on a Pd coated pyrolytic platform cuvette using a simple and inexpensive system, and finally detected by GFAAS. Instrument parameters, hydride generation, transportation, and collection were optimized. The analytical behavior for major species including As(3+), As(5+), monomethyl As (MMA), and dimethyl As (DMA) were investigated individually. Problems arising from use of the system were discussed and eliminated. The necessity of sample digestion and an efficient digestion method were studied. Sample digestion for water with low organic content such as tap water and clean ground water and some clean surface water can be omitted. The method detection limit (MDL) is 0.3 ng l(-1) for a 25 ml water sample. Recoveries close to 100% with R.S.D.<5% can be easily achieved. Typical aqueous samples including tap, ground, lake, river, rain, sewage effluent, and saline water from different origins in the US, China, and Canada were collected and analyzed using ultra clean sampling and analysis techniques. The background levels of As in most water analyzed were established for the first time, and found to be far above the EPA's health effect criteria, 18 ng l(-1).
Some Methods for Evaluating Program Implementation.
ERIC Educational Resources Information Center
Hardy, Roy A.
An approach to evaluating program implementation is described. This approach includes the development of a project description which includes a structure matrix, sampling from the structure matrix, and preparing an implementation evaluation plan. The implementation evaluation plan should include: (1) verification of implementation of planned…
Rapid Sampling of Molecules via Skin for Diagnostic and Forensic Applications
Paliwal, Sumit; Ogura, Makoto
2010-01-01
ABSTRACT Purpose Skin provides an excellent portal for diagnostic monitoring of a variety of entities; however, there is a dearth of reliable methods for patient-friendly sampling of skin constituents. This study describes the use of low-frequency ultrasound as a one-step methodology for rapid sampling of molecules from the skin. Methods Sampling was performed using a brief exposure of 20 kHz ultrasound to skin in the presence of a sampling fluid. In vitro sampling from porcine skin was performed to assess the effectiveness of the method and its ability to sample drugs and endogenous epidermal biomolecules from the skin. Dermal presence of an antifungal drug—fluconazole and an abused substance, cocaine—was assessed in rats. Results Ultrasonic sampling captured the native profile of various naturally occurring moisturizing factors in skin. A high sampling efficiency (79 ± 13%) of topically delivered drug was achieved. Ultrasound consistently sampled greater amounts of drug from the skin compared to tape stripping. Ultrasonic sampling also detected sustained presence of cocaine in rat skin for up to 7 days as compared to its rapid disappearance from the urine. Conclusions Ultrasonic sampling provides significant advantages including enhanced sampling from deeper layers of skin and high temporal sampling sensitivity. PMID:20238151
Rare Earth Element and Trace Element Data Associated with Hydrothermal Spring Reservoir Rock, Idaho
Quillinan, Scott; Bagdonas, Davin
2017-06-22
These data represent rock samples collected in Idaho that correspond with naturally occurring hydrothermal samples that were collected and analyzed by INL (Idaho Falls, ID). Representative samples of type rocks were selected to best represent the various regions of Idaho in which naturally occurring hydrothermal waters occur. This includes the Snake River Plain (SRP), Basin and Range type structures east of the SRP, and large scale/deep seated orogenic uplift of the Sawtooth Mountains, ID. Analysis includes ICP-OES and ICP-MS methods for Major, Trace, and REE concentrations.
NASA Technical Reports Server (NTRS)
King, R. B.; Fordyce, J. S.; Antoine, A. C.; Leibecki, H. F.; Neustadter, H. E.; Sidik, S. M.
1976-01-01
Concentrations of 60 chemical elements in the airborne particulate matter were measured at 16 sites in Cleveland, OH over a 1 year period during 1971 and 1972 (45 to 50 sampling days). Analytical methods used included instrumental neutron activation, emission spectroscopy, and combustion techniques. Uncertainties in the concentrations associated with the sampling procedures, the analytical methods, the use of several analytical facilities, and samples with concentrations below the detection limits are evaluated in detail. The data are discussed in relation to other studies and source origins. The trace constituent concentrations as a function of wind direction are used to suggest a practical method for air pollution source identification.
NASA Technical Reports Server (NTRS)
Lites, B. W.; Skumanich, A.
1985-01-01
A method is presented for recovery of the vector magnetic field and thermodynamic parameters from polarization measurement of photospheric line profiles measured with filtergraphs. The method includes magneto-optic effects and may be utilized on data sampled at arbitrary wavelengths within the line profile. The accuracy of this method is explored through inversion of synthetic Stokes profiles subjected to varying levels of random noise, instrumental wave-length resolution, and line profile sampling. The level of error introduced by the systematic effect of profile sampling over a finite fraction of the 5 minute oscillation cycle is also investigated. The results presented here are intended to guide instrumental design and observational procedure.
Method and apparatus for implementing material thermal property measurement by flash thermal imaging
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Jiangang
A method and apparatus are provided for implementing measurement of material thermal properties including measurement of thermal effusivity of a coating and/or film or a bulk material of uniform property. The test apparatus includes an infrared camera, a data acquisition and processing computer coupled to the infrared camera for acquiring and processing thermal image data, a flash lamp providing an input of heat onto the surface of a two-layer sample with an enhanced optical filter covering the flash lamp attenuating an entire infrared wavelength range with a series of thermal images is taken of the surface of the two-layer sample.
Sampling in freshwater environments: suspended particle traps and variability in the final data.
Barbizzi, Sabrina; Pati, Alessandra
2008-11-01
This paper reports one practical method to estimate the measurement uncertainty including sampling, derived by the approach implemented by Ramsey for soil investigations. The methodology has been applied to estimate the measurements uncertainty (sampling and analyses) of (137)Cs activity concentration (Bq kg(-1)) and total carbon content (%) in suspended particle sampling in a freshwater ecosystem. Uncertainty estimates for between locations, sampling and analysis components have been evaluated. For the considered measurands, the relative expanded measurement uncertainties are 12.3% for (137)Cs and 4.5% for total carbon. For (137)Cs, the measurement (sampling+analysis) variance gives the major contribution to the total variance, while for total carbon the spatial variance is the dominant contributor to the total variance. The limitations and advantages of this basic method are discussed.
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong
2017-04-01
Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.
Determination of fossil carbon content in Swedish waste fuel by four different methods.
Jones, Frida C; Blomqvist, Evalena W; Bisaillon, Mattias; Lindberg, Daniel K; Hupa, Mikko
2013-10-01
This study aimed to determine the content of fossil carbon in waste combusted in Sweden by using four different methods at seven geographically spread combustion plants. In total, the measurement campaign included 42 solid samples, 21 flue gas samples, 3 sorting analyses and 2 investigations using the balance method. The fossil carbon content in the solid samples and in the flue gas samples was determined using (14)C-analysis. From the analyses it was concluded that about a third of the carbon in mixed Swedish waste (municipal solid waste and industrial waste collected at Swedish industry sites) is fossil. The two other methods (the balance method and calculations from sorting analyses), based on assumptions and calculations, gave similar results in the plants in which they were used. Furthermore, the results indicate that the difference between samples containing as much as 80% industrial waste and samples consisting of solely municipal solid waste was not as large as expected. Besides investigating the fossil content of the waste, the project was also established to investigate the usability of various methods. However, it is difficult to directly compare the different methods used in this project because besides the estimation of emitted fossil carbon the methods provide other information, which is valuable to the plant owner. Therefore, the choice of method can also be controlled by factors other than direct determination of the fossil fuel emissions when considering implementation in the combustion plants.
Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models.
Blutke, Andreas; Wanke, Rüdiger
2018-03-06
In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the "Orientator" and "Isector" methods, and vertical uniform random (VUR) sections.
A thioacidolysis method tailored for higher‐throughput quantitative analysis of lignin monomers
Foster, Cliff; Happs, Renee M.; Doeppke, Crissa; Meunier, Kristoffer; Gehan, Jackson; Yue, Fengxia; Lu, Fachuang; Davis, Mark F.
2016-01-01
Abstract Thioacidolysis is a method used to measure the relative content of lignin monomers bound by β‐O‐4 linkages. Current thioacidolysis methods are low‐throughput as they require tedious steps for reaction product concentration prior to analysis using standard GC methods. A quantitative thioacidolysis method that is accessible with general laboratory equipment and uses a non‐chlorinated organic solvent and is tailored for higher‐throughput analysis is reported. The method utilizes lignin arylglycerol monomer standards for calibration, requires 1–2 mg of biomass per assay and has been quantified using fast‐GC techniques including a Low Thermal Mass Modular Accelerated Column Heater (LTM MACH). Cumbersome steps, including standard purification, sample concentrating and drying have been eliminated to help aid in consecutive day‐to‐day analyses needed to sustain a high sample throughput for large screening experiments without the loss of quantitation accuracy. The method reported in this manuscript has been quantitatively validated against a commonly used thioacidolysis method and across two different research sites with three common biomass varieties to represent hardwoods, softwoods, and grasses. PMID:27534715
Determination of total mercury in biological and geological samples
Crock, James G.
2005-01-01
The analytical chemist is faced with several challenges when determining mercury in biological and geological materials. These challenges include widespread mercury contamination, both in the laboratory and the environment, possible losses of mercury during sample preparation and digestion, the wide range of mercury values commonly observed, ranging from the low nanogram per gram or per liter for background areas to hundreds of milligrams per kilogram in contaminated or ore-bearing areas, great matrix diversity, and sample heterogeneity1. These factors can be naturally occurring or anthropogenic, but must be addressed to provide a precise and accurate analysis. Although there are many instrumental methods available for the successful determination of mercury, no one technique will address all problems or all samples all of the time. The approach for the determination of mercury used at the U.S. Geological Survey, Crustal Imaging and Characterization Team, Denver Laboratories, utilizes a suite of complementary instrumental methods when approaching a study requiring mercury analyses. Typically, a study could require the analysis of waters, leachates or selective digestions of solids, vegetation, and biological materials such as tissue, bone, or shell, soils, rocks, sediments, coals, sludges, and(or) ashes. No one digestion or sample preparation method will be suitable for all of these matrices. The digestions typically employed at our laboratories include: (i) a closed-vessel microwave method using nitric acid and hydrogen peroxide, followed by digestion/dilution with a nitric acid/sodium dichromate solution, (ii) a robotic open test-tube digestion with nitric acid and sodium dichromate, (iii) a sealed Teflon? vessel with nitric acid and sodium dichromate, (iv) a sealed glass bottle with nitric acid and sodium dichromate, or (v) open test tube digestion with nitric and sulfuric acids and vanadium pentoxide. The common factor in all these digestions is that they are very oxidative to ensure the conversion of all mercury forms into Hg (II). Each method of digestion has its advantages and limitations. The method of detection used in our laboratories involves a combination of an in-house, custom, classic continuous-flow cold-vapor atomic absorption spectrometry (CVAAS), a commercially available, automated, flow-injection and a continuous flow cold-vapor atomic fluorescence spectrometry (CV-AFS) systems, and a relatively new, automated and integrated approach where solid or liquid samples are thermally decomposed under an oxygen atmosphere (a nitrogen atmosphere is used for coals) and the released mercury vapor trapped onto a gold gauze and then thermally released into an AAS system. Other less frequently used instrumental methods available for the determination of mercury include inductively coupled plasma ? optical emission spectrometry (ICP-OES), inductively couple plasma ? mass spectrometry (ICP-MS) (both solution nebulization and laser ablation), and instrumental neutron activation analysis (INAA). Results from two case studies involving the determination of mercury in the challenging matrices of biological materials will be presented. These will include fillet, liver and stomach-content samples from grayling for a baseline/background study in Alaska, and samples of meat tissue and shell material from Tanner crabs from Glacier Bay, Alaska. These studies show that the method of digestion is more important than a very sensitive detection limit for mercury.
Toroid cavity/coil NMR multi-detector
Gerald, II, Rex E.; Meadows, Alexander D.; Gregar, Joseph S.; Rathke, Jerome W.
2007-09-18
An analytical device for rapid, non-invasive nuclear magnetic resonance (NMR) spectroscopy of multiple samples using a single spectrometer is provided. A modified toroid cavity/coil detector (TCD), and methods for conducting the simultaneous acquisition of NMR data for multiple samples including a protocol for testing NMR multi-detectors are provided. One embodiment includes a plurality of LC resonant circuits including spatially separated toroid coil inductors, each toroid coil inductor enveloping its corresponding sample volume, and tuned to resonate at a predefined frequency using a variable capacitor. The toroid coil is formed into a loop, where both ends of the toroid coil are brought into coincidence. Another embodiment includes multiple micro Helmholtz coils arranged on a circular perimeter concentric with a central conductor of the toroid cavity.
Analysis of large soil samples for actinides
Maxwell, III; Sherrod, L [Aiken, SC
2009-03-24
A method of analyzing relatively large soil samples for actinides by employing a separation process that includes cerium fluoride precipitation for removing the soil matrix and precipitates plutonium, americium, and curium with cerium and hydrofluoric acid followed by separating these actinides using chromatography cartridges.
CONCEPTS AND APPROACHES FOR THE BIOASSESSMENT OF NON-WADEABLE STREAMS AND RIVERS
This document is intended to assist users in establishing or refining protocols, including the specific methods related to field sampling, laboratory sample processing, taxonomy, data entry, management and analysis, and final assessment and reporting. It also reviews and provide...
ENVIRONMENTAL TECHNOLOGY VERIFICATION (ETV) TEST OF DIOXIN EMISSION MONITORS
The performance of four dioxin emission monitors including two long-term sampling devices, the DMS (DioxinMonitoringSystem) and AMESA (Adsorption Method for Sampling Dioxins and Furans), and two semi-real-time continuous monitors, RIMMPA-TOFMS (Resonance Ionization with Multi-Mir...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, Gregory F.; Amidan, Brett G.; Krauter, Paula
2011-05-01
Two concerns were raised by the Government Accountability Office following the 2001 building contaminations via letters containing Bacillus anthracis (BA). These included the: 1) lack of validated sampling methods, and 2) need to use statistical sampling to quantify the confidence of no contamination when all samples have negative results. Critical to addressing these concerns is quantifying the false negative rate (FNR). The FNR may depend on the 1) method of contaminant deposition, 2) surface concentration of the contaminant, 3) surface material being sampled, 4) sample collection method, 5) sample storage/transportation conditions, 6) sample processing method, and 7) sample analytical method.more » A review of the literature found 17 laboratory studies that focused on swab, wipe, or vacuum samples collected from a variety of surface materials contaminated by BA or a surrogate, and used culture methods to determine the surface contaminant concentration. These studies quantified performance of the sampling and analysis methods in terms of recovery efficiency (RE) and not FNR (which left a major gap in available information). Quantifying the FNR under a variety of conditions is a key aspect of validating sample and analysis methods, and also for calculating the confidence in characterization or clearance decisions based on a statistical sampling plan. A laboratory study was planned to partially fill the gap in FNR results. This report documents the experimental design developed by Pacific Northwest National Laboratory and Sandia National Laboratories (SNL) for a sponge-wipe method. The testing was performed by SNL and is now completed. The study investigated the effects on key response variables from six surface materials contaminated with eight surface concentrations of a BA surrogate (Bacillus atrophaeus). The key response variables include measures of the contamination on test coupons of surface materials tested, contamination recovered from coupons by sponge-wipe samples, RE, and FNR. The experimental design involves 16 test runs, performed in two blocks of eight runs. Three surface materials (stainless steel, vinyl tile, and ceramic tile) were tested in the first block, while three other surface materials (plastic, painted wood paneling, and faux leather) were tested in the second block. The eight surface concentrations of the surrogate were randomly assigned to test runs within each block. Some of the concentrations were very low and presented challenges for deposition, sampling, and analysis. However, such tests are needed to investigate RE and FNR over the full range of concentrations of interest. In each run, there were 10 test coupons of each of the three surface materials. A positive control sample was generated at the same time as each test sample. The positive control results will be used to 1) calculate RE values for the wipe sampling and analysis method, and 2) fit RE- and FNR-concentration equations, for each of the six surface materials. Data analyses will support 1) estimating the FNR for each combination of contaminant concentration and surface material, 2) estimating the surface concentrations and their uncertainties of the contaminant for each combination of concentration and surface material, 3) estimating RE (%) and their uncertainties for each combination of contaminant concentration and surface material, 4) fitting FNR-concentration and RE-concentration equations for each of the six surface materials, 5) assessing goodness-of-fit of the equations, and 6) quantifying the uncertainty in FNR and RE predictions made with the fitted equations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, Gregory F.; Amidan, Brett G.; Krauter, Paula
2010-12-16
Two concerns were raised by the Government Accountability Office following the 2001 building contaminations via letters containing Bacillus anthracis (BA). These included the: 1) lack of validated sampling methods, and 2) need to use statistical sampling to quantify the confidence of no contamination when all samples have negative results. Critical to addressing these concerns is quantifying the probability of correct detection (PCD) (or equivalently the false negative rate FNR = 1 - PCD). The PCD/FNR may depend on the 1) method of contaminant deposition, 2) surface concentration of the contaminant, 3) surface material being sampled, 4) sample collection method, 5)more » sample storage/transportation conditions, 6) sample processing method, and 7) sample analytical method. A review of the literature found 17 laboratory studies that focused on swab, wipe, or vacuum samples collected from a variety of surface materials contaminated by BA or a surrogate, and used culture methods to determine the surface contaminant concentration. These studies quantified performance of the sampling and analysis methods in terms of recovery efficiency (RE) and not PCD/FNR (which left a major gap in available information). Quantifying the PCD/FNR under a variety of conditions is a key aspect of validating sample and analysis methods, and also for calculating the confidence in characterization or clearance decisions based on a statistical sampling plan. A laboratory study was planned to partially fill the gap in PCD/FNR results. This report documents the experimental design developed by Pacific Northwest National Laboratory and Sandia National Laboratories (SNL) for a sponge-wipe method. The study will investigate the effects on key response variables from six surface materials contaminated with eight surface concentrations of a BA surrogate (Bacillus atrophaeus). The key response variables include measures of the contamination on test coupons of surface materials tested, contamination recovered from coupons by sponge-wipe samples, RE, and PCD/FNR. The experimental design involves 16 test runs, to be performed in two blocks of eight runs. Three surface materials (stainless steel, vinyl tile, and ceramic tile) were tested in the first block, while three other surface materials (plastic, painted wood paneling, and faux leather) will be tested in the second block. The eight surface concentrations of the surrogate were randomly assigned to test runs within each block. Some of the concentrations will be very low and may present challenges for deposition, sampling, and analysis. However, such tests are needed to investigate RE and PCD/FNR over the full range of concentrations of interest. In each run, there will be 10 test coupons of each of the three surface materials. A positive control sample will be generated prior to each test sample. The positive control results will be used to 1) calculate RE values for the wipe sampling and analysis method, and 2) fit RE- and PCD-concentration equations, for each of the six surface materials. Data analyses will support 1) estimating the PCD for each combination of contaminant concentration and surface material, 2) estimating the surface concentrations and their uncertainties of the contaminant for each combination of concentration and surface material, 3) estimating RE (%) and their uncertainties for each combination of contaminant concentration and surface material, 4) fitting PCD-concentration and RE-concentration equations for each of the six surface materials, 5) assessing goodness-of-fit of the equations, and 6) quantifying the uncertainty in PCD and RE predictions made with the fitted equations.« less
Method for isolating nucleic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hurt, Jr., Richard Ashley; Elias, Dwayne A.
The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids formore » a wide variety of applications including, sequencing or species population analysis.« less
[Isolation and identification of Cronobacter (Enterobacter sakazakii) strains from food].
Dong, Xiaohui; Li, Chengsi; Wu, Qingping; Zhang, Jumei; Mo, Shuping; Guo, Weipeng; Yang, Xiaojuan; Xu, Xiaoke
2013-05-04
This study aimed to detect and quantify Cronobacter in 300 powdered milk samples and 50 non-powdered milk samples. Totally, 24 Cronobacter (formerly Enterobacter sakazakii) strains isolated from powdered milk and other foods were identified and confirmed. Cronobacter strains were detected quantitatively using most probable number (MPN) method and molecular detection method. We identified 24 Cronobacter strains using biochemical patterns, including indole production and dulcitol, malonate, melezitose, turanose, and myo-Inositol utilization. Of the 24 strains, their 16S rRNA genes were sequenced, and constructed phylogenetic tree by N-J (Neighbour-Joining) with the 16S rRNA gene sequences of 17 identified Cronobacter strains and 10 non-Cronobacter strains. Quantitative detection showed that Cronobacter strains were detected in 23 out of 350 samples yielding 6.6% detection rate. Twenty-four Cronobacter strains were isolated from 23 samples and the Cronobacter was more than 100 MPN/100g in 4 samples out of 23 samples. The 24 Cronobacter spp. isolates strains were identified and confirmed, including 19 Cronobacter sakazakii strains, 2 C. malonaticus strains, 2 C. dubliensis subsp. lactaridi strains, and 1 C. muytjensii strain. The combination of molecular detection method and most probable number (MPN) method could be suitable for the detection of Cronobacter in powdered milk, with low rate of contamination and high demand of quantitative detection. 24 isolated strains were confirmed and identified by biochemical patterns and molecular technology, and C. sakazakii could be the dominant species. The problem of Cronobacter in powdered milk should be a hidden danger to nurseling, and should catch the government and consumer's attention.
Stark, James R.; Fallon, J.D.; Fong, A.L.; Goldstein, R.M.; Hanson, P.E.; Kroening, S.E.; Lee, K.E.
1999-01-01
This report describes the design, site-selection, and implementation of the study. Methods used to collect, process, and analyze samples; characterize sites; and assess habitat are described. A comprehensive list of sample sites is provided. Sample analyses for water-quality studies included chlorophyll a, major inorganic constituents, nutrients, trace elements, tritium, radon, environmental isotopes, organic carbon, pesticides, volatile organic compounds, and other synthetic and naturallyoccurring organic compounds. Aquatic-biological samples included fish, benthic macroinvertebrates, and algal enumeration and identification, as well as synthetic-organic compounds and trace elements in fish tissue.
Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M
2016-02-06
Legionella spp. are ubiquitous in aquatic habitats and water distribution systems, including dental unit waterlines (DUWLs). The aim of the present study was to determine the prevalence of Legionella in DUWLs and tap water samples using PMA-qPCR and standard culture methods. The total viable counts (TVCs) of aerobic heterotrophic bacteria in the samples were also determined. Legionella spp. were detected and quantified using the modified ISO 11731 culture method. Extracted genomic DNA was analysed using the iQ-Check Quanti Legionella spp. kit, and the TVCs were determined according to the ISO protocol 6222. Legionella spp. were detected in 100% of the samples using the PMA-qPCR method, whereas these bacteria were detected in only 7% of the samples using the culture method. The number of colony forming units (CFUs) of the TVCs in the DUWL and tap water samples differed, with the bacterial load being significantly lower in the tap water samples (p-value = 0). The counts obtained were within the Italian standard range established for potable water in only 5% of the DUWL water samples and in 77% of the tap water samples. Our results show that the level of Legionella spp. contamination determined using the culture method does not reflect the true scale of the problem, and consequently we recommend testing for the presence of aerobic heterotrophic bacteria based on the assumption that Legionella spp. are components of biofilms.
Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M.
2016-01-01
Legionella spp. are ubiquitous in aquatic habitats and water distribution systems, including dental unit waterlines (DUWLs). The aim of the present study was to determine the prevalence of Legionella in DUWLs and tap water samples using PMA-qPCR and standard culture methods. The total viable counts (TVCs) of aerobic heterotrophic bacteria in the samples were also determined. Legionella spp. were detected and quantified using the modified ISO 11731 culture method. Extracted genomic DNA was analysed using the iQ-Check Quanti Legionella spp. kit, and the TVCs were determined according to the ISO protocol 6222. Legionella spp. were detected in 100% of the samples using the PMA-qPCR method, whereas these bacteria were detected in only 7% of the samples using the culture method. The number of colony forming units (CFUs) of the TVCs in the DUWL and tap water samples differed, with the bacterial load being significantly lower in the tap water samples (p-value = 0). The counts obtained were within the Italian standard range established for potable water in only 5% of the DUWL water samples and in 77% of the tap water samples. Our results show that the level of Legionella spp. contamination determined using the culture method does not reflect the true scale of the problem, and consequently we recommend testing for the presence of aerobic heterotrophic bacteria based on the assumption that Legionella spp. are components of biofilms. PMID:26861373
O'Reilly, Joseph E; Donoghue, Philip C J
2018-03-01
Consensus trees are required to summarize trees obtained through MCMC sampling of a posterior distribution, providing an overview of the distribution of estimated parameters such as topology, branch lengths, and divergence times. Numerous consensus tree construction methods are available, each presenting a different interpretation of the tree sample. The rise of morphological clock and sampled-ancestor methods of divergence time estimation, in which times and topology are coestimated, has increased the popularity of the maximum clade credibility (MCC) consensus tree method. The MCC method assumes that the sampled, fully resolved topology with the highest clade credibility is an adequate summary of the most probable clades, with parameter estimates from compatible sampled trees used to obtain the marginal distributions of parameters such as clade ages and branch lengths. Using both simulated and empirical data, we demonstrate that MCC trees, and trees constructed using the similar maximum a posteriori (MAP) method, often include poorly supported and incorrect clades when summarizing diffuse posterior samples of trees. We demonstrate that the paucity of information in morphological data sets contributes to the inability of MCC and MAP trees to accurately summarise of the posterior distribution. Conversely, majority-rule consensus (MRC) trees represent a lower proportion of incorrect nodes when summarizing the same posterior samples of trees. Thus, we advocate the use of MRC trees, in place of MCC or MAP trees, in attempts to summarize the results of Bayesian phylogenetic analyses of morphological data.
O’Reilly, Joseph E; Donoghue, Philip C J
2018-01-01
Abstract Consensus trees are required to summarize trees obtained through MCMC sampling of a posterior distribution, providing an overview of the distribution of estimated parameters such as topology, branch lengths, and divergence times. Numerous consensus tree construction methods are available, each presenting a different interpretation of the tree sample. The rise of morphological clock and sampled-ancestor methods of divergence time estimation, in which times and topology are coestimated, has increased the popularity of the maximum clade credibility (MCC) consensus tree method. The MCC method assumes that the sampled, fully resolved topology with the highest clade credibility is an adequate summary of the most probable clades, with parameter estimates from compatible sampled trees used to obtain the marginal distributions of parameters such as clade ages and branch lengths. Using both simulated and empirical data, we demonstrate that MCC trees, and trees constructed using the similar maximum a posteriori (MAP) method, often include poorly supported and incorrect clades when summarizing diffuse posterior samples of trees. We demonstrate that the paucity of information in morphological data sets contributes to the inability of MCC and MAP trees to accurately summarise of the posterior distribution. Conversely, majority-rule consensus (MRC) trees represent a lower proportion of incorrect nodes when summarizing the same posterior samples of trees. Thus, we advocate the use of MRC trees, in place of MCC or MAP trees, in attempts to summarize the results of Bayesian phylogenetic analyses of morphological data. PMID:29106675
Evaluating Composite Sampling Methods of Bacillus spores at Low Concentrations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hess, Becky M.; Amidan, Brett G.; Anderson, Kevin K.
Restoring facility operations after the 2001 Amerithrax attacks took over three months to complete, highlighting the need to reduce remediation time. The most time intensive tasks were environmental sampling and sample analyses. Composite sampling allows disparate samples to be combined, with only a single analysis needed, making it a promising method to reduce response times. We developed a statistical experimental design to test three different composite sampling methods: 1) single medium single pass composite: a single cellulose sponge samples multiple coupons; 2) single medium multi-pass composite: a single cellulose sponge is used to sample multiple coupons; and 3) multi-medium post-samplemore » composite: a single cellulose sponge samples a single surface, and then multiple sponges are combined during sample extraction. Five spore concentrations of Bacillus atrophaeus Nakamura spores were tested; concentrations ranged from 5 to 100 CFU/coupon (0.00775 to 0.155CFU/cm2, respectively). Study variables included four clean surface materials (stainless steel, vinyl tile, ceramic tile, and painted wallboard) and three grime coated/dirty materials (stainless steel, vinyl tile, and ceramic tile). Analysis of variance for the clean study showed two significant factors: composite method (p-value < 0.0001) and coupon material (p-value = 0.0008). Recovery efficiency (RE) was higher overall using the post-sample composite (PSC) method compared to single medium composite from both clean and grime coated materials. RE with the PSC method for concentrations tested (10 to 100 CFU/coupon) was similar for ceramic tile, painted wall board, and stainless steel for clean materials. RE was lowest for vinyl tile with both composite methods. Statistical tests for the dirty study showed RE was significantly higher for vinyl and stainless steel materials, but significantly lower for ceramic tile. These results suggest post-sample compositing can be used to reduce sample analysis time when responding to a Bacillus anthracis contamination event of clean or dirty surfaces.« less
Recruitment for Occupational Research: Using Injured Workers as the Point of Entry into Workplaces
Koehoorn, Mieke; Trask, Catherine M.; Teschke, Kay
2013-01-01
Objective To investigate the feasibility, costs and sample representativeness of a recruitment method that used workers with back injuries as the point of entry into diverse working environments. Methods Workers' compensation claims were used to randomly sample workers from five heavy industries and to recruit their employers for ergonomic assessments of the injured worker and up to 2 co-workers. Results The final study sample included 54 workers from the workers’ compensation registry and 72 co-workers. This sample of 126 workers was based on an initial random sample of 822 workers with a compensation claim, or a ratio of 1 recruited worker to approximately 7 sampled workers. The average recruitment cost was CND$262/injured worker and CND$240/participating worksite including co-workers. The sample was representative of the heavy industry workforce, and was successful in recruiting the self-employed (8.2%), workers from small employers (<20 workers, 38.7%), and workers from diverse working environments (49 worksites, 29 worksite types, and 51 occupations). Conclusions The recruitment rate was low but the cost per participant reasonable and the sample representative of workers in small worksites. Small worksites represent a significant portion of the workforce but are typically underrepresented in occupational research despite having distinct working conditions, exposures and health risks worthy of investigation. PMID:23826387
System and method for measuring permeability of materials
Hallman, Jr., Russell Louis; Renner, Michael John
2013-07-09
Systems and methods are provided for measuring the permeance of a material. The permeability of the material may also be derived. Systems typically provide a liquid or high concentration fluid bath on one side of a material test sample, and a gas flow across the opposing side of the material test sample. The mass flow rate of permeated fluid as a fraction of the combined mass flow rate of gas and permeated fluid is used to calculate the permeance of the material. The material test sample may be a sheet, a tube, or a solid shape. Operational test conditions may be varied, including concentration of the fluid, temperature of the fluid, strain profile of the material test sample, and differential pressure across the material test sample.
High energy PIXE: A tool to characterize multi-layer thick samples
NASA Astrophysics Data System (ADS)
Subercaze, A.; Koumeir, C.; Métivier, V.; Servagent, N.; Guertin, A.; Haddad, F.
2018-02-01
High energy PIXE is a useful and non-destructive tool to characterize multi-layer thick samples such as cultural heritage objects. In a previous work, we demonstrated the possibility to perform quantitative analysis of simple multi-layer samples using high energy PIXE, without any assumption on their composition. In this work an in-depth study of the parameters involved in the method previously published is proposed. Its extension to more complex samples with a repeated layer is also presented. Experiments have been performed at the ARRONAX cyclotron using 68 MeV protons. The thicknesses and sequences of a multi-layer sample including two different layers of the same element have been determined. Performances and limits of this method are presented and discussed.
Salmonella testing of pooled pre-enrichment broth cultures for screening multiple food samples.
Price, W R; Olsen, R A; Hunter, J E
1972-04-01
A method has been described for testing multiple food samples for Salmonella without loss in sensitivity. The method pools multiple pre-enrichment broth cultures into single enrichment broths. The subsequent stages of the Salmonella analysis are not altered. The method was found applicable to several dry food materials including nonfat dry milk, dried egg albumin, cocoa, cottonseed flour, wheat flour, and shredded coconut. As many as 25 pre-enrichment broth cultures were pooled without apparent loss in the sensitivity of Salmonella detection as compared to individual sample analysis. The procedure offers a simple, yet effective, way to increase sample capacity in the Salmonella testing of foods, particularly where a large proportion of samples ordinarily is negative. It also permits small portions of pre-enrichment broth cultures to be retained for subsequent individual analysis if positive tests are found. Salmonella testing of pooled pre-enrichment broths provides increased consumer protection for a given amount of analytical effort as compared to individual sample analysis.
Dielectrophoresis-Based Sample Handling in General-Purpose Programmable Diagnostic Instruments
Gascoyne, Peter R. C.; Vykoukal, Jody V.
2009-01-01
As the molecular origins of disease are better understood, the need for affordable, rapid, and automated technologies that enable microscale molecular diagnostics has become apparent. Widespread use of microsystems that perform sample preparation and molecular analysis could ensure that the benefits of new biomedical discoveries are realized by a maximum number of people, even those in environments lacking any infrastructure. While progress has been made in developing miniaturized diagnostic systems, samples are generally processed off-device using labor-intensive and time-consuming traditional sample preparation methods. We present the concept of an integrated programmable general-purpose sample analysis processor (GSAP) architecture where raw samples are routed to separation and analysis functional blocks contained within a single device. Several dielectrophoresis-based methods that could serve as the foundation for building GSAP functional blocks are reviewed including methods for cell and particle sorting, cell focusing, cell ac impedance analysis, cell lysis, and the manipulation of molecules and reagent droplets. PMID:19684877
NASA Technical Reports Server (NTRS)
Chen, H. C.; Neback, H. E.; Kao, T. J.; Yu, N. Y.; Kusunose, K.
1991-01-01
This manual explains how to use an Euler based computational method for predicting the airframe/propulsion integration effects for an aft-mounted turboprop transport. The propeller power effects are simulated by the actuator disk concept. This method consists of global flow field analysis and the embedded flow solution for predicting the detailed flow characteristics in the local vicinity of an aft-mounted propfan engine. The computational procedure includes the use of several computer programs performing four main functions: grid generation, Euler solution, grid embedding, and streamline tracing. This user's guide provides information for these programs, including input data preparations with sample input decks, output descriptions, and sample Unix scripts for program execution in the UNICOS environment.
USDA-ARS?s Scientific Manuscript database
Over the past 50 years, significant progress has been made in improving our understanding of the extent and potential consequences of groundwater contamination, with research advancing on several fronts including groundwater sampling methods, laboratory detection methods, subsurface transport (and m...
This data set contains the method performance results for CTEPP-OH. This includes field blanks, method blanks, duplicate samples, analytical duplicates, matrix spikes, and surrogate recovery standards.
The Children’s Total Exposure to Persistent Pesticides and Other Persisten...
Proximate Composition Analysis.
2016-01-01
The proximate composition of foods includes moisture, ash, lipid, protein and carbohydrate contents. These food components may be of interest in the food industry for product development, quality control (QC) or regulatory purposes. Analyses used may be rapid methods for QC or more accurate but time-consuming official methods. Sample collection and preparation must be considered carefully to ensure analysis of a homogeneous and representative sample, and to obtain accurate results. Estimation methods of moisture content, ash value, crude lipid, total carbohydrates, starch, total free amino acids and total proteins are put together in a lucid manner.
Lin, Zhichao; Wu, Zhongyu
2009-05-01
A rapid and reliable radiochemical method coupled with a simple and compact plating apparatus was developed, validated, and applied for the analysis of (210)Po in variety of food products and bioassay samples. The method performance characteristics, including accuracy, precision, robustness, and specificity, were evaluated along with a detailed measurement uncertainty analysis. With high Po recovery, improved energy resolution, and effective removal of interfering elements by chromatographic extraction, the overall method accuracy was determined to be better than 5% with measurement precision of 10%, at 95% confidence level.
Detection of Helicobacter pylori in bovine, buffalo, camel, ovine, and caprine milk in Iran.
Rahimi, Ebrahim; Kheirabadi, Elahe Kazemi
2012-05-01
Helicobacter pylori infection in humans is one of the most common infections worldwide. However, the origin and transmission of this bacterium has not been clearly explained. One of the suggested theories is transmission via raw milk from animals to human beings. This study was conducted to determine the prevalence rate of H. pylori in bulk milk samples from dairy bovine, buffalo, camel, ovine, and caprine herds in Iran. In the present study, 447 bulk milk samples from 230 dairy bovine, buffalo, camel, ovine, and caprine herds were collected in four provinces and tested for H. pylori by cultural method and polymerase chain reaction (PCR) for the detection of the ureC (glmM) gene. The animals whose milk samples collected for this study were clinically healthy. Using the cultural method, three of 447 milk samples (0.67%), including two sheep (2.2%) and one buffalo (1.6%) milk samples, were found to be contaminated with H. pylori. H. pylori ureC gene was detected in 56 (12.5%) of milk samples, including 19 cow (14.1%), 11 sheep (12.2%), nine goat (8.7%), two camel (3.6%), and 15 buffalo (23.4%) milk samples. Using PCR method, there were significant differences (p<0.05) in the level of contamination with H. pylori between milk samples collected from different species. The present study is the first report of the isolation of H. pylori from raw sheep and buffalo milk in Iran and the first demonstration of H. pylori DNA in camel and buffalo milk.
[EXPRESS IDENTIFICATION OF POSITIVE BLOOD CULTURES USING DIRECT MALDI-TOF MASS SPECTROMETRY].
Popov, D A; Ovseenko, S T; Vostrikova, T Yu
2015-01-01
To evaluate the effectiveness of direct identification of pathogens of bacteremia by direct matrix assisted laser desorption ionization time-flight mass spectrometry (mALDI-TOF) compared to routine method. A prospective study included 211 positive blood cultures obtained from 116 patients (106 adults and 10 children, aged from 2 weeks to 77 years old in the ICU after open heart surgery. Incubation was carried out under aerobic vials with a sorbent for antibiotics Analyzer BacT/ALERT 3D 120 (bioMerieux, France) in parallel with the primary sieving blood cultures on solid nutrient media with subsequent identification of pure cultures using MALDI-TOF mass spectrometry analyzer Vitek MS, bioMerieux, France routine method), after appropriate sample preparation we carried out a direct (without screening) MALDI-TOF mass spectrometric study of monocomponental blood cultures (n = 201). using a routine method in 211 positive blood cultures we identified 23 types of microorganisms (Staphylococcus (n = 87), Enterobacteria- ceae (n = 71), Enterococci (n = 20), non-fermentative Gram-negative bacteria (n = 18), others (n = 5). The average time of incubation of samples to obtain a signal of a blood culture growth was 16.2 ± 7.4 h (from 3.75 to 51 hours.) During the first 12 hours of incubation, growth was obtained in 32.4% of the samples, and on the first day in 92.2%. In the direct mass spectrometric analysis mnonocomponental blood cultures (n = 201) is well defined up to 153 species of the sample (76.1%), while the share of successful identification of Gram-negative bacteria was higher than that of Gram-positive (85.4 and 69, 1%, respectively p = 0.01). The high degree of consistency in the results of standard and direct method of identifying blood cultures using MALDI-TOF mass spectrometry (κ = 0.96, p < 0.001; the samples included in the calculation for which both option given result). Duration of the direct mass spectrometric analysis, including sample preparation, was no longer than 1 hour: The method of direct MALDI-TOF mass spectrometry allows to significantly speed up the identification of blood cultures that may contribute as much as possible early appointment effective regimes of starting antibiotic therapy.
Aase, Audun; Hajdusek, Ondrej; Øines, Øivind; Quarsten, Hanne; Wilhelmsson, Peter; Herstad, Tove K; Kjelland, Vivian; Sima, Radek; Jalovecka, Marie; Lindgren, Per-Eric; Aaberge, Ingeborg S
2016-01-01
A modified microscopy protocol (the LM-method) was used to demonstrate what was interpreted as Borrelia spirochetes and later also Babesia sp., in peripheral blood from patients. The method gained much publicity, but was not validated prior to publication, which became the purpose of this study using appropriate scientific methodology, including a control group. Blood from 21 patients previously interpreted as positive for Borrelia and/or Babesia infection by the LM-method and 41 healthy controls without known history of tick bite were collected, blinded and analysed for these pathogens by microscopy in two laboratories by the LM-method and conventional method, respectively, by PCR methods in five laboratories and by serology in one laboratory. Microscopy by the LM-method identified structures claimed to be Borrelia- and/or Babesia in 66% of the blood samples of the patient group and in 85% in the healthy control group. Microscopy by the conventional method for Babesia only did not identify Babesia in any samples. PCR analysis detected Borrelia DNA in one sample of the patient group and in eight samples of the control group; whereas Babesia DNA was not detected in any of the blood samples using molecular methods. The structures interpreted as Borrelia and Babesia by the LM-method could not be verified by PCR. The method was, thus, falsified. This study underlines the importance of doing proper test validation before new or modified assays are introduced.
Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Xu, Yijuan; Melton-Kreft, Rachael; Ahmed, Azad; Eickhardt, Steffen; Bjarnsholt, Thomas; Poulsen, Steen Seier; Nielsen, Per Halkjær; Earl, Joshua P; Ehrlich, Garth D; Moser, Claus
2016-11-08
Necrotizing soft tissue infections (NSTIs) are a group of infections affecting all soft tissues. NSTI involves necrosis of the afflicted tissue and is potentially life threatening due to major and rapid destruction of tissue, which often leads to septic shock and organ failure. The gold standard for identification of pathogens is culture; however molecular methods for identification of microorganisms may provide a more rapid result and may be able to identify additional microorganisms that are not detected by culture. In this study, tissue samples (n = 20) obtained after debridement of 10 patients with NSTI were analyzed by standard culture, fluorescence in situ hybridization (FISH) and multiple molecular methods. The molecular methods included analysis of microbial diversity by 1) direct 16S and D2LSU rRNA gene Microseq 2) construction of near full-length 16S rRNA gene clone libraries with subsequent Sanger sequencing for most samples, 3) the Ibis T5000 biosensor and 4) 454-based pyrosequencing. Furthermore, quantitative PCR (qPCR) was used to verify and determine the relative abundance of Streptococcus pyogenes in samples. For 70 % of the surgical samples it was possible to identify microorganisms by culture. Some samples did not result in growth (presumably due to administration of antimicrobial therapy prior to sampling). The molecular methods identified microorganisms in 90 % of the samples, and frequently detected additional microorganisms when compared to culture. Although the molecular methods generally gave concordant results, our results indicate that Microseq may misidentify or overlook microorganisms that can be detected by other molecular methods. Half of the patients were found to be infected with S. pyogenes, but several atypical findings were also made including infection by a) Acinetobacter baumannii, b) Streptococcus pneumoniae, and c) fungi, mycoplasma and Fusobacterium necrophorum. The study emphasizes that many pathogens can be involved in NSTIs, and that no specific "NSTI causing" combination of species exists. This means that clinicians should be prepared to diagnose and treat any combination of microbial pathogens. Some of the tested molecular methods offer a faster turnaround time combined with a high specificity, which makes supplemental use of such methods attractive for identification of microorganisms, especially for fulminant life-threatening infections such as NSTI.
Azzouz, Abdelmonaim; Ballesteros, Evaristo
2014-09-19
A novel analytical method using a continuous solid-phase extraction system in combination with gas chromatography-mass spectrometry for the simultaneous separation and determination of endocrine disrupting compounds (EDCs) is reported. The method was applied to major EDCs of various types including parabens, alkylphenols, phenylphenols, bisphenol A and triclosan in water. Samples were preconcentrated by using an automatic solid-phase extraction module containing a sorbent column, and retained analytes eluted with acetonitrile for derivatization with a mixture of N,O-bis(trimethylsilyl)trifluoroacetamide and trimethylchlorosilane. A number of variables potentially influencing recovery of the target compounds such as the type of SPE sorbent (Silica gel, Florisil, RP-C18, Amberlite XAD-2 and XAD-4, Oasis HLB and LiChrolut EN), eluent and properties of the water including pH and ionic strength, were examined. LiChrolut EN was found to be the most efficient sorbent for retaining the analytes, with ∼100% efficiency. The ensuing method was validated with good analytical results including low limits of detection (0.01-0.08ng/L for 100mL of sample) and good linearity (r(2)>0.997) throughout the studied concentration ranges. The method exhibited good accuracy (recoveries of 90-101%) and precision (relative standard deviations less than 7%) in the determination of EDCs in drinking, river, pond, well, swimming pool and waste water. Waste water samples were found to contain the largest number and highest concentrations of analytes (3.2-390ng/L). Copyright © 2014 Elsevier B.V. All rights reserved.
Emerson, Rachel M.
2015-01-01
Abstract Inorganic compounds in biomass, often referred to as ash, are known to be problematic in the thermochemical conversion of biomass to bio-oil or syngas and, ultimately, hydrocarbon fuels because they negatively influence reaction pathways, contribute to fouling and corrosion, poison catalysts, and impact waste streams. The most common ash-analysis methods, such as inductively coupled plasma-optical emission spectrometry/mass spectrometry (ICP-OES/MS), require considerable time and expensive reagents. Laser-induced breakdown spectroscopy (LIBS) is emerging as a technique for rapid analysis of the inorganic constituents in a wide range of biomass materials. This study compares analytical results using LIBS data to results obtained from three separate ICP-OES/MS methods for 12 samples, including six standard reference materials. Analyzed elements include aluminum, calcium, iron, magnesium, manganese, phosphorus, potassium, sodium, and silicon, and results show that concentrations can be measured with an uncertainty of approximately 100 parts per million using univariate calibration models and relatively few calibration samples. These results indicate that the accuracy of LIBS is comparable to that of ICP-OES methods and indicate that some acid-digestion methods for ICP-OES may not be reliable for Na and Al. These results also demonstrate that germanium can be used as an internal standard to improve the reliability and accuracy of measuring many elements of interest, and that LIBS can be used for rapid determination of total ash in biomass samples. Key benefits of LIBS include little sample preparation, no reagent consumption, and the generation of meaningful analytical data instantaneously. PMID:26733765
Seifertová, Marta; Čechová, Eliška; Llansola, Marta; Felipo, Vicente; Vykoukalová, Martina; Kočan, Anton
2017-10-01
We developed a simple analytical method for the simultaneous determination of representatives of various groups of neurotoxic insecticides (carbaryl, chlorpyrifos, cypermethrin, and α-endosulfan and β-endosulfan and their metabolite endosulfan sulfate) in limited amounts of animal tissues containing different amounts of lipids. Selected tissues (rodent fat, liver, and brain) were extracted in a special in-house-designed mini-extractor constructed on the basis of the Soxhlet and Twisselmann extractors. A dried tissue sample placed in a small cartridge was extracted, while the nascent extract was simultaneously filtered through a layer of sodium sulfate. The extraction was followed by combined clean-up, including gel permeation chromatography (in case of high lipid content), ultrasonication, and solid-phase extraction chromatography using C 18 on silica and aluminum oxide. Gas chromatography coupled with high-resolution mass spectrometry was used for analyte separation, detection, and quantification. Average recoveries for individual insecticides ranged from 82 to 111%. Expanded measurement uncertainties were generally lower than 35%. The developed method was successfully applied to rat tissue samples obtained from an animal model dealing with insecticide exposure during brain development. This method may also be applied to the analytical treatment of small amounts of various types of animal and human tissue samples. A significant advantage achieved using this method is high sample throughput due to the simultaneous treatment of many samples. Graphical abstract Optimized workflow for the determination of selected insecticides in small amounts of animal tissue including newly developed mini-extractor.
Phase II Tungsten Fate-and Transport Study for Camp Edwards
2010-02-01
soil and water . However, previous studies at the Massachusetts Military Reservation (MMR) at Camp Edwards demonstrated that metallic tungsten used ...7.5-12.5 ft bwt) using a Waterra sampler. Unfiltered and filtered water samples were sent to ERDC-EL for analysis of tungsten and other metals... water for tungsten and metals using ICP-MS, following the USEPA Method 6020 for sample preparation by EPA Method 3005. Metals analysis included antimony
NASA Technical Reports Server (NTRS)
Cole, H.; Habercom, M.; Crenshaw, M.; Johnson, S.; Manuel, S.; Martindale, W.; Whitman, G.; Traweek, M.
1991-01-01
Examples of the application of various methods for characterizing samples for alcohols, fatty acids, detergents, and volatile/semivolatile basic, neutral, and phenolic acid contaminants are presented. Data, applications, and interpretations are given for a variety of methods including sample preparation/cleanup procedures, ion chromatography, and gas chromatography with various detectors. Summaries of the major organic contaminants that contribute to the total organic carbon content are presented.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harper, M.
A sorbent to be used for air sampling must meet certain performance criteria including sample background, capacity, stability, and recovery. Anasorb{sup R} 747 is a proprietary 20/40 mesh beaded active carbon prepared from raw materials with a very low ash content in a process which creates a regular pore structure. The background is very low for both inorganic and organic species, and the surface is more inert and less hydrophilic than coconut charcoal, while capacity is similar. The low catalytic activity of the surface means samples of many reactive compounds remain stable for longer periods. The sorbent is compatible withmore » most solvent systems in use (e.g. carbon disulfide, methylene chloride, methanol, dimethyformamide). Anasorb 747 can be coated with chemicals for efficient adsorption of inorganic gases, which can be analyzed at very low levels because of low background interference. A large number of validated sampling methods use Anasorb 747, including methods from OSHA and NIOSH, corporate industrial hygiene laboratories, various branches of the EPA, and international agencies. These methods refer to around fifty different gases and vapors. Although this sorbent is not compatible with some compounds (e.g. low molecular weight aldehydes) it is quite close to being of universal application.« less
Optical method for determining the mechanical properties of a material
Maris, H.J.; Stoner, R.J.
1998-12-01
Disclosed is a method for characterizing a sample, comprising the steps of: (a) acquiring data from the sample using at least one probe beam wavelength to measure, for times less than a few nanoseconds, a change in the reflectivity of the sample induced by a pump beam; (b) analyzing the data to determine at least one material property by comparing a background signal component of the data with data obtained for a similar delay time range from one or more samples prepared under conditions known to give rise to certain physical and chemical material properties; and (c) analyzing a component of the measured time dependent reflectivity caused by ultrasonic waves generated by the pump beam using the at least one determined material property. The first step of analyzing may include a step of interpolating between reference samples to obtain an intermediate set of material properties. The material properties may include sound velocity, density, and optical constants. In one embodiment, only a correlation is made with the background signal, and at least one of the structural phase, grain orientation, and stoichiometry is determined. 14 figs.
Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey
2018-01-01
DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.
Optical method for determining the mechanical properties of a material
Maris, Humphrey J.; Stoner, Robert J.
1998-01-01
Disclosed is a method for characterizing a sample, comprising the steps of: (a) acquiring data from the sample using at least one probe beam wavelength to measure, for times less than a few nanoseconds, a change in the reflectivity of the sample induced by a pump beam; (b) analyzing the data to determine at least one material property by comparing a background signal component of the data with data obtained for a similar delay time range from one or more samples prepared under conditions known to give rise to certain physical and chemical material properties; and (c) analyzing a component of the measured time dependent reflectivity caused by ultrasonic waves generated by the pump beam using the at least one determined material property. The first step of analyzing may include a step of interpolating between reference samples to obtain an intermediate set of material properties. The material properties may include sound velocity, density, and optical constants. In one embodiment, only a correlation is made with the background signal, and at least one of the structural phase, grain orientation, and stoichiometry is determined.
Mori, Toshifumi; Hamers, Robert J; Pedersen, Joel A; Cui, Qiang
2014-07-17
Motivated by specific applications and the recent work of Gao and co-workers on integrated tempering sampling (ITS), we have developed a novel sampling approach referred to as integrated Hamiltonian sampling (IHS). IHS is straightforward to implement and complementary to existing methods for free energy simulation and enhanced configurational sampling. The method carries out sampling using an effective Hamiltonian constructed by integrating the Boltzmann distributions of a series of Hamiltonians. By judiciously selecting the weights of the different Hamiltonians, one achieves rapid transitions among the energy landscapes that underlie different Hamiltonians and therefore an efficient sampling of important regions of the conformational space. Along this line, IHS shares similar motivations as the enveloping distribution sampling (EDS) approach of van Gunsteren and co-workers, although the ways that distributions of different Hamiltonians are integrated are rather different in IHS and EDS. Specifically, we report efficient ways for determining the weights using a combination of histogram flattening and weighted histogram analysis approaches, which make it straightforward to include many end-state and intermediate Hamiltonians in IHS so as to enhance its flexibility. Using several relatively simple condensed phase examples, we illustrate the implementation and application of IHS as well as potential developments for the near future. The relation of IHS to several related sampling methods such as Hamiltonian replica exchange molecular dynamics and λ-dynamics is also briefly discussed.
Geffré, Anne; Concordet, Didier; Braun, Jean-Pierre; Trumel, Catherine
2011-03-01
International recommendations for determination of reference intervals have been recently updated, especially for small reference sample groups, and use of the robust method and Box-Cox transformation is now recommended. Unfortunately, these methods are not included in most software programs used for data analysis by clinical laboratories. We have created a set of macroinstructions, named Reference Value Advisor, for use in Microsoft Excel to calculate reference limits applying different methods. For any series of data, Reference Value Advisor calculates reference limits (with 90% confidence intervals [CI]) using a nonparametric method when n≥40 and by parametric and robust methods from native and Box-Cox transformed values; tests normality of distributions using the Anderson-Darling test and outliers using Tukey and Dixon-Reed tests; displays the distribution of values in dot plots and histograms and constructs Q-Q plots for visual inspection of normality; and provides minimal guidelines in the form of comments based on international recommendations. The critical steps in determination of reference intervals are correct selection of as many reference individuals as possible and analysis of specimens in controlled preanalytical and analytical conditions. Computing tools cannot compensate for flaws in selection and size of the reference sample group and handling and analysis of samples. However, if those steps are performed properly, Reference Value Advisor, available as freeware at http://www.biostat.envt.fr/spip/spip.php?article63, permits rapid assessment and comparison of results calculated using different methods, including currently unavailable methods. This allows for selection of the most appropriate method, especially as the program provides the CI of limits. It should be useful in veterinary clinical pathology when only small reference sample groups are available. ©2011 American Society for Veterinary Clinical Pathology.
Critical considerations for the application of environmental DNA methods to detect aquatic species
Goldberg, Caren S.; Turner, Cameron R.; Deiner, Kristy; Klymus, Katy E.; Thomsen, Philip Francis; Murphy, Melanie A.; Spear, Stephen F.; McKee, Anna; Oyler-McCance, Sara J.; Cornman, Robert S.; Laramie, Matthew B.; Mahon, Andrew R.; Lance, Richard F.; Pilliod, David S.; Strickler, Katherine M.; Waits, Lisette P.; Fremier, Alexander K.; Takahara, Teruhiko; Herder, Jelger E.; Taberlet, Pierre
2016-01-01
Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed.Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms.Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA.We present a synthesis of knowledge at this stage for application of this new and powerful detection method.
Feature genes predicting the FLT3/ITD mutation in acute myeloid leukemia
LI, CHENGLONG; ZHU, BIAO; CHEN, JIAO; HUANG, XIAOBING
2016-01-01
In the present study, gene expression profiles of acute myeloid leukemia (AML) samples were analyzed to identify feature genes with the capacity to predict the mutation status of FLT3/ITD. Two machine learning models, namely the support vector machine (SVM) and random forest (RF) methods, were used for classification. Four datasets were downloaded from the European Bioinformatics Institute, two of which (containing 371 samples, including 281 FLT3/ITD mutation-negative and 90 mutation-positive samples) were randomly defined as the training group, while the other two datasets (containing 488 samples, including 350 FLT3/ITD mutation-negative and 138 mutation-positive samples) were defined as the test group. Differentially expressed genes (DEGs) were identified by significance analysis of the micro-array data by using the training samples. The classification efficiency of the SCM and RF methods was evaluated using the following parameters: Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and the area under the receiver operating characteristic curve. Functional enrichment analysis was performed for the feature genes with DAVID. A total of 585 DEGs were identified in the training group, of which 580 were upregulated and five were downregulated. The classification accuracy rates of the two methods for the training group, the test group and the combined group using the 585 feature genes were >90%. For the SVM and RF methods, the rates of correct determination, specificity and PPV were >90%, while the sensitivity and NPV were >80%. The SVM method produced a slightly better classification effect than the RF method. A total of 13 biological pathways were overrepresented by the feature genes, mainly involving energy metabolism, chromatin organization and translation. The feature genes identified in the present study may be used to predict the mutation status of FLT3/ITD in patients with AML. PMID:27177049
Feature genes predicting the FLT3/ITD mutation in acute myeloid leukemia.
Li, Chenglong; Zhu, Biao; Chen, Jiao; Huang, Xiaobing
2016-07-01
In the present study, gene expression profiles of acute myeloid leukemia (AML) samples were analyzed to identify feature genes with the capacity to predict the mutation status of FLT3/ITD. Two machine learning models, namely the support vector machine (SVM) and random forest (RF) methods, were used for classification. Four datasets were downloaded from the European Bioinformatics Institute, two of which (containing 371 samples, including 281 FLT3/ITD mutation-negative and 90 mutation‑positive samples) were randomly defined as the training group, while the other two datasets (containing 488 samples, including 350 FLT3/ITD mutation-negative and 138 mutation-positive samples) were defined as the test group. Differentially expressed genes (DEGs) were identified by significance analysis of the microarray data by using the training samples. The classification efficiency of the SCM and RF methods was evaluated using the following parameters: Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and the area under the receiver operating characteristic curve. Functional enrichment analysis was performed for the feature genes with DAVID. A total of 585 DEGs were identified in the training group, of which 580 were upregulated and five were downregulated. The classification accuracy rates of the two methods for the training group, the test group and the combined group using the 585 feature genes were >90%. For the SVM and RF methods, the rates of correct determination, specificity and PPV were >90%, while the sensitivity and NPV were >80%. The SVM method produced a slightly better classification effect than the RF method. A total of 13 biological pathways were overrepresented by the feature genes, mainly involving energy metabolism, chromatin organization and translation. The feature genes identified in the present study may be used to predict the mutation status of FLT3/ITD in patients with AML.
Evaluation of a new automated instrument for pretransfusion testing.
Morelati, F; Revelli, N; Maffei, L M; Poretti, M; Santoro, C; Parravicini, A; Rebulla, P; Cole, R; Sirchia, G
1998-10-01
A number of automated devices for pretransfusion testing have recently become available. This study evaluated a fully automated device based on column agglutination technology (AutoVue System, Ortho, Raritan, NJ). Some 6747 tests including forward and reverse ABO group, Rh type and phenotype, antibody screen, autocontrol, and crossmatch were performed on random samples from 1069 blood donors, 2063 patients, and 98 newborns and cord blood. Also tested were samples from 168 immunized patients and 53 donors expressing weak or variant A and D antigens. Test results and technician times required for their performance were compared with those obtained by standard methods (manual column agglutination technology, slide, semiautomatic handler). No erroneous conclusions were found in regard to the 5028 ABO group and Rh type or phenotype determinations carried out with the device. The device rejected 1.53 percent of tests for sample inadequacy. Of the remaining 18 tests with discrepant results found with the device and not confirmed with the standard methods, 6 gave such results because of mixed-field reactions, 10 gave negative results with A2 RBCs in reverse ABO grouping, and 2 gave very weak positive reactions in antibody screening and crossmatching. In the samples from immunized patients, the device missed one weak anti-K, whereas standard methods missed five weak antibodies. In addition, 48, 34, and 31 of the 53 weak or variant antigens were detected by the device, the slide method, and the semiautomated handler, respectively. Technician time with the standard methods was 1.6 to 7 times higher than that with the device. The technical performance of the device compared favorably with that of standard methods, with a number of advantages, including in particular the saving of technician time. Sample inadequacy was the most common cause of discrepancy, which suggests that standardization of sample collection can further improve the performance of the device.
Eduardoff, Mayra; Xavier, Catarina; Strobl, Christina; Casas-Vargas, Andrea; Parson, Walther
2017-01-01
The analysis of mitochondrial DNA (mtDNA) has proven useful in forensic genetics and ancient DNA (aDNA) studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR) is commonly sequenced using established Sanger-type Sequencing (STS) protocols involving fragment sizes down to approximately 150 base pairs (bp). Recent developments include Massively Parallel Sequencing (MPS) of (multiplex) PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC) methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less), and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples), and tested challenging forensic samples (n = 2) as well as compromised solid tissue samples (n = 15) up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS method for final implementation in forensic genetic laboratories. PMID:28934125
Laser-induced fluorescence fiber optic probe measurement of oil dilution by fuel
Parks, II, James E [Knoxville, TN; Partridge, Jr., William P [Oak Ridge, TN
2010-11-23
Apparatus for detecting fuel in oil includes an excitation light source in optical communication with an oil sample for exposing the oil sample to excitation light in order to excite the oil sample from a non-excited state to an excited state and a spectrally selective device in optical communication with the oil sample for detecting light emitted from the oil sample as the oil sample returns from the excited state to a non-excited state to produce spectral indicia that can be analyzed to determine the presence of fuel in the oil sample. A method of detecting fuel in oil includes the steps of exposing a oil sample to excitation light in order to excite the oil sample from a non-excited state to an excited state, as the oil sample returns from the excited state to a non-excited state, detecting light emitted from the oil sample to produce spectral indicia; and analyzing the spectral indicia to determine the presence of fuel in the oil sample.
Ochiai, Nobuo; Tsunokawa, Jun; Sasamoto, Kikuo; Hoffmann, Andreas
2014-12-05
A novel multi-volatile method (MVM) using sequential dynamic headspace (DHS) sampling for analysis of aroma compounds in aqueous sample was developed. The MVM consists of three different DHS method parameters sets including choice of the replaceable adsorbent trap. The first DHS sampling at 25 °C using a carbon-based adsorbent trap targets very volatile solutes with high vapor pressure (>20 kPa). The second DHS sampling at 25 °C using the same type of carbon-based adsorbent trap targets volatile solutes with moderate vapor pressure (1-20 kPa). The third DHS sampling using a Tenax TA trap at 80 °C targets solutes with low vapor pressure (<1 kPa) and/or hydrophilic characteristics. After the 3 sequential DHS samplings using the same HS vial, the three traps are sequentially desorbed with thermal desorption in reverse order of the DHS sampling and the desorbed compounds are trapped and concentrated in a programmed temperature vaporizing (PTV) inlet and subsequently analyzed in a single GC-MS run. Recoveries of the 21 test aroma compounds for each DHS sampling and the combined MVM procedure were evaluated as a function of vapor pressure in the range of 0.000088-120 kPa. The MVM provided very good recoveries in the range of 91-111%. The method showed good linearity (r2>0.9910) and high sensitivity (limit of detection: 1.0-7.5 ng mL(-1)) even with MS scan mode. The feasibility and benefit of the method was demonstrated with analysis of a wide variety of aroma compounds in brewed coffee. Ten potent aroma compounds from top-note to base-note (acetaldehyde, 2,3-butanedione, 4-ethyl guaiacol, furaneol, guaiacol, 3-methyl butanal, 2,3-pentanedione, 2,3,5-trimethyl pyrazine, vanillin, and 4-vinyl guaiacol) could be identified together with an additional 72 aroma compounds. Thirty compounds including 9 potent aroma compounds were quantified in the range of 74-4300 ng mL(-1) (RSD<10%, n=5). Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Apparatus for transporting hazardous materials
Osterman, Robert A.; Cox, Robert
1992-01-01
An apparatus and method are provided for selectively receiving, transporting, and releasing one or more radioactive or other hazardous samples for analysis on a differential thermal analysis (DTA) apparatus. The apparatus includes a portable sample transporting apparatus for storing and transporting the samples and includes a support assembly for supporting the transporting apparatus when a sample is transferred to the DTA apparatus. The transporting apparatus includes a storage member which includes a plurality of storage chambers arrayed circumferentially with respect to a central axis. An adjustable top door is located on the top side of the storage member, and the top door includes a channel capable of being selectively placed in registration with the respective storage chambers thereby permitting the samples to selectively enter the respective storage chambers. The top door, when closed, isolates the respective samples within the storage chambers. A plurality of spring-biased bottom doors are located on the bottom sides of the respective storage chambers. The bottom doors isolate the samples in the respective storage chambers when the bottom doors are in the closed position. The bottom doors permit the samples to leave the respective storage chambers from the bottom side when the respective bottom doors are in respective open positions. The bottom doors permit the samples to be loaded into the respective storage chambers after the analysis for storage and transport to a permanent storage location.
Washburn, Kathryn E.; Birdwell, Justin E.; Foster, Michael; Gutierrez, Fernando
2015-01-01
Mineralogical and geochemical information on reservoir and source rocks is necessary to assess and produce from petroleum systems. The standard methods in the petroleum industry for obtaining these properties are bulk measurements on homogenized, generally crushed, and pulverized rock samples and can take from hours to days to perform. New methods using Fourier transform infrared (FTIR) spectroscopy have been developed to more rapidly obtain information on mineralogy and geochemistry. However, these methods are also typically performed on bulk, homogenized samples. We present a new approach to rock sample characterization incorporating multivariate analysis and FTIR microscopy to provide non-destructive, spatially resolved mineralogy and geochemistry on whole rock samples. We are able to predict bulk mineralogy and organic carbon content within the same margin of error as standard characterization techniques, including X-ray diffraction (XRD) and total organic carbon (TOC) analysis. Validation of the method was performed using two oil shale samples from the Green River Formation in the Piceance Basin with differing sedimentary structures. One sample represents laminated Green River oil shales, and the other is representative of oil shale breccia. The FTIR microscopy results on the oil shales agree with XRD and LECO TOC data from the homogenized samples but also give additional detail regarding sample heterogeneity by providing information on the distribution of mineral phases and organic content. While measurements for this study were performed on oil shales, the method could also be applied to other geological samples, such as other mudrocks, complex carbonates, and soils.
COMPARISON OF TWO DIFFERENT SOLID PHASE EXTRACTION/LARGE VOLUME INJECTION PROCEDURES FOR METHOD 8270
Two solid phase (SPE) and one traditional continuous liquid-liquid extraction method are compared for analysis of Method 8270 SVOCs. Productivity parameters include data quality, sample volume, analysis time and solvent waste.
One SPE system, unique in the U.S., uses aut...
An evaluation of performance criteria for US Environmental Protection Agency Compendium Method TO-17 for monitoring volatile organic compounds (VOCs) in air has been accomplished. The method is a solid adsorbent-based sampling and analytical procedure including performance crit...
ERIC Educational Resources Information Center
Chiu, Chung-Yi; Jochman, Joseph; Fujikawa, Mayu; Strand, David; Cheing, Gladys; Lee, Gloria; Chan, Fong
2014-01-01
Purpose: To examine the factorial structure of the "Coping Strategy Questionnaire"-24 (CSQ-24) in a sample of Canadians with chronic musculoskeletal pain. Method: The sample included 171 workers' compensation clients (50.9% men) recruited from outpatient rehabilitation facilities in Canada. Mean age of participants was 42.45 years (SD =…
Rapid Radiochemical Analyses in Support of Fukushima Nuclear Accident - 13196
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.
There is an increasing need to develop faster analytical methods for emergency response, including emergency soil and air filter samples [1, 2]. The Savannah River National Laboratory (SRNL) performed analyses on samples received from Japan in April, 2011 as part of a U.S. Department of Energy effort to provide assistance to the government of Japan, following the nuclear event at Fukushima Daiichi, resulting from the earthquake and tsunami on March 11, 2011. Of particular concern was whether it was safe to plant rice in certain areas (prefectures) near Fukushima. The primary objectives of the sample collection, sample analysis, and datamore » assessment teams were to evaluate personnel exposure hazards, identify the nuclear power plant radiological source term and plume deposition, and assist the government of Japan in assessing any environmental and agricultural impacts associated with the nuclear event. SRNL analyzed approximately 250 samples and reported approximately 500 analytical method determinations. Samples included soil from farmland surrounding the Fukushima reactors and air monitoring samples of national interest, including those collected at the U.S. Embassy and American military bases. Samples were analyzed for a wide range of radionuclides, including strontium-89, strontium-90, gamma-emitting radionuclides, and plutonium, uranium, americium and curium isotopes. Technical aspects of the rapid soil and air filter analyses will be described. The extent of radiostrontium contamination was a significant concern. For {sup 89,90}Sr analyses on soil samples, a rapid fusion technique using 1.5 gram soil aliquots to enable a Minimum Detectable Activity (MDA) of <1 pCi {sup 89,90}Sr /g of soil was employed. This sequential technique has been published recently by this laboratory for actinides and radiostrontium in soil and vegetation [3, 4]. It consists of a rapid sodium hydroxide fusion, pre-concentration steps using iron hydroxide and calcium fluoride precipitations, followed by Sr-Resin separation and gas flow proportional counting. To achieve a lower detection limit for analysis of some of the Japanese soil samples, a 10 gram aliquot of soil was taken, acid-leached and processed with similar preconcentration chemistry. The MDA using this approach was ∼0.03 pCi/g (1.1 mBq/g)/, which is less than the 0.05-0.10 pCi/g {sup 90}Sr levels found in soil as a result of global fallout. The chemical yields observed for the Japanese soil samples was typically 75-80% and the laboratory control sample (LCS) and matrix spike (MS) results looked very good for this work Individual QC results were well within the ± 25% acceptable range and the average of these results does not show significant bias. Additional data for a radiostrontium in soil method for 50 gram samples will also be presented, which appears to be a significant step forward based on looking at the current literature, with higher chemical yields for even larger sample aliquots and lower MDA [5, 6, 7] Hou et al surveyed a wide range of separation methods for Pu in waters and environmental solid samples [8]. While there are many actinide methods in the scientific literature, few would be considered rapid due to the tedious and time-consuming steps involved. For actinide analyses in soil, a new rapid method for the determination of actinide isotopes in soil samples using both alpha spectrometry and inductively-coupled plasma mass spectrometry was employed. The new rapid soil method utilizes an acid leaching method, iron/titanium hydroxide precipitation, a lanthanum fluoride soil matrix removal step, and a rapid column separation process with TEVA Resin. The large soil matrix is removed easily and rapidly using these two simple precipitations with high chemical recoveries and effective removal of interferences. [9, 10] Vacuum box technology and rapid flow rates were used to reduce analytical time. Challenges associated with the mineral content in the volcanic soil will be discussed. Air filter samples were reported within twenty-four (24) hours of receipt using rapid techniques published previously. [11] The rapid reporting of high quality analytical data arranged through the U.S. Department of Energy Consequence Management Home Team was critical to allow the government of Japan to readily evaluate radiological impacts from the nuclear reactor incident to both personnel and the environment. SRNL employed unique rapid methods capability for radionuclides to support Japan that can also be applied to environmental, bioassay and waste management samples. New rapid radiochemical techniques for radionuclides in soil and other environmental matrices as well as some of the unique challenges associated with this work will be presented that can be used for application to environmental monitoring, environmental remediation, decommissioning and decontamination activities. (authors)« less
RAPID RADIOCHEMICAL ANALYSES IN SUPPORT OF FUKUSHIMA NUCLEAR ACCIDENT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, S.
2012-11-07
There is an increasing need to develop faster analytical methods for emergency response, including emergency soil and air filter samples. The Savannah River National Laboratory (SRNL) performed analyses on samples received from Japan in April, 2011 as part of a U.S. Department of Energy effort to provide assistance to the government of Japan, following the nuclear event at Fukushima Daiichi, resulting from the earthquake and tsunami on March 11, 2011. Of particular concern was whether it was safe to plant rice in certain areas (prefectures) near Fukushima. The primary objectives of the sample collection, sample analysis, and data assessment teamsmore » were to evaluate personnel exposure hazards, identify the nuclear power plant radiological source term and plume deposition, and assist the government of Japan in assessing any environmental and agricultural impacts associated with the nuclear event. SRNL analyzed approximately 250 samples and reported approximately 500 analytical method determinations. Samples included soil from farmland surrounding the Fukushima reactors and air monitoring samples of national interest, including those collected at the U.S. Embassy and American military bases. Samples were analyzed for a wide range of radionuclides, including strontium-89, strontium-90, gamma-emitting radionuclides, and plutonium, uranium, americium and curium isotopes. Technical aspects of the rapid soil and air filter analyses will be described. The extent of radiostrontium contamination was a significant concern. For {sup 89,90}Sr analyses on soil samples, a rapid fusion technique using 1.5 gram soil aliquots to enable a Minimum Detectable Activity (MDA) of <1 pCi {sup 89,90} Sr /g of soil was employed. This sequential technique has been published recently by this laboratory for actinides and radiostrontium in soil and vegetation. It consists of a rapid sodium hydroxide fusion, pre-concentration steps using iron hydroxide and calcium fluoride precipitations, followed by Sr-Resin separation and gas flow proportional counting. To achieve a lower detection limit for analysis of some of the Japanese soil samples, a 10 gram aliquot of soil was taken, acid-leached and processed with similar preconcentration chemistry. The MDA using this approach was ~0.03 pCi/g (1.1 mBq/g)/, which is less than the 0.05-0.10 pCi/g {sup 90}Sr levels found in soil as a result of global fallout. The chemical yields observed for the Japanese soil samples was typically 75-80% and the laboratory control sample (LCS) and matrix spike (MS) results looked very good for this work Individual QC results were well within the ± 25% acceptable range and the average of these results does not show significant bias. Additional data for a radiostrontium in soil method for 50 gram samples will also be presented, which appears to be a significant step forward based on looking at the current literature, with higher chemical yields for even larger sample aliquots and lower MDA. Hou et al surveyed a wide range of separation methods for Pu in waters and environmental solid samples. While there are many actinide methods in the scientific literature, few would be considered rapid due to the tedious and time-consuming steps involved. For actinide analyses in soil, a new rapid method for the determination of actinide isotopes in soil samples using both alpha spectrometry and inductively-coupled plasma mass spectrometry was employed. The new rapid soil method utilizes an acid leaching method, iron/titanium hydroxide precipitation, a lanthanum fluoride soil matrix removal step, and a rapid column separation process with TEVA Resin. The large soil matrix is removed easily and rapidly using these two simple precipitations with high chemical recoveries and effective removal of interferences. Vacuum box technology and rapid flow rates were used to reduce analytical time. Challenges associated with the mineral content in the volcanic soil will be discussed. Air filter samples were reported within twenty-four (24) hours of receipt using rapid techniques published previously. The rapid reporting of high quality analytical data arranged through the U.S. Department of Energy Consequence Management Home Team was critical to allow the government of Japan to readily evaluate radiological impacts from the nuclear reactor incident to both personnel and the environment. SRNL employed unique rapid methods capability for radionuclides to support Japan that can also be applied to environmental, bioassay and waste management samples. New rapid radiochemical techniques for radionuclides in soil and other environmental matrices as well as some of the unique challenges associated with this work will be presented that can be used for application to environmental monitoring, environmental remediation, decommissioning and decontamination activities.« less
Giorgino, M.J.; Rasmussen, R.B.; Pfeifle, C.M .
2007-01-01
Selected organic wastewater compounds, such as household, industrial, and agricultural-use compounds, sterols, pharmaceuticals, and antibiotics, were measured at eight sites classified as drinking-water supplies in the Triangle Area of North Carolina. From October 2002 through July 2005, seven of the sites were sampled twice, and one site was sampled 28 times, for a total of 42 sets of environmental samples. Samples were analyzed for as many as 126 compounds using three laboratory analytical methods. These methods were developed by the U.S. Geological Survey to detect low levels (generally less than or equal to 1.0 microgram per liter) of the target compounds in filtered water. Because analyses were conducted on filtered samples, the results presented in this report may not reflect the total concentration of organic wastewater compounds in the waters that were sampled. Various quality-control samples were used to quality assure the results in terms of method performance and possible laboratory or field contamination. Of the 108 organic wastewater compounds that met method performance criteria, 24 were detected in at least one sample during the study. These 24 compounds included 3 pharmaceutical compounds, 6 fire retardants and plasticizers, 3 antibiotics, 3 pesticides, 6 fragrances and flavorants, 1 disinfectant, and 2 miscellaneous-use compounds, all of which likely originated from a variety of domestic, industrial, and agricultural sources. The 10 most frequently detected compounds included acetyl-hexamethyl tetrahydronaphthalene and hexahydro-hexamethyl cyclopentabenzopyran (synthetic musks that are widely used in personal-care products and are known endocrine disruptors); tri(2-chloroethyl) phosphate, tri(dichloroisopropyl) phosphate, and tributyl phosphate (fire retardants); metolachlor (herbicide); caffeine (nonprescription stimulant); cotinine (metabolite of nicotine); acetaminophen (nonprescription analgesic); and sulfamethoxazole (prescription antibiotic). The occurrence and distribution of organic wastewater compounds varied considerably among sampling sites, but at least one compound was detected at every location. The most organic wastewater compounds (19) were detected at the Neuse River above U.S. 70 at Smithfield, where two-thirds of the total number of samples were collected. The fewest organic wastewater compounds (1) were detected at the Eno River at Hillsborough. The detection of multiple organic wastewater compounds was common, with a median of 3.5 and as many as 12 compounds observed in individual samples. Some compounds, including acetaminophen, cotinine, tri(2-chloroethyl) phosphate, and metolachlor, were detected at numerous sites and in numerous samples, indicating that they are widely distributed in the environment. Other organic wastewater compounds, including acetyl-hexamethyl tetrahydronaphthalene and hexahydro-hexamethyl cyclopentabenzopyran, were detected in numerous samples but at only one location, indicating that sources of these compounds are more site specific. Results indicate that municipal wastewater may be a source of antibiotics and synthetic musks; however, the three sites in this study that are located downstream from wastewater discharges also receive runoff from agricultural, urban, and rural residential lands. Source identification was not an objective of this study. Concentrations of individual compounds generally were less than 0.5 microgram per liter. No concentrations exceeded Federal drinking-water standards or health advisories, nor water-quality criteria established by the State of North Carolina; however, such criteria are available for only a few of the compounds that were studied. Compared with other surface waters that have been sampled across the United States, the Triangle Area water-supply sites had fewer detections of organic wastewater compounds; however, differences in study design and analytical methods used among studies must be considered when mak
NASA Astrophysics Data System (ADS)
Younse, Paulo
Four sealing methods for encapsulating samples in 1 cm diameter thin-walled sample tubes were designed, along with a set of tests for characterization and evaluation of contamination prevention and sample preservation capability for the proposed Mars Sample Return (MSR) campaign. The sealing methods include a finned shape memory alloy (SMA) plug, expanding torque plug, contracting SMA ring cap, and expanding SMA ring plug. Mechanical strength and hermeticity of the seal were measured using a helium leak detector. Robustness of the seal to Mars simulant dust, surface abrasion, and pressure differentials were tested. Survivability tests were run to simulate thermal cycles on Mars, vibration from a Mars Ascent Vehicle (MAV), and shock from Earth Entry Vehicle (EEV) landing. Material compatibility with potential sample minerals and organic molecules were studied to select proper tube and seal materials that would not lead to adverse reactions nor contaminate the sample. Cleaning and sterilization techniques were executed on coupons made from the seal materials to assess compliance with planetary protection and contamination control. Finally, a method to cut a sealed tube for sample removal was designed and tested.
Yu, Conrad M.; Koo, Jackson C.
2000-01-01
A system and method for preconcentrating, identifying, and quantifying chemical and biological substances is disclosed. An input valve directs a first volume of a sample gas to a surface acoustic wave (SAW) device. The SAW device preconcentrates and detects a mass of a substance within the sample gas. An output valve receives a second volume of the sample gas containing the preconcentrated substance from the SAW device and directs the second volume to a gas chromatograph (GC). The GC identifies the preconcentrated substance within the sample gas. A shunt valve exhausts a volume of the sample gas equal to the first volume minus the second volume away from the SAW device and the GC. The method of the present invention includes the steps of opening an input valve for passing a first volume of a sample gas to a SAW device; preconcentrating and detecting a mass of a substance within the sample gas using the SAW device; opening an output valve for passing a second volume of the sample gas containing the preconcentrated substance to a gas chromatograph (GC); and then identifying the preconcentrated substance within the sample gas using the GC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, S.; Jones, V.
2009-05-27
A new rapid separation method that allows separation and preconcentration of actinides in urine samples was developed for the measurement of longer lived actinides by inductively coupled plasma mass spectrometry (ICP-MS) and short-lived actinides by alpha spectrometry; a hybrid approach. This method uses stacked extraction chromatography cartridges and vacuum box technology to facilitate rapid separations. Preconcentration, if required, is performed using a streamlined calcium phosphate precipitation. Similar technology has been applied to separate actinides prior to measurement by alpha spectrometry, but this new method has been developed with elution reagents now compatible with ICP-MS as well. Purified solutions are splitmore » between ICP-MS and alpha spectrometry so that long- and short-lived actinide isotopes can be measured successfully. The method allows for simultaneous extraction of 24 samples (including QC samples) in less than 3 h. Simultaneous sample preparation can offer significant time savings over sequential sample preparation. For example, sequential sample preparation of 24 samples taking just 15 min each requires 6 h to complete. The simplicity and speed of this new method makes it attractive for radiological emergency response. If preconcentration is applied, the method is applicable to larger sample aliquots for occupational exposures as well. The chemical recoveries are typically greater than 90%, in contrast to other reported methods using flow injection separation techniques for urine samples where plutonium yields were 70-80%. This method allows measurement of both long-lived and short-lived actinide isotopes. 239Pu, 242Pu, 237Np, 243Am, 234U, 235U and 238U were measured by ICP-MS, while 236Pu, 238Pu, 239Pu, 241Am, 243Am and 244Cm were measured by alpha spectrometry. The method can also be adapted so that the separation of uranium isotopes for assay is not required, if uranium assay by direct dilution of the urine sample is preferred instead. Multiple vacuum box locations may be set-up to supply several ICP-MS units with purified sample fractions such that a high sample throughput may be achieved, while still allowing for rapid measurement of short-lived actinides by alpha spectrometry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jonsson, Jacob C.; Branden, Henrik
2006-10-19
This paper demonstrates a method to determine thebidirectional transfer distribution function (BTDF) using an integratingsphere. Information about the sample's angle dependent scattering isobtained by making transmittance measurements with the sample atdifferent distances from the integrating sphere. Knowledge about theilluminated area of the sample and the geometry of the sphere port incombination with the measured data combines to an system of equationsthat includes the angle dependent transmittance. The resulting system ofequations is an ill-posed problem which rarely gives a physical solution.A solvable system is obtained by using Tikhonov regularization on theill-posed problem. The solution to this system can then be usedmore » to obtainthe BTDF. Four bulk-scattering samples were characterised using both twogoniophotometers and the described method to verify the validity of thenew method. The agreement shown is great for the more diffuse samples.The solution to the low-scattering samples contains unphysicaloscillations, butstill gives the correct shape of the solution. Theorigin of the oscillations and why they are more prominent inlow-scattering samples are discussed.« less
Rapid determination of actinides in asphalt samples
Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.
2014-01-12
A new rapid method for the determination of actinides in asphalt samples has been developed that can be used in emergency response situations or for routine analysis If a radiological dispersive device (RDD), Improvised Nuclear Device (IND) or a nuclear accident such as the accident at the Fukushima Nuclear Power Plant in March, 2011 occurs, there will be an urgent need for rapid analyses of many different environmental matrices, including asphalt materials, to support dose mitigation and environmental clean up. The new method for the determination of actinides in asphalt utilizes a rapid furnace step to destroy bitumen and organicsmore » present in the asphalt and sodium hydroxide fusion to digest the remaining sample. Sample preconcentration steps are used to collect the actinides and a new stacked TRU Resin + DGA Resin column method is employed to separate the actinide isotopes in the asphalt samples. The TRU Resin plus DGA Resin separation approach, which allows sequential separation of plutonium, uranium, americium and curium isotopes in asphalt samples, can be applied to soil samples as well.« less
MontePython 3: Parameter inference code for cosmology
NASA Astrophysics Data System (ADS)
Brinckmann, Thejs; Lesgourgues, Julien; Audren, Benjamin; Benabed, Karim; Prunet, Simon
2018-05-01
MontePython 3 provides numerous ways to explore parameter space using Monte Carlo Markov Chain (MCMC) sampling, including Metropolis-Hastings, Nested Sampling, Cosmo Hammer, and a Fisher sampling method. This improved version of the Monte Python (ascl:1307.002) parameter inference code for cosmology offers new ingredients that improve the performance of Metropolis-Hastings sampling, speeding up convergence and offering significant time improvement in difficult runs. Additional likelihoods and plotting options are available, as are post-processing algorithms such as Importance Sampling and Adding Derived Parameter.
ERIC Educational Resources Information Center
Engel, Mimi
2013-01-01
Purpose: Relatively little is known about how principals make decisions about teacher hiring. This article uses mixed methods to examine what characteristics principals look for in teachers. Research Methods: Data were gathered using a mixed method approach, including in-depth interviews with a representative sample of 31 principals as well as an…
NASA Astrophysics Data System (ADS)
Yang, Y.; Tenenbaum, D. E.
2009-12-01
The process of urbanization has major effects on both human and natural systems. In order to monitor these changes and better understand how urban ecological systems work, urban spatial structure and the variation needs to be first quantified at a fine scale. Because the land-use and land-cover (LULC) in urbanizing areas is highly heterogeneous, the classification of urbanizing environments is the most challenging field in remote sensing. Although a pixel-based method is a common way to do classification, the results are not good enough for many research objectives which require more accurate classification data in fine scales. Transect sampling and object-oriented classification methods are more appropriate for urbanizing areas. Tenenbaum used a transect sampling method using a computer-based facility within a widely available commercial GIS in the Glyndon Catchment and the Upper Baismans Run Catchment, Baltimore, Maryland. It was a two-tiered classification system, including a primary level (which includes 7 classes) and a secondary level (which includes 37 categories). The statistical information of LULC was collected. W. Zhou applied an object-oriented method at the parcel level in Gwynn’s Falls Watershed which includes the two previously mentioned catchments and six classes were extracted. The two urbanizing catchments are located in greater Baltimore, Maryland and drain into Chesapeake Bay. In this research, the two different methods are compared for 6 classes (woody, herbaceous, water, ground, pavement and structure). The comparison method uses the segments in the transect method to extract LULC information from the results of the object-oriented method. Classification results were compared in order to evaluate the difference between the two methods. The overall proportions of LULC classes from the two studies show that there is overestimation of structures in the object-oriented method. For the other five classes, the results from the two methods are similar, except for a difference in the proportions of the woody class. The segment to segment comparison shows that the resolution of the light detection and ranging (LIDAR) data used in the object-oriented method does affect the accuracy of the classification. Shadows of trees and structures are still a big problem in the object-oriented method. For classes that make up a small proportion of the catchments, such as water, neither method was capable of detecting them.
Rezende, Vinícius Marcondes; Rivellis, Ariane Julio; Gomes, Melissa Medrano; Dörr, Felipe Augusto; Novaes, Mafalda Megumi Yoshinaga; Nardinelli, Luciana; Costa, Ariel Lais de Lima; Chamone, Dalton de Alencar Fisher; Bendit, Israel
2013-01-01
Objective The goal of this study was to monitor imatinib mesylate therapeutically in the Tumor Biology Laboratory, Department of Hematology and Hemotherapy, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo (USP). A simple and sensitive method to quantify imatinib and its metabolite (CGP74588) in human serum was developed and fully validated in order to monitor treatment compliance. Methods The method used to quantify these compounds in serum included protein precipitation extraction followed by instrumental analysis using high performance liquid chromatography coupled with mass spectrometry. The method was validated for several parameters, including selectivity, precision, accuracy, recovery and linearity. Results The parameters evaluated during the validation stage exhibited satisfactory results based on the Food and Drug Administration and the Brazilian Health Surveillance Agency (ANVISA) guidelines for validating bioanalytical methods. These parameters also showed a linear correlation greater than 0.99 for the concentration range between 0.500 µg/mL and 10.0 µg/mL and a total analysis time of 13 minutes per sample. This study includes results (imatinib serum concentrations) for 308 samples from patients being treated with imatinib mesylate. Conclusion The method developed in this study was successfully validated and is being efficiently used to measure imatinib concentrations in samples from chronic myeloid leukemia patients to check treatment compliance. The imatinib serum levels of patients achieving a major molecular response were significantly higher than those of patients who did not achieve this result. These results are thus consistent with published reports concerning other populations. PMID:23741187
NASA Astrophysics Data System (ADS)
Chan, Y. C.; Vowles, P. D.; McTainsh, G. H.; Simpson, R. W.; Cohen, D. D.; Bailey, G. M.; McOrist, G. D.
This paper describes a method for the simultaneous collection of size-fractionated aerosol samples on several collection substrates, including glass-fibre filter, carbon tape and silver tape, with a commercially available high-volume cascade impactor. This permitted various chemical analysis procedures, including ion beam analysis (IBA), instrumental neutron activation analysis (INAA), carbon analysis and scanning electron microscopy (SEM), to be carried out on the samples.
General introduction for the “National Field Manual for the Collection of Water-Quality Data”
,
2018-02-28
BackgroundAs part of its mission, the U.S. Geological Survey (USGS) collects data to assess the quality of our Nation’s water resources. A high degree of reliability and standardization of these data are paramount to fulfilling this mission. Documentation of nationally accepted methods used by USGS personnel serves to maintain consistency and technical quality in data-collection activities. “The National Field Manual for the Collection of Water-Quality Data” (NFM) provides documented guidelines and protocols for USGS field personnel who collect water-quality data. The NFM provides detailed, comprehensive, and citable procedures for monitoring the quality of surface water and groundwater. Topics in the NFM include (1) methods and protocols for sampling water resources, (2) methods for processing samples for analysis of water quality, (3) methods for measuring field parameters, and (4) specialized procedures, such as sampling water for low levels of mercury and organic wastewater chemicals, measuring biological indicators, and sampling bottom sediment for chemistry. Personnel who collect water-quality data for national USGS programs and projects, including projects supported by USGS cooperative programs, are mandated to use protocols provided in the NFM per USGS Office of Water Quality Technical Memorandum 2002.13. Formal training, for example, as provided in the USGS class, “Field Water-Quality Methods for Groundwater and Surface Water,” and field apprenticeships supplement the guidance provided in the NFM and ensure that the data collected are high quality, accurate, and scientifically defensible.
NASA Astrophysics Data System (ADS)
Bhartia, R.; Wanger, G.; Orphan, V. J.; Fries, M.; Rowe, A. R.; Nealson, K. H.; Abbey, W. J.; DeFlores, L. P.; Beegle, L. W.
2014-12-01
Detection of in situ biosignatures on terrestrial and planetary missions is becoming increasingly more important. Missions that target the Earth's deep biosphere, Mars, moons of Jupiter (including Europa), moons of Saturn (Titan and Enceladus), and small bodies such as asteroids or comets require methods that enable detection of materials for both in-situ analysis that preserve context and as a means to select high priority sample for return to Earth. In situ instrumentation for biosignature detection spans a wide range of analytical and spectroscopic methods that capitalize on amino acid distribution, chirality, lipid composition, isotopic fractionation, or textures that persist in the environment. Many of the existing analytical instruments are bulk analysis methods and while highly sensitive, these require sample acquisition and sample processing. However, by combining with triaging spectroscopic methods, biosignatures can be targeted on a surface and preserve spatial context (including mineralogy, textures, and organic distribution). To provide spatially correlated chemical analysis at multiple spatial scales (meters to microns) we have employed a dual spectroscopic approach that capitalizes on high sensitivity deep UV native fluorescence detection and high specificity deep UV Raman analysis.. Recently selected as a payload on the Mars 2020 mission, SHERLOC incorporates these optical methods for potential biosignatures detection on Mars. We present data from both Earth analogs that operate as our only examples known biosignatures and meteorite samples that provide an example of abiotic organic formation, and demonstrate how provenance effects the spatial distribution and composition of organics.
Estimating abundance of mountain lions from unstructured spatial sampling
Russell, Robin E.; Royle, J. Andrew; Desimone, Richard; Schwartz, Michael K.; Edwards, Victoria L.; Pilgrim, Kristy P.; Mckelvey, Kevin S.
2012-01-01
Mountain lions (Puma concolor) are often difficult to monitor because of their low capture probabilities, extensive movements, and large territories. Methods for estimating the abundance of this species are needed to assess population status, determine harvest levels, evaluate the impacts of management actions on populations, and derive conservation and management strategies. Traditional mark–recapture methods do not explicitly account for differences in individual capture probabilities due to the spatial distribution of individuals in relation to survey effort (or trap locations). However, recent advances in the analysis of capture–recapture data have produced methods estimating abundance and density of animals from spatially explicit capture–recapture data that account for heterogeneity in capture probabilities due to the spatial organization of individuals and traps. We adapt recently developed spatial capture–recapture models to estimate density and abundance of mountain lions in western Montana. Volunteers and state agency personnel collected mountain lion DNA samples in portions of the Blackfoot drainage (7,908 km2) in west-central Montana using 2 methods: snow back-tracking mountain lion tracks to collect hair samples and biopsy darting treed mountain lions to obtain tissue samples. Overall, we recorded 72 individual capture events, including captures both with and without tissue sample collection and hair samples resulting in the identification of 50 individual mountain lions (30 females, 19 males, and 1 unknown sex individual). We estimated lion densities from 8 models containing effects of distance, sex, and survey effort on detection probability. Our population density estimates ranged from a minimum of 3.7 mountain lions/100 km2 (95% Cl 2.3–5.7) under the distance only model (including only an effect of distance on detection probability) to 6.7 (95% Cl 3.1–11.0) under the full model (including effects of distance, sex, survey effort, and distance x sex on detection probability). These numbers translate to a total estimate of 293 mountain lions (95% Cl 182–451) to 529 (95% Cl 245–870) within the Blackfoot drainage. Results from the distance model are similar to previous estimates of 3.6 mountain lions/100 km2 for the study area; however, results from all other models indicated greater numbers of mountain lions. Our results indicate that unstructured spatial sampling combined with spatial capture–recapture analysis can be an effective method for estimating large carnivore densities.
Wan, Xiang; Wang, Wenqian; Liu, Jiming; Tong, Tiejun
2014-12-19
In systematic reviews and meta-analysis, researchers often pool the results of the sample mean and standard deviation from a set of similar clinical trials. A number of the trials, however, reported the study using the median, the minimum and maximum values, and/or the first and third quartiles. Hence, in order to combine results, one may have to estimate the sample mean and standard deviation for such trials. In this paper, we propose to improve the existing literature in several directions. First, we show that the sample standard deviation estimation in Hozo et al.'s method (BMC Med Res Methodol 5:13, 2005) has some serious limitations and is always less satisfactory in practice. Inspired by this, we propose a new estimation method by incorporating the sample size. Second, we systematically study the sample mean and standard deviation estimation problem under several other interesting settings where the interquartile range is also available for the trials. We demonstrate the performance of the proposed methods through simulation studies for the three frequently encountered scenarios, respectively. For the first two scenarios, our method greatly improves existing methods and provides a nearly unbiased estimate of the true sample standard deviation for normal data and a slightly biased estimate for skewed data. For the third scenario, our method still performs very well for both normal data and skewed data. Furthermore, we compare the estimators of the sample mean and standard deviation under all three scenarios and present some suggestions on which scenario is preferred in real-world applications. In this paper, we discuss different approximation methods in the estimation of the sample mean and standard deviation and propose some new estimation methods to improve the existing literature. We conclude our work with a summary table (an Excel spread sheet including all formulas) that serves as a comprehensive guidance for performing meta-analysis in different situations.
Vodnick, David James; Dwivedi, Arpit; Keranen, Lucas Paul; Okerlund, Michael David; Schmitz, Roger William; Warren, Oden Lee; Young, Christopher David
2014-07-08
An automated testing system includes systems and methods to facilitate inline production testing of samples at a micro (multiple microns) or less scale with a mechanical testing instrument. In an example, the system includes a probe changing assembly for coupling and decoupling a probe of the instrument. The probe changing assembly includes a probe change unit configured to grasp one of a plurality of probes in a probe magazine and couple one of the probes with an instrument probe receptacle. An actuator is coupled with the probe change unit, and the actuator is configured to move and align the probe change unit with the probe magazine and the instrument probe receptacle. In another example, the automated testing system includes a multiple degree of freedom stage for aligning a sample testing location with the instrument. The stage includes a sample stage and a stage actuator assembly including translational and rotational actuators.
Vodnick, David James; Dwivedi, Arpit; Keranen, Lucas Paul; Okerlund, Michael David; Schmitz, Roger William; Warren, Oden Lee; Young, Christopher David
2015-01-27
An automated testing system includes systems and methods to facilitate inline production testing of samples at a micro (multiple microns) or less scale with a mechanical testing instrument. In an example, the system includes a probe changing assembly for coupling and decoupling a probe of the instrument. The probe changing assembly includes a probe change unit configured to grasp one of a plurality of probes in a probe magazine and couple one of the probes with an instrument probe receptacle. An actuator is coupled with the probe change unit, and the actuator is configured to move and align the probe change unit with the probe magazine and the instrument probe receptacle. In another example, the automated testing system includes a multiple degree of freedom stage for aligning a sample testing location with the instrument. The stage includes a sample stage and a stage actuator assembly including translational and rotational actuators.
Vodnick, David James; Dwivedi, Arpit; Keranen, Lucas Paul; Okerlund, Michael David; Schmitz, Roger William; Warren, Oden Lee; Young, Christopher David
2015-02-24
An automated testing system includes systems and methods to facilitate inline production testing of samples at a micro (multiple microns) or less scale with a mechanical testing instrument. In an example, the system includes a probe changing assembly for coupling and decoupling a probe of the instrument. The probe changing assembly includes a probe change unit configured to grasp one of a plurality of probes in a probe magazine and couple one of the probes with an instrument probe receptacle. An actuator is coupled with the probe change unit, and the actuator is configured to move and align the probe change unit with the probe magazine and the instrument probe receptacle. In another example, the automated testing system includes a multiple degree of freedom stage for aligning a sample testing location with the instrument. The stage includes a sample stage and a stage actuator assembly including translational and rotational actuators.
Nonclinical dose formulation analysis method validation and sample analysis.
Whitmire, Monica Lee; Bryan, Peter; Henry, Teresa R; Holbrook, John; Lehmann, Paul; Mollitor, Thomas; Ohorodnik, Susan; Reed, David; Wietgrefe, Holly D
2010-12-01
Nonclinical dose formulation analysis methods are used to confirm test article concentration and homogeneity in formulations and determine formulation stability in support of regulated nonclinical studies. There is currently no regulatory guidance for nonclinical dose formulation analysis method validation or sample analysis. Regulatory guidance for the validation of analytical procedures has been developed for drug product/formulation testing; however, verification of the formulation concentrations falls under the framework of GLP regulations (not GMP). The only current related regulatory guidance is the bioanalytical guidance for method validation. The fundamental parameters for bioanalysis and formulation analysis validations that overlap include: recovery, accuracy, precision, specificity, selectivity, carryover, sensitivity, and stability. Divergence in bioanalytical and drug product validations typically center around the acceptance criteria used. As the dose formulation samples are not true "unknowns", the concept of quality control samples that cover the entire range of the standard curve serving as the indication for the confidence in the data generated from the "unknown" study samples may not always be necessary. Also, the standard bioanalytical acceptance criteria may not be directly applicable, especially when the determined concentration does not match the target concentration. This paper attempts to reconcile the different practices being performed in the community and to provide recommendations of best practices and proposed acceptance criteria for nonclinical dose formulation method validation and sample analysis.
Differential expression analysis for RNAseq using Poisson mixed models
Sun, Shiquan; Hood, Michelle; Scott, Laura; Peng, Qinke; Mukherjee, Sayan; Tung, Jenny
2017-01-01
Abstract Identifying differentially expressed (DE) genes from RNA sequencing (RNAseq) studies is among the most common analyses in genomics. However, RNAseq DE analysis presents several statistical and computational challenges, including over-dispersed read counts and, in some settings, sample non-independence. Previous count-based methods rely on simple hierarchical Poisson models (e.g. negative binomial) to model independent over-dispersion, but do not account for sample non-independence due to relatedness, population structure and/or hidden confounders. Here, we present a Poisson mixed model with two random effects terms that account for both independent over-dispersion and sample non-independence. We also develop a scalable sampling-based inference algorithm using a latent variable representation of the Poisson distribution. With simulations, we show that our method properly controls for type I error and is generally more powerful than other widely used approaches, except in small samples (n <15) with other unfavorable properties (e.g. small effect sizes). We also apply our method to three real datasets that contain related individuals, population stratification or hidden confounders. Our results show that our method increases power in all three data compared to other approaches, though the power gain is smallest in the smallest sample (n = 6). Our method is implemented in MACAU, freely available at www.xzlab.org/software.html. PMID:28369632
Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth
2007-06-15
The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.