Sample records for methods methods included

  1. Phosphorescent compositions, methods of making the compositions, and methods of using the compositions

    DOEpatents

    Jia, Weiyi; Wang, Xiaojun; Yen, William; Yen, Laurel C.; Jia, George D.

    2012-12-04

    Compositions, methods of making compositions, materials including compositions, crayons including compositions, paint including compositions, ink including compositions, waxes including compositions, polymers including compositions, vesicles including the compositions, methods of making each, and the like are disclosed.

  2. Phosphorescent compositions, methods of making the compositions, and methods of using the compositions

    DOEpatents

    Jia, Weiyi; Wang, Xiaojun; Jia, George D.; Lewis, Linda; Yen, Laurel C.

    2014-06-24

    Compositions, methods of making compositions, materials including compositions, crayons including compositions, paint including compositions, ink including compositions, waxes including compositions, polymers including compositions, vesicles including the compositions, methods of making each, and the like are disclosed.

  3. Compositions and methods for treating nuclear fuel

    DOEpatents

    Soderquist, Chuck Z; Johnsen, Amanda M; McNamara, Bruce K; Hanson, Brady D; Smith, Steven C; Peper, Shane M

    2013-08-13

    Compositions are provided that include nuclear fuel. Methods for treating nuclear fuel are provided which can include exposing the fuel to a carbonate-peroxide solution. Methods can also include exposing the fuel to an ammonium solution. Methods for acquiring molybdenum from a uranium comprising material are provided.

  4. Compositions and methods for treating nuclear fuel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Soderquist, Chuck Z; Johnsen, Amanda M; McNamara, Bruce K

    Compositions are provided that include nuclear fuel. Methods for treating nuclear fuel are provided which can include exposing the fuel to a carbonate-peroxide solution. Methods can also include exposing the fuel to an ammonium solution. Methods for acquiring molybdenum from a uranium comprising material are provided.

  5. Geophysical methods in Geology. Second edition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, P.V.

    This book presents an introduction to the methods of geophysics and their application to geological problems. The text emphasizes the broader aspects of geophysics, including the way in which geophysical methods help solve structural, correlational, and geochromological problems. Stress is laid on the principles and applications of methods rather than on instrumental techniques. This edition includes coverage of recent developments in geophysics and geology. New topics are introduced, including paleomagnetic methods, electromagnetic methods, microplate tectronics, and the use of multiple geophysical techniques.

  6. Updates to Selected Analytical Methods for Environmental Remediation and Recovery (SAM)

    EPA Pesticide Factsheets

    View information on the latest updates to methods included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM), including the newest recommended methods and publications.

  7. System and method of designing models in a feedback loop

    DOEpatents

    Gosink, Luke C.; Pulsipher, Trenton C.; Sego, Landon H.

    2017-02-14

    A method and system for designing models is disclosed. The method includes selecting a plurality of models for modeling a common event of interest. The method further includes aggregating the results of the models and analyzing each model compared to the aggregate result to obtain comparative information. The method also includes providing the information back to the plurality of models to design more accurate models through a feedback loop.

  8. Bio-inspired method to obtain multifunctional dynamic nanocomposites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kushner, Aaron M.; Guan, Zhibin; Williams, Gregory

    A method for a polymeric or nanocomposite material. The method includes assembling a multiphase hard-soft structure, where the structure includes a hard micro- or nano-phase, and a soft micro- or nano-phase that includes a polymeric scaffold. In the method, the polymeric scaffold includes dynamically interacting motifs and has a glass transition temperature (T.sub.g) lower than the intended operating temperature of the material.

  9. Methods for globally treating silica optics to reduce optical damage

    DOEpatents

    Miller, Philip Edward; Suratwala, Tayyab Ishaq; Bude, Jeffrey Devin; Shen, Nan; Steele, William Augustus; Laurence, Ted Alfred; Feit, Michael Dennis; Wong, Lana Louie

    2012-11-20

    A method for preventing damage caused by high intensity light sources to optical components includes annealing the optical component for a predetermined period. Another method includes etching the optical component in an etchant including fluoride and bi-fluoride ions. The method also includes ultrasonically agitating the etching solution during the process followed by rinsing of the optical component in a rinse bath.

  10. Systems and methods for facilitating hydrogen storage using naturally occurring nanostructure assemblies

    DOEpatents

    Fliermans,; Carl, B [Augusta, GA

    2012-08-07

    Some or all of the needs above can be addressed by embodiments of the invention. According to embodiments of the invention, systems and methods for facilitating hydrogen storage using naturally occurring nanostructure assemblies can be implemented. In one embodiment, a method for storing hydrogen can be provided. The method can include providing diatoms comprising diatomaceous earth or diatoms from a predefined culture. In addition, the method can include heating the diatoms in a sealed environment in the presence of at least one of titanium, a transition metal, or a noble metal to provide a porous hydrogen storage medium. Furthermore, the method can include exposing the porous hydrogen storage medium to hydrogen. In addition, the method can include storing at least a portion of the hydrogen in the porous hydrogen storage medium.

  11. Methods of forming CIGS films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mansfield, Lorelle; Ramanathan, Kannan

    2017-09-19

    Methods for forming CIGS films are provided. According to an aspect of the invention, a method of forming a CIGS film includes a precursor step, which includes simultaneously evaporating Cu, In, Ga, Se, and Sb onto a substrate. The Se is incident on the substrate at a rate of at least 20 .ANG./s. The method also includes a selenization step, which includes evaporating Se over the substrate after the precursor step.

  12. Methods and systems to facilitate reducing NO.sub.x emissions in combustion systems

    DOEpatents

    Lacy, Benjamin Paul [Greer, SC; Kraemer, Gilbert Otto [Greer, SC; Varatharajan, Balachandar [Clifton Park, NY; Yilmaz, Ertan [Albany, NY; Lipinski, John Joseph [Simpsonville, SC; Ziminsky, Willy Steve [Simpsonville, SC

    2011-02-15

    A method for assembling a gas turbine combustor system is provided. The method includes providing a combustion liner including a center axis, an outer wall, a first end, and a second end. The outer wall is orientated substantially parallel to the center axis. The method also includes coupling a transition piece to the liner second end. The transition piece includes an outer wall. The method further includes coupling a plurality of lean-direct injectors along at least one of the liner outer wall and the transition piece outer wall such that the injectors are spaced axially apart along the wall.

  13. Composite materials and bodies including silicon carbide and titanium diboride and methods of forming same

    DOEpatents

    Lillo, Thomas M.; Chu, Henry S.; Harrison, William M.; Bailey, Derek

    2013-01-22

    Methods of forming composite materials include coating particles of titanium dioxide with a substance including boron (e.g., boron carbide) and a substance including carbon, and reacting the titanium dioxide with the substance including boron and the substance including carbon to form titanium diboride. The methods may be used to form ceramic composite bodies and materials, such as, for example, a ceramic composite body or material including silicon carbide and titanium diboride. Such bodies and materials may be used as armor bodies and armor materials. Such methods may include forming a green body and sintering the green body to a desirable final density. Green bodies formed in accordance with such methods may include particles comprising titanium dioxide and a coating at least partially covering exterior surfaces thereof, the coating comprising a substance including boron (e.g., boron carbide) and a substance including carbon.

  14. Nanotube structures, methods of making nanotube structures, and methods of accessing intracellular space

    DOEpatents

    VanDersarl, Jules J.; Xu, Alexander M.; Melosh, Nicholas A.; Tayebi, Noureddine

    2016-02-23

    In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to methods of making a structure including nanotubes, a structure including nanotubes, methods of delivering a fluid to a cell, methods of removing a fluid to a cell, methods of accessing intracellular space, and the like.

  15. Plastic phase change material and articles made therefrom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abhari, Ramin

    The present invention generally relates to a method for manufacturing phase change material (PCM) pellets. The method includes providing a melt composition, including paraffin and a polymer. The paraffin has a melt point of between about 10.degree. C. and about 50.degree. C., and more preferably between about 18.degree. C. and about 28.degree. C. In one embodiment, the melt composition includes various additives, such as a flame retardant. The method further includes forming the melt composition into PCM pellets. The method further may include the step of cooling the melt to increase the melt viscosity before pelletizing. Further, PCM compounds aremore » provided having an organic PCM and a polymer. Methods are provided to convert the PCM compounds into various form-stable PCMs. A method of coating the PCMs is included to provide PCMs with substantially no paraffin seepage and with ignition resistance properties.« less

  16. Military applications and examples of near-surface seismic surface wave methods (Invited)

    NASA Astrophysics Data System (ADS)

    sloan, S.; Stevens, R.

    2013-12-01

    Although not always widely known or publicized, the military uses a variety of geophysical methods for a wide range of applications--some that are already common practice in the industry while others are truly novel. Some of those applications include unexploded ordnance detection, general site characterization, anomaly detection, countering improvised explosive devices (IEDs), and security monitoring, to name a few. Techniques used may include, but are not limited to, ground penetrating radar, seismic, electrical, gravity, and electromagnetic methods. Seismic methods employed include surface wave analysis, refraction tomography, and high-resolution reflection methods. Although the military employs geophysical methods, that does not necessarily mean that those methods enable or support combat operations--often times they are being used for humanitarian applications within the military's area of operations to support local populations. The work presented here will focus on the applied use of seismic surface wave methods, including multichannel analysis of surface waves (MASW) and backscattered surface waves, often in conjunction with other methods such as refraction tomography or body-wave diffraction analysis. Multiple field examples will be shown, including explosives testing, tunnel detection, pre-construction site characterization, and cavity detection.

  17. Method for alignment of microwires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beardslee, Joseph A.; Lewis, Nathan S.; Sadtler, Bryce

    2017-01-24

    A method of aligning microwires includes modifying the microwires so they are more responsive to a magnetic field. The method also includes using a magnetic field so as to magnetically align the microwires. The method can further include capturing the microwires in a solid support structure that retains the longitudinal alignment of the microwires when the magnetic field is not applied to the microwires.

  18. The 5-Step Method: Principles and Practice

    ERIC Educational Resources Information Center

    Copello, Alex; Templeton, Lorna; Orford, Jim; Velleman, Richard

    2010-01-01

    This article includes a description of the 5-Step Method. First, the origins and theoretical basis of the method are briefly described. This is followed by a discussion of the general principles that guide the delivery of the method. Each step is then described in more detail, including the content and focus of each of the five steps that include:…

  19. Recent progress in invariant pattern recognition

    NASA Astrophysics Data System (ADS)

    Arsenault, Henri H.; Chang, S.; Gagne, Philippe; Gualdron Gonzalez, Oscar

    1996-12-01

    We present some recent results in invariant pattern recognition, including methods that are invariant under two or more distortions of position, orientation and scale. There are now a few methods that yield good results under changes of both rotation and scale. Some new methods are introduced. These include locally adaptive nonlinear matched filters, scale-adapted wavelet transforms and invariant filters for disjoint noise. Methods using neural networks will also be discussed, including an optical method that allows simultaneous classification of multiple targets.

  20. Motion Estimation System Utilizing Point Cloud Registration

    NASA Technical Reports Server (NTRS)

    Chen, Qi (Inventor)

    2016-01-01

    A system and method of estimation motion of a machine is disclosed. The method may include determining a first point cloud and a second point cloud corresponding to an environment in a vicinity of the machine. The method may further include generating a first extended gaussian image (EGI) for the first point cloud and a second EGI for the second point cloud. The method may further include determining a first EGI segment based on the first EGI and a second EGI segment based on the second EGI. The method may further include determining a first two dimensional distribution for points in the first EGI segment and a second two dimensional distribution for points in the second EGI segment. The method may further include estimating motion of the machine based on the first and second two dimensional distributions.

  1. Test methods for optical disk media characteristics (for 356 mm ruggedized magneto-optic media)

    NASA Technical Reports Server (NTRS)

    Podio, Fernando L.

    1991-01-01

    Standard test methods for computer storage media characteristics are essential and allow for conformance to media interchange standards. The test methods were developed for 356 mm two-sided laminated glass substrate with a magneto-optic active layer media technology. These test methods may be used for testing other media types, but in each case their applicability must be evaluated. Test methods are included for a series of different media characteristics, including operational, nonoperational, and storage environments; mechanical and physical characteristics; and substrate, recording layer, and preformat characteristics. Tests for environmental qualification and media lifetimes are also included. The best methods include testing conditions, testing procedures, a description of the testing setup, and the required calibration procedures.

  2. Prediction of forces and moments for hypersonic flight vehicle control effectors

    NASA Technical Reports Server (NTRS)

    Maughmer, Mark D.; Long, Lyle N.; Guilmette, Neal; Pagano, Peter

    1993-01-01

    This research project includes three distinct phases. For completeness, all three phases of the work are briefly described in this report. The goal was to develop methods of predicting flight control forces and moments for hypersonic vehicles which could be used in a preliminary design environment. The first phase included a preliminary assessment of subsonic/supersonic panel methods and hypersonic local flow inclination methods for such predictions. While these findings clearly indicated the usefulness of such methods for conceptual design activities, deficiencies exist in some areas. Thus, a second phase of research was conducted in which a better understanding was sought for the reasons behind the successes and failures of the methods considered, particularly for the cases at hypersonic Mach numbers. This second phase involved using computational fluid dynamics methods to examine the flow fields in detail. Through these detailed predictions, the deficiencies in the simple surface inclination methods were determined. In the third phase of this work, an improvement to the surface inclination methods was developed. This used a novel method for including viscous effects by modifying the geometry to include the viscous/shock layer.

  3. Temperature analysis with voltage-current time differential operation of electrochemical sensors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woo, Leta Yar-Li; Glass, Robert Scott; Fitzpatrick, Joseph Jay

    A method for temperature analysis of a gas stream. The method includes identifying a temperature parameter of an affected waveform signal. The method also includes calculating a change in the temperature parameter by comparing the affected waveform signal with an original waveform signal. The method also includes generating a value from the calculated change which corresponds to the temperature of the gas stream.

  4. Ultrasensitive surveillance of sensors and processes

    DOEpatents

    Wegerich, Stephan W.; Jarman, Kristin K.; Gross, Kenneth C.

    2001-01-01

    A method and apparatus for monitoring a source of data for determining an operating state of a working system. The method includes determining a sensor (or source of data) arrangement associated with monitoring the source of data for a system, activating a method for performing a sequential probability ratio test if the data source includes a single data (sensor) source, activating a second method for performing a regression sequential possibility ratio testing procedure if the arrangement includes a pair of sensors (data sources) with signals which are linearly or non-linearly related; activating a third method for performing a bounded angle ratio test procedure if the sensor arrangement includes multiple sensors and utilizing at least one of the first, second and third methods to accumulate sensor signals and determining the operating state of the system.

  5. Ultrasensitive surveillance of sensors and processes

    DOEpatents

    Wegerich, Stephan W.; Jarman, Kristin K.; Gross, Kenneth C.

    1999-01-01

    A method and apparatus for monitoring a source of data for determining an operating state of a working system. The method includes determining a sensor (or source of data) arrangement associated with monitoring the source of data for a system, activating a method for performing a sequential probability ratio test if the data source includes a single data (sensor) source, activating a second method for performing a regression sequential possibility ratio testing procedure if the arrangement includes a pair of sensors (data sources) with signals which are linearly or non-linearly related; activating a third method for performing a bounded angle ratio test procedure if the sensor arrangement includes multiple sensors and utilizing at least one of the first, second and third methods to accumulate sensor signals and determining the operating state of the system.

  6. Derek Vigil-Fowler | NREL

    Science.gov Websites

    simulation methods for materials physics and chemistry, with particular expertise in post-DFT, high accuracy methods such as the GW approximation for electronic structure and random phase approximation (RPA) total the art in computational methods, including efficient methods for including the effects of substrates

  7. Multidimensional structured data visualization method and apparatus, text visualization method and apparatus, method and apparatus for visualizing and graphically navigating the world wide web, method and apparatus for visualizing hierarchies

    DOEpatents

    Risch, John S [Kennewick, WA; Dowson, Scott T [West Richland, WA

    2012-03-06

    A method of displaying correlations among information objects includes receiving a query against a database; obtaining a query result set; and generating a visualization representing the components of the result set, the visualization including one of a plane and line to represent a data field, nodes representing data values, and links showing correlations among fields and values. Other visualization methods and apparatus are disclosed.

  8. Current Progress in Gene Delivery Technology Based on Chemical Methods and Nano-carriers

    PubMed Central

    Jin, Lian; Zeng, Xin; Liu, Ming; Deng, Yan; He, Nongyue

    2014-01-01

    Gene transfer methods are promising in the field of gene therapy. Current methods for gene transfer include three major groups: viral, physical and chemical methods. This review mainly summarizes development of several types of chemical methods for gene transfer in vitro and in vivo by means of nano-carriers like; calcium phosphates, lipids, and cationic polymers including chitosan, polyethylenimine, polyamidoamine dendrimers, and poly(lactide-co-glycolide). This review also briefly introduces applications of these chemical methods for gene delivery. PMID:24505233

  9. Transparent ceramics and methods of preparation thereof

    DOEpatents

    Hollingsworth, Joel P [Oakland, CA; Kuntz, Joshua D [Livermore, CA; Seeley, Zachary M [Pullman, WA; Soules, Thomas F [Livermore, CA

    2011-10-18

    According to one embodiment, a method for forming a transparent ceramic preform includes forming a suspension of oxide particles in a solvent, adding the suspension to a mold of a desired shape, and uniformly curing the suspension in the mold for forming a preform. The suspension includes a dispersant but does not include a gelling agent. In another embodiment, a method includes creating a mixture without a gelling agent, the mixture including: inorganic particles, a solvent, and a dispersant. The inorganic particles have a mean diameter of less than about 2000 nm. The method also includes agitating the mixture, adding the mixture to a mold, and curing the mixture in the mold at a temperature of less than about 80.degree. C. for forming a preform. Other methods for forming a transparent ceramic preform are also described according to several embodiments.

  10. Method and apparatus for ceramic analysis

    DOEpatents

    Jankowiak, Ryszard J.; Schilling, Chris; Small, Gerald J.; Tomasik, Piotr

    2003-04-01

    The present invention relates to a method and apparatus for ceramic analysis, in particular, a method for analyzing density, density gradients and/or microcracks, including an apparatus with optical instrumentation for analysis of density, density gradients and/or microcracks in ceramics. The method provides analyzing density of a ceramic comprising exciting a component on a surface/subsurface of the ceramic by exposing the material to excitation energy. The method may further include the step of obtaining a measurement of an emitted energy from the component. The method may additionally include comparing the measurement of the emitted energy from the component with a predetermined reference measurement so as to obtain a density for said ceramic.

  11. Method of forming aluminum oxynitride material and bodies formed by such methods

    DOEpatents

    Bakas, Michael P [Ammon, ID; Lillo, Thomas M [Idaho Falls, ID; Chu, Henry S [Idaho Falls, ID

    2010-11-16

    Methods of forming aluminum oxynitride (AlON) materials include sintering green bodies comprising aluminum orthophosphate or another sacrificial material therein. Such green bodies may comprise aluminum, oxygen, and nitrogen in addition to the aluminum orthophosphate. For example, the green bodies may include a mixture of aluminum oxide, aluminum nitride, and aluminum orthophosphate or another sacrificial material. Additional methods of forming aluminum oxynitride (AlON) materials include sintering a green body including a sacrificial material therein, using the sacrificial material to form pores in the green body during sintering, and infiltrating the pores formed in the green body with a liquid infiltrant during sintering. Bodies are formed using such methods.

  12. A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis

    PubMed Central

    2017-01-01

    Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338

  13. A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis.

    PubMed

    Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi

    2017-01-01

    Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.

  14. Systems and methods for producing metal clusters; functionalized surfaces; and droplets including solvated metal ions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cooks, Robert Graham; Li, Anyin; Luo, Qingjie

    The invention generally relates to systems and methods for producing metal clusters; functionalized surfaces; and droplets including solvated metal ions. In certain aspects, the invention provides methods that involve providing a metal and a solvent. The methods additionally involve applying voltage to the solvated metal to thereby produce solvent droplets including ions of the metal containing compound, and directing the solvent droplets including the metal ions to a target. In certain embodiments, once at the target, the metal ions can react directly or catalyze reactions.

  15. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  16. Systems and methods for producing metal clusters; functionalized surfaces; and droplets including solvated metal ions

    DOEpatents

    Cooks, Robert Graham; Li, Anyin; Luo, Qingjie

    2017-01-24

    The invention generally relates to systems and methods for producing metal clusters; functionalized surfaces; and droplets including solvated metal ions. In certain aspects, the invention provides methods that involve providing a metal and a solvent. The methods additionally involve applying voltage to the solvated metal to thereby produce solvent droplets including ions of the metal containing compound, and directing the solvent droplets including the metal ions to a target. In certain embodiments, once at the target, the metal ions can react directly or catalyze reactions.

  17. Graph modeling systems and methods

    DOEpatents

    Neergaard, Mike

    2015-10-13

    An apparatus and a method for vulnerability and reliability modeling are provided. The method generally includes constructing a graph model of a physical network using a computer, the graph model including a plurality of terminating vertices to represent nodes in the physical network, a plurality of edges to represent transmission paths in the physical network, and a non-terminating vertex to represent a non-nodal vulnerability along a transmission path in the physical network. The method additionally includes evaluating the vulnerability and reliability of the physical network using the constructed graph model, wherein the vulnerability and reliability evaluation includes a determination of whether each terminating and non-terminating vertex represents a critical point of failure. The method can be utilized to evaluate wide variety of networks, including power grid infrastructures, communication network topologies, and fluid distribution systems.

  18. Methods for designing interventions to change healthcare professionals' behaviour: a systematic review.

    PubMed

    Colquhoun, Heather L; Squires, Janet E; Kolehmainen, Niina; Fraser, Cynthia; Grimshaw, Jeremy M

    2017-03-04

    Systematic reviews consistently indicate that interventions to change healthcare professional (HCP) behaviour are haphazardly designed and poorly specified. Clarity about methods for designing and specifying interventions is needed. The objective of this review was to identify published methods for designing interventions to change HCP behaviour. A search of MEDLINE, Embase, and PsycINFO was conducted from 1996 to April 2015. Using inclusion/exclusion criteria, a broad screen of abstracts by one rater was followed by a strict screen of full text for all potentially relevant papers by three raters. An inductive approach was first applied to the included studies to identify commonalities and differences between the descriptions of methods across the papers. Based on this process and knowledge of related literatures, we developed a data extraction framework that included, e.g. level of change (e.g. individual versus organization); context of development; a brief description of the method; tasks included in the method (e.g. barrier identification, component selection, use of theory). 3966 titles and abstracts and 64 full-text papers were screened to yield 15 papers included in the review, each outlining one design method. All of the papers reported methods developed within a specific context. Thirteen papers included barrier identification and 13 included linking barriers to intervention components; although not the same 13 papers. Thirteen papers targeted individual HCPs with only one paper targeting change across individual, organization, and system levels. The use of theory and user engagement were included in 13/15 and 13/15 papers, respectively. There is an agreement across methods of four tasks that need to be completed when designing individual-level interventions: identifying barriers, selecting intervention components, using theory, and engaging end-users. Methods also consist of further additional tasks. Examples of methods for designing the organisation and system-level interventions were limited. Further analysis of design tasks could facilitate the development of detailed guidelines for designing interventions.

  19. Method and Device for Extraction of Liquids from a Solid Particle Material

    NASA Technical Reports Server (NTRS)

    deMayo, Benjamin (Inventor)

    2017-01-01

    A method, system, and device for separating oil from oil sands or oil shale is disclosed. The method includes heating the oil sands, spinning the heated oil sands, confining the sand particles mechanically, and recovering the oil substantially free of the sand. The method can be used without the addition of chemical extraction agents. The system includes a source of centrifugal force, a heat source, a separation device, and a recovery device. The separation device includes a method of confining the sands while allowing the oil to escape, such as through an aperture.

  20. Composition and methods for improved fuel production

    DOEpatents

    Steele, Philip H.; Tanneru, Sathishkumar; Gajjela, Sanjeev K.

    2015-12-29

    Certain embodiments of the present invention are configured to produce boiler and transportation fuels. A first phase of the method may include oxidation and/or hyper-acidification of bio-oil to produce an intermediate product. A second phase of the method may include catalytic deoxygenation, esterification, or olefination/esterification of the intermediate product under pressurized syngas. The composition of the resulting product--e.g., a boiler fuel--produced by these methods may be used directly or further upgraded to a transportation fuel. Certain embodiments of the present invention also include catalytic compositions configured for use in the method embodiments.

  1. AN EULERIAN-LAGRANGIAN LOCALIZED ADJOINT METHOD FOR THE ADVECTION-DIFFUSION EQUATION

    EPA Science Inventory

    Many numerical methods use characteristic analysis to accommodate the advective component of transport. Such characteristic methods include Eulerian-Lagrangian methods (ELM), modified method of characteristics (MMOC), and operator splitting methods. A generalization of characteri...

  2. Method Development in Forensic Toxicology.

    PubMed

    Peters, Frank T; Wissenbach, Dirk K; Busardo, Francesco Paolo; Marchei, Emilia; Pichini, Simona

    2017-01-01

    In the field of forensic toxicology, the quality of analytical methods is of great importance to ensure the reliability of results and to avoid unjustified legal consequences. A key to high quality analytical methods is a thorough method development. The presented article will provide an overview on the process of developing methods for forensic applications. This includes the definition of the method's purpose (e.g. qualitative vs quantitative) and the analytes to be included, choosing an appropriate sample matrix, setting up separation and detection systems as well as establishing a versatile sample preparation. Method development is concluded by an optimization process after which the new method is subject to method validation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Finite elements and finite differences for transonic flow calculations

    NASA Technical Reports Server (NTRS)

    Hafez, M. M.; Murman, E. M.; Wellford, L. C.

    1978-01-01

    The paper reviews the chief finite difference and finite element techniques used for numerical solution of nonlinear mixed elliptic-hyperbolic equations governing transonic flow. The forms of the governing equations for unsteady two-dimensional transonic flow considered are the Euler equation, the full potential equation in both conservative and nonconservative form, the transonic small-disturbance equation in both conservative and nonconservative form, and the hodograph equations for the small-disturbance case and the full-potential case. Finite difference methods considered include time-dependent methods, relaxation methods, semidirect methods, and hybrid methods. Finite element methods include finite element Lax-Wendroff schemes, implicit Galerkin method, mixed variational principles, dual iterative procedures, optimal control methods and least squares.

  4. Method and Pd/V2 O5 device for H2 detection

    DOEpatents

    Liu, Ping [San Diego, CA; Tracy, C Edwin [Golden, CO; Pitts, J Roland [Lakewood, CO; Smith, II, R. Davis; Lee, Se-Hee [Lakewood, CO

    2011-12-27

    Methods and Pd/V.sub.2O.sub.5 devices for hydrogen detection are disclosed. An exemplary method of preparing an improved sensor for chemochromic detection of hydrogen gas over a wide response range exhibits stability during repeated coloring/bleaching cycles upon exposure and removal of hydrogen gas. The method may include providing a substrate. The method may also include depositing a V.sub.20.sub.5 layer that functions as a H.sub.2 insertion host in a Pd/V.sub.20.sub.5 hydrogen sensor to be formed on said substrate. The method may also include depositing a Pd layer onto said V.sub.20.sub.5 layer; said Pd layer functioning as an optical modulator.

  5. Methods, systems and devices for detecting threatening objects and for classifying magnetic data

    DOEpatents

    Kotter, Dale K [Shelley, ID; Roybal, Lyle G [Idaho Falls, ID; Rohrbaugh, David T [Idaho Falls, ID; Spencer, David F [Idaho Falls, ID

    2012-01-24

    A method for detecting threatening objects in a security screening system. The method includes a step of classifying unique features of magnetic data as representing a threatening object. Another step includes acquiring magnetic data. Another step includes determining if the acquired magnetic data comprises a unique feature.

  6. Including Exceptional Students in Your Instrumental Music Program

    ERIC Educational Resources Information Center

    Mixon, Kevin

    2005-01-01

    This article describes the method and adaptations used by the author in including students with special needs in an instrumental music program. To ensure success in the program, the author shares the method he uses to include exceptional students and enumerates some possible adaptations. There are certainly other methods and modifications that…

  7. Method for generating hydrogen for fuel cells

    DOEpatents

    Ahmed, Shabbir; Lee, Sheldon H. D.; Carter, John David; Krumpelt, Michael

    2004-03-30

    A method of producing a H.sub.2 rich gas stream includes supplying an O.sub.2 rich gas, steam, and fuel to an inner reforming zone of a fuel processor that includes a partial oxidation catalyst and a steam reforming catalyst or a combined partial oxidation and stream reforming catalyst. The method also includes contacting the O.sub.2 rich gas, steam, and fuel with the partial oxidation catalyst and the steam reforming catalyst or the combined partial oxidation and stream reforming catalyst in the inner reforming zone to generate a hot reformate stream. The method still further includes cooling the hot reformate stream in a cooling zone to produce a cooled reformate stream. Additionally, the method includes removing sulfur-containing compounds from the cooled reformate stream by contacting the cooled reformate stream with a sulfur removal agent. The method still further includes contacting the cooled reformate stream with a catalyst that converts water and carbon monoxide to carbon dioxide and H.sub.2 in a water-gas-shift zone to produce a final reformate stream in the fuel processor.

  8. Fuel processor and method for generating hydrogen for fuel cells

    DOEpatents

    Ahmed, Shabbir [Naperville, IL; Lee, Sheldon H. D. [Willowbrook, IL; Carter, John David [Bolingbrook, IL; Krumpelt, Michael [Naperville, IL; Myers, Deborah J [Lisle, IL

    2009-07-21

    A method of producing a H.sub.2 rich gas stream includes supplying an O.sub.2 rich gas, steam, and fuel to an inner reforming zone of a fuel processor that includes a partial oxidation catalyst and a steam reforming catalyst or a combined partial oxidation and stream reforming catalyst. The method also includes contacting the O.sub.2 rich gas, steam, and fuel with the partial oxidation catalyst and the steam reforming catalyst or the combined partial oxidation and stream reforming catalyst in the inner reforming zone to generate a hot reformate stream. The method still further includes cooling the hot reformate stream in a cooling zone to produce a cooled reformate stream. Additionally, the method includes removing sulfur-containing compounds from the cooled reformate stream by contacting the cooled reformate stream with a sulfur removal agent. The method still further includes contacting the cooled reformate stream with a catalyst that converts water and carbon monoxide to carbon dioxide and H.sub.2 in a water-gas-shift zone to produce a final reformate stream in the fuel processor.

  9. Nuclear reactor target assemblies, nuclear reactor configurations, and methods for producing isotopes, modifying materials within target material, and/or characterizing material within a target material

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toth, James J.; Wall, Donald; Wittman, Richard S.

    Target assemblies are provided that can include a uranium-comprising annulus. The assemblies can include target material consisting essentially of non-uranium material within the volume of the annulus. Reactors are disclosed that can include one or more discrete zones configured to receive target material. At least one uranium-comprising annulus can be within one or more of the zones. Methods for producing isotopes within target material are also disclosed, with the methods including providing neutrons to target material within a uranium-comprising annulus. Methods for modifying materials within target material are disclosed as well as are methods for characterizing material within a targetmore » material.« less

  10. Method and System for Producing Full Motion Media to Display on a Spherical Surface

    NASA Technical Reports Server (NTRS)

    Starobin, Michael A. (Inventor)

    2015-01-01

    A method and system for producing full motion media for display on a spherical surface is described. The method may include selecting a subject of full motion media for display on a spherical surface. The method may then include capturing the selected subject as full motion media (e.g., full motion video) in a rectilinear domain. The method may then include processing the full motion media in the rectilinear domain for display on a spherical surface, such as by orienting the full motion media, adding rotation to the full motion media, processing edges of the full motion media, and/or distorting the full motion media in the rectilinear domain for instance. After processing the full motion media, the method may additionally include providing the processed full motion media to a spherical projection system, such as a Science on a Sphere system.

  11. Control methods and systems for indirect evaporative coolers

    DOEpatents

    Woods, Jason; Kozubal, Erik

    2015-09-22

    A control method for operating an indirect evaporative cooler to control temperature and humidity. The method includes operating an airflow control device to provide supply air at a flow rate to a liquid desiccant dehumidifier. The supply air flows through the dehumidifier and an indirect evaporative cooler prior to exiting an outlet into a space. The method includes operating a pump to provide liquid desiccant to the liquid desiccant dehumidifier and sensing a temperature of an airstream at the outlet of the indirect evaporative cooler. The method includes comparing the temperature of the airstream at the outlet to a setpoint temperature at the outlet and controlling the pump to set the flow rate of the liquid desiccant. The method includes sensing space temperature, comparing the space temperature with a setpoint temperature, and controlling the airflow control device to set the flow rate of the supply air based on the comparison.

  12. Assessment methods for the evaluation of vitiligo.

    PubMed

    Alghamdi, K M; Kumar, A; Taïeb, A; Ezzedine, K

    2012-12-01

    There is no standardized method for assessing vitiligo. In this article, we review the literature from 1981 to 2011 on different vitiligo assessment methods. We aim to classify the techniques available for vitiligo assessment as subjective, semi-objective or objective; microscopic or macroscopic; and as based on morphometry or colorimetry. Macroscopic morphological measurements include visual assessment, photography in natural or ultraviolet light, photography with computerized image analysis and tristimulus colorimetry or spectrophotometry. Non-invasive micromorphological methods include confocal laser microscopy (CLM). Subjective methods include clinical evaluation by a dermatologist and a vitiligo disease activity score. Semi-objective methods include the Vitiligo Area Scoring Index (VASI) and point-counting methods. Objective methods include software-based image analysis, tristimulus colorimetry, spectrophotometry and CLM. Morphometry is the measurement of the vitiliginous surface area, whereas colorimetry quantitatively analyses skin colour changes caused by erythema or pigment. Most methods involve morphometry, except for the chromameter method, which assesses colorimetry. Some image analysis software programs can assess both morphometry and colorimetry. The details of these programs (Corel Draw, Image Pro Plus, AutoCad and Photoshop) are discussed in the review. Reflectance confocal microscopy provides real-time images and has great potential for the non-invasive assessment of pigmentary lesions. In conclusion, there is no single best method for assessing vitiligo. This review revealed that VASI, the rule of nine and Wood's lamp are likely to be the best techniques available for assessing the degree of pigmentary lesions and measuring the extent and progression of vitiligo in the clinic and in clinical trials. © 2012 The Authors. Journal of the European Academy of Dermatology and Venereology © 2012 European Academy of Dermatology and Venereology.

  13. Review of Artificial Abrasion Test Methods for PV Module Technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, David C.; Muller, Matt T.; Simpson, Lin J.

    This review is intended to identify the method or methods--and the basic details of those methods--that might be used to develop an artificial abrasion test. Methods used in the PV literature were compared with their closest implementation in existing standards. Also, meetings of the International PV Quality Assurance Task Force Task Group 12-3 (TG12-3, which is concerned with coated glass) were used to identify established test methods. Feedback from the group, which included many of the authors from the PV literature, included insights not explored within the literature itself. The combined experience and examples from the literature are intended tomore » provide an assessment of the present industry practices and an informed path forward. Recommendations toward artificial abrasion test methods are then identified based on the experiences in the literature and feedback from the PV community. The review here is strictly focused on abrasion. Assessment methods, including optical performance (e.g., transmittance or reflectance), surface energy, and verification of chemical composition were not examined. Methods of artificially soiling PV modules or other specimens were not examined. The weathering of artificial or naturally soiled specimens (which may ultimately include combined temperature and humidity, thermal cycling and ultraviolet light) were also not examined. A sense of the purpose or application of an abrasion test method within the PV industry should, however, be evident from the literature.« less

  14. Composites comprising novel RTIL-based polymers, and methods of making and using same

    DOEpatents

    Gin, Douglas; Carlisle, Trevor; Noble, Richard; Nicodemus, Garret; McDanel, William; Cowan, Matthew

    2017-06-27

    The invention includes compositions comprising curable imidazolium-functionalized poly(room-temperature ionic liquid) copolymers and homopolymers. The invention further includes methods of preparing and using the compositions of the invention. The invention further includes novel methods of preparing thin, supported, room-temperature ionic liquid-containing polymeric films on a porous support. In certain embodiments, the methods of the invention avoid the use of a gutter layer, which greatly reduces the overall gas permeance and selectivity of the composite membrane. In other embodiments, the films of the invention have increased gas selectivity and permeance over films prepared using methods described in the prior art.

  15. Method for removing strongly adsorbed surfactants and capping agents from metal to facilitate their catalytic applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adzic, Radoslav R.; Gong, Kuanping; Cai, Yun

    A method of synthesizing activated electrocatalyst, preferably having a morphology of a nanostructure, is disclosed. The method includes safely and efficiently removing surfactants and capping agents from the surface of the metal structures. With regard to metal nanoparticles, the method includes synthesis of nanoparticle(s) in polar or non-polar solution with surfactants or capping agents and subsequent activation by CO-adsorption-induced surfactant/capping agent desorption and electrochemical oxidation. The method produces activated macroparticle or nanoparticle electrocatalysts without damaging the surface of the electrocatalyst that includes breaking, increasing particle thickness or increasing the number of low coordination sites.

  16. Methods of Making Z-Shielding

    NASA Technical Reports Server (NTRS)

    Thomsen, III, Donald Laurence (Inventor); Cano, Roberto J. (Inventor); Jensen, Brian J. (Inventor); Hales, Stephen J. (Inventor); Alexa, Joel A. (Inventor)

    2014-01-01

    Methods of building Z-graded radiation shielding and covers. In one aspect, the method includes: providing a substrate surface having about medium Z-grade; plasma spraying a first metal having higher Z-grade than the substrate surface; and infusing a polymer layer to form a laminate. In another aspect, the method includes electro/electroless plating a first metal having higher Z-grade than the substrate surface. In other aspects, the methods include improving an existing electronics enclosure to build a Z-graded radiation shield by applying a temperature controller to at least part of the enclosure and affixing at least one layer of a first metal having higher Z-grade from the enclosure.

  17. Compositions, antibodies, asthma diagnosis methods, and methods for preparing antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jin, Hongjun; Zangar, Richard C.

    Methods for preparing an antibody are provided with the method including incorporating 3-bromo-4-hydroxy-benzoic acid into a protein to form an antigen, immunizing a mammalian host with the antigen, and recovering an antibody having an affinity for the antigen from the host. Antibodies having a binding affinity for a monohalotyrosine are provided as well as composition comprising an antibody bound with monohalotyrosine. Compositions comprising a protein having a 3-bromo-4-hydroxy-benzoic acid moiety are also provided. Methods for evaluating the severity of asthma are provide with the methods including analyzing sputum of a patient using an antibody having a binding affinity for monohalotyrosine,more » and measuring the amount of antibody bound to protein. Methods for determining eosinophil activity in bodily fluid are also provided with the methods including exposing bodily fluid to an antibody having a binding affinity for monohalotyrosine, and measuring the amount of bound antibody to determine the eosinophil activity.« less

  18. Numerical solution methods for viscoelastic orthotropic materials

    NASA Technical Reports Server (NTRS)

    Gramoll, K. C.; Dillard, D. A.; Brinson, H. F.

    1988-01-01

    Numerical solution methods for viscoelastic orthotropic materials, specifically fiber reinforced composite materials, are examined. The methods include classical lamination theory using time increments, direction solution of the Volterra Integral, Zienkiewicz's linear Prony series method, and a new method called Nonlinear Differential Equation Method (NDEM) which uses a nonlinear Prony series. The criteria used for comparison of the various methods include the stability of the solution technique, time step size stability, computer solution time length, and computer memory storage. The Volterra Integral allowed the implementation of higher order solution techniques but had difficulties solving singular and weakly singular compliance function. The Zienkiewicz solution technique, which requires the viscoelastic response to be modeled by a Prony series, works well for linear viscoelastic isotropic materials and small time steps. The new method, NDEM, uses a modified Prony series which allows nonlinear stress effects to be included and can be used with orthotropic nonlinear viscoelastic materials. The NDEM technique is shown to be accurate and stable for both linear and nonlinear conditions with minimal computer time.

  19. Heap/stack guard pages using a wakeup unit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gooding, Thomas M; Satterfield, David L; Steinmacher-Burow, Burkhard

    A method and system for providing a memory access check on a processor including the steps of detecting accesses to a memory device including level-1 cache using a wakeup unit. The method includes invalidating level-1 cache ranges corresponding to a guard page, and configuring a plurality of wakeup address compare (WAC) registers to allow access to selected WAC registers. The method selects one of the plurality of WAC registers, and sets up a WAC register related to the guard page. The method configures the wakeup unit to interrupt on access of the selected WAC register. The method detects access ofmore » the memory device using the wakeup unit when a guard page is violated. The method generates an interrupt to the core using the wakeup unit, and determines the source of the interrupt. The method detects the activated WAC registers assigned to the violated guard page, and initiates a response.« less

  20. Systems and methods for detecting a failure event in a field programmable gate array

    NASA Technical Reports Server (NTRS)

    Ng, Tak-Kwong (Inventor); Herath, Jeffrey A. (Inventor)

    2009-01-01

    An embodiment generally relates to a method of self-detecting an error in a field programmable gate array (FPGA). The method includes writing a signature value into a signature memory in the FPGA and determining a conclusion of a configuration refresh operation in the FPGA. The method also includes reading an outcome value from the signature memory.

  1. Extracellular secretion of recombinant proteins

    DOEpatents

    Linger, Jeffrey G.; Darzins, Aldis

    2014-07-22

    Nucleic acids encoding secretion signals, expression vectors containing the nucleic acids, and host cells containing the expression vectors are disclosed. Also disclosed are polypeptides that contain the secretion signals and methods of producing polypeptides, including methods of directing the extracellular secretion of the polypeptides. Exemplary embodiments include cellulase proteins fused to secretion signals, methods to produce and isolate these polypeptides, and methods to degrade lignocellulosic biomass.

  2. Remote sensing change detection methods to track deforestation and growth in threatened rainforests in Madre de Dios, Peru

    USGS Publications Warehouse

    Shermeyer, Jacob S.; Haack, Barry N.

    2015-01-01

    Two forestry-change detection methods are described, compared, and contrasted for estimating deforestation and growth in threatened forests in southern Peru from 2000 to 2010. The methods used in this study rely on freely available data, including atmospherically corrected Landsat 5 Thematic Mapper and Moderate Resolution Imaging Spectroradiometer (MODIS) vegetation continuous fields (VCF). The two methods include a conventional supervised signature extraction method and a unique self-calibrating method called MODIS VCF guided forest/nonforest (FNF) masking. The process chain for each of these methods includes a threshold classification of MODIS VCF, training data or signature extraction, signature evaluation, k-nearest neighbor classification, analyst-guided reclassification, and postclassification image differencing to generate forest change maps. Comparisons of all methods were based on an accuracy assessment using 500 validation pixels. Results of this accuracy assessment indicate that FNF masking had a 5% higher overall accuracy and was superior to conventional supervised classification when estimating forest change. Both methods succeeded in classifying persistently forested and nonforested areas, and both had limitations when classifying forest change.

  3. Cast B2-phase iron-aluminum alloys with improved fluidity

    DOEpatents

    Maziasz, Philip J.; Paris, Alan M.; Vought, Joseph D.

    2002-01-01

    Systems and methods are described for iron aluminum alloys. A composition includes iron, aluminum and manganese. A method includes providing an alloy including iron, aluminum and manganese; and processing the alloy. The systems and methods provide advantages because additions of manganese to iron aluminum alloys dramatically increase the fluidity of the alloys prior to solidification during casting.

  4. Power system

    DOEpatents

    Hickam, Christopher Dale [Glasford, IL

    2008-03-18

    A power system includes a prime mover, a transmission, and a fluid coupler having a selectively engageable lockup clutch. The fluid coupler may be drivingly connected between the prime mover and the transmission. Additionally, the power system may include a motor/generator drivingly connected to at least one of the prime mover and the transmission. The power-system may also include power-system controls configured to execute a control method. The control method may include selecting one of a plurality of modes of operation of the power system. Additionally, the control method may include controlling the operating state of the lockup clutch dependent upon the mode of operation selected. The control method may also include controlling the operating state of the motor/generator dependent upon the mode of operation selected.

  5. Diffractive laser beam homogenizer including a photo-active material and method of fabricating the same

    DOEpatents

    Bayramian, Andy J; Ebbers, Christopher A; Chen, Diana C

    2014-05-20

    A method of manufacturing a plurality of diffractive optical elements includes providing a partially transmissive slide, providing a first piece of PTR glass, and directing first UV radiation through the partially transmissive slide to impinge on the first piece of PTR glass. The method also includes exposing predetermined portions of the first piece of PTR glass to the first UV radiation and thermally treating the exposed first piece of PTR glass. The method further includes providing a second piece of PTR glass and directing second UV radiation through the thermally treated first piece of PTR glass to impinge on the second piece of PTR glass. The method additionally includes exposing predetermined portions of the second piece of PTR glass to the second UV radiation, thermally treating the exposed second piece of PTR glass, and repeating providing and processing of the second piece of PTR glass using additional pieces of PTR glass.

  6. Fluorine compounds for doping conductive oxide thin films

    DOEpatents

    Gessert, Tim; Li, Xiaonan; Barnes, Teresa M; Torres, Jr., Robert; Wyse, Carrie L

    2013-04-23

    Methods of forming a conductive fluorine-doped metal oxide layer on a substrate by chemical vapor deposition are described. The methods may include heating the substrate in a processing chamber, and introducing a metal-containing precursor and a fluorine-containing precursor to the processing chamber. The methods may also include adding an oxygen-containing precursor to the processing chamber. The precursors are reacted to deposit the fluorine-doped metal oxide layer on the substrate. Methods may also include forming the conductive fluorine-doped metal oxide layer by plasma-assisted chemical vapor deposition. These methods may include providing the substrate in a processing chamber, and introducing a metal-containing precursor, and a fluorine-containing precursor to the processing chamber. A plasma may be formed that includes species from the metal-containing precursor and the fluorine-containing precursor. The species may react to deposit the fluorine-doped metal oxide layer on the substrate.

  7. Multigrid Methods for Aerodynamic Problems in Complex Geometries

    NASA Technical Reports Server (NTRS)

    Caughey, David A.

    1995-01-01

    Work has been directed at the development of efficient multigrid methods for the solution of aerodynamic problems involving complex geometries, including the development of computational methods for the solution of both inviscid and viscous transonic flow problems. The emphasis is on problems of complex, three-dimensional geometry. The methods developed are based upon finite-volume approximations to both the Euler and the Reynolds-Averaged Navier-Stokes equations. The methods are developed for use on multi-block grids using diagonalized implicit multigrid methods to achieve computational efficiency. The work is focused upon aerodynamic problems involving complex geometries, including advanced engine inlets.

  8. Educating Instructional Designers: Different Methods for Different Outcomes.

    ERIC Educational Resources Information Center

    Rowland, Gordon; And Others

    1994-01-01

    Suggests new methods of teaching instructional design based on literature reviews of other design fields including engineering, architecture, interior design, media design, and medicine. Methods discussed include public presentations, visiting experts, competitions, artifacts, case studies, design studios, and internships and apprenticeships.…

  9. Study report on a double isotope method of calcium absorption

    NASA Technical Reports Server (NTRS)

    1978-01-01

    Some of the pros and cons of three methods to study gastrointestinal calcium absorption are briefly discussed. The methods are: (1) a balance study; (2) a single isotope method; and (3) a double isotope method. A procedure for the double isotope method is also included.

  10. Methods, systems and devices for detecting and locating ferromagnetic objects

    DOEpatents

    Roybal, Lyle Gene [Idaho Falls, ID; Kotter, Dale Kent [Shelley, ID; Rohrbaugh, David Thomas [Idaho Falls, ID; Spencer, David Frazer [Idaho Falls, ID

    2010-01-26

    Methods for detecting and locating ferromagnetic objects in a security screening system. One method includes a step of acquiring magnetic data that includes magnetic field gradients detected during a period of time. Another step includes representing the magnetic data as a function of the period of time. Another step includes converting the magnetic data to being represented as a function of frequency. Another method includes a step of sensing a magnetic field for a period of time. Another step includes detecting a gradient within the magnetic field during the period of time. Another step includes identifying a peak value of the gradient detected during the period of time. Another step includes identifying a portion of time within the period of time that represents when the peak value occurs. Another step includes configuring the portion of time over the period of time to represent a ratio.

  11. [Molecular typing methods for Pasteurella multocida-A review].

    PubMed

    Peng, Zhong; Liang, Wan; Wu, Bin

    2016-10-04

    Pasteurella multocida is an important gram-negative pathogenic bacterium that could infect wide ranges of animals. Humans could also be infected by P. multocida via animal bite or scratching. Current typing methods for P. multocida include serological typing methods and molecular typing methods. Of them, serological typing methods are based on immunological assays, which are too complicated for clinical bacteriological studies. However, the molecular methods including multiple PCRs and multilocus sequence typing (MLST) methods are more suitable for bacteriological studies of P. multocida in clinic, with their simple operation, high efficiency and accurate detection compared to the traditional serological typing methods, they are therefore widely used. In the current review, we briefly describe the molecular typing methods for P. multocida. Our aim is to provide a knowledge-foundation for clinical bacteriological investigation especially the molecular investigation for P. multocida.

  12. Rapid synthesis of beta zeolites

    DOEpatents

    Fan, Wei; Chang, Chun -Chih; Dornath, Paul; Wang, Zhuopeng

    2015-08-18

    The invention provides methods for rapidly synthesizing heteroatom containing zeolites including Sn-Beta, Si-Beta, Ti-Beta, Zr-Beta and Fe-Beta. The methods for synthesizing heteroatom zeolites include using well-crystalline zeolite crystals as seeds and using a fluoride-free, caustic medium in a seeded dry-gel conversion method. The Beta zeolite catalysts made by the methods of the invention catalyze both isomerization and dehydration reactions.

  13. Method for Fabricating Composite Structures Using Pultrusion Processing

    NASA Technical Reports Server (NTRS)

    Farley, Gary L. (Inventor)

    2000-01-01

    A method for fabricating composite structures at a low-cost, moderate-to-high production rate. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform and debulking the partially debulked preform to form a net-shape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length and electron-beam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates, resulting in lower cost and high structural performance.

  14. Method for Fabricating Composite Structures Using Continuous Press Forming

    NASA Technical Reports Server (NTRS)

    Farley, Gary L. (Inventor)

    1997-01-01

    A method for fabricating composite structures at a low-cost. moderate-to-high production rate. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform and debulking the partially debulked preform to form a net-shape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length and electron-beam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates. resulting in lower cost and high structural performance.

  15. Method for Fabricating Composite Structures Using Pultrusion Processing

    NASA Technical Reports Server (NTRS)

    Farley, Gary L. (Inventor)

    2000-01-01

    A method for fabricating composite structures at a low-cost, moderate-to-high production rate. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform and debulking the partially debulked preform to form a netshape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length and electronbeam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates, resulting in lower cost and high structural performance.

  16. System and method for evaluating a wire conductor

    DOEpatents

    Panozzo, Edward; Parish, Harold

    2013-10-22

    A method of evaluating an electrically conductive wire segment having an insulated intermediate portion and non-insulated ends includes passing the insulated portion of the wire segment through an electrically conductive brush. According to the method, an electrical potential is established on the brush by a power source. The method also includes determining a value of electrical current that is conducted through the wire segment by the brush when the potential is established on the brush. The method additionally includes comparing the value of electrical current conducted through the wire segment with a predetermined current value to thereby evaluate the wire segment. A system for evaluating an electrically conductive wire segment is also disclosed.

  17. Methods of refining natural oils, and methods of producing fuel compositions

    DOEpatents

    Firth, Bruce E.; Kirk, Sharon E.

    2015-10-27

    A method of refining a natural oil includes: (a) providing a feedstock that includes a natural oil; (b) reacting the feedstock in the presence of a metathesis catalyst to form a metathesized product that includes olefins and esters; (c) passivating residual metathesis catalyst with an agent that comprises nitric acid; (d) separating the olefins in the metathesized product from the esters in the metathesized product; and (e) transesterifying the esters in the presence of an alcohol to form a transesterified product and/or hydrogenating the olefins to form a fully or partially saturated hydrogenated product. Methods for suppressing isomerization of olefin metathesis products produced in a metathesis reaction, and methods of producing fuel compositions are described.

  18. Conformal coating of highly structured surfaces

    DOEpatents

    Ginley, David S.; Perkins, John; Berry, Joseph; Gennett, Thomas

    2012-12-11

    Method of applying a conformal coating to a highly structured substrate and devices made by the disclosed methods are disclosed. An example method includes the deposition of a substantially contiguous layer of a material upon a highly structured surface within a deposition process chamber. The highly structured surface may be associated with a substrate or another layer deposited on a substrate. The method includes depositing a material having an amorphous structure on the highly structured surface at a deposition pressure of equal to or less than about 3 mTorr. The method may also include removing a portion of the amorphous material deposited on selected surfaces and depositing additional amorphous material on the highly structured surface.

  19. Sampling system and method

    DOEpatents

    Decker, David L; Lyles, Brad F; Purcell, Richard G; Hershey, Ronald Lee

    2014-05-20

    An apparatus and method for supporting a tubing bundle during installation or removal. The apparatus includes a clamp for securing the tubing bundle to an external wireline. The method includes deploying the tubing bundle and wireline together, The tubing bundle is periodically secured to the wireline using a clamp.

  20. Hydrogenation of passivated contacts

    DOEpatents

    Nemeth, William; Yuan, Hao-Chih; LaSalvia, Vincenzo; Stradins, Pauls; Page, Matthew R.

    2018-03-06

    Methods of hydrogenation of passivated contacts using materials having hydrogen impurities are provided. An example method includes applying, to a passivated contact, a layer of a material, the material containing hydrogen impurities. The method further includes subsequently annealing the material and subsequently removing the material from the passivated contact.

  1. Multi-parametric centrality method for graph network models

    NASA Astrophysics Data System (ADS)

    Ivanov, Sergei Evgenievich; Gorlushkina, Natalia Nikolaevna; Ivanova, Lubov Nikolaevna

    2018-04-01

    The graph model networks are investigated to determine centrality, weights and the significance of vertices. For centrality analysis appliesa typical method that includesany one of the properties of graph vertices. In graph theory, methods of analyzing centrality are used: in terms by degree, closeness, betweenness, radiality, eccentricity, page-rank, status, Katz and eigenvector. We have proposed a new method of multi-parametric centrality, which includes a number of basic properties of the network member. The mathematical model of multi-parametric centrality method is developed. Comparison of results for the presented method with the centrality methods is carried out. For evaluate the results for the multi-parametric centrality methodthe graph model with hundreds of vertices is analyzed. The comparative analysis showed the accuracy of presented method, includes simultaneously a number of basic properties of vertices.

  2. Replica amplification of nucleic acid arrays

    DOEpatents

    Church, George M.; Mitra, Robi D.

    2010-08-31

    Disclosed are improved methods of making and using immobilized arrays of nucleic acids, particularly methods for producing replicas of such arrays. Included are methods for producing high density arrays of nucleic acids and replicas of such arrays, as well as methods for preserving the resolution of arrays through rounds of replication. Also included are methods which take advantage of the availability of replicas of arrays for increased sensitivity in detection of sequences on arrays. Improved methods of sequencing nucleic acids immobilized on arrays utilizing single copies of arrays and methods taking further advantage of the availability of replicas of arrays are disclosed. The improvements lead to higher fidelity and longer read lengths of sequences immobilized on arrays. Methods are also disclosed which improve the efficiency of multiplex PCR using arrays of immobilized nucleic acids.

  3. Method for Fabricating Composite Structures Including Continuous Press Forming and Pultrusion Processing

    NASA Technical Reports Server (NTRS)

    Farley, Gary L. (Inventor)

    1995-01-01

    A method for fabricating composite structures at a low-cost, moderate-to-high production rate is disclosed. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply, and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform, and debulking the partially debulked preform to form a netshape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length, and electron-beam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates, resulting in lower cost and high structural performance.

  4. Speaker verification system using acoustic data and non-acoustic data

    DOEpatents

    Gable, Todd J [Walnut Creek, CA; Ng, Lawrence C [Danville, CA; Holzrichter, John F [Berkeley, CA; Burnett, Greg C [Livermore, CA

    2006-03-21

    A method and system for speech characterization. One embodiment includes a method for speaker verification which includes collecting data from a speaker, wherein the data comprises acoustic data and non-acoustic data. The data is used to generate a template that includes a first set of "template" parameters. The method further includes receiving a real-time identity claim from a claimant, and using acoustic data and non-acoustic data from the identity claim to generate a second set of parameters. The method further includes comparing the first set of parameters to the set of parameters to determine whether the claimant is the speaker. The first set of parameters and the second set of parameters include at least one purely non-acoustic parameter, including a non-acoustic glottal shape parameter derived from averaging multiple glottal cycle waveforms.

  5. A review of propeller noise prediction methodology: 1919-1994

    NASA Technical Reports Server (NTRS)

    Metzger, F. Bruce

    1995-01-01

    This report summarizes a review of the literature regarding propeller noise prediction methods. The review is divided into six sections: (1) early methods; (2) more recent methods based on earlier theory; (3) more recent methods based on the Acoustic Analogy; (4) more recent methods based on Computational Acoustics; (5) empirical methods; and (6) broadband methods. The report concludes that there are a large number of noise prediction procedures available which vary markedly in complexity. Deficiencies in accuracy of methods in many cases may be related, not to the methods themselves, but the accuracy and detail of the aerodynamic inputs used to calculate noise. The steps recommended in the report to provide accurate and easy to use prediction methods are: (1) identify reliable test data; (2) define and conduct test programs to fill gaps in the existing data base; (3) identify the most promising prediction methods; (4) evaluate promising prediction methods relative to the data base; (5) identify and correct the weaknesses in the prediction methods, including lack of user friendliness, and include features now available only in research codes; (6) confirm the accuracy of improved prediction methods to the data base; and (7) make the methods widely available and provide training in their use.

  6. Phytometric intelligence sensors

    NASA Technical Reports Server (NTRS)

    Seelig, Hans-Dieter (Inventor); Stoner, II, Richard J. (Inventor); Hoehn, Alexander (Inventor); Adams, III, William Walter (Inventor)

    2010-01-01

    Methods and apparatus for determining when plants require watering, and methods of attending to the watering of plants including signaling the grower that the plants are in need of hydration are provided. The novel methods include real-time measurement of plant metabolics and phytometric physiology changes of intrinsic physical or behavioral traits within the plant such as determining physiological flux measurement of enzyme flux due to environmental changes such as the wind and drought stress, soil and plant mineral deficiencies, or the interaction with a bio-control for organic disease control including, cell movement, signal transduction, internal chemical processes and external environmental processes including when plants require watering, and methods of attending to the watering of plants including signaling the grower that the plants are in need of hydration.

  7. A Comparison of PSD Enveloping Methods for Nonstationary Vibration

    NASA Technical Reports Server (NTRS)

    Irvine, Tom

    2015-01-01

    There is a need to derive a power spectral density (PSD) envelope for nonstationary acceleration time histories, including launch vehicle data, so that components can be designed and tested accordingly. This paper presents the results of the three methods for an actual flight accelerometer record. Guidelines are given for the application of each method to nonstationary data. The method can be extended to other scenarios, including transportation vibration.

  8. Methods of manipulating stressed epistructures

    DOEpatents

    Wanlass, Mark W

    2014-04-08

    A method of processing an epistructure or processing a semiconductor device including associating a conformal and flexible handle with the epistructure and removing the epistructure and handle as a unit from the parent substrate. The method further includes causing the epistructure and handle unit to conform to a shape that differs from the shape the epistructure otherwise inherently assumes upon removal from the parent substrate. A device prepared according to the disclosed methods.

  9. Molcas 8: New capabilities for multiconfigurational quantum chemical calculations across the periodic table.

    PubMed

    Aquilante, Francesco; Autschbach, Jochen; Carlson, Rebecca K; Chibotaru, Liviu F; Delcey, Mickaël G; De Vico, Luca; Fdez Galván, Ignacio; Ferré, Nicolas; Frutos, Luis Manuel; Gagliardi, Laura; Garavelli, Marco; Giussani, Angelo; Hoyer, Chad E; Li Manni, Giovanni; Lischka, Hans; Ma, Dongxia; Malmqvist, Per Åke; Müller, Thomas; Nenov, Artur; Olivucci, Massimo; Pedersen, Thomas Bondo; Peng, Daoling; Plasser, Felix; Pritchard, Ben; Reiher, Markus; Rivalta, Ivan; Schapiro, Igor; Segarra-Martí, Javier; Stenrup, Michael; Truhlar, Donald G; Ungur, Liviu; Valentini, Alessio; Vancoillie, Steven; Veryazov, Valera; Vysotskiy, Victor P; Weingart, Oliver; Zapata, Felipe; Lindh, Roland

    2016-02-15

    In this report, we summarize and describe the recent unique updates and additions to the Molcas quantum chemistry program suite as contained in release version 8. These updates include natural and spin orbitals for studies of magnetic properties, local and linear scaling methods for the Douglas-Kroll-Hess transformation, the generalized active space concept in MCSCF methods, a combination of multiconfigurational wave functions with density functional theory in the MC-PDFT method, additional methods for computation of magnetic properties, methods for diabatization, analytical gradients of state average complete active space SCF in association with density fitting, methods for constrained fragment optimization, large-scale parallel multireference configuration interaction including analytic gradients via the interface to the Columbus package, and approximations of the CASPT2 method to be used for computations of large systems. In addition, the report includes the description of a computational machinery for nonlinear optical spectroscopy through an interface to the QM/MM package Cobramm. Further, a module to run molecular dynamics simulations is added, two surface hopping algorithms are included to enable nonadiabatic calculations, and the DQ method for diabatization is added. Finally, we report on the subject of improvements with respects to alternative file options and parallelization. © 2015 Wiley Periodicals, Inc.

  10. A systematic review and critical appraisal of qualitative metasynthetic practice in public health to develop a taxonomy of operations of reciprocal translation.

    PubMed

    Melendez-Torres, G J; Grant, Sean; Bonell, Chris

    2015-12-01

    Reciprocal translation, the understanding of one study's findings in terms of another's, is the foundation of most qualitative metasynthetic methods. In light of the proliferation of metasynthesis methods, the current review sought to create a taxonomy of operations of reciprocal translation using recently published qualitative metasyntheses. On 19 August 2013, MEDLINE, Embase and PsycINFO were searched. Included articles were full reports of metasyntheses of qualitative studies published in 2012 in English-language peer-reviewed journals. Two reviewers, working independently, screened records, assessed full texts for inclusion and extracted data on methods from each included metasynthesis. Systematic review methods used were summarised, and metasynthetic methods were inductively analysed to develop the taxonomy. Of 61 included metasyntheses, 21 (34%) reported fully replicable search strategies and 51 (84%) critically appraised included studies. Based on methods in these metasyntheses, we developed a taxonomy of reciprocal translation with four overlapping categories: visual representation; key paper integration; data reduction and thematic extraction; and line-by-line coding. This systematic review presents an update on methods and reporting currently used in qualitative metasynthesis. It also goes beyond the proliferation of approaches to offer a parsimonious approach to understanding how reciprocal translations are accomplished across metasynthetis methods. Copyright © 2015 John Wiley & Sons, Ltd.

  11. 40 CFR 53.52 - Leak check test.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM 2.5 or PM 10-2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...

  12. 26 CFR 20.2032-1 - Alternate valuation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... alternate valuation method under section 2032, the property included in the decedent's gross estate on the..., the alternate valuation method applies to all property included in the gross estate and cannot be... elects the alternate valuation method under section 2432, all property interests existing at the date of...

  13. Long lasting decontamination foam

    DOEpatents

    Demmer, Ricky L.; Peterman, Dean R.; Tripp, Julia L.; Cooper, David C.; Wright, Karen E.

    2010-12-07

    Compositions and methods for decontaminating surfaces are disclosed. More specifically, compositions and methods for decontamination using a composition capable of generating a long lasting foam are disclosed. Compositions may include a surfactant and gelatin and have a pH of less than about 6. Such compositions may further include affinity-shifting chemicals. Methods may include decontaminating a contaminated surface with a composition or a foam that may include a surfactant and gelatin and have a pH of less than about 6.

  14. Methods for suppressing isomerization of olefin metathesis products

    DOEpatents

    Firth, Bruce E.; Kirk, Sharon E.

    2015-10-27

    A method for suppressing isomerization of an olefin metathesis product produced in a metathesis reaction includes adding an isomerization suppression agent that includes nitric acid to a mixture that includes the olefin metathesis product and residual metathesis catalyst from the metathesis reaction under conditions that are sufficient to passivate at least a portion of the residual metathesis catalyst. Methods of refining a natural oil are described.

  15. Interagency comparison of iodometric methods for ozone determination

    NASA Technical Reports Server (NTRS)

    Demore, W. B.; Romanovsky, J. C.; Feldstein, M.; Mueller, P. K.; Hamming, W. J.

    1976-01-01

    The California Air Resources Board appointed an Oxidant Calibration Committee for the purpose of evaluating the accuracy of the different agency calibration procedures. The committee chose UV absorption photometry as the reference method for ozone measurement. Interagency comparisons of the various iodometric methods were conducted relative to the ultraviolet standard. The tests included versions of the iodometric methods as employed by the Air Resources Board, the Los Angeles Air Pollution Control District, and the EPA. An alternative candidate reference method for ozone measurement, gas phase titration, was also included in the test series.

  16. Inventory of research methods for librarianship and informatics.

    PubMed

    Eldredge, Jonathan D

    2004-01-01

    This article defines and describes the rich variety of research designs found in librarianship and informatics practice. Familiarity with the range of methods and the ability to make distinctions between those specific methods can enable authors to label their research reports correctly. The author has compiled an inventory of methods from a variety of disciplines, but with attention to the relevant applications of a methodology to the field of librarianship. Each entry in the inventory includes a definition and description for the particular research method. Some entries include references to resource material and examples.

  17. Comparison of electrical conductivity calculation methods for natural waters

    USGS Publications Warehouse

    McCleskey, R. Blaine; Nordstrom, D. Kirk; Ryan, Joseph N.

    2012-01-01

    The capability of eleven methods to calculate the electrical conductivity of a wide range of natural waters from their chemical composition was investigated. A brief summary of each method is presented including equations to calculate the conductivities of individual ions, the ions incorporated, and the method's limitations. The ability of each method to reliably predict the conductivity depends on the ions included, effective accounting of ion pairing, and the accuracy of the equation used to estimate the ionic conductivities. The performances of the methods were evaluated by calculating the conductivity of 33 environmentally important electrolyte solutions, 41 U.S. Geological Survey standard reference water samples, and 1593 natural water samples. The natural waters tested include acid mine waters, geothermal waters, seawater, dilute mountain waters, and river water impacted by municipal waste water. The three most recent conductivity methods predict the conductivity of natural waters better than other methods. Two of the recent methods can be used to reliably calculate the conductivity for samples with pH values greater than about 3 and temperatures between 0 and 40°C. One method is applicable to a variety of natural water types with a range of pH from 1 to 10, temperature from 0 to 95°C, and ionic strength up to 1 m.

  18. The importance of quality control in validating concentrations ...

    EPA Pesticide Factsheets

    A national-scale survey of 247 contaminants of emerging concern (CECs), including organic and inorganic chemical compounds, and microbial contaminants, was conducted in source and treated drinking water samples from 25 treatment plants across the United States. Multiple methods were used to determine these CECs, including six analytical methods to measure 174 pharmaceuticals, personal care products, and pesticides. A three-component quality assurance/quality control (QA/QC) program was designed for the subset of 174 CECs which allowed us to assess and compare performances of the methods used. The three components included: 1) a common field QA/QC protocol and sample design, 2) individual investigator-developed method-specific QA/QC protocols, and 3) a suite of 46 method comparison analytes that were determined in two or more analytical methods. Overall method performance for the 174 organic chemical CECs was assessed by comparing spiked recoveries in reagent, source, and treated water over a two-year period. In addition to the 247 CECs reported in the larger drinking water study, another 48 pharmaceutical compounds measured did not consistently meet predetermined quality standards. Methodologies that did not seem suitable for these analytes are overviewed. The need to exclude analytes based on method performance demonstrates the importance of additional QA/QC protocols. This paper compares the method performance of six analytical methods used to measure 174 emer

  19. A Critical Review of Methods to Evaluate the Impact of FDA Regulatory Actions

    PubMed Central

    Briesacher, Becky A.; Soumerai, Stephen B.; Zhang, Fang; Toh, Sengwee; Andrade, Susan E.; Wagner, Joann L.; Shoaibi, Azadeh; Gurwitz, Jerry H.

    2013-01-01

    Purpose To conduct a synthesis of the literature on methods to evaluate the impacts of FDA regulatory actions, and identify best practices for future evaluations. Methods We searched MEDLINE for manuscripts published between January 1948 and August 2011 that included terms related to FDA, regulatory actions, and empirical evaluation; the review additionally included FDA-identified literature. We used a modified Delphi method to identify preferred methodologies. We included studies with explicit methods to address threats to validity, and identified designs and analytic methods with strong internal validity that have been applied to other policy evaluations. Results We included 18 studies out of 243 abstracts and papers screened. Overall, analytic rigor in prior evaluations of FDA regulatory actions varied considerably; less than a quarter of studies (22%) included control groups. Only 56% assessed changes in the use of substitute products/services, and 11% examined patient health outcomes. Among studies meeting minimal criteria of rigor, 50% found no impact or weak/modest impacts of FDA actions and 33% detected unintended consequences. Among those studies finding significant intended effects of FDA actions, all cited the importance of intensive communication efforts. There are preferred methods with strong internal validity that have yet to be applied to evaluations of FDA regulatory actions. Conclusions Rigorous evaluations of the impact of FDA regulatory actions have been limited and infrequent. Several methods with strong internal validity are available to improve trustworthiness of future evaluations of FDA policies. PMID:23847020

  20. Neutron absorption detector

    DOEpatents

    Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN

    2011-05-31

    A method of detecting an activator, the method including impinging a receptor material that is not predominately water and lacks a photoluminescent material with an activator and generating Cherenkov effect light due to the activator impinging the receptor material. The method further including identifying a characteristic of the activator based on the light.

  1. 40 CFR 53.52 - Leak check test.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...

  2. 40 CFR 53.52 - Leak check test.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...

  3. 40 CFR 53.52 - Leak check test.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...

  4. Engine and method for operating an engine

    DOEpatents

    Lauper, Jr., John Christian; Willi, Martin Leo [Dunlap, IL; Thirunavukarasu, Balamurugesh [Peoria, IL; Gong, Weidong [Dunlap, IL

    2008-12-23

    A method of operating an engine is provided. The method may include supplying a combustible combination of reactants to a combustion chamber of the engine, which may include supplying a first hydrocarbon fuel, hydrogen fuel, and a second hydrocarbon fuel to the combustion chamber. Supplying the second hydrocarbon fuel to the combustion chamber may include at least one of supplying at least a portion of the second hydrocarbon fuel from an outlet port that discharges into an intake system of the engine and supplying at least a portion of the second hydrocarbon fuel from an outlet port that discharges into the combustion chamber. Additionally, the method may include combusting the combustible combination of reactants in the combustion chamber.

  5. Semiquantitative determination of mesophilic, aerobic microorganisms in cocoa products using the Soleris NF-TVC method.

    PubMed

    Montei, Carolyn; McDougal, Susan; Mozola, Mark; Rice, Jennifer

    2014-01-01

    The Soleris Non-fermenting Total Viable Count method was previously validated for a wide variety of food products, including cocoa powder. A matrix extension study was conducted to validate the method for use with cocoa butter and cocoa liquor. Test samples included naturally contaminated cocoa liquor and cocoa butter inoculated with natural microbial flora derived from cocoa liquor. A probability of detection statistical model was used to compare Soleris results at multiple test thresholds (dilutions) with aerobic plate counts determined using the AOAC Official Method 966.23 dilution plating method. Results of the two methods were not statistically different at any dilution level in any of the three trials conducted. The Soleris method offers the advantage of results within 24 h, compared to the 48 h required by standard dilution plating methods.

  6. An overview of very high level software design methods

    NASA Technical Reports Server (NTRS)

    Asdjodi, Maryam; Hooper, James W.

    1988-01-01

    Very High Level design methods emphasize automatic transfer of requirements to formal design specifications, and/or may concentrate on automatic transformation of formal design specifications that include some semantic information of the system into machine executable form. Very high level design methods range from general domain independent methods to approaches implementable for specific applications or domains. Applying AI techniques, abstract programming methods, domain heuristics, software engineering tools, library-based programming and other methods different approaches for higher level software design are being developed. Though one finds that a given approach does not always fall exactly in any specific class, this paper provides a classification for very high level design methods including examples for each class. These methods are analyzed and compared based on their basic approaches, strengths and feasibility for future expansion toward automatic development of software systems.

  7. Evaluation of PDA Technical Report No 33. Statistical Testing Recommendations for a Rapid Microbiological Method Case Study.

    PubMed

    Murphy, Thomas; Schwedock, Julie; Nguyen, Kham; Mills, Anna; Jones, David

    2015-01-01

    New recommendations for the validation of rapid microbiological methods have been included in the revised Technical Report 33 release from the PDA. The changes include a more comprehensive review of the statistical methods to be used to analyze data obtained during validation. This case study applies those statistical methods to accuracy, precision, ruggedness, and equivalence data obtained using a rapid microbiological methods system being evaluated for water bioburden testing. Results presented demonstrate that the statistical methods described in the PDA Technical Report 33 chapter can all be successfully applied to the rapid microbiological method data sets and gave the same interpretation for equivalence to the standard method. The rapid microbiological method was in general able to pass the requirements of PDA Technical Report 33, though the study shows that there can be occasional outlying results and that caution should be used when applying statistical methods to low average colony-forming unit values. Prior to use in a quality-controlled environment, any new method or technology has to be shown to work as designed by the manufacturer for the purpose required. For new rapid microbiological methods that detect and enumerate contaminating microorganisms, additional recommendations have been provided in the revised PDA Technical Report No. 33. The changes include a more comprehensive review of the statistical methods to be used to analyze data obtained during validation. This paper applies those statistical methods to analyze accuracy, precision, ruggedness, and equivalence data obtained using a rapid microbiological method system being validated for water bioburden testing. The case study demonstrates that the statistical methods described in the PDA Technical Report No. 33 chapter can be successfully applied to rapid microbiological method data sets and give the same comparability results for similarity or difference as the standard method. © PDA, Inc. 2015.

  8. Systems and Methods for Fabricating Structures Including Metallic Glass-Based Materials Using Low Pressure Casting

    NASA Technical Reports Server (NTRS)

    Hofmann, Douglas C. (Inventor); Kennett, Andrew (Inventor)

    2018-01-01

    Systems and methods to fabricate objects including metallic glass-based materials using low-pressure casting techniques are described. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: introducing molten alloy into a mold cavity defined by a mold using a low enough pressure such that the molten alloy does not conform to features of the mold cavity that are smaller than 100 microns; and cooling the molten alloy such that it solidifies, the solid including a metallic glass-based material.

  9. Systems and Methods for Fabricating Structures Including Metallic Glass-Based Materials Using Ultrasonic Welding

    NASA Technical Reports Server (NTRS)

    Hofmann, Douglas C. (Inventor); Roberts, Scott N. (Inventor)

    2017-01-01

    Systems and methods in accordance with embodiments of the invention fabricate objects including metallic glass-based materials using ultrasonic welding. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: ultrasonically welding at least one ribbon to a surface; where at least one ribbon that is ultrasonically welded to a surface has a thickness of less than approximately 150.mu.m; and where at least one ribbon that is ultrasonically welded to a surface includes a metallic glass-based material.

  10. Methods of producing adsorption media including a metal oxide

    DOEpatents

    Mann, Nicholas R; Tranter, Troy J

    2014-03-04

    Methods of producing a metal oxide are disclosed. The method comprises dissolving a metal salt in a reaction solvent to form a metal salt/reaction solvent solution. The metal salt is converted to a metal oxide and a caustic solution is added to the metal oxide/reaction solvent solution to adjust the pH of the metal oxide/reaction solvent solution to less than approximately 7.0. The metal oxide is precipitated and recovered. A method of producing adsorption media including the metal oxide is also disclosed, as is a precursor of an active component including particles of a metal oxide.

  11. Heating production fluids in a wellbore

    DOEpatents

    Orrego, Yamila; Jankowski, Todd A.

    2016-07-12

    A method for heating a production fluid in a wellbore. The method can include heating, using a packer fluid, a working fluid flowing through a first medium disposed in a first section of the wellbore, where the first medium transfers heat from the packer fluid to the working fluid. The method can also include circulating the working fluid into a second section of the wellbore through a second medium, where the second medium transfers heat from the working fluid to the production fluid. The method can further include returning the working fluid to the first section of the wellbore through the first medium.

  12. Imaging indicator for ESD safety testing.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whinnery, LeRoy L.,; Nissen, April; Keifer, Patrick N.

    2013-05-01

    This report describes the development of a new detection method for electrostatic discharge (ESD) testing of explosives, using a single-lens reflex (SLR) digital camera and a 200-mm macro lens. This method has demonstrated several distinct advantages to other current ESD detection methods, including the creation of a permanent record, an enlarged image for real-time viewing as well as extended periods of review, and ability to combine with most other Go/No-Go sensors. This report includes details of the method, including camera settings and position, and results with wellcharacterized explosives PETN and RDX, and two ESD-sensitive aluminum powders.

  13. System for testing properties of a network

    DOEpatents

    Rawle, Michael; Bartholomew, David B.; Soares, Marshall A.

    2009-06-16

    A method for identifying properties of a downhole electromagnetic network in a downhole tool sting, including the step of providing an electromagnetic path intermediate a first location and a second location on the electromagnetic network. The method further includes the step of providing a receiver at the second location. The receiver includes a known reference. The analog signal includes a set amplitude, a set range of frequencies, and a set rate of change between the frequencies. The method further includes the steps of sending the analog signal, and passively modifying the signal. The analog signal is sent from the first location through the electromagnetic path, and the signal is modified by the properties of the electromagnetic path. The method further includes the step of receiving a modified signal at the second location and comparing the known reference to the modified signal.

  14. Method and system for progressive mesh storage and reconstruction using wavelet-encoded height fields

    NASA Technical Reports Server (NTRS)

    Baxes, Gregory A. (Inventor); Linger, Timothy C. (Inventor)

    2011-01-01

    Systems and methods are provided for progressive mesh storage and reconstruction using wavelet-encoded height fields. A method for progressive mesh storage includes reading raster height field data, and processing the raster height field data with a discrete wavelet transform to generate wavelet-encoded height fields. In another embodiment, a method for progressive mesh storage includes reading texture map data, and processing the texture map data with a discrete wavelet transform to generate wavelet-encoded texture map fields. A method for reconstructing a progressive mesh from wavelet-encoded height field data includes determining terrain blocks, and a level of detail required for each terrain block, based upon a viewpoint. Triangle strip constructs are generated from vertices of the terrain blocks, and an image is rendered utilizing the triangle strip constructs. Software products that implement these methods are provided.

  15. Method and system for progressive mesh storage and reconstruction using wavelet-encoded height fields

    NASA Technical Reports Server (NTRS)

    Baxes, Gregory A. (Inventor)

    2010-01-01

    Systems and methods are provided for progressive mesh storage and reconstruction using wavelet-encoded height fields. A method for progressive mesh storage includes reading raster height field data, and processing the raster height field data with a discrete wavelet transform to generate wavelet-encoded height fields. In another embodiment, a method for progressive mesh storage includes reading texture map data, and processing the texture map data with a discrete wavelet transform to generate wavelet-encoded texture map fields. A method for reconstructing a progressive mesh from wavelet-encoded height field data includes determining terrain blocks, and a level of detail required for each terrain block, based upon a viewpoint. Triangle strip constructs are generated from vertices of the terrain blocks, and an image is rendered utilizing the triangle strip constructs. Software products that implement these methods are provided.

  16. Description and use of LSODE, the Livermore Solver for Ordinary Differential Equations

    NASA Technical Reports Server (NTRS)

    Radhakrishnan, Krishnan; Hindmarsh, Alan C.

    1993-01-01

    LSODE, the Livermore Solver for Ordinary Differential Equations, is a package of FORTRAN subroutines designed for the numerical solution of the initial value problem for a system of ordinary differential equations. It is particularly well suited for 'stiff' differential systems, for which the backward differentiation formula method of orders 1 to 5 is provided. The code includes the Adams-Moulton method of orders 1 to 12, so it can be used for nonstiff problems as well. In addition, the user can easily switch methods to increase computational efficiency for problems that change character. For both methods a variety of corrector iteration techniques is included in the code. Also, to minimize computational work, both the step size and method order are varied dynamically. This report presents complete descriptions of the code and integration methods, including their implementation. It also provides a detailed guide to the use of the code, as well as an illustrative example problem.

  17. [Recent advances in sample preparation methods of plant hormones].

    PubMed

    Wu, Qian; Wang, Lus; Wu, Dapeng; Duan, Chunfeng; Guan, Yafeng

    2014-04-01

    Plant hormones are a group of naturally occurring trace substances which play a crucial role in controlling the plant development, growth and environment response. With the development of the chromatography and mass spectroscopy technique, chromatographic analytical method has become a widely used way for plant hormone analysis. Among the steps of chromatographic analysis, sample preparation is undoubtedly the most vital one. Thus, a highly selective and efficient sample preparation method is critical for accurate identification and quantification of phytohormones. For the three major kinds of plant hormones including acidic plant hormones & basic plant hormones, brassinosteroids and plant polypeptides, the sample preparation methods are reviewed in sequence especially the recently developed methods. The review includes novel methods, devices, extractive materials and derivative reagents for sample preparation of phytohormones analysis. Especially, some related works of our group are included. At last, the future developments in this field are also prospected.

  18. Methods of natural gas liquefaction and natural gas liquefaction plants utilizing multiple and varying gas streams

    DOEpatents

    Wilding, Bruce M; Turner, Terry D

    2014-12-02

    A method of natural gas liquefaction may include cooling a gaseous NG process stream to form a liquid NG process stream. The method may further include directing the first tail gas stream out of a plant at a first pressure and directing a second tail gas stream out of the plant at a second pressure. An additional method of natural gas liquefaction may include separating CO.sub.2 from a liquid NG process stream and processing the CO.sub.2 to provide a CO.sub.2 product stream. Another method of natural gas liquefaction may include combining a marginal gaseous NG process stream with a secondary substantially pure NG stream to provide an improved gaseous NG process stream. Additionally, a NG liquefaction plant may include a first tail gas outlet, and at least a second tail gas outlet, the at least a second tail gas outlet separate from the first tail gas outlet.

  19. Vertebrate species introductions in the United States and its territories

    USGS Publications Warehouse

    Witmer, Gary W.; Fuller, Pam L.

    2011-01-01

    At least 1,065 introduced vertebrate species have been introduced in the United States and its territories, including at least 86 mammalian, 127 avian, 179 reptilian/amphibian, and 673 fish species. Examples in each major taxonomic group include domestic cat, small Indian mongoose, red fox, goat, pig, rabbit, rats, house mouse, gray squirrel, nutria, starling, Indian common myna, red-vented bulbul, brown treesnake, red-eared slider, brown trout, tilapia, and grass carp. We briefly review some of these species and the types of damage they cause. We then review the basic types of methods used for control or eradication of each taxonomic group, including physical, chemical, biological, and cultural methods. We discuss some of the challenges in managing these species, including issues with the use of toxicants, land access, public attitudes, and monitoring difficulties. Finally, we list some ongoing research and future research needs, including improved detection methods, improved attractants, improved barriers, improved capture methods, fertility control, and risk assessment methods.

  20. Costs and Efficiency of Online and Offline Recruitment Methods: A Web-Based Cohort Study

    PubMed Central

    Riis, Anders H; Hatch, Elizabeth E; Wise, Lauren A; Nielsen, Marie G; Rothman, Kenneth J; Toft Sørensen, Henrik; Mikkelsen, Ellen M

    2017-01-01

    Background The Internet is widely used to conduct research studies on health issues. Many different methods are used to recruit participants for such studies, but little is known about how various recruitment methods compare in terms of efficiency and costs. Objective The aim of our study was to compare online and offline recruitment methods for Internet-based studies in terms of efficiency (number of recruited participants) and costs per participant. Methods We employed several online and offline recruitment methods to enroll 18- to 45-year-old women in an Internet-based Danish prospective cohort study on fertility. Offline methods included press releases, posters, and flyers. Online methods comprised advertisements placed on five different websites, including Facebook and Netdoktor.dk. We defined seven categories of mutually exclusive recruitment methods and used electronic tracking via unique Uniform Resource Locator (URL) and self-reported data to identify the recruitment method for each participant. For each method, we calculated the average cost per participant and efficiency, that is, the total number of recruited participants. Results We recruited 8252 study participants. Of these, 534 were excluded as they could not be assigned to a specific recruitment method. The final study population included 7724 participants, of whom 803 (10.4%) were recruited by offline methods, 3985 (51.6%) by online methods, 2382 (30.8%) by online methods not initiated by us, and 554 (7.2%) by other methods. Overall, the average cost per participant was €6.22 for online methods initiated by us versus €9.06 for offline methods. Costs per participant ranged from €2.74 to €105.53 for online methods and from €0 to €67.50 for offline methods. Lowest average costs per participant were for those recruited from Netdoktor.dk (€2.99) and from Facebook (€3.44). Conclusions In our Internet-based cohort study, online recruitment methods were superior to offline methods in terms of efficiency (total number of participants enrolled). The average cost per recruited participant was also lower for online than for offline methods, although costs varied greatly among both online and offline recruitment methods. We observed a decrease in the efficiency of some online recruitment methods over time, suggesting that it may be optimal to adopt multiple online methods. PMID:28249833

  1. Orientation of airborne laser scanning point clouds with multi-view, multi-scale image blocks.

    PubMed

    Rönnholm, Petri; Hyyppä, Hannu; Hyyppä, Juha; Haggrén, Henrik

    2009-01-01

    Comprehensive 3D modeling of our environment requires integration of terrestrial and airborne data, which is collected, preferably, using laser scanning and photogrammetric methods. However, integration of these multi-source data requires accurate relative orientations. In this article, two methods for solving relative orientation problems are presented. The first method includes registration by minimizing the distances between of an airborne laser point cloud and a 3D model. The 3D model was derived from photogrammetric measurements and terrestrial laser scanning points. The first method was used as a reference and for validation. Having completed registration in the object space, the relative orientation between images and laser point cloud is known. The second method utilizes an interactive orientation method between a multi-scale image block and a laser point cloud. The multi-scale image block includes both aerial and terrestrial images. Experiments with the multi-scale image block revealed that the accuracy of a relative orientation increased when more images were included in the block. The orientations of the first and second methods were compared. The comparison showed that correct rotations were the most difficult to detect accurately by using the interactive method. Because the interactive method forces laser scanning data to fit with the images, inaccurate rotations cause corresponding shifts to image positions. However, in a test case, in which the orientation differences included only shifts, the interactive method could solve the relative orientation of an aerial image and airborne laser scanning data repeatedly within a couple of centimeters.

  2. Orientation of Airborne Laser Scanning Point Clouds with Multi-View, Multi-Scale Image Blocks

    PubMed Central

    Rönnholm, Petri; Hyyppä, Hannu; Hyyppä, Juha; Haggrén, Henrik

    2009-01-01

    Comprehensive 3D modeling of our environment requires integration of terrestrial and airborne data, which is collected, preferably, using laser scanning and photogrammetric methods. However, integration of these multi-source data requires accurate relative orientations. In this article, two methods for solving relative orientation problems are presented. The first method includes registration by minimizing the distances between of an airborne laser point cloud and a 3D model. The 3D model was derived from photogrammetric measurements and terrestrial laser scanning points. The first method was used as a reference and for validation. Having completed registration in the object space, the relative orientation between images and laser point cloud is known. The second method utilizes an interactive orientation method between a multi-scale image block and a laser point cloud. The multi-scale image block includes both aerial and terrestrial images. Experiments with the multi-scale image block revealed that the accuracy of a relative orientation increased when more images were included in the block. The orientations of the first and second methods were compared. The comparison showed that correct rotations were the most difficult to detect accurately by using the interactive method. Because the interactive method forces laser scanning data to fit with the images, inaccurate rotations cause corresponding shifts to image positions. However, in a test case, in which the orientation differences included only shifts, the interactive method could solve the relative orientation of an aerial image and airborne laser scanning data repeatedly within a couple of centimeters. PMID:22454569

  3. Fabrication of contacts for silicon solar cells including printing burn through layers

    DOEpatents

    Ginley, David S; Kaydanova, Tatiana; Miedaner, Alexander; Curtis, Calvin J; Van Hest, Marinus Franciscus Antonius Maria

    2014-06-24

    A method for fabricating a contact (240) for a solar cell (200). The method includes providing a solar cell substrate (210) with a surface that is covered or includes an antireflective coating (220). For example, the substrate (210) may be positioned adjacent or proximate to an outlet of an inkjet printer (712) or other deposition device. The method continues with forming a burn through layer (230) on the coating (220) by depositing a metal oxide precursor (e.g., using an inkjet or other non-contact printing method to print or apply a volume of liquid or solution containing the precursor). The method includes forming a contact layer (240) comprising silver over or on the burn through layer (230), and then annealing is performed to electrically connect the contact layer (240) to the surface of the solar cell substrate (210) through a portion of the burn through layer (230) and the coating (220).

  4. Downhole fluid injection systems, CO2 sequestration methods, and hydrocarbon material recovery methods

    DOEpatents

    Schaef, Herbert T.; McGrail, B. Peter

    2015-07-28

    Downhole fluid injection systems are provided that can include a first well extending into a geological formation, and a fluid injector assembly located within the well. The fluid injector assembly can be configured to inject a liquid CO2/H2O-emulsion into the surrounding geological formation. CO2 sequestration methods are provided that can include exposing a geological formation to a liquid CO2/H2O-emulsion to sequester at least a portion of the CO2 from the emulsion within the formation. Hydrocarbon material recovery methods are provided that can include exposing a liquid CO2/H2O-emulsion to a geological formation having the hydrocarbon material therein. The methods can include recovering at least a portion of the hydrocarbon material from the formation.

  5. Method and system for processing optical elements using magnetorheological finishing

    DOEpatents

    Menapace, Joseph Arthur; Schaffers, Kathleen Irene; Bayramian, Andrew James; Molander, William A

    2012-09-18

    A method of finishing an optical element includes mounting the optical element in an optical mount having a plurality of fiducials overlapping with the optical element and obtaining a first metrology map for the optical element and the plurality of fiducials. The method also includes obtaining a second metrology map for the optical element without the plurality of fiducials, forming a difference map between the first metrology map and the second metrology map, and aligning the first metrology map and the second metrology map. The method further includes placing mathematical fiducials onto the second metrology map using the difference map to form a third metrology map and associating the third metrology map to the optical element. Moreover, the method includes mounting the optical element in the fixture in an MRF tool, positioning the optical element in the fixture; removing the plurality of fiducials, and finishing the optical element.

  6. Methods for separating particles and/or nucleic acids using isotachophoresis

    DOEpatents

    Jung, Byoungsok; Ness, Kevin; Rose, Klint A.

    2016-03-15

    According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.

  7. Augmented reality building operations tool

    DOEpatents

    Brackney, Larry J.

    2014-09-09

    A method (700) for providing an augmented reality operations tool to a mobile client (642) positioned in a building (604). The method (700) includes, with a server (660), receiving (720) from the client (642) an augmented reality request for building system equipment (612) managed by an energy management system (EMS) (620). The method (700) includes transmitting (740) a data request for the equipment (612) to the EMS (620) and receiving (750) building management data (634) for the equipment (612). The method (700) includes generating (760) an overlay (656) with an object created based on the building management data (634), which may be sensor data, diagnostic procedures, or the like. The overlay (656) is configured for concurrent display on a display screen (652) of the client (642) with a real-time image of the building equipment (612). The method (700) includes transmitting (770) the overlay (656) to the client (642).

  8. Method and system for laser-based formation of micro-shapes in surfaces of optical elements

    DOEpatents

    Bass, Isaac Louis; Guss, Gabriel Mark

    2013-03-05

    A method of forming a surface feature extending into a sample includes providing a laser operable to emit an output beam and modulating the output beam to form a pulse train having a plurality of pulses. The method also includes a) directing the pulse train along an optical path intersecting an exposed portion of the sample at a position i and b) focusing a first portion of the plurality of pulses to impinge on the sample at the position i. Each of the plurality of pulses is characterized by a spot size at the sample. The method further includes c) ablating at least a portion of the sample at the position i to form a portion of the surface feature and d) incrementing counter i. The method includes e) repeating steps a) through d) to form the surface feature. The sample is free of a rim surrounding the surface feature.

  9. Using liquid desiccant as a regenerable filter for capturing and deactivating contaminants

    DOEpatents

    Slayzak, Steven J.; Anderson, Ren S.; Judkoff, Ronald D.; Blake, Daniel M.; Vinzant, Todd B.; Ryan, Joseph P.

    2007-12-11

    A method, and systems for implementing such method, for purifying and conditioning air of weaponized contaminants. The method includes wetting a filter packing media with a salt-based liquid desiccant, such as water with a high concentration of lithium chloride. Air is passed through the wetted filter packing media and the contaminants in are captured with the liquid desiccant while the liquid desiccant dehumidifies the air. The captured contaminants are then deactivated in the liquid desiccant, which may include heating the liquid desiccant. The liquid desiccant is regenerated by applying heat to the liquid desiccant and then removing moisture. The method includes repeating the wetting with the regenerated liquid desiccant which provides a regenerable filtering process that captures and deactivates contaminants on an ongoing basis while also conditioning the air. The method may include filtration effectiveness enhancement by electrostatic or inertial means.

  10. Marine asset security and tracking (MAST) system

    DOEpatents

    Hanson, Gregory Richard [Clinton, TN; Smith, Stephen Fulton [Loudon, TN; Moore, Michael Roy [Corryton, TN; Dobson, Eric Lesley [Charleston, SC; Blair, Jeffrey Scott [Charleston, SC; Duncan, Christopher Allen [Marietta, GA; Lenarduzzi, Roberto [Knoxville, TN

    2008-07-01

    Methods and apparatus are described for marine asset security and tracking (MAST). A method includes transmitting identification data, location data and environmental state sensor data from a radio frequency tag. An apparatus includes a radio frequency tag that transmits identification data, location data and environmental state sensor data. Another method includes transmitting identification data and location data from a radio frequency tag using hybrid spread-spectrum modulation. Another apparatus includes a radio frequency tag that transmits both identification data and location data using hybrid spread-spectrum modulation.

  11. Treatment of addiction and addiction-related behavior

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dewey, S.L.; Brodie, J.D.; Ashby, C.R. Jr.

    2000-05-02

    The present invention provides a highly efficient method for treating substance addiction and for changing addiction-related behavior of a primate suffering from substance addiction. The method includes administering to a primate an effective amount of a pharmaceutical composition including gamma vinylGABA. The present invention also provides a method of treatment of nicotine addiction by treating a patient with an effective amount of a composition including gamma vinylGABA.

  12. Treatment of addiction and addiction-related behavior

    DOEpatents

    Dewey, Stephen L.; Brodie, Jonathan D.; Ashby, Jr., Charles R.

    2000-01-01

    The present invention provides a highly efficient method for treating substance addiction and for changing addiction-related behavior of a primate suffering from substance addiction. The method includes administering to a primate an effective amount of a pharmaceutical composition including gamma vinylGABA. The present invention also provides a method of treatment of nicotine addiction by treating a patient with an effective amount of a composition including gamma vinylGABA.

  13. Methods and apparatuses for reagent delivery, reactive barrier formation, and pest control

    DOEpatents

    Gilmore, Tyler [Pasco, WA; Kaplan, Daniel I [Aiken, SC; Last, George [Richland, WA

    2002-07-09

    A reagent delivery method includes positioning reagent delivery tubes in contact with soil. The tubes can include a wall that is permeable to a soil-modifying reagent. The method further includes supplying the reagent in the tubes, diffusing the reagent through the permeable wall and into the soil, and chemically modifying a selected component of the soil using the reagent. The tubes can be in subsurface contact with soil, including groundwater, and can be placed with directional drilling equipment independent of groundwater well casings. The soil-modifying reagent includes a variety of gases, liquids, colloids, and adsorbents that may be reactive or non-reactive with soil components. The method may be used inter alia to form reactive barriers, control pests, and enhance soil nutrients for microbes and plants.

  14. Nutritional assessment in intravenous drug users with HIV/AIDS.

    PubMed

    Smit, E; Tang, A

    2000-10-01

    Studying metabolic, endocrine, and gastrointestinal (MEG) disorders in drug abuse and HIV infection is important. Equally important, however, are the tools we use to assess these disorders. Assessment of nutritional status may include any combination of biochemical and body composition measurements, dietary intake assessment, and metabolic studies. Each method has its strengths and weaknesses and there is no perfect tool. When assessing nutritional status in injection drug users (IDU) and in HIV-infected people, the decision on which method or methods to use becomes even more complex. A review of studies reported during the XII World Conference on AIDS reveals that of 64 abstracts on the topic of nutrition in HIV-infected adults, only 11 assessed diet, 41 assessed anthropometry, and 24 assessed some form of biochemical measure. The most commonly reported methods for dietary intake included 24-hour recalls, food records, and food frequencies. The commonest methods used for measuring body composition included height, weight, bioimpedance, and dual-energy x-ray absorptiometry (DEXA). Biochemical measurements included various blood nutrients, lipids, and albumin. Methods varied greatly between studies, and caution should be taken when trying to compare results across studies, especially among those using different methods. Currently, few studies deal with the development of methods that can be used for research in HIV-infected and IDU populations. We need to work toward better tools in dietary intake assessment, body composition, and biochemical measurements, especially methods that will allow us to track changes in nutritional status over time.

  15. 24 CFR 941.102 - Development methods and funding.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Development methods and funding... URBAN DEVELOPMENT PUBLIC HOUSING DEVELOPMENT General § 941.102 Development methods and funding. (a) Methods. A PHA may use any generally accepted method of development including, but not limited to...

  16. Using Corporate-Based Methods To Assess Technical Communication Programs.

    ERIC Educational Resources Information Center

    Faber, Brenton; Bekins, Linn; Karis, Bill

    2002-01-01

    Investigates methods of program assessment used by corporate learning sites and profiles value added methods as a way to both construct and evaluate academic programs in technical communication. Examines and critiques assessment methods from corporate training environments including methods employed by corporate universities and value added…

  17. Log sampling methods and software for stand and landscape analyses.

    Treesearch

    Lisa J. Bate; Torolf R. Torgersen; Michael J. Wisdom; Edward O. Garton; Shawn C. Clabough

    2008-01-01

    We describe methods for efficient, accurate sampling of logs at landscape and stand scales to estimate density, total length, cover, volume, and weight. Our methods focus on optimizing the sampling effort by choosing an appropriate sampling method and transect length for specific forest conditions and objectives. Sampling methods include the line-intersect method and...

  18. Comparison of four different reduction methods for anterior dislocation of the shoulder.

    PubMed

    Guler, Olcay; Ekinci, Safak; Akyildiz, Faruk; Tirmik, Uzeyir; Cakmak, Selami; Ugras, Akin; Piskin, Ahmet; Mahirogullari, Mahir

    2015-05-28

    Shoulder dislocations account for almost 50% of all major joint dislocations and are mainly anterior. The aim is a comparative retrospective study of different reduction maneuvers without anesthesia to reduce the dislocated shoulder. Patients were treated with different reduction maneuvers, including various forms of traction and external rotation, in the emergency departments of four training hospitals between 2009 and 2012. Each of the four hospitals had different treatment protocols for reduction and applying one of four maneuvers: Spaso, Chair, Kocher, and Matsen methods. Thirty-nine patients were treated by the Spaso method, 47 by the Chair reduction method, 40 by the Kocher method, and 27 patients by Matsen's traction-countertraction method. All patients' demographic data were recorded. Dislocation number, reduction time, time interval between dislocation and reduction, and associated complications, pre- and post-reduction period, were recorded prospectively. No anesthetic method was used for the reduction. All of the methods used included traction and some external rotation. The Chair method had the shortest reduction time. All surgeons involved in the study agreed that the Kocher and Matsen methods needed more force for the reduction. Patients could contract their muscles because of the pain in these two methods. The Spaso method includes flexion of the shoulder and blocks muscle contraction somewhat. The Chair method was found to be the easiest because the patients could not contract their muscles while sitting on a chair with the affected arm at their side. We suggest that the Chair method is an effective and fast reduction maneuver that may be an alternative for the treatment of anterior shoulder dislocations. Further prospective studies with larger sample size are needed to compare safety of different reduction techniques.

  19. The use of rapid review methods in health technology assessments: 3 case studies.

    PubMed

    Kaltenthaler, Eva; Cooper, Katy; Pandor, Abdullah; Martyn-St James, Marrissa; Chatters, Robin; Wong, Ruth

    2016-08-26

    Rapid reviews are of increasing importance within health technology assessment due to time and resource constraints. There are many rapid review methods available although there is little guidance as to the most suitable methods. We present three case studies employing differing methods to suit the evidence base for each review and outline some issues to consider when selecting an appropriate method. Three recently completed systematic review short reports produced for the UK National Institute for Health Research were examined. Different approaches to rapid review methods were used in the three reports which were undertaken to inform the commissioning of services within the NHS and to inform future trial design. We describe the methods used, the reasoning behind the choice of methods and explore the strengths and weaknesses of each method. Rapid review methods were chosen to meet the needs of the review and each review had distinctly different challenges such as heterogeneity in terms of populations, interventions, comparators and outcome measures (PICO) and/or large numbers of relevant trials. All reviews included at least 10 randomised controlled trials (RCTs), each with numerous included outcomes. For the first case study (sexual health interventions), very diverse studies in terms of PICO were included. P-values and summary information only were presented due to substantial heterogeneity between studies and outcomes measured. For the second case study (premature ejaculation treatments), there were over 100 RCTs but also several existing systematic reviews. Data for meta-analyses were extracted directly from existing systematic reviews with new RCT data added where available. For the final case study (cannabis cessation therapies), studies included a wide range of interventions and considerable variation in study populations and outcomes. A brief summary of the key findings for each study was presented and narrative synthesis used to summarise results for each pair of interventions compared. Rapid review methods need to be chosen to meet both the nature of the evidence base of a review and the challenges presented by the included studies. Appropriate methods should be chosen after an assessment of the evidence base.

  20. X-Ray Diffraction (XRD) Characterization Methods for Sigma=3 Twin Defects in Cubic Semiconductor (100) Wafers

    NASA Technical Reports Server (NTRS)

    Park, Yeonjoon (Inventor); Kim, Hyun Jung (Inventor); Skuza, Jonathan R. (Inventor); Lee, Kunik (Inventor); Choi, Sang Hyouk (Inventor); King, Glen C. (Inventor)

    2017-01-01

    An X-ray defraction (XRD) characterization method for sigma=3 twin defects in cubic semiconductor (100) wafers includes a concentration measurement method and a wafer mapping method for any cubic tetrahedral semiconductor wafers including GaAs (100) wafers and Si (100) wafers. The methods use the cubic semiconductor's (004) pole figure in order to detect sigma=3/{111} twin defects. The XRD methods are applicable to any (100) wafers of tetrahedral cubic semiconductors in the diamond structure (Si, Ge, C) and cubic zinc-blend structure (InP, InGaAs, CdTe, ZnSe, and so on) with various growth methods such as Liquid Encapsulated Czochralski (LEC) growth, Molecular Beam Epitaxy (MBE), Organometallic Vapor Phase Epitaxy (OMVPE), Czochralski growth and Metal Organic Chemical Vapor Deposition (MOCVD) growth.

  1. Statistical methods for analysis of radiation effects with tumor and dose location-specific information with application to the WECARE study of asynchronous contralateral breast cancer

    PubMed Central

    Langholz, Bryan; Thomas, Duncan C.; Stovall, Marilyn; Smith, Susan A.; Boice, John D.; Shore, Roy E.; Bernstein, Leslie; Lynch, Charles F.; Zhang, Xinbo; Bernstein, Jonine L.

    2009-01-01

    Summary Methods for the analysis of individually matched case-control studies with location-specific radiation dose and tumor location information are described. These include likelihood methods for analyses that just use cases with precise location of tumor information and methods that also include cases with imprecise tumor location information. The theory establishes that each of these likelihood based methods estimates the same radiation rate ratio parameters, within the context of the appropriate model for location and subject level covariate effects. The underlying assumptions are characterized and the potential strengths and limitations of each method are described. The methods are illustrated and compared using the WECARE study of radiation and asynchronous contralateral breast cancer. PMID:18647297

  2. Method and apparatus for synthesizing filamentary structures

    DOEpatents

    Height, Murray J [Somerville, MA; Howard, Jack B [Winchester, MA; Vandersande, John B [Newbury, MA

    2008-02-26

    Method and apparatus for producing filamentary structures. The structures include single-walled nanotubes. The method includes combusting hydrocarbon fuel and oxygen to establish a non-sooting flame and providing an unsupported catalyst to synthesize the filamentary structure in a post-flame region of the flame. Residence time is selected to favor filamentary structure growth.

  3. Methods for the evaluation of alternative disaster warning systems

    NASA Technical Reports Server (NTRS)

    Agnew, C. E.; Anderson, R. J., Jr.; Lanen, W. N.

    1977-01-01

    For each of the methods identified, a theoretical basis is provided and an illustrative example is described. The example includes sufficient realism and detail to enable an analyst to conduct an evaluation of other systems. The methods discussed in the study include equal capability cost analysis, consumers' surplus, and statistical decision theory.

  4. Power systems utilizing the heat of produced formation fluid

    DOEpatents

    Lambirth, Gene Richard [Houston, TX

    2011-01-11

    Systems, methods, and heaters for treating a subsurface formation are described herein. At least one method includes treating a hydrocarbon containing formation. The method may include providing heat to the formation; producing heated fluid from the formation; and generating electricity from at least a portion of the heated fluid using a Kalina cycle.

  5. The Effects of Consequence Manipulation during Functional Analysis of Problem Behavior Maintained by Negative Reinforcement

    ERIC Educational Resources Information Center

    Potoczak, Kathryn; Carr, James E.; Michael, Jack

    2007-01-01

    Two distinct analytic methods have been used to identify the function of problem behavior. The antecedent-behavior-consequence (ABC) method (Iwata, Dorsey, Slifer, Bauman, & Richman, 1982/1994) includes the delivery of consequences for problem behavior. The AB method (Carr & Durand, 1985) does not include consequence delivery, instead relying…

  6. Enhancing hydrogen spillover and storage

    DOEpatents

    Yang, Ralph T [Ann Arbor, MI; Li, Yingwel [Ann Arbor, MI; Lachawiec, Jr., Anthony J.

    2011-05-31

    Methods for enhancing hydrogen spillover and storage are disclosed. One embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the hydrogen receptor to ultrasonification as doping occurs. Another embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the doped hydrogen receptor to a plasma treatment.

  7. Enhancing hydrogen spillover and storage

    DOEpatents

    Yang, Ralph T; Li, Yingwei; Lachawiec, Jr., Anthony J

    2013-02-12

    Methods for enhancing hydrogen spillover and storage are disclosed. One embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the hydrogen receptor to ultrasonication as doping occurs. Another embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the doped hydrogen receptor to a plasma treatment.

  8. Comparing Two Methods for Reducing Variability in Voice Quality Measurements

    ERIC Educational Resources Information Center

    Kreiman, Jody; Gerratt, Bruce R.

    2011-01-01

    Purpose: Interrater disagreements in ratings of quality plague the study of voice. This study compared 2 methods for handling this variability. Method: Listeners provided multiple breathiness ratings for 2 sets of pathological voices, one including 20 male and 20 female voices unselected for quality and one including 20 breathy female voices.…

  9. Filter desulfation system and method

    DOEpatents

    Lowe, Michael D.; Robel, Wade J.; Verkiel, Maarten; Driscoll, James J.

    2010-08-10

    A method of removing sulfur from a filter system of an engine includes continuously passing an exhaust flow through a desulfation leg of the filter system during desulfation. The method also includes sensing at least one characteristic of the exhaust flow and modifying a flow rate of the exhaust flow during desulfation in response to the sensing.

  10. Neutron detector and fabrication method thereof

    DOEpatents

    Bhandari, Harish B.; Nagarkar, Vivek V.; Ovechkina, Olena E.

    2016-08-16

    A neutron detector and a method for fabricating a neutron detector. The neutron detector includes a photodetector, and a solid-state scintillator operatively coupled to the photodetector. In one aspect, the method for fabricating a neutron detector includes providing a photodetector, and depositing a solid-state scintillator on the photodetector to form a detector structure.

  11. Inventory of research methods for librarianship and informatics

    PubMed Central

    Eldredge, Jonathan D.

    2004-01-01

    This article defines and describes the rich variety of research designs found in librarianship and informatics practice. Familiarity with the range of methods and the ability to make distinctions between those specific methods can enable authors to label their research reports correctly. The author has compiled an inventory of methods from a variety of disciplines, but with attention to the relevant applications of a methodology to the field of librarianship. Each entry in the inventory includes a definition and description for the particular research method. Some entries include references to resource material and examples. PMID:14762467

  12. Advanced X-ray Spectroscopic Methods for Studying Iron-Sulfur-Containing Proteins and Model Complexes.

    PubMed

    DeBeer, Serena

    2018-01-01

    In this chapter, a brief overview of X-ray spectroscopic methods that may be utilized to obtain insight into the geometric and electronic structure of iron-sulfur proteins is provided. These methods include conventional methods, such as metal and ligand K-edge X-ray absorption, as well as more advanced methods including nonresonant and resonant X-ray emission. In each section, the basic information content of the spectra is highlighted and important experimental considerations are discussed. Throughout the chapter, recent applications to iron-sulfur-containing models and proteins are highlighted. © 2018 Elsevier Inc. All rights reserved.

  13. Systems and methods for data quality control and cleansing

    DOEpatents

    Wenzel, Michael; Boettcher, Andrew; Drees, Kirk; Kummer, James

    2016-05-31

    A method for detecting and cleansing suspect building automation system data is shown and described. The method includes using processing electronics to automatically determine which of a plurality of error detectors and which of a plurality of data cleansers to use with building automation system data. The method further includes using processing electronics to automatically detect errors in the data and cleanse the data using a subset of the error detectors and a subset of the cleansers.

  14. System and methods for determining masking signals for applying empirical mode decomposition (EMD) and for demodulating intrinsic mode functions obtained from application of EMD

    DOEpatents

    Senroy, Nilanjan [New Delhi, IN; Suryanarayanan, Siddharth [Littleton, CO

    2011-03-15

    A computer-implemented method of signal processing is provided. The method includes generating one or more masking signals based upon a computed Fourier transform of a received signal. The method further includes determining one or more intrinsic mode functions (IMFs) of the received signal by performing a masking-signal-based empirical mode decomposition (EMD) using the at least one masking signal.

  15. 77 FR 32038 - Energy Conservation Program: Alternative Efficiency Determination Methods and Alternative Rating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-31

    ... Determination Methods and Alternative Rating Methods AGENCY: Office of Energy Efficiency and Renewable Energy... proposing to revise and expand its existing regulations governing the use of particular methods as...- TP-0024, by any of the following methods: Email: to AED/[email protected] . Include EERE...

  16. Beyond Euler's Method: Implicit Finite Differences in an Introductory ODE Course

    ERIC Educational Resources Information Center

    Kull, Trent C.

    2011-01-01

    A typical introductory course in ordinary differential equations (ODEs) exposes students to exact solution methods. However, many differential equations must be approximated with numerical methods. Textbooks commonly include explicit methods such as Euler's and Improved Euler's. Implicit methods are typically introduced in more advanced courses…

  17. A Comparison of Two Methods for Boolean Query Relevancy Feedback.

    ERIC Educational Resources Information Center

    Salton, G.; And Others

    1984-01-01

    Evaluates and compares two recently proposed automatic methods for relevance feedback of Boolean queries (Dillon method, which uses probabilistic approach as basis, and disjunctive normal form method). Conclusions are drawn concerning the use of effective feedback methods in a Boolean query environment. Nineteen references are included. (EJS)

  18. Algorithms for Mathematical Programming with Emphasis on Bi-level Models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldfarb, Donald; Iyengar, Garud

    2014-05-22

    The research supported by this grant was focused primarily on first-order methods for solving large scale and structured convex optimization problems and convex relaxations of nonconvex problems. These include optimal gradient methods, operator and variable splitting methods, alternating direction augmented Lagrangian methods, and block coordinate descent methods.

  19. Nanotextured Surfaces and Related Methods, Systems, and Uses

    NASA Technical Reports Server (NTRS)

    Greer, Harold F. (Inventor); Greer, Julia R. (Inventor)

    2014-01-01

    A method of controlling wetting characteristics is described. Such method includes forming and configuring nanostructures on a surface where controlling of the wetting characteristics is desired. Surfaces and methods of fabricating such surfaces are also described.

  20. Finite difference and Runge-Kutta methods for solving vibration problems

    NASA Astrophysics Data System (ADS)

    Lintang Renganis Radityani, Scolastika; Mungkasi, Sudi

    2017-11-01

    The vibration of a storey building can be modelled into a system of second order ordinary differential equations. If the number of floors of a building is large, then the result is a large scale system of second order ordinary differential equations. The large scale system is difficult to solve, and if it can be solved, the solution may not be accurate. Therefore, in this paper, we seek for accurate methods for solving vibration problems. We compare the performance of numerical finite difference and Runge-Kutta methods for solving large scale systems of second order ordinary differential equations. The finite difference methods include the forward and central differences. The Runge-Kutta methods include the Euler and Heun methods. Our research results show that the central finite difference and the Heun methods produce more accurate solutions than the forward finite difference and the Euler methods do.

  1. Analysis of pharmaceutical and other organic wastewater compounds in filtered and unfiltered water samples by gas chromatography/mass spectrometry

    USGS Publications Warehouse

    Zaugg, Steven D.; Phillips, Patrick J.; Smith, Steven G.

    2014-01-01

    Research on the effects of exposure of stream biota to complex mixtures of pharmaceuticals and other organic compounds associated with wastewater requires the development of additional analytical capabilities for these compounds in water samples. Two gas chromatography/mass spectrometry (GC/MS) analytical methods used at the U.S. Geological Survey National Water Quality Laboratory (NWQL) to analyze organic compounds associated with wastewater were adapted to include additional pharmaceutical and other organic compounds beginning in 2009. This report includes a description of method performance for 42 additional compounds for the filtered-water method (hereafter referred to as the filtered method) and 46 additional compounds for the unfiltered-water method (hereafter referred to as the unfiltered method). The method performance for the filtered method described in this report has been published for seven of these compounds; however, the addition of several other compounds to the filtered method and the addition of the compounds to the unfiltered method resulted in the need to document method performance for both of the modified methods. Most of these added compounds are pharmaceuticals or pharmaceutical degradates, although two nonpharmaceutical compounds are included in each method. The main pharmaceutical compound classes added to the two modified methods include muscle relaxants, opiates, analgesics, and sedatives. These types of compounds were added to the original filtered and unfiltered methods largely in response to the tentative identification of a wide range of pharmaceutical and other organic compounds in samples collected from wastewater-treatment plants. Filtered water samples are extracted by vacuum through disposable solid-phase cartridges that contain modified polystyrene-divinylbenzene resin. Unfiltered samples are extracted by using continuous liquid-liquid extraction with dichloromethane. The compounds of interest for filtered and unfiltered sample types were determined by use of the capillary-column gas chromatography/mass spectrometry. The performance of each method was assessed by using data on recoveries of compounds in fortified surface-water, wastewater, and reagent-water samples. These experiments (referred to as spike experiments) consist of fortifying (or spiking) samples with known amounts of target analytes. Surface-water-spike experiments were performed by using samples obtained from a stream in Colorado (unfiltered method) and a stream in New York (filtered method). Wastewater spike experiments for both the filtered and unfiltered methods were performed by using a treated wastewater obtained from a single wastewater treatment plant in New York. Surface water and wastewater spike experiments were fortified at both low and high concentrations and termed low- and high-level spikes, respectively. Reagent water spikes were assessed in three ways: (1) set spikes, (2) a low-concentration fortification experiment, and (3) a high-concentration fortification experiment. Set spike samples have been determined since 2009, and consist of analysis of fortified reagent water for target compounds included for each group of 10 to18 environmental samples analyzed at the NWQL. The low-concentration and high-concentration reagent spike experiments, by contrast, represent a one-time assessment of method performance. For each spike experiment, mean recoveries ranging from 60 to 130 percent indicate low bias, and relative standard deviations (RSDs) less than ( Of the compounds included in the filtered method, 21 had mean recoveries ranging from 63 to 129 percent for the low-level and high-level surface-water spikes, and had low ()132 percent]. For wastewater spikes, 24 of the compounds included in the filtered method had recoveries ranging from 61 to 130 percent for the low-level and high-level spikes. RSDs were 130 percent) or variable recoveries (RSDs >30 percent) for low-level wastewater spikes, or low recoveries ( Of the compounds included in the unfiltered method, 17 had mean spike recoveries ranging from 74 to 129 percent and RSDs ranging from 5 to 25 percent for low-level and high-level surface water spikes. The remaining compounds had poor mean recoveries (130 percent), or high RSDs (>29 percent) for these spikes. For wastewater, 14 of the compounds included in the unfiltered method had mean recoveries ranging from 62 to 127 percent and RSDs 130 percent), or low mean recoveries (33 percent) for the low-level wastewater spikes. Of the compounds found in wastewater, 24 had mean set spike recoveries ranging from 64 to 104 percent and RSDs Separate method detection limits (MDLs) were computed for surface water and wastewater for both the filtered and unfiltered methods. Filtered method MDLs ranged from 0.007 to 0.14 microgram per liter (μg/L) for the surface water matrix and from 0.004 to 0.62 μg/L for the wastewater matrix. Unfiltered method MDLs ranged from 0.014 to 0.33 μg/L for the surface water matrix and from 0.008 to 0.36 μg/L for the wastewater matrix.

  2. The Parker-Sochacki Method--A Powerful New Method for Solving Systems of Differential Equations

    NASA Astrophysics Data System (ADS)

    Rudmin, Joseph W.

    2001-04-01

    The Parker-Sochacki Method--A Powerful New Method for Solving Systems of Differential Equations Joseph W. Rudmin (Physics Dept, James Madison University) A new system of solving systems of differential equations will be presented, which has been developed by J. Edgar Parker and James Sochacki, of the James Madison University Mathematics Department. The method produces MacClaurin Series solutions to systems of differential equations, with the coefficients in either algebraic or numerical form. The method yields high-degree solutions: 20th degree is easily obtainable. It is conceptually simple, fast, and extremely general. It has been applied to over a hundred systems of differential equations, some of which were previously unsolved, and has yet to fail to solve any system for which the MacClaurin series converges. The method is non-recursive: each coefficient in the series is calculated just once, in closed form, and its accuracy is limited only by the digital accuracy of the computer. Although the original differential equations may include any mathematical functions, the computational method includes ONLY the operations of addition, subtraction, and multiplication. Furthermore, it is perfectly suited to parallel -processing computer languages. Those who learn this system will never use Runge-Kutta or predictor-corrector methods again. Examples will be presented, including the classical many-body problem.

  3. Methods of refining natural oils and methods of producing fuel compositions

    DOEpatents

    Firth, Bruce E; Kirk, Sharon E; Gavaskar, Vasudeo S

    2015-11-04

    A method of refining a natural oil includes: (a) providing a feedstock that includes a natural oil; (b) reacting the feedstock in the presence of a metathesis catalyst to form a metathesized product that includes olefins and esters; (c) passivating residual metathesis catalyst with an agent selected from the group consisting of phosphorous acid, phosphinic acid, and a combination thereof; (d) separating the olefins in the metathesized product from the esters in the metathesized product; and (e) transesterifying the esters in the presence of an alcohol to form a transesterified product and/or hydrogenating the olefins to form a fully or partially saturated hydrogenated product. Methods for suppressing isomerization of olefin metathesis products produced in a metathesis reaction, and methods of producing fuel compositions are described.

  4. Multifidelity Analysis and Optimization for Supersonic Design

    NASA Technical Reports Server (NTRS)

    Kroo, Ilan; Willcox, Karen; March, Andrew; Haas, Alex; Rajnarayan, Dev; Kays, Cory

    2010-01-01

    Supersonic aircraft design is a computationally expensive optimization problem and multifidelity approaches over a significant opportunity to reduce design time and computational cost. This report presents tools developed to improve supersonic aircraft design capabilities including: aerodynamic tools for supersonic aircraft configurations; a systematic way to manage model uncertainty; and multifidelity model management concepts that incorporate uncertainty. The aerodynamic analysis tools developed are appropriate for use in a multifidelity optimization framework, and include four analysis routines to estimate the lift and drag of a supersonic airfoil, a multifidelity supersonic drag code that estimates the drag of aircraft configurations with three different methods: an area rule method, a panel method, and an Euler solver. In addition, five multifidelity optimization methods are developed, which include local and global methods as well as gradient-based and gradient-free techniques.

  5. Basic analytical methods for identification of erythropoiesis-stimulating agents in doping control

    NASA Astrophysics Data System (ADS)

    Postnikov, P. V.; Krotov, G. I.; Efimova, Yu A.; Rodchenkov, G. M.

    2016-02-01

    The design of new erythropoiesis-stimulating agents for clinical use necessitates constant development of methods for detecting the abuse of these substances, which are prohibited under the World Anti-Doping Code and are included in the World Anti-Doping Agency (WADA) prohibited list. This review integrates and describes systematically the published data on the key methods currently used by WADA-accredited anti-doping laboratories around the world to detect the abuse of erythropoiesis-stimulating agents, including direct methods (various polyacrylamide gel electrophoresis techniques, enzyme-linked immunosorbent assay, membrane enzyme immunoassay and mass spectrometry) and indirect methods (athlete biological passport). Particular attention is given to promising approaches and investigations that can be used to control prohibited erythropoietins in the near future. The bibliography includes 122 references.

  6. Evaluation of DFT methods for computing the interaction energies of homomolecular and heteromolecular dimers of monosubstituted benzene

    NASA Astrophysics Data System (ADS)

    Godfrey-Kittle, Andrew; Cafiero, Mauricio

    We present density functional theory (DFT) interaction energies for the sandwich and T-shaped conformers of substituted benzene dimers. The DFT functionals studied include TPSS, HCTH407, B3LYP, and X3LYP. We also include Hartree-Fock (HF) and second-order Møller-Plesset perturbation theory calculations (MP2), as well as calculations using a new functional, P3LYP, which includes PBE and HF exchange and LYP correlation. Although DFT methods do not explicitly account for the dispersion interactions important in the benzene-dimer interactions, we find that our new method, P3LYP, as well as HCTH407 and TPSS, match MP2 and CCSD(T) calculations much better than the hybrid methods B3LYP and X3LYP methods do.

  7. Sublimation systems and associated methods

    DOEpatents

    Turner, Terry D.; McKellar, Michael G.; Wilding, Bruce M.

    2016-02-09

    A system for vaporizing and sublimating a slurry comprising a fluid including solid particles therein. The system includes a first heat exchanger configured to receive the fluid including solid particles and vaporize the fluid and a second heat exchanger configured to receive the vaporized fluid and solid particles and sublimate the solid particles. A method for vaporizing and sublimating a fluid including solid particles therein is also disclosed. The method includes feeding the fluid including solid particles to a first heat exchanger, vaporizing the fluid, feeding the vaporized fluid and solid particles to a second heat exchanger and sublimating the solid particles. In some embodiments the fluid including solid particles is liquid natural gas or methane including solid carbon dioxide particles.

  8. New methods for the numerical integration of ordinary differential equations and their application to the equations of motion of spacecraft

    NASA Technical Reports Server (NTRS)

    Banyukevich, A.; Ziolkovski, K.

    1975-01-01

    A number of hybrid methods for solving Cauchy problems are described on the basis of an evaluation of advantages of single and multiple-point numerical integration methods. The selection criterion is the principle of minimizing computer time. The methods discussed include the Nordsieck method, the Bulirsch-Stoer extrapolation method, and the method of recursive Taylor-Steffensen power series.

  9. Method and apparatus for vibrating a substrate during material formation

    DOEpatents

    Bailey, Jeffrey A [Richland, WA; Roger, Johnson N [Richland, WA; John, Munley T [Benton City, WA; Walter, Park R [Benton City, WA

    2008-10-21

    A method and apparatus for affecting the properties of a material include vibrating the material during its formation (i.e., "surface sifting"). The method includes the steps of providing a material formation device and applying a plurality of vibrations to the material during formation, which vibrations are oscillations having dissimilar, non-harmonic frequencies and at least two different directions. The apparatus includes a plurality of vibration sources that impart vibrations to the material.

  10. Characterization of dielectric materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    King, Danny J.; Babinec, Susan; Hagans, Patrick L.

    2017-06-27

    A system and a method for characterizing a dielectric material are provided. The system and method generally include applying an excitation signal to electrodes on opposing sides of the dielectric material to evaluate a property of the dielectric material. The method can further include measuring the capacitive impedance across the dielectric material, and determining a variation in the capacitive impedance with respect to either or both of a time domain and a frequency domain. The measured property can include pore size and surface imperfections. The method can still further include modifying a processing parameter as the dielectric material is formedmore » in response to the detected variations in the capacitive impedance, which can correspond to a non-uniformity in the dielectric material.« less

  11. Methods for detecting, quantifying, and adjusting for dissemination bias in meta-analysis are described.

    PubMed

    Mueller, Katharina Felicitas; Meerpohl, Joerg J; Briel, Matthias; Antes, Gerd; von Elm, Erik; Lang, Britta; Motschall, Edith; Schwarzer, Guido; Bassler, Dirk

    2016-12-01

    To systematically review methodological articles which focus on nonpublication of studies and to describe methods of detecting and/or quantifying and/or adjusting for dissemination in meta-analyses. To evaluate whether the methods have been applied to an empirical data set for which one can be reasonably confident that all studies conducted have been included. We systematically searched Medline, the Cochrane Library, and Web of Science, for methodological articles that describe at least one method of detecting and/or quantifying and/or adjusting for dissemination bias in meta-analyses. The literature search retrieved 2,224 records, of which we finally included 150 full-text articles. A great variety of methods to detect, quantify, or adjust for dissemination bias were described. Methods included graphical methods mainly based on funnel plot approaches, statistical methods, such as regression tests, selection models, sensitivity analyses, and a great number of more recent statistical approaches. Only few methods have been validated in empirical evaluations using unpublished studies obtained from regulators (Food and Drug Administration, European Medicines Agency). We present an overview of existing methods to detect, quantify, or adjust for dissemination bias. It remains difficult to advise which method should be used as they are all limited and their validity has rarely been assessed. Therefore, a thorough literature search remains crucial in systematic reviews, and further steps to increase the availability of all research results need to be taken. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Documentation of spreadsheets for the analysis of aquifer-test and slug-test data

    USGS Publications Warehouse

    Halford, Keith J.; Kuniansky, Eve L.

    2002-01-01

    Several spreadsheets have been developed for the analysis of aquifer-test and slug-test data. Each spreadsheet incorporates analytical solution(s) of the partial differential equation for ground-water flow to a well for a specific type of condition or aquifer. The derivations of the analytical solutions were previously published. Thus, this report abbreviates the theoretical discussion, but includes practical information about each method and the important assumptions for the applications of each method. These spreadsheets were written in Microsoft Excel 9.0 (use of trade names does not constitute endorsement by the USGS). Storage properties should not be estimated with many of the spreadsheets because most are for analyzing single-well tests. Estimation of storage properties from single-well tests is generally discouraged because single-well tests are affected by wellbore storage and by well construction. These non-ideal effects frequently cause estimates of storage to be erroneous by orders of magnitude. Additionally, single-well tests are not sensitive to aquifer-storage properties. Single-well tests include all slug tests (Bouwer and Rice Method, Cooper, Bredehoeft, Papadopulos Method, and van der Kamp Method), the Cooper-Jacob straight-line Method, Theis recovery-data analysis, Jacob-Lohman method for flowing wells in a confined aquifer, and the step-drawdown test. Multi-well test spreadsheets included in this report are; Hantush-Jacob Leaky Aquifer Method and Distance-Drawdown Methods. The distance-drawdown method is an equilibrium or steady-state method, thus storage cannot be estimated.

  13. Experimental methods for identifying failure mechanisms

    NASA Technical Reports Server (NTRS)

    Daniel, I. M.

    1983-01-01

    Experimental methods for identifying failure mechanisms in fibrous composites are studied. Methods to identify failure in composite materials includes interferometry, holography, fractography and ultrasonics.

  14. Hypothesis Testing Using Factor Score Regression: A Comparison of Four Methods

    ERIC Educational Resources Information Center

    Devlieger, Ines; Mayer, Axel; Rosseel, Yves

    2016-01-01

    In this article, an overview is given of four methods to perform factor score regression (FSR), namely regression FSR, Bartlett FSR, the bias avoiding method of Skrondal and Laake, and the bias correcting method of Croon. The bias correcting method is extended to include a reliable standard error. The four methods are compared with each other and…

  15. Methods to control for unmeasured confounding in pharmacoepidemiology: an overview.

    PubMed

    Uddin, Md Jamal; Groenwold, Rolf H H; Ali, Mohammed Sanni; de Boer, Anthonius; Roes, Kit C B; Chowdhury, Muhammad A B; Klungel, Olaf H

    2016-06-01

    Background Unmeasured confounding is one of the principal problems in pharmacoepidemiologic studies. Several methods have been proposed to detect or control for unmeasured confounding either at the study design phase or the data analysis phase. Aim of the Review To provide an overview of commonly used methods to detect or control for unmeasured confounding and to provide recommendations for proper application in pharmacoepidemiology. Methods/Results Methods to control for unmeasured confounding in the design phase of a study are case only designs (e.g., case-crossover, case-time control, self-controlled case series) and the prior event rate ratio adjustment method. Methods that can be applied in the data analysis phase include, negative control method, perturbation variable method, instrumental variable methods, sensitivity analysis, and ecological analysis. A separate group of methods are those in which additional information on confounders is collected from a substudy. The latter group includes external adjustment, propensity score calibration, two-stage sampling, and multiple imputation. Conclusion As the performance and application of the methods to handle unmeasured confounding may differ across studies and across databases, we stress the importance of using both statistical evidence and substantial clinical knowledge for interpretation of the study results.

  16. Method and tool to reverse the charges in anti-reflection films used for solar cell applications

    DOEpatents

    Sharma, Vivek; Tracy, Clarence

    2017-01-31

    A method is provided for making a solar cell. The method includes providing a stack including a substrate, a barrier layer disposed on the substrate, and an anti-reflective layer disposed on the barrier layer, where the anti-reflective layer has charge centers. The method also includes generating a corona with a charging tool and contacting the anti-reflective layer with the corona thereby injecting charge into at least some of the charge centers in the anti-reflective layer. Ultra-violet illumination and temperature-based annealing may be used to modify the charge of the anti-reflective layer.

  17. Method and apparatus for wavefront sensing

    DOEpatents

    Bahk, Seung-Whan

    2016-08-23

    A method of measuring characteristics of a wavefront of an incident beam includes obtaining an interferogram associated with the incident beam passing through a transmission mask and Fourier transforming the interferogram to provide a frequency domain interferogram. The method also includes selecting a subset of harmonics from the frequency domain interferogram, individually inverse Fourier transforming each of the subset of harmonics to provide a set of spatial domain harmonics, and extracting a phase profile from each of the set of spatial domain harmonics. The method further includes removing phase discontinuities in the phase profile, rotating the phase profile, and reconstructing a phase front of the wavefront of the incident beam.

  18. Silicon release coating, method of making same, and method of using same

    DOEpatents

    Jonczyk, Ralf [Wilmington, DE

    2011-11-22

    A method of making a release coating includes the following steps: forming a mixture that includes (a) solid components comprising (i) 20-99% silicon by weight and (ii) 1-80% silicon nitride by weight and (b) a solvent; applying the mixture to an inner portion of a crucible or graphite board adapted to form an ingot or wafer comprising silicon; and annealing the mixture in a nitrogen atmosphere at a temperature ranging from 1000 to 2000.degree. C. The invention may also relate to release coatings and methods of making a silicon ingot or wafer including the use of a release coating.

  19. Implementation of Leak Test Methods for the International Space Station (ISS) Elements, Systems and Components

    NASA Technical Reports Server (NTRS)

    Underwood, Steve; Lvovsky, Oleg

    2007-01-01

    The International Space Station (ISS has Qualification and Acceptance Environmental Test Requirements document, SSP 41172 that includes many environmental tests such as Thermal vacuum & Cycling, Depress/Repress, Sinusoidal, Random, and Acoustic Vibration, Pyro Shock, Acceleration, Humidity, Pressure, Electromatic Interference (EMI)/Electromagnetic Compatibility (EMCO), etc. This document also includes (13) leak test methods for Pressure Integrity Verification of the ISS Elements, Systems, and Components. These leak test methods are well known, however, the test procedure for specific leak test method shall be written and implemented paying attention to the important procedural steps/details that, if omitted or deviated, could impact the quality of the final product and affect the crew safety. Such procedural steps/details for different methods include, but not limited to: - Sequence of testing, f or example, pressurization and submersion steps for Method I (Immersion); - Stabilization of the mass spectrometer leak detector outputs fo r Method II (vacuum Chamber or Bell jar); - Proper data processing an d taking a conservative approach while making predictions for on-orbit leakage rate for Method III(Pressure Change); - Proper Calibration o f the mass spectrometer leak detector for all the tracer gas (mostly Helium) Methods such as Method V (Detector Probe), Method VI (Hood), Method VII (Tracer Probe), Method VIII(Accumulation); - Usage of visibl ility aides for Method I (Immersion), Method IV (Chemical Indicator), Method XII (Foam/Liquid Application), and Method XIII (Hydrostatic/Visual Inspection); While some methods could be used for the total leaka ge (either internal-to-external or external-to-internal) rate requirement verification (Vacuum Chamber, Pressure Decay, Hood, Accumulation), other methods shall be used only as a pass/fail test for individual joints (e.g., welds, fittings, and plugs) or for troubleshooting purposes (Chemical Indicator, Detector Probe, Tracer Probe, Local Vacuum Chamber, Foam/Liquid Application, and Hydrostatic/Visual Inspection). Any isolation of SSP 41172 requirements have led to either retesting of hardware or accepting a risk associated with the potential system or component pressure integrity problem during flight.

  20. An analysis of shock coalescence including three-dimensional effects with application to sonic boom extrapolation. Ph.D. Thesis - George Washington Univ.

    NASA Technical Reports Server (NTRS)

    Darden, C. M.

    1984-01-01

    A method for analyzing shock coalescence which includes three dimensional effects was developed. The method is based on an extension of the axisymmetric solution, with asymmetric effects introduced through an additional set of governing equations, derived by taking the second circumferential derivative of the standard shock equations in the plane of symmetry. The coalescence method is consistent with and has been combined with a nonlinear sonic boom extrapolation program which is based on the method of characteristics. The extrapolation program, is able to extrapolate pressure signatures which include embedded shocks from an initial data line in the plane of symmetry at approximately one body length from the axis of the aircraft to the ground. The axisymmetric shock coalescence solution, the asymmetric shock coalescence solution, the method of incorporating these solutions into the extrapolation program, and the methods used to determine spatial derivatives needed in the coalescence solution are described. Results of the method are shown for a body of revolution at a small, positive angle of attack.

  1. Wafer characteristics via reflectometry

    DOEpatents

    Sopori, Bhushan L.

    2010-10-19

    Various exemplary methods (800, 900, 1000, 1100) are directed to determining wafer thickness and/or wafer surface characteristics. An exemplary method (900) includes measuring reflectance of a wafer and comparing the measured reflectance to a calculated reflectance or a reflectance stored in a database. Another exemplary method (800) includes positioning a wafer on a reflecting support to extend a reflectance range. An exemplary device (200) has an input (210), analysis modules (222-228) and optionally a database (230). Various exemplary reflectometer chambers (1300, 1400) include radiation sources positioned at a first altitudinal angle (1308, 1408) and at a second altitudinal angle (1312, 1412). An exemplary method includes selecting radiation sources positioned at various altitudinal angles. An exemplary element (1650, 1850) includes a first aperture (1654, 1854) and a second aperture (1658, 1858) that can transmit reflected radiation to a fiber and an imager, respectfully.

  2. Modeling Interactions Among Turbulence, Gas-Phase Chemistry, Soot and Radiation Using Transported PDF Methods

    NASA Astrophysics Data System (ADS)

    Haworth, Daniel

    2013-11-01

    The importance of explicitly accounting for the effects of unresolved turbulent fluctuations in Reynolds-averaged and large-eddy simulations of chemically reacting turbulent flows is increasingly recognized. Transported probability density function (PDF) methods have emerged as one of the most promising modeling approaches for this purpose. In particular, PDF methods provide an elegant and effective resolution to the closure problems that arise from averaging or filtering terms that correspond to nonlinear point processes, including chemical reaction source terms and radiative emission. PDF methods traditionally have been associated with studies of turbulence-chemistry interactions in laboratory-scale, atmospheric-pressure, nonluminous, statistically stationary nonpremixed turbulent flames; and Lagrangian particle-based Monte Carlo numerical algorithms have been the predominant method for solving modeled PDF transport equations. Recent advances and trends in PDF methods are reviewed and discussed. These include advances in particle-based algorithms, alternatives to particle-based algorithms (e.g., Eulerian field methods), treatment of combustion regimes beyond low-to-moderate-Damköhler-number nonpremixed systems (e.g., premixed flamelets), extensions to include radiation heat transfer and multiphase systems (e.g., soot and fuel sprays), and the use of PDF methods as the basis for subfilter-scale modeling in large-eddy simulation. Examples are provided that illustrate the utility and effectiveness of PDF methods for physics discovery and for applications to practical combustion systems. These include comparisons of results obtained using the PDF method with those from models that neglect unresolved turbulent fluctuations in composition and temperature in the averaged or filtered chemical source terms and/or the radiation heat transfer source terms. In this way, the effects of turbulence-chemistry-radiation interactions can be isolated and quantified.

  3. Methods for describing the electromagnetic properties of silver and gold nanoparticles.

    PubMed

    Zhao, Jing; Pinchuk, Anatoliy O; McMahon, Jeffrey M; Li, Shuzhou; Ausman, Logan K; Atkinson, Ariel L; Schatz, George C

    2008-12-01

    This Account provides an overview of the methods that are currently being used to study the electromagnetics of silver and gold nanoparticles, with an emphasis on the determination of extinction and surface-enhanced Raman scattering (SERS) spectra. These methods have proven to be immensely useful in recent years for interpreting a wide range of nanoscience experiments and providing the capability to describe optical properties of particles up to several hundred nanometers in dimension, including arbitrary particle structures and complex dielectric environments (adsorbed layers of molecules, nearby metal films, and other particles). While some of the methods date back to Mie's celebrated work a century ago, others are still at the forefront of algorithm development in computational electromagnetics. This Account gives a qualitative description of the physical and mathematical basis behind the most commonly used methods, including both analytical and numerical methods, as well as representative results of applications that are relevant to current experiments. The analytical methods that we discuss are either derived from Mie theory for spheres or from the quasistatic (Gans) model as applied to spheres and spheroids. In this discussion, we describe the use of Mie theory to determine electromagnetic contributions to SERS enhancements that include for retarded dipole emission effects, and the use of the quasistatic approximation for spheroidal particles interacting with dye adsorbate layers. The numerical methods include the discrete dipole approximation (DDA), the finite difference time domain (FDTD) method, and the finite element method (FEM) based on Whitney forms. We discuss applications such as using DDA to describe the interaction of two gold disks to define electromagnetic hot spots, FDTD for light interacting with metal wires that go from particle-like plasmonic response to the film-like transmission as wire dimension is varied, and FEM studies of electromagnetic fields near cubic particles.

  4. Diagnostics of Tree Diseases Caused by Phytophthora austrocedri Species.

    PubMed

    Mulholland, Vincent; Elliot, Matthew; Green, Sarah

    2015-01-01

    We present methods for the detection and quantification of four Phytophthora species which are pathogenic on trees; Phytophthora ramorum, Phytophthora kernoviae, Phytophthora lateralis, and Phytophthora austrocedri. Nucleic acid extraction methods are presented for phloem tissue from trees, soil, and pure cultures on agar plates. Real-time PCR methods are presented and include primer and probe sets for each species, general advice on real-time PCR setup and data analysis. A method for sequence-based identification, useful for pure cultures, is also included.

  5. SRC-I demonstration plant analytical laboratory methods manual. Final technical report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klusaritz, M.L.; Tewari, K.C.; Tiedge, W.F.

    1983-03-01

    This manual is a compilation of analytical procedures required for operation of a Solvent-Refined Coal (SRC-I) demonstration or commercial plant. Each method reproduced in full includes a detailed procedure, a list of equipment and reagents, safety precautions, and, where possible, a precision statement. Procedures for the laboratory's environmental and industrial hygiene modules are not included. Required American Society for Testing and Materials (ASTM) methods are cited, and ICRC's suggested modifications to these methods for handling coal-derived products are provided.

  6. Catalytic reforming methods

    DOEpatents

    Tadd, Andrew R; Schwank, Johannes

    2013-05-14

    A catalytic reforming method is disclosed herein. The method includes sequentially supplying a plurality of feedstocks of variable compositions to a reformer. The method further includes adding a respective predetermined co-reactant to each of the plurality of feedstocks to obtain a substantially constant output from the reformer for the plurality of feedstocks. The respective predetermined co-reactant is based on a C/H/O atomic composition for a respective one of the plurality of feedstocks and a predetermined C/H/O atomic composition for the substantially constant output.

  7. Method to fabricate high performance tubular solid oxide fuel cells

    DOEpatents

    Chen, Fanglin; Yang, Chenghao; Jin, Chao

    2013-06-18

    In accordance with the present disclosure, a method for fabricating a solid oxide fuel cell is described. The method includes forming an asymmetric porous ceramic tube by using a phase inversion process. The method further includes forming an asymmetric porous ceramic layer on a surface of the asymmetric porous ceramic tube by using a phase inversion process. The tube is co-sintered to form a structure having a first porous layer, a second porous layer, and a dense layer positioned therebetween.

  8. Monte Carlo approaches to sampling forested tracts with lines or points

    Treesearch

    Harry T. Valentine; Jeffrey H. Gove; Timothy G. Gregoire

    2001-01-01

    Several line- and point-based sampling methods can be employed to estimate the aggregate dimensions of trees standing on a forested tract or pieces of coarse woody debris lying on the forest floor. Line methods include line intersect sampling, horizontal line sampling, and transect relascope sampling; point methods include variable- and fixed-radius plot sampling, and...

  9. Spectral multigrid methods for elliptic equations 2

    NASA Technical Reports Server (NTRS)

    Zang, T. A.; Wong, Y. S.; Hussaini, M. Y.

    1983-01-01

    A detailed description of spectral multigrid methods is provided. This includes the interpolation and coarse-grid operators for both periodic and Dirichlet problems. The spectral methods for periodic problems use Fourier series and those for Dirichlet problems are based upon Chebyshev polynomials. An improved preconditioning for Dirichlet problems is given. Numerical examples and practical advice are included.

  10. Method of forming emitters for a back-contact solar cell

    DOEpatents

    Li, Bo; Cousins, Peter J.; Smith, David D.

    2015-09-29

    Methods of forming emitters for back-contact solar cells are described. In one embodiment, a method includes forming a first solid-state dopant source above a substrate. The first solid-state dopant source includes a plurality of regions separated by gaps. Regions of a second solid-state dopant source are formed above the substrate by printing.

  11. Method of forming emitters for a back-contact solar cell

    DOEpatents

    Li, Bo; Cousins, Peter J; Smith, David D

    2014-12-16

    Methods of forming emitters for back-contact solar cells are described. In one embodiment, a method includes forming a first solid-state dopant source above a substrate. The first solid-state dopant source includes a plurality of regions separated by gaps. Regions of a second solid-state dopant source are formed above the substrate by printing.

  12. Method or forming emitters for a back-contact solar cell

    DOEpatents

    Li, Bo; Cousins, Peter J.; Smith, David D.

    2014-08-12

    Methods of forming emitters for back-contact solar cells are described. In one embodiment, a method includes forming a first solid-state dopant source above a substrate. The first solid-state dopant source includes a plurality of regions separated by gaps. Regions of a second solid-state dopant source are formed above the substrate by printing.

  13. Ni modified ceramic anodes for direct-methane solid oxide fuel cells

    DOEpatents

    Xiao, Guoliang; Chen, Fanglin

    2016-01-19

    In accordance with certain embodiments of the present disclosure, a method for fabricating a solid oxide fuel cell is described. The method includes synthesizing a composition having a perovskite present therein. The method further includes applying the composition on an electrolyte support to form an anode and applying Ni to the composition on the anode.

  14. Experimental Methods for Protein Interaction Identification and Characterization

    NASA Astrophysics Data System (ADS)

    Uetz, Peter; Titz, Björn; Cagney, Gerard

    There are dozens of methods for the detection of protein-protein interactions but they fall into a few broad categories. Fragment complementation assays such as the yeast two-hybrid (Y2H) system are based on split proteins that are functionally reconstituted by fusions of interacting proteins. Biophysical methods include structure determination and mass spectrometric (MS) identification of proteins in complexes. Biochemical methods include methods such as far western blotting and peptide arrays. Only the Y2H and protein complex purification combined with MS have been used on a larger scale. Due to the lack of data it is still difficult to compare these methods with respect to their efficiency and error rates. Current data does not favor any particular method and thus multiple experimental approaches are necessary to maximally cover the interactome of any target cell or organism.

  15. Review on methods for determination of metallothioneins in aquatic organisms.

    PubMed

    Shariati, Fatemeh; Shariati, Shahab

    2011-06-01

    One aspect of environmental degradation in coastal areas is pollution from toxic metals, which are persistent and are bioaccumulated by marine organisms, with serious public health implications. A conventional monitoring system of environmental metal pollution includes measuring the level of selected metals in the whole organism or in respective organs. However, measuring only the metal content in particular organs does not give information about its effect at the subcellular level. Therefore, the evaluation of biochemical biomarker metallothionein may be useful in assessing metal exposure and the prediction of potential detrimental effects induced by metal contamination. There are some methods for the determination of metallothioneins including spectrophotometric method, electrochemical methods, chromatography, saturation-based methods, immunological methods, electrophoresis, and RT-PCR. In this paper, different methods are discussed briefly and the comparison between them will be presented.

  16. Set of new draft methods for the analysis of organic disinfection by-products, including 551 and 552. Draft report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1993-01-01

    The set of documents discusses the new draft methods (EPA method 551, EPA method 552) for the analysis of disinfection byproducts contained in drinking water. The methods use the techniques of liquid/liquid extraction and gas chromatography with electron capture detection.

  17. Method for using global optimization to the estimation of surface-consistent residual statics

    DOEpatents

    Reister, David B.; Barhen, Jacob; Oblow, Edward M.

    2001-01-01

    An efficient method for generating residual statics corrections to compensate for surface-consistent static time shifts in stacked seismic traces. The method includes a step of framing the residual static corrections as a global optimization problem in a parameter space. The method also includes decoupling the global optimization problem involving all seismic traces into several one-dimensional problems. The method further utilizes a Stochastic Pijavskij Tunneling search to eliminate regions in the parameter space where a global minimum is unlikely to exist so that the global minimum may be quickly discovered. The method finds the residual statics corrections by maximizing the total stack power. The stack power is a measure of seismic energy transferred from energy sources to receivers.

  18. Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; determination of inorganic and organic constituents in water and fluvial sediments

    USGS Publications Warehouse

    Fishman, M. J.

    1993-01-01

    Methods to be used to analyze samples of water, suspended sediment and bottom material for their content of inorganic and organic constituents are presented. Technology continually changes, and so this laboratory manual includes new and revised methods for determining the concentration of dissolved constituents in water, whole water recoverable constituents in water-suspended sediment samples, and recoverable concentration of constit- uents in bottom material. For each method, the general topics covered are the application, the principle of the method, interferences, the apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data. Included in this manual are 30 methods.

  19. Determination of the transmission coefficients for quantum structures using FDTD method.

    PubMed

    Peng, Yangyang; Wang, Xiaoying; Sui, Wenquan

    2011-12-01

    The purpose of this work is to develop a simple method to incorporate quantum effect in traditional finite-difference time-domain (FDTD) simulators. Witch could make it possible to co-simulate systems include quantum structures and traditional components. In this paper, tunneling transmission coefficient is calculated by solving time-domain Schrödinger equation with a developed FDTD technique, called FDTD-S method. To validate the feasibility of the method, a simple resonant tunneling diode (RTD) structure model has been simulated using the proposed method. The good agreement between the numerical and analytical results proves its accuracy. The effectness and accuracy of this approach makes it a potential method for analysis and design of hybrid systems includes quantum structures and traditional components.

  20. Flexible methods for segmentation evaluation: results from CT-based luggage screening.

    PubMed

    Karimi, Seemeen; Jiang, Xiaoqian; Cosman, Pamela; Martz, Harry

    2014-01-01

    Imaging systems used in aviation security include segmentation algorithms in an automatic threat recognition pipeline. The segmentation algorithms evolve in response to emerging threats and changing performance requirements. Analysis of segmentation algorithms' behavior, including the nature of errors and feature recovery, facilitates their development. However, evaluation methods from the literature provide limited characterization of the segmentation algorithms. To develop segmentation evaluation methods that measure systematic errors such as oversegmentation and undersegmentation, outliers, and overall errors. The methods must measure feature recovery and allow us to prioritize segments. We developed two complementary evaluation methods using statistical techniques and information theory. We also created a semi-automatic method to define ground truth from 3D images. We applied our methods to evaluate five segmentation algorithms developed for CT luggage screening. We validated our methods with synthetic problems and an observer evaluation. Both methods selected the same best segmentation algorithm. Human evaluation confirmed the findings. The measurement of systematic errors and prioritization helped in understanding the behavior of each segmentation algorithm. Our evaluation methods allow us to measure and explain the accuracy of segmentation algorithms.

  1. Hollow fiber membranes and methods for forming same

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhandari, Dhaval Ajit; McCloskey, Patrick Joseph; Howson, Paul Edward

    2016-03-22

    The invention provides improved hollow fiber membranes having at least two layers, and methods for forming the same. The methods include co-extruding a first composition, a second composition, and a third composition to form a dual layer hollow fiber membrane. The first composition includes a glassy polymer; the second composition includes a polysiloxane; and the third composition includes a bore fluid. The dual layer hollow fiber membranes include a first layer and a second layer, the first layer being a porous layer which includes the glassy polymer of the first composition, and the second layer being a polysiloxane layer whichmore » includes the polysiloxane of the second composition.« less

  2. Infra-red signature neutron detector

    DOEpatents

    Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN

    2009-10-13

    A method of detecting an activator, the method including impinging with an activator a receptor material that includes a photoluminescent material that generates infrared radiation and generation a by-product of a nuclear reaction due to the activator impinging the receptor material. The method further includes generating light from the by-product via the Cherenkov effect, wherein the light activates the photoluminescent material so as to generate the infrared radiation. Identifying a characteristic of the activator based on the infrared radiation.

  3. The Application of Deterministic Spectral Domain Method to the Analysis of Planar Circuit Discontinuities on Open Substrates

    DTIC Science & Technology

    1990-08-01

    the spectral domain is extended to include the effects of two-dimensional, two-component current flow in planar transmission line discontinuities 6n...PROFESSOR: Tatsuo Itoh A deterministic formulation of the method of moments carried out in the spectral domain is extended to include the effects of...two-dimensional, two- component current flow in planar transmission line discontinuities on open substrates. The method includes the effects of space

  4. Determining postural stability

    NASA Technical Reports Server (NTRS)

    Forth, Katharine E. (Inventor); Paloski, William H. (Inventor); Lieberman, Erez (Inventor)

    2011-01-01

    A method for determining postural stability of a person can include acquiring a plurality of pressure data points over a period of time from at least one pressure sensor. The method can also include the step of identifying a postural state for each pressure data point to generate a plurality of postural states. The method can include the step of determining a postural state of the person at a point in time based on at least the plurality of postural states.

  5. High-Sensitivity Spectrophotometry.

    ERIC Educational Resources Information Center

    Harris, T. D.

    1982-01-01

    Selected high-sensitivity spectrophotometric methods are examined, and comparisons are made of their relative strengths and weaknesses and the circumstances for which each can best be applied. Methods include long path cells, noise reduction, laser intracavity absorption, thermocouple calorimetry, photoacoustic methods, and thermo-optical methods.…

  6. Method for analyzing the chemical composition of liquid effluent from a direct contact condenser

    DOEpatents

    Bharathan, Desikan; Parent, Yves; Hassani, A. Vahab

    2001-01-01

    A computational modeling method for predicting the chemical, physical, and thermodynamic performance of a condenser using calculations based on equations of physics for heat, momentum and mass transfer and equations of equilibrium thermodynamics to determine steady state profiles of parameters throughout the condenser. The method includes providing a set of input values relating to a condenser including liquid loading, vapor loading, and geometric characteristics of the contact medium in the condenser. The geometric and packing characteristics of the contact medium include the dimensions and orientation of a channel in the contact medium. The method further includes simulating performance of the condenser using the set of input values to determine a related set of output values such as outlet liquid temperature, outlet flow rates, pressures, and the concentration(s) of one or more dissolved noncondensable gas species in the outlet liquid. The method may also include iteratively performing the above computation steps using a plurality of sets of input values and then determining whether each of the resulting output values and performance profiles satisfies acceptance criteria.

  7. VIDAS Listeria species Xpress (LSX).

    PubMed

    Johnson, Ronald; Mills, John

    2013-01-01

    The AOAC GovVal study compared the VIDAS Listeria species Xpress (LSX) to the Health Products and Food Branch MFHPB-30 reference method for detection of Listeria on stainless steel. The LSX method utilizes a novel and proprietary enrichment media, Listeria Xpress broth, enabling detection of Listeria species in environmental samples with the automated VIDAS in a minimum of 26 h. The LSX method also includes the use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LSX presumptive results. In previous AOAC validation studies comparing VIDAS LSX to the U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA-BAM) and the U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) reference methods, the LSX method was approved as AOAC Official Method 2010.02 for the detection of Listeria species in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry, and as AOAC Performance Tested Method 100501 in a variety of foods and on environmental surfaces. The GovVal comparative study included 20 replicate test portions each at two contamination levels for stainless steel where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. In the stainless steel artificially contaminated surface study, there were 25 confirmed positives by the VIDAS LSX assay and 22 confirmed positives by the standard culture methods. Chi-square analysis indicated no statistical differences between the VIDAS LSX method and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LSX results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data in this study demonstrate that the VIDAS LSX method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of Listeria species on stainless steel.

  8. Multiple and mixed methods in formative evaluation: Is more better? Reflections from a South African study.

    PubMed

    Odendaal, Willem; Atkins, Salla; Lewin, Simon

    2016-12-15

    Formative programme evaluations assess intervention implementation processes, and are seen widely as a way of unlocking the 'black box' of any programme in order to explore and understand why a programme functions as it does. However, few critical assessments of the methods used in such evaluations are available, and there are especially few that reflect on how well the evaluation achieved its objectives. This paper describes a formative evaluation of a community-based lay health worker programme for TB and HIV/AIDS clients across three low-income communities in South Africa. It assesses each of the methods used in relation to the evaluation objectives, and offers suggestions on ways of optimising the use of multiple, mixed-methods within formative evaluations of complex health system interventions. The evaluation's qualitative methods comprised interviews, focus groups, observations and diary keeping. Quantitative methods included a time-and-motion study of the lay health workers' scope of practice and a client survey. The authors conceptualised and conducted the evaluation, and through iterative discussions, assessed the methods used and their results. Overall, the evaluation highlighted programme issues and insights beyond the reach of traditional single methods evaluations. The strengths of the multiple, mixed-methods in this evaluation included a detailed description and nuanced understanding of the programme and its implementation, and triangulation of the perspectives and experiences of clients, lay health workers, and programme managers. However, the use of multiple methods needs to be carefully planned and implemented as this approach can overstretch the logistic and analytic resources of an evaluation. For complex interventions, formative evaluation designs including multiple qualitative and quantitative methods hold distinct advantages over single method evaluations. However, their value is not in the number of methods used, but in how each method matches the evaluation questions and the scientific integrity with which the methods are selected and implemented.

  9. Methods for batch fabrication of cold cathode vacuum switch tubes

    DOEpatents

    Walker, Charles A [Albuquerque, NM; Trowbridge, Frank R [Albuquerque, NM

    2011-05-10

    Methods are disclosed for batch fabrication of vacuum switch tubes that reduce manufacturing costs and improve tube to tube uniformity. The disclosed methods comprise creating a stacked assembly of layers containing a plurality of adjacently spaced switch tube sub-assemblies aligned and registered through common layers. The layers include trigger electrode layer, cathode layer including a metallic support/contact with graphite cathode inserts, trigger probe sub-assembly layer, ceramic (e.g. tube body) insulator layer, and metallic anode sub-assembly layer. Braze alloy layers are incorporated into the stacked assembly of layers, and can include active metal braze alloys or direct braze alloys, to eliminate costs associated with traditional metallization of the ceramic insulator layers. The entire stacked assembly is then heated to braze/join/bond the stack-up into a cohesive body, after which individual switch tubes are singulated by methods such as sawing. The inventive methods provide for simultaneously fabricating a plurality of devices as opposed to traditional methods that rely on skilled craftsman to essentially hand build individual devices.

  10. Applicability of linearized-theory attached-flow methods to design and analysis of flap systems at low speeds for thin swept wings with sharp leading edges

    NASA Technical Reports Server (NTRS)

    Carlson, Harry W.; Darden, Christine M.

    1987-01-01

    Low-speed experimental force and data on a series of thin swept wings with sharp leading edges and leading and trailing-edge flaps are compared with predictions made using a linearized-theory method which includes estimates of vortex forces. These comparisons were made to assess the effectiveness of linearized-theory methods for use in the design and analysis of flap systems in subsonic flow. Results demonstrate that linearized-theory, attached-flow methods (with approximate representation of vortex forces) can form the basis of a rational system for flap design and analysis. Even attached-flow methods that do not take vortex forces into account can be used for the selection of optimized flap-system geometry, but design-point performance levels tend to be underestimated unless vortex forces are included. Illustrative examples of the use of these methods in the design of efficient low-speed flap systems are included.

  11. A class of high resolution explicit and implicit shock-capturing methods

    NASA Technical Reports Server (NTRS)

    Yee, H. C.

    1989-01-01

    An attempt is made to give a unified and generalized formulation of a class of high resolution, explicit and implicit shock capturing methods, and to illustrate their versatility in various steady and unsteady complex shock wave computations. Included is a systematic review of the basic design principle of the various related numerical methods. Special emphasis is on the construction of the basis nonlinear, spatially second and third order schemes for nonlinear scalar hyperbolic conservation laws and the methods of extending these nonlinear scalar schemes to nonlinear systems via the approximate Riemann solvers and the flux vector splitting approaches. Generalization of these methods to efficiently include equilibrium real gases and large systems of nonequilibrium flows are discussed. Some issues concerning the applicability of these methods that were designed for homogeneous hyperbolic conservation laws to problems containing stiff source terms and shock waves are also included. The performance of some of these schemes is illustrated by numerical examples for 1-, 2- and 3-dimensional gas dynamics problems.

  12. Methods of forming semiconductor devices and devices formed using such methods

    DOEpatents

    Fox, Robert V; Rodriguez, Rene G; Pak, Joshua

    2013-05-21

    Single source precursors are subjected to carbon dioxide to form particles of material. The carbon dioxide may be in a supercritical state. Single source precursors also may be subjected to supercritical fluids other than supercritical carbon dioxide to form particles of material. The methods may be used to form nanoparticles. In some embodiments, the methods are used to form chalcopyrite materials. Devices such as, for example, semiconductor devices may be fabricated that include such particles. Methods of forming semiconductor devices include subjecting single source precursors to carbon dioxide to form particles of semiconductor material, and establishing electrical contact between the particles and an electrode.

  13. New Finger Biometric Method Using Near Infrared Imaging

    PubMed Central

    Lee, Eui Chul; Jung, Hyunwoo; Kim, Daeyeoul

    2011-01-01

    In this paper, we propose a new finger biometric method. Infrared finger images are first captured, and then feature extraction is performed using a modified Gaussian high-pass filter through binarization, local binary pattern (LBP), and local derivative pattern (LDP) methods. Infrared finger images include the multimodal features of finger veins and finger geometries. Instead of extracting each feature using different methods, the modified Gaussian high-pass filter is fully convolved. Therefore, the extracted binary patterns of finger images include the multimodal features of veins and finger geometries. Experimental results show that the proposed method has an error rate of 0.13%. PMID:22163741

  14. Method of treating contaminated HEPA filter media in pulp process

    DOEpatents

    Hu, Jian S.; Argyle, Mark D.; Demmer, Ricky L.; Mondok, Emilio P.

    2003-07-29

    A method for reducing contamination of HEPA filters with radioactive and/or hazardous materials is described. The method includes pre-processing of the filter for removing loose particles. Next, the filter medium is removed from the housing, and the housing is decontaminated. Finally, the filter medium is processed as pulp for removing contaminated particles by physical and/or chemical methods, including gravity, flotation, and dissolution of the particles. The decontaminated filter medium is then disposed of as non-RCRA waste; the particles are collected, stabilized, and disposed of according to well known methods of handling such materials; and the liquid medium in which the pulp was processed is recycled.

  15. Some efficient methods for obtaining infinite series solutions of n-th order linear ordinary differential equations

    NASA Technical Reports Server (NTRS)

    Allen, G.

    1972-01-01

    The use of the theta-operator method and generalized hypergeometric functions in obtaining solutions to nth-order linear ordinary differential equations is explained. For completeness, the analysis of the differential equation to determine whether the point of expansion is an ordinary point or a regular singular point is included. The superiority of the two methods shown over the standard method is demonstrated by using all three of the methods to work out several examples. Also included is a compendium of formulae and properties of the theta operator and generalized hypergeometric functions which is complete enough to make the report self-contained.

  16. Trade study: Liquid hydrogen transportation - Kennedy Space Center. [cost and operational effectivenss of shipping methods.

    NASA Technical Reports Server (NTRS)

    Gray, D. J.

    1978-01-01

    Cryogenic transportation methods for providing liquid hydrogen requirements are examined in support of shuttle transportation system launch operations at Kennedy Space Center, Florida, during the time frames 1982-1991 in terms of cost and operational effectiveness. Transportation methods considered included sixteen different options employing mobile semi-trailer tankers, railcars, barges and combinations of each method. The study concludes that the most effective method of delivering liquid hydrogen from the vendor production facility in New Orleans to Kennedy Space Center includes maximum utilization of existing mobile tankers and railcars supplemented by maximum capacity mobile tankers procured incrementally in accordance with shuttle launch rates actually achieved.

  17. An assessment of unstructured grid technology for timely CFD analysis

    NASA Technical Reports Server (NTRS)

    Kinard, Tom A.; Schabowski, Deanne M.

    1995-01-01

    An assessment of two unstructured methods is presented in this paper. A tetrahedral unstructured method USM3D, developed at NASA Langley Research Center is compared to a Cartesian unstructured method, SPLITFLOW, developed at Lockheed Fort Worth Company. USM3D is an upwind finite volume solver that accepts grids generated primarily from the Vgrid grid generator. SPLITFLOW combines an unstructured grid generator with an implicit flow solver in one package. Both methods are exercised on three test cases, a wing, and a wing body, and a fully expanded nozzle. The results for the first two runs are included here and compared to the structured grid method TEAM and to available test data. On each test case, the set up procedure are described, including any difficulties that were encountered. Detailed descriptions of the solvers are not included in this paper.

  18. Costs and Efficiency of Online and Offline Recruitment Methods: A Web-Based Cohort Study.

    PubMed

    Christensen, Tina; Riis, Anders H; Hatch, Elizabeth E; Wise, Lauren A; Nielsen, Marie G; Rothman, Kenneth J; Toft Sørensen, Henrik; Mikkelsen, Ellen M

    2017-03-01

    The Internet is widely used to conduct research studies on health issues. Many different methods are used to recruit participants for such studies, but little is known about how various recruitment methods compare in terms of efficiency and costs. The aim of our study was to compare online and offline recruitment methods for Internet-based studies in terms of efficiency (number of recruited participants) and costs per participant. We employed several online and offline recruitment methods to enroll 18- to 45-year-old women in an Internet-based Danish prospective cohort study on fertility. Offline methods included press releases, posters, and flyers. Online methods comprised advertisements placed on five different websites, including Facebook and Netdoktor.dk. We defined seven categories of mutually exclusive recruitment methods and used electronic tracking via unique Uniform Resource Locator (URL) and self-reported data to identify the recruitment method for each participant. For each method, we calculated the average cost per participant and efficiency, that is, the total number of recruited participants. We recruited 8252 study participants. Of these, 534 were excluded as they could not be assigned to a specific recruitment method. The final study population included 7724 participants, of whom 803 (10.4%) were recruited by offline methods, 3985 (51.6%) by online methods, 2382 (30.8%) by online methods not initiated by us, and 554 (7.2%) by other methods. Overall, the average cost per participant was €6.22 for online methods initiated by us versus €9.06 for offline methods. Costs per participant ranged from €2.74 to €105.53 for online methods and from €0 to €67.50 for offline methods. Lowest average costs per participant were for those recruited from Netdoktor.dk (€2.99) and from Facebook (€3.44). In our Internet-based cohort study, online recruitment methods were superior to offline methods in terms of efficiency (total number of participants enrolled). The average cost per recruited participant was also lower for online than for offline methods, although costs varied greatly among both online and offline recruitment methods. We observed a decrease in the efficiency of some online recruitment methods over time, suggesting that it may be optimal to adopt multiple online methods. ©Tina Christensen, Anders H Riis, Elizabeth E Hatch, Lauren A Wise, Marie G Nielsen, Kenneth J Rothman, Henrik Toft Sørensen, Ellen M Mikkelsen. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 01.03.2017.

  19. Methods for the additive manufacturing of semiconductor and crystal materials

    DOEpatents

    Stowe, Ashley C.; Speight, Douglas

    2016-11-22

    A method for the additive manufacturing of inorganic crystalline materials, including: physically combining a plurality of starting materials that are used to form an inorganic crystalline compound to be used as one or more of a semiconductor, scintillator, laser crystal, and optical filter; heating or melting successive regions of the combined starting materials using a directed heat source having a predetermined energy characteristic, thereby facilitating the reaction of the combined starting materials; and allowing each region of the combined starting materials to cool in a controlled manner, such that the desired inorganic crystalline compound results. The method also includes, prior to heating or melting the successive regions of the combined starting materials using the directed heat source, heating the combined starting materials to facilitate initial reaction of the combined starting materials. The method further includes translating the combined starting materials and/or the directed heat source between successive locations. The method still further includes controlling the mechanical, electrical, photonic, and/or optical properties of the inorganic crystalline compound.

  20. Method for forming silicon on a glass substrate

    DOEpatents

    McCarthy, Anthony M.

    1995-01-01

    A method by which single-crystal silicon microelectronics may be fabricated on glass substrates at unconventionally low temperatures. This is achieved by fabricating a thin film of silicon on glass and subsequently forming the doped components by a short wavelength (excimer) laser doping procedure and conventional patterning techniques. This method may include introducing a heavily boron doped etch stop layer on a silicon wafer using an excimer laser, which permits good control of the etch stop layer removal process. This method additionally includes dramatically reducing the remaining surface roughness of the silicon thin films after etching in the fabrication of silicon on insulator wafers by scanning an excimer laser across the surface of the silicon thin film causing surface melting, whereby the surface tension of the melt causes smoothing of the surface during recrystallization. Applications for this method include those requiring a transparent or insulating substrate, such as display manufacturing. Other applications include sensors, actuators, optoelectronics, radiation hard and high temperature electronics.

  1. Method for forming silicon on a glass substrate

    DOEpatents

    McCarthy, A.M.

    1995-03-07

    A method by which single-crystal silicon microelectronics may be fabricated on glass substrates at unconventionally low temperatures. This is achieved by fabricating a thin film of silicon on glass and subsequently forming the doped components by a short wavelength (excimer) laser doping procedure and conventional patterning techniques. This method may include introducing a heavily boron doped etch stop layer on a silicon wafer using an excimer laser, which permits good control of the etch stop layer removal process. This method additionally includes dramatically reducing the remaining surface roughness of the silicon thin films after etching in the fabrication of silicon on insulator wafers by scanning an excimer laser across the surface of the silicon thin film causing surface melting, whereby the surface tension of the melt causes smoothing of the surface during recrystallization. Applications for this method include those requiring a transparent or insulating substrate, such as display manufacturing. Other applications include sensors, actuators, optoelectronics, radiation hard and high temperature electronics. 15 figs.

  2. Flexible methods for segmentation evaluation: Results from CT-based luggage screening

    PubMed Central

    Karimi, Seemeen; Jiang, Xiaoqian; Cosman, Pamela; Martz, Harry

    2017-01-01

    BACKGROUND Imaging systems used in aviation security include segmentation algorithms in an automatic threat recognition pipeline. The segmentation algorithms evolve in response to emerging threats and changing performance requirements. Analysis of segmentation algorithms’ behavior, including the nature of errors and feature recovery, facilitates their development. However, evaluation methods from the literature provide limited characterization of the segmentation algorithms. OBJECTIVE To develop segmentation evaluation methods that measure systematic errors such as oversegmentation and undersegmentation, outliers, and overall errors. The methods must measure feature recovery and allow us to prioritize segments. METHODS We developed two complementary evaluation methods using statistical techniques and information theory. We also created a semi-automatic method to define ground truth from 3D images. We applied our methods to evaluate five segmentation algorithms developed for CT luggage screening. We validated our methods with synthetic problems and an observer evaluation. RESULTS Both methods selected the same best segmentation algorithm. Human evaluation confirmed the findings. The measurement of systematic errors and prioritization helped in understanding the behavior of each segmentation algorithm. CONCLUSIONS Our evaluation methods allow us to measure and explain the accuracy of segmentation algorithms. PMID:24699346

  3. Dopant ink composition and method of fabricating a solar cell there from

    DOEpatents

    Loscutoff, Paul; Wu, Kahn; Molesa, Steven Edward

    2017-10-25

    Dopant ink compositions and methods of fabricating solar cells there from are described. A dopant ink composition may include a cross-linkable matrix precursor, a bound dopant species, and a solvent. A method of fabricating a solar cell may include delivering a dopant ink composition to a region above a substrate. The dopant ink composition includes a cross-linkable matrix precursor, a bound dopant species, and a solvent. The method also includes baking the dopant ink composition to remove a substantial portion of the solvent of the dopant ink composition, curing the baked dopant ink composition to cross-link a substantial portion of the cross-linkable matrix precursor of the dopant ink composition, and driving dopants from the cured dopant ink composition toward the substrate.

  4. Dopant ink composition and method of fabricating a solar cell there from

    DOEpatents

    Loscutoff, Paul; Wu, Kahn; Molesa, Steven Edward

    2015-03-31

    Dopant ink compositions and methods of fabricating solar cells there from are described. A dopant ink composition may include a cross-linkable matrix precursor, a bound dopant species, and a solvent. A method of fabricating a solar cell may include delivering a dopant ink composition to a region above a substrate. The dopant ink composition includes a cross-linkable matrix precursor, a bound dopant species, and a solvent. The method also includes baking the dopant ink composition to remove a substantial portion of the solvent of the dopant ink composition, curing the baked dopant ink composition to cross-link a substantial portion of the cross-linkable matrix precursor of the dopant ink composition, and driving dopants from the cured dopant ink composition toward the substrate.

  5. Multi-model blending

    DOEpatents

    Hamann, Hendrik F.; Hwang, Youngdeok; van Kessel, Theodore G.; Khabibrakhmanov, Ildar K.; Muralidhar, Ramachandran

    2016-10-18

    A method and a system to perform multi-model blending are described. The method includes obtaining one or more sets of predictions of historical conditions, the historical conditions corresponding with a time T that is historical in reference to current time, and the one or more sets of predictions of the historical conditions being output by one or more models. The method also includes obtaining actual historical conditions, the actual historical conditions being measured conditions at the time T, assembling a training data set including designating the two or more set of predictions of historical conditions as predictor variables and the actual historical conditions as response variables, and training a machine learning algorithm based on the training data set. The method further includes obtaining a blended model based on the machine learning algorithm.

  6. A Systematic Evaluation of Field-Based Screening Methods for the Assessment of Anterior Cruciate Ligament (ACL) Injury Risk.

    PubMed

    Fox, Aaron S; Bonacci, Jason; McLean, Scott G; Spittle, Michael; Saunders, Natalie

    2016-05-01

    Laboratory-based measures provide an accurate method to identify risk factors for anterior cruciate ligament (ACL) injury; however, these methods are generally prohibitive to the wider community. Screening methods that can be completed in a field or clinical setting may be more applicable for wider community use. Examination of field-based screening methods for ACL injury risk can aid in identifying the most applicable method(s) for use in these settings. The objective of this systematic review was to evaluate and compare field-based screening methods for ACL injury risk to determine their efficacy of use in wider community settings. An electronic database search was conducted on the SPORTDiscus™, MEDLINE, AMED and CINAHL databases (January 1990-July 2015) using a combination of relevant keywords. A secondary search of the same databases, using relevant keywords from identified screening methods, was also undertaken. Studies identified as potentially relevant were independently examined by two reviewers for inclusion. Where consensus could not be reached, a third reviewer was consulted. Original research articles that examined screening methods for ACL injury risk that could be undertaken outside of a laboratory setting were included for review. Two reviewers independently assessed the quality of included studies. Included studies were categorized according to the screening method they examined. A description of each screening method, and data pertaining to the ability to prospectively identify ACL injuries, validity and reliability, recommendations for identifying 'at-risk' athletes, equipment and training required to complete screening, time taken to screen athletes, and applicability of the screening method across sports and athletes were extracted from relevant studies. Of 1077 citations from the initial search, a total of 25 articles were identified as potentially relevant, with 12 meeting all inclusion/exclusion criteria. From the secondary search, eight further studies met all criteria, resulting in 20 studies being included for review. Five ACL-screening methods-the Landing Error Scoring System (LESS), Clinic-Based Algorithm, Observational Screening of Dynamic Knee Valgus (OSDKV), 2D-Cam Method, and Tuck Jump Assessment-were identified. There was limited evidence supporting the use of field-based screening methods in predicting ACL injuries across a range of populations. Differences relating to the equipment and time required to complete screening methods were identified. Only screening methods for ACL injury risk were included for review. Field-based screening methods developed for lower-limb injury risk in general may also incorporate, and be useful in, screening for ACL injury risk. Limited studies were available relating to the OSDKV and 2D-Cam Method. The LESS showed predictive validity in identifying ACL injuries, however only in a youth athlete population. The LESS also appears practical for community-wide use due to the minimal equipment and set-up/analysis time required. The Clinic-Based Algorithm may have predictive value for ACL injury risk as it identifies athletes who exhibit high frontal plane knee loads during a landing task, but requires extensive additional equipment and time, which may limit its application to wider community settings.

  7. Methods and compositions using calcium carbonate

    DOEpatents

    Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Patterson, Joshua [Freedom, CA; Ginder-Vogel, Matthew [Los Gatos, CA; Yaccato, Karin [San Jose, CA; Stagnaro, John [Santa Clara, CA; Devenney, Martin [Mountain View, CA; Ries, Justin [Chapel Hill, NC

    2012-03-20

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  8. Methods and compositions using calcium carbonate

    DOEpatents

    Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Patterson, Joshua [Freedom, CA; Fernandez, Miguel [San Jose, CA; Yaccato, Karin [San Jose, CA; Thatcher, Ryan [Sunnyvale, CA; Stagnaro, John [Santa Clara, CA; Chen, Irvin [Santa Clara, CA; Omelon, Sidney [Willowdale, CA; Hodson, Keith [Palo Alto, CA; Clodic, Laurence [Sunnyvale, CA; Geramita, Katharine [Seattle, CA; Holland, Terence C [Auburn Township, OH; Ries, Justin [Chapel Hill, NC

    2012-02-14

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  9. SAM Methods Query

    EPA Pesticide Factsheets

    Laboratories measuring target chemical, radiochemical, pathogens, and biotoxin analytes in environmental samples can use this online query tool to identify analytical methods included in EPA's Selected Analytical Methods for Environmental Remediation

  10. Methods and compositions using calcium carbonate

    DOEpatents

    Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Chen, Irvin [San Jose, CA

    2011-04-12

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  11. Methods and compositions using calcium carbonate

    DOEpatents

    Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Chen, Irvin [Santa Clara, CA; Ginder-Vogel, Matthew [Los Gatos, CA; Fernandez, Miguel [San Jose, CA

    2012-05-15

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  12. Methods and compositions using calcium carbonate

    DOEpatents

    Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Patterson, Joshua [Freedom, CA; Ginder-Vogel, Matthew [Los Gatos, CA; Yaccato, Karin [San Jose, CA; Stagnaro, John [Santa Clara, CA; Devenney, Martin [Mountain View, CA; Ries, Justin [Chapel Hill, NC

    2011-11-22

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  13. Methods and compositions using calcium carbonate

    DOEpatents

    Chen, Irvin; Fernandez, Miguel; Patterson, Joshua; Devenney, Martin

    2015-01-13

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  14. Methods and compositions using calcium carbonate

    DOEpatents

    Chen, Irvin; Fernandez, Miguel; Patterson, Joshua; Devenney, Martin

    2015-06-16

    Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.

  15. Comparison of transect sampling and object-oriented image classification methods of urbanizing catchments

    NASA Astrophysics Data System (ADS)

    Yang, Y.; Tenenbaum, D. E.

    2009-12-01

    The process of urbanization has major effects on both human and natural systems. In order to monitor these changes and better understand how urban ecological systems work, urban spatial structure and the variation needs to be first quantified at a fine scale. Because the land-use and land-cover (LULC) in urbanizing areas is highly heterogeneous, the classification of urbanizing environments is the most challenging field in remote sensing. Although a pixel-based method is a common way to do classification, the results are not good enough for many research objectives which require more accurate classification data in fine scales. Transect sampling and object-oriented classification methods are more appropriate for urbanizing areas. Tenenbaum used a transect sampling method using a computer-based facility within a widely available commercial GIS in the Glyndon Catchment and the Upper Baismans Run Catchment, Baltimore, Maryland. It was a two-tiered classification system, including a primary level (which includes 7 classes) and a secondary level (which includes 37 categories). The statistical information of LULC was collected. W. Zhou applied an object-oriented method at the parcel level in Gwynn’s Falls Watershed which includes the two previously mentioned catchments and six classes were extracted. The two urbanizing catchments are located in greater Baltimore, Maryland and drain into Chesapeake Bay. In this research, the two different methods are compared for 6 classes (woody, herbaceous, water, ground, pavement and structure). The comparison method uses the segments in the transect method to extract LULC information from the results of the object-oriented method. Classification results were compared in order to evaluate the difference between the two methods. The overall proportions of LULC classes from the two studies show that there is overestimation of structures in the object-oriented method. For the other five classes, the results from the two methods are similar, except for a difference in the proportions of the woody class. The segment to segment comparison shows that the resolution of the light detection and ranging (LIDAR) data used in the object-oriented method does affect the accuracy of the classification. Shadows of trees and structures are still a big problem in the object-oriented method. For classes that make up a small proportion of the catchments, such as water, neither method was capable of detecting them.

  16. David W. Templeton | NREL

    Science.gov Websites

    and algal biomass analysis methods and applications of these methods to different processes. Templeton , internally funded research project to develop microalgal compositional analysis methods that included setting methods Closing mass and component balances around pretreatment, saccharification, and fermentation unit

  17. Structures for capturing CO.sub.2, methods of making the structures, and methods of capturing CO.sub.2

    DOEpatents

    Jones, Christopher W; Hicks, Jason C; Fauth, Daniel J; McMahan, Gray

    2012-10-30

    Briefly described, embodiments of this disclosure, among others, include carbon dioxide (CO.sub.2) sorption structures, methods of making CO.sub.2 sorption structures, and methods of using CO.sub.2 sorption structures.

  18. Bootstrap Methods: A Very Leisurely Look.

    ERIC Educational Resources Information Center

    Hinkle, Dennis E.; Winstead, Wayland H.

    The Bootstrap method, a computer-intensive statistical method of estimation, is illustrated using a simple and efficient Statistical Analysis System (SAS) routine. The utility of the method for generating unknown parameters, including standard errors for simple statistics, regression coefficients, discriminant function coefficients, and factor…

  19. Ensemble Methods for MiRNA Target Prediction from Expression Data.

    PubMed

    Le, Thuc Duy; Zhang, Junpeng; Liu, Lin; Li, Jiuyong

    2015-01-01

    microRNAs (miRNAs) are short regulatory RNAs that are involved in several diseases, including cancers. Identifying miRNA functions is very important in understanding disease mechanisms and determining the efficacy of drugs. An increasing number of computational methods have been developed to explore miRNA functions by inferring the miRNA-mRNA regulatory relationships from data. Each of the methods is developed based on some assumptions and constraints, for instance, assuming linear relationships between variables. For such reasons, computational methods are often subject to the problem of inconsistent performance across different datasets. On the other hand, ensemble methods integrate the results from individual methods and have been proved to outperform each of their individual component methods in theory. In this paper, we investigate the performance of some ensemble methods over the commonly used miRNA target prediction methods. We apply eight different popular miRNA target prediction methods to three cancer datasets, and compare their performance with the ensemble methods which integrate the results from each combination of the individual methods. The validation results using experimentally confirmed databases show that the results of the ensemble methods complement those obtained by the individual methods and the ensemble methods perform better than the individual methods across different datasets. The ensemble method, Pearson+IDA+Lasso, which combines methods in different approaches, including a correlation method, a causal inference method, and a regression method, is the best performed ensemble method in this study. Further analysis of the results of this ensemble method shows that the ensemble method can obtain more targets which could not be found by any of the single methods, and the discovered targets are more statistically significant and functionally enriched. The source codes, datasets, miRNA target predictions by all methods, and the ground truth for validation are available in the Supplementary materials.

  20. Ensemble Methods for MiRNA Target Prediction from Expression Data

    PubMed Central

    Le, Thuc Duy; Zhang, Junpeng; Liu, Lin; Li, Jiuyong

    2015-01-01

    Background microRNAs (miRNAs) are short regulatory RNAs that are involved in several diseases, including cancers. Identifying miRNA functions is very important in understanding disease mechanisms and determining the efficacy of drugs. An increasing number of computational methods have been developed to explore miRNA functions by inferring the miRNA-mRNA regulatory relationships from data. Each of the methods is developed based on some assumptions and constraints, for instance, assuming linear relationships between variables. For such reasons, computational methods are often subject to the problem of inconsistent performance across different datasets. On the other hand, ensemble methods integrate the results from individual methods and have been proved to outperform each of their individual component methods in theory. Results In this paper, we investigate the performance of some ensemble methods over the commonly used miRNA target prediction methods. We apply eight different popular miRNA target prediction methods to three cancer datasets, and compare their performance with the ensemble methods which integrate the results from each combination of the individual methods. The validation results using experimentally confirmed databases show that the results of the ensemble methods complement those obtained by the individual methods and the ensemble methods perform better than the individual methods across different datasets. The ensemble method, Pearson+IDA+Lasso, which combines methods in different approaches, including a correlation method, a causal inference method, and a regression method, is the best performed ensemble method in this study. Further analysis of the results of this ensemble method shows that the ensemble method can obtain more targets which could not be found by any of the single methods, and the discovered targets are more statistically significant and functionally enriched. The source codes, datasets, miRNA target predictions by all methods, and the ground truth for validation are available in the Supplementary materials. PMID:26114448

  1. Microfabricated instruments and methods to treat recurrent corneal erosions

    DOEpatents

    Britton, Jr., Charles L.; D'urso, Brian R.; Chaum, Edward; Simpson, John T.; Baba, Justin S.; Ericson, M. Nance; Warmack, Robert J.

    2015-06-02

    In one embodiment, the present invention provides a device and method for treating recurrent corneal erosion. In one embodiment, the method includes the steps of contacting an epithelium layer of a cornea with an array of glass micro-rods including a plurality of sharp features having a length that penetrates a Bowman's layer of the eye, wherein the plurality of sharp features of the array of glass micro-rods produces a plurality of punctures in the Bowman's layer of the eye that are of micro-scale or less. In another embodiment, the present invention provides a method and device for drug delivery. In one embodiment, the device includes an array of glass micro-rods, wherein at least one glass micro-rod of the array of glass micro-rods includes a sharp feature opposite a base of the array of glass micro-rods, wherein the sharp feature includes a treated surface for delivering a chemical compound to the eye.

  2. Microfabricated instruments and methods to treat recurrent corneal erosion

    DOEpatents

    Britton, Charles L; D& #x27; Urso, Brian R; Chaum, Edward; Simpson, John T; Baba, Justin S; Ericson, M. Nance; Warmack, Robert J

    2013-11-26

    In one embodiment, the present invention provides a device and method for treating recurrent corneal erosion. In one embodiment, the method includes the steps of contacting an epithelium layer of a cornea with an array of glass micro-rods including a plurality of sharp features having a length that penetrates a Bowman's layer of the eye, wherein the plurality of sharp features of the array of glass micro-rods produces a plurality of punctures in the Bowman's layer of the eye that are of micro-scale or less. In another embodiment, the present invention provides a method and device for drug delivery. In one embodiment, the device includes an array of glass micro-rods, wherein at least one glass micro-rod of the array of glass micro-rods includes a sharp feature opposite a base of the array of glass micro-rods, wherein the sharp feature includes a treated surface for delivering a chemical compound to the eye.

  3. Engineered high expansion glass-ceramics having near linear thermal strain and methods thereof

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Steve Xunhu; Rodriguez, Mark A.; Lyon, Nathanael L.

    The present invention relates to glass-ceramic compositions, as well as methods for forming such composition. In particular, the compositions include various polymorphs of silica that provide beneficial thermal expansion characteristics (e.g., a near linear thermal strain). Also described are methods of forming such compositions, as well as connectors including hermetic seals containing such compositions.

  4. Power generation method including membrane separation

    DOEpatents

    Lokhandwala, Kaaeid A.

    2000-01-01

    A method for generating electric power, such as at, or close to, natural gas fields. The method includes conditioning natural gas containing C.sub.3+ hydrocarbons and/or acid gas by means of a membrane separation step. This step creates a leaner, sweeter, drier gas, which is then used as combustion fuel to run a turbine, which is in turn used for power generation.

  5. Substrate comprising a nanometer-scale projection array

    DOEpatents

    Cui, Yi; Zhu, Jia; Hsu, Ching-Mei; Connor, Stephen T; Yu, Zongfu; Fan, Shanhui; Burkhard, George

    2012-11-27

    A method for forming a substrate comprising nanometer-scale pillars or cones that project from the surface of the substrate is disclosed. The method enables control over physical characteristics of the projections including diameter, sidewall angle, and tip shape. The method further enables control over the arrangement of the projections including characteristics such as center-to-center spacing and separation distance.

  6. 26 CFR 1.481-4 - Adjustments taken into account with consent.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... effecting a change in method of accounting, including the taxable year or years in which the amount of the... Commissioner's consent to a change in method of accounting. (b) An agreement to the terms and conditions of a change in method of accounting under § 1.446-1(e)(3), including the taxable year or years prescribed by...

  7. Method and apparatus for controlling LCL converters using asymmetric voltage cancellation techniques

    DOEpatents

    Wu, Hunter; Sealy, Kylee Devro; Sharp, Bryan Thomas; Gilchrist, Aaron

    2016-01-26

    A method and apparatus for LCL resonant converter control utilizing Asymmetric Voltage Cancellation is described. The methods to determine the optimal trajectory of the control variables are discussed. Practical implementations of sensing load parameters are included. Simple PI, PID and fuzzy logic controllers are included with AVC for achieving good transient response characteristics with output current regulation.

  8. 76 FR 45673 - Methods of Accounting Used by Corporations That Acquire the Assets of Other Corporations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-01

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Part 1 [TD 9534] RIN 1545-BD81 Methods... regulations relating to the methods of accounting, including the inventory methods, to be used by corporations... liquidations. These regulations clarify and simplify the rules regarding the accounting methods to be used...

  9. Evaluation of Propiconazole Application Methods for Control of Oak Wilt in Texas Live Oaks

    Treesearch

    A. Dan Wilson; D.G. Lester

    1996-01-01

    Four fungicide application methods using the microencapsulated (blue) 14.3% EC formulation of propiconazole (Alamo), including a low-concentration high volume method, two high-concentration low volume microinjection methods, and a low-concentration intermediate volume soil drench method, were tested for effectiveness in controlling oak wilt in a mature natural stand of...

  10. Methods for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1995-01-01

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  11. Transforming Elementary Science Teacher Education by Bridging Formal and Informal Science Education in an Innovative Science Methods Course

    NASA Astrophysics Data System (ADS)

    Riedinger, Kelly; Marbach-Ad, Gili; Randy McGinnis, J.; Hestness, Emily; Pease, Rebecca

    2011-02-01

    We investigated curricular and pedagogical innovations in an undergraduate science methods course for elementary education majors at the University of Maryland. The goals of the innovative elementary science methods course included: improving students' attitudes toward and views of science and science teaching, to model innovative science teaching methods and to encourage students to continue in teacher education. We redesigned the elementary science methods course to include aspects of informal science education. The informal science education course features included informal science educator guest speakers, a live animal demonstration and a virtual field trip. We compared data from a treatment course ( n = 72) and a comparison course ( n = 26). Data collection included: researchers' observations, instructors' reflections, and teacher candidates' feedback. Teacher candidate feedback involved interviews and results on a reliable and valid Attitudes and Beliefs about the Nature of and the Teaching of Science instrument. We used complementary methods to analyze the data collected. A key finding of the study was that while benefits were found in both types of courses, the difference in results underscores the need of identifying the primary purpose for innovation as a vital component of consideration.

  12. Analysis of Environmental Contamination resulting from ...

    EPA Pesticide Factsheets

    Catastrophic incidents can generate a large number of samples with analytically diverse types including forensic, clinical, environmental, food, and others. Environmental samples include water, wastewater, soil, air, urban building and infrastructure materials, and surface residue. Such samples may arise not only from contamination from the incident but also from the multitude of activities surrounding the response to the incident, including decontamination. This document summarizes a range of activities to help build laboratory capability in preparation for analysis following a catastrophic incident, including selection and development of fit-for-purpose analytical methods for chemical, biological, and radiological contaminants. Fit-for-purpose methods are those which have been selected to meet project specific data quality objectives. For example, methods could be fit for screening contamination in the early phases of investigation of contamination incidents because they are rapid and easily implemented, but those same methods may not be fit for the purpose of remediating the environment to safe levels when a more sensitive method is required. While the exact data quality objectives defining fitness-for-purpose can vary with each incident, a governing principle of the method selection and development process for environmental remediation and recovery is based on achieving high throughput while maintaining high quality analytical results. This paper illu

  13. Web-based emergency response exercise management systems and methods thereof

    DOEpatents

    Goforth, John W.; Mercer, Michael B.; Heath, Zach; Yang, Lynn I.

    2014-09-09

    According to one embodiment, a method for simulating portions of an emergency response exercise includes generating situational awareness outputs associated with a simulated emergency and sending the situational awareness outputs to a plurality of output devices. Also, the method includes outputting to a user device a plurality of decisions associated with the situational awareness outputs at a decision point, receiving a selection of one of the decisions from the user device, generating new situational awareness outputs based on the selected decision, and repeating the sending, outputting and receiving steps based on the new situational awareness outputs. Other methods, systems, and computer program products are included according to other embodiments of the invention.

  14. Neural networks: Application to medical imaging

    NASA Technical Reports Server (NTRS)

    Clarke, Laurence P.

    1994-01-01

    The research mission is the development of computer assisted diagnostic (CAD) methods for improved diagnosis of medical images including digital x-ray sensors and tomographic imaging modalities. The CAD algorithms include advanced methods for adaptive nonlinear filters for image noise suppression, hybrid wavelet methods for feature segmentation and enhancement, and high convergence neural networks for feature detection and VLSI implementation of neural networks for real time analysis. Other missions include (1) implementation of CAD methods on hospital based picture archiving computer systems (PACS) and information networks for central and remote diagnosis and (2) collaboration with defense and medical industry, NASA, and federal laboratories in the area of dual use technology conversion from defense or aerospace to medicine.

  15. An improved method for design of expansion-chamber mufflers with application to an operational helicopter

    NASA Technical Reports Server (NTRS)

    Parrott, T. L.

    1973-01-01

    An improved method for the design of expansion-chamber mufflers is described and applied to the task of reducing exhaust noise generated by a helicopter. The method is an improvement of standard transmission-line theory in that it accounts for the effect of the mean exhaust-gas flow on the acoustic-transmission properties of a muffler system, including the termination boundary condition. The method has been computerized, and the computer program includes an optimization procedure that adjusts muffler component lengths to achieve a minimum specified desired transmission loss over a specified frequency range. A printout of the program is included together with a user-oriented description.

  16. Gas stream analysis using voltage-current time differential operation of electrochemical sensors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woo, Leta Yar-Li; Glass, Robert Scott; Fitzpatrick, Joseph Jay

    A method for analysis of a gas stream. The method includes identifying an affected region of an affected waveform signal corresponding to at least one characteristic of the gas stream. The method also includes calculating a voltage-current time differential between the affected region of the affected waveform signal and a corresponding region of an original waveform signal. The affected region and the corresponding region of the waveform signals have a sensitivity specific to the at least one characteristic of the gas stream. The method also includes generating a value for the at least one characteristic of the gas stream basedmore » on the calculated voltage-current time differential.« less

  17. Method of making metal-polymer composite catalysts

    DOEpatents

    Zelena, Piotr [Los Alamos, NM; Bashyam, Rajesh [Los Alamos, NM

    2009-06-23

    A metal-polymer-carbon composite catalyst for use as a cathode electrocatalyst in fuel cells. The catalyst includes a heteroatomic polymer; a transition metal linked to the heteroatomic polymer by one of nitrogen, sulfur, and phosphorus, and a recast ionomer dispersed throughout the heteroatomic polymer-carbon composite. The method includes forming a heteroatomic polymer-carbon composite and loading the transition metal onto the composite. The invention also provides a method of making a membrane electrode assembly for a fuel cell that includes the metal-polymer-carbon composite catalyst.

  18. Electrorheological fluids and methods

    DOEpatents

    Green, Peter F.; McIntyre, Ernest C.

    2015-06-02

    Electrorheological fluids and methods include changes in liquid-like materials that can flow like milk and subsequently form solid-like structures under applied electric fields; e.g., about 1 kV/mm. Such fluids can be used in various ways as smart suspensions, including uses in automotive, defense, and civil engineering applications. Electrorheological fluids and methods include one or more polar molecule substituted polyhedral silsesquioxanes (e.g., sulfonated polyhedral silsesquioxanes) and one or more oils (e.g., silicone oil), where the fluid can be subjected to an electric field.

  19. Methods of capturing and immobilizing radioactive nuclei with metal fluorite-based inorganic materials

    DOEpatents

    Wang, Yifeng; Miller, Andy; Bryan, Charles R.; Kruichak, Jessica Nicole

    2015-11-17

    Methods of capturing and immobilizing radioactive nuclei with metal fluorite-based inorganic materials are described. For example, a method of capturing and immobilizing radioactive nuclei includes flowing a gas stream through an exhaust apparatus. The exhaust apparatus includes a metal fluorite-based inorganic material. The gas stream includes a radioactive species. The radioactive species is removed from the gas stream by adsorbing the radioactive species to the metal fluorite-based inorganic material of the exhaust apparatus.

  20. Localized surface plasmon resonance mercury detection system and methods

    DOEpatents

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.

    2016-03-22

    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  1. The experimental determination of the moments of inertia of airplanes by a simplified compound-pendulum method

    NASA Technical Reports Server (NTRS)

    Gracey, William

    1948-01-01

    A simplified compound-pendulum method for the experimental determination of the moments of inertia of airplanes about the x and y axes is described. The method is developed as a modification of the standard pendulum method reported previously in NACA report, NACA-467. A brief review of the older method is included to form a basis for discussion of the simplified method. (author)

  2. Critical review of methods for risk ranking of food-related hazards, based on risks for human health.

    PubMed

    Van der Fels-Klerx, H J; Van Asselt, E D; Raley, M; Poulsen, M; Korsgaard, H; Bredsdorff, L; Nauta, M; D'agostino, M; Coles, D; Marvin, H J P; Frewer, L J

    2018-01-22

    This study aimed to critically review methods for ranking risks related to food safety and dietary hazards on the basis of their anticipated human health impacts. A literature review was performed to identify and characterize methods for risk ranking from the fields of food, environmental science and socio-economic sciences. The review used a predefined search protocol, and covered the bibliographic databases Scopus, CAB Abstracts, Web of Sciences, and PubMed over the period 1993-2013. All references deemed relevant, on the basis of predefined evaluation criteria, were included in the review, and the risk ranking method characterized. The methods were then clustered-based on their characteristics-into eleven method categories. These categories included: risk assessment, comparative risk assessment, risk ratio method, scoring method, cost of illness, health adjusted life years (HALY), multi-criteria decision analysis, risk matrix, flow charts/decision trees, stated preference techniques and expert synthesis. Method categories were described by their characteristics, weaknesses and strengths, data resources, and fields of applications. It was concluded there is no single best method for risk ranking. The method to be used should be selected on the basis of risk manager/assessor requirements, data availability, and the characteristics of the method. Recommendations for future use and application are provided.

  3. A text zero-watermarking method based on keyword dense interval

    NASA Astrophysics Data System (ADS)

    Yang, Fan; Zhu, Yuesheng; Jiang, Yifeng; Qing, Yin

    2017-07-01

    Digital watermarking has been recognized as a useful technology for the copyright protection and authentication of digital information. However, rarely did the former methods focus on the key content of digital carrier. The idea based on the protection of key content is more targeted and can be considered in different digital information, including text, image and video. In this paper, we use text as research object and a text zero-watermarking method which uses keyword dense interval (KDI) as the key content is proposed. First, we construct zero-watermarking model by introducing the concept of KDI and giving the method of KDI extraction. Second, we design detection model which includes secondary generation of zero-watermark and the similarity computing method of keyword distribution. Besides, experiments are carried out, and the results show that the proposed method gives better performance than other available methods especially in the attacks of sentence transformation and synonyms substitution.

  4. The spa typing of methicillin-resistant Staphylococcus aureus isolates by High Resolution Melting (HRM) analysis.

    PubMed

    Fasihi, Yasser; Fooladi, Saba; Mohammadi, Mohammad Ali; Emaneini, Mohammad; Kalantar-Neyestanaki, Davood

    2017-09-06

    Molecular typing is an important tool for control and prevention of infection. A suitable molecular typing method for epidemiological investigation must be easy to perform, highly reproducible, inexpensive, rapid and easy to interpret. In this study, two molecular typing methods including the conventional PCR-sequencing method and high resolution melting (HRM) analysis were used for staphylococcal protein A (spa) typing of 30 Methicillin-resistant Staphylococcus aureus (MRSA) isolates recovered from clinical samples. Based on PCR-sequencing method results, 16 different spa types were identified among the 30 MRSA isolates. Among the 16 different spa types, 14 spa types separated by HRM method. Two spa types including t4718 and t2894 were not separated from each other. According to our results, spa typing based on HRM analysis method is very rapid, easy to perform and cost-effective, but this method must be standardized for different regions, spa types, and real-time machinery.

  5. Purification of anti-Japanese encephalitis virus monoclonal antibody by ceramic hydroxyapatite chromatography without proteins A and G.

    PubMed

    Saito, Maiko; Kurosawa, Yae; Okuyama, Tsuneo

    2012-02-01

    Antibody purification using proteins A and G has been a standard method for research and industrial processes. The conventional method, however, includes a three-step process, including buffer exchange, before chromatography. In addition, proteins A and G require low pH elution, which causes antibody aggregation and inactivates the antibody's immunity. This report proposes a two-step method using hydroxyapatite chromatography and membrane filtration, without proteins A and G. This novel method shortens the running time to one-third the conventional method for each cycle. Using our two-step method, 90.2% of the monoclonal antibodies purified were recovered in the elution fraction, the purity achieved was >90%, and most of the antigen-specific activity was retained. This report suggests that the two-step method using hydroxyapatite chromatography and membrane filtration should be considered as an alternative to purification using proteins A and G.

  6. Radiologic methods of evaluating generalized osteopenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schneider, R.

    1984-10-01

    Noninvasive methods of evaluating generalized osteopenia include radiography, radionuclide studies, and various quantitative studies. These methods differ in availability, cost, accuracy, precision, radiation dose, and information supplied about bony change. A combination of methods is necessary to detect and follow the course and treatment of osteopenia.

  7. Model reduction methods for control design

    NASA Technical Reports Server (NTRS)

    Dunipace, K. R.

    1988-01-01

    Several different model reduction methods are developed and detailed implementation information is provided for those methods. Command files to implement the model reduction methods in a proprietary control law analysis and design package are presented. A comparison and discussion of the various reduction techniques is included.

  8. A Review on Human Activity Recognition Using Vision-Based Method.

    PubMed

    Zhang, Shugang; Wei, Zhiqiang; Nie, Jie; Huang, Lei; Wang, Shuang; Li, Zhen

    2017-01-01

    Human activity recognition (HAR) aims to recognize activities from a series of observations on the actions of subjects and the environmental conditions. The vision-based HAR research is the basis of many applications including video surveillance, health care, and human-computer interaction (HCI). This review highlights the advances of state-of-the-art activity recognition approaches, especially for the activity representation and classification methods. For the representation methods, we sort out a chronological research trajectory from global representations to local representations, and recent depth-based representations. For the classification methods, we conform to the categorization of template-based methods, discriminative models, and generative models and review several prevalent methods. Next, representative and available datasets are introduced. Aiming to provide an overview of those methods and a convenient way of comparing them, we classify existing literatures with a detailed taxonomy including representation and classification methods, as well as the datasets they used. Finally, we investigate the directions for future research.

  9. A Review on Human Activity Recognition Using Vision-Based Method

    PubMed Central

    Nie, Jie

    2017-01-01

    Human activity recognition (HAR) aims to recognize activities from a series of observations on the actions of subjects and the environmental conditions. The vision-based HAR research is the basis of many applications including video surveillance, health care, and human-computer interaction (HCI). This review highlights the advances of state-of-the-art activity recognition approaches, especially for the activity representation and classification methods. For the representation methods, we sort out a chronological research trajectory from global representations to local representations, and recent depth-based representations. For the classification methods, we conform to the categorization of template-based methods, discriminative models, and generative models and review several prevalent methods. Next, representative and available datasets are introduced. Aiming to provide an overview of those methods and a convenient way of comparing them, we classify existing literatures with a detailed taxonomy including representation and classification methods, as well as the datasets they used. Finally, we investigate the directions for future research. PMID:29065585

  10. A Ricin Forensic Profiling Approach Based on a Complex Set of Biomarkers

    DOE PAGES

    Fredriksson, Sten-Ake; Wunschel, David S.; Lindstrom, Susanne Wiklund; ...

    2018-03-28

    A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1 – PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods andmore » robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved.« less

  11. A Ricin Forensic Profiling Approach Based on a Complex Set of Biomarkers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fredriksson, Sten-Ake; Wunschel, David S.; Lindstrom, Susanne Wiklund

    A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1 – PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods andmore » robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved.« less

  12. 42 CFR 441.472 - Budget methodology.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... based utilizing valid, reliable cost data. (2) The State's method is applied consistently to participants. (3) The State's method is open for public inspection. (4) The State's method includes a...

  13. SAM Biotoxin Methods Query

    EPA Pesticide Factsheets

    Laboratories measuring target biotoxin analytes in environmental samples can use this online query tool to identify analytical methods included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery for select biotoxins.

  14. 42 CFR 441.472 - Budget methodology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... based utilizing valid, reliable cost data. (2) The State's method is applied consistently to participants. (3) The State's method is open for public inspection. (4) The State's method includes a...

  15. Method for non-referential defect characterization using fractal encoding and active contours

    DOEpatents

    Gleason, Shaun S [Knoxville, TN; Sari-Sarraf, Hamed [Lubbock, TX

    2007-05-15

    A method for identification of anomalous structures, such as defects, includes the steps of providing a digital image and applying fractal encoding to identify a location of at least one anomalous portion of the image. The method does not require a reference image to identify the location of the anomalous portion. The method can further include the step of initializing an active contour based on the location information obtained from the fractal encoding step and deforming an active contour to enhance the boundary delineation of the anomalous portion.

  16. Method of forming a ceramic matrix composite and a ceramic matrix component

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Diego, Peter; Zhang, James

    A method of forming a ceramic matrix composite component includes providing a formed ceramic member having a cavity, filling at least a portion of the cavity with a ceramic foam. The ceramic foam is deposited on a barrier layer covering at least one internal passage of the cavity. The method includes processing the formed ceramic member and ceramic foam to obtain a ceramic matrix composite component. Also provided is a method of forming a ceramic matrix composite blade and a ceramic matrix composite component.

  17. [Extraction method suitable for detection of unheated crustaceans including cephalothorax by ELISA].

    PubMed

    Shibahara, Yusuke; Yamada, Itta; Uesaka, Yoshihiko; Uneo, Noriko; Abe, Akihisa; Ohashi, Eiji; Shiomi, Kazuo

    2009-08-01

    When unheated whole samples of crustaceans (shrimp, prawn and crab) were analyzed with our ELISA kit (FA test EIA-Crustacean 'Nissui') using anti-tropomyosin antibodies, a remarkable reduction in reactivity was recognized. This reduction in activity was found to be due to the digestion of tropomyosin during the extraction process by proteases contained in cephalothorax. To avoid the digestion of tropomyosin by proteases, we developed an extraction method (heating method) suitable for the detection of tropomyosin in unheated crustaceans including cephalothorax. Experiments with unheated whole samples of various species of crustaceans confirmed that the heating method greatly improved the low reactivity in the standard method; the heating method gave extraction efficiencies of as high as 93-107%. Various processed crustaceans with cephalothorax, such as dry products (unheated or weakly heated products) and pickles in soy sauce (unheated products), that showed low reactivity with the standard method were confirmed to give superior results with the heating method. These results indicated that the developed heating method is suitable for detecting unheated crustaceans with cephalothorax by means of the ELISA kit.

  18. A Review of High-Order and Optimized Finite-Difference Methods for Simulating Linear Wave Phenomena

    NASA Technical Reports Server (NTRS)

    Zingg, David W.

    1996-01-01

    This paper presents a review of high-order and optimized finite-difference methods for numerically simulating the propagation and scattering of linear waves, such as electromagnetic, acoustic, or elastic waves. The spatial operators reviewed include compact schemes, non-compact schemes, schemes on staggered grids, and schemes which are optimized to produce specific characteristics. The time-marching methods discussed include Runge-Kutta methods, Adams-Bashforth methods, and the leapfrog method. In addition, the following fourth-order fully-discrete finite-difference methods are considered: a one-step implicit scheme with a three-point spatial stencil, a one-step explicit scheme with a five-point spatial stencil, and a two-step explicit scheme with a five-point spatial stencil. For each method studied, the number of grid points per wavelength required for accurate simulation of wave propagation over large distances is presented. Recommendations are made with respect to the suitability of the methods for specific problems and practical aspects of their use, such as appropriate Courant numbers and grid densities. Avenues for future research are suggested.

  19. Evaluation of methods for the assay of radium-228 in water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Noyce, J.R.

    1981-02-01

    The technical literature from 1967 to May 1980 was searched for methods for assaying radium-228 in water. These methods were evaluated for their suitability as potential EPA reference methods for drinking water assays. The authors suggest the present EPA reference method (Krieger, 1976) be retained but improved, and a second method (McCurdy and Mellor, 1979), which employs beta-gamma coincidence counting, be added. Included in this report is a table that lists the principal features of 17 methods for radium-228 assays.

  20. TECHNIQUES FOR TEACHING CONSERVATION EDUCATION.

    ERIC Educational Resources Information Center

    BROWN, ROBERT E.; MOUSER, G.W.

    CONSERVATION PRINCIPLES, FIELD METHODS AND TECHNIQUES, AND SPECIFIC FIELD LEARNING ACTIVITIES ARE INCLUDED IN THIS REFERENCE VOLUME FOR TEACHERS. CONSERVATION PRINCIPLES INCLUDE STATEMENTS PERTAINING TO (1) SOIL, (2) WATER, (3) FOREST, AND (4) WILDLIFE. FIELD METHODS AND TECHNIQUES INCLUDE (1) PREPARING FOR A FIELD TRIP, (2) GETTING STUDENT…

  1. General method and thermodynamic tables for computation of equilibrium composition and temperature of chemical reactions

    NASA Technical Reports Server (NTRS)

    Huff, Vearl N; Gordon, Sanford; Morrell, Virginia E

    1951-01-01

    A rapidly convergent successive approximation process is described that simultaneously determines both composition and temperature resulting from a chemical reaction. This method is suitable for use with any set of reactants over the complete range of mixture ratios as long as the products of reaction are ideal gases. An approximate treatment of limited amounts of liquids and solids is also included. This method is particularly suited to problems having a large number of products of reaction and to problems that require determination of such properties as specific heat or velocity of sound of a dissociating mixture. The method presented is applicable to a wide variety of problems that include (1) combustion at constant pressure or volume; and (2) isentropic expansion to an assigned pressure, temperature, or Mach number. Tables of thermodynamic functions needed with this method are included for 42 substances for convenience in numerical computations.

  2. Nanofiber electrode and method of forming same

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pintauro, Peter N.; Zhang, Wenjing

    In one aspect, a method of forming an electrode for an electrochemical device is disclosed. In one embodiment, the method includes the steps of mixing at least a first amount of a catalyst and a second amount of an ionomer or uncharged polymer to form a solution and delivering the solution into a metallic needle having a needle tip. The method further includes the steps of applying a voltage between the needle tip and a collector substrate positioned at a distance from the needle tip, and extruding the solution from the needle tip at a flow rate such as tomore » generate electrospun fibers and deposit the generated fibers on the collector substrate to form a mat with a porous network of fibers. Each fiber in the porous network of the mat has distributed particles of the catalyst. The method also includes the step of pressing the mat onto a membrane.« less

  3. Method for controlling powertrain pumps

    DOEpatents

    Sime, Karl Andrew; Spohn, Brian L; Demirovic, Besim; Martini, Ryan D; Miller, Jean Marie

    2013-10-22

    A method of controlling a pump supplying a fluid to a transmission includes sensing a requested power and an excess power for a powertrain. The requested power substantially meets the needs of the powertrain, while the excess power is not part of the requested power. The method includes sensing a triggering condition in response to the ability to convert the excess power into heat in the transmission, and determining that an operating temperature of the transmission is below a maximum. The method also includes determining a calibrated baseline and a dissipation command for the pump. The calibrated baseline command is configured to supply the fluid based upon the requested power, and the dissipation command is configured to supply additional fluid and consume the excess power with the pump. The method operates the pump at a combined command, which is equal to the calibrated baseline command plus the dissipation command.

  4. Carbide and carbonitride surface treatment method for refractory metals

    DOEpatents

    Meyer, G.A.; Schildbach, M.A.

    1996-12-03

    A carbide and carbonitride surface treatment method for refractory metals is provided, in steps including, heating a part formed of boron, chromium, hafnium, molybdenum, niobium, tantalum, titanium, tungsten or zirconium, or alloys thereof, in an evacuated chamber and then introducing reaction gases including nitrogen and hydrogen, either in elemental or water vapor form, which react with a source of elemental carbon to form carbon-containing gaseous reactants which then react with the metal part to form the desired surface layer. Apparatus for practicing the method is also provided, in the form of a carbide and carbonitride surface treatment system including a reaction chamber, a source of elemental carbon, a heating subassembly and a source of reaction gases. Alternative methods of providing the elemental carbon and the reaction gases are provided, as well as methods of supporting the metal part, evacuating the chamber with a vacuum subassembly and heating all of the components to the desired temperature. 5 figs.

  5. Determination of antennae patterns and radar reflection characteristics of aircraft

    NASA Astrophysics Data System (ADS)

    Bothe, H.; MacDonald, D.; Pool, A.

    1986-05-01

    The different types of aircraft antennas, their radiation characteristics and their preferred siting on the airframe are described. Emphasis is placed on the various methods for determining aircraft antenna radiation patterns (ARP) and advantages, disadvantages and limitations of each method are indicated. Mathematical modelling, model measurements and in-flight measurements in conjunction with the applied flight test techniques are included. Examples of practical results are given. Methods of determining aircraft radar characteristics are also described, indicating advantages, disadvantages and limitations of each method. Relevant fundamentals of radar theory are included only as necessary to appreciation of the real meaning of radar cross section (RCS) and angular glint. The measuring methods included are dynamic full-scale, static full-scale, sub-scale optical, ultrasonic and radio modelling. References are made to RCS measuring facilities in the USA and Europe and the UK Radio Modelling Facility is used extensively to exemplify the sub scale technique.

  6. Forming high efficiency silicon solar cells using density-graded anti-reflection surfaces

    DOEpatents

    Yuan, Hao-Chih; Branz, Howard M.; Page, Matthew R.

    2014-09-09

    A method (50) is provided for processing a graded-density AR silicon surface (14) to provide effective surface passivation. The method (50) includes positioning a substrate or wafer (12) with a silicon surface (14) in a reaction or processing chamber (42). The silicon surface (14) has been processed (52) to be an AR surface with a density gradient or region of black silicon. The method (50) continues with heating (54) the chamber (42) to a high temperature for both doping and surface passivation. The method (50) includes forming (58), with a dopant-containing precursor in contact with the silicon surface (14) of the substrate (12), an emitter junction (16) proximate to the silicon surface (14) by doping the substrate (12). The method (50) further includes, while the chamber is maintained at the high or raised temperature, forming (62) a passivation layer (19) on the graded-density silicon anti-reflection surface (14).

  7. Forming high-efficiency silicon solar cells using density-graded anti-reflection surfaces

    DOEpatents

    Yuan, Hao-Chih; Branz, Howard M.; Page, Matthew R.

    2015-07-07

    A method (50) is provided for processing a graded-density AR silicon surface (14) to provide effective surface passivation. The method (50) includes positioning a substrate or wafer (12) with a silicon surface (14) in a reaction or processing chamber (42). The silicon surface (14) has been processed (52) to be an AR surface with a density gradient or region of black silicon. The method (50) continues with heating (54) the chamber (42) to a high temperature for both doping and surface passivation. The method (50) includes forming (58), with a dopant-containing precursor in contact with the silicon surface (14) of the substrate (12), an emitter junction (16) proximate to the silicon surface (14) by doping the substrate (12). The method (50) further includes, while the chamber is maintained at the high or raised temperature, forming (62) a passivation layer (19) on the graded-density silicon anti-reflection surface (14).

  8. SIAM Conference on Parallel Processing for Scientific Computing, 4th, Chicago, IL, Dec. 11-13, 1989, Proceedings

    NASA Technical Reports Server (NTRS)

    Dongarra, Jack (Editor); Messina, Paul (Editor); Sorensen, Danny C. (Editor); Voigt, Robert G. (Editor)

    1990-01-01

    Attention is given to such topics as an evaluation of block algorithm variants in LAPACK and presents a large-grain parallel sparse system solver, a multiprocessor method for the solution of the generalized Eigenvalue problem on an interval, and a parallel QR algorithm for iterative subspace methods on the CM2. A discussion of numerical methods includes the topics of asynchronous numerical solutions of PDEs on parallel computers, parallel homotopy curve tracking on a hypercube, and solving Navier-Stokes equations on the Cedar Multi-Cluster system. A section on differential equations includes a discussion of a six-color procedure for the parallel solution of elliptic systems using the finite quadtree structure, data parallel algorithms for the finite element method, and domain decomposition methods in aerodynamics. Topics dealing with massively parallel computing include hypercube vs. 2-dimensional meshes and massively parallel computation of conservation laws. Performance and tools are also discussed.

  9. Smoking education programs 1960-1976.

    PubMed Central

    Thompson, E L

    1978-01-01

    This paper is a review of published reports, in English, of educational programs designed to change smoking behavior. Attempts to change the smoking behavior of young people have included anti-smoking campaigns, youth-to-youth programs, and a variety of message themes and teaching methods. Instruction has been presented both by teachers who were committed or persuasive and by teachers who were neutral or presented both sides of the issue. Didactic teaching, group discussion, individual study, peer instruction, and mass media have been employed. Health effects of smoking, both short- and long-term effects, have been emphasized. Most methods used with youth have shown little success. Studies of other methods have produced contradictory results. Educational programs for adults have included large scale anti-smoking campaigns, smoking cessation clinics, and a variety of more specific withdrawal methods. These methods have included individual counseling, emotional role playing, aversive conditioning, desensitization, and specific techniques to reduce the likelihood that smoking will occur in situations previously associated with smoking. Some of these techniques have produced poor results while studies of other methods have shown inconsistent results. The two methods showing the most promise are individual counseling and smoking withdrawal clinics. PMID:25026

  10. Nurse practitioner preferences for distance education methods related to learning style, course content, and achievement.

    PubMed

    Andrusyszyn, M A; Cragg, C E; Humbert, J

    2001-04-01

    The relationships among multiple distance delivery methods, preferred learning style, content, and achievement was sought for primary care nurse practitioner students. A researcher-designed questionnaire was completed by 86 (71%) participants, while 6 engaged in follow-up interviews. The results of the study included: participants preferred learning by "considering the big picture"; "setting own learning plans"; and "focusing on concrete examples." Several positive associations were found: learning on own with learning by reading, and setting own learning plans; small group with learning through discussion; large group with learning new things through hearing and with having learning plans set by others. The most preferred method was print-based material and the least preferred method was audio tape. The most suited method for content included video teleconferencing for counseling, political action, and transcultural issues; and video tape for physical assessment. Convenience, self-direction, and timing of learning were more important than delivery method or learning style. Preferred order of learning was reading, discussing, observing, doing, and reflecting. Recommended considerations when designing distance courses include a mix of delivery methods, specific content, outcomes, learner characteristics, and state of technology.

  11. Smoking education programs 1960-1976.

    PubMed

    Thompson, E L

    1978-03-01

    This paper is a review of published reports, in English, of educational programs designed to change smoking behavior. Attempts to change the smoking behavior of young people have included anti-smoking campaigns, youth-to-youth programs, and a variety of message themes and teaching methods. Instruction has been presented both by teachers who were committed or persuasive and by teachers who were neutral or presented both sides of the issue. Didactic teaching, group discussion, individual study, peer instruction, and mass media have been employed. Health effects of smoking, both short- and long-term effects, have been emphasized. Most methods used with youth have shown little success. Studies of other methods have produced contradictory results. Educational programs for adults have included large scale anti-smoking campaigns, smoking cessation clinics, and a variety of more specific withdrawal methods. These methods have included individual counseling, emotional role playing, aversive conditioning, desensitization, and specific techniques to reduce the likelihood that smoking will occur in situations previously associated with smoking. Some of these techniques have produced poor results while studies of other methods have shown inconsistent results. The two methods showing the most promise are individual counseling and smoking withdrawal clinics.

  12. Setting Standards for Minimum Competency Tests.

    ERIC Educational Resources Information Center

    Mehrens, William A.

    Some general questions about minimum competency tests are discussed, and various methods of setting standards are reviewed with major attention devoted to those methods used for dichotomizing a continuum. Methods reviewed under the heading of Absolute Judgments of Test Content include Nedelsky's, Angoff's, Ebel's, and Jaeger's. These methods are…

  13. Computational methods for global/local analysis

    NASA Technical Reports Server (NTRS)

    Ransom, Jonathan B.; Mccleary, Susan L.; Aminpour, Mohammad A.; Knight, Norman F., Jr.

    1992-01-01

    Computational methods for global/local analysis of structures which include both uncoupled and coupled methods are described. In addition, global/local analysis methodology for automatic refinement of incompatible global and local finite element models is developed. Representative structural analysis problems are presented to demonstrate the global/local analysis methods.

  14. Development of a Benchtop Baking Method for Chemically Leavened Crackers

    USDA-ARS?s Scientific Manuscript database

    Traditionally, the baking performance of soft wheat flours has been evaluated by well-established benchtop cookie-baking methods. In contrast, a benchtop cracker-baking method has not been widely explored or implemented as an official method, due to hurdles including the difficulty in finding ideal...

  15. Membranes, methods of making membranes, and methods of separating gases using membranes

    DOEpatents

    Ho, W. S. Winston

    2012-10-02

    Membranes, methods of making membranes, and methods of separating gases using membranes are provided. The membranes can include at least one hydrophilic polymer, at least one cross-linking agent, at least one base, and at least one amino compound. The methods of separating gases using membranes can include contacting a gas stream containing at least one of CO.sub.2, H.sub.2S, and HCl with one side of a nonporous and at least one of CO.sub.2, H.sub.2S, and HCl selectively permeable membrane such that at least one of CO.sub.2, H.sub.2S, and HCl is selectively transported through the membrane.

  16. Methods and systems relating to an augmented virtuality environment

    DOEpatents

    Nielsen, Curtis W; Anderson, Matthew O; McKay, Mark D; Wadsworth, Derek C; Boyce, Jodie R; Hruska, Ryan C; Koudelka, John A; Whetten, Jonathan; Bruemmer, David J

    2014-05-20

    Systems and methods relating to an augmented virtuality system are disclosed. A method of operating an augmented virtuality system may comprise displaying imagery of a real-world environment in an operating picture. The method may further include displaying a plurality of virtual icons in the operating picture representing at least some assets of a plurality of assets positioned in the real-world environment. Additionally, the method may include displaying at least one virtual item in the operating picture representing data sensed by one or more of the assets of the plurality of assets and remotely controlling at least one asset of the plurality of assets by interacting with a virtual icon associated with the at least one asset.

  17. Methods and compositions for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    2003-07-22

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  18. A Comparison of Foreign Language Teaching Methods: Total Physical Response versus Song/Chants with Kindergartners.

    ERIC Educational Resources Information Center

    Omari, Deena Rae

    Several teaching methods aid young children in learning foreign languages, all of which include continuous repetition and review of learned information. The two methods used in this study were Total Physical Response (TPR) and songs/chants. The TPR method used a gesture for each vocabulary card, and the songs/chants method incorporated Spanish…

  19. Energy Decision Science and Informatics | Integrated Energy Solutions |

    Science.gov Websites

    Science Advanced decision science methods include multi-objective and multi-criteria decision support. Our decision science methods, including multi-objective and multi-criteria decision support. For example, we

  20. Solving large-scale dynamic systems using band Lanczos method in Rockwell NASTRAN on CRAY X-MP

    NASA Technical Reports Server (NTRS)

    Gupta, V. K.; Zillmer, S. D.; Allison, R. E.

    1986-01-01

    The improved cost effectiveness using better models, more accurate and faster algorithms and large scale computing offers more representative dynamic analyses. The band Lanczos eigen-solution method was implemented in Rockwell's version of 1984 COSMIC-released NASTRAN finite element structural analysis computer program to effectively solve for structural vibration modes including those of large complex systems exceeding 10,000 degrees of freedom. The Lanczos vectors were re-orthogonalized locally using the Lanczos Method and globally using the modified Gram-Schmidt method for sweeping rigid-body modes and previously generated modes and Lanczos vectors. The truncated band matrix was solved for vibration frequencies and mode shapes using Givens rotations. Numerical examples are included to demonstrate the cost effectiveness and accuracy of the method as implemented in ROCKWELL NASTRAN. The CRAY version is based on RPK's COSMIC/NASTRAN. The band Lanczos method was more reliable and accurate and converged faster than the single vector Lanczos Method. The band Lanczos method was comparable to the subspace iteration method which was a block version of the inverse power method. However, the subspace matrix tended to be fully populated in the case of subspace iteration and not as sparse as a band matrix.

  1. Energy storage cell impedance measuring apparatus, methods and related systems

    DOEpatents

    Morrison, John L.; Morrison, William H.; Christophersen, Jon P.

    2017-12-26

    Energy storage cell impedance testing devices, circuits, and related methods are disclosed. An energy storage cell impedance measuring device includes a sum of sinusoids (SOS) current excitation circuit including differential current sources configured to isolate a ground terminal of the differential current sources from a positive terminal and a negative terminal of an energy storage cell. A method includes applying an SOS signal comprising a sum of sinusoidal current signals to the energy storage cell with the SOS current excitation circuit, each of the sinusoidal current signals oscillating at a different one of a plurality of different frequencies. The method also includes measuring an electrical signal at a positive terminal and a negative terminal of the energy storage cell, and computing an impedance of the energy storage cell at each of the plurality of different frequencies using the measured electrical signal.

  2. 2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method

    NASA Technical Reports Server (NTRS)

    Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)

    2000-01-01

    The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.

  3. Waterflooding injectate design systems and methods

    DOEpatents

    Brady, Patrick V.; Krumhansl, James L.

    2016-12-13

    A method of recovering a liquid hydrocarbon using an injectate includes recovering the liquid hydrocarbon through primary extraction. Physico-chemical data representative of electrostatic interactions between the liquid hydrocarbon and the reservoir rock are measured. At least one additive of the injectate is selected based on the physico-chemical data. The method includes recovering the liquid hydrocarbon from the reservoir rock through secondary extraction using the injectate.

  4. Method and apparatus for wind turbine braking

    DOEpatents

    Barbu, Corneliu [Laguna Hills, CA; Teichmann, Ralph [Nishkayuna, NY; Avagliano, Aaron [Houston, TX; Kammer, Leonardo Cesar [Niskayuna, NY; Pierce, Kirk Gee [Simpsonville, SC; Pesetsky, David Samuel [Greenville, SC; Gauchel, Peter [Muenster, DE

    2009-02-10

    A method for braking a wind turbine including at least one rotor blade coupled to a rotor. The method includes selectively controlling an angle of pitch of the at least one rotor blade with respect to a wind direction based on a design parameter of a component of the wind turbine to facilitate reducing a force induced into the wind turbine component as a result of braking.

  5. Superconducting articles, and methods for forming and using same

    DOEpatents

    Knoll, Allan Robert [Guilderland, NY; Lenseth, Kenneth Patrick [Wynantskill, NY

    2007-01-09

    A superconducting tape is disclosed, including a substrate having a first surface and a second surface opposite the first surface, the substrate including a plurality of indicia provided on the first surface spaced apart along a length of the substrate; and a superconductor layer overlying the second surface. Also disclosed are components incorporating superconducting tapes, methods for manufacturing same, and methods for using same.

  6. Activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, C.W.; Mangel, W.F.

    1999-08-10

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described. 29 figs.

  7. Activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, Carl W.; Mangel, Walter F.

    1999-08-10

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying said peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described.

  8. A Microcontroller-Based Device for Monitoring Blood Pressure in the Field

    DTIC Science & Technology

    1993-12-01

    Service de sant6 des Forces armies canadiennes. On a mis au point un appareil de mesure des signes vitaux, qui peut mesurer la fr~quence cardiaque et...methods for taking systolic and diastolic pressure readings include the auscultation method, the oscillometric method, and the ultrasonic method...pressures are determined from its output, are the best ways of distinguishing between the three main methods previously listed. The auscultation method

  9. Comparison of DNA extraction methods for meat analysis.

    PubMed

    Yalçınkaya, Burhanettin; Yumbul, Eylem; Mozioğlu, Erkan; Akgoz, Muslum

    2017-04-15

    Preventing adulteration of meat and meat products with less desirable or objectionable meat species is important not only for economical, religious and health reasons, but also, it is important for fair trade practices, therefore, several methods for identification of meat and meat products have been developed. In the present study, ten different DNA extraction methods, including Tris-EDTA Method, a modified Cetyltrimethylammonium Bromide (CTAB) Method, Alkaline Method, Urea Method, Salt Method, Guanidinium Isothiocyanate (GuSCN) Method, Wizard Method, Qiagen Method, Zymogen Method and Genespin Method were examined to determine their relative effectiveness for extracting DNA from meat samples. The results show that the salt method is easy to perform, inexpensive and environmentally friendly. Additionally, it has the highest yield among all the isolation methods tested. We suggest this method as an alternative method for DNA isolation from meat and meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Generational differences of baccalaureate nursing students' preferred teaching methods and faculty use of teaching methods

    NASA Astrophysics Data System (ADS)

    Delahoyde, Theresa

    Nursing education is experiencing a generational phenomenon with student enrollment spanning three generations. Classrooms of the 21st century include the occasional Baby Boomer and a large number of Generation X and Generation Y students. Each of these generations has its own unique set of characteristics that have been shaped by values, trends, behaviors, and events in society. These generational characteristics create vast opportunities to learn, as well as challenges. One such challenge is the use of teaching methods that are congruent with nursing student preferences. Although there is a wide range of studies conducted on student learning styles within the nursing education field, there is little research on the preferred teaching methods of nursing students. The purpose of this quantitative, descriptive study was to compare the preferred teaching methods of multi-generational baccalaureate nursing students with faculty use of teaching methods. The research study included 367 participants; 38 nursing faculty and 329 nursing students from five different colleges within the Midwest region. The results of the two-tailed t-test found four statistically significant findings between Generation X and Y students and their preferred teaching methods including; lecture, listening to the professor lecture versus working in groups; actively participating in group discussion; and the importance of participating in group assignments. The results of the Analysis of Variance (ANOVA) found seventeen statistically significant findings between levels of students (freshmen/sophomores, juniors, & seniors) and their preferred teaching methods. Lecture was found to be the most frequently used teaching method by faculty as well as the most preferred teaching method by students. Overall, the support for a variety of teaching methods was also found in the analysis of data.

  11. An exploration of the data collection methods utilised with children, teenagers and young people (CTYPs).

    PubMed

    Flanagan, Sarah M; Greenfield, Sheila; Coad, Jane; Neilson, Susan

    2015-03-01

    The impact of cancer upon children, teenagers and young people can be profound. Research has been undertaken to explore the impacts upon children, teenagers and young people with cancer, but little is known about how researchers can 'best' engage with this group to explore their experiences. This review paper provides an overview of the utility of data collection methods employed when undertaking research with children, teenagers and young people. A systematic review of relevant databases was undertaken utilising the search terms 'young people', 'young adult', 'adolescent' and 'data collection methods'. The full-text of the papers that were deemed eligible from the title and abstract were accessed and following discussion within the research team, thirty papers were included. Due to the heterogeneity in terms of the scope of the papers identified the following data collections methods were included in the results section. Three of the papers identified provided an overview of data collection methods utilised with this population and the remaining twenty seven papers covered the following data collection methods: Digital technologies; art based research; comparing the use of 'paper and pencil' research with web-based technologies, the use of games; the use of a specific communication tool; questionnaires and interviews; focus groups and telephone interviews/questionnaires. The strengths and limitations of the range of data collection methods included are discussed drawing upon such issues as of the appropriateness of particular methods for particular age groups, or the most appropriate method to employ when exploring a particularly sensitive topic area. There are a number of data collection methods utilised to undertaken research with children, teenagers and young adults. This review provides a summary of the current available evidence and an overview of the strengths and limitations of data collection methods employed.

  12. 30 CFR 250.1503 - What are my general responsibilities for training?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... plan that specifies the type, method(s), length, frequency, and content of the training for your employees. Your training plan must specify the method(s) of verifying employee understanding and performance. This plan must include at least the following information: (1) Procedures for training employees in...

  13. Minimizing the Free Energy: A Computer Method for Teaching Chemical Equilibrium Concepts.

    ERIC Educational Resources Information Center

    Heald, Emerson F.

    1978-01-01

    Presents a computer method for teaching chemical equilibrium concepts using material balance conditions and the minimization of the free energy. Method for the calculation of chemical equilibrium, the computer program used to solve equilibrium problems and applications of the method are also included. (HM)

  14. 31 CFR 203.10 - Electronic payment methods.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Electronic payment methods. 203.10... TAX AND LOAN PROGRAM Electronic Federal Tax Payments § 203.10 Electronic payment methods. (a) General. Electronic payment methods for Federal tax payments available under this subpart include ACH debit entries...

  15. 41 CFR 302-7.12 - What are the various methods of shipping HHG and how is the weight determined for each type of...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... BOOKS, PAPERS, AND EQUIPMENT (PBP&E) General Rules § 302-7.12 What are the various methods of shipping... economical method available. The various methods of shipment and weight calculations include the following...

  16. A Teacher's Guide to Memory Techniques.

    ERIC Educational Resources Information Center

    Hodges, Daniel L.

    1982-01-01

    To aid instructors in teaching their students to use effective methods of memorization, this article outlines major memory methods, provides examples of their use, evaluates the methods, and discusses ways students can be taught to apply them. First, common, but less effective, memory methods are presented, including reading and re-reading…

  17. 26 CFR 1.460-6 - Look-back method.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) for the redetermination year, as adjusted for past applications of the look-back method and taking... the year in question with respect to other contracts. Notwithstanding the look-back method, the...) INCOME TAXES Taxable Year for Which Items of Gross Income Included § 1.460-6 Look-back method. (a) In...

  18. Porosimetry as an effective method of fuel cell investigation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kazarinov, V.E.

    1996-04-01

    A porosimetric method is described for the investigation of all kinds of porous materials including soft or frail materials and powders. The method is well suited for the investigation of electrodes in fuel cells and batteries. The method is nondestructive and allows for repeated measurements on the same sample.

  19. Rapid identification of salmonella serotypes with stereo and hyperspectral microscope imaging Methods

    USDA-ARS?s Scientific Manuscript database

    The hyperspectral microscope imaging (HMI) method can reduce detection time within 8 hours including incubation process. The early and rapid detection with this method in conjunction with the high throughput capabilities makes HMI method a prime candidate for implementation for the food industry. Th...

  20. Rapid Identification of Salmonella Serotypes with Stereo and Hyperspectral Microscope Imaging Methods

    USDA-ARS?s Scientific Manuscript database

    The hyperspectral microscope imaging (HMI) method can reduce detection time within 8 hours including incubation process. The early and rapid detection with this method in conjunction with the high throughput capabilities makes HMI method a prime candidate for implementation for the food industry. Th...

  1. 31 CFR 203.10 - Electronic payment methods.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Electronic payment methods. 203.10... TAX AND LOAN PROGRAM Electronic Federal Tax Payments § 203.10 Electronic payment methods. (a) General. Electronic payment methods for Federal tax payments available under this subpart include ACH debit entries...

  2. 31 CFR 203.10 - Electronic payment methods.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Electronic payment methods. 203.10... TAX AND LOAN PROGRAM Electronic Federal Tax Payments § 203.10 Electronic payment methods. (a) General. Electronic payment methods for Federal tax payments available under this subpart include ACH debit entries...

  3. 31 CFR 203.10 - Electronic payment methods.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Electronic payment methods. 203.10... TAX AND LOAN PROGRAM Electronic Federal Tax Payments § 203.10 Electronic payment methods. (a) General. Electronic payment methods for Federal tax payments available under this subpart include ACH debit entries...

  4. 31 CFR 203.10 - Electronic payment methods.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Electronic payment methods. 203.10... TAX AND LOAN PROGRAM Electronic Federal Tax Payments § 203.10 Electronic payment methods. (a) General. Electronic payment methods for Federal tax payments available under this subpart include ACH debit entries...

  5. Method of Detecting Coliform Bacteria and Escherichia Coli Bacteria from Reflected Light

    NASA Technical Reports Server (NTRS)

    Vincent, Robert (Inventor)

    2013-01-01

    The present invention relates to a method of detecting coliform bacteria in water from reflected light and a method of detecting Eschericha Coli bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

  6. Practical techniques for enhancing the high-frequency MASW method

    USDA-ARS?s Scientific Manuscript database

    For soil exploration in the vadose zone, a high-frequency multi-channel analysis of surface waves (HF-MASW) method has been developed. In the study, several practical techniques were applied to enhance the overtone image of the HF-MASW method. They included (1) the self-adaptive MASW method using a ...

  7. Evaluation of dysphagia in early stroke patients by bedside, endoscopic, and electrophysiological methods.

    PubMed

    Umay, Ebru Karaca; Unlu, Ece; Saylam, Guleser Kılıc; Cakci, Aytul; Korkmaz, Hakan

    2013-09-01

    We aimed in this study to evaluate dysphagia in early stroke patients using a bedside screening test and flexible fiberoptic endoscopic evaluation of swallowing (FFEES) and electrophysiological evaluation (EE) methods and to compare the effectiveness of these methods. Twenty-four patients who were hospitalized in our clinic within the first 3 months after stroke were included in this study. Patients were evaluated using a bedside screening test [including bedside dysphagia score (BDS), neurological examination dysphagia score (NEDS), and total dysphagia score (TDS)] and FFEES and EE methods. Patients were divided into normal-swallowing and dysphagia groups according to the results of the evaluation methods. Patients with dysphagia as determined by any of these methods were compared to the patients with normal swallowing based on the results of the other two methods. Based on the results of our study, a high BDS was positively correlated with dysphagia identified by FFEES and EE methods. Moreover, the FFEES and EE methods were positively correlated. There was no significant correlation between NEDS and TDS levels and either EE or FFEES method. Bedside screening tests should be used mainly as an initial screening test; then FFEES and EE methods should be combined in patients who show risks. This diagnostic algorithm may provide a practical and fast solution for selected stroke patients.

  8. System and method for diagnosing EGR performance using NOx sensor

    DOEpatents

    Mazur, Christopher John

    2003-12-23

    A method and system for diagnosing a condition of an EGR valve used in an engine system. The EGR valve controls the portion exhaust gases produced by such engine system and fed back to an intake of such engine system. The engine system includes a NOx sensor for measuring NOx in such exhaust. The method includes: determining a time rate of change in NOx measured by the NOx sensor; comparing the determined time rate of change in the measured NOx with a predetermined expected time rate of change in measured NOx; and determining the condition of the EGR valve as a function of such comparison. The method also includes: determining from NOx measured by the NOx sensor and engine operating conditions indications of instances when samples of such measured NOx are greater than an expected maximum NOx level for such engine condition and less than an expected minimum NOx level for such engine condition; and determining the condition of the EGR valve as a function of a statistical analysis of such indications. The method includes determining whether the NOx sensor is faulty and wherein the EGR condition determining includes determining whether the NOx sensor is faulty.

  9. Accuracy of the visual estimation method as a predictor of food intake in Alzheimer's patients provided with different types of food.

    PubMed

    Amano, Nobuko; Nakamura, Tomiyo

    2018-02-01

    The visual estimation method is commonly used in hospitals and other care facilities to evaluate food intake through estimation of plate waste. In Japan, no previous studies have investigated the validity and reliability of this method under the routine conditions of a hospital setting. The present study aimed to evaluate the validity and reliability of the visual estimation method, in long-term inpatients with different levels of eating disability caused by Alzheimer's disease. The patients were provided different therapeutic diets presented in various food types. This study was performed between February and April 2013, and 82 patients with Alzheimer's disease were included. Plate waste was evaluated for the 3 main daily meals, for a total of 21 days, 7 consecutive days during each of the 3 months, originating a total of 4851 meals, from which 3984 were included. Plate waste was measured by the nurses through the visual estimation method, and by the hospital's registered dietitians through the actual measurement method. The actual measurement method was first validated to serve as a reference, and the level of agreement between both methods was then determined. The month, time of day, type of food provided, and patients' physical characteristics were considered for analysis. For the 3984 meals included in the analysis, the level of agreement between the measurement methods was 78.4%. Disagreement of measurements consisted of 3.8% of underestimation and 17.8% of overestimation. Cronbach's α (0.60, P < 0.001) indicated that the reliability of the visual estimation method was within the acceptable range. The visual estimation method was found to be a valid and reliable method for estimating food intake in patients with different levels of eating impairment. The successful implementation and use of the method depends upon adequate training and motivation of the nurses and care staff involved. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  10. Flood-frequency prediction methods for unregulated streams of Tennessee, 2000

    USGS Publications Warehouse

    Law, George S.; Tasker, Gary D.

    2003-01-01

    Up-to-date flood-frequency prediction methods for unregulated, ungaged rivers and streams of Tennessee have been developed. Prediction methods include the regional-regression method and the newer region-of-influence method. The prediction methods were developed using stream-gage records from unregulated streams draining basins having from 1 percent to about 30 percent total impervious area. These methods, however, should not be used in heavily developed or storm-sewered basins with impervious areas greater than 10 percent. The methods can be used to estimate 2-, 5-, 10-, 25-, 50-, 100-, and 500-year recurrence-interval floods of most unregulated rural streams in Tennessee. A computer application was developed that automates the calculation of flood frequency for unregulated, ungaged rivers and streams of Tennessee. Regional-regression equations were derived by using both single-variable and multivariable regional-regression analysis. Contributing drainage area is the explanatory variable used in the single-variable equations. Contributing drainage area, main-channel slope, and a climate factor are the explanatory variables used in the multivariable equations. Deleted-residual standard error for the single-variable equations ranged from 32 to 65 percent. Deleted-residual standard error for the multivariable equations ranged from 31 to 63 percent. These equations are included in the computer application to allow easy comparison of results produced by the different methods. The region-of-influence method calculates multivariable regression equations for each ungaged site and recurrence interval using basin characteristics from 60 similar sites selected from the study area. Explanatory variables that may be used in regression equations computed by the region-of-influence method include contributing drainage area, main-channel slope, a climate factor, and a physiographic-region factor. Deleted-residual standard error for the region-of-influence method tended to be only slightly smaller than those for the regional-regression method and ranged from 27 to 62 percent.

  11. Pharmacoeconomics

    PubMed Central

    Hughes, Dyfrig A

    2012-01-01

    Pharmacoeconomics is an essential component of health technology assessment and the appraisal of medicines for use by UK National Health Service (NHS) patients. As a comparatively young discipline, its methods continue to evolve. Priority research areas for development include methods for synthesizing indirect comparisons when head-to-head trials have not been performed, synthesizing qualitative evidence (for example, stakeholder views), addressing the limitations of the EQ-5D tool for assessing quality of life, including benefits not captured in quality-adjusted life years (QALYs), ways of assessing valuation methods (for determining utility scores), extrapolation of costs and benefits beyond those observed in trials, early estimation of cost-effectiveness (including mechanism-based economic evaluation), methods for incorporating the impact of non-adherence and the role of behavioural economics in influencing patients and prescribers. PMID:22360714

  12. The method of complex characteristics for design of transonic blade sections

    NASA Technical Reports Server (NTRS)

    Bledsoe, M. R.

    1986-01-01

    A variety of computational methods were developed to obtain shockless or near shockless flow past two-dimensional airfoils. The approach used was the method of complex characteristics, which determines smooth solutions to the transonic flow equations based on an input speed distribution. General results from fluid mechanics are presented. An account of the method of complex characteristics is given including a description of the particular spaces and coordinates, conformal transformations, and numerical procedures that are used. The operation of the computer program COMPRES is presented along with examples of blade sections designed with the code. A user manual is included with a glossary to provide additional information which may be helpful. The computer program in Fortran, including numerous comment cards is listed.

  13. Method and system to measure temperature of gases using coherent anti-stokes doppler spectroscopy

    DOEpatents

    Rhodes, Mark

    2013-12-17

    A method of measuring a temperature of a noble gas in a chamber includes providing the noble gas in the chamber. The noble gas is characterized by a pressure and a temperature. The method also includes directing a first laser beam into the chamber and directing a second laser beam into the chamber. The first laser beam is characterized by a first frequency and the second laser beam is characterized by a second frequency. The method further includes converting at least a portion of the first laser beam and the second laser beam into a coherent anti-Stokes beam, measuring a Doppler broadening of the coherent anti-Stokes beam, and computing the temperature using the Doppler broadening.

  14. Method Of Wire Insertion For Electric Machine Stators

    DOEpatents

    Brown, David L; Stabel, Gerald R; Lawrence, Robert Anthony

    2005-02-08

    A method of inserting coils in slots of a stator is provided. The method includes interleaving a first set of first phase windings and a first set of second phase windings on an insertion tool. The method also includes activating the insertion tool to radially insert the first set of first phase windings and the first set of second phase windings in the slots of the stator. In one embodiment, interleaving the first set of first phase windings and the first set of second phase windings on the insertion tool includes forming the first set of first phase windings in first phase openings defined in the insertion tool, and forming the first set of second phase windings in second phase openings defined in the insertion tool.

  15. Methodology issues in implementation science.

    PubMed

    Newhouse, Robin; Bobay, Kathleen; Dykes, Patricia C; Stevens, Kathleen R; Titler, Marita

    2013-04-01

    Putting evidence into practice at the point of care delivery requires an understanding of implementation strategies that work, in what context and how. To identify methodological issues in implementation science using 4 studies as cases and make recommendations for further methods development. Four cases are presented and methodological issues identified. For each issue raised, evidence on the state of the science is described. Issues in implementation science identified include diverse conceptual frameworks, potential weaknesses in pragmatic study designs, and the paucity of standard concepts and measurement. Recommendations to advance methods in implementation include developing a core set of implementation concepts and metrics, generating standards for implementation methods including pragmatic trials, mixed methods designs, complex interventions and measurement, and endorsing reporting standards for implementation studies.

  16. Method of surface preparation of niobium

    DOEpatents

    Srinivasan-Rao, Triveni; Schill, John F.

    2003-01-01

    The present invention is for a method of preparing a surface of niobium. The preparation method includes polishing, cleaning, baking and irradiating the niobium surface whereby the resulting niobium surface has a high quantum efficiency.

  17. Method of Detecting Coliform Bacteria from Reflected Light

    NASA Technical Reports Server (NTRS)

    Vincent, Robert K. (Inventor)

    2014-01-01

    The present invention relates to a method of detecting coliform bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

  18. [RESEARCH PROGRESS OF EXPERIMENTAL ANIMAL MODELS OF AVASCULAR NECROSIS OF FEMORAL HEAD].

    PubMed

    Yu, Kaifu; Tan, Hongbo; Xu, Yongqing

    2015-12-01

    To summarize the current researches and progress on experimental animal models of avascular necrosis of the femoral head. Domestic and internation literature concerning experimental animal models of avascular necrosis of the femoral head was reviewed and analyzed. The methods to prepare the experimental animal models of avascular necrosis of the femoral head can be mainly concluded as traumatic methods (including surgical, physical, and chemical insult), and non-traumatic methods (including steroid, lipopolysaccharide, steroid combined with lipopolysaccharide, steroid combined with horse serum, etc). Each method has both merits and demerits, yet no ideal methods have been developed. There are many methods to prepare the experimental animal models of avascular necrosis of the femoral head, but proper model should be selected based on the aim of research. The establishment of ideal experimental animal models needs further research in future.

  19. A review of numerical techniques approaching microstructures of crystalline rocks

    NASA Astrophysics Data System (ADS)

    Zhang, Yahui; Wong, Louis Ngai Yuen

    2018-06-01

    The macro-mechanical behavior of crystalline rocks including strength, deformability and failure pattern are dominantly influenced by their grain-scale structures. Numerical technique is commonly used to assist understanding the complicated mechanisms from a microscopic perspective. Each numerical method has its respective strengths and limitations. This review paper elucidates how numerical techniques take geometrical aspects of the grain into consideration. Four categories of numerical methods are examined: particle-based methods, block-based methods, grain-based methods, and node-based methods. Focusing on the grain-scale characters, specific relevant issues including increasing complexity of micro-structure, deformation and breakage of model elements, fracturing and fragmentation process are described in more detail. Therefore, the intrinsic capabilities and limitations of different numerical approaches in terms of accounting for the micro-mechanics of crystalline rocks and their phenomenal mechanical behavior are explicitly presented.

  20. [An Introduction to Methods for Evaluating Health Care Technology].

    PubMed

    Lee, Ting-Ting

    2015-06-01

    The rapid and continual advance of healthcare technology makes ensuring that this technology is used effectively to achieve its original goals a critical issue. This paper presents three methods that may be applied by healthcare professionals in the evaluation of healthcare technology. These methods include: the perception/experiences of users, user work-pattern changes, and chart review or data mining. The first method includes two categories: using interviews to explore the user experience and using theory-based questionnaire surveys. The second method applies work sampling to observe the work pattern changes of users. The last method conducts chart reviews or data mining to analyze the designated variables. In conclusion, while evaluative feedback may be used to improve the design and development of healthcare technology applications, the informatics competency and informatics literacy of users may be further explored in future research.

  1. Environmental and economic assessment methods for waste management decision-support: possibilities and limitations.

    PubMed

    Finnveden, Göran; Björklund, Anna; Moberg, Asa; Ekvall, Tomas

    2007-06-01

    A large number of methods and approaches that can be used for supporting waste management decisions at different levels in society have been developed. In this paper an overview of methods is provided and preliminary guidelines for the choice of methods are presented. The methods introduced include: Environmental Impact Assessment, Strategic Environmental Assessment, Life Cycle Assessment, Cost-Benefit Analysis, Cost-effectiveness Analysis, Life-cycle Costing, Risk Assessment, Material Flow Accounting, Substance Flow Analysis, Energy Analysis, Exergy Analysis, Entropy Analysis, Environmental Management Systems, and Environmental Auditing. The characteristics used are the types of impacts included, the objects under study and whether the method is procedural or analytical. The different methods can be described as systems analysis methods. Waste management systems thinking is receiving increasing attention. This is, for example, evidenced by the suggested thematic strategy on waste by the European Commission where life-cycle analysis and life-cycle thinking get prominent positions. Indeed, life-cycle analyses have been shown to provide policy-relevant and consistent results. However, it is also clear that the studies will always be open to criticism since they are simplifications of reality and include uncertainties. This is something all systems analysis methods have in common. Assumptions can be challenged and it may be difficult to generalize from case studies to policies. This suggests that if decisions are going to be made, they are likely to be made on a less than perfect basis.

  2. Comparison of some optimal control methods for the design of turbine blades

    NASA Technical Reports Server (NTRS)

    Desilva, B. M. E.; Grant, G. N. C.

    1977-01-01

    This paper attempts a comparative study of some numerical methods for the optimal control design of turbine blades whose vibration characteristics are approximated by Timoshenko beam idealizations with shear and incorporating simple boundary conditions. The blade was synthesized using the following methods: (1) conjugate gradient minimization of the system Hamiltonian in function space incorporating penalty function transformations, (2) projection operator methods in a function space which includes the frequencies of vibration and the control function, (3) epsilon-technique penalty function transformation resulting in a highly nonlinear programming problem, (4) finite difference discretization of the state equations again resulting in a nonlinear program, (5) second variation methods with complex state differential equations to include damping effects resulting in systems of inhomogeneous matrix Riccatti equations some of which are stiff, (6) quasi-linear methods based on iterative linearization of the state and adjoint equation. The paper includes a discussion of some substantial computational difficulties encountered in the implementation of these techniques together with a resume of work presently in progress using a differential dynamic programming approach.

  3. Learning spinal manipulation: A best-evidence synthesis of teaching methods*

    PubMed Central

    Stainsby, Brynne E.; Clarke, Michelle C.S.; Egonia, Jade R.

    2016-01-01

    Objective: The purpose of this study was to evaluate the effectiveness of different reported methods used to teach spinal manipulative therapy to chiropractic students. Methods: For this best-evidence literature synthesis, 5 electronic databases were searched from 1900 to 2015. Eligible studies were critically appraised using the criteria of the Scottish Intercollegiate Guidelines Network. Scientifically admissible studies were synthesized following best-evidence synthesis principles. Results: Twenty articles were critically appraised, including 9 randomized clinical trials, 9 cohort studies, and 2 systematic reviews/meta-analyses. Eleven articles were accepted as scientifically admissible. The type of teaching method aids included a Thrust in Motion cervical manikin, instrumented cardiopulmonary reanimation manikin, padded contact with a load cell, instrumented treatment table with force sensor/transducer, and Dynadjust instrument. Conclusions: Several different methods exist in the literature for teaching spinal manipulative therapy techniques; however, future research in this developing area of chiropractic education is proposed. It is suggested that various teaching methods be included in the regular curricula of chiropractic colleges to aid in developing manipulation skills, efficiency, and knowledge of performance. PMID:26998630

  4. Constrained CVT meshes and a comparison of triangular mesh generators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Hoa; Burkardt, John; Gunzburger, Max

    2009-01-01

    Mesh generation in regions in Euclidean space is a central task in computational science, and especially for commonly used numerical methods for the solution of partial differential equations, e.g., finite element and finite volume methods. We focus on the uniform Delaunay triangulation of planar regions and, in particular, on how one selects the positions of the vertices of the triangulation. We discuss a recently developed method, based on the centroidal Voronoi tessellation (CVT) concept, for effecting such triangulations and present two algorithms, including one new one, for CVT-based grid generation. We also compare several methods, including CVT-based methods, for triangulatingmore » planar domains. To this end, we define several quantitative measures of the quality of uniform grids. We then generate triangulations of several planar regions, including some having complexities that are representative of what one may encounter in practice. We subject the resulting grids to visual and quantitative comparisons and conclude that all the methods considered produce high-quality uniform grids and that the CVT-based grids are at least as good as any of the others.« less

  5. Separating semiconductor devices from substrate by etching graded composition release layer disposed between semiconductor devices and substrate including forming protuberances that reduce stiction

    DOEpatents

    Tauke-Pedretti, Anna; Nielson, Gregory N; Cederberg, Jeffrey G; Cruz-Campa, Jose Luis

    2015-05-12

    A method includes etching a release layer that is coupled between a plurality of semiconductor devices and a substrate with an etch. The etching includes etching the release layer between the semiconductor devices and the substrate until the semiconductor devices are at least substantially released from the substrate. The etching also includes etching a protuberance in the release layer between each of the semiconductor devices and the substrate. The etch is stopped while the protuberances remain between each of the semiconductor devices and the substrate. The method also includes separating the semiconductor devices from the substrate. Other methods and apparatus are also disclosed.

  6. Methods and systems to thermally protect fuel nozzles in combustion systems

    DOEpatents

    Helmick, David Andrew; Johnson, Thomas Edward; York, William David; Lacy, Benjamin Paul

    2013-12-17

    A method of assembling a gas turbine engine is provided. The method includes coupling a combustor in flow communication with a compressor such that the combustor receives at least some of the air discharged by the compressor. A fuel nozzle assembly is coupled to the combustor and includes at least one fuel nozzle that includes a plurality of interior surfaces, wherein a thermal barrier coating is applied across at least one of the plurality of interior surfaces to facilitate shielding the interior surfaces from combustion gases.

  7. Neutron absorbers and methods of forming at least a portion of a neutron absorber

    DOEpatents

    Guillen, Donna P; Porter, Douglas L; Swank, W David; Erickson, Arnold W

    2014-12-02

    Methods of forming at least a portion of a neutron absorber include combining a first material and a second material to form a compound, reducing the compound into a plurality of particles, mixing the plurality of particles with a third material, and pressing the mixture of the plurality of particles and the third material. One or more components of neutron absorbers may be formed by such methods. Neutron absorbers may include a composite material including an intermetallic compound comprising hafnium aluminide and a matrix material comprising pure aluminum.

  8. Charge gradient microscopy

    DOEpatents

    Roelofs, Andreas; Hong, Seungbum

    2018-02-06

    A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.

  9. Solar cell contact formation using laser ablation

    DOEpatents

    Harley, Gabriel; Smith, David D.; Cousins, Peter John

    2015-07-21

    The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline material layer; and forming conductive contacts in the plurality of contact holes.

  10. Solar cell contact formation using laser ablation

    DOEpatents

    Harley, Gabriel; Smith, David; Cousins, Peter

    2012-12-04

    The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline material layer; and forming conductive contacts in the plurality of contact holes.

  11. Solar cell contact formation using laser ablation

    DOEpatents

    Harley, Gabriel; Smith, David D.; Cousins, Peter John

    2014-07-22

    The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline materiat layer; and forming conductive contacts in the plurality of contact holes.

  12. Apparatus and method to enhance X-ray production in laser produced plasmas

    DOEpatents

    Augustoni, Arnold L.; Gerardo, James B.; Raymond, Thomas D.

    1992-01-01

    Method and apparatus for generating x-rays for use in, for instance, x-ray photolithography. The method of generating x-rays includes the steps of providing a target and irradiating the target with a laser system which produces a train of sub-pulses to generate an x-ray producing plasma. The sub-pulses are of both high intensity and short duration. The apparatus for generating x-rays from a plasma includes a vacuum chamber, a target supported within the chamber and a laser system, including a short storage time laser.

  13. Co-factor activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, Carl W.; Mangel, Walter F.

    1996-08-06

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying said peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described.

  14. Co-factor activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, C.W.; Mangel, W.F.

    1996-08-06

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying the peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described. 29 figs.

  15. Life cycle management of analytical methods.

    PubMed

    Parr, Maria Kristina; Schmidt, Alexander H

    2018-01-05

    In modern process management, the life cycle concept gains more and more importance. It focusses on the total costs of the process from invest to operation and finally retirement. Also for analytical procedures an increasing interest for this concept exists in the recent years. The life cycle of an analytical method consists of design, development, validation (including instrumental qualification, continuous method performance verification and method transfer) and finally retirement of the method. It appears, that also regulatory bodies have increased their awareness on life cycle management for analytical methods. Thus, the International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH), as well as the United States Pharmacopeial Forum discuss the enrollment of new guidelines that include life cycle management of analytical methods. The US Pharmacopeia (USP) Validation and Verification expert panel already proposed a new General Chapter 〈1220〉 "The Analytical Procedure Lifecycle" for integration into USP. Furthermore, also in the non-regulated environment a growing interest on life cycle management is seen. Quality-by-design based method development results in increased method robustness. Thereby a decreased effort is needed for method performance verification, and post-approval changes as well as minimized risk of method related out-of-specification results. This strongly contributes to reduced costs of the method during its life cycle. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Gaussian Quadrature is an efficient method for the back-transformation in estimating the usual intake distribution when assessing dietary exposure.

    PubMed

    Dekkers, A L M; Slob, W

    2012-10-01

    In dietary exposure assessment, statistical methods exist for estimating the usual intake distribution from daily intake data. These methods transform the dietary intake data to normal observations, eliminate the within-person variance, and then back-transform the data to the original scale. We propose Gaussian Quadrature (GQ), a numerical integration method, as an efficient way of back-transformation. We compare GQ with six published methods. One method uses a log-transformation, while the other methods, including GQ, use a Box-Cox transformation. This study shows that, for various parameter choices, the methods with a Box-Cox transformation estimate the theoretical usual intake distributions quite well, although one method, a Taylor approximation, is less accurate. Two applications--on folate intake and fruit consumption--confirmed these results. In one extreme case, some methods, including GQ, could not be applied for low percentiles. We solved this problem by modifying GQ. One method is based on the assumption that the daily intakes are log-normally distributed. Even if this condition is not fulfilled, the log-transformation performs well as long as the within-individual variance is small compared to the mean. We conclude that the modified GQ is an efficient, fast and accurate method for estimating the usual intake distribution. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    DOEpatents

    West, Phillip B [Idaho Falls, ID; Novascone, Stephen R [Idaho Falls, ID; Wright, Jerry P [Idaho Falls, ID

    2012-05-29

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  18. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    DOEpatents

    West, Phillip B [Idaho Falls, ID; Novascone, Stephen R [Idaho Falls, ID; Wright, Jerry P [Idaho Falls, ID

    2011-09-27

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  19. Handbook of Research Methods in Social and Personality Psychology

    NASA Astrophysics Data System (ADS)

    Reis, Harry T.; Judd, Charles M.

    2000-03-01

    This volume provides an overview of research methods in contemporary social psychology. Coverage includes conceptual issues in research design, methods of research, and statistical approaches. Because the range of research methods available for social psychology have expanded extensively in the past decade, both traditional and innovative methods are presented. The goal is to introduce new and established researchers alike to new methodological developments in the field.

  20. Effects of Drama Method on Speaking Anxieties of Pre-Service Teachers and Their Opinions about the Method

    ERIC Educational Resources Information Center

    Sevim, Oguzhan

    2014-01-01

    The aim of this study is to determine the effects of the drama method on speaking anxieties of pre-service teachers and their opinions about the method. In the study, mixed method including experimental design, quantitative, and basic qualitative research was used. The study was carried out with 77 first grade students from day-time and evening…

  1. Techniques of Water-Resources Investigations of the United States Geological Survey. Book 5, Laboratory Analysis. Chapter A5, Methods for Determination of Radioactive Substances in Water and Fluvial Sediments.

    ERIC Educational Resources Information Center

    Thatcher, L. L.; And Others

    Analytical methods for determining important components of fission and natural radioactivity found in water are reported. The discussion of each method includes conditions for application of the method, a summary of the method, interferences, required apparatus, procedures, calculations and estimation of precision. Isotopes considered are…

  2. Three-dimensional Stress Analysis Using the Boundary Element Method

    NASA Technical Reports Server (NTRS)

    Wilson, R. B.; Banerjee, P. K.

    1984-01-01

    The boundary element method is to be extended (as part of the NASA Inelastic Analysis Methods program) to the three-dimensional stress analysis of gas turbine engine hot section components. The analytical basis of the method (as developed in elasticity) is outlined, its numerical implementation is summarized, and the approaches to be followed in extending the method to include inelastic material response indicated.

  3. Multi-layer articles and methods of making same

    DOEpatents

    Fritzemeier, Leslie G.; Zhang, Wei; Palm, Walter C.; Rupich, Martin W.

    2005-05-17

    The invention relates to superconductor articles, and compositions and methods for making superconductor articles. The methods can include using a precursor solution having a relatively small concentration of total free acid. The articles can include more than one layer of superconductor material in which at least one layer of superconductor material can be formed by a solution process, such as a solution process involving the use of metalorganic precursors.

  4. Compounds, compositions, pharmaceutical compositions, and methods of use

    DOEpatents

    Hammond, Gerald B.; Jin, Zhuang; Bates, Paula J.; Reyes-Reyes, Elsa Merit

    2016-11-15

    Certain embodiments of the invention include compositions comprising a compound of Formula (I), and salts, isomers, and derivatives thereof. Pharmaceutical compositions of some embodiments of the present invention comprise a compound of Formula (I), and salts, isomers, and derivatives thereof. Other embodiments of this invention include methods for treating disease (e.g., cancer) and methods for administering a compound of Formula (I), and salts, isomers, and derivatives thereof.

  5. Low temperature chemical processing of graphite-clad nuclear fuels

    DOEpatents

    Pierce, Robert A.

    2017-10-17

    A reduced-temperature method for treatment of a fuel element is described. The method includes molten salt treatment of a fuel element with a nitrate salt. The nitrate salt can oxidize the outer graphite matrix of a fuel element. The method can also include reduced temperature degradation of the carbide layer of a fuel element and low temperature solubilization of the fuel in a kernel of a fuel element.

  6. GneimoSim: A Modular Internal Coordinates Molecular Dynamics Simulation Package

    PubMed Central

    Larsen, Adrien B.; Wagner, Jeffrey R.; Kandel, Saugat; Salomon-Ferrer, Romelia; Vaidehi, Nagarajan; Jain, Abhinandan

    2014-01-01

    The Generalized Newton Euler Inverse Mass Operator (GNEIMO) method is an advanced method for internal coordinates molecular dynamics (ICMD). GNEIMO includes several theoretical and algorithmic advancements that address longstanding challenges with ICMD simulations. In this paper we describe the GneimoSim ICMD software package that implements the GNEIMO method. We believe that GneimoSim is the first software package to include advanced features such as the equipartition principle derived for internal coordinates, and a method for including the Fixman potential to eliminate systematic statistical biases introduced by the use of hard constraints. Moreover, by design, GneimoSim is extensible and can be easily interfaced with third party force field packages for ICMD simulations. Currently, GneimoSim includes interfaces to LAMMPS, OpenMM, Rosetta force field calculation packages. The availability of a comprehensive Python interface to the underlying C++ classes and their methods provides a powerful and versatile mechanism for users to develop simulation scripts to configure the simulation and control the simulation flow. GneimoSim has been used extensively for studying the dynamics of protein structures, refinement of protein homology models, and for simulating large scale protein conformational changes with enhanced sampling methods. GneimoSim is not limited to proteins and can also be used for the simulation of polymeric materials. PMID:25263538

  7. GneimoSim: a modular internal coordinates molecular dynamics simulation package.

    PubMed

    Larsen, Adrien B; Wagner, Jeffrey R; Kandel, Saugat; Salomon-Ferrer, Romelia; Vaidehi, Nagarajan; Jain, Abhinandan

    2014-12-05

    The generalized Newton-Euler inverse mass operator (GNEIMO) method is an advanced method for internal coordinates molecular dynamics (ICMD). GNEIMO includes several theoretical and algorithmic advancements that address longstanding challenges with ICMD simulations. In this article, we describe the GneimoSim ICMD software package that implements the GNEIMO method. We believe that GneimoSim is the first software package to include advanced features such as the equipartition principle derived for internal coordinates, and a method for including the Fixman potential to eliminate systematic statistical biases introduced by the use of hard constraints. Moreover, by design, GneimoSim is extensible and can be easily interfaced with third party force field packages for ICMD simulations. Currently, GneimoSim includes interfaces to LAMMPS, OpenMM, and Rosetta force field calculation packages. The availability of a comprehensive Python interface to the underlying C++ classes and their methods provides a powerful and versatile mechanism for users to develop simulation scripts to configure the simulation and control the simulation flow. GneimoSim has been used extensively for studying the dynamics of protein structures, refinement of protein homology models, and for simulating large scale protein conformational changes with enhanced sampling methods. GneimoSim is not limited to proteins and can also be used for the simulation of polymeric materials. © 2014 Wiley Periodicals, Inc.

  8. Methods for determination of inorganic substances in water and fluvial sediments

    USGS Publications Warehouse

    Fishman, Marvin J.; Friedman, Linda C.

    1989-01-01

    Chapter Al of the laboratory manual contains methods used by the U.S. Geological Survey to analyze samples of water, suspended sediments, and bottom material for their content of inorganic constituents. Included are methods for determining the concentration of dissolved constituents in water, the total recoverable and total of constituents in water-suspended sediment samples, and the recoverable and total concentrations of constituents in samples of bottom material. The introduction to the manual includes essential definitions and a brief discussion of the use of significant figures in calculating and reporting analytical results. Quality control in the water-analysis laboratory is discussed, including the accuracy and precision of analyses, the use of standard-reference water samples, and the operation of an effective quality-assurance program. Methods for sample preparation and pretreatment are given also. A brief discussion of the principles of the analytical techniques involved and their particular application to water and sediment analysis is presented. The analytical methods of these techniques are arranged alphabetically by constituent. For each method, the general topics covered are the application, the principle of the method, the interferences, the apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data, when available. More than 126 methods are given for the determination of 70 inorganic constituents and physical properties of water, suspended sediment, and bottom material.

  9. Methods for determination of inorganic substances in water and fluvial sediments

    USGS Publications Warehouse

    Fishman, Marvin J.; Friedman, Linda C.

    1985-01-01

    Chapter Al of the laboratory manual contains methods used by the Geological Survey to analyze samples of water, suspended sediments, and bottom material for their content of inorganic constituents. Included are methods for determining the concentration of dissolved constituents in water, total recoverable and total of constituents in water-suspended sediment samples, and recoverable and total concentrations of constituents in samples of bottom material. Essential definitions are included in the introduction to the manual, along with a brief discussion of the use of significant figures in calculating and reporting analytical results. Quality control in the water-analysis laboratory is discussed, including accuracy and precision of analyses, the use of standard reference water samples, and the operation of an effective quality assurance program. Methods for sample preparation and pretreatment are given also.A brief discussion of the principles of the analytical techniques involved and their particular application to water and sediment analysis is presented. The analytical methods involving these techniques are arranged alphabetically according to constituent. For each method given, the general topics covered are application, principle of the method, interferences, apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data, when available. More than 125 methods are given for the determination of 70 different inorganic constituents and physical properties of water, suspended sediment, and bottom material.

  10. Testing contamination source identification methods for water distribution networks

    DOE PAGES

    Seth, Arpan; Klise, Katherine A.; Siirola, John D.; ...

    2016-04-01

    In the event of contamination in a water distribution network (WDN), source identification (SI) methods that analyze sensor data can be used to identify the source location(s). Knowledge of the source location and characteristics are important to inform contamination control and cleanup operations. Various SI strategies that have been developed by researchers differ in their underlying assumptions and solution techniques. The following manuscript presents a systematic procedure for testing and evaluating SI methods. The performance of these SI methods is affected by various factors including the size of WDN model, measurement error, modeling error, time and number of contaminant injections,more » and time and number of measurements. This paper includes test cases that vary these factors and evaluates three SI methods on the basis of accuracy and specificity. The tests are used to review and compare these different SI methods, highlighting their strengths in handling various identification scenarios. These SI methods and a testing framework that includes the test cases and analysis tools presented in this paper have been integrated into EPA’s Water Security Toolkit (WST), a suite of software tools to help researchers and others in the water industry evaluate and plan various response strategies in case of a contamination incident. Lastly, a set of recommendations are made for users to consider when working with different categories of SI methods.« less

  11. The importance of quality control in validating concentrations of contaminants of emerging concern in source and treated drinking water samples.

    PubMed

    Batt, Angela L; Furlong, Edward T; Mash, Heath E; Glassmeyer, Susan T; Kolpin, Dana W

    2017-02-01

    A national-scale survey of 247 contaminants of emerging concern (CECs), including organic and inorganic chemical compounds, and microbial contaminants, was conducted in source and treated drinking water samples from 25 treatment plants across the United States. Multiple methods were used to determine these CECs, including six analytical methods to measure 174 pharmaceuticals, personal care products, and pesticides. A three-component quality assurance/quality control (QA/QC) program was designed for the subset of 174 CECs which allowed us to assess and compare performances of the methods used. The three components included: 1) a common field QA/QC protocol and sample design, 2) individual investigator-developed method-specific QA/QC protocols, and 3) a suite of 46 method comparison analytes that were determined in two or more analytical methods. Overall method performance for the 174 organic chemical CECs was assessed by comparing spiked recoveries in reagent, source, and treated water over a two-year period. In addition to the 247 CECs reported in the larger drinking water study, another 48 pharmaceutical compounds measured did not consistently meet predetermined quality standards. Methodologies that did not seem suitable for these analytes are overviewed. The need to exclude analytes based on method performance demonstrates the importance of additional QA/QC protocols. Published by Elsevier B.V.

  12. Modified carbohydrate-chitosan compounds, methods of making the same and methods of using the same

    DOEpatents

    Venditti, Richard A; Pawlak, Joel J; Salam, Abdus; El-Tahlawy, Khaled Fathy

    2015-03-10

    Compositions of matter are provided that include chitosan and a modified carbohydrate. The modified carbohydrate includes a carbohydrate component and a cross linking agent. The modified carbohydrate has increased carboxyl content as compared to an unmodified counterpart carbohydrate. A carboxyl group of the modified carbohydrate is covalently bonded with an amino group of chitosan. The compositions of matter provided herein may include cross linked starch citrate-chitosan and cross linked hemicellulose citrate-chitosan, including foams thereof. These compositions yield excellent absorbency and metal chelation properties. Methods of making cross linked modified carbohydrate-chitosan compounds are also provided.

  13. Dual phase magnetic material component and method of forming

    DOEpatents

    Dial, Laura Cerully; DiDomizio, Richard; Johnson, Francis

    2017-04-25

    A magnetic component having intermixed first and second regions, and a method of preparing that magnetic component are disclosed. The first region includes a magnetic phase and the second region includes a non-magnetic phase. The method includes mechanically masking pre-selected sections of a surface portion of the component by using a nitrogen stop-off material and heat-treating the component in a nitrogen-rich atmosphere at a temperature greater than about 900.degree. C. Both the first and second regions are substantially free of carbon, or contain only limited amounts of carbon; and the second region includes greater than about 0.1 weight % of nitrogen.

  14. Catalysts for converting syngas into liquid hydrocarbons and methods thereof

    DOEpatents

    Yu, Fei; Yan, Qiangu; Batchelor, William

    2016-03-15

    The presently-disclosed subject matter includes methods for producing liquid hydrocarbons from syngas. In some embodiments the syngas is obtained from biomass and/or comprises a relatively high amount of nitrogen and/or carbon dioxide. In some embodiments the present methods can convert syngas into liquid hydrocarbons through a one-stage process. Also provided are catalysts for producing liquid hydrocarbons from syngas, wherein the catalysts include a base material, a transition metal, and a promoter. In some embodiments the base material includes a zeolite-iron material or a cobalt-molybdenum carbide material. In still further embodiments the promoter can include an alkali metal.

  15. Photovoltaic cell module and method of forming

    DOEpatents

    Howell, Malinda; Juen, Donnie; Ketola, Barry; Tomalia, Mary Kay

    2017-12-12

    A photovoltaic cell module, a photovoltaic array including at least two modules, and a method of forming the module are provided. The module includes a first outermost layer and a photovoltaic cell disposed on the first outermost layer. The module also includes a second outermost layer disposed on the photovoltaic cell and sandwiching the photovoltaic cell between the second outermost layer and the first outermost layer. The method of forming the module includes the steps of disposing the photovoltaic cell on the first outermost layer, disposing a silicone composition on the photovoltaic cell, and compressing the first outermost layer, the photovoltaic cell, and the second layer to form the photovoltaic cell module.

  16. Domain epitaxy for thin film growth

    DOEpatents

    Narayan, Jagdish

    2005-10-18

    A method of forming an epitaxial film on a substrate includes growing an initial layer of a film on a substrate at a temperature T.sub.growth, said initial layer having a thickness h and annealing the initial layer of the film at a temperature T.sub.anneal, thereby relaxing the initial layer, wherein said thickness h of the initial layer of the film is greater than a critical thickness h.sub.c. The method further includes growing additional layers of the epitaxial film on the initial layer subsequent to annealing. In some embodiments, the method further includes growing a layer of the film that includes at least one amorphous island.

  17. [Classification of local anesthesia methods].

    PubMed

    Petricas, A Zh; Medvedev, D V; Olkhovskaya, E B

    The traditional classification methods of dental local anesthesia must be modified. In this paper we proved that the vascular mechanism is leading component of spongy injection. It is necessary to take into account the high effectiveness and relative safety of spongy anesthesia, as well as versatility, ease of implementation and the growing prevalence in the world. The essence of the proposed modification is to distinguish the methods in diffusive (including surface anesthesia, infiltration and conductive anesthesia) and vascular-diffusive (including intraosseous, intraligamentary, intraseptal and intrapulpal anesthesia). For the last four methods the common term «spongy (intraosseous) anesthesia» may be used.

  18. Analysis of New Composite Architectures

    NASA Technical Reports Server (NTRS)

    Whitcomb, John D.

    1996-01-01

    Efficient and accurate specialty finite elements methods to analyze textile composites were developed and are described. Textile composites present unique challenges to the analyst because of the large, complex 'microstructure'. The geometry of the microstructure is difficult to model and it introduces unusual free surface effects. The size of the microstructure complicates the use of traditional homogenization methods. The methods developed constitute considerable progress in addressing the modeling difficulties. The details of the methods and attended results obtained therefrom, are described in the various chapters included in Part 1 of the report. Specific conclusions and computer codes generated are included in Part 2 of the report.

  19. Methods for the selective detection of alkyne-presenting molecules and related compositions and systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valdez, Carlos A.; Vu, Alexander K.

    Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.

  20. Single Cell Spectroscopy: Noninvasive Measures of Small-Scale Structure and Function

    PubMed Central

    Mousoulis, Charilaos; Xu, Xin; Reiter, David A.; Neu, Corey P.

    2013-01-01

    The advancement of spectroscopy methods attained through increases in sensitivity, and often with the coupling of complementary techniques, has enabled real-time structure and function measurements of single cells. The purpose of this review is to illustrate, in light of advances, the strengths and the weaknesses of these methods. Included also is an assessment of the impact of the experimental setup and conditions of each method on cellular function and integrity. A particular emphasis is placed on noninvasive and nondestructive techniques for achieving single cell detection, including nuclear magnetic resonance, in addition to physical, optical, and vibrational methods. PMID:23886910

  1. Half-heusler alloys with enhanced figure of merit and methods of making

    DOEpatents

    Ren, Zhifeng; Yan, Xiao; Joshi, Giri; Chen, Shuo; Chen, Gang; Poudel, Bed; Caylor, James Christopher

    2015-06-02

    Thermoelectric materials and methods of making thermoelectric materials having a nanometer mean grain size less than 1 micron. The method includes combining and arc melting constituent elements of the thermoelectric material to form a liquid alloy of the thermoelectric material and casting the liquid alloy of the thermoelectric material to form a solid casting of the thermoelectric material. The method also includes ball milling the solid casting of the thermoelectric material into nanometer mean size particles and sintering the nanometer size particles to form the thermoelectric material having nanometer scale mean grain size.

  2. Selective aerobic alcohol oxidation method for conversion of lignin into simple aromatic compounds

    DOEpatents

    Stahl, Shannon S; Rahimi, Alireza

    2015-03-03

    Described is a method to oxidize lignin or lignin sub-units. The method includes oxidation of secondary benzylic alcohol in the lignin or lignin sub-unit to a corresponding ketone in the presence of unprotected primarily aliphatic alcohol in the lignin or lignin sub-unit. The optimal catalyst system consists of HNO.sub.3 in combination with another Bronsted acid, in the absence of a metal-containing catalyst, thereby yielding a selectively oxidized lignin or lignin sub-unit. The method may be carried out in the presence or absence of additional reagents including TEMPO and TEMPO derivatives.

  3. Apparatuses and methods for generating electric fields

    DOEpatents

    Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L

    2013-08-06

    Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.

  4. Powder-based adsorbents having high adsorption capacities for recovering dissolved metals and methods thereof

    DOEpatents

    Janke, Christopher J.; Dai, Sheng; Oyola, Yatsandra

    2016-05-03

    A powder-based adsorbent and a related method of manufacture are provided. The powder-based adsorbent includes polymer powder with grafted side chains and an increased surface area per unit weight to increase the adsorption of dissolved metals, for example uranium, from aqueous solutions. A method for forming the powder-based adsorbent includes irradiating polymer powder, grafting with polymerizable reactive monomers, reacting with hydroxylamine, and conditioning with an alkaline solution. Powder-based adsorbents formed according to the present method demonstrated a significantly improved uranium adsorption capacity per unit weight over existing adsorbents.

  5. Development of a time-dependent incompressible Navier-Stokes solver based on a fractional-step method

    NASA Technical Reports Server (NTRS)

    Rosenfeld, Moshe

    1990-01-01

    The development, validation and application of a fractional step solution method of the time-dependent incompressible Navier-Stokes equations in generalized coordinate systems are discussed. A solution method that combines a finite-volume discretization with a novel choice of the dependent variables and a fractional step splitting to obtain accurate solutions in arbitrary geometries was previously developed for fixed-grids. In the present research effort, this solution method is extended to include more general situations, including cases with moving grids. The numerical techniques are enhanced to gain efficiency and generality.

  6. Foam-based adsorbents having high adsorption capacities for recovering dissolved metals and methods thereof

    DOEpatents

    Janke, Christopher J.; Dai, Sheng; Oyola, Yatsandra

    2015-06-02

    Foam-based adsorbents and a related method of manufacture are provided. The foam-based adsorbents include polymer foam with grafted side chains and an increased surface area per unit weight to increase the adsorption of dissolved metals, for example uranium, from aqueous solutions. A method for forming the foam-based adsorbents includes irradiating polymer foam, grafting with polymerizable reactive monomers, reacting with hydroxylamine, and conditioning with an alkaline solution. Foam-based adsorbents formed according to the present method demonstrated a significantly improved uranium adsorption capacity per unit weight over existing adsorbents.

  7. Method for implementation of recursive hierarchical segmentation on parallel computers

    NASA Technical Reports Server (NTRS)

    Tilton, James C. (Inventor)

    2005-01-01

    A method, computer readable storage, and apparatus for implementing a recursive hierarchical segmentation algorithm on a parallel computing platform. The method includes setting a bottom level of recursion that defines where a recursive division of an image into sections stops dividing, and setting an intermediate level of recursion where the recursive division changes from a parallel implementation into a serial implementation. The segmentation algorithm is implemented according to the set levels. The method can also include setting a convergence check level of recursion with which the first level of recursion communicates with when performing a convergence check.

  8. General design method for three-dimensional potential flow fields. 1: Theory

    NASA Technical Reports Server (NTRS)

    Stanitz, J. D.

    1980-01-01

    A general design method was developed for steady, three dimensional, potential, incompressible or subsonic-compressible flow. In this design method, the flow field, including the shape of its boundary, was determined for arbitrarily specified, continuous distributions of velocity as a function of arc length along the boundary streamlines. The method applied to the design of both internal and external flow fields, including, in both cases, fields with planar symmetry. The analytic problems associated with stagnation points, closure of bodies in external flow fields, and prediction of turning angles in three dimensional ducts were reviewed.

  9. Wireless autonomous device data transmission

    NASA Technical Reports Server (NTRS)

    Sammel, Jr., David W. (Inventor); Mickle, Marlin H. (Inventor); Cain, James T. (Inventor); Mi, Minhong (Inventor)

    2013-01-01

    A method of communicating information from a wireless autonomous device (WAD) to a base station. The WAD has a data element having a predetermined profile having a total number of sequenced possible data element combinations. The method includes receiving at the WAD an RF profile transmitted by the base station that includes a triggering portion having a number of pulses, wherein the number is at least equal to the total number of possible data element combinations. The method further includes keeping a count of received pulses and wirelessly transmitting a piece of data, preferably one bit, to the base station when the count reaches a value equal to the stored data element's particular number in the sequence. Finally, the method includes receiving the piece of data at the base station and using the receipt thereof to determine which of the possible data element combinations the stored data element is.

  10. Devices, systems, and methods for harvesting energy and methods for forming such devices

    DOEpatents

    Kotter, Dale K.; Novack, Steven D.

    2012-12-25

    Energy harvesting devices include a substrate coupled with a photovoltaic material and a plurality of resonance elements associated with the substrate. The resonance elements are configured to collect energy in at least visible and infrared light spectra. Each resonance element is capacitively coupled with the photovoltaic material, and may be configured to resonate at a bandgap energy of the photovoltaic material. Systems include a photovoltaic material coupled with a feedpoint of a resonance element. Methods for harvesting energy include exposing a resonance element having a resonant electromagnetic radiation having a frequency between approximately 20 THz and approximately 1,000 THz, absorbing at least a portion of the electromagnetic radiation with the resonance element, and resonating the resonance element at a bandgap energy of an underlying photovoltaic material. Methods for forming an energy harvesting device include forming resonance elements on a substrate and capacitively coupling the resonance elements with a photovoltaic material.

  11. Apparatus and method for controlling autotroph cultivation

    DOEpatents

    Fuxman, Adrian M; Tixier, Sebastien; Stewart, Gregory E; Haran, Frank M; Backstrom, Johan U; Gerbrandt, Kelsey

    2013-07-02

    A method includes receiving at least one measurement of a dissolved carbon dioxide concentration of a mixture of fluid containing an autotrophic organism. The method also includes determining an adjustment to one or more manipulated variables using the at least one measurement. The method further includes generating one or more signals to modify the one or more manipulated variables based on the determined adjustment. The one or more manipulated variables could include a carbon dioxide flow rate, an air flow rate, a water temperature, and an agitation level for the mixture. At least one model relates the dissolved carbon dioxide concentration to one or more manipulated variables, and the adjustment could be determined by using the at least one model to drive the dissolved carbon dioxide concentration to at least one target that optimize a goal function. The goal function could be to optimize biomass growth rate, nutrient removal and/or lipid production.

  12. The need and approach for characterization - U.S. air force perspectives on materials state awareness

    NASA Astrophysics Data System (ADS)

    Aldrin, John C.; Lindgren, Eric A.

    2018-04-01

    This paper expands on the objective and motivation for NDE-based characterization and includes a discussion of the current approach using model-assisted inversion being pursued within the Air Force Research Laboratory (AFRL). This includes a discussion of the multiple model-based methods that can be used, including physics-based models, deep machine learning, and heuristic approaches. The benefits and drawbacks of each method is reviewed and the potential to integrate multiple methods is discussed. Initial successes are included to highlight the ability to obtain quantitative values of damage. Additional steps remaining to realize this capability with statistical metrics of accuracy are discussed, and how these results can be used to enable probabilistic life management are addressed. The outcome of this initiative will realize the long-term desired capability of NDE methods to provide quantitative characterization to accelerate certification of new materials and enhance life management of engineered systems.

  13. False alarm recognition in hyperspectral gas plume identification

    DOEpatents

    Conger, James L [San Ramon, CA; Lawson, Janice K [Tracy, CA; Aimonetti, William D [Livermore, CA

    2011-03-29

    According to one embodiment, a method for analyzing hyperspectral data includes collecting first hyperspectral data of a scene using a hyperspectral imager during a no-gas period and analyzing the first hyperspectral data using one or more gas plume detection logics. The gas plume detection logic is executed using a low detection threshold, and detects each occurrence of an observed hyperspectral signature. The method also includes generating a histogram for all occurrences of each observed hyperspectral signature which is detected using the gas plume detection logic, and determining a probability of false alarm (PFA) for all occurrences of each observed hyperspectral signature based on the histogram. Possibly at some other time, the method includes collecting second hyperspectral data, and analyzing the second hyperspectral data using the one or more gas plume detection logics and the PFA to determine if any gas is present. Other systems and methods are also included.

  14. Method of forming a hardened surface on a substrate

    DOEpatents

    Branagan, Daniel J.

    2010-08-31

    The invention includes a method of producing a hard metallic material by forming a mixture containing at least 55% iron and at least one of B, C, Si and P. The mixture is formed into an alloy and cooled to form a metallic material having a hardness of greater than about 9.2 GPa. The invention includes a method of forming a wire by combining a metal strip and a powder. The metal strip and the powder are rolled to form a wire containing at least 55% iron and from two to seven additional elements including at least one of C, Si and B. The invention also includes a method of forming a hardened surface on a substrate by processing a solid mass to form a powder, applying the powder to a surface to form a layer containing metallic glass, and converting the glass to a crystalline material having a nanocrystalline grain size.

  15. Force measuring valve assemblies, systems including such valve assemblies and related methods

    DOEpatents

    DeWall, Kevin George [Pocatello, ID; Garcia, Humberto Enrique [Idaho Falls, ID; McKellar, Michael George [Idaho Falls, ID

    2012-04-17

    Methods of evaluating a fluid condition may include stroking a valve member and measuring a force acting on the valve member during the stroke. Methods of evaluating a fluid condition may include measuring a force acting on a valve member in the presence of fluid flow over a period of time and evaluating at least one of the frequency of changes in the measured force over the period of time and the magnitude of the changes in the measured force over the period of time to identify the presence of an anomaly in a fluid flow and, optionally, its estimated location. Methods of evaluating a valve condition may include directing a fluid flow through a valve while stroking a valve member, measuring a force acting on the valve member during the stroke, and comparing the measured force to a reference force. Valve assemblies and related systems are also disclosed.

  16. Superconducting transition edge sensors and methods for design and manufacture thereof

    NASA Technical Reports Server (NTRS)

    Sadleir, John E. (Inventor)

    2013-01-01

    Methods for forming sensors using transition edge sensors (TES) and sensors therefrom are described. The method includes forming a plurality of sensor arrays includes at least one TES device. The TES device includes a TES device body, a first superconducting lead contacting a first portion of the TES device body, and a second superconducting lead contacting of a second portion of the TES device body, where the first and second superconducting leads separated on the TES device body by a lead spacing. The lead spacing can be selected to be different for at least two of the plurality of sensor arrays. The method also includes determining a transition temperature for each of the plurality of sensor arrays and generating a signal responsive to detecting a change in the electrical characteristics of one of the plurality of sensor arrays meeting a transition temperature criterion.

  17. System for controlling a hybrid energy system

    DOEpatents

    Hoff, Brian D.; Akasam, Sivaprasad

    2013-01-29

    A method includes identifying a first operating sequence of a repeated operation of at least one non-traction load. The method also includes determining first and second parameters respectively indicative of a requested energy and output energy of the at least one non-traction load and comparing the determined first and second parameters at a plurality of time increments of the first operating sequence. The method also includes determining a third parameter of the hybrid energy system indicative of energy regenerated from the at least one non-traction load and monitoring the third parameter at the plurality of time increments of the first operating sequence. The method also includes determining at least one of an energy deficiency or an energy surplus associated with the non-traction load of the hybrid energy system and selectively adjusting energy stored within the storage device during at least a portion of a second operating sequence.

  18. Method for production of an isotopically enriched compound

    DOEpatents

    Watrous, Matthew G.

    2012-12-11

    A method is presented for producing and isolating an isotopically enriched compound of a desired isotope from a parent radionuclide. The method includes forming, or placing, a precipitate containing a parent radionuclide of the desired daughter isotope in a first reaction zone and allowing sufficient time for the parent to decay into the desired gaseous daughter radioisotope. The method further contemplates collecting the desired daughter isotope as a solid in a second reaction zone through the application of temperatures below the freezing point of the desired isotope to a second reaction zone that is connected to the first reaction zone. Specifically, a method is presented for producing isotopically enriched compounds of xenon, including the radioactive isotope Xe-131m and the stable isotope Xe-131.

  19. Scene-based nonuniformity correction with reduced ghosting using a gated LMS algorithm.

    PubMed

    Hardie, Russell C; Baxley, Frank; Brys, Brandon; Hytla, Patrick

    2009-08-17

    In this paper, we present a scene-based nouniformity correction (NUC) method using a modified adaptive least mean square (LMS) algorithm with a novel gating operation on the updates. The gating is designed to significantly reduce ghosting artifacts produced by many scene-based NUC algorithms by halting updates when temporal variation is lacking. We define the algorithm and present a number of experimental results to demonstrate the efficacy of the proposed method in comparison to several previously published methods including other LMS and constant statistics based methods. The experimental results include simulated imagery and a real infrared image sequence. We show that the proposed method significantly reduces ghosting artifacts, but has a slightly longer convergence time. (c) 2009 Optical Society of America

  20. Partial spline models for the inclusion of tropopause and frontal boundary information in otherwise smooth two- and three-dimensional objective analysis

    NASA Technical Reports Server (NTRS)

    Shiau, Jyh-Jen; Wahba, Grace; Johnson, Donald R.

    1986-01-01

    A new method, based on partial spline models, is developed for including specified discontinuities in otherwise smooth two- and three-dimensional objective analyses. The method is appropriate for including tropopause height information in two- and three-dimensinal temperature analyses, using the O'Sullivan-Wahba physical variational method for analysis of satellite radiance data, and may in principle be used in a combined variational analysis of observed, forecast, and climate information. A numerical method for its implementation is described and a prototype two-dimensional analysis based on simulated radiosonde and tropopause height data is shown. The method may also be appropriate for other geophysical problems, such as modeling the ocean thermocline, fronts, discontinuities, etc.

  1. In-situ trainable intrusion detection system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symons, Christopher T.; Beaver, Justin M.; Gillen, Rob

    A computer implemented method detects intrusions using a computer by analyzing network traffic. The method includes a semi-supervised learning module connected to a network node. The learning module uses labeled and unlabeled data to train a semi-supervised machine learning sensor. The method records events that include a feature set made up of unauthorized intrusions and benign computer requests. The method identifies at least some of the benign computer requests that occur during the recording of the events while treating the remainder of the data as unlabeled. The method trains the semi-supervised learning module at the network node in-situ, such thatmore » the semi-supervised learning modules may identify malicious traffic without relying on specific rules, signatures, or anomaly detection.« less

  2. Extension of a hybrid particle-continuum method for a mixture of chemical species

    NASA Astrophysics Data System (ADS)

    Verhoff, Ashley M.; Boyd, Iain D.

    2012-11-01

    Due to the physical accuracy and numerical efficiency achieved by analyzing transitional, hypersonic flow fields with hybrid particle-continuum methods, this paper describes a Modular Particle-Continuum (MPC) method and its extension to include multiple chemical species. Considerations that are specific to a hybrid approach for simulating gas mixtures are addressed, including a discussion of the Chapman-Enskog velocity distribution function (VDF) for near-equilibrium flows, and consistent viscosity models for the individual CFD and DSMC modules of the MPC method. Representative results for a hypersonic blunt-body flow are then presented, where the flow field properties, surface properties, and computational performance are compared for simulations employing full CFD, full DSMC, and the MPC method.

  3. Method for adding nodes to a quantum key distribution system

    DOEpatents

    Grice, Warren P

    2015-02-24

    An improved quantum key distribution (QKD) system and method are provided. The system and method introduce new clients at intermediate points along a quantum channel, where any two clients can establish a secret key without the need for a secret meeting between the clients. The new clients perform operations on photons as they pass through nodes in the quantum channel, and participate in a non-secret protocol that is amended to include the new clients. The system and method significantly increase the number of clients that can be supported by a conventional QKD system, with only a modest increase in cost. The system and method are compatible with a variety of QKD schemes, including polarization, time-bin, continuous variable and entanglement QKD.

  4. Patterns of Contraceptive Adoption, Continuation, and Switching after Delivery among Malawian Women.

    PubMed

    Kopp, Dawn M; Rosenberg, Nora E; Stuart, Gretchen S; Miller, William C; Hosseinipour, Mina C; Bonongwe, Phylos; Mwale, Mwawi; Tang, Jennifer H

    2017-01-01

    Women who report use of postpartum family planning may not continue their initial method or use it consistently. Understanding the patterns of method uptake, discontinuation, and switching among women after delivery is important to promote uptake and continuation of effective methods of contraception. This is a secondary analysis of 634 Malawian women enrolled into a prospective cohort study after delivery. They completed baseline surveys upon enrollment and follow-up telephone surveys 3, 6, and 12 months post-delivery. Women were included in this analysis if they had completed at least the 3- and 6-month post-delivery surveys. Descriptive statistics were used to assess contraceptive method mix and patterns of switching, whereas Pearson's χ2 tests were used for bivariable analyses to compare characteristics of women who continued and discontinued their initial post-delivery contraceptive method. Among the 479 women included in this analysis, the use of abstinence/traditional methods decreased and the use of long-acting and permanent methods (LAPM) increased over time. Almost half (47%) discontinued the contraceptive method reported at 3-months post-delivery; women using injectables or LAPM at 3-months post-delivery were significantly more likely to continue their method than those using non-modern methods (p<0.001). Of the 216 women who switched methods, 82% switched to a more or equally effective method. The change in contraceptive method mix and high rate of contraceptive switching in the first 12 months postpartum highlights a need to assist women in accessing effective contraceptives soon after delivery.

  5. System and method of self-properties for an autonomous and automatic computer environment

    NASA Technical Reports Server (NTRS)

    Sterritt, Roy (Inventor); Hinchey, Michael G. (Inventor)

    2010-01-01

    Systems, methods and apparatus are provided through which in some embodiments self health/urgency data and environment health/urgency data may be transmitted externally from an autonomic element. Other embodiments may include transmitting the self health/urgency data and environment health/urgency data together on a regular basis similar to the lub-dub of a heartbeat. Yet other embodiments may include a method for managing a system based on the functioning state and operating status of the system, wherein the method may include processing received signals from the system indicative of the functioning state and the operating status to obtain an analysis of the condition of the system, generating one or more stay alive signals based on the functioning status and the operating state of the system, transmitting the stay-alive signal, transmitting self health/urgency data, and transmitting environment health/urgency data. Still other embodiments may include an autonomic element that includes a self monitor, a self adjuster, an environment monitor, and an autonomic manager.

  6. NOx reduction methods and apparatuses

    DOEpatents

    Tonkyn, Russell G.; Barlow, Stephan E.; Balmer, M. Lou; Maupin, Gary D.

    2004-10-26

    A NO.sub.x reduction method includes treating a first gas containing NO.sub.x, producing a second gas containing NO.sub.2, reducing a portion of the NO.sub.2 in the second gas to N.sub.2, and producing a third gas containing less NO.sub.x than the first gas, substantially all of the third gas NO.sub.x being NO. The method also includes treating the third gas, producing a fourth gas containing NO.sub.2, reducing a portion of the NO.sub.2 in the fourth gas to N.sub.2, and producing a fifth gas containing less NO.sub.x than the third gas, substantially all of the fifth gas NO.sub.x being NO. Treating the first and/or third gas can include treatment with a plasma. Reducing a portion of the NO.sub.2 in the second and/or fourth gas can include reducing with a catalyst. The method can further include controlling energy consumption of the plasmas independent of each other.

  7. 78 FR 20695 - Walk-Through Metal Detectors and Hand-Held Metal Detectors Test Method Validation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-05

    ... Detectors and Hand-Held Metal Detectors Test Method Validation AGENCY: National Institute of Justice, DOJ... ensure that the test methods in the standards are properly documented, NIJ is requesting proposals (including price quotes) for test method validation efforts from testing laboratories. NIJ is also seeking...

  8. Diversified Research Methods Education in LIS: Thinking outside the Box

    ERIC Educational Resources Information Center

    Luo, Lili

    2017-01-01

    A small number of LIS degree programs have adopted a diversified approach to research methods education, including offering an array of specialized research methods courses in addition to a general introductory course. The current study conducted an in-depth investigation of the diversified research methods curriculum of the LIS program at San…

  9. Tumor-Initiating Cells and Methods of Use

    NASA Technical Reports Server (NTRS)

    Hlatky, Lynn (Inventor)

    2014-01-01

    Provided herein are an isolated or enriched population of tumor initiating cells derived from normal cells, cells susceptible to neoplasia, or neoplastic cells. Methods of use of the cells for screening for anti-hyperproliferative agents, and use of the cells for animal models of hyperproliferative disorders including metastatic cancer, diagnostic methods, and therapeutic methods are provided.

  10. Chemical control methods and tools

    Treesearch

    Steven Manning; James Miller

    2011-01-01

    After determining the best course of action for control of an invasive plant population, it is important to understand the variety of methods available to the integrated pest management professional. A variety of methods are now widely used in managing invasive plants in natural areas, including chemical, mechanical, and cultural control methods. Once the preferred...

  11. Methods to recover value-added co-products from dry grind processing of grains into fuel ethanol

    USDA-ARS?s Scientific Manuscript database

    Three methods were described to fractionate condensed distillers solubles (CDS) into several new co-products, including a protein-mineral fraction and a glycerol fraction by a chemical method; a protein fraction, an oil fraction and a glycerol-mineral fraction by a physical method; or a protein frac...

  12. NHEXAS PHASE I ARIZONA STUDY--STANDARD OPERATING PROCEDURE--COMPENDIUM OF METHODS FOR ANALYSIS OF METALS, PESTICIDES, AND VOCS IN WATER (EPA-COMPENDIUM)

    EPA Science Inventory

    This compendium includes descriptions of methods for analyzing metals, pesticides and volatile organic compounds (VOCs) in water. The individual methods covered are these: (1) Method 200.8: determination of trace elements in waters and wastes by inductively coupled plasma-mass s...

  13. A Phase-Only technique for enhancing the high-frequency MASW method

    USDA-ARS?s Scientific Manuscript database

    For soil exploration in the vadose zone, a high-frequency multi-channel analysis of surface waves (HF-MASW) method has been developed. In the study, several practical techniques were applied to enhance the overtone image of the HF-MASW method. They included (1) the self-adaptive MASW method using a ...

  14. Recruiting Adolescent Research Participants: In-Person Compared to Social Media Approaches.

    PubMed

    Moreno, Megan A; Waite, Alan; Pumper, Megan; Colburn, Trina; Holm, Matt; Mendoza, Jason

    2017-01-01

    Recruiting adolescent participants for research is challenging. The purpose of this study was to compare traditional in-person recruitment methods to social media recruitment. We recruited adolescents aged 14-18 years for a pilot physical activity intervention study, including a wearable physical activity tracking device and a Facebook group. Participants were recruited (a) in person from a local high school and an adolescent medicine clinic and (b) through social media, including Facebook targeted ads, sponsored tweets on Twitter, and a blog post. Data collected included total exposure (i.e., reach), engagement (i.e., interaction), and effectiveness. Effectiveness included screening and enrollment for each recruitment method, as well as time and resources spent on each recruitment method. In-person recruitment reached a total of 297 potential participants of which 37 enrolled in the study. Social media recruitment reached a total of 34,272 potential participants of which 8 enrolled in the study. Social media recruitment methods utilized an average of 1.6 hours of staff time and cost an average of $40.99 per participant enrolled, while in-person recruitment methods utilized an average of 0.75 hours of staff time and cost an average of $19.09 per participant enrolled. Social media recruitment reached more potential participants, but the cost per participant enrolled was higher compared to traditional methods. Studies need to consider benefits and downsides of traditional and social media recruitment methods based on study goals and population.

  15. Water demand forecasting: review of soft computing methods.

    PubMed

    Ghalehkhondabi, Iman; Ardjmand, Ehsan; Young, William A; Weckman, Gary R

    2017-07-01

    Demand forecasting plays a vital role in resource management for governments and private companies. Considering the scarcity of water and its inherent constraints, demand management and forecasting in this domain are critically important. Several soft computing techniques have been developed over the last few decades for water demand forecasting. This study focuses on soft computing methods of water consumption forecasting published between 2005 and 2015. These methods include artificial neural networks (ANNs), fuzzy and neuro-fuzzy models, support vector machines, metaheuristics, and system dynamics. Furthermore, it was discussed that while in short-term forecasting, ANNs have been superior in many cases, but it is still very difficult to pick a single method as the overall best. According to the literature, various methods and their hybrids are applied to water demand forecasting. However, it seems soft computing has a lot more to contribute to water demand forecasting. These contribution areas include, but are not limited, to various ANN architectures, unsupervised methods, deep learning, various metaheuristics, and ensemble methods. Moreover, it is found that soft computing methods are mainly used for short-term demand forecasting.

  16. A ricin forensic profiling approach based on a complex set of biomarkers.

    PubMed

    Fredriksson, Sten-Åke; Wunschel, David S; Lindström, Susanne Wiklund; Nilsson, Calle; Wahl, Karen; Åstot, Crister

    2018-08-15

    A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1-PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods and robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Dacarbazine.

    PubMed

    Al-Badr, Abdullah A; Alodhaib, Mansour M

    2016-01-01

    Dacarbazine is a cell cycle nonspecific antineoplastic alkylating agent used in the treatment of metastatic malignant melanoma. This chapter contains the descriptions of the drug: nomenclature, formulae, chemical structure, elemental composition, and appearance. The uses and applications of dacarbazine and the methods that were used for its preparation are reported. The methods which were used for the physical characterization of the drug are ionization constant, solubility, X-ray powder diffraction pattern, crystal structure, melting point, and differential scanning calorimetry. The profile contains the spectra of the drug: ultraviolet spectrum, vibrational spectrum, nuclear magnetic resonance spectra, and mass spectrum. The compendial methods of analysis for dacarbazine include the United States Pharmacopeia methods, British Pharmacopeia methods, and International Pharmacopeia methods. Other reported methods that are used for the analysis of the drug are high-performance liquid chromatography, high-performance liquid chromatography-mass spectrometry, and polarography. Metabolism, pharmacokinetics, and stability studies on dacarbazine are also included. Reviews of some analytical methods and physicochemical properties of the drug as well as the most important enzymes that are involved in the prodrug activation are provided. Sixty-four references are listed at the end of this monograph. © 2016 Elsevier Inc. All rights reserved.

  18. An improved panel method for the solution of three-dimensional leading-edge vortex flows. Volume 1: Theory document

    NASA Technical Reports Server (NTRS)

    Johnson, F. T.; Lu, P.; Tinoco, E. N.

    1980-01-01

    An improved panel method for the solution of three dimensional flow and wing and wing-body combinations with leading edge vortex separation is presented. The method employs a three dimensional inviscid flow model in which the configuration, the rolled-up vortex sheets, and the wake are represented by quadratic doublet distributions. The strength of the singularity distribution as well as shape and position of the vortex spirals are computed in an iterative fashion starting with an assumed initial sheet geometry. The method calculates forces and moments as well as detail surface pressure distributions. Improvements include the implementation of improved panel numerics for the purpose of elimination the highly nonlinear effects of ring vortices around double panel edges, and the development of a least squares procedure for damping vortex sheet geometry update instabilities. A complete description of the method is included. A variety of cases generated by the computer program implementing the method are presented which verify the mathematical assumptions of the method and which compare computed results with experimental data to verify the underlying physical assumptions made by the method.

  19. A thioacidolysis method tailored for higher‐throughput quantitative analysis of lignin monomers

    PubMed Central

    Foster, Cliff; Happs, Renee M.; Doeppke, Crissa; Meunier, Kristoffer; Gehan, Jackson; Yue, Fengxia; Lu, Fachuang; Davis, Mark F.

    2016-01-01

    Abstract Thioacidolysis is a method used to measure the relative content of lignin monomers bound by β‐O‐4 linkages. Current thioacidolysis methods are low‐throughput as they require tedious steps for reaction product concentration prior to analysis using standard GC methods. A quantitative thioacidolysis method that is accessible with general laboratory equipment and uses a non‐chlorinated organic solvent and is tailored for higher‐throughput analysis is reported. The method utilizes lignin arylglycerol monomer standards for calibration, requires 1–2 mg of biomass per assay and has been quantified using fast‐GC techniques including a Low Thermal Mass Modular Accelerated Column Heater (LTM MACH). Cumbersome steps, including standard purification, sample concentrating and drying have been eliminated to help aid in consecutive day‐to‐day analyses needed to sustain a high sample throughput for large screening experiments without the loss of quantitation accuracy. The method reported in this manuscript has been quantitatively validated against a commonly used thioacidolysis method and across two different research sites with three common biomass varieties to represent hardwoods, softwoods, and grasses. PMID:27534715

  20. Efficacy and Safety of Long-Acting Reversible Contraception

    PubMed Central

    Stoddard, Amy; McNicholas, Colleen; Peipert, Jeffrey F.

    2013-01-01

    Long-acting reversible contraception (LARC) includes intrauterine devices (IUDs) and the subdermal implant. These methods are the most effective reversible methods of contraception, and have the additional advantages of being long-lasting, convenient, well liked by users and cost effective. Compared with other user-dependent methods that increase the risk of noncompliance-related method failure, LARC methods can bring ‘typical use’ failure rates more in line with ‘perfect use’ failure rates. LARC methods are ‘forgettable’; they are not dependent on compliance with a pill-taking regimen, remembering to change a patch or ring, or coming back to the clinician for an injection. LARC method failure rates rival that of tubal sterilization at <1% for IUDs and the subdermal implant. For these reasons, we believe that IUDs and implants should be offered as first-line contraception for most women. This article provides a review of the LARC methods that are currently available in the US, including their effectiveness, advantages, disadvantages and contraindications. Additionally, we dispel myths and misconceptions regarding IUDs, and address the barriers to LARC use. PMID:21668037

  1. A new method based on the Butler-Volmer formalism to evaluate voltammetric cation and anion sensors.

    PubMed

    Cano, Manuel; Rodríguez-Amaro, Rafael; Fernández Romero, Antonio J

    2008-12-11

    A new method based on the Butler-Volmer formalism is applied to assess the capability of two voltammetric ion sensors based on polypyrrole films: PPy/DBS and PPy/ClO4 modified electrodes were studied as voltammetric cation and anion sensors, respectively. The reversible potential versus electrolyte concentrations semilogarithm plots provided positive calibration slopes for PPy/DBS and negative ones for PPy/ClO4, as was expected from the proposed method and that based on the Nernst equation. The slope expressions deduced from Butler-Volmer include the electron-transfer coefficient, which allows slope values different from the ideal Nernstian value to be explained. Both polymeric films exhibited a degree of ion-selectivity when they were immersed in mixed-analyte solutions. Selectivity coefficients for the two proposed voltammetric cation and anion sensors were obtained by several experimental methods, including the separated solution method (SSM) and matched potential method (MPM). The K values acquired by the different methods were very close for both polymeric sensors.

  2. Methods for comparing 3D surface attributes

    NASA Astrophysics Data System (ADS)

    Pang, Alex; Freeman, Adam

    1996-03-01

    A common task in data analysis is to compare two or more sets of data, statistics, presentations, etc. A predominant method in use is side-by-side visual comparison of images. While straightforward, it burdens the user with the task of discerning the differences between the two images. The user if further taxed when the images are of 3D scenes. This paper presents several methods for analyzing the extent, magnitude, and manner in which surfaces in 3D differ in their attributes. The surface geometry are assumed to be identical and only the surface attributes (color, texture, etc.) are variable. As a case in point, we examine the differences obtained when a 3D scene is rendered progressively using radiosity with different form factor calculation methods. The comparison methods include extensions of simple methods such as mapping difference information to color or transparency, and more recent methods including the use of surface texture, perturbation, and adaptive placements of error glyphs.

  3. [Therapeutic strategies targeting brain tumor stem cells].

    PubMed

    Toda, Masahiro

    2009-07-01

    Progress in stem cell research reveals cancer stem cells to be present in a variety of malignant tumors. Since they exhibit resistance to anticancer drugs and radiotherapy, analysis of their properties has been rapidly carried forward as an important target for the treatment of intractable malignancies, including brain tumors. In fact, brain cancer stem cells (BCSCs) have been isolated from brain tumor tissue and brain tumor cell lines by using neural stem cell culture methods and isolation methods for side population (SP) cells, which have high drug-efflux capacity. Although the analysis of the properties of BCSCs is the most important to developing methods in treating BCSCs, the absence of BCSC purification methods should be remedied by taking it up as an important research task in the immediate future. Thus far, there are no effective treatment methods for BCSCs, and several treatment methods have been proposed based on the cell biology characteristics of BCSCs. In this article, I outline potential treatment methods damaging treatment-resistant BCSCs, including immunotherapy which is currently a topic of our research.

  4. Evaluation of methods for managing censored results when calculating the geometric mean.

    PubMed

    Mikkonen, Hannah G; Clarke, Bradley O; Dasika, Raghava; Wallis, Christian J; Reichman, Suzie M

    2018-01-01

    Currently, there are conflicting views on the best statistical methods for managing censored environmental data. The method commonly applied by environmental science researchers and professionals is to substitute half the limit of reporting for derivation of summary statistics. This approach has been criticised by some researchers, raising questions around the interpretation of historical scientific data. This study evaluated four complete soil datasets, at three levels of simulated censorship, to test the accuracy of a range of censored data management methods for calculation of the geometric mean. The methods assessed included removal of censored results, substitution of a fixed value (near zero, half the limit of reporting and the limit of reporting), substitution by nearest neighbour imputation, maximum likelihood estimation, regression on order substitution and Kaplan-Meier/survival analysis. This is the first time such a comprehensive range of censored data management methods have been applied to assess the accuracy of calculation of the geometric mean. The results of this study show that, for describing the geometric mean, the simple method of substitution of half the limit of reporting is comparable or more accurate than alternative censored data management methods, including nearest neighbour imputation methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Analytical methods for quantifying greenhouse gas flux in animal production systems.

    PubMed

    Powers, W; Capelari, M

    2016-08-01

    Given increased interest by all stakeholders to better understand the contribution of animal agriculture to climate change, it is important that appropriate methodologies be used when measuring greenhouse gas (GHG) emissions from animal agriculture. Similarly, a fundamental understanding of the differences between methods is necessary to appropriately compare data collected using different approaches and design meaningful experiments. Sources of carbon dioxide, methane, and nitrous oxide emissions in animal production systems includes the animals, feed storage areas, manure deposition and storage areas, and feed and forage production fields. These 3 gases make up the primary GHG emissions from animal feeding operations. Each of the different GHG may be more or less prominent from each emitting source. Similarly, the species dictates the importance of methane emissions from the animals themselves. Measures of GHG flux from animals are often made using respiration chambers, head boxes, tracer gas techniques, or in vitro gas production techniques. In some cases, a combination of techniques are used (i.e., head boxes in combination with tracer gas). The prominent methods for measuring GHG emissions from housing include the use of tracer gas techniques or direct or indirect ventilation measures coupled with concentration measures of gases of interest. Methods for collecting and measuring GHG emissions from manure storage and/or production lots include the use of downwind measures, often using photoacoustic or open path Fourier transform infrared spectroscopy, combined with modeling techniques or the use of static chambers or flux hood methods. Similar methods can be deployed for determining GHG emissions from fields. Each method identified has its own benefits and challenges to use for the stated application. Considerations for use include intended goal, equipment investment and maintenance, frequency and duration of sampling needed to achieve desired representativeness of emissions over time, accuracy and precision of the method, and environmental influences on the method. In the absence of a perfect method for all situations, full knowledge of the advantages and disadvantages of each method is extremely important during the development of the experimental design and interpretation of results. The selection of the suitable technique depends on the animal production system, resource availability, and objective for measurements.

  6. Multidimensional structured data visualization method and apparatus, text visualization method and apparatus, method and apparatus for visualizing and graphically navigating the world wide web, method and apparatus for visualizing hierarchies

    DOEpatents

    Risch, John S [Kennewick, WA; Dowson, Scott T [West Richland, WA; Hart, Michelle L [Richland, WA; Hatley, Wes L [Kennewick, WA

    2008-05-13

    A method of displaying correlations among information objects comprises receiving a query against a database; obtaining a query result set; and generating a visualization representing the components of the result set, the visualization including one of a plane and line to represent a data field, nodes representing data values, and links showing correlations among fields and values. Other visualization methods and apparatus are disclosed.

  7. Group IV nanocrystals with ion-exchangeable surface ligands and methods of making the same

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.

    Methods are described that include reacting a starting nanocrystal that includes a starting nanocrystal core and a covalently bound surface species to create an ion-exchangeable (IE) nanocrystal that includes a surface charge and a first ion-exchangeable (IE) surface ligand ionically bound to the surface charge, where the starting nanocrystal core includes a group IV element.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seth, Arpan; Klise, Katherine A.; Siirola, John D.

    In the event of contamination in a water distribution network (WDN), source identification (SI) methods that analyze sensor data can be used to identify the source location(s). Knowledge of the source location and characteristics are important to inform contamination control and cleanup operations. Various SI strategies that have been developed by researchers differ in their underlying assumptions and solution techniques. The following manuscript presents a systematic procedure for testing and evaluating SI methods. The performance of these SI methods is affected by various factors including the size of WDN model, measurement error, modeling error, time and number of contaminant injections,more » and time and number of measurements. This paper includes test cases that vary these factors and evaluates three SI methods on the basis of accuracy and specificity. The tests are used to review and compare these different SI methods, highlighting their strengths in handling various identification scenarios. These SI methods and a testing framework that includes the test cases and analysis tools presented in this paper have been integrated into EPA’s Water Security Toolkit (WST), a suite of software tools to help researchers and others in the water industry evaluate and plan various response strategies in case of a contamination incident. Lastly, a set of recommendations are made for users to consider when working with different categories of SI methods.« less

  9. Contraceptives: choice for the millions?

    PubMed

    Dhall, A

    1994-06-01

    India adds each year the population of Sub-Saharan Africa to the earth. User based factors determining the type of contraceptive that is used most often in a country are sociocultural practices including religion, literacy, women's status and their role in decision making, men's status, misconceptions, and convenience of use. Service related factors include knowledge and skill of the provider, attitude of the provider, accessibility of family planning services, cost of the contraceptives, and quality of services. The government, nongovernmental organizations, and the pharmaceutical firms tend to be the contraceptive researchers and suppliers. The mass media are used to disseminate information on contraceptives. They often relay sensational reports about a contraceptive method that results in its reduced use. Temporary or spacing family planning methods include natural family planning methods, condoms, IUDs, oral contraceptives, implants, and injectables, spermicides and vaginal barriers. The natural family planning methods are sexual abstinence, especially in the postpartum period; rhythm or calendar method; and coitus interruptus. The most cost-effective method is also the most popular method--sexual sterilization. Even though female sterilization is more difficult to perform than vasectomy, it is more common than vasectomy. Contraception should become a people's movement rather than be forced upon the people. People should insist on good quality, affordable contraceptive services as their basic right.

  10. Modification of the BAX Salmonella test kit to include a hot start functionality (modification of AOAC Official Method 2003.09).

    PubMed

    Wallace, F Morgan; DiCosimo, Deana; Farnum, Andrew; Tice, George; Andaloro, Bridget; Davis, Eugene; Burns, Frank R

    2011-01-01

    In 2010, the BAX System PCR assay for Salmonella was modified to include a hot start functionality designed to keep the reaction enzyme inactive until PCR begins. To validate the assay's Official Methods of Analysis status to include this procedure modification, an evaluation was conducted on four food types that were simultaneously analyzed with the BAX System and either the U.S. Food and Drug Administration's Bacteriological Analytical Manual or the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook reference method for detecting Salmonella. Identical performance between the BAX System method and the reference methods was observed. Additionally, lysates were analyzed using both the BAX System Classic and BAX System Q7 instruments with identical results using both platforms for all samples tested. Of the 100 samples analyzed, 34 samples were positive for both the BAX System and reference methods, and 66 samples were negative by both the BAX System and reference methods, demonstrating 100% correlation. No instrument platform variation was observed. Additional inclusivity and exclusivity testing using the modified test kit demonstrated the test kit to be 100% accurate in evaluation of test panels of 352 Salmonella strains and 46 non-Salmonella strains.

  11. Gingival Retraction Methods: A Systematic Review.

    PubMed

    Tabassum, Sadia; Adnan, Samira; Khan, Farhan Raza

    2017-12-01

    The aim of this systematic review was to assess the gingival retraction methods in terms of the amount of gingival retraction achieved and changes observed in various clinical parameters: gingival index (GI), plaque index (PI), probing depth (PD), and attachment loss (AL). Data sources included three major databases, PubMed, CINAHL plus (Ebsco), and Cochrane, along with hand search. Search was made using the key terms in different permutations of gingival retraction* AND displacement method* OR technique* OR agents OR material* OR medicament*. The initial search results yielded 145 articles which were narrowed down to 10 articles using a strict eligibility criteria of including clinical trials or experimental studies on gingival retraction methods with the amount of tooth structure gained and assessment of clinical parameters as the outcomes conducted on human permanent teeth only. Gingival retraction was measured in 6/10 studies whereas the clinical parameters were assessed in 5/10 studies. The total number of teeth assessed in the 10 included studies was 400. The most common method used for gingival retraction was chemomechanical. The results were heterogeneous with regards to the outcome variables. No method seemed to be significantly superior to the other in terms of gingival retraction achieved. Clinical parameters were not significantly affected by the gingival retraction method. © 2016 by the American College of Prosthodontists.

  12. Methods for Equating Mental Tests.

    DTIC Science & Technology

    1984-11-01

    1983) compared conventional and IRT methods for equating the Test of English as a Foreign Language ( TOEFL ) after chaining. Three conventional and...three IRT equating methods were examined in this study; two sections of TOEFL were each (separately) equated. The IRT methods included the following: (a...group. A separate base form was established for each of the six equating methods. Instead of equating the base-form TOEFL to itself, the last (eighth

  13. Ordering of the O-O stretching vibrational frequencies in ozone

    NASA Technical Reports Server (NTRS)

    Scuseria, Gustavo E.; Lee, Timothy J.; Scheiner, Andrew C.; Schaefer, Henry F., III

    1989-01-01

    The ordering of nu1 and nu3 for O3 is incorrectly predicted by most theoretical methods, including some very high level methods. The first systematic electron correlation method based on one-reference configuration to solve this problem is the coupled cluster single and double excitation method. However, a relatively large basis set, triple zeta plus double polarization is required. Comparison with other theoretical methods is made.

  14. Systems and Methods for Fabricating Objects Including Amorphous Metal Using Techniques Akin to Additive Manufacturing

    NASA Technical Reports Server (NTRS)

    Hofmann, Douglas (Inventor)

    2017-01-01

    Systems and methods in accordance with embodiments of the invention fabricate objects including amorphous metals using techniques akin to additive manufacturing. In one embodiment, a method of fabricating an object that includes an amorphous metal includes: applying a first layer of molten metallic alloy to a surface; cooling the first layer of molten metallic alloy such that it solidifies and thereby forms a first layer including amorphous metal; subsequently applying at least one layer of molten metallic alloy onto a layer including amorphous metal; cooling each subsequently applied layer of molten metallic alloy such that it solidifies and thereby forms a layer including amorphous metal prior to the application of any adjacent layer of molten metallic alloy; where the aggregate of the solidified layers including amorphous metal forms a desired shape in the object to be fabricated; and removing at least the first layer including amorphous metal from the surface.

  15. High Temperature Stable Nanocrystalline SiGe Thermoelectric Material

    NASA Technical Reports Server (NTRS)

    Yang, Sherwin (Inventor); Matejczyk, Daniel Edward (Inventor); Determan, William (Inventor)

    2013-01-01

    A method of forming a nanocomposite thermoelectric material having microstructural stability at temperatures greater than 1000 C. The method includes creating nanocrystalline powder by cryomilling. The method is particularly useful in forming SiGe alloy powder.

  16. Method of forming nanodielectrics

    DOEpatents

    Tuncer, Enis [Knoxville, TN; Polyzos, Georgios [Oak Ridge, TN

    2014-01-07

    A method of making a nanoparticle filled dielectric material. The method includes mixing nanoparticle precursors with a polymer material and reacting the nanoparticle mixed with the polymer material to form nanoparticles dispersed within the polymer material to form a dielectric composite.

  17. Optimization of structures to satisfy aeroelastic requirements

    NASA Technical Reports Server (NTRS)

    Rudisill, C. S.

    1975-01-01

    A method for the optimization of structures to satisfy flutter velocity constraints is presented along with a method for determining the flutter velocity. A method for the optimization of structures to satisfy divergence velocity constraints is included.

  18. Exploring alternative methods for vegetation control and maintenance along roadsides.

    DOT National Transportation Integrated Search

    2003-02-01

    The search for alternative methods for controlling : and maintaining vegetation along roadsides has : just begun. This work was initiated to find : alternatives to the traditional methods for roadside : vegetation maintenance that includes the use of...

  19. LNG safety assessment evaluation methods : task 3 letter report.

    DOT National Transportation Integrated Search

    2016-07-01

    Sandia National Laboratories evaluated published safety assessment methods across a variety of industries including Liquefied Natural Gas (LNG), hydrogen, land and marine transportation, as well as the US Department of Defense (DOD). All the methods ...

  20. A procedural method for express bus-fringe parking transit planning.

    DOT National Transportation Integrated Search

    1976-01-01

    The report illustrates a procedural method for planning express bus-fringe parking transit services - a method built upon the findings from previous research, including disaggregate travel choice models and planning guidelines. The methodology addres...

  1. Methods and Devices for Micro-Isolation, Extraction, and/or Analysis of Microscale Components

    NASA Technical Reports Server (NTRS)

    Wade, Lawrence A. (Inventor); Kartalov, Emil P. (Inventor); Taylor, Clive (Inventor); Shibata, Darryl (Inventor)

    2014-01-01

    Provided herein are devices and methods for the micro-isolation of biological cellular material. A micro-isolation apparatus described can comprise a photomask that protects regions of interest against DNA-destroying illumination. The micro-isolation apparatus can further comprise photosensitive material defining access wells following illumination and subsequent developing of the photosensitive material. The micro-isolation apparatus can further comprise a chambered microfluidic device comprising channels providing access to wells defined in photosensitive material. The micro-isolation apparatus can comprise a chambered microfluidic device without access wells defined in photosensitive material where valves control the flow of gases or liquids through the channels of the microfluidic device. Also included are methods for selectively isolating cellular material using the apparatuses described herein, as are methods for biochemical analysis of individual regions of interest of cellular material using the devices described herein. Further included are methods of making masking arrays useful for the methods described herein.

  2. Infrared Ship Target Segmentation Based on Spatial Information Improved FCM.

    PubMed

    Bai, Xiangzhi; Chen, Zhiguo; Zhang, Yu; Liu, Zhaoying; Lu, Yi

    2016-12-01

    Segmentation of infrared (IR) ship images is always a challenging task, because of the intensity inhomogeneity and noise. The fuzzy C-means (FCM) clustering is a classical method widely used in image segmentation. However, it has some shortcomings, like not considering the spatial information or being sensitive to noise. In this paper, an improved FCM method based on the spatial information is proposed for IR ship target segmentation. The improvements include two parts: 1) adding the nonlocal spatial information based on the ship target and 2) using the spatial shape information of the contour of the ship target to refine the local spatial constraint by Markov random field. In addition, the results of K -means are used to initialize the improved FCM method. Experimental results show that the improved method is effective and performs better than the existing methods, including the existing FCM methods, for segmentation of the IR ship images.

  3. Detecting waste-combustion emissions: several advanced methods are useful for sampling air contaminants from hazardous-waste-incinerator stacks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, L.D.

    1986-01-01

    This paper is an overview of sampling methods being recommended to EPA regulatory programs, to EPA engineering research and development projects, and to interested parties in the industrial community. The methods discussed are generally applicable to both incineration and processes closely related to incineration (e.g., co-firing of waste in industrial boilers, and burning of contaminated heating oil). Although methods for inorganic hazardous compounds are very briefly outlined, the primary emphasis of the paper is on organic compounds that are likely to be chosen as principal organic hazardous constituents (POHCs) for a trial burn. Methods receiving major attention include: the Modifiedmore » Method 5 Train (MM5) which includes an XAD-2 sorbent module, the Source Assessment Sampling System (SASS), the recently developed Volatile Organic Sampling Train (VOST), and assorted containers such as glass bulbs and plastic bags.« less

  4. Methyl-CpG island-associated genome signature tags

    DOEpatents

    Dunn, John J

    2014-05-20

    Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

  5. Prediction of ground effects on aircraft noise

    NASA Technical Reports Server (NTRS)

    Pao, S. P.; Wenzel, A. R.; Oncley, P. B.

    1978-01-01

    A unified method is recommended for predicting ground effects on noise. This method may be used in flyover noise predictions and in correcting static test-stand data to free-field conditions. The recommendation is based on a review of recent progress in the theory of ground effects and of the experimental evidence which supports this theory. It is shown that a surface wave must be included sometimes in the prediction method. Prediction equations are collected conveniently in a single section of the paper. Methods of measuring ground impedance and the resulting ground-impedance data are also reviewed because the recommended method is based on a locally reactive impedance boundary model. Current practice of estimating ground effects are reviewed and consideration is given to practical problems in applying the recommended method. These problems include finite frequency-band filters, finite source dimension, wind and temperature gradients, and signal incoherence.

  6. Flow-gated radial phase-contrast imaging in the presence of weak flow.

    PubMed

    Peng, Hsu-Hsia; Huang, Teng-Yi; Wang, Fu-Nien; Chung, Hsiao-Wen

    2013-01-01

    To implement a flow-gating method to acquire phase-contrast (PC) images of carotid arteries without use of an electrocardiography (ECG) signal to synchronize the acquisition of imaging data with pulsatile arterial flow. The flow-gating method was realized through radial scanning and sophisticated post-processing methods including downsampling, complex difference, and correlation analysis to improve the evaluation of flow-gating times in radial phase-contrast scans. Quantitatively comparable results (R = 0.92-0.96, n = 9) of flow-related parameters, including mean velocity, mean flow rate, and flow volume, with conventional ECG-gated imaging demonstrated that the proposed method is highly feasible. The radial flow-gating PC imaging method is applicable in carotid arteries. The proposed flow-gating method can potentially avoid the setting up of ECG-related equipment for brain imaging. This technique has potential use in patients with arrhythmia or weak ECG signals.

  7. Immunoaffinity chromatography: an introduction to applications and recent developments

    PubMed Central

    Moser, Annette C

    2010-01-01

    Immunoaffinity chromatography (IAC) combines the use of LC with the specific binding of antibodies or related agents. The resulting method can be used in assays for a particular target or for purification and concentration of analytes prior to further examination by another technique. This review discusses the history and principles of IAC and the various formats that can be used with this method. An overview is given of the general properties of antibodies and of antibody-production methods. The supports and immobilization methods used with antibodies in IAC and the selection of application and elution conditions for IAC are also discussed. Several applications of IAC are considered, including its use in purification, immunodepletion, direct sample analysis, chromatographic immunoassays and combined analysis methods. Recent developments include the use of IAC with CE or MS, ultrafast immunoextraction methods and the use of immunoaffinity columns in microanalytical systems. PMID:20640220

  8. Viscous-inviscid interaction method including wake effects for three-dimensional wing-body configurations

    NASA Technical Reports Server (NTRS)

    Streett, C. L.

    1981-01-01

    A viscous-inviscid interaction method has been developed by using a three-dimensional integral boundary-layer method which produces results in good agreement with a finite-difference method in a fraction of the computer time. The integral method is stable and robust and incorporates a model for computation in a small region of streamwise separation. A locally two-dimensional wake model, accounting for thickness and curvature effects, is also included in the interaction procedure. Computation time spent in converging an interacted result is, many times, only slightly greater than that required to converge an inviscid calculation. Results are shown from the interaction method, run at experimental angle of attack, Reynolds number, and Mach number, on a wing-body test case for which viscous effects are large. Agreement with experiment is good; in particular, the present wake model improves prediction of the spanwise lift distribution and lower surface cove pressure.

  9. 28 CFR 36.309 - Examinations and courses.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... include taped examinations, interpreters or other effective methods of making orally delivered materials... qualified readers for individuals with visual impairments or learning disabilities, transcribers for... and services required by this section may include taped texts, interpreters or other effective methods...

  10. 28 CFR 36.309 - Examinations and courses.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... include taped examinations, interpreters or other effective methods of making orally delivered materials... qualified readers for individuals with visual impairments or learning disabilities, transcribers for... and services required by this section may include taped texts, interpreters or other effective methods...

  11. 28 CFR 36.309 - Examinations and courses.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... include taped examinations, interpreters or other effective methods of making orally delivered materials... qualified readers for individuals with visual impairments or learning disabilities, transcribers for... and services required by this section may include taped texts, interpreters or other effective methods...

  12. The Weakest Link: Library Catalogs.

    ERIC Educational Resources Information Center

    Young, Terrence E., Jr.

    2002-01-01

    Describes methods of correcting MARC records in online public access catalogs in school libraries. Highlights include in-house methods; professional resources; conforming to library cataloging standards; vendor services, including Web-based services; software specifically developed for record cleanup; and outsourcing. (LRW)

  13. Non-cementitious compositions comprising vaterite and methods thereof

    DOEpatents

    Devenney, Martin; Fernandez, Miguel; Morgan, Samuel O.

    2015-09-15

    Non-cementitious compositions and products are provided. The compositions of the invention include a carbonate additive comprising vaterite such as reactive vaterite. Additional aspects of the invention include methods of making and using the non-cementitious compositions and products.

  14. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    DOEpatents

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  15. Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

    DOEpatents

    Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

    2010-08-17

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  16. Method and apparatus for wavefront sensing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bahk, Seung-Whan

    A method for performing optical wavefront sensing includes providing an amplitude transmission mask having a light input side, a light output side, and an optical transmission axis passing from the light input side to the light output side. The amplitude transmission mask is characterized by a checkerboard pattern having a square unit cell of size .LAMBDA.. The method also includes directing an incident light field having a wavelengthmore » $$ \\lamda $$ to be incident on the light input side and propagating the incident light field through the amplitude transmission mask. The method further includes producing a plurality of diffracted light fields on the light output side and detecting, at a detector disposed a distance L from the amplitude transmission mask, an interferogram associated with the plurality of diffracted light fields.« less

  17. Conversion of 2,3-butanediol to 2-butanol, olefins and fuels

    DOEpatents

    Lilga, Michael A.; Lee, Guo-Shuh; Lee, Suh-Jane

    2016-12-13

    Embodiments of an integrated method for step-wise conversion of 2,3-butanediol to 2-butanol, and optionally to hydrocarbons, are disclosed. The method includes providing an acidic catalyst, exposing a composition comprising aqueous 2,3-butanediol to the acidic catalyst to produce an intermediate composition comprising methyl ethyl ketone, providing a hydrogenation catalyst that is spatially separated from the acidic catalyst, and subsequently exposing the intermediate composition to the hydrogenation catalyst to produce a composition comprising 2-butanol. The method may further include subsequently exposing the composition comprising 2-butanol to a deoxygenation catalyst, and deoxygenating the 2-butanol to form hydrocarbons. In some embodiments, the hydrocarbons comprise olefins, such as butenes, and the method may further include subsequently exposing the hydrocarbons to a hydrogenation catalyst to form saturated hydrocarbons.

  18. Control system health test system and method

    DOEpatents

    Hoff, Brian D.; Johnson, Kris W.; Akasam, Sivaprasad; Baker, Thomas M.

    2006-08-15

    A method is provided for testing multiple elements of a work machine, including a control system, a component, a sub-component that is influenced by operations of the component, and a sensor that monitors a characteristic of the sub-component. In one embodiment, the method is performed by the control system and includes sending a command to the component to adjust a first parameter associated with an operation of the component. Also, the method includes detecting a sensor signal from the sensor reflecting a second parameter associated with a characteristic of the sub-component and determining whether the second parameter is acceptable based on the command. The control system may diagnose at least one of the elements of the work machine when the second parameter of the sub-component is not acceptable.

  19. Stationary semi-solid battery module and method of manufacture

    DOEpatents

    Slocum, Alexander; Doherty, Tristan; Bazzarella, Ricardo; Cross, III, James C.; Limthongkul, Pimpa; Duduta, Mihai; Disko, Jeffry; Yang, Allen; Wilder, Throop; Carter, William Craig; Chiang, Yet-Ming

    2015-12-01

    A method of manufacturing an electrochemical cell includes transferring an anode semi-solid suspension to an anode compartment defined at least in part by an anode current collector and an separator spaced apart from the anode collector. The method also includes transferring a cathode semi-solid suspension to a cathode compartment defined at least in part by a cathode current collector and the separator spaced apart from the cathode collector. The transferring of the anode semi-solid suspension to the anode compartment and the cathode semi-solid to the cathode compartment is such that a difference between a minimum distance and a maximum distance between the anode current collector and the separator is maintained within a predetermined tolerance. The method includes sealing the anode compartment and the cathode compartment.

  20. Lattice-mismatched GaInP LED devices and methods of fabricating same

    DOEpatents

    Mascarenhas, Angelo; Steiner, Myles A; Bhusal, Lekhnath; Zhang, Yong

    2014-10-21

    A method (100) of fabricating an LED or the active regions of an LED and an LED (200). The method includes growing, depositing or otherwise providing a bottom cladding layer (208) of a selected semiconductor alloy with an adjusted bandgap provided by intentionally disordering the structure of the cladding layer (208). A first active layer (202) may be grown above the bottom cladding layer (208) wherein the first active layer (202) is fabricated of the same semiconductor alloy, with however, a partially ordered structure. The first active layer (202) will also be fabricated to include a selected n or p type doping. The method further includes growing a second active layer (204) above the first active layer (202) where the second active layer (204) Is fabricated from the same semiconductor alloy.

  1. Combinatorial Screening Of Inorganic And Organometallic Materials

    DOEpatents

    Li, Yi , Li, Jing , Britton, Ted W.

    2002-06-25

    A method for differentiating and enumerating nucleated red blood cells in a blood sample is described. The method includes the steps of lysing red blood cells of a blood sample with a lytic reagent, measuring nucleated blood cells by DC impedance measurement in a non-focused flow aperture, differentiating nucleated red blood cells from other cell types, and reporting nucleated red blood cells in the blood sample. The method further includes subtracting nucleated red blood cells and other interference materials from the count of remaining blood cells, and reporting a corrected white blood cell count of the blood sample. Additionally, the method further includes measuring spectrophotometric absorbance of the sample mixture at a predetermined wavelength of a hemoglobin chromogen formed upon lysing the blood sample, and reporting hemoglobin concentration of the blood sample.

  2. Restriction/modification polypeptides, polynucleotides, and methods

    DOEpatents

    Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

    2015-02-24

    The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

  3. Initiation disruptor systems and methods of initiation disruption

    DOEpatents

    Baum, Dennis W

    2014-09-23

    A system that may be used as an initiation disruption system (IDS) according to one embodiment includes an explosive charge; a plurality of particles in a layer at least partially surrounding the explosive charge; and a fire suppressant adjacent the plurality of particles. A method for disabling an object according to one embodiment includes placing the system as recited above near an object; and causing the explosive charge to initiate, thereby applying mechanical loading to the object such that the object becomes disabled. Additional systems and methods are also presented. A device according to another embodiment includes a plurality of particles bound by a binder thereby defining a sidewall having an interior for receiving an explosive; and a fire suppressant adjacent the plurality of particles and binder. Additional systems and methods are also presented.

  4. Method and system for determining the torque required to launch a vehicle having a hybrid drive-train

    DOEpatents

    Hughes, Douglas A.

    2006-04-04

    A method and system are provided for determining the torque required to launch a vehicle having a hybrid drive-train that includes at least two independently operable prime movers. The method includes the steps of determining the value of at least one control parameter indicative of a vehicle operating condition, determining the torque required to launch the vehicle from the at least one determined control parameter, comparing the torque available from the prime movers to the torque required to launch the vehicle, and controlling operation of the prime movers to launch the vehicle in response to the comparing step. The system of the present invention includes a control unit configured to perform the steps of the method outlined above.

  5. Methods, computer readable media, and graphical user interfaces for analysis of frequency selective surfaces

    DOEpatents

    Kotter, Dale K [Shelley, ID; Rohrbaugh, David T [Idaho Falls, ID

    2010-09-07

    A frequency selective surface (FSS) and associated methods for modeling, analyzing and designing the FSS are disclosed. The FSS includes a pattern of conductive material formed on a substrate to form an array of resonance elements. At least one aspect of the frequency selective surface is determined by defining a frequency range including multiple frequency values, determining a frequency dependent permittivity across the frequency range for the substrate, determining a frequency dependent conductivity across the frequency range for the conductive material, and analyzing the frequency selective surface using a method of moments analysis at each of the multiple frequency values for an incident electromagnetic energy impinging on the frequency selective surface. The frequency dependent permittivity and the frequency dependent conductivity are included in the method of moments analysis.

  6. Shaped nanocrystal particles and methods for making the same

    DOEpatents

    Alivisatos, A Paul [Oakland, CA; Scher, Erik C [Menlo Park, CA; Manna, Liberato [Berkeley, CA

    2011-11-22

    Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.

  7. Shaped nanocrystal particles and methods for making the same

    DOEpatents

    Alivisatos, A. Paul; Scher, Erik C; Manna, Liberato

    2013-12-17

    Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.

  8. Methods for creating ligand induced paramagnetism in nanocrystalline structures

    DOEpatents

    Meulenberg, Robert W.; Lee, Jonathan R. I.; Van Buuren, Anthony W.; Terminello, Louis J.

    2016-12-13

    A method according to one general embodiment includes applying an organic surfactant to a nanoparticle having a d.sup.10 configuration for altering a magnetic property of the nanoparticle. A method according to another general embodiment includes applying an organic surfactant to a II-VI semiconductor nanoparticle having a d.sup.10 configuration for altering a magnetic property of the nanoparticle, wherein the nanoparticle has a mean radius of less than about 50 .ANG..

  9. Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters

    DTIC Science & Technology

    2016-06-01

    simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the

  10. Shaped nanocrystal particles and methods for working the same

    DOEpatents

    Alivisatos, A. Paul; Sher, Eric C.; Manna, Liberato

    2007-12-25

    Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.

  11. Shaped Nonocrystal Particles And Methods For Making The Same

    DOEpatents

    Alivisatos, A. Paul; Scher, Erik C.; Manna, Liberato

    2005-02-15

    Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.

  12. [Essential characteristics of qualitative research and its commonly used methods].

    PubMed

    Zhang, Hong-wei

    2008-02-01

    The main objectives of qualitative research lies in exploring the opinion, attitude, behavior, and experience of a person as a social role, also a patient. This essay introduces the basic characteristics of qualitative research, including its natural property, inductive method adopted, open character and wholism concept; the results of qualitative research are presented in a text form; and its commonly used methods include observation, individual interview and focus group discussion.

  13. Pressurized Anneal of Consolidated Powders

    NASA Technical Reports Server (NTRS)

    Nemir, David Charles (Inventor); Rubio, Edward S. (Inventor); Beck, Jan Bastian (Inventor)

    2017-01-01

    Systems and methods for producing a dense, well bonded solid material from a powder may include consolidating the powder utilizing any suitable consolidation method, such as explosive shockwave consolidation. The systems and methods may also include a post-processing thermal treatment that exploits a mismatch between the coefficients of thermal expansion between the consolidated material and the container. Due to the mismatch in the coefficients, internal pressure on the consolidated material during the heat treatment may be increased.

  14. Method for determining gene knockouts

    DOEpatents

    Maranas, Costas D [Port Matilda, PA; Burgard, Anthony R [State College, PA; Pharkya, Priti [State College, PA

    2011-09-27

    A method for determining candidates for gene deletions and additions using a model of a metabolic network associated with an organism, the model includes a plurality of metabolic reactions defining metabolite relationships, the method includes selecting a bioengineering objective for the organism, selecting at least one cellular objective, forming an optimization problem that couples the at least one cellular objective with the bioengineering objective, and solving the optimization problem to yield at least one candidate.

  15. Method for determining gene knockouts

    DOEpatents

    Maranas, Costa D; Burgard, Anthony R; Pharkya, Priti

    2013-06-04

    A method for determining candidates for gene deletions and additions using a model of a metabolic network associated with an organism, the model includes a plurality of metabolic reactions defining metabolite relationships, the method includes selecting a bioengineering objective for the organism, selecting at least one cellular objective, forming an optimization problem that couples the at least one cellular objective with the bioengineering objective, and solving the optimization problem to yield at least one candidate.

  16. An evaluation of methods for estimating decadal stream loads

    NASA Astrophysics Data System (ADS)

    Lee, Casey J.; Hirsch, Robert M.; Schwarz, Gregory E.; Holtschlag, David J.; Preston, Stephen D.; Crawford, Charles G.; Vecchia, Aldo V.

    2016-11-01

    Effective management of water resources requires accurate information on the mass, or load of water-quality constituents transported from upstream watersheds to downstream receiving waters. Despite this need, no single method has been shown to consistently provide accurate load estimates among different water-quality constituents, sampling sites, and sampling regimes. We evaluate the accuracy of several load estimation methods across a broad range of sampling and environmental conditions. This analysis uses random sub-samples drawn from temporally-dense data sets of total nitrogen, total phosphorus, nitrate, and suspended-sediment concentration, and includes measurements of specific conductance which was used as a surrogate for dissolved solids concentration. Methods considered include linear interpolation and ratio estimators, regression-based methods historically employed by the U.S. Geological Survey, and newer flexible techniques including Weighted Regressions on Time, Season, and Discharge (WRTDS) and a generalized non-linear additive model. No single method is identified to have the greatest accuracy across all constituents, sites, and sampling scenarios. Most methods provide accurate estimates of specific conductance (used as a surrogate for total dissolved solids or specific major ions) and total nitrogen - lower accuracy is observed for the estimation of nitrate, total phosphorus and suspended sediment loads. Methods that allow for flexibility in the relation between concentration and flow conditions, specifically Beale's ratio estimator and WRTDS, exhibit greater estimation accuracy and lower bias. Evaluation of methods across simulated sampling scenarios indicate that (1) high-flow sampling is necessary to produce accurate load estimates, (2) extrapolation of sample data through time or across more extreme flow conditions reduces load estimate accuracy, and (3) WRTDS and methods that use a Kalman filter or smoothing to correct for departures between individual modeled and observed values benefit most from more frequent water-quality sampling.

  17. Systematic review of the application of the plan–do–study–act method to improve quality in healthcare

    PubMed Central

    Taylor, Michael J; McNicholas, Chris; Nicolay, Chris; Darzi, Ara; Bell, Derek; Reed, Julie E

    2014-01-01

    Background Plan–do–study–act (PDSA) cycles provide a structure for iterative testing of changes to improve quality of systems. The method is widely accepted in healthcare improvement; however there is little overarching evaluation of how the method is applied. This paper proposes a theoretical framework for assessing the quality of application of PDSA cycles and explores the consistency with which the method has been applied in peer-reviewed literature against this framework. Methods NHS Evidence and Cochrane databases were searched by three independent reviewers. Empirical studies were included that reported application of the PDSA method in healthcare. Application of PDSA cycles was assessed against key features of the method, including documentation characteristics, use of iterative cycles, prediction-based testing of change, initial small-scale testing and use of data over time. Results 73 of 409 individual articles identified met the inclusion criteria. Of the 73 articles, 47 documented PDSA cycles in sufficient detail for full analysis against the whole framework. Many of these studies reported application of the PDSA method that failed to accord with primary features of the method. Less than 20% (14/73) fully documented the application of a sequence of iterative cycles. Furthermore, a lack of adherence to the notion of small-scale change is apparent and only 15% (7/47) reported the use of quantitative data at monthly or more frequent data intervals to inform progression of cycles. Discussion To progress the development of the science of improvement, a greater understanding of the use of improvement methods, including PDSA, is essential to draw reliable conclusions about their effectiveness. This would be supported by the development of systematic and rigorous standards for the application and reporting of PDSAs. PMID:24025320

  18. An evaluation of methods for estimating decadal stream loads

    USGS Publications Warehouse

    Lee, Casey; Hirsch, Robert M.; Schwarz, Gregory E.; Holtschlag, David J.; Preston, Stephen D.; Crawford, Charles G.; Vecchia, Aldo V.

    2016-01-01

    Effective management of water resources requires accurate information on the mass, or load of water-quality constituents transported from upstream watersheds to downstream receiving waters. Despite this need, no single method has been shown to consistently provide accurate load estimates among different water-quality constituents, sampling sites, and sampling regimes. We evaluate the accuracy of several load estimation methods across a broad range of sampling and environmental conditions. This analysis uses random sub-samples drawn from temporally-dense data sets of total nitrogen, total phosphorus, nitrate, and suspended-sediment concentration, and includes measurements of specific conductance which was used as a surrogate for dissolved solids concentration. Methods considered include linear interpolation and ratio estimators, regression-based methods historically employed by the U.S. Geological Survey, and newer flexible techniques including Weighted Regressions on Time, Season, and Discharge (WRTDS) and a generalized non-linear additive model. No single method is identified to have the greatest accuracy across all constituents, sites, and sampling scenarios. Most methods provide accurate estimates of specific conductance (used as a surrogate for total dissolved solids or specific major ions) and total nitrogen – lower accuracy is observed for the estimation of nitrate, total phosphorus and suspended sediment loads. Methods that allow for flexibility in the relation between concentration and flow conditions, specifically Beale’s ratio estimator and WRTDS, exhibit greater estimation accuracy and lower bias. Evaluation of methods across simulated sampling scenarios indicate that (1) high-flow sampling is necessary to produce accurate load estimates, (2) extrapolation of sample data through time or across more extreme flow conditions reduces load estimate accuracy, and (3) WRTDS and methods that use a Kalman filter or smoothing to correct for departures between individual modeled and observed values benefit most from more frequent water-quality sampling.

  19. Single-Transducer, Ultrasonic Imaging Method for High-Temperature Structural Materials Eliminates the Effect of Thickness Variation in the Image

    NASA Technical Reports Server (NTRS)

    Roth, Don J.

    1998-01-01

    NASA Lewis Research Center's Life Prediction Branch, in partnership with Sonix, Inc., and Cleveland State University, recently advanced the development of, refined, and commercialized an advanced nondestructive evaluation (NDE) inspection method entitled the Single Transducer Thickness-Independent Ultrasonic Imaging Method. Selected by R&D Magazine as one of the 100 most technologically significant new products of 1996, the method uses a single transducer to eliminate the superimposing effects of thickness variation in the ultrasonic images of materials. As a result, any variation seen in the image is due solely to microstructural variation. This nondestructive method precisely and accurately characterizes material gradients (pore fraction, density, or chemical) that affect the uniformity of a material's physical performance (mechanical, thermal, or electrical). Advantages of the method over conventional ultrasonic imaging include (1) elimination of machining costs (for precision thickness control) during the quality control stages of material processing and development and (2) elimination of labor costs and subjectivity involved in further image processing and image interpretation. At NASA Lewis, the method has been used primarily for accurate inspections of high temperature structural materials including monolithic ceramics, metal matrix composites, and polymer matrix composites. Data were published this year for platelike samples, and current research is focusing on applying the method to tubular components. The initial publicity regarding the development of the method generated 150 requests for further information from a wide variety of institutions and individuals including the Federal Bureau of Investigation (FBI), Lockheed Martin Corporation, Rockwell International, Hewlett Packard Company, and Procter & Gamble Company. In addition, NASA has been solicited by the 3M Company and Allison Abrasives to use this method to inspect composite materials that are manufactured by these companies.

  20. Learning spinal manipulation: A best-evidence synthesis of teaching methods.

    PubMed

    Stainsby, Brynne E; Clarke, Michelle C S; Egonia, Jade R

    2016-10-01

    The purpose of this study was to evaluate the effectiveness of different reported methods used to teach spinal manipulative therapy to chiropractic students. For this best-evidence literature synthesis, 5 electronic databases were searched from 1900 to 2015. Eligible studies were critically appraised using the criteria of the Scottish Intercollegiate Guidelines Network. Scientifically admissible studies were synthesized following best-evidence synthesis principles. Twenty articles were critically appraised, including 9 randomized clinical trials, 9 cohort studies, and 2 systematic reviews/meta-analyses. Eleven articles were accepted as scientifically admissible. The type of teaching method aids included a Thrust in Motion cervical manikin, instrumented cardiopulmonary reanimation manikin, padded contact with a load cell, instrumented treatment table with force sensor/transducer, and Dynadjust instrument. Several different methods exist in the literature for teaching spinal manipulative therapy techniques; however, future research in this developing area of chiropractic education is proposed. It is suggested that various teaching methods be included in the regular curricula of chiropractic colleges to aid in developing manipulation skills, efficiency, and knowledge of performance.

  1. Entry Debris Field Estimation Methods and Application to Compton Gamma Ray Observatory Disposal

    NASA Technical Reports Server (NTRS)

    Mrozinski, Richard B.

    2001-01-01

    For public safety reasons, the Compton Gamma Ray Observatory (CGRO) was intentionally deorbited on June 4, 2000. This deorbit was NASA's first intentional controlled deorbit of a satellite, and more will come including the eventual deorbit of the International Space Station. To maximize public safety, satellite deorbit planning requires conservative estimates of the debris footprint size and location. These estimates are needed to properly design a deorbit sequence that places the debris footprint over unpopulated areas, including protection for deorbit contingencies. This paper details a method for estimating the length (range), width (crossrange), and location of entry and breakup debris footprints. This method utilizes a three degree-of-freedom Monte Carlo simulation incorporating uncertainties in all aspects of the problem, including vehicle and environment uncertainties. The method incorporates a range of debris characteristics based on historical data in addition to any vehicle-specific debris catalog information. This paper describes the method in detail, and presents results of its application as used in planning the deorbit of the CGRO.

  2. Word aligned bitmap compression method, data structure, and apparatus

    DOEpatents

    Wu, Kesheng; Shoshani, Arie; Otoo, Ekow

    2004-12-14

    The Word-Aligned Hybrid (WAH) bitmap compression method and data structure is a relatively efficient method for searching and performing logical, counting, and pattern location operations upon large datasets. The technique is comprised of a data structure and methods that are optimized for computational efficiency by using the WAH compression method, which typically takes advantage of the target computing system's native word length. WAH is particularly apropos to infrequently varying databases, including those found in the on-line analytical processing (OLAP) industry, due to the increased computational efficiency of the WAH compressed bitmap index. Some commercial database products already include some version of a bitmap index, which could possibly be replaced by the WAH bitmap compression techniques for potentially increased operation speed, as well as increased efficiencies in constructing compressed bitmaps. Combined together, this technique may be particularly useful for real-time business intelligence. Additional WAH applications may include scientific modeling, such as climate and combustion simulations, to minimize search time for analysis and subsequent data visualization.

  3. Carbide and carbonitride surface treatment method for refractory metals

    DOEpatents

    Meyer, Glenn A.; Schildbach, Marcus A.

    1996-01-01

    A carbide and carbonitride surface treatment method for refractory metals is provided, in steps including, heating a part formed of boron, chromium, hafnium, molybdenum, niobium, tantalum, titanium, tungsten or zirconium, or alloys thereof, in an evacuated chamber and then introducing reaction gases including nitrogen and hydrogen, either in elemental or water vapor form, which react with a source of elemental carbon to form carbon-containing gaseous reactants which then react with the metal part to form the desired surface layer. Apparatus for practicing the method is also provided, in the form of a carbide and carbonitride surface treatment system (10) including a reaction chamber (14), a source of elemental carbon (17), a heating subassembly (20) and a source of reaction gases (23). Alternative methods of providing the elemental carbon (17) and the reaction gases (23) are provided, as well as methods of supporting the metal part (12), evacuating the chamber (14) with a vacuum subassembly (18) and heating all of the components to the desired temperature.

  4. GPU computing with Kaczmarz’s and other iterative algorithms for linear systems

    PubMed Central

    Elble, Joseph M.; Sahinidis, Nikolaos V.; Vouzis, Panagiotis

    2009-01-01

    The graphics processing unit (GPU) is used to solve large linear systems derived from partial differential equations. The differential equations studied are strongly convection-dominated, of various sizes, and common to many fields, including computational fluid dynamics, heat transfer, and structural mechanics. The paper presents comparisons between GPU and CPU implementations of several well-known iterative methods, including Kaczmarz’s, Cimmino’s, component averaging, conjugate gradient normal residual (CGNR), symmetric successive overrelaxation-preconditioned conjugate gradient, and conjugate-gradient-accelerated component-averaged row projections (CARP-CG). Computations are preformed with dense as well as general banded systems. The results demonstrate that our GPU implementation outperforms CPU implementations of these algorithms, as well as previously studied parallel implementations on Linux clusters and shared memory systems. While the CGNR method had begun to fall out of favor for solving such problems, for the problems studied in this paper, the CGNR method implemented on the GPU performed better than the other methods, including a cluster implementation of the CARP-CG method. PMID:20526446

  5. Systems and methods for detecting an image of an object by use of an X-ray beam having a polychromatic distribution

    DOEpatents

    Parham, Christopher; Zhong, Zhong; Pisano, Etta; Connor, Dean; Chapman, Leroy D.

    2010-06-22

    Systems and methods for detecting an image of an object using an X-ray beam having a polychromatic energy distribution are disclosed. According to one aspect, a method can include detecting an image of an object. The method can include generating a first X-ray beam having a polychromatic energy distribution. Further, the method can include positioning a single monochromator crystal in a predetermined position to directly intercept the first X-ray beam such that a second X-ray beam having a predetermined energy level is produced. Further, an object can be positioned in the path of the second X-ray beam for transmission of the second X-ray beam through the object and emission from the object as a transmitted X-ray beam. The transmitted X-ray beam can be directed at an angle of incidence upon a crystal analyzer. Further, an image of the object can be detected from a beam diffracted from the analyzer crystal.

  6. Methods for environmental change; an exploratory study.

    PubMed

    Kok, Gerjo; Gottlieb, Nell H; Panne, Robert; Smerecnik, Chris

    2012-11-28

    While the interest of health promotion researchers in change methods directed at the target population has a long tradition, interest in change methods directed at the environment is still developing. In this survey, the focus is on methods for environmental change; especially about how these are composed of methods for individual change ('Bundling') and how within one environmental level, organizations, methods differ when directed at the management ('At') or applied by the management ('From'). The first part of this online survey dealt with examining the 'bundling' of individual level methods to methods at the environmental level. The question asked was to what extent the use of an environmental level method would involve the use of certain individual level methods. In the second part of the survey the question was whether there are differences between applying methods directed 'at' an organization (for instance, by a health promoter) versus 'from' within an organization itself. All of the 20 respondents are experts in the field of health promotion. Methods at the individual level are frequently bundled together as part of a method at a higher ecological level. A number of individual level methods are popular as part of most of the environmental level methods, while others are not chosen very often. Interventions directed at environmental agents often have a strong focus on the motivational part of behavior change.There are different approaches targeting a level or being targeted from a level. The health promoter will use combinations of motivation and facilitation. The manager will use individual level change methods focusing on self-efficacy and skills. Respondents think that any method may be used under the right circumstances, although few endorsed coercive methods. Taxonomies of theoretical change methods for environmental change should include combinations of individual level methods that may be bundled and separate suggestions for methods targeting a level or being targeted from a level. Future research needs to cover more methods to rate and to be rated. Qualitative data may explain some of the surprising outcomes, such as the lack of large differences and the avoidance of coercion. Taxonomies should include the theoretical parameters that limit the effectiveness of the method.

  7. Multi-laboratory evaluations of the performance of Catellicoccus marimammalium PCR assays developed to target gull fecal sources

    USGS Publications Warehouse

    Sinigalliano, Christopher D.; Ervin, Jared S.; Van De Werfhorst, Laurie C.; Badgley, Brian D.; Ballestée, Elisenda; Bartkowiaka, Jakob; Boehm, Alexandria B.; Byappanahalli, Muruleedhara N.; Goodwin, Kelly D.; Gourmelon, Michèle; Griffith, John; Holden, Patricia A.; Jay, Jenny; Layton, Blythe; Lee, Cheonghoon; Lee, Jiyoung; Meijer, Wim G.; Noble, Rachel; Raith, Meredith; Ryu, Hodon; Sadowsky, Michael J.; Schriewer, Alexander; Wang, Dan; Wanless, David; Whitman, Richard; Wuertz, Stefan; Santo Domingo, Jorge W.

    2013-01-01

    Here we report results from a multi-laboratory (n = 11) evaluation of four different PCR methods targeting the 16S rRNA gene of Catellicoccus marimammalium originally developed to detect gull fecal contamination in coastal environments. The methods included a conventional end-point PCR method, a SYBR® Green qPCR method, and two TaqMan® qPCR methods. Different techniques for data normalization and analysis were tested. Data analysis methods had a pronounced impact on assay sensitivity and specificity calculations. Across-laboratory standardization of metrics including the lower limit of quantification (LLOQ), target detected but not quantifiable (DNQ), and target not detected (ND) significantly improved results compared to results submitted by individual laboratories prior to definition standardization. The unit of measure used for data normalization also had a pronounced effect on measured assay performance. Data normalization to DNA mass improved quantitative method performance as compared to enterococcus normalization. The MST methods tested here were originally designed for gulls but were found in this study to also detect feces from other birds, particularly feces composited from pigeons. Sequencing efforts showed that some pigeon feces from California contained sequences similar to C. marimammalium found in gull feces. These data suggest that the prevalence, geographic scope, and ecology of C. marimammalium in host birds other than gulls require further investigation. This study represents an important first step in the multi-laboratory assessment of these methods and highlights the need to broaden and standardize additional evaluations, including environmentally relevant target concentrations in ambient waters from diverse geographic regions.

  8. Selection of nursing teaching strategies in mainland China: A questionnaire survey.

    PubMed

    Zhou, HouXiu; Liu, MengJie; Zeng, Jing; Zhu, JingCi

    2016-04-01

    In nursing education, the traditional lecture and direct demonstration teaching method cannot cultivate the various skills that nursing students need. How to choose a more scientific and rational teaching method is a common concern for nursing educators worldwide. To investigate the basis for selecting teaching methods among nursing teachers in mainland China, the factors affecting the selection of different teaching methods, and the application of different teaching methods in theoretical and skill-based nursing courses. Questionnaire survey. Seventy one nursing colleges from 28 provincial-level administrative regions in mainland China. Following the principle of voluntary informed consent, 262 nursing teachers were randomly selected through a nursing education network platform and a conference platform. The questionnaire contents included the basis for and the factors influencing the selection of nursing teaching methods, the participants' common teaching methods, and the teaching experience of the surveyed nursing teachers. The questionnaires were distributed through the network or conference platform, and the data were analyzed by SPSS 17.0 software. The surveyed nursing teachers selected teaching methods mainly based on the characteristics of the teaching content, the characteristics of the students, and their previous teaching experiences. The factors affecting the selection of teaching methods mainly included large class sizes, limited class time, and limited examination formats. The surveyed nursing teachers primarily used lectures to teach theory courses and the direct demonstration method to teach skills courses, and the application frequencies of these two teaching methods were significantly higher than those of other teaching methods (P=0.000). More attention should be paid to the selection of nursing teaching methods. Every teacher should strategically choose teaching methods before each lesson, and nursing education training focused on selecting effective teaching methods should be more extensive. Copyright © 2016. Published by Elsevier Ltd.

  9. An improved EMD method for modal identification and a combined static-dynamic method for damage detection

    NASA Astrophysics Data System (ADS)

    Yang, Jinping; Li, Peizhen; Yang, Youfa; Xu, Dian

    2018-04-01

    Empirical mode decomposition (EMD) is a highly adaptable signal processing method. However, the EMD approach has certain drawbacks, including distortions from end effects and mode mixing. In the present study, these two problems are addressed using an end extension method based on the support vector regression machine (SVRM) and a modal decomposition method based on the characteristics of the Hilbert transform. The algorithm includes two steps: using the SVRM, the time series data are extended at both endpoints to reduce the end effects, and then, a modified EMD method using the characteristics of the Hilbert transform is performed on the resulting signal to reduce mode mixing. A new combined static-dynamic method for identifying structural damage is presented. This method combines the static and dynamic information in an equilibrium equation that can be solved using the Moore-Penrose generalized matrix inverse. The combination method uses the differences in displacements of the structure with and without damage and variations in the modal force vector. Tests on a four-story, steel-frame structure were conducted to obtain static and dynamic responses of the structure. The modal parameters are identified using data from the dynamic tests and improved EMD method. The new method is shown to be more accurate and effective than the traditional EMD method. Through tests with a shear-type test frame, the higher performance of the proposed static-dynamic damage detection approach, which can detect both single and multiple damage locations and the degree of the damage, is demonstrated. For structures with multiple damage, the combined approach is more effective than either the static or dynamic method. The proposed EMD method and static-dynamic damage detection method offer improved modal identification and damage detection, respectively, in structures.

  10. 30 CFR 1218.155 - Method of payment.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 3 2011-07-01 2011-07-01 false Method of payment. 1218.155 Section 1218.155... Sulfur, Offshore § 1218.155 Method of payment. (a) Payment of royalties and rentals. With the exception... with the bid will be included in the notice of each lease offering. EFT may be used as a method of...

  11. STEM VQ Method, Using Scanning Transmission Electron Microscopy (STEM) for Accurate Virus Quantification

    DTIC Science & Technology

    2017-02-02

    Corresponding Author Abstract Accurate virus quantification is sought, but a perfect method still eludes the scientific community. Electron...unlimited. UNCLASSIFIED 2 provides morphology data and counts all viral particles, including partial or noninfectious particles; however, EM methods ...consistent, reproducible virus quantification method called Scanning Transmission Electron Microscopy – Virus Quantification (STEM-VQ) which simplifies

  12. 76 FR 53819 - Methods of Accounting Used by Corporations That Acquire the Assets of Other Corporations; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-30

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Part 1 [TD 9534] RIN 1545-BD81 Methods... describes corrections to final regulations (TD 9534) relating to the methods of accounting, including the inventory methods, to be used by corporations that acquire the assets of other corporations in certain...

  13. Glycoprotein synthesis

    DOEpatents

    Schultz, Peter G.; Wang, Lei; Zhang, Zhiwen

    2005-08-09

    Methods for making glycoproteins, both in vitro and in vivo, are provided. One method involves incorporating an unnatural amino acid into a protein and attaching one or more saccharide moieties to the unnatural amino acid. Another method involves incorporating an unnatural amino acid that includes a saccharide moiety into a protein. Proteins made by both methods can be further modified with additional sugars.

  14. The Method Effect in Communicative Testing.

    ERIC Educational Resources Information Center

    Canale, Michael

    1981-01-01

    A focus on test validity includes a consideration of the way a test measures that which it proposes to test; in other words, the validity of a test depends on method as well as content. This paper examines three areas of concern: (1) some features of communication that test method should reflect, (2) the main components of method, and (3) some…

  15. Classical methods and modern analysis for studying fungal diversity

    Treesearch

    John Paul Schmit

    2005-01-01

    In this chapter, we examine the use of classical methods to study fungal diversity. Classical methods rely on the direct observation of fungi, rather than sampling fungal DNA. We summarize a wide variety of classical methods, including direct sampling of fungal fruiting bodies, incubation of substrata in moist chambers, culturing of endophytes, and particle plating. We...

  16. Classical Methods and Modern Analysis for Studying Fungal Diversity

    Treesearch

    J. P. Schmit; D. J. Lodge

    2005-01-01

    In this chapter, we examine the use of classical methods to study fungal diversity. Classical methods rely on the direct observation of fungi, rather than sampling fungal DNA. We summarize a wide variety of classical methods, including direct sampling of fungal fruiting bodies, incubation of substrata in moist chambers, culturing of endophytes, and particle plating. We...

  17. Development of New Methods for the Solution of Nonlinear Differential Equations by the Method of Lie Series and Extension to New Fields.

    DTIC Science & Technology

    perturbation formulas of Groebner (1960) and Alexseev (1961) for the solution of ordinary differential equations. These formulas are generalized and...iteration methods are given, which include the Methods of Picard, Groebner -Knapp, Poincare, Chen, as special cases. Chapter 3 generalizes an iterated

  18. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Deployment of long-term database methods for... long-term database methods for number portability by CMRS providers. (a) By November 24, 2003, all covered CMRS providers must provide a long-term database method for number portability, including the...

  19. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 3 2011-10-01 2011-10-01 false Deployment of long-term database methods for... long-term database methods for number portability by CMRS providers. (a) By November 24, 2003, all covered CMRS providers must provide a long-term database method for number portability, including the...

  20. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 3 2013-10-01 2013-10-01 false Deployment of long-term database methods for... long-term database methods for number portability by CMRS providers. (a) By November 24, 2003, all covered CMRS providers must provide a long-term database method for number portability, including the...

Top