Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen
2017-04-01
In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.
Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer
Kwok, Pui-Yan; Chen, Xiangning
1999-01-01
A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.
Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.
2012-01-01
Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373
Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?
USDA-ARS?s Scientific Manuscript database
Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L
2006-01-15
Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.
Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.
Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin
2018-07-01
We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.
Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.
Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru
2017-04-18
Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven
2006-01-01
Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.
Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki
2010-07-01
Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.
Detecting and Analyzing Genetic Recombination Using RDP4.
Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev
2017-01-01
Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.
Testing for genetic association taking into account phenotypic information of relatives.
Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J
2009-12-15
We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.
Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li
2009-03-01
The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-01-01
Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596
Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun
2018-05-22
Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.
Using of methods of speckle optics for Chlamydia trachomatis typing
NASA Astrophysics Data System (ADS)
Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.
2017-03-01
Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant
2017-11-01
Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.
A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.
Zeng, Lingwen; Xiao, Zhuo
2017-01-01
A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.
A Bioluminometric Method of DNA Sequencing
NASA Technical Reports Server (NTRS)
Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)
2001-01-01
Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.
NASA Astrophysics Data System (ADS)
Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.
2018-04-01
Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.
Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-01-01
Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242
Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E
2015-01-01
The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
NASA Astrophysics Data System (ADS)
Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan
2017-02-01
Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.
Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.
Wood-Bouwens, Christina M; Ji, Hanlee P
2018-01-01
Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.
Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik
2007-08-31
Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.
OncoNEM: inferring tumor evolution from single-cell sequencing data.
Ross, Edith M; Markowetz, Florian
2016-04-15
Single-cell sequencing promises a high-resolution view of genetic heterogeneity and clonal evolution in cancer. However, methods to infer tumor evolution from single-cell sequencing data lag behind methods developed for bulk-sequencing data. Here, we present OncoNEM, a probabilistic method for inferring intra-tumor evolutionary lineage trees from somatic single nucleotide variants of single cells. OncoNEM identifies homogeneous cellular subpopulations and infers their genotypes as well as a tree describing their evolutionary relationships. In simulation studies, we assess OncoNEM's robustness and benchmark its performance against competing methods. Finally, we show its applicability in case studies of muscle-invasive bladder cancer and essential thrombocythemia.
Single nucleotide variations: Biological impact and theoretical interpretation
Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier
2014-01-01
Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433
NASA Technical Reports Server (NTRS)
Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.
2003-01-01
We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.
Single-feature polymorphism discovery in the barley transcriptome
Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie
2005-01-01
A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806
Use of causative variants and SNP weighting in a single-step GBLUP context
USDA-ARS?s Scientific Manuscript database
Much effort has been recently put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, aiming genomic prediction. Among the genomic methods available, single-step GBLUP (ssGBLUP) became the choice because of its simplicity and potentially higher accuracy. When QTN are ...
WEB-server for search of a periodicity in amino acid and nucleotide sequences
NASA Astrophysics Data System (ADS)
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne
2001-01-01
A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336
Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases
Su, Yan; Guengerich, F. Peter
2016-01-01
Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785
DNAzyme based gap-LCR detection of single-nucleotide polymorphism.
Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo
2013-07-15
Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.
Shirasu, Naoto; Kuroki, Masahide
2014-01-01
We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.
Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.
2016-01-01
The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325
Park, Ji Hye
2018-01-01
Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531
Dou, Dan; Hernández-Neuta, Iván; Wang, Hao; Östbye, Henrik; Qian, Xiaoyan; Thiele, Swantje; Resa-Infante, Patricia; Kouassi, Nancy Mounogou; Sender, Vicky; Hentrich, Karina; Mellroth, Peter; Henriques-Normark, Birgitta; Gabriel, Gülsah; Nilsson, Mats; Daniels, Robert
2017-07-05
Genome delivery to the proper cellular compartment for transcription and replication is a primary goal of viruses. However, methods for analyzing viral genome localization and differentiating genomes with high identity are lacking, making it difficult to investigate entry-related processes and co-examine heterogeneous RNA viral populations. Here, we present an RNA labeling approach for single-cell analysis of RNA viral replication and co-infection dynamics in situ, which uses the versatility of padlock probes. We applied this method to identify influenza A virus (IAV) infections in cells and lung tissue with single-nucleotide specificity and to classify entry and replication stages by gene segment localization. Extending the classification strategy to co-infections of IAVs with single-nucleotide variations, we found that the dependence on intracellular trafficking places a time restriction on secondary co-infections necessary for genome reassortment. Altogether, these data demonstrate how RNA viral genome labeling can help dissect entry and co-infections. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Association genetics in Pinus taeda L. I. wood property traits
Santiago C. Gonzalez-Martinez; Nicholas C. Wheeler; Elhan Ersoz; C. Dana Nelson; David B. Neale
2007-01-01
Genetic association is a powerful method for dissecting complex adaptive traits due to (i) fine-scale mapping resulting from historical recombination, (ii) wide coverage of phenotypic and genotypic variation within a single experiment, and (iii) the simultaneous discovery of loci and alleles. In this article, genetic association among single nucleotide polymorphisms (...
Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi
2001-01-01
We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Quantitative Understanding of SHAPE Mechanism from RNA Structure and Dynamics Analysis.
Hurst, Travis; Xu, Xiaojun; Zhao, Peinan; Chen, Shi-Jie
2018-05-10
The selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) method probes RNA local structural and dynamic information at single nucleotide resolution. To gain quantitative insights into the relationship between nucleotide flexibility, RNA 3D structure, and SHAPE reactivity, we develop a 3D Structure-SHAPE Relationship model (3DSSR) to rebuild SHAPE profiles from 3D structures. The model starts from RNA structures and combines nucleotide interaction strength and conformational propensity, ligand (SHAPE reagent) accessibility, and base-pairing pattern through a composite function to quantify the correlation between SHAPE reactivity and nucleotide conformational stability. The 3DSSR model shows the relationship between SHAPE reactivity and RNA structure and energetics. Comparisons between the 3DSSR-predicted SHAPE profile and the experimental SHAPE data show correlation, suggesting that the extracted analytical function may have captured the key factors that determine the SHAPE reactivity profile. Furthermore, the theory offers an effective method to sieve RNA 3D models and exclude models that are incompatible with experimental SHAPE data.
Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus
2012-01-01
Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. Keywords: single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit PMID:22594601
An innovative SNP genotyping method adapting to multiple platforms and throughputs
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) are highly abundant, distributed throughout the genome in various species, and therefore they are widely used as genetic markers. However, the usefulness of this genetic tool relies heavily on the availability of user-friendly SNP genotyping methods. We have d...
USDA-ARS?s Scientific Manuscript database
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...
[Biophysics of single molecules].
Serdiuk, I N; Deriusheva, E I
2011-01-01
The modern methods of research of biological molecules whose application led to the development of a new field of science, biophysics of single molecules, are reviewed. The measurement of the characteristics of single molecules enables one to reveal their individual features, and it is just for this reason that much more information can be obtained from one molecule than from the entire ensample of molecules. The high sensitivity of the methods considered in detail makes it possible to come close to the solution of the basic problem of practical importance, namely, the determination of the nucleotide sequence of a single DNA molecule.
Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L
2015-05-01
Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Electron attachment to DNA single strands: gas phase and aqueous solution.
Gu, Jiande; Xie, Yaoming; Schaefer, Henry F
2007-01-01
The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage.
Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.
Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.
Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline
2012-05-17
The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit.
Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.
Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).
Studer, Jacqueline; Bartsch, Christine; Haas, Cordula
2014-07-01
Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-05-05
Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.
Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na
2013-03-15
We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.
Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.
Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A
2010-08-01
Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.
2013-01-01
Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528
Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura
2015-01-01
Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342
Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira
2016-01-01
OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237
Wu, Lei; He, Yao; Zhang, Di
2015-11-01
To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.
CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.
Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru
2015-11-01
Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...
van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick
2012-03-27
In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Gerstner, Arpad; DeFord, James H; Papaconstantinou, John
2003-07-25
Ames dwarfism is caused by a homozygous single nucleotide mutation in the pituitary specific prop-1 gene, resulting in combined pituitary hormone deficiency, reduced growth and extended lifespan. Thus, these mice serve as an important model system for endocrinological, aging and longevity studies. Because the phenotype of wild type and heterozygous mice is undistinguishable, it is imperative for successful breeding to accurately genotype these animals. Here we report a novel, yet simple, approach for prop-1 genotyping using PCR-based allele-specific amplification (PCR-ASA). We also compare this method to other potential genotyping techniques, i.e. PCR-based restriction fragment length polymorphism analysis (PCR-RFLP) and fluorescence automated DNA sequencing. We demonstrate that the single-step PCR-ASA has several advantages over the classical PCR-RFLP because the procedure is simple, less expensive and rapid. To further increase the specificity and sensitivity of the PCR-ASA, we introduced a single-base mismatch at the 3' penultimate position of the mutant primer. Our results also reveal that the fluorescence automated DNA sequencing has limitations for detecting a single nucleotide polymorphism in the prop-1 gene, particularly in heterozygotes.
Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun
2015-01-01
Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.
Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K
2017-09-01
Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.
Electron attachment to DNA single strands: gas phase and aqueous solution
Gu, Jiande; Xie, Yaoming; Schaefer, Henry F.
2007-01-01
The 2′-deoxyguanosine-3′,5′-diphosphate, 2′-deoxyadenosine-3′,5′-diphosphate, 2′-deoxycytidine-3′,5′-diphosphate and 2′-deoxythymidine-3′,5′-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3′,5′-dTDP (0.17 eV) and 3′,5′-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3′,5′-dTDP > 3′,5′-dCDP > 3′,5′-dGDP > 3′,5′-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3′-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3′-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3′,5′-dADP− (0.26 eV) and 3′,5′-dGDP− (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage. PMID:17660189
Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q
2010-11-01
Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.
Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population
Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying
2014-01-01
Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408
Single nucleotide polymorphisms in the Mycobacterium bovis genome resolve phylogenetic relationships
USDA-ARS?s Scientific Manuscript database
Mycobacterium bovis isolates carry restricted allelic variation yet exhibit a range of disease phenotypes and host preferences. Conventional genotyping methods target small hyper-variable regions of their genome and provide anonymous biallelic information insufficient to develop phylogeny. To resolv...
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
NASA Astrophysics Data System (ADS)
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Refactoring the Genetic Code for Increased Evolvability
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pines, Gur; Winkler, James D.; Pines, Assaf
ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less
Refactoring the Genetic Code for Increased Evolvability
Pines, Gur; Winkler, James D.; Pines, Assaf; ...
2017-11-14
ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less
Gentilini, Fabio; Turba, Maria E
2014-01-01
A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.
Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H
2012-01-01
PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.
Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening
Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D
2016-01-01
Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999
NASA Astrophysics Data System (ADS)
Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.
2017-05-01
Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.
Maternal grandsire confirmation and discovery in dairy cattle
USDA-ARS?s Scientific Manuscript database
Accurate pedigree information is essential for selecting dairy animals to improve economically important traits. Two methods of maternal grandsire (MGS) discovery were compared. The first compared one single nucleotide polymorphism (SNP) at a time using a genotype from one or both parents (SNP metho...
A high-throughput approach to profile RNA structure.
Delli Ponti, Riccardo; Marti, Stefanie; Armaos, Alexandros; Tartaglia, Gian Gaetano
2017-03-17
Here we introduce the Computational Recognition of Secondary Structure (CROSS) method to calculate the structural profile of an RNA sequence (single- or double-stranded state) at single-nucleotide resolution and without sequence length restrictions. We trained CROSS using data from high-throughput experiments such as Selective 2΄-Hydroxyl Acylation analyzed by Primer Extension (SHAPE; Mouse and HIV transcriptomes) and Parallel Analysis of RNA Structure (PARS; Human and Yeast transcriptomes) as well as high-quality NMR/X-ray structures (PDB database). The algorithm uses primary structure information alone to predict experimental structural profiles with >80% accuracy, showing high performances on large RNAs such as Xist (17 900 nucleotides; Area Under the ROC Curve AUC of 0.75 on dimethyl sulfate (DMS) experiments). We integrated CROSS in thermodynamics-based methods to predict secondary structure and observed an increase in their predictive power by up to 30%. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.
2015-01-01
Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965
Suyama, Yoshihisa; Matsuki, Yu
2015-01-01
Restriction-enzyme (RE)-based next-generation sequencing methods have revolutionized marker-assisted genetic studies; however, the use of REs has limited their widespread adoption, especially in field samples with low-quality DNA and/or small quantities of DNA. Here, we developed a PCR-based procedure to construct reduced representation libraries without RE digestion steps, representing de novo single-nucleotide polymorphism discovery, and its genotyping using next-generation sequencing. Using multiplexed inter-simple sequence repeat (ISSR) primers, thousands of genome-wide regions were amplified effectively from a wide variety of genomes, without prior genetic information. We demonstrated: 1) Mendelian gametic segregation of the discovered variants; 2) reproducibility of genotyping by checking its applicability for individual identification; and 3) applicability in a wide variety of species by checking standard population genetic analysis. This approach, called multiplexed ISSR genotyping by sequencing, should be applicable to many marker-assisted genetic studies with a wide range of DNA qualities and quantities. PMID:26593239
Statistical method to compare massive parallel sequencing pipelines.
Elsensohn, M H; Leblay, N; Dimassi, S; Campan-Fournier, A; Labalme, A; Roucher-Boulez, F; Sanlaville, D; Lesca, G; Bardel, C; Roy, P
2017-03-01
Today, sequencing is frequently carried out by Massive Parallel Sequencing (MPS) that cuts drastically sequencing time and expenses. Nevertheless, Sanger sequencing remains the main validation method to confirm the presence of variants. The analysis of MPS data involves the development of several bioinformatic tools, academic or commercial. We present here a statistical method to compare MPS pipelines and test it in a comparison between an academic (BWA-GATK) and a commercial pipeline (TMAP-NextGENe®), with and without reference to a gold standard (here, Sanger sequencing), on a panel of 41 genes in 43 epileptic patients. This method used the number of variants to fit log-linear models for pairwise agreements between pipelines. To assess the heterogeneity of the margins and the odds ratios of agreement, four log-linear models were used: a full model, a homogeneous-margin model, a model with single odds ratio for all patients, and a model with single intercept. Then a log-linear mixed model was fitted considering the biological variability as a random effect. Among the 390,339 base-pairs sequenced, TMAP-NextGENe® and BWA-GATK found, on average, 2253.49 and 1857.14 variants (single nucleotide variants and indels), respectively. Against the gold standard, the pipelines had similar sensitivities (63.47% vs. 63.42%) and close but significantly different specificities (99.57% vs. 99.65%; p < 0.001). Same-trend results were obtained when only single nucleotide variants were considered (99.98% specificity and 76.81% sensitivity for both pipelines). The method allows thus pipeline comparison and selection. It is generalizable to all types of MPS data and all pipelines.
Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline
2015-01-01
Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167
Noninvasive Prenatal Diagnosis of Single-Gene Disorders by Use of Droplet Digital PCR.
Camunas-Soler, Joan; Lee, Hojae; Hudgins, Louanne; Hintz, Susan R; Blumenfeld, Yair J; El-Sayed, Yasser Y; Quake, Stephen R
2018-02-01
Prenatal diagnosis in pregnancies at risk of single-gene disorders is currently performed using invasive methods such as chorionic villus sampling and amniocentesis. This is in contrast with screening for common aneuploidies, for which noninvasive methods with a single maternal blood sample have become standard clinical practice. We developed a protocol for noninvasive prenatal diagnosis of inherited single-gene disorders using droplet digital PCR from circulating cell-free DNA (cfDNA) in maternal plasma. First, the amount of cfDNA and fetal fraction is determined using a panel of TaqMan assays targeting high-variability single-nucleotide polymorphisms. Second, the ratio of healthy and diseased alleles in maternal plasma is quantified using TaqMan assays targeting the mutations carried by the parents. Two validation approaches of the mutation assay are presented. We collected blood samples from 9 pregnancies at risk for different single-gene disorders, including common conditions and rare metabolic disorders. We measured cases at risk of hemophilia, ornithine transcarbamylase deficiency, cystic fibrosis, β-thalassemia, mevalonate kinase deficiency, acetylcholine receptor deficiency, and DFNB1 nonsyndromic hearing loss. We correctly differentiated affected and unaffected pregnancies (2 affected, 7 unaffected), confirmed by neonatal testing. We successfully measured an affected pregnancy as early as week 11 and with a fetal fraction as low as 3.7% (0.3). Our method detects single-nucleotide mutations of autosomal recessive diseases as early as the first trimester of pregnancy. This is of importance for metabolic disorders in which early diagnosis can affect management of the disease and reduce complications and anxiety related to invasive testing. © 2017 American Association for Clinical Chemistry.
A Method to Determine 18O Kinetic Isotope Effects in the Hydrolysis of Nucleotide Triphosphates
Du, Xinlin; Ferguson, Kurt; Sprang, Stephen R.
2007-01-01
A method to determine 18O kinetic isotope effects (KIE) in the hydrolysis of GTP is described that is generally applicable to reactions involving other nucleotide triphosphates. Internal competition, wherein the substrate of the reaction is a mixture of 18O-labeled and unlabeled nucleotides, is employed and the change in relative abundance of the two species in the course of the reaction is used to calculate KIE. The nucleotide labeled with 18O at sites of mechanistic interest also contains 13C at all carbon positions, while the 16O-nucleotide is depleted of 13C. The relative abundance of the labeled and unlabeled substrates or products is reflected in the carbon isotope ratio (13C/12C) in GTP or GDP, which is determined by use of a liquid chromatography-coupled isotope ratio mass spectrometer (LC-coupled IRMS). The LC is coupled to the IRMS by an Isolink™ interface (ThermoFinnigan). Carbon isotope ratios can be determined with accuracy and precision greater than 0.04%, and are consistent over an order of magnitude in sample amount. KIE values for Ras/NF1333-catalyzed hydrolysis of [β18O3,13C]GTP were determined by change in the isotope ratio of GTP or GDP or the ratio of the isotope ratio of GDP to that of GTP. KIE values computed in the three ways agree within 0.1%, although the method using the ratio of isotope ratios of GDP and GTP gives superior precision (< 0.1%). A single KIE measurement can be conducted in 25 minutes with less than 5 μg nucleotide reaction product. PMID:17963711
Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D
2012-07-01
DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.
Analysis of genetic diversity using SNP markers in oat
USDA-ARS?s Scientific Manuscript database
A large-scale single nucleotide polymorphism (SNP) discovery was carried out in cultivated oat using Roche 454 sequencing methods. DNA sequences were generated from cDNAs originating from a panel of 20 diverse oat cultivars, and from Diversity Array Technology (DArT) genomic complexity reductions fr...
Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.
2015-01-01
We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide polymorphism in the cyp51A gene of A. fumigatus is a reliable tool for the rapid screening and monitoring of TR34/L98H- and TR46/Y121F/T289A-positive isolates and can easily be incorporated into clinical mycology algorithms. PMID:26525787
Gehring, I; Geider, K
2012-07-01
Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.
Anderson, Justin E; Michno, Jean-Michel; Kono, Thomas J Y; Stec, Adrian O; Campbell, Benjamin W; Curtin, Shaun J; Stupar, Robert M
2016-05-12
The safety of mutagenized and genetically transformed plants remains a subject of scrutiny. Data gathered and communicated on the phenotypic and molecular variation induced by gene transfer technologies will provide a scientific-based means to rationally address such concerns. In this study, genomic structural variation (e.g. large deletions and duplications) and single nucleotide polymorphism rates were assessed among a sample of soybean cultivars, fast neutron-derived mutants, and five genetically transformed plants developed through Agrobacterium based transformation methods. On average, the number of genes affected by structural variations in transgenic plants was one order of magnitude less than that of fast neutron mutants and two orders of magnitude less than the rates observed between cultivars. Structural variants in transgenic plants, while rare, occurred adjacent to the transgenes, and at unlinked loci on different chromosomes. DNA repair junctions at both transgenic and unlinked sites were consistent with sequence microhomology across breakpoints. The single nucleotide substitution rates were modest in both fast neutron and transformed plants, exhibiting fewer than 100 substitutions genome-wide, while inter-cultivar comparisons identified over one-million single nucleotide polymorphisms. Overall, these patterns provide a fresh perspective on the genomic variation associated with high-energy induced mutagenesis and genetically transformed plants. The genetic transformation process infrequently results in novel genetic variation and these rare events are analogous to genetic variants occurring spontaneously, already present in the existing germplasm, or induced through other types of mutagenesis. It remains unclear how broadly these results can be applied to other crops or transformation methods.
2013-01-01
Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216
Desai, Prerak T.; den Bakker, Henk C.; Mikoleit, Matthew; Tolar, Beth; Trees, Eija; Hendriksen, Rene S.; Frye, Jonathan G.; Porwollik, Steffen; Weimer, Bart C.; Wiedmann, Martin; Weinstock, George M.; Fields, Patricia I.; McClelland, Michael
2014-01-01
Salmonella enterica serotype Enteritidis is one of the most commonly reported causes of human salmonellosis. Its low genetic diversity, measured by fingerprinting methods, has made subtyping a challenge. We used whole-genome sequencing to characterize 125 S. enterica Enteritidis and 3 S. enterica serotype Nitra strains. Single-nucleotide polymorphisms were filtered to identify 4,887 reliable loci that distinguished all isolates from each other. Our whole-genome single-nucleotide polymorphism typing approach was robust for S. enterica Enteritidis subtyping with combined data for different strains from 2 different sequencing platforms. Five major genetic lineages were recognized, which revealed possible patterns of geographic and epidemiologic distribution. Analyses on the population dynamics and evolutionary history estimated that major lineages emerged during the 17th–18th centuries and diversified during the 1920s and 1950s. PMID:25147968
An exonuclease III and graphene oxide-aided assay for DNA detection.
Peng, Lu; Zhu, Zhi; Chen, Yan; Han, Da; Tan, Weihong
2012-05-15
We have developed a novel DNA assay based on exonuclease III (ExoIII)-induced target recycling and the fluorescence quenching ability of graphene oxide (GO). This assay consists of a linear DNA probe labeled with a fluorophore in the middle. Introduction of target sequence induces the exonuclease III catalyzed probe digestion and generation of single nucleotides. After each cycle of digestion, the target is recycled to realize the amplification. Finally, graphene oxide is added to quench the remaining probes and the signal from the resulting fluorophore labeled single nucleotides is detected. With this approach, a sub-picomolar detection limit can be achieved within 40 min at 37°C. The method was successfully applied to multicolor DNA detection and the analysis of telomerase activity in extracts from cancer cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Evaluation of the reliability of maize reference assays for GMO quantification.
Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel
2010-03-01
A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.
El-Sabrout, Karim; Aggag, Sarah A.
2017-01-01
Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458
Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan
2018-01-01
To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.
Comparison of three PCR-based assays for SNP genotyping in sugar beet
USDA-ARS?s Scientific Manuscript database
Background: PCR allelic discrimination technologies have broad applications in the detection of single nucleotide polymorphisms (SNPs) in genetics and genomics. The use of fluorescence-tagged probes is the leading method for targeted SNP detection, but assay costs and error rates could be improved t...
USDA-ARS?s Scientific Manuscript database
Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific to birds (S. e...
Li, Su-Xia
2004-12-01
Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.
Feng, Hao; Conneely, Karen N.; Wu, Hao
2014-01-01
DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
USDA-ARS?s Scientific Manuscript database
High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...
Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing
NASA Astrophysics Data System (ADS)
Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación
2016-05-01
A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c
Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki
2013-09-23
Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.
Nanopores and nucleic acids: prospects for ultrarapid sequencing
NASA Technical Reports Server (NTRS)
Deamer, D. W.; Akeson, M.
2000-01-01
DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.
Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.
Ohno, T; Takamatsu, N; Meshi, T; Okada, Y
1983-01-01
The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
USDA-ARS?s Scientific Manuscript database
Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...
Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms
USDA-ARS?s Scientific Manuscript database
We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...
USDA-ARS?s Scientific Manuscript database
Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...
USDA-ARS?s Scientific Manuscript database
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...
USDA-ARS?s Scientific Manuscript database
Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Ryynänen, Heikki J; Primmer, Craig R
2006-01-01
Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523
Equalizer reduces SNP bias in Affymetrix microarrays.
Quigley, David
2015-07-30
Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.
Genetic Variants of TPCN2 Associated with Type 2 Diabetes Risk in the Chinese Population
Zhang, Yu; Fan, Xiaofang; Zhang, Ning; Zheng, Hui; Song, Yuping; Shen, Chunfang; Shen, Jiayi; Ren, Fengdong; Yang, Jialin
2016-01-01
Objective The aim of this study was to determine whether TPCN2 genetic variants are associated with type 2 diabetes and to elucidate which variants in TPCN2 confer diabetes susceptibility in the Chinese population. Research Design and Methods The sample population included 384 patients with type 2 diabetes and 1468 controls. Anthropometric parameters, glycemic and lipid profiles and insulin resistance were measured. We selected 6 TPCN2 tag single nucleotide polymorphisms (rs35264875, rs267603153, rs267603154, rs3829241, rs1551305, and rs3750965). Genotypes were determined using a Sequenom MassARRAY SNP genotyping system. Results Ultimately, we genotyped 3 single nucleotide polymorphisms (rs3750965, rs3829241, and rs1551305) in all individuals. There was a 5.1% higher prevalence of the rs1551305 variant allele in type 2 diabetes individuals (A) compared with wild-type homozygous individuals (G). The AA genotype of rs1551305 was associated with a higher diabetes risk (p<0.05). The distributions of rs3829241 and rs3750965 polymorphisms were not significantly different between the two groups. HOMA-%B of subjects harboring the AA genotype of rs1551305 decreased by 14.87% relative to the GG genotype. Conclusions TPCN2 plays a role in metabolic regulation, and the rs1551305 single nucleotide polymorphism is associated with type 2 diabetes risk. Future work will begin to unravel the underlying mechanisms. PMID:26918892
Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui
2016-01-01
The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.
Kimura, Hiroki; Tsuboi, Daisuke; Wang, Chenyao; Kushima, Itaru; Koide, Takayoshi; Ikeda, Masashi; Iwayama, Yoshimi; Toyota, Tomoko; Yamamoto, Noriko; Kunimoto, Shohko; Nakamura, Yukako; Yoshimi, Akira; Banno, Masahiro; Xing, Jingrui; Takasaki, Yuto; Yoshida, Mami; Aleksic, Branko; Uno, Yota; Okada, Takashi; Iidaka, Tetsuya; Inada, Toshiya; Suzuki, Michio; Ujike, Hiroshi; Kunugi, Hiroshi; Kato, Tadafumi; Yoshikawa, Takeo; Iwata, Nakao; Kaibuchi, Kozo; Ozaki, Norio
2015-01-01
Background: Nuclear distribution E homolog 1 (NDE1), located within chromosome 16p13.11, plays an essential role in microtubule organization, mitosis, and neuronal migration and has been suggested by several studies of rare copy number variants to be a promising schizophrenia (SCZ) candidate gene. Recently, increasing attention has been paid to rare single-nucleotide variants (SNVs) discovered by deep sequencing of candidate genes, because such SNVs may have large effect sizes and their functional analysis may clarify etiopathology. Methods and Results: We conducted mutation screening of NDE1 coding exons using 433 SCZ and 145 pervasive developmental disorders samples in order to identify rare single nucleotide variants with a minor allele frequency ≤5%. We then performed genetic association analysis using a large number of unrelated individuals (3554 SCZ, 1041 bipolar disorder [BD], and 4746 controls). Among the discovered novel rare variants, we detected significant associations between SCZ and S214F (P = .039), and between BD and R234C (P = .032). Furthermore, functional assays showed that S214F affected axonal outgrowth and the interaction between NDE1 and YWHAE (14-3-3 epsilon; a neurodevelopmental regulator). Conclusions: This study strengthens the evidence for association between rare variants within NDE1 and SCZ, and may shed light into the molecular mechanisms underlying this severe psychiatric disorder. PMID:25332407
Destouni, A; Poulou, M; Kakourou, G; Vrettou, C; Tzetis, M; Traeger-Synodinos, J; Kitsiou-Tzeli, S
2016-03-01
Institutions offering CF-PGD face the challenge of developing and optimizing single cell genotyping protocols that should cover for the extremely heterogeneous CF mutation spectrum. Here we report the development and successful clinical application of a generic CF-PGD protocol to facilitate direct detection of any CFTR nucleotide variation(s) by HRMA and simultaneous confirmation of diagnosis through haplotype analysis. A multiplex PCR was optimized supporting co-amplification of any CFTR exon-region, along with 6 closely linked STRs. Single cell genotypes were established through HRM analysis following melting of the 2nd round PCR products and were confirmed by STR haplotype analysis of the 1st PCR products. The protocol was validated pre-clinically, by testing 208 single lymphocytes, isolated from whole blood samples from 4 validation family trios. Fifteen PGD cycles were performed and 103 embryos were biopsied. In 15 clinical PGD cycles, genotypes were achieved in 88/93 (94.6%) embryo biopsy samples, of which 57/88 (64.8%) were deemed genetically suitable for embryo transfer. Amplification failed at all loci for 10/103 blastomeres biopsied from poor quality embryos. Six clinical pregnancies were achieved (2 twin, 4 singletons). PGD genotypes were confirmed following conventional amniocentesis or chorionic villus sampling in all achieved pregnancies. The single cell HRMA CF-PGD protocol described herein is a flexible, generic, low cost and robust genotyping method, which facilitates the analysis of any CFTR genotype combination. Single-cell HRMA can be beneficial to other clinical settings, for example the detection of single nucleotide variants in single cells derived from clinical tumor samples. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji
2015-04-01
Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.
Smidansky, Eric D.; Arnold, Jamie J.; Reynolds, Shelley L.; Cameron, Craig E.
2013-01-01
The human mitochondrial RNA polymerase (h-mtRNAP) serves as both the transcriptase for expression and the primase for replication of mitochondrial DNA. As such, the enzyme is of fundamental importance to cellular energy metabolism, and defects in its function may be related to human disease states. Here we describe in vitro analysis of the h-mtRNAP kinetic mechanism for single, correct nucleotide incorporation. This was made possible by the development of efficient methods for expression and purification of h-mtRNAP using a bacterial system and by utilization of assays that rely on simple, synthetic RNA/DNA scaffolds without the need for mitochondrial transcription accessory proteins. We find that h-mtRNAP accomplishes single-nucleotide incorporation by using the same core steps, including conformational change steps before and after chemistry, that are prototypical for most types of nucleic acid polymerases. The polymerase binds to scaffolds via a two-step mechanism consisting of a fast initial-encounter step followed by a much slower isomerization that leads to catalytic competence. A substantial solvent deuterium kinetic isotope effect was observed for the forward reaction, but none was detectable for the reverse reaction, suggesting that chemistry is at least partially rate-limiting in the forward direction but not in the reverse. h-mtRNAP appears to exercise much more stringent surveillance over base than over sugar in determining the correctness of a nucleotide. The utility of developing the robust in vitro assays described here and of establishing a baseline of kinetic performance for the wild-type enzyme is that biological questions concerning h-mtRNAP may now begin to be addressed. PMID:21548588
Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de
2015-01-01
Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834
Berro, Mariano; Mayor, Neema P.; Maldonado-Torres, Hazael; Cooke, Louise; Kusminsky, Gustavo; Marsh, Steven G.E.; Madrigal, J. Alejandro; Shaw, Bronwen E.
2010-01-01
Background Many genetic factors play major roles in the outcome of hematopoietic stem cell transplants from unrelated donors. Transforming growth factor β1 is a member of a highly pleiotrophic family of growth factors involved in the regulation of numerous immunomodulatory processes. Design and Methods We investigated the impact of single nucleotide polymorphisms at codons 10 and 25 of TGFB1, the gene encoding for transforming growth factor β1, on outcomes in 427 mye-loablative-conditioned transplanted patients. In addition, transforming growth factor β1 plasma levels were measured in 263 patients and 327 donors. Results Patients homozygous for the single nucleotide polymorphism at codon 10 had increased non-relapse mortality (at 3 years: 46.8% versus 29.4%, P=0.014) and reduced overall survival (at 5 years 29.3% versus 42.2%, P=0.013); the differences remained statistically significant in multivariate analysis. Donor genotype alone had no impact, although multiple single nucleotide polymorphisms within the pair were significantly associated with higher non-relapse mortality (at 3 years: 44% versus 29%, P=0.021) and decreased overall survival (at 5 years: 33.8% versus 41.9%, P=0.033). In the 10/10 HLA matched transplants (n=280), recipients of non-wild type grafts tended to have a higher incidence of acute graft-versus-host disease grades II-IV (P=0.052). In multivariate analysis, when analyzed with patients’ genotype, the incidences of both overall and grades II-IV acute graft-versus-host disease were increased (P=0.025 and P=0.009, respectively) in non-wild-type pairs. Conclusions We conclude that increasing numbers of single nucleotide polymorphisms in codon 10 of TGFB1 in patients and donors are associated with a worse outcome following hematopoietic stem cell transplantation from unrelated donors. PMID:19713222
USDA-ARS?s Scientific Manuscript database
The objective of this study was to investigate alternative methods for designing and utilizing reduced single nucleotide polymorphism (SNP) panels for imputing SNP genotypes. Two purebred Hereford populations, an experimental population known as Line 1 Hereford (L1, N=240) and registered Hereford wi...
Methods for discovering and validating relationships among genotyped animals
USDA-ARS?s Scientific Manuscript database
Genomic selection based on single-nucleotide polymorphisms (SNPs) has led to the collection of genotypes for over 2.2 million animals by the Council on Dairy Cattle Breeding in the United States. To assure that a genotype is assigned to the correct animal and that the animal’s pedigree is correct, t...
Amplified fragment length polymorphism (AFLP) markers can be developed more quickly and at a lower cost than microsatellite and single nucleotide polymorphism markers, which makes them ideal markers for large-scale studies of understudied taxa — such as species at risk. However,...
Genome-Wide Association Study of Intelligence: Additive Effects of Novel Brain Expressed Genes
ERIC Educational Resources Information Center
Loo, Sandra K.; Shtir, Corina; Doyle, Alysa E.; Mick, Eric; McGough, James J.; McCracken, James; Biederman, Joseph; Smalley, Susan L.; Cantor, Rita M.; Faraone, Stephen V.; Nelson, Stanley F.
2012-01-01
Objective: The purpose of the present study was to identify common genetic variants that are associated with human intelligence or general cognitive ability. Method: We performed a genome-wide association analysis with a dense set of 1 million single-nucleotide polymorphisms (SNPs) and quantitative intelligence scores within an ancestrally…
A Laboratory Exercise to Determine Human ABO Blood Type by Noninvasive Methods
ERIC Educational Resources Information Center
Martin, Michael P.; Detzel, Stephen M.
2008-01-01
Analysis of single-nucleotide polymorphisms and their association with diseases and nondisease phenotypes is of growing importance in human biology studies. In this laboratory exercise, students determine the genetic basis for their ABO blood type; however, no blood is drawn. Students isolate genomic DNA from buccal mucosa cells that are present…
Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen
2014-01-01
Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391
Identification of pathogen genomic variants through an integrated pipeline
2014-01-01
Background Whole-genome sequencing represents a powerful experimental tool for pathogen research. We present methods for the analysis of small eukaryotic genomes, including a streamlined system (called Platypus) for finding single nucleotide and copy number variants as well as recombination events. Results We have validated our pipeline using four sets of Plasmodium falciparum drug resistant data containing 26 clones from 3D7 and Dd2 background strains, identifying an average of 11 single nucleotide variants per clone. We also identify 8 copy number variants with contributions to resistance, and report for the first time that all analyzed amplification events are in tandem. Conclusions The Platypus pipeline provides malaria researchers with a powerful tool to analyze short read sequencing data. It provides an accurate way to detect SNVs using known software packages, and a novel methodology for detection of CNVs, though it does not currently support detection of small indels. We have validated that the pipeline detects known SNVs in a variety of samples while filtering out spurious data. We bundle the methods into a freely available package. PMID:24589256
Single-Cell Whole-Genome Amplification and Sequencing: Methodology and Applications.
Huang, Lei; Ma, Fei; Chapman, Alec; Lu, Sijia; Xie, Xiaoliang Sunney
2015-01-01
We present a survey of single-cell whole-genome amplification (WGA) methods, including degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR), multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycles (MALBAC). The key parameters to characterize the performance of these methods are defined, including genome coverage, uniformity, reproducibility, unmappable rates, chimera rates, allele dropout rates, false positive rates for calling single-nucleotide variations, and ability to call copy-number variations. Using these parameters, we compare five commercial WGA kits by performing deep sequencing of multiple single cells. We also discuss several major applications of single-cell genomics, including studies of whole-genome de novo mutation rates, the early evolution of cancer genomes, circulating tumor cells (CTCs), meiotic recombination of germ cells, preimplantation genetic diagnosis (PGD), and preimplantation genomic screening (PGS) for in vitro-fertilized embryos.
A space-efficient algorithm for local similarities.
Huang, X Q; Hardison, R C; Miller, W
1990-10-01
Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam
2014-08-05
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam Huu
2015-11-24
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
USDA-ARS?s Scientific Manuscript database
The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...
USDA-ARS?s Scientific Manuscript database
Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...
USDA-ARS?s Scientific Manuscript database
Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...
Prospects for inferring pairwise relationships with single nucleotide polymorphisms
Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody
2003-01-01
An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...
USDA-ARS?s Scientific Manuscript database
Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...
USDA-ARS?s Scientific Manuscript database
Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...
Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu
2016-04-01
Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.
Single-molecule comparison of DNA Pol I activity with native and analog nucleotides
NASA Astrophysics Data System (ADS)
Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip
2014-03-01
DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-11-01
Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.
ADEPT, a dynamic next generation sequencing data error-detection program with trimming
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Shihai; Lo, Chien-Chi; Li, Po-E
Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less
ADEPT, a dynamic next generation sequencing data error-detection program with trimming
Feng, Shihai; Lo, Chien-Chi; Li, Po-E; ...
2016-02-29
Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less
Technologies in the Whole-Genome Age: MALDI-TOF-Based Genotyping.
Vogel, Nicolas; Schiebel, Katrin; Humeny, Andreas
2009-01-01
With the decipherment of the human genome, new questions have moved into the focus of today's research. One key aspect represents the discovery of DNA variations capable to influence gene transcription, RNA splicing, or regulating processes, and their link to pathology. Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF-MS) is a powerful tool for the qualitative investigation and relative quantification of variations like single nucleotide polymorphisms, DNA methylation, microsatellite instability, or loss of heterozygosity. After its introduction into proteomics, efforts were made to adopt this technique to DNA analysis. Initially intended for peptide/protein analysis, it held several difficulties for application to nucleic acids. Today, MALDI-TOF-MS has reached worldwide acceptance and application in nucleic acid research, with a wide spectrum of methods being available. One of the most versatile approaches relies on primer extension to genotype single alleles, microsatellite repeat lengths or the methylation status of a given cytosine. Optimized methods comprising intelligent primer design and proper nucleotide selection for primer extension enabled multiplexing of reactions, rendering the analysis more economic due to parallel genotyping of several alleles in a single experiment. Laboratories equipped with MALDI-TOF-MS possess a universal technical platform for the analysis of a large variety of different molecules.
Holland, Erika G; Buhr, Diane L; Acca, Felicity E; Alderman, Dawn; Bovat, Kristin; Busygina, Valeria; Kay, Brian K; Weiner, Michael P; Kiss, Margaret M
2013-08-30
Affinity maturation is an important part of the recombinant antibody development process. There are several well-established approaches for generating libraries of mutated antibody genes for affinity maturation, but these approaches are generally too laborious or expensive to allow high-throughput, parallel processing of multiple antibodies. Here, we describe a scalable approach that enables the generation of libraries with greater than 10(8) clones from a single Escherichia coli transformation. In our method, a mutated DNA fragment is produced using PCR conditions that promote nucleotide misincorporation into newly synthesized DNA. In the PCR reaction, one of the primers contains at least three phosphorothioate linkages at its 5' end, and treatment of the PCR product with a 5' to 3' exonuclease is used to preferentially remove the strand synthesized with the non-modified primer, resulting in a single-stranded DNA fragment. This fragment then serves as a megaprimer to prime DNA synthesis on a uracilated, circular, single-stranded template in a Kunkel-like mutagenesis reaction that biases nucleotide base-changes between the megaprimer and uracilated DNA sequence in favor of the in vitro synthesized megaprimer. This method eliminates the inefficient subcloning steps that are normally required for the construction of affinity maturation libraries from randomly mutagenized antibody genes. Copyright © 2013. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng
2017-10-01
The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.
DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†
Comer, Jeffrey
2016-01-01
Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233
2012-01-01
Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830
Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur
2012-01-01
Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607
Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder
ERIC Educational Resources Information Center
Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.
2012-01-01
Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…
USDA-ARS?s Scientific Manuscript database
Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...
USDA-ARS?s Scientific Manuscript database
Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...
USDA-ARS?s Scientific Manuscript database
Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...
Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent
2012-05-01
Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.
NASA Astrophysics Data System (ADS)
Kholmurodov, Kholmirzo; Dushanov, Eric; Khusenov, Mirzoaziz; Rahmonov, Khaiyom; Zelenyak, Tatyana; Doroshkevich, Alexander; Majumder, Subrata
2017-05-01
Studying of molecular systems as single nucleotides, nucleotide and peptide chains, RNA and DNA interacting with metallic nanoparticles within a carbon nanotube matrix represents a great interest in modern research. In this respect it is worth mentioning the development of the electronics diagnostic apparatus, the biochemical and biotechnological application tools (nanorobotic design, facilities of drug delivery in a living cell), so on. In the present work using molecular dynamics (MD) simulation method the interaction process of small nucleotide chains (NCs) and elongated peptide chains with different sets of metallic nanoparticles (NPs) on a matrix from carbon nanotube (CNT) were simulated to study their mechanisms of encapsulation and folding processes. We have performed a series of the MD calculations with different NC,peptides-NP-CNT models that were aimed on the investigation of the peculiarities of NC,peptide-NP interactions, the formation of bonds and structures in the system, as well as the dynamical behavior in an environment confined by the CNT matrix.
Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro
2016-01-01
Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874
Gardner, Andrew F; Wang, Jinchun; Wu, Weidong; Karouby, Jennifer; Li, Hong; Stupi, Brian P; Jack, William E; Hersh, Megan N; Metzker, Michael L
2012-08-01
Recent developments of unique nucleotide probes have expanded our understanding of DNA polymerase function, providing many benefits to techniques involving next-generation sequencing (NGS) technologies. The cyclic reversible termination (CRT) method depends on efficient base-selective incorporation of reversible terminators by DNA polymerases. Most terminators are designed with 3'-O-blocking groups but are incorporated with low efficiency and fidelity. We have developed a novel class of 3'-OH unblocked nucleotides, called Lightning Terminators™, which have a terminating 2-nitrobenzyl moiety attached to hydroxymethylated nucleobases. A key structural feature of this photocleavable group displays a 'molecular tuning' effect with respect to single-base termination and improved nucleotide fidelity. Using Therminator DNA polymerase, we demonstrate that these 3'-OH unblocked terminators exhibit superior enzymatic performance compared to two other reversible terminators, 3'-O-amino-TTP and 3'-O-azidomethyl-TTP. Lightning Terminators show maximum incorporation rates (k(pol)) that range from 35 to 45 nt/s, comparable to the fastest NGS chemistries, yet with catalytic efficiencies (k(pol)/K(D)) comparable to natural nucleotides. Pre-steady-state kinetic studies of thymidine analogs revealed that the major determinant for improved nucleotide selectivity is a significant reduction in k(pol) by >1000-fold over TTP misincorporation. These studies highlight the importance of structure-function relationships of modified nucleotides in dictating polymerase performance.
QQ-SNV: single nucleotide variant detection at low frequency by comparing the quality quantiles.
Van der Borght, Koen; Thys, Kim; Wetzels, Yves; Clement, Lieven; Verbist, Bie; Reumers, Joke; van Vlijmen, Herman; Aerssens, Jeroen
2015-11-10
Next generation sequencing enables studying heterogeneous populations of viral infections. When the sequencing is done at high coverage depth ("deep sequencing"), low frequency variants can be detected. Here we present QQ-SNV (http://sourceforge.net/projects/qqsnv), a logistic regression classifier model developed for the Illumina sequencing platforms that uses the quantiles of the quality scores, to distinguish true single nucleotide variants from sequencing errors based on the estimated SNV probability. To train the model, we created a dataset of an in silico mixture of five HIV-1 plasmids. Testing of our method in comparison to the existing methods LoFreq, ShoRAH, and V-Phaser 2 was performed on two HIV and four HCV plasmid mixture datasets and one influenza H1N1 clinical dataset. For default application of QQ-SNV, variants were called using a SNV probability cutoff of 0.5 (QQ-SNV(D)). To improve the sensitivity we used a SNV probability cutoff of 0.0001 (QQ-SNV(HS)). To also increase specificity, SNVs called were overruled when their frequency was below the 80(th) percentile calculated on the distribution of error frequencies (QQ-SNV(HS-P80)). When comparing QQ-SNV versus the other methods on the plasmid mixture test sets, QQ-SNV(D) performed similarly to the existing approaches. QQ-SNV(HS) was more sensitive on all test sets but with more false positives. QQ-SNV(HS-P80) was found to be the most accurate method over all test sets by balancing sensitivity and specificity. When applied to a paired-end HCV sequencing study, with lowest spiked-in true frequency of 0.5%, QQ-SNV(HS-P80) revealed a sensitivity of 100% (vs. 40-60% for the existing methods) and a specificity of 100% (vs. 98.0-99.7% for the existing methods). In addition, QQ-SNV required the least overall computation time to process the test sets. Finally, when testing on a clinical sample, four putative true variants with frequency below 0.5% were consistently detected by QQ-SNV(HS-P80) from different generations of Illumina sequencers. We developed and successfully evaluated a novel method, called QQ-SNV, for highly efficient single nucleotide variant calling on Illumina deep sequencing virology data.
Volkán-Kacsó, Sándor; Marcus, Rudolph A
2016-10-25
A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.
Wang, Chun-Chi; Shih, Chi-Jen; Jong, Yuh-Jyh; Wu, Shou-Mei
2014-06-23
This is the first ligase chain reaction used for diagnosis of spinal muscular atrophy (SMA). Universal fluorescent tri-probe ligation (UFTPL), a novel strategy used for distinguishing the multi-nucleotide alternations at single base, is developed to quantitatively analyze the SMN1/SMN2 genes in diagnosis of SMA. Ligase chain reaction was performed by adding three probes including universal fluorescent probe, connecting probe and recognizing probe to differentiate single nucleotide polymorphisms in UFTPL. Our approach was based on the two UFTPL products of survival motor neuron 1 (SMN1) and SMN2 genes (the difference of 9 mer) and analyzed by capillary electrophoresis (CE). We successfully determined various gene dosages of SMN1 and SMN2 genes in homologous or heterologous subjects. By using the UFTPL-CE method, the SMN1 and SMN2 genes were fully resolved with the resolution of 2.16±0.37 (n=3). The r values of SMN1 and SMN2 regression curves over a range of 1-4 copies were above 0.9944. Of the 48 DNA samples, the data of gene dosages were corresponding to that analyzed by conformation sensitive CE and denatured high-performance liquid chromatography (DHPLC). This technique was found to be a good methodology for quantification or determination of the relative genes having multi-nucleotide variants at single base. Copyright © 2014 Elsevier B.V. All rights reserved.
Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA
Watson, Claire L.; Lockwood, Diana N. J.
2009-01-01
Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306
Er, Tze-Kiong; Kan, Tzu-Min; Su, Yu-Fa; Liu, Ta-Chih; Chang, Jan-Gowth; Hung, Shih-Ya; Jong, Yuh-Jyh
2012-11-12
Spinal muscular atrophy (SMA) is a neurodegenerative disease with the leading genetic cause of infant mortality. More than 95% of patients with SMA have a homozygous disruption in the survival motor neuron1 (SMN1) gene, caused by mutation, deletion, or rearrangement. Recently, treatment in humans in the immediate postnatal period, prior to the development of weakness or very early in the course of the disease, may be effective. Therefore, our objective was to establish a feasible method for SMA screening. High-resolution melting (HRM) analysis is rapidly becoming the most important mutation-scanning methodology that allows mutation scanning and genotyping without the need for costly labeled oligonucleotides. In the current study, we aim to develop a method for identifying the substitution of single nucleotide in SMN1 exon 7 (c.840C>T) by HRM analysis. Genomic DNA was extracted from peripheral blood samples and dried blood spots obtained from 30 patients with SMA and 30 normal individuals. All results were previously confirmed by denaturing high-performance liquid chromatography (DHPLC). In order to identify the substitution of single nucleotide in SMN1 exon 7 (c.840C>T) by HRM analysis, a primer set was used in HRM analysis. At first, we failed to identify the substitution of single nucleotide in SMN1 exon 7 (c.840C>T) by HRM analysis because the homozygous CC and homozygous TT cannot be distinguished by HRM analysis. Therefore, all samples were mixed with a known SMN1/SMN2 copy number (SMN1/SMN2=0:3), which we may call driver. This strategy is used to differentiate between homozygous CC and homozygous TT. After mixing with driver, the melting profile of homozygous CC becomes heteroduplex; however, the homozygous TT remains the same in the normalized and temperature-shifted difference plots. HRM analysis can be successfully applied to screen SMA via DNA obtained from whole blood and dried blood spots. We strongly believe that HRM analysis, a high-throughput method, could be used for identifying affected infants prior to the presentation of clinical symptoms in future. Copyright © 2012 Elsevier B.V. All rights reserved.
The Single Nucleotide Polymorphism Consortium
NASA Technical Reports Server (NTRS)
Morgan, Michael
2003-01-01
I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms
ERIC Educational Resources Information Center
Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.
2016-01-01
The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…
USDA-ARS?s Scientific Manuscript database
The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...
Winterhagen, Patrick; Wünsche, Jens-Norbert
2016-05-01
Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.
Wang, Yejun; MacKenzie, Keith D; White, Aaron P
2015-05-07
As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for comparative analyses with other Salmonella serotypes.
Jannink, Jean-Luc
2010-01-01
Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Single nucleotide polymorphism analysis using different colored dye dimer probes
NASA Astrophysics Data System (ADS)
Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter
2006-09-01
Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.
In silico prediction of splice-altering single nucleotide variants in the human genome.
Jian, Xueqiu; Boerwinkle, Eric; Liu, Xiaoming
2014-12-16
In silico tools have been developed to predict variants that may have an impact on pre-mRNA splicing. The major limitation of the application of these tools to basic research and clinical practice is the difficulty in interpreting the output. Most tools only predict potential splice sites given a DNA sequence without measuring splicing signal changes caused by a variant. Another limitation is the lack of large-scale evaluation studies of these tools. We compared eight in silico tools on 2959 single nucleotide variants within splicing consensus regions (scSNVs) using receiver operating characteristic analysis. The Position Weight Matrix model and MaxEntScan outperformed other methods. Two ensemble learning methods, adaptive boosting and random forests, were used to construct models that take advantage of individual methods. Both models further improved prediction, with outputs of directly interpretable prediction scores. We applied our ensemble scores to scSNVs from the Catalogue of Somatic Mutations in Cancer database. Analysis showed that predicted splice-altering scSNVs are enriched in recurrent scSNVs and known cancer genes. We pre-computed our ensemble scores for all potential scSNVs across the human genome, providing a whole genome level resource for identifying splice-altering scSNVs discovered from large-scale sequencing studies.
Anderson, Eric C; Ng, Thomas C
2016-02-01
We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.
1991-02-15
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less
Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu
2018-05-09
The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.
Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin
2009-08-01
Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
USDA-ARS?s Scientific Manuscript database
Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...
ERIC Educational Resources Information Center
Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli
2010-01-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…
USDA-ARS?s Scientific Manuscript database
The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...
Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins
2016-01-01
Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...
ERIC Educational Resources Information Center
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-01-01
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…
Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.
2007-01-01
A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140
Duployez, Nicolas; Boudry-Labis, Elise; Decool, Gauthier; Grzych, Guillaume; Grardel, Nathalie; Abou Chahla, Wadih; Preudhomme, Claude; Roche-Lestienne, Catherine
2015-10-01
Intrachromosomal amplification of chromosome 21 (iAMP21) defines a distinct cytogenetic subgroup of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) with poor prognosis that should be investigated in routine practice. Single-nucleotide polymorphism (SNP)-array provides a useful method to detect such cases showing a highly characteristic profile.
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) are the marker of choice for many researchers due to their abundance and the high-throughput methods available for their multiplex analysis. Only recently have SNP markers been available to researchers in soybean [Glycine max (L.) Merr.] with the release of th...
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
NASA Astrophysics Data System (ADS)
Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue
2008-11-01
Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.
Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer
NASA Astrophysics Data System (ADS)
Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming
2017-09-01
Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.
Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.
Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima
2015-09-15
Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.
Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua
2013-03-28
Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.
Gymoese, Pernille; Sørensen, Gitte; Litrup, Eva; Olsen, John Elmerdal; Nielsen, Eva Møller
2017-01-01
Whole-genome sequencing is rapidly replacing current molecular typing methods for surveillance purposes. Our study evaluates core-genome single-nucleotide polymorphism analysis for outbreak detection and linking of sources of Salmonella enterica serovar Typhimurium and its monophasic variants during a 7-month surveillance period in Denmark. We reanalyzed and defined 8 previously characterized outbreaks from the phylogenetic relatedness of the isolates, epidemiologic data, and food traceback investigations. All outbreaks were identified, and we were able to exclude unrelated and include additional related human cases. We were furthermore able to link possible food and veterinary sources to the outbreaks. Isolates clustered according to sequence types (STs) 19, 34, and 36. Our study shows that core-genome single-nucleotide polymorphism analysis is suitable for surveillance and outbreak investigation for Salmonella Typhimurium (ST19 and ST36), but whole genome–wide analysis may be required for the tight genetic clone of monophasic variants (ST34). PMID:28930002
Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi
2017-06-13
We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.
Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang
2018-02-23
The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.
Rueda, Oscar M; Diaz-Uriarte, Ramon
2007-10-16
Yu et al. (BMC Bioinformatics 2007,8: 145+) have recently compared the performance of several methods for the detection of genomic amplification and deletion breakpoints using data from high-density single nucleotide polymorphism arrays. One of the methods compared is our non-homogenous Hidden Markov Model approach. Our approach uses Markov Chain Monte Carlo for inference, but Yu et al. ran the sampler for a severely insufficient number of iterations for a Markov Chain Monte Carlo-based method. Moreover, they did not use the appropriate reference level for the non-altered state. We rerun the analysis in Yu et al. using appropriate settings for both the Markov Chain Monte Carlo iterations and the reference level. Additionally, to show how easy it is to obtain answers to additional specific questions, we have added a new analysis targeted specifically to the detection of breakpoints. The reanalysis shows that the performance of our method is comparable to that of the other methods analyzed. In addition, we can provide probabilities of a given spot being a breakpoint, something unique among the methods examined. Markov Chain Monte Carlo methods require using a sufficient number of iterations before they can be assumed to yield samples from the distribution of interest. Running our method with too small a number of iterations cannot be representative of its performance. Moreover, our analysis shows how our original approach can be easily adapted to answer specific additional questions (e.g., identify edges).
Martin, Lauren; Damaso, Natalie; Mills, DeEtta
2016-10-01
Molecular methods for the detection of mammalian coat color phenotypes have expanded greatly within the past decade. Many phenotypes are associated with a single nucleotide polymorphism mutation in the genetic sequence. Traditionally, these mutations are detected through sequencing, hybridization assays or mini-sequencing. However, these techniques can be expensive and tedious. Previously, CE-SSCP using the F-108 polymer was able to distinguish SNPs for the melanocortin-1 receptor (mc1r) coat color gene in horses (Equus caballus) that differed by one nucleotide substitution. The objective of this study was to expand the detection of coat color SNPs in horses. The genes for the solute carrier family member 2 (slc45a2/matp), type III receptor protein-tyrosine kinase (kit) and mc1r genes using CE-SSCP and F-108 polymer were compared to mini-sequencing with the SNaPshot TM kit. The F-108 polymer reproducibly resolved homozygous and heterozygous individuals for the mc1r and kit markers, but was unable to resolve heterozygous individuals for slc45a2 at 38ºC. The need for temperatures <15ºC, the SNP position being close to the 5'-end, and conformational structures/free energy with similar values resulted in the inability to resolve the secondary structures. Despite this limitation, the CE-SSCP method could be used to provide a rapid phenotypic description for equine forensic investigations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Huang, D; Wu, W; Lu, L
2004-05-01
Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.
Method for nucleic acid hybridization using single-stranded DNA binding protein
Tabor, Stanley; Richardson, Charles C.
1996-01-01
Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.
OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities
NASA Astrophysics Data System (ADS)
Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.
2016-09-01
The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.
E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China
Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man
2017-01-01
Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822
Method for promoting specific alignment of short oligonucleotides on nucleic acids
Studier, F. William; Kieleczawa, Jan; Dunn, John J.
1996-01-01
Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.
USDA-ARS?s Scientific Manuscript database
In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...
Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan
2015-12-01
We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.
Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.
2010-01-01
Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771
Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M
2010-01-12
Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.
Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei
2017-08-01
Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Zador, Anthony M.; Dubnau, Joshua; Oyibo, Hassana K.; Zhan, Huiqing; Cao, Gang; Peikon, Ian D.
2012-01-01
Connectivity determines the function of neural circuits. Historically, circuit mapping has usually been viewed as a problem of microscopy, but no current method can achieve high-throughput mapping of entire circuits with single neuron precision. Here we describe a novel approach to determining connectivity. We propose BOINC (“barcoding of individual neuronal connections”), a method for converting the problem of connectivity into a form that can be read out by high-throughput DNA sequencing. The appeal of using sequencing is that its scale—sequencing billions of nucleotides per day is now routine—is a natural match to the complexity of neural circuits. An inexpensive high-throughput technique for establishing circuit connectivity at single neuron resolution could transform neuroscience research. PMID:23109909
Asymmetric structure of five and six membered DNA hairpin loops
NASA Technical Reports Server (NTRS)
Baumann, U.; Chang, S.
1995-01-01
The tertiary structure of nucleic acid hairpins was elucidated by means of the accessibility of the single-strand-specific nuclease from mung bean. This molecular probe has proven especially useful in determining details of the structural arrangement of the nucleotides within a loop. In this study 3'-labeling is introduced to complement previously used 5'-labeling in order to assess and to exclude possible artifacts of the method. Both labeling procedures result in mutually consistent cleavage patterns. Therefore, methodological artifacts can be excluded and the potential of the nuclease as structural probe is increased. DNA hairpins with five and six membered loops reveal an asymmetric loop structure with a sharp bend of the phosphate-ribose backbone between the second and third nucleotide on the 3'-side of a loop. These hairpin structures differ from smaller loops with 3 or 4 members, which reveal this type of bend between the first and second 3' nucleotide, and resemble with respect to the asymmetry anticodon loops of tRNA.
The beginning of kinesin's force-generating cycle visualized at 9-Å resolution
Sindelar, Charles V.; Downing, Kenneth H.
2007-01-01
We have used cryo-electron microscopy of kinesin-decorated microtubules to resolve the structure of the motor protein kinesin's crucial nucleotide response elements, switch I and the switch II helix, in kinesin's poorly understood nucleotide-free state. Both of the switch elements undergo conformational change relative to the microtubule-free state. The changes in switch I suggest a role for it in “ejecting” adenosine diphosphate when kinesin initially binds to the microtubule. The switch II helix has an N-terminal extension, apparently stabilized by conserved microtubule contacts, implying a microtubule activation mechanism that could convey the state of the bound nucleotide to kinesin's putative force-delivering element (the “neck linker”). In deriving this structure, we have adapted an image-processing technique, single-particle reconstruction, for analyzing decorated microtubules. The resulting reconstruction visualizes the asymmetric seam present in native, 13-protofilament microtubules, and this method will provide an avenue to higher-resolution characterization of a variety of microtubule- binding proteins, as well as the microtubule itself. PMID:17470637
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan
Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less
Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu
2016-04-11
Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.
Method for producing labeled single-stranded nucleic acid probes
Dunn, John J.; Quesada, Mark A.; Randesi, Matthew
1999-10-19
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.
Duployez, Nicolas; Boudry-Labis, Elise; Decool, Gauthier; Grzych, Guillaume; Grardel, Nathalie; Abou Chahla, Wadih; Preudhomme, Claude; Roche-Lestienne, Catherine
2015-01-01
Key Clinical Message Intrachromosomal amplification of chromosome 21 (iAMP21) defines a distinct cytogenetic subgroup of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) with poor prognosis that should be investigated in routine practice. Single-nucleotide polymorphism (SNP)-array provides a useful method to detect such cases showing a highly characteristic profile. PMID:26509013
Effective fragment potential study of the interaction of DNA bases.
Smith, Quentin A; Gordon, Mark S; Slipchenko, Lyudmila V
2011-10-20
Hydrogen-bonded and stacked structures of adenine-thymine and guanine-cytosine nucleotide base pairs, along with their methylated analogues, are examined with the ab inito based general effective fragment potential (EFP2) method. A comparison of coupled cluster with single, double, and perturbative triple (CCSD(T)) energies is presented, along with an EFP2 energy decomposition to illustrate the components of the interaction energy.
Reconstructing population histories from single nucleotide polymorphism data.
Sirén, Jukka; Marttinen, Pekka; Corander, Jukka
2011-01-01
Population genetics encompasses a strong theoretical and applied research tradition on the multiple demographic processes that shape genetic variation present within a species. When several distinct populations exist in the current generation, it is often natural to consider the pattern of their divergence from a single ancestral population in terms of a binary tree structure. Inference about such population histories based on molecular data has been an intensive research topic in the recent years. The most common approach uses coalescent theory to model genealogies of individuals sampled from the current populations. Such methods are able to compare several different evolutionary scenarios and to estimate demographic parameters. However, their major limitation is the enormous computational complexity associated with the indirect modeling of the demographies, which limits the application to small data sets. Here, we propose a novel Bayesian method for inferring population histories from unlinked single nucleotide polymorphisms, which is applicable also to data sets harboring large numbers of individuals from distinct populations. We use an approximation to the neutral Wright-Fisher diffusion to model random fluctuations in allele frequencies. The population histories are modeled as binary rooted trees that represent the historical order of divergence of the different populations. A combination of analytical, numerical, and Monte Carlo integration techniques are utilized for the inferences. A particularly important feature of our approach is that it provides intuitive measures of statistical uncertainty related with the estimates computed, which may be entirely lacking for the alternative methods in this context. The potential of our approach is illustrated by analyses of both simulated and real data sets.
Yang, Shangbin; Xu, LiHui; Wu, Haifeng M.
2010-01-01
Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy. PMID:20075209
Yang, Shangbin; Xu, LiHui; Wu, Haifeng M
2010-03-01
Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy.
2013-10-01
identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year
Single-cell analysis of intercellular heteroplasmy of mtDNA in Leber hereditary optic neuropathy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobayashi, Y.; Sharpe, H.; Brown, N.
1994-07-01
The authors have investigated the distribution of mutant mtDNA molecules in single cells from a patient with Leber hereditary optic neuropathy (LHON). LHON is a maternally inherited disease that is characterized by a sudden-onset bilateral loss of central vision, which typically occurs in early adulthood. More than 50% of all LHON patients carry an mtDNA mutation at nucleotide position 11778. This nucleotide change converts a highly conserved arginine residue to histidine at codon 340 in the NADH-ubiquinone oxidoreductase subunit 4 (ND4) gene of mtDNA. In the present study, the authors used PCR amplification of mtDNA from lymphocytes to investigate mtDNAmore » heteroplasmy at the single-cell level in a LHON patient. They found that most cells were either homoplasmic normal or homoplasmic mutant at nucleotide position 11778. Some (16%) cells contained both mutant and normal mtDNA.« less
A short review of variants calling for single-cell-sequencing data with applications.
Wei, Zhuohui; Shu, Chang; Zhang, Changsheng; Huang, Jingying; Cai, Hongmin
2017-11-01
The field of single-cell sequencing is fleetly expanding, and many techniques have been developed in the past decade. With this technology, biologists can study not only the heterogeneity between two adjacent cells in the same tissue or organ, but also the evolutionary relationships and degenerative processes in a single cell. Calling variants is the main purpose in analyzing single cell sequencing (SCS) data. Currently, some popular methods used for bulk-cell-sequencing data analysis are tailored directly to be applied in dealing with SCS data. However, SCS requires an extra step of genome amplification to accumulate enough quantity for satisfying sequencing needs. The amplification yields large biases and thus raises challenge for using the bulk-cell-sequencing methods. In order to provide guidance for the development of specialized analyzed methods as well as using currently developed tools for SNS, this paper aims to bridge the gap. In this paper, we firstly introduced two popular genome amplification methods and compared their capabilities. Then we introduced a few popular models for calling single-nucleotide polymorphisms and copy-number variations. Finally, break-through applications of SNS were summarized to demonstrate its potential in researching cell evolution. Copyright © 2017 Elsevier Ltd. All rights reserved.
2012-01-01
Background Efficient, robust, and accurate genotype imputation algorithms make large-scale application of genomic selection cost effective. An algorithm that imputes alleles or allele probabilities for all animals in the pedigree and for all genotyped single nucleotide polymorphisms (SNP) provides a framework to combine all pedigree, genomic, and phenotypic information into a single-stage genomic evaluation. Methods An algorithm was developed for imputation of genotypes in pedigreed populations that allows imputation for completely ungenotyped animals and for low-density genotyped animals, accommodates a wide variety of pedigree structures for genotyped animals, imputes unmapped SNP, and works for large datasets. The method involves simple phasing rules, long-range phasing and haplotype library imputation and segregation analysis. Results Imputation accuracy was high and computational cost was feasible for datasets with pedigrees of up to 25 000 animals. The resulting single-stage genomic evaluation increased the accuracy of estimated genomic breeding values compared to a scenario in which phenotypes on relatives that were not genotyped were ignored. Conclusions The developed imputation algorithm and software and the resulting single-stage genomic evaluation method provide powerful new ways to exploit imputation and to obtain more accurate genetic evaluations. PMID:22462519
Method for introducing unidirectional nested deletions
Dunn, J.J.; Quesada, M.A.; Randesi, M.
1999-07-27
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.
Method for introducing unidirectional nested deletions
Dunn, John J.; Quesada, Mark A.; Randesi, Matthew
1999-07-27
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.
Taylor, Angela J; Lappi, Victoria; Wolfgang, William J; Lapierre, Pascal; Palumbo, Michael J; Medus, Carlota; Boxrud, David
2015-10-01
Salmonella enterica serovar Enteritidis is a significant cause of gastrointestinal illness in the United States; however, current molecular subtyping methods lack resolution for this highly clonal serovar. Advances in next-generation sequencing technologies have made it possible to examine whole-genome sequencing (WGS) as a potential molecular subtyping tool for outbreak detection and source trace back. Here, we conducted a retrospective analysis of S. Enteritidis isolates from seven epidemiologically confirmed foodborne outbreaks and sporadic isolates (not epidemiologically linked) to determine the utility of WGS to identify outbreaks. A collection of 55 epidemiologically characterized clinical and environmental S. Enteritidis isolates were sequenced. Single nucleotide polymorphism (SNP)-based cluster analysis of the S. Enteritidis genomes revealed well supported clades, with less than four-SNP pairwise diversity, that were concordant with epidemiologically defined outbreaks. Sporadic isolates were an average of 42.5 SNPs distant from the outbreak clusters. Isolates collected from the same patient over several weeks differed by only two SNPs. Our findings show that WGS provided greater resolution between outbreak, sporadic, and suspect isolates than the current gold standard subtyping method, pulsed-field gel electrophoresis (PFGE). Furthermore, results could be obtained in a time frame suitable for surveillance activities, supporting the use of WGS as an outbreak detection and characterization method for S. Enteritidis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.
Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A
2012-03-01
Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.
Schermerhorn, Kelly M.; Gardner, Andrew F.
2015-01-01
Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
NASA Astrophysics Data System (ADS)
Wang, Quan; Serban, Andrew J.; Wachter, Rebekka M.; Moerner, W. E.
2018-03-01
Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ˜0.1 s-1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.
Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K
2016-10-01
Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.
Wang, Quan; Serban, Andrew J; Wachter, Rebekka M; Moerner, W E
2018-03-28
Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ∼0.1 s -1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.
Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun
2010-11-26
Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.
McGowen, Michael R; Clark, Clay; Gatesy, John
2008-08-01
The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.
CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.
Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C
2005-04-15
Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.
Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader
2016-07-22
High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.
Wang, Junxiu; Xiong, Guoliang; Ma, Liang; Wang, Shihui; Zhou, Xu; Wang, Lei; Xiao, Lehui; Su, Xin; Yu, Changyuan
2017-08-15
Single-nucleotide mutation (SNM) has proven to be associated with a variety of human diseases. Development of reliable methods for the detection of SNM is crucial for molecular diagnosis and personalized medicine. The sandwich assays are widely used tools for detecting nucleic acid biomarkers due to their low cost and rapid signaling. However, the poor hybridization specificity of signal probe at room temperature hampers the discrimination of mutant and wild type. Here, we demonstrate a dynamic sandwich assay on magnetic beads for SNM detection based on the transient binding between signal probe and target. By taking the advantage of mismatch sensitive thermodynamics of transient DNA binding, the dynamic sandwich assay exhibits high discrimination factor for mutant with a broad range of salt concentration at room temperature. The beads used in this assay serve as a tool for separation, and might be helpful to enhance SNM selectivity. Flexible design of signal probe and facile magnetic separation allow multiple-mode downstream analysis including colorimetric detection and isothermal amplification. With this method, BRAF mutations in the genomic DNA extracted from cancer cell lines were tested, allowing sensitive detection of SNM at very low abundances (0.1-0.5% mutant/wild type). Copyright © 2017 Elsevier B.V. All rights reserved.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX
2009-02-24
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Lühr, B; Scheller, J; Meyer, P; Kramer, W
1998-02-01
We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.
Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome
Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark
2016-01-01
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting
2007-01-01
The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383
The Role of Constitutional Copy Number Variants in Breast Cancer
Walker, Logan C.; Wiggins, George A.R.; Pearson, John F.
2015-01-01
Constitutional copy number variants (CNVs) include inherited and de novo deviations from a diploid state at a defined genomic region. These variants contribute significantly to genetic variation and disease in humans, including breast cancer susceptibility. Identification of genetic risk factors for breast cancer in recent years has been dominated by the use of genome-wide technologies, such as single nucleotide polymorphism (SNP)-arrays, with a significant focus on single nucleotide variants. To date, these large datasets have been underutilised for generating genome-wide CNV profiles despite offering a massive resource for assessing the contribution of these structural variants to breast cancer risk. Technical challenges remain in determining the location and distribution of CNVs across the human genome due to the accuracy of computational prediction algorithms and resolution of the array data. Moreover, better methods are required for interpreting the functional effect of newly discovered CNVs. In this review, we explore current and future application of SNP array technology to assess rare and common CNVs in association with breast cancer risk in humans. PMID:27600231
Linear nicking endonuclease-mediated strand-displacement DNA amplification.
Joneja, Aric; Huang, Xiaohua
2011-07-01
We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length is linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. Copyright © 2011 Elsevier Inc. All rights reserved.
Catalano, Valentina; Moreno-Sanz, Paula; Lorenzi, Silvia; Grando, Maria Stella
2016-09-21
The genetic varietal authentication of wine was investigated according to DNA isolation procedures reported for enological matrices and also by testing 11 commercial extraction kits and various protocol modifications. Samples were collected at different stages of the winemaking process of renowned Italian wines Brunello di Montalcino, Lambruschi Modenesi, and Trento DOC. Results demonstrated not only that grape DNA loss is produced by the fermentation process but also that clarification and stabilization operations contribute to the reduction of double-stranded DNA content on wine. Despite the presence of inhibitors, downstream PCR genotyping yielded reliable nuclear and chloroplast SSR markers for must samples, whereas no amplification or inconsistent results were obtained at later stages of the vinification. In addition, a TaqMan genotyping assay based on cultivar-specific single-nucleotide polymorphisms (SNPs) was designed, which allowed assessment of grapevine DNA mixtures. Once the wine matrix limitations are overcome, this sensitive tool may be implemented for the relative quantification of cultivars used for blend wines or frauds.
Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu
2018-01-01
Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844
Linear nicking endonuclease-mediated strand displacement DNA amplification
Joneja, Aric; Huang, Xiaohua
2011-01-01
We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to five thousand nucleotides can be linearly amplified using a nicking endonuclease with seven base-pair recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length are linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. PMID:21342654
Integrated Cox's model for predicting survival time of glioblastoma multiforme.
Ai, Zhibing; Li, Longti; Fu, Rui; Lu, Jing-Min; He, Jing-Dong; Li, Sen
2017-04-01
Glioblastoma multiforme is the most common primary brain tumor and is highly lethal. This study aims to figure out signatures for predicting the survival time of patients with glioblastoma multiforme. Clinical information, messenger RNA expression, microRNA expression, and single-nucleotide polymorphism array data of patients with glioblastoma multiforme were retrieved from The Cancer Genome Atlas. Patients were separated into two groups by using 1 year as a cutoff, and a logistic regression model was used to figure out any variables that can predict whether the patient was able to live longer than 1 year. Furthermore, Cox's model was used to find out features that were correlated with the survival time. Finally, a Cox model integrated the significant clinical variables, messenger RNA expression, microRNA expression, and single-nucleotide polymorphism was built. Although the classification method failed, signatures of clinical features, messenger RNA expression levels, and microRNA expression levels were figured out by using Cox's model. However, no single-nucleotide polymorphisms related to prognosis were found. The selected clinical features were age at initial diagnosis, Karnofsky score, and race, all of which had been suggested to correlate with survival time. Both of the two significant microRNAs, microRNA-221 and microRNA-222, were targeted to p27 Kip1 protein, which implied the important role of p27 Kip1 on the prognosis of glioblastoma multiforme patients. Our results suggested that survival modeling was more suitable than classification to figure out prognostic biomarkers for patients with glioblastoma multiforme. An integrated model containing clinical features, messenger RNA levels, and microRNA expression levels was built, which has the potential to be used in clinics and thus to improve the survival status of glioblastoma multiforme patients.
A Genome-Wide Association Study of Chronic Obstructive Pulmonary Disease in Hispanics
Chen, Wei; Brehm, John M.; Manichaikul, Ani; Cho, Michael H.; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M.; Enright, Paul L.; Rotter, Jerome I.; Petersen, Hans; Leng, Shuguang; Obeidat, Ma’en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S.; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K.; Tesfaigzi, Yohannes; Barr, R. Graham
2015-01-01
Rationale: Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. Objectives: We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. Methods: We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. Measurements and Main Results: We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10−8) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10−8) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. Conclusions: We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations. PMID:25584925
Lee, Bridgin G.; Anastasia, Agustin; Hempstead, Barbara L.; Lee, Francis S.
2015-01-01
Introduction: Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. Methods: This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNFMet/Met) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Results: Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNFMet/Met mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNFMet/Met mice; and (3) an increase in BDNF prodomain in BDNFMet/Met mice following nicotine withdrawal. Conclusions: Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNFMet/Met mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. PMID:25744957
Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne
2014-06-16
The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.
Empirical Performance of Cross-Validation With Oracle Methods in a Genomics Context.
Martinez, Josue G; Carroll, Raymond J; Müller, Samuel; Sampson, Joshua N; Chatterjee, Nilanjan
2011-11-01
When employing model selection methods with oracle properties such as the smoothly clipped absolute deviation (SCAD) and the Adaptive Lasso, it is typical to estimate the smoothing parameter by m-fold cross-validation, for example, m = 10. In problems where the true regression function is sparse and the signals large, such cross-validation typically works well. However, in regression modeling of genomic studies involving Single Nucleotide Polymorphisms (SNP), the true regression functions, while thought to be sparse, do not have large signals. We demonstrate empirically that in such problems, the number of selected variables using SCAD and the Adaptive Lasso, with 10-fold cross-validation, is a random variable that has considerable and surprising variation. Similar remarks apply to non-oracle methods such as the Lasso. Our study strongly questions the suitability of performing only a single run of m-fold cross-validation with any oracle method, and not just the SCAD and Adaptive Lasso.
Analysis of Genome-Wide Association Studies with Multiple Outcomes Using Penalization
Liu, Jin; Huang, Jian; Ma, Shuangge
2012-01-01
Genome-wide association studies have been extensively conducted, searching for markers for biologically meaningful outcomes and phenotypes. Penalization methods have been adopted in the analysis of the joint effects of a large number of SNPs (single nucleotide polymorphisms) and marker identification. This study is partly motivated by the analysis of heterogeneous stock mice dataset, in which multiple correlated phenotypes and a large number of SNPs are available. Existing penalization methods designed to analyze a single response variable cannot accommodate the correlation among multiple response variables. With multiple response variables sharing the same set of markers, joint modeling is first employed to accommodate the correlation. The group Lasso approach is adopted to select markers associated with all the outcome variables. An efficient computational algorithm is developed. Simulation study and analysis of the heterogeneous stock mice dataset show that the proposed method can outperform existing penalization methods. PMID:23272092
Sequence of a cDNA encoding pancreatic preprosomatostatin-22.
Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E
1982-01-01
We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673
Single molecule and single cell epigenomics.
Hyun, Byung-Ryool; McElwee, John L; Soloway, Paul D
2015-01-15
Dynamically regulated changes in chromatin states are vital for normal development and can produce disease when they go awry. Accordingly, much effort has been devoted to characterizing these states under normal and pathological conditions. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is the most widely used method to characterize where in the genome transcription factors, modified histones, modified nucleotides and chromatin binding proteins are found; bisulfite sequencing (BS-seq) and its variants are commonly used to characterize the locations of DNA modifications. Though very powerful, these methods are not without limitations. Notably, they are best at characterizing one chromatin feature at a time, yet chromatin features arise and function in combination. Investigators commonly superimpose separate ChIP-seq or BS-seq datasets, and then infer where chromatin features are found together. While these inferences might be correct, they can be misleading when the chromatin source has distinct cell types, or when a given cell type exhibits any cell to cell variation in chromatin state. These ambiguities can be eliminated by robust methods that directly characterize the existence and genomic locations of combinations of chromatin features in very small inputs of cells or ideally, single cells. Here we review single molecule epigenomic methods under development to overcome these limitations, the technical challenges associated with single molecule methods and their potential application to single cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Single Molecule and Single Cell Epigenomics
Hyun, Byung-Ryool; McElwee, John L.; Soloway, Paul D.
2014-01-01
Dynamically regulated changes in chromatin states are vital for normal development and can produce disease when they go awry. Accordingly, much effort has been devoted to characterizing these states under normal and pathological conditions. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is the most widely used method to characterize where in the genome transcription factors, modified histones, modified nucleotides and chromatin binding proteins are found; bisulfite sequencing (BS-seq) and its variants are commonly used to characterize the locations of DNA modifications. Though very powerful, these methods are not without limitations. Notably, they are best at characterizing one chromatin feature at a time, yet chromatin features arise and function in combination. Investigators commonly superimpose separate ChIP-seq or BS-seq datasets, and then infer where chromatin features are found together. While these inferences might be correct, they can be misleading when the chromatin source has distinct cell types, or when a given cell type exhibits any cell to cell variation in chromatin state. These ambiguities can be eliminated by robust methods that directly characterize the existence and genomic locations of combinations of chromatin features in very small inputs of cells or ideally, single cells. Here we review single molecule epigenomic methods under development to overcome these limitations, the technical challenges associated with single molecule methods and their potential application to single cells. PMID:25204781
Generalization of Associations of Kidney-Related Genetic Loci to American Indians
Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.
2014-01-01
Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711
Genome amplification of single sperm using multiple displacement amplification.
Jiang, Zhengwen; Zhang, Xingqi; Deka, Ranjan; Jin, Li
2005-06-07
Sperm typing is an effective way to study recombination rate on a fine scale in regions of interest. There are two strategies for the amplification of single meiotic recombinants: repulsion-phase allele-specific PCR and whole genome amplification (WGA). The former can selectively amplify single recombinant molecules from a batch of sperm but is not scalable for high-throughput operation. Currently, primer extension pre-amplification is the only method used in WGA of single sperm, whereas it has limited capacity to produce high-coverage products enough for the analysis of local recombination rate in multiple large regions. Here, we applied for the first time a recently developed WGA method, multiple displacement amplification (MDA), to amplify single sperm DNA, and demonstrated its great potential for producing high-yield and high-coverage products. In a 50 mul reaction, 76 or 93% of loci can be amplified at least 2500- or 250-fold, respectively, from single sperm DNA, and second-round MDA can further offer >200-fold amplification. The MDA products are usable for a variety of genetic applications, including sequencing and microsatellite marker and single nucleotide polymorphism (SNP) analysis. The use of MDA in single sperm amplification may open a new era for studies on local recombination rates.
NASA Astrophysics Data System (ADS)
Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen
2018-03-01
MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.
Molecular Diagnostics in Transfusion Medicine: In Capillary, on a Chip, in Silico, or in Flight?
Garritsen, Henk S.P.; Xiu-Cheng Fan, Alex; Lenz, Daniela; Hannig, Horst; Yan Zhong, Xiao; Geffers, Robert; Lindenmaier, Werner; Dittmar, Kurt E.J.; Wörmann, Bernhard
2009-01-01
Summary Serology, defined as antibody-based diagnostics, has been regarded as the diagnostic gold standard in transfusion medicine. Nowadays however the impact of molecular diagnostics in transfusion medicine is rapidly growing. Molecular diagnostics can improve tissue typing (HLA typing), increase safety of blood products (NAT testing of infectious diseases), and enable blood group typing in difficult situations (after transfusion of blood products or prenatal non-invasive RhD typing). Most of the molecular testing involves the determination of the presence of single nucleotide polymorphisms (SNPs). Antigens (e.g. blood group antigens) mostly result from single nucleotide differences in critical positions. However, most blood group systems cannot be determined by looking at a single SNP. To identify members of a blood group system a number of critical SNPs have to be taken into account. The platforms which are currently used to perform molecular diagnostics are mostly gel-based, requiring time-consuming multiple manual steps. To implement molecular methods in transfusion medicine in the future the development of higher-throughput SNP genotyping non-gel-based platforms which allow a rapid, cost-effective screening are essential. Because of its potential for automation, high throughput and cost effectiveness the special focus of this paper is a relative new technique: SNP genotyping by MALDI-TOF MS analysis. PMID:21113259
Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing
2009-06-01
The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.
A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification
Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.
2016-01-01
The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544
Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing
2014-12-01
Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.
Detecting Single-Nucleotide Substitutions Induced by Genome Editing.
Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R
2016-08-01
The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.
Kamba, Keisuke; Nagata, Takashi; Katahira, Masato
2015-01-01
APOBEC3G (A3G) is a single-stranded DNA-specific cytidine deaminase that preferentially converts cytidine to uridine at the third position of triplet cytosine (CCC) hotspots. A3G restricts the infectivity of viruses, such as HIV-1, by targeting CCC hotspots scattered through minus DNA strands, reverse-transcribed from genomic RNA. Previously, we developed a real-time NMR method and elucidated the origin of the 3'→5' polarity of deamination of DNA by the C-terminal domain of A3G (CD2), which is a phenomenon by which a hotspot located closer to the 5'-end is deaminated more effectively than one less close to the 5'-end, through quantitative analysis involving nonspecific binding to and sliding along DNA. In the present study we applied the real-time NMR method to analyze the catalytic activity of CD2 toward DNA oligonucleotides containing a nucleotide analog at a single or multiple positions. Analyses revealed the importance of the sugar and base moieties throughout the consecutive 5 nucleotides, the CCC hotspot being positioned at the center. It was also shown that the sugar or base moieties of the nucleotides outside this 5 nucleotide recognition sequence are also relevant as to CD2's activity. Analyses involving DNA oligonucleotides having two CCC hotspots linked by a long sequence of either deoxyribonucleotides, ribonucleotides or abasic deoxyribonucleotides suggested that the phosphate backbone is required for CD2 to slide along the DNA strand and to exert the 3'→5' polarity. Examination of the effects of different salt concentrations on the 3'→5' polarity indicated that the higher the salt concentration, the less prominent the 3'→5' polarity. This is most likely the result of alleviation of sliding due to a decrease in the affinity of CD2 with the phosphate backbone at high salt concentrations. We also investigated the reactivity of substrates containing 5-methylcytidine (5mC) or 5-hydroxymethylcytidine, and found that A3G exhibited low activity toward 5mC.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2007-02-06
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2009-02-24
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
Nelson, Chase W; Moncla, Louise H; Hughes, Austin L
2015-11-15
New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten
2013-01-01
Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002
Ebola Virus Epidemiology and Evolution in Nigeria
2016-10-04
the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of 10 Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012...cases, and full-4 length Ebola virus (EBOV) genome sequences for 12 of the 20. The detailed contact data permits 5 nearly complete reconstruction of...two methods highlights the strengths of each, and the importance 16 of both contact tracing and genomic sequencing during an outbreak. 17 18
Urschitz, Johann; Sultan, Omar; Ward, Kenneth
2011-01-01
Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308
Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.
Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E
2016-11-18
Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.
Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu
2012-10-01
To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.
Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E
2007-09-01
HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.
Analysis of mutational changes at the HLA locus in single human sperm.
Huang, M M; Erlich, H A; Goodman, M F; Arnheim, N
1995-01-01
Using a simple and efficient single sperm PCR and direct sequencing method, we screened for HLA-DPB1 gene mutations that may give rise to new alleles at this highly polymorphic locus. More than 800 single sperm were studied from a heterozygous individual whose two alleles carried 16 nucleotide sequence differences clustered in six polymorphic regions. A potential microgene conversion event was detected. Unrepaired heteroduplex DNA similar to that which gives rise to postmeiotic segregation events in yeast was observed in three cases. Control experiments also revealed unusual sperm from DPB1 homozygous individuals. The data may help explain allelic diversity in the MHC and suggest that a possible source of human mosaicism may be incomplete DNA mismatch repair during gametogenesis.
Chuang, Li-Yeh; Moi, Sin-Hua; Lin, Yu-Da; Yang, Cheng-Hong
2016-10-01
Evolutionary algorithms could overcome the computational limitations for the statistical evaluation of large datasets for high-order single nucleotide polymorphism (SNP) barcodes. Previous studies have proposed several chaotic particle swarm optimization (CPSO) methods to detect SNP barcodes for disease analysis (e.g., for breast cancer and chronic diseases). This work evaluated additional chaotic maps combined with the particle swarm optimization (PSO) method to detect SNP barcodes using a high-dimensional dataset. Nine chaotic maps were used to improve PSO method results and compared the searching ability amongst all CPSO methods. The XOR and ZZ disease models were used to compare all chaotic maps combined with PSO method. Efficacy evaluations of CPSO methods were based on statistical values from the chi-square test (χ 2 ). The results showed that chaotic maps could improve the searching ability of PSO method when population are trapped in the local optimum. The minor allele frequency (MAF) indicated that, amongst all CPSO methods, the numbers of SNPs, sample size, and the highest χ 2 value in all datasets were found in the Sinai chaotic map combined with PSO method. We used the simple linear regression results of the gbest values in all generations to compare the all methods. Sinai chaotic map combined with PSO method provided the highest β values (β≥0.32 in XOR disease model and β≥0.04 in ZZ disease model) and the significant p-value (p-value<0.001 in both the XOR and ZZ disease models). The Sinai chaotic map was found to effectively enhance the fitness values (χ 2 ) of PSO method, indicating that the Sinai chaotic map combined with PSO method is more effective at detecting potential SNP barcodes in both the XOR and ZZ disease models. Copyright © 2016 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...
Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição
2013-01-01
The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785
Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu
2014-01-01
Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287
Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M
2015-09-01
Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.
Martínez, Luz Maira Wintaco; Castro, Gloria Puerto; Guerrero, Martha Inírida
2016-02-01
Developing a fast, inexpensive, and specific test that reflects the mutations present in Mycobacterium tuberculosis isolates according to geographic region is the main challenge for drug-resistant tuberculosis (TB) control. The objective of this study was to develop a molecular platform to make a rapid diagnosis of multidrug-resistant (MDR) and extensively drug-resistant TB based on single nucleotide polymorphism (SNP) mutations present in therpoB, katG, inhA,ahpC, and gyrA genes from Colombian M. tuberculosis isolates. The amplification and sequencing of each target gene was performed. Capture oligonucleotides, which were tested before being used with isolates to assess the performance, were designed for wild type and mutated codons, and the platform was standardised based on the reverse hybridisation principle. This method was tested on DNA samples extracted from clinical isolates from 160 Colombian patients who were previously phenotypically and genotypically characterised as having susceptible or MDR M. tuberculosis. For our method, the kappa index of the sequencing results was 0,966, 0,825, 0,766, 0,740, and 0,625 forrpoB, katG, inhA,ahpC, and gyrA, respectively. Sensitivity and specificity were ranked between 90-100% compared with those of phenotypic drug susceptibility testing. Our assay helps to pave the way for implementation locally and for specifically adapted methods that can simultaneously detect drug resistance mutations to first and second-line drugs within a few hours.
Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat
2016-11-01
Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko
2018-01-01
Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.
Genetic source tracking of an anthrax outbreak in Shaanxi province, China.
Liu, Dong-Li; Wei, Jian-Chun; Chen, Qiu-Lan; Guo, Xue-Jun; Zhang, En-Min; He, Li; Liang, Xu-Dong; Ma, Guo-Zhu; Zhou, Ti-Cao; Yin, Wen-Wu; Liu, Wei; Liu, Kai; Shi, Yi; Ji, Jian-Jun; Zhang, Hui-Juan; Ma, Lin; Zhang, Fa-Xin; Zhang, Zhi-Kai; Zhou, Hang; Yu, Hong-Jie; Kan, Biao; Xu, Jian-Guo; Liu, Feng; Li, Wei
2017-01-17
Anthrax is an acute zoonotic infectious disease caused by the bacterium known as Bacillus anthracis. From 26 July to 8 August 2015, an outbreak with 20 suspected cutaneous anthrax cases was reported in Ganquan County, Shaanxi province in China. The genetic source tracking analysis of the anthrax outbreak was performed by molecular epidemiological methods in this study. Three molecular typing methods, namely canonical single nucleotide polymorphisms (canSNP), multiple-locus variable-number tandem repeat analysis (MLVA), and single nucleotide repeat (SNR) analysis, were used to investigate the possible source of transmission and identify the genetic relationship among the strains isolated from human cases and diseased animals during the outbreak. Five strains isolated from diseased mules were clustered together with patients' isolates using canSNP typing and MLVA. The causative B. anthracis lineages in this outbreak belonged to the A.Br.001/002 canSNP subgroup and the MLVA15-31 genotype (the 31 genotype in MLVA15 scheme). Because nine isolates from another four provinces in China were clustered together with outbreak-related strains by the canSNP (A.Br.001/002 subgroup) and MLVA15 method (MLVA15-31 genotype), still another SNR analysis (CL10, CL12, CL33, and CL35) was used to source track the outbreak, and the results suggesting that these patients in the anthrax outbreak were probably infected by the same pathogen clone. It was deduced that the anthrax outbreak occurred in Shaanxi province, China in 2015 was a local occurrence.
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-08-19
Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-01-01
Background Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required. PMID:18710585
Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease
Heidari, Mohammad Mehdi; Soheilyfar, Sorour
2016-01-01
Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013
Zianni, Michael R; Nikbakhtzadeh, Mahmood R; Jackson, Bryan T; Panescu, Jenny; Foster, Woodbridge A
2013-04-01
There is a need for more cost-effective options to more accurately discriminate among members of the Anopheles gambiae complex, particularly An. gambiae and Anopheles arabiensis. These species are morphologically indistinguishable in the adult stage, have overlapping distributions, but are behaviorally and ecologically different, yet both are efficient vectors of malaria in equatorial Africa. The method described here, High-Resolution Melt (HRM) analysis, takes advantage of minute differences in DNA melting characteristics, depending on the number of incongruent single nucleotide polymorphisms in an intragenic spacer region of the X-chromosome-based ribosomal DNA. The two species in question differ by an average of 13 single-nucleotide polymorphisms giving widely divergent melting curves. A real-time PCR system, Bio-Rad CFX96, was used in combination with a dsDNA-specific dye, EvaGreen, to detect and measure the melting properties of the amplicon generated from leg-extracted DNA of selected mosquitoes. Results with seven individuals from pure colonies of known species, as well as 10 field-captured individuals unambiguously identified by DNA sequencing, demonstrated that the method provided a high level of accuracy. The method was used to identify 86 field mosquitoes through the assignment of each to the two common clusters with a high degree of certainty. Each cluster was defined by individuals from pure colonies. HRM analysis is simpler to use than most other methods and provides comparable or more accurate discrimination between the two sibling species but requires a specialized melt-analysis instrument and software.
Zianni, Michael R.; Nikbakhtzadeh, Mahmood R.; Jackson, Bryan T.; Panescu, Jenny; Foster, Woodbridge A.
2013-01-01
There is a need for more cost-effective options to more accurately discriminate among members of the Anopheles gambiae complex, particularly An. gambiae and Anopheles arabiensis. These species are morphologically indistinguishable in the adult stage, have overlapping distributions, but are behaviorally and ecologically different, yet both are efficient vectors of malaria in equatorial Africa. The method described here, High-Resolution Melt (HRM) analysis, takes advantage of minute differences in DNA melting characteristics, depending on the number of incongruent single nucleotide polymorphisms in an intragenic spacer region of the X-chromosome-based ribosomal DNA. The two species in question differ by an average of 13 single-nucleotide polymorphisms giving widely divergent melting curves. A real-time PCR system, Bio-Rad CFX96, was used in combination with a dsDNA-specific dye, EvaGreen, to detect and measure the melting properties of the amplicon generated from leg-extracted DNA of selected mosquitoes. Results with seven individuals from pure colonies of known species, as well as 10 field-captured individuals unambiguously identified by DNA sequencing, demonstrated that the method provided a high level of accuracy. The method was used to identify 86 field mosquitoes through the assignment of each to the two common clusters with a high degree of certainty. Each cluster was defined by individuals from pure colonies. HRM analysis is simpler to use than most other methods and provides comparable or more accurate discrimination between the two sibling species but requires a specialized melt-analysis instrument and software. PMID:23543777
2011-01-01
Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311
Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen
2013-12-04
Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.
Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel
2013-10-01
Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.
SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells.
Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang
2018-01-01
Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. © 2018 Han et al.; Published by Cold Spring Harbor Laboratory Press.
SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells
Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang
2018-01-01
Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. PMID:29208629
Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment
Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378
3'-End labeling of nucleic acids by a polymerase ribozyme.
Samanta, Biswajit; Horning, David P; Joyce, Gerald F
2018-06-13
A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.
Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis
Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai
2010-01-01
The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817
Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P
1993-01-01
The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.
Eastwood, Heather; Xia, Fang; Lo, Mei-Chu; Zhou, Jing; Jordan, John B; McCarter, John; Barnhart, Wesley W; Gahm, Kyung-Hyun
2015-11-10
Analysis of nucleotide sugars, nucleoside di- and triphosphates and sugar-phosphates is an essential step in the process of understanding enzymatic pathways. A facile and rapid separation method was developed to analyze these compounds present in an enzymatic reaction mixture utilized to produce nucleotide sugars. The Primesep SB column explored in this study utilizes hydrophobic interactions as well as electrostatic interactions with the phosphoric portion of the nucleotide sugars. Ammonium formate buffer was selected due to its compatibility with mass spectrometry. Negative ion mode mass spectrometry was adopted for detection of the sugar phosphate (fucose-1-phophate), as the compound is not amenable to UV detection. Various mobile phase conditions such as pH, buffer concentration and organic modifier were explored. The semi-preparative separation method was developed to prepare 30mg of the nucleotide sugar. (19)F NMR was utilized to determine purity of the purified fluorinated nucleotide sugar. The collected nucleotide sugar was found to be 99% pure. Published by Elsevier B.V.
Shi, Chao; Ge, Yujie; Gu, Hongxi; Ma, Cuiping
2011-08-15
Single nucleotide polymorphism (SNP) genotyping is attracting extensive attentions owing to its direct connections with human diseases including cancers. Here, we have developed a highly sensitive chemiluminescence biosensor based on circular strand-displacement amplification and the separation by magnetic beads reducing the background signal for point mutation detection at room temperature. This method took advantage of both the T4 DNA ligase recognizing single-base mismatch with high selectivity and the strand-displacement reaction of polymerase to perform signal amplification. The detection limit of this method was 1.3 × 10(-16)M, which showed better sensitivity than that of most of those reported detection methods of SNP. Additionally, the magnetic beads as carrier of immobility was not only to reduce the background signal, but also may have potential apply in high through-put screening of SNP detection in human genome. Copyright © 2011 Elsevier B.V. All rights reserved.
Detection limit of intragenic deletions with targeted array comparative genomic hybridization
2013-01-01
Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607
Subangstrom Measurements of Enzyme Function Using a Biological Nanopore, SPRNT.
Laszlo, A H; Derrrington, I M; Gundlach, J H
2017-01-01
Nanopores are emerging as new single-molecule tools in the study of enzymes. Based on the progress in nanopore sequencing of DNA, a tool called Single-molecule Picometer Resolution Nanopore Tweezers (SPRNT) was developed to measure the movement of enzymes along DNA in real time. In this new method, an enzyme is loaded onto a DNA (or RNA) molecule. A single-stranded DNA end of this complex is drawn into a nanopore by an electrostatic potential that is applied across the pore. The single-stranded DNA passes through the pore's constriction until the enzyme comes into contact with the pore. Further progression of the DNA through the pore is then controlled by the enzyme. An ion current that flows through the pore's constriction is modulated by the DNA in the constriction. Analysis of ion current changes reveals the advance of the DNA with high spatiotemporal precision, thereby providing a real-time record of the enzyme's activity. Using an engineered version of the protein nanopore MspA, SPRNT has spatial resolution as small as 40pm at millisecond timescales, while simultaneously providing the DNA's sequence within the enzyme. In this chapter, SPRNT is introduced and its extraordinary potential is exemplified using the helicase Hel308. Two distinct substates are observed for each one-nucleotide advance; one of these about half-nucleotide long steps is ATP dependent and the other is ATP independent. The spatiotemporal resolution of this low-cost single-molecule technique lifts the study of enzymes to a new level of precision, enabling exploration of hitherto unobservable enzyme dynamics in real time. © 2017 Elsevier Inc. All rights reserved.
Extension of the COG and arCOG databases by amino acid and nucleotide sequences
Meereis, Florian; Kaufmann, Michael
2008-01-01
Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535
ERIC Educational Resources Information Center
Huang, William C. W.; Lin, Yi-MeiJoy; Chiu, Ching Che J.; Chiu, Chia-Huei; Chang, Fu-Sheng
2017-01-01
Purpose: This study was to investigate whether there is an age dependent effect on the association between ADIPPOR1 SNP and hypertriglyceridemia for each gender. Materials and Methods: 116 individuals aged 20 and above who claimed to be healthy were enrolled and grouped into male and female populations. Blood samples were taken to determine…
USDA-ARS?s Scientific Manuscript database
Marek’s disease virus (MDV) is an oncogenic herpesvirus that afflicts chickens with the disease known as Marek’s disease (MD). This virus induces tumors, nerve lesions, immunosuppression, and death of affected birds. Vaccines are the primary control method for MD but, due to the periodic evolution o...
Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW
2006-01-01
Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617
Goudey, Benjamin; Abedini, Mani; Hopper, John L; Inouye, Michael; Makalic, Enes; Schmidt, Daniel F; Wagner, John; Zhou, Zeyu; Zobel, Justin; Reumann, Matthias
2015-01-01
Genome-wide association studies (GWAS) are a common approach for systematic discovery of single nucleotide polymorphisms (SNPs) which are associated with a given disease. Univariate analysis approaches commonly employed may miss important SNP associations that only appear through multivariate analysis in complex diseases. However, multivariate SNP analysis is currently limited by its inherent computational complexity. In this work, we present a computational framework that harnesses supercomputers. Based on our results, we estimate a three-way interaction analysis on 1.1 million SNP GWAS data requiring over 5.8 years on the full "Avoca" IBM Blue Gene/Q installation at the Victorian Life Sciences Computation Initiative. This is hundreds of times faster than estimates for other CPU based methods and four times faster than runtimes estimated for GPU methods, indicating how the improvement in the level of hardware applied to interaction analysis may alter the types of analysis that can be performed. Furthermore, the same analysis would take under 3 months on the currently largest IBM Blue Gene/Q supercomputer "Sequoia" at the Lawrence Livermore National Laboratory assuming linear scaling is maintained as our results suggest. Given that the implementation used in this study can be further optimised, this runtime means it is becoming feasible to carry out exhaustive analysis of higher order interaction studies on large modern GWAS.
Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun
2013-08-01
Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.
Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio
2009-08-13
Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.
Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira
2016-02-01
This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.
Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming
2017-06-15
In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non-synonymous substitutions (4 in the coil). Selection pressure analysis revealed no positive selection in the amino acid sites of the genes encoding for structural and non-structural proteins. This study may help understand the intrinsic geographical relatedness of dengue virus 3 and contributes further to research on their infectivity, pathogenicity and vaccine development. Copyright © 2017 Elsevier B.V. All rights reserved.
Marq, Jean-Baptiste; Hausmann, Stéphane; Veillard, Nicolas; Kolakofsky, Daniel; Garcin, Dominique
2011-02-25
Arenavirus RNA genomes are initiated by a "prime and realign" mechanism, such that the initiating GTP is found as a single unpaired (overhanging) nucleotide when the complementary genome ends anneal to form double-stranded (ds) RNA panhandle structures. dsRNAs modeled on these structures do not induce interferon (IFN), as opposed to blunt-ended (5' ppp)dsRNA. This study examines whether these viral structures can also act as decoys, by trapping RIG-I in inactive dsRNA complexes. We examined the ability of various dsRNAs to activate the RIG-I ATPase (presumably a measure of helicase translocation on dsRNA) relative to their ability to induce IFN. We found that there is no simple relationship between these two properties, as if RIG-I can translocate on short dsRNAs without inducing IFN. Moreover, we found that (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide can in fact competitively inhibit the ability of blunt-ended (5' ppp)dsRNAs to induce IFN when co-transfected into cells and that this inhibition is strongly dependent on the presence of the 5' ppp. In contrast, (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide does not inhibit poly(I-C)-induced IFN activation, which is independent of the presence of a 5' ppp group.
Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast
Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora
2006-01-01
Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318
Genetics of Oxidative Stress in Obesity
Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.
2014-01-01
Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334
Genetics of oxidative stress in obesity.
Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M
2014-02-20
Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.
A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.
Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie
2011-06-15
A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
NASA Astrophysics Data System (ADS)
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin
2004-01-01
Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145
Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin
2014-10-01
Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.
Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša
2017-03-01
The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.
Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin
2015-07-01
To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.
Pescatello, Linda S; Devaney, Joseph M; Hubal, Monica J; Thompson, Paul D; Hoffman, Eric P
2013-01-01
The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.
Pescatello, Linda S.; Devaney, Joseph M.; Hubal, Monica J.; Thompson, Paul D.; Hoffman, Eric P.
2013-01-01
The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity. PMID:24455711
Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun
2018-01-01
Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.
Jordan, Julie Ann; Aguirre, Gustavo D.; Acland, Gregory M.
2013-01-01
Purpose To identify the causative mutation of canine progressive retinal atrophy (PRA) segregating as an adult onset autosomal recessive disorder in the Basenji breed of dog. Methods Basenji dogs were ascertained for the PRA phenotype by clinical ophthalmoscopic examination. Blood samples from six affected cases and three nonaffected controls were collected, and DNA extraction was used for a genome-wide association study using the canine HD Illumina single nucleotide polymorphism (SNP) array and PLINK. Positional candidate genes identified within the peak association signal region were evaluated. Results The highest -Log10(P) value of 4.65 was obtained for 12 single nucleotide polymorphisms on three chromosomes. Homozygosity and linkage disequilibrium analyses favored one chromosome, CFA25, and screening of the S-antigen (SAG) gene identified a non-stop mutation (c.1216T>C), which would result in the addition of 25 amino acids (p.*405Rext*25). Conclusions Identification of this non-stop SAG mutation in dogs affected with retinal degeneration establishes this canine disease as orthologous to Oguchi disease and SAG-associated retinitis pigmentosa in humans, and offers opportunities for genetic therapeutic intervention. PMID:24019744
Yeast ribonuclease III uses a network of multiple hydrogen bonds for RNA binding and cleavage.
Lavoie, Mathieu; Abou Elela, Sherif
2008-08-19
Members of the bacterial RNase III family recognize a variety of short structured RNAs with few common features. It is not clear how this group of enzymes supports high cleavage fidelity while maintaining a broad base of substrates. Here we show that the yeast orthologue of RNase III (Rnt1p) uses a network of 2'-OH-dependent interactions to recognize substrates with different structures. We designed a series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate was engineered to carry a single or multiple 2'- O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Interestingly, introduction of 2'- O-methyl ribonucleotides near the cleavage site increased the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'- O-methyl ribonucleotides inhibited cleavage while single 2'-fluoro ribonucleotide substitutions did not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated. Strikingly, several nucleotide substitutions greatly increased the substrate dissociation constant with little or no effect on the Michaelis-Menten constant or rate of catalysis. Together, the results indicate that Rnt1p uses a network of nucleotide interactions to identify its substrate and support two distinct modes of binding. One mode is primarily mediated by the dsRNA binding domain and leads to the formation of stable RNA/protein complex, while the other requires the presence of the nuclease and N-terminal domains and leads to RNA cleavage.
The SNPforID Assay as a Supplementary Method in Kinship and Trace Analysis
Schwark, Thorsten; Meyer, Patrick; Harder, Melanie; Modrow, Jan-Hendrick; von Wurmb-Schwark, Nicole
2012-01-01
Objective Short tandem repeat (STR) analysis using commercial multiplex PCR kits is the method of choice for kinship testing and trace analysis. However, under certain circumstances (deficiency testing, mutations, minute DNA amounts), STRs alone may not suffice. Methods We present a 50-plex single nucleotide polymorphism (SNP) assay based on the SNPs chosen by the SNPforID consortium as an additional method for paternity and for trace analysis. The new assay was applied to selected routine paternity and trace cases from our laboratory. Results and Conclusions Our investigation shows that the new SNP multiplex assay is a valuable method to supplement STR analysis, and is a powerful means to solve complicated genetic analyses. PMID:22851934
Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.
Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala
2006-06-01
Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.
Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms
Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala
2006-01-01
Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700
Scaltriti, Erika; Sassera, Davide; Comandatore, Francesco; Morganti, Marina; Mandalari, Carmen; Gaiarsa, Stefano; Bandi, Claudio; Zehender, Gianguglielmo; Bolzoni, Luca; Casadei, Gabriele
2015-01-01
We retrospectively analyzed a rare Salmonella enterica serovar Manhattan outbreak that occurred in Italy in 2009 to evaluate the potential of new genomic tools based on differential single nucleotide polymorphism (SNP) analysis in comparison with the gold standard genotyping method, pulsed-field gel electrophoresis. A total of 39 isolates were analyzed from patients (n = 15) and food, feed, animal, and environmental sources (n = 24), resulting in five different pulsed-field gel electrophoresis (PFGE) profiles. Isolates epidemiologically related to the outbreak clustered within the same pulsotype, SXB_BS.0003, without any further differentiation. Thirty-three isolates were considered for genomic analysis based on different sets of SNPs, core, synonymous, nonsynonymous, as well as SNPs in different codon positions, by Bayesian and maximum likelihood algorithms. Trees generated from core and nonsynonymous SNPs, as well as SNPs at the second and first plus second codon positions detailed four distinct groups of isolates within the outbreak pulsotype, discriminating outbreak-related isolates of human and food origins. Conversely, the trees derived from synonymous and third-codon-position SNPs clustered food and human isolates together, indicating that all outbreak-related isolates constituted a single clone, which was in line with the epidemiological evidence. Further experiments are in place to extend this approach within our regional enteropathogen surveillance system. PMID:25653407
Scaltriti, Erika; Sassera, Davide; Comandatore, Francesco; Morganti, Marina; Mandalari, Carmen; Gaiarsa, Stefano; Bandi, Claudio; Zehender, Gianguglielmo; Bolzoni, Luca; Casadei, Gabriele; Pongolini, Stefano
2015-04-01
We retrospectively analyzed a rare Salmonella enterica serovar Manhattan outbreak that occurred in Italy in 2009 to evaluate the potential of new genomic tools based on differential single nucleotide polymorphism (SNP) analysis in comparison with the gold standard genotyping method, pulsed-field gel electrophoresis. A total of 39 isolates were analyzed from patients (n=15) and food, feed, animal, and environmental sources (n=24), resulting in five different pulsed-field gel electrophoresis (PFGE) profiles. Isolates epidemiologically related to the outbreak clustered within the same pulsotype, SXB_BS.0003, without any further differentiation. Thirty-three isolates were considered for genomic analysis based on different sets of SNPs, core, synonymous, nonsynonymous, as well as SNPs in different codon positions, by Bayesian and maximum likelihood algorithms. Trees generated from core and nonsynonymous SNPs, as well as SNPs at the second and first plus second codon positions detailed four distinct groups of isolates within the outbreak pulsotype, discriminating outbreak-related isolates of human and food origins. Conversely, the trees derived from synonymous and third-codon-position SNPs clustered food and human isolates together, indicating that all outbreak-related isolates constituted a single clone, which was in line with the epidemiological evidence. Further experiments are in place to extend this approach within our regional enteropathogen surveillance system. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J
2003-10-01
The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.
MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments
Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin
2017-01-01
Motivation: With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. Results: We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. Availability and implementation: MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator. The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. Contact: igs@sanger.ac.uk or mh26@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27605100
MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments.
Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin
2017-01-01
With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. igs@sanger.ac.uk or mh26@sanger.ac.ukSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
NASA Astrophysics Data System (ADS)
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
USDA-ARS?s Scientific Manuscript database
One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...
A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, G K; Hillier, L; Brandstrom, M
2005-02-20
We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less
Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel
Eriksson, Anders; Manica, Andrea
2011-01-01
Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358
NASA Astrophysics Data System (ADS)
Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.
2015-11-01
Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.
Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.
2014-01-01
Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324
Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji
2010-07-01
We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.
Büttner, Lea; Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia
2014-06-04
A general and efficient single-step method was established for site-specific post-transcriptional labeling of RNA. Using Tb(3+) as accelerating cofactor for deoxyribozymes, various labeled guanosines were site-specifically attached to 2'-OH groups of internal adenosines in in vitro transcribed RNA. The DNA-catalyzed 2',5'-phosphodiester bond formation proceeded efficiently with fluorescent, spin-labeled, biotinylated, or cross-linker-modified guanosine triphosphates. The sequence context of the labeling site was systematically analyzed by mutating the nucleotides flanking the targeted adenosine. Labeling of adenosines in a purine-rich environment showed the fastest reactions and highest yields. Overall, practically useful yields >70% were obtained for 13 out of 16 possible nucleotide (nt) combinations. Using this approach, we demonstrate preparative labeling under mild conditions for up to ~160-nt-long RNAs, including spliceosomal U6 small nuclear RNA and a cyclic-di-AMP binding riboswitch RNA.
Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila
2012-07-01
Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.
Suzuki, Norihiko; Fukushima, Masakazu
2010-11-01
To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.
Error correction and diversity analysis of population mixtures determined by NGS
Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.
2014-01-01
The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074
Wang, Lu-Yong; Fasulo, D
2006-01-01
Genome-wide association study for complex diseases will generate massive amount of single nucleotide polymorphisms (SNPs) data. Univariate statistical test (i.e. Fisher exact test) was used to single out non-associated SNPs. However, the disease-susceptible SNPs may have little marginal effects in population and are unlikely to retain after the univariate tests. Also, model-based methods are impractical for large-scale dataset. Moreover, genetic heterogeneity makes the traditional methods harder to identify the genetic causes of diseases. A more recent random forest method provides a more robust method for screening the SNPs in thousands scale. However, for more large-scale data, i.e., Affymetrix Human Mapping 100K GeneChip data, a faster screening method is required to screening SNPs in whole-genome large scale association analysis with genetic heterogeneity. We propose a boosting-based method for rapid screening in large-scale analysis of complex traits in the presence of genetic heterogeneity. It provides a relatively fast and fairly good tool for screening and limiting the candidate SNPs for further more complex computational modeling task.
Empirical Performance of Cross-Validation With Oracle Methods in a Genomics Context
Martinez, Josue G.; Carroll, Raymond J.; Müller, Samuel; Sampson, Joshua N.; Chatterjee, Nilanjan
2012-01-01
When employing model selection methods with oracle properties such as the smoothly clipped absolute deviation (SCAD) and the Adaptive Lasso, it is typical to estimate the smoothing parameter by m-fold cross-validation, for example, m = 10. In problems where the true regression function is sparse and the signals large, such cross-validation typically works well. However, in regression modeling of genomic studies involving Single Nucleotide Polymorphisms (SNP), the true regression functions, while thought to be sparse, do not have large signals. We demonstrate empirically that in such problems, the number of selected variables using SCAD and the Adaptive Lasso, with 10-fold cross-validation, is a random variable that has considerable and surprising variation. Similar remarks apply to non-oracle methods such as the Lasso. Our study strongly questions the suitability of performing only a single run of m-fold cross-validation with any oracle method, and not just the SCAD and Adaptive Lasso. PMID:22347720
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection
KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.
2016-01-01
CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703
CNG and HCN channels: two peas, one pod.
Craven, Kimberley B; Zagotta, William N
2006-01-01
Cyclic nucleotide-activated ion channels play a fundamental role in a variety of physiological processes. By opening in response to intracellular cyclic nucleotides, they translate changes in concentrations of signaling molecules to changes in membrane potential. These channels belong to two families: the cyclic nucleotide-gated (CNG) channels and the hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels. The two families exhibit high sequence similarity and belong to the superfamily of voltage-gated potassium channels. Whereas HCN channels are activated by voltage and CNG channels are virtually voltage independent, both channels are activated by cyclic nucleotide binding. Furthermore, the channels are thought to have similar channel structures, leading to similar mechanisms of activation by cyclic nucleotides. However, although these channels are structurally and behaviorally similar, they have evolved to perform distinct physiological functions. This review describes the physiological roles and biophysical behavior of CNG and HCN channels. We focus on how similarities in structure and activation mechanisms result in common biophysical models, allowing CNG and HCN channels to be viewed as a single genre.
Structure of a eukaryotic cyclic nucleotide-gated channel
Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian
2018-01-01
Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415
HRM and SNaPshot as alternative forensic SNP genotyping methods.
Mehta, Bhavik; Daniel, Runa; McNevin, Dennis
2017-09-01
Single nucleotide polymorphisms (SNPs) have been widely used in forensics for prediction of identity, biogeographical ancestry (BGA) and externally visible characteristics (EVCs). Single base extension (SBE) assays, most notably SNaPshot® (Thermo Fisher Scientific), are commonly used for forensic SNP genotyping as they can be employed on standard instrumentation in forensic laboratories (e.g. capillary electrophoresis). High resolution melt (HRM) analysis is an alternative method and is a simple, fast, single tube assay for low throughput SNP typing. This study compares HRM and SNaPshot®. HRM produced reproducible and concordant genotypes at 500 pg, however, difficulties were encountered when genotyping SNPs with high GC content in flanking regions and differentiating variants of symmetrical SNPs. SNaPshot® was reproducible at 100 pg and is less dependent on SNP choice. HRM has a shorter processing time in comparison to SNaPshot®, avoids post PCR contamination risk and has potential as a screening tool for many forensic applications.
Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.
Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko
2017-12-01
A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.
Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.
Cui, Chenghua; Shu, Wei; Li, Peining
2016-01-01
Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.
Kullback-Leibler divergence for detection of rare haplotype common disease association.
Lin, Shili
2015-11-01
Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.
Wu, Jiaxin; Li, Yanda; Jiang, Rui
2014-03-01
Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs) for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data) for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP) and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations), SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.
Nei, M; Tateno, Y
1981-01-01
Conducting computer simulations, Nei and Tateno (1978) have shown that Jukes and Holmquist's (1972) method of estimating the number of nucleotide substitutions tends to give an overestimate and the estimate obtained has a large variance. Holmquist and Conroy (1980) repeated some parts of our simulation and claim that the overestimation of nucleotide substitutions in our paper occurred mainly because we used selected data. Examination of Holmquist and Conroy's simulation indicates that their results are essentially the same as ours when the Jukes-Holmquist method is used, but since they used a different method of computation their estimates of nucleotide substitutions differed substantially from ours. Another problem in Holmquist and Conroy's Letter is that they confused the expected number of nucleotide substitution with the number in a sample. This confusion has resulted in a number of unnecessary arguments. They also criticized our X2 measure, but this criticism is apparently due to a misunderstanding of the assumptions of our method and a failure to use our method in the way we described. We believe that our earlier conclusions remain unchanged.
Silva-Junior, Orzenil B; Grattapaglia, Dario
2015-11-01
We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
The nucleotide sequence and genome organization of Plasmopara halstedii virus.
Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar
2011-03-17
Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.
Uncovering drug-responsive regulatory elements
Luizon, Marcelo R; Ahituv, Nadav
2015-01-01
Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224
Huang, Shih-Ying; Chang, Jia-Ru; Liao, Yu-Chieh; Dou, Horng-Yunn; Chuang, Min-Chieh
2018-05-12
Tuberculosis (TB) remains one of the major infectious diseases worldwide. The pathogenic bacterium, Mycobacterium tuberculosis (M.tb), continuously evolves strains carrying drug-resistance genes, thus posing a growing challenge to TB prevention and treatment. We report a diagnostic system that uses a molecular beacon probe and an assistant strand as the core to simultaneously interact with an M.tb-specific fragment (in IS6110) and a single nucleotide substitution (SNS)-encoded segment (in rpoB) associated with drug resistance. A single fluorescent output in three-tiered levels was produced for combinatorial interpretations based on formation of a four-way DNA junction (4WJ). The SNS caused the 4WJ to partially dissociate, thus resulting in medium-level fluorescence. By contrast, high- and low-level fluorescence, represented the complete complementary complex and absence of either targeted fragments, respectively. Manipulating the length of the analyte-binding arm realized the medium output. The thermodynamics and kinetics of 4WJ construction were investigated to maximize the tiered-output performance. Biocatalytic amplification driven by the Klenow Fragment and Nt.AlwI was incorporated into the method to enhance the signal 64-fold and ensure long-term stability of the three-tiered output. The detection accuracy of the sensing system was verified using unpurified amplicons with templates of extracted DNA and boiled bacterial solutions. The tiered-output mechanism was usable at bacterial loads ranging from 4 × 10 0 to 4 × 10 3 CFU per reaction. The interference caused by nontuberculous mycobacteria was minimal. The results demonstrated the integrity of the sensing method as an alternative strategy for rapid screening of M.tb and detecting rifampin-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Enabling multiplexed testing of pooled donor cells through whole-genome sequencing.
Chan, Yingleong; Chan, Ying Kai; Goodman, Daniel B; Guo, Xiaoge; Chavez, Alejandro; Lim, Elaine T; Church, George M
2018-04-19
We describe a method that enables the multiplex screening of a pool of many different donor cell lines. Our method accurately predicts each donor proportion from the pool without requiring the use of unique DNA barcodes as markers of donor identity. Instead, we take advantage of common single nucleotide polymorphisms, whole-genome sequencing, and an algorithm to calculate the proportions from the sequencing data. By testing using simulated and real data, we showed that our method robustly predicts the individual proportions from a mixed-pool of numerous donors, thus enabling the multiplexed testing of diverse donor cells en masse.More information is available at https://pgpresearch.med.harvard.edu/poolseq/.
Trembizki, Ella; Smith, Helen; Lahra, Monica M; Chen, Marcus; Donovan, Basil; Fairley, Christopher K; Guy, Rebecca; Kaldor, John; Regan, David; Ward, James; Nissen, Michael D; Sloots, Theo P; Whiley, David M
2014-06-01
Neisseria gonorrhoeae antimicrobial resistance (AMR) is a global problem heightened by emerging resistance to ceftriaxone. Appropriate molecular typing methods are important for understanding the emergence and spread of N. gonorrhoeae AMR. We report on the development, validation and testing of a Sequenom MassARRAY iPLEX method for multilocus sequence typing (MLST)-style genotyping of N. gonorrhoeae isolates. An iPLEX MassARRAY method (iPLEX14SNP) was developed targeting 14 informative gonococcal single nucleotide polymorphisms (SNPs) previously shown to predict MLST types. The method was initially validated using 24 N. gonorrhoeae control isolates and was then applied to 397 test isolates collected throughout Queensland, Australia in the first half of 2012. The iPLEX14SNP method provided 100% accuracy for the control isolates, correctly identifying all 14 SNPs for all 24 isolates (336/336). For the 397 test isolates, the iPLEX14SNP assigned results for 5461 of the possible 5558 SNPs (SNP call rate 98.25%), with complete 14 SNP profiles obtained for 364 isolates. Based on the complete SNP profile data, there were 49 different sequence types identified in Queensland, with 11 of the 49 SNP profiles accounting for the majority (n = 280; 77%) of isolates. AMR was dominated by several geographically clustered sequence types. Using the iPLEX14SNP method, up to 384 isolates could be tested within 1 working day for less than Aus$10 per isolate. The iPLEX14SNP offers an accurate and high-throughput method for the MLST-style genotyping of N. gonorrhoeae and may prove particularly useful for large-scale studies investigating the emergence and spread of gonococcal AMR. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...
2016-09-07
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease
Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.
2016-01-01
Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
Transient state kinetics of transcription elongation by T7 RNA polymerase.
Anand, Vasanti Subramanian; Patel, Smita S
2006-11-24
The single subunit DNA-dependent RNA polymerase (RNAP) from bacteriophage T7 catalyzes both promoter-dependent transcription initiation and promoter-independent elongation. Using a promoter-free substrate, we have dissected the kinetic pathway of single nucleotide incorporation during elongation. We show that T7 RNAP undergoes a slow conformational change (0.01-0.03 s(-1)) to form an elongation competent complex with the promoter-free substrate (dissociation constant (Kd) of 96 nM). The complex binds to a correct NTP (Kd of 80 microM) and incorporates the nucleoside monophosphate (NMP) into RNA primer very efficiently (220 s(-1) at 25 degrees C). An overall free energy change (-5.5 kcal/mol) and internal free energy change (-3.7 kcal/mol) of single NMP incorporation was calculated from the measured equilibrium constants. In the presence of inorganic pyrophosphate (PPi), the elongation complex catalyzes the reverse pyrophosphorolysis reaction at a maximum rate of 0.8 s(-1) with PPi Kd of 1.2 mM. Several experiments were designed to investigate the rate-limiting step in the pathway of single nucleotide addition. Acid-quench and pulse-chase kinetics indicated that an isomerization step before chemistry is rate-limiting. The very similar rate constants of sequential incorporation of two nucleotides indicated that the steps after chemistry are fast. Based on available data, we propose that the preinsertion to insertion isomerization of NTP observed in the crystallographic studies of T7 RNAP is a likely candidate for the rate-limiting step. The studies here provide a kinetic framework to investigate structure-function and fidelity of RNA synthesis and to further explore the role of the conformational change in nucleotide selection during RNA synthesis.
Analysis of gene expression in single live neurons.
Eberwine, J; Yeh, H; Miyashiro, K; Cao, Y; Nair, S; Finnell, R; Zettel, M; Coleman, P
1992-01-01
We present here a method for broadly characterizing single cells at the molecular level beyond the more common morphological and transmitter/receptor classifications. The RNA from defined single cells is amplified by microinjecting primer, nucleotides, and enzyme into acutely dissociated cells from a defined region of rat brain. Further processing yields amplified antisense RNA. A second round of amplification results in greater than 10(6)-fold amplification of the original starting material, which is adequate for analysis--e.g., use as a probe, making of cDNA libraries, etc. We demonstrate this method by constructing expression profiles of single live cells from rat hippocampus. This profiling suggests that cells that appear to be morphologically similar may show marked differences in patterns of expression. In addition, we characterize several mRNAs from a single cell, some of which were previously undescribed, perhaps due to "rarity" when averaged over many cell types. Electrophysiological analysis coupled with molecular biology within the same cell will facilitate a better understanding of how changes at the molecular level are manifested in functional properties. This approach should be applicable to a wide variety of studies, including development, mutant models, aging, and neurodegenerative disease. Images PMID:1557406
Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne
2012-01-01
Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761
Seyednasrollah, Fatemeh; Mäkelä, Johanna; Pitkänen, Niina; Juonala, Markus; Hutri-Kähönen, Nina; Lehtimäki, Terho; Viikari, Jorma; Kelly, Tanika; Li, Changwei; Bazzano, Lydia; Elo, Laura L; Raitakari, Olli T
2017-06-01
Obesity is a known risk factor for cardiovascular disease. Early prediction of obesity is essential for prevention. The aim of this study is to assess the use of childhood clinical factors and the genetic risk factors in predicting adulthood obesity using machine learning methods. A total of 2262 participants from the Cardiovascular Risk in YFS (Young Finns Study) were followed up from childhood (age 3-18 years) to adulthood for 31 years. The data were divided into training (n=1625) and validation (n=637) set. The effect of known genetic risk factors (97 single-nucleotide polymorphisms) was investigated as a weighted genetic risk score of all 97 single-nucleotide polymorphisms (WGRS97) or a subset of 19 most significant single-nucleotide polymorphisms (WGRS19) using boosting machine learning technique. WGRS97 and WGRS19 were validated using external data (n=369) from BHS (Bogalusa Heart Study). WGRS19 improved the accuracy of predicting adulthood obesity in training (area under the curve [AUC=0.787 versus AUC=0.744, P <0.0001) and validation data (AUC=0.769 versus AUC=0.747, P =0.026). WGRS97 improved the accuracy in training (AUC=0.782 versus AUC=0.744, P <0.0001) but not in validation data (AUC=0.749 versus AUC=0.747, P =0.785). Higher WGRS19 associated with higher body mass index at 9 years and WGRS97 at 6 years. Replication in BHS confirmed our findings that WGRS19 and WGRS97 are associated with body mass index. WGRS19 improves prediction of adulthood obesity. Predictive accuracy is highest among young children (3-6 years), whereas among older children (9-18 years) the risk can be identified using childhood clinical factors. The model is helpful in screening children with high risk of developing obesity. © 2017 American Heart Association, Inc.
Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.
2012-01-01
Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577
Guo, Juan; Wang, Yunsheng; Song, Chi; Zhou, Jianfeng; Qiu, Lijuan; Huang, Hongwen; Wang, Ying
2010-01-01
Background and Aims It is essential to illuminate the evolutionary history of crop domestication in order to understand further the origin and development of modern cultivation and agronomy; however, despite being one of the most important crops, the domestication origin and bottleneck of soybean (Glycine max) are poorly understood. In the present study, microsatellites and nucleotide sequences were employed to elucidate the domestication genetics of soybean. Methods The genomes of 79 landrace soybeans (endemic cultivated soybeans) and 231 wild soybeans (G. soja) that represented the species-wide distribution of wild soybean in East Asia were scanned with 56 microsatellites to identify the genetic structure and domestication origin of soybean. To understand better the domestication bottleneck, four nucleotide sequences were selected to simulate the domestication bottleneck. Key Results Model-based analysis revealed that most of the landrace genotypes were assigned to the inferred wild soybean cluster of south China, South Korea and Japan. Phylogeny for wild and landrace soybeans showed that all landrace soybeans formed a single cluster supporting a monophyletic origin of all the cultivars. The populations of the nearest branches which were basal to the cultivar lineage were wild soybeans from south China. The coalescent simulation detected a bottleneck severity of K′ = 2 during soybean domestication, which could be explained by a foundation population of 6000 individuals if domestication duration lasted 3000 years. Conclusions As a result of integrating geographic distribution with microsatellite genotype assignment and phylogeny between landrace and wild soybeans, a single origin of soybean in south China is proposed. The coalescent simulation revealed a moderate genetic bottleneck with an effective wild soybean population used for domestication estimated to be ≈2 % of the total number of ancestral wild soybeans. Wild soybeans in Asia, especially in south China contain tremendous genetic resources for cultivar improvement. PMID:20566681
Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.
2009-01-01
OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852
Calcium Signaling Pathway Genes RUNX2 and CACNA1C Are Associated With Calcific Aortic Valve Disease
Guauque-Olarte, Sandra; Messika-Zeitoun, David; Droit, Arnaud; Lamontagne, Maxime; Tremblay-Marchand, Joël; Lavoie-Charland, Emilie; Gaudreault, Nathalie; Arsenault, Benoit J.; Dubé, Marie-Pierre; Tardif, Jean-Claude; Body, Simon C.; Seidman, Jonathan G.; Boileau, Catherine; Mathieu, Patrick; Pibarot, Philippe; Bossé, Yohan
2016-01-01
Background Calcific aortic valve stenosis (AS) is a life-threatening disease with no medical therapy. The genetic architecture of AS remains elusive. This study combines genome-wide association studies, gene expression, and expression quantitative trait loci mapping in human valve tissues to identify susceptibility genes of AS. Methods and Results A meta-analysis was performed combining the results of 2 genome-wide association studies in 474 and 486 cases from Quebec City (Canada) and Paris (France), respectively. Corresponding controls consisted of 2988 and 1864 individuals with European ancestry from the database of genotypes and phenotypes. mRNA expression levels were evaluated in 9 calcified and 8 normal aortic valves by RNA sequencing. The results were integrated with valve expression quantitative trait loci data obtained from 22 AS patients. Twenty-five single-nucleotide polymorphisms had P<5×10−6 in the genome-wide association studies meta-analysis. The calcium signaling pathway was the top gene set enriched for genes mapped to moderately AS-associated single-nucleotide polymorphisms. Genes in this pathway were found differentially expressed in valves with and without AS. Two single-nucleotide polymorphisms located in RUNX2 (runt-related transcription factor 2), encoding an osteogenic transcription factor, demonstrated some association with AS (genome-wide association studies P=5.33×10−5). The mRNA expression levels of RUNX2 were upregulated in calcified valves and associated with eQTL-SNPs. CACNA1C encoding a subunit of a voltage-dependent calcium channel was upregulated in calcified valves. The eQTL-SNP with the most significant association with AS located in CACNA1C was associated with higher expression of the gene. Conclusions This integrative genomic study confirmed the role of RUNX2 as a potential driver of AS and identified a new AS susceptibility gene, CACNA1C, belonging to the calcium signaling pathway. PMID:26553695
Leung, Kaston; Klaus, Anders; Lin, Bill K; Laks, Emma; Biele, Justina; Lai, Daniel; Bashashati, Ali; Huang, Yi-Fei; Aniba, Radhouane; Moksa, Michelle; Steif, Adi; Mes-Masson, Anne-Marie; Hirst, Martin; Shah, Sohrab P; Aparicio, Samuel; Hansen, Carl L
2016-07-26
The genomes of large numbers of single cells must be sequenced to further understanding of the biological significance of genomic heterogeneity in complex systems. Whole genome amplification (WGA) of single cells is generally the first step in such studies, but is prone to nonuniformity that can compromise genomic measurement accuracy. Despite recent advances, robust performance in high-throughput single-cell WGA remains elusive. Here, we introduce droplet multiple displacement amplification (MDA), a method that uses commercially available liquid dispensing to perform high-throughput single-cell MDA in nanoliter volumes. The performance of droplet MDA is characterized using a large dataset of 129 normal diploid cells, and is shown to exceed previously reported single-cell WGA methods in amplification uniformity, genome coverage, and/or robustness. We achieve up to 80% coverage of a single-cell genome at 5× sequencing depth, and demonstrate excellent single-nucleotide variant (SNV) detection using targeted sequencing of droplet MDA product to achieve a median allelic dropout of 15%, and using whole genome sequencing to achieve false and true positive rates of 9.66 × 10(-6) and 68.8%, respectively, in a G1-phase cell. We further show that droplet MDA allows for the detection of copy number variants (CNVs) as small as 30 kb in single cells of an ovarian cancer cell line and as small as 9 Mb in two high-grade serous ovarian cancer samples using only 0.02× depth. Droplet MDA provides an accessible and scalable method for performing robust and accurate CNV and SNV measurements on large numbers of single cells.
Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree
2018-05-24
Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.
IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes.
Dumoutier, L; Van Roost, E; Ameye, G; Michaux, L; Renauld, J C
2000-12-01
IL-TIF is a new cytokine originally identified as a gene induced by IL-9 in murine T lymphocytes, and showing 22% amino acid identity with IL-10. Here, we report the sequence and organization of the mouse and human IL-TIF genes, which both consist of 6 exons spreading over approximately 6 Kb. The IL-TIF gene is a single copy gene in humans, and is located on chromosome 12q15, at 90 Kb from the IFN gamma gene, and at 27 Kb from the AK155 gene, which codes for another IL-10-related cytokine. In the mouse, the IL-TIF gene is located on chromosome 10, also in the same region as the IFN gamma gene. Although it is a single copy gene in BALB/c and DBA/2 mice, the IL-TIF gene is duplicated in other strains such as C57Bl/6, FVB and 129. The two copies, which show 98% nucleotide identity in the coding region, were named IL-TIF alpha and IL-TIF beta. Beside single nucleotide variations, they differ by a 658 nucleotide deletion in IL-TIF beta, including the first non-coding exon and 603 nucleotides from the promoter. A DNA fragment corresponding to this deletion was sufficient to confer IL-9-regulated expression of a luciferase reporter plasmid, suggesting that the IL-TIF beta gene is either differentially regulated, or not expressed at all.
Duellman, Tyler; Warren, Christopher; Yang, Jay
2014-01-01
Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221
Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H
2013-02-01
Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.
Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A
2017-04-01
Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.
Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G
2015-02-07
The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.
Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K
2015-11-10
Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs can inform control programs. This manuscript describes modifications to high resolution melting technology that further increase its sensitivity to identify polygenomic infections in patient samples.
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.
2001-01-01
We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035
Optimizing complex phenotypes through model-guided multiplex genome engineering
Kuznetsov, Gleb; Goodman, Daniel B.; Filsinger, Gabriel T.; ...
2017-05-25
Here, we present a method for identifying genomic modifications that optimize a complex phenotype through multiplex genome engineering and predictive modeling. We apply our method to identify six single nucleotide mutations that recover 59% of the fitness defect exhibited by the 63-codon E. coli strain C321.ΔA. By introducing targeted combinations of changes in multiplex we generate rich genotypic and phenotypic diversity and characterize clones using whole-genome sequencing and doubling time measurements. Regularized multivariate linear regression accurately quantifies individual allelic effects and overcomes bias from hitchhiking mutations and context-dependence of genome editing efficiency that would confound other strategies.
Optimizing complex phenotypes through model-guided multiplex genome engineering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznetsov, Gleb; Goodman, Daniel B.; Filsinger, Gabriel T.
Here, we present a method for identifying genomic modifications that optimize a complex phenotype through multiplex genome engineering and predictive modeling. We apply our method to identify six single nucleotide mutations that recover 59% of the fitness defect exhibited by the 63-codon E. coli strain C321.ΔA. By introducing targeted combinations of changes in multiplex we generate rich genotypic and phenotypic diversity and characterize clones using whole-genome sequencing and doubling time measurements. Regularized multivariate linear regression accurately quantifies individual allelic effects and overcomes bias from hitchhiking mutations and context-dependence of genome editing efficiency that would confound other strategies.
Homer, Michael V.; Charo, Lindsey M.; Natarajan, Loki; Haunschild, Carolyn; Chung, Karine; Mao, Jun J.; DeMichele, Angela M.; Su, H. Irene
2016-01-01
Objective To determine if inter-individual genetic variation in single nucleotide polymorphisms related to age at natural menopause are associated with risk of ovarian failure in breast cancer survivors. Methods A prospective cohort of 169 premenopausal breast cancer survivors recruited at diagnosis with Stages 0 to III disease were followed longitudinally for menstrual pattern via self-reported daily menstrual diaries. Participants were genotyped for 13 single nucleotide polymorphisms (SNPs) previously found to be associated with age at natural menopause: EXO1, TLK1, HELQ, UIMC1, PRIM1, POLG, TMEM224, BRSK1, and MCM8. A risk variable summed the total number of risk alleles in each participant. The association between individual genotypes, as well as the risk variable, and time to ovarian failure (> 12 months of amenorrhea) was tested using time-to-event methods. Results Median age at enrollment was 40.5 years old (range 20.6–46.1). The majority of participants were white (69%) and underwent chemotherapy (76%). Thirty-eight participants (22%) experienced ovarian failure. None of the candidate SNPs or the summary risk variable were significantly associated with time to ovarian failure. Sensitivity analysis restricted to whites or only to participants receiving chemotherapy yielded similar findings. Older age, chemotherapy exposure and lower BMI were related to shorter time to ovarian failure. Conclusions Thirteen previously identified genetic variants associated with time to natural menopause were not related to timing of ovarian failure in breast cancer survivors. PMID:28118297
Elkins, C A; Kotewicz, M L; Jackson, S A; Lacher, D W; Abu-Ali, G S; Patel, I R
2013-01-01
Modern risk control and food safety practices involving food-borne bacterial pathogens are benefiting from new genomic technologies for rapid, yet highly specific, strain characterisations. Within the United States Food and Drug Administration (USFDA) Center for Food Safety and Applied Nutrition (CFSAN), optical genome mapping and DNA microarray genotyping have been used for several years to quickly assess genomic architecture and gene content, respectively, for outbreak strain subtyping and to enhance retrospective trace-back analyses. The application and relative utility of each method varies with outbreak scenario and the suspect pathogen, with comparative analytical power enhanced by database scale and depth. Integration of these two technologies allows high-resolution scrutiny of the genomic landscapes of enteric food-borne pathogens with notable examples including Shiga toxin-producing Escherichia coli (STEC) and Salmonella enterica serovars from a variety of food commodities. Moreover, the recent application of whole genome sequencing technologies to food-borne pathogen outbreaks and surveillance has enhanced resolution to the single nucleotide scale. This new wealth of sequence data will support more refined next-generation custom microarray designs, targeted re-sequencing and "genomic signature recognition" approaches involving a combination of genes and single nucleotide polymorphism detection to distil strain-specific fingerprinting to a minimised scale. This paper examines the utility of microarrays and optical mapping in analysing outbreaks, reviews best practices and the limits of these technologies for pathogen differentiation, and it considers future integration with whole genome sequencing efforts.
Tong, Steven Y C; Xie, Shirley; Richardson, Leisha J; Ballard, Susan A; Dakh, Farshid; Grabsch, Elizabeth A; Grayson, M Lindsay; Howden, Benjamin P; Johnson, Paul D R; Giffard, Philip M
2011-01-01
We have developed a single nucleotide polymorphism (SNP) nucleated high-resolution melting (HRM) technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST) database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE) and an allele specific real-time PCR (AS kinetic PCR) SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs) in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs) and provides a Simpson's Index of Diversity (D) of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].
Bai, Peng; Tian, Li; Zhou, Xue-ping
2005-05-01
DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.
Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif
2015-05-15
Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.
Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone
2016-04-14
Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.
Iddamalgoda, Lahiru; Das, Partha S; Aponso, Achala; Sundararajan, Vijayaraghava S; Suravajhala, Prashanth; Valadi, Jayaraman K
2016-01-01
Data mining and pattern recognition methods reveal interesting findings in genetic studies, especially on how the genetic makeup is associated with inherited diseases. Although researchers have proposed various data mining models for biomedical approaches, there remains a challenge in accurately prioritizing the single nucleotide polymorphisms (SNP) associated with the disease. In this commentary, we review the state-of-art data mining and pattern recognition models for identifying inherited diseases and deliberate the need of binary classification- and scoring-based prioritization methods in determining causal variants. While we discuss the pros and cons associated with these methods known, we argue that the gene prioritization methods and the protein interaction (PPI) methods in conjunction with the K nearest neighbors' could be used in accurately categorizing the genetic factors in disease causation.
Formation of template-switching artifacts by linear amplification.
Chakravarti, Dhrubajyoti; Mailander, Paula C
2008-07-01
Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.
NASA Astrophysics Data System (ADS)
Zwolak, Michael
2013-03-01
A rapid and low-cost method to sequence DNA would revolutionize personalized medicine, where genetic information is used to diagnose, treat, and prevent diseases. There is a longstanding interest in nanopores as a platform for rapid interrogation of single DNA molecules. I will discuss a sequencing protocol based on the measurement of transverse electronic currents during the translocation of single-stranded DNA through nanopores. Using molecular dynamics simulations coupled to quantum mechanical calculations of the tunneling current, I will show that the DNA nucleotides are predicted to have distinguishable electronic signatures in experimentally realizable systems. Several recent experiments support our theoretical predictions. In addition to their possible impact in medicine and biology, the above methods offer ideal test beds to study open scientific issues in the relatively unexplored area at the interface between solids, liquids, and biomolecules at the nanometer length scale. http://mike.zwolak.org
USDA-ARS?s Scientific Manuscript database
Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...
Wu, Jian; Dai, Wei; Wu, Lin; Wang, Jinke
2018-02-13
Next-generation sequencing (NGS) is fundamental to the current biological and biomedical research. Construction of sequencing library is a key step of NGS. Therefore, various library construction methods have been explored. However, the current methods are still limited by some shortcomings. This study developed a new NGS library construction method, Single strand Adaptor Library Preparation (SALP), by using a novel single strand adaptor (SSA). SSA is a double-stranded oligonucleotide with a 3' overhang of 3 random nucleotides, which can be efficiently ligated to the 3' end of single strand DNA by T4 DNA ligase. SALP can be started with any denatured DNA fragments such as those sheared by Tn5 tagmentation, enzyme digestion and sonication. When started with Tn5-tagmented chromatin, SALP can overcome a key limitation of ATAC-seq and become a high-throughput NGS library construction method, SALP-seq, which can be used to comparatively characterize the chromatin openness state of multiple cells unbiasly. In this way, this study successfully characterized the comparative chromatin openness states of four different cell lines, including GM12878, HepG2, HeLa and 293T, with SALP-seq. Similarly, this study also successfully characterized the chromatin openness states of HepG2 cells with SALP-seq by using 10 5 to 500 cells. This study developed a new NGS library construction method, SALP, by using a novel kind of single strand adaptor (SSA), which should has wide applications in the future due to its unique performance.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Liu, Meiying; Yuan, Min; Lou, Xinhui; Mao, Hongju; Zheng, Dongmei; Zou, Ruxing; Zou, Nengli; Tang, Xiangrong; Zhao, Jianlong
2011-07-15
We report here an optical approach that enables highly selective and colorimetric single-base mismatch detection without the need of target modification, precise temperature control or stringent washes. The method is based on the finding that nucleoside monophosphates (dNMPs), which are digested elements of DNA, can better stabilize unmodified gold nanoparticles (AuNPs) than single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with the same base-composition and concentration. The method combines the exceptional mismatch discrimination capability of the structure-selective nucleases with the attractive optical property of AuNPs. Taking S1 nuclease as one example, the perfectly matched 16-base synthetic DNA target was distinctively differentiated from those with single-base mutation located at any position of the 16-base synthetic target. Single-base mutations present in targets with varied length up to 80-base, located either in the middle or near to the end of the targets, were all effectively detected. In order to prove that the method can be potentially used for real clinic samples, the single-base mismatch detections with two HBV genomic DNA samples were conducted. To further prove the generality of this method and potentially overcome the limitation on the detectable lengths of the targets of the S1 nuclease-based method, we also demonstrated the use of a duplex-specific nuclease (DSN) for color reversed single-base mismatch detection. The main limitation of the demonstrated methods is that it is limited to detect mutations in purified ssDNA targets. However, the method coupled with various convenient ssDNA generation and purification techniques, has the potential to be used for the future development of detector-free testing kits in single nucleotide polymorphism screenings for disease diagnostics and treatments. Copyright © 2011 Elsevier B.V. All rights reserved.
Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G
2014-09-05
The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
A 1:2 crystalline complex of ApA:proflavine: a model for binding to single-stranded regions in RNA.
Neidle, S; Taylor, G; Sanderson, M
1978-01-01
The structure of a 1"2 complex of adenylyl-(3',5')-adenosine phosphate and proflavine hemisulfate has been determined using the methods of x-ray crystallography. Since the ApA does not form a mini double helix, it may serve as a model for the interaction of planar molecules with single stranded nucleic acids. The dinucleotide adopts an extended conformation with the adenines in adjacent molecules forming base pairs. A most unusual feature of the molecule is that it does not obey the "rigid nucleotide" concept although none of the torsion angles occur in energetically unfavourable regions. This is most probably due to the strong interactions between the proflavine and the oligonucleotide. PMID:724521
Probing Gαi1 Protein Activation at Single Amino Acid Resolution
Sun, Dawei; Maeda, Shoji; Matkovic, Milos; Mendieta, Sandro; Mayer, Daniel; Dawson, Roger; Schertler, Gebhard F.X.; Madan Babu, M.; Veprintsev, Dmitry B.
2016-01-01
We present comprehensive single amino acid resolution maps of the residues stabilising the human Gαi1 subunit in nucleotide- and receptor-bound states. We generated these maps by measuring the effects of alanine mutations on the stability of Gαi1 and of the rhodopsin-Gαi1 complex. We identified stabilization clusters in the GTPase and helical domains responsible for structural integrity and the conformational changes associated with activation. In activation cluster I, helices α1 and α5 pack against strands β1-3 to stabilize the nucleotide-bound states. In the receptor-bound state, these interactions are replaced by interactions between α5 and strands β4-6. Key residues in this cluster are Y320, crucial for the stabilization of the receptor-bound state, and F336, which stabilizes nucleotide-bound states. Destabilization of helix α1, caused by rearrangement of this activation cluster, leads to the weakening of the inter-domain interface and release of GDP. PMID:26258638
Cao, Zhao-Yun; Ma, You-Ning; Sun, Li-Hua; Mou, Ren-Xiang; Zhu, Zhi-Wei; Chen, Ming-Xue
2017-11-15
Coconut contains many uncharacterized cytokinins that have important physiological effects in plants and humans. In this work, a method based on liquid chromatography-tandem mass spectrometry was developed for identification and quantification of six cytokinin nucleotide monophosphates in coconut flesh. Excellent separation was achieved using a low-coverage C18 bonded-phase column with an acidic mobile phase, which greatly improved the retention of target compounds. To enable high-throughput analysis, a single-step solid-phase extraction using mixed-mode anion-exchange cartridges was employed for sample preparation. This proved to be an effective method to minimize matrix effects and ensure high selectivity. The limits of detection varied from 0.06 to 0.3 ng/mL, and the limits of quantification ranged from 0.2 to 1.0 ng/mL. The linearity was statistically verified over 2 orders of magnitude, giving a coefficient of determination (R 2 ) greater than 0.9981. The mean recoveries were from 81 to 108%; the intraday precision (n = 6) was less than 11%; and the interday precision (n = 11) was within 14%. The developed method was applied to the determination of cytokinin nucleotide monophosphates in coconut flesh samples, and four of them were successfully identified and quantified. The results showed that trans-zeatin riboside-5'-monophosphate was the dominant cytokinin, with a concentration of 2.7-34.2 ng/g, followed by N 6 -isopentenyladenosine-5'-monophosphate (≤12.9 ng/g), while the concentrations of cis-zeatin riboside-5'-monophosphate and dihydrozeatin riboside-5'-monophosphate were less than 2.2 and 4.9 ng/g, respectively.
Fabre, Michel; Koeck, Jean-Louis; Le Flèche, Philippe; Simon, Fabrice; Hervé, Vincent; Vergnaud, Gilles; Pourcel, Christine
2004-01-01
We have analyzed, using complementary molecular methods, the diversity of 43 strains of “Mycobacterium canettii” originating from the Republic of Djibouti, on the Horn of Africa, from 1998 to 2003. Genotyping by multiple-locus variable-number tandem repeat analysis shows that all the strains belong to a single but very distant group when compared to strains of the Mycobacterium tuberculosis complex (MTBC). Thirty-one strains cluster into one large group with little variability and five strains form another group, whereas the other seven are more diverged. In total, 14 genotypes are observed. The DR locus analysis reveals additional variability, some strains being devoid of a direct repeat locus and others having unique spacers. The hsp65 gene polymorphism was investigated by restriction enzyme analysis and sequencing of PCR amplicons. Four new single nucleotide polymorphisms were discovered. One strain was characterized by three nucleotide changes in 441 bp, creating new restriction enzyme polymorphisms. As no sequence variability was found for hsp65 in the whole MTBC, and as a single point mutation separates M. tuberculosis from the closest “M. canettii” strains, this diversity within “M. canettii” subspecies strongly suggests that it is the most probable source species of the MTBC rather than just another branch of the MTBC. PMID:15243089
Dynamic variable selection in SNP genotype autocalling from APEX microarray data.
Podder, Mohua; Welch, William J; Zamar, Ruben H; Tebbutt, Scott J
2006-11-30
Single nucleotide polymorphisms (SNPs) are DNA sequence variations, occurring when a single nucleotide--adenine (A), thymine (T), cytosine (C) or guanine (G)--is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX). This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart) is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA) using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU) of St. Paul's Hospital (plus one negative PCR control sample). Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our model-based genotype calling algorithm captures the redundancy in the system considering all the underlying probe features of a particular SNP, automatically down-weighting any 'bad data' corresponding to image artifacts on the microarray slide or failure of a specific chemistry. In this regard, our method is able to automatically select the probes which work well and reduce the effect of other so-called bad performing probes in a sample-specific manner, for any number of SNPs.
Optimized Next-Generation Sequencing Genotype-Haplotype Calling for Genome Variability Analysis
Navarro, Javier; Nevado, Bruno; Hernández, Porfidio; Vera, Gonzalo; Ramos-Onsins, Sebastián E
2017-01-01
The accurate estimation of nucleotide variability using next-generation sequencing data is challenged by the high number of sequencing errors produced by new sequencing technologies, especially for nonmodel species, where reference sequences may not be available and the read depth may be low due to limited budgets. The most popular single-nucleotide polymorphism (SNP) callers are designed to obtain a high SNP recovery and low false discovery rate but are not designed to account appropriately the frequency of the variants. Instead, algorithms designed to account for the frequency of SNPs give precise results for estimating the levels and the patterns of variability. These algorithms are focused on the unbiased estimation of the variability and not on the high recovery of SNPs. Here, we implemented a fast and optimized parallel algorithm that includes the method developed by Roesti et al and Lynch, which estimates the genotype of each individual at each site, considering the possibility to call both bases from the genotype, a single one or none. This algorithm does not consider the reference and therefore is independent of biases related to the reference nucleotide specified. The pipeline starts from a BAM file converted to pileup or mpileup format and the software outputs a FASTA file. The new program not only reduces the running times but also, given the improved use of resources, it allows its usage with smaller computers and large parallel computers, expanding its benefits to a wider range of researchers. The output file can be analyzed using software for population genetics analysis, such as the R library PopGenome, the software VariScan, and the program mstatspop for analysis considering positions with missing data. PMID:28894353
Erhardt, Georg; Shuiep, El Tahir Salih; Lisson, Maria; Weimann, Christina; Wang, Zhaoxin; El Zubeir, Ibtisam El Yas Mohamed; Pauciullo, Alfredo
2016-06-01
Milk samples of 193 camels (Camelus dromedarius) from different regions of Sudan were screened for casein variability by isoelectric focusing. Kappa-casein and beta-casein were monomorphic, whereas three protein patterns named αs1-casein A, C, and D were identified. The major allele A revealed frequencies of 0.79 (Lahaoi), 0.75 (Shanbali), 0.90 (Arabi Khali), and 0.88 (Arabi Gharbawi) in the different ecotypes. CSN1S1*C shows a single G > T nucleotide substitution in the exon 5, leading to a non-synonymous amino acid exchange (p.Glu30 > Asp30) in comparison to CSN1S1*A and D. At cDNA level, no further single nucleotide polymorphisms could be identified in CSN1S1* A, C, and D, whereas the variants CSN1S1*A and CSN1S1*C are characterized by missing of exon 18 compared to the already described CSN1S1*B, as consequence of DNA insertion of 11 bp at intron 17 which alter the pre-mRNA spliceosome machinery. A polymerase chain-restriction fragment length polymorphism method (PCR-RFLP) was established to type for G > T nucleotide substitution at genomic DNA level. The occurrence and differences of IgE-binding epitopes and bioactive peptides between αs1-casein A, C, and D after digestion were analyzed in silico. The amino acid substitutions and deletion affected the arising peptide pattern and thus modifications between IgE-binding epitopes and bioactive peptides of the variants were found. The allergenic potential of these different peptides will be investigated by microarray immunoassay using sera from milk-sensitized individuals, as it was already demonstrated for bovine αs1-casein variants.
DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)
Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.
2012-01-01
Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462
Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne
2015-01-01
Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.
Artells, Rosa; Pruna, Ricard; Dellal, Alexandre; Maffulli, Nicola
2016-01-01
Summary Background The study of new genetic biomarkers in genes related to connective tissue repair and regeneration may help to identify individuals with greater predisposition to injury, who may benefit from targeted preventive measures, and those who require longer recovery time following a muscle, ligament or tendon injury. The present study investigated whether single nucleotide polymorphisms of the Elastin gene could be related to MCL injury. Methods 60 top class football players were studied to identify single nucleotide polymorphisms for the Elastin (ELN) gene using Allelic Discrimination analysis. Each player was followed for 7 seasons, and each MCL injury was noted. Results Ligament injury rate, severity and recovery time are related to specific genotypes observed in the elastin gene, especially the ELN-AA (16 MCL) and the ELN-AG (3 MCL). Players with the ELN-GG genotype sustained no MCL injury during the 7 seasons of the study. Conclusions The identification of polymorphisms in the ELN gene may be used as a novel tool to better define an athlete’s genotype, and help to plan training and rehabilitation programmes to prevent or minimize MCL ligament injuries, and optimize the therapeutic and rehabilitation process after soft tissue injuries, and manage the workloads during trainings and matches. PMID:27900291
Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza
2014-07-01
Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.
Casellas, J; Cañas-Álvarez, J J; González-Rodríguez, A; Puig-Oliveras, A; Fina, M; Piedrafita, J; Molina, A; Díaz, C; Baró, J A; Varona, L
2017-02-01
Transmission ratio distortion (TRD) is the departure from the expected Mendelian ratio in offspring, a poorly investigated biological phenomenon in livestock species. Given the current availability of specific parametric methods for the analysis of segregation data, this study focused on the screening of TRD in 602 402 single nucleotide polymorphisms covering all autosomal chromosomes in seven Spanish beef cattle breeds. On average, 0.13% (n = 786) and 0.01% (n = 29) of genetic markers evidenced sire- or dam-specific TRD respectively. There were no single nucleotide polymorphisms accounting for both sire- and dam-specific TRD at the same time, and only one marker (rs43147474) accounted for (sire-specific) TRD in all seven breeds. It must be noted that rs43147474 is located in the fourth intronic region of the GTP-binding protein 10 gene, and this locus has been previously linked to the maintenance of mitochondria and nucleolar architectures. Alternatively, other candidate genes surround this hot-spot for sire-specific TRD in the cattle genome, and they are related to embryonic and postnatal lethality as well as prostate cancer, among others. This research characterized the distribution of TRD in the bovine genome, highlighting heterogeneous results when comparing across breeds. © 2016 Stichting International Foundation for Animal Genetics.
Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S
2016-06-01
Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.
Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh
2017-01-01
Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.
Single genome retrieval of context-dependent variability in mutation rates for human germline.
Sahakyan, Aleksandr B; Balasubramanian, Shankar
2017-01-13
Accurate knowledge of the core components of substitution rates is of vital importance to understand genome evolution and dynamics. By performing a single-genome and direct analysis of 39,894 retrotransposon remnants, we reveal sequence context-dependent germline nucleotide substitution rates for the human genome. The rates are characterised through rate constants in a time-domain, and are made available through a dedicated program (Trek) and a stand-alone database. Due to the nature of the method design and the imposed stringency criteria, we expect our rate constants to be good estimates for the rates of spontaneous mutations. Benefiting from such data, we study the short-range nucleotide (up to 7-mer) organisation and the germline basal substitution propensity (BSP) profile of the human genome; characterise novel, CpG-independent, substitution prone and resistant motifs; confirm a decreased tendency of moieties with low BSP to undergo somatic mutations in a number of cancer types; and, produce a Trek-based estimate of the overall mutation rate in human. The extended set of rate constants we report may enrich our resources and help advance our understanding of genome dynamics and evolution, with possible implications for the role of spontaneous mutations in the emergence of pathological genotypes and neutral evolution of proteomes.
Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek
2005-02-01
Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.
Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina
2015-04-01
Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.
Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjuan; Li, Shanqu
2015-01-01
Background Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. Material/Methods In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Results Using the χ2 test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes “CC” of rs2297440 and “GG” of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Conclusions Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population. PMID:26156397
Nandi, Shyam Sundar; Sharma, Deepa Kailash; Deshpande, Jagadish M
2016-07-01
It is important to understand the role of cell surface receptors in susceptibility to infectious diseases. CD155 a member of the immunoglobulin super family, serves as the poliovirus receptor (PVR). Heterozygous (Ala67Thr) polymorphism in CD155 has been suggested as a risk factor for paralytic outcome of poliovirus infection. The present study pertains to the development of a screening test to detect the single nucleotide (SNP) polymorphism in the CD155 gene. New primers were designed for PCR, sequencing and SNP analysis of Exon2 of CD155 gene. DNAs extracted from either whole blood (n=75) or cells from oral cavity (n=75) were used for standardization and validation of the SNP assay. DNA sequencing was used as the gold standard method. A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150) of DNA samples tested by both SNP detection assay and sequencing. The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.
Polymorphism of the renalase gene in gestational diabetes mellitus.
Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna
2017-01-01
Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.
Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L
2016-01-01
Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529
Reciprocal uniparental disomy in yeast.
Andersen, Sabrina L; Petes, Thomas D
2012-06-19
In the diploid cells of most organisms, including humans, each chromosome is usually distinguishable from its partner homolog by multiple single-nucleotide polymorphisms. One common type of genetic alteration observed in tumor cells is uniparental disomy (UPD), in which a pair of homologous chromosomes are derived from a single parent, resulting in loss of heterozygosity for all single-nucleotide polymorphisms while maintaining diploidy. Somatic UPD events are usually explained as reflecting two consecutive nondisjunction events. Here we report a previously undescribed mode of chromosome segregation in Saccharomyces cerevisiae in which one cell division produces daughter cells with reciprocal UPD for the same pair of chromosomes without an aneuploid intermediate. One pair of sister chromatids is segregated into one daughter cell and the other pair is segregated into the other daughter cell, mimicking a meiotic chromosome segregation pattern. We term this process "reciprocal uniparental disomy."
2013-01-01
Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766
CRISPR-STOP: gene silencing through base-editing-induced nonsense mutations.
Kuscu, Cem; Parlak, Mahmut; Tufan, Turan; Yang, Jiekun; Szlachta, Karol; Wei, Xiaolong; Mammadov, Rashad; Adli, Mazhar
2017-07-01
CRISPR-Cas9-induced DNA damage may have deleterious effects at high-copy-number genomic regions. Here, we use CRISPR base editors to knock out genes by changing single nucleotides to create stop codons. We show that the CRISPR-STOP method is an efficient and less deleterious alternative to wild-type Cas9 for gene-knockout studies. Early stop codons can be introduced in ∼17,000 human genes. CRISPR-STOP-mediated targeted screening demonstrates comparable efficiency to WT Cas9, which indicates the suitability of our approach for genome-wide functional screenings.
Jensen, Michael A; Davis, Ronald W
2018-03-27
There is a growing demand for sustainable methods in research and development, where instead of hazardous chemicals, an aqueous medium is chosen to perform biological reactions. In this Perspective, we examine the history and current methodology of using enzymes to generate artificial single-stranded DNA. By using traditional solid-phase phosphoramidite chemistry as a metric, we also explore criteria for the method of template-independent enzymatic oligonucleotide synthesis (TiEOS). As its key component, we delve into the biology of one of the most enigmatic enzymes, terminal deoxynucleotidyl transferase (TdT). As TdT is found to exponentially increase antigen receptor diversity in the vertebrate immune system by adding nucleotides in a template-free manner, researchers have exploited this function as an alternative to the phosphoramidite synthesis method. Though TdT is currently the preferred enzyme for TiEOS, its random nucleotide incorporation presents a barrier in synthesis automation. Taking a closer look at the TiEOS cycle, particularly the coupling step, we find it is comprised of additions > n+1 and deletions. By tapping into the physical and biochemical properties of TdT, we strive to further elucidate its mercurial behavior and offer ways to better optimize TiEOS for production-grade oligonucleotide synthesis.
Integrated sequencing of exome and mRNA of large-sized single cells.
Wang, Lily Yan; Guo, Jiajie; Cao, Wei; Zhang, Meng; He, Jiankui; Li, Zhoufang
2018-01-10
Current approaches of single cell DNA-RNA integrated sequencing are difficult to call SNPs, because a large amount of DNA and RNA is lost during DNA-RNA separation. Here, we performed simultaneous single-cell exome and transcriptome sequencing on individual mouse oocytes. Using microinjection, we kept the nuclei intact to avoid DNA loss, while retaining the cytoplasm inside the cell membrane, to maximize the amount of DNA and RNA captured from the single cell. We then conducted exome-sequencing on the isolated nuclei and mRNA-sequencing on the enucleated cytoplasm. For single oocytes, exome-seq can cover up to 92% of exome region with an average sequencing depth of 10+, while mRNA-sequencing reveals more than 10,000 expressed genes in enucleated cytoplasm, with similar performance for intact oocytes. This approach provides unprecedented opportunities to study DNA-RNA regulation, such as RNA editing at single nucleotide level in oocytes. In future, this method can also be applied to other large cells, including neurons, large dendritic cells and large tumour cells for integrated exome and transcriptome sequencing.
Genomic diversity of the human intestinal parasite Entamoeba histolytica
2012-01-01
Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.
Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A
2018-06-01
Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.
Monsuur, Alienke J; de Bakker, Paul I W; Zhernakova, Alexandra; Pinto, Dalila; Verduijn, Willem; Romanos, Jihane; Auricchio, Renata; Lopez, Ana; van Heel, David A; Crusius, J Bart A; Wijmenga, Cisca
2008-05-28
The HLA genes, located in the MHC region on chromosome 6p21.3, play an important role in many autoimmune disorders, such as celiac disease (CD), type 1 diabetes (T1D), rheumatoid arthritis, multiple sclerosis, psoriasis and others. Known HLA variants that confer risk to CD, for example, include DQA1*05/DQB1*02 (DQ2.5) and DQA1*03/DQB1*0302 (DQ8). To diagnose the majority of CD patients and to study disease susceptibility and progression, typing these strongly associated HLA risk factors is of utmost importance. However, current genotyping methods for HLA risk factors involve many reactions, and are complicated and expensive. We sought a simple experimental approach using tagging SNPs that predict the CD-associated HLA risk factors. Our tagging approach exploits linkage disequilibrium between single nucleotide polymorphism (SNPs) and the CD-associated HLA risk factors DQ2.5 and DQ8 that indicate direct risk, and DQA1*0201/DQB1*0202 (DQ2.2) and DQA1*0505/DQB1*0301 (DQ7) that attribute to the risk of DQ2.5 to CD. To evaluate the predictive power of this approach, we performed an empirical comparison of the predicted DQ types, based on these six tag SNPs, with those executed with current validated laboratory typing methods of the HLA-DQA1 and -DQB1 genes in three large cohorts. The results were validated in three European celiac populations. Using this method, only six SNPs were needed to predict the risk types carried by >95% of CD patients. We determined that for this tagging approach the sensitivity was >0.991, specificity >0.996 and the predictive value >0.948. Our results show that this tag SNP method is very accurate and provides an excellent basis for population screening for CD. This method is broadly applicable in European populations.
The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.
Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang
2018-05-15
Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR: short tandem repeat; TE: trophectoderm; WGA: whole-genome amplification.
Hein, David W.
2009-01-01
Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125
Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija
2012-04-01
Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.
Mycobacterium leprae: genes, pseudogenes and genetic diversity
Singh, Pushpendra; Cole, Stewart T
2011-01-01
Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636
2012-01-01
The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645
Fixed-Gap Tunnel Junction for Reading DNA Nucleotides
2015-01-01
Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505
Recent patents of nanopore DNA sequencing technology: progress and challenges.
Zhou, Jianfeng; Xu, Bingqian
2010-11-01
DNA sequencing techniques witnessed fast development in the last decades, primarily driven by the Human Genome Project. Among the proposed new techniques, Nanopore was considered as a suitable candidate for the single DNA sequencing with ultrahigh speed and very low cost. Several fabrication and modification techniques have been developed to produce robust and well-defined nanopore devices. Many efforts have also been done to apply nanopore to analyze the properties of DNA molecules. By comparing with traditional sequencing techniques, nanopore has demonstrated its distinctive superiorities in main practical issues, such as sample preparation, sequencing speed, cost-effective and read-length. Although challenges still remain, recent researches in improving the capabilities of nanopore have shed a light to achieve its ultimate goal: Sequence individual DNA strand at single nucleotide level. This patent review briefly highlights recent developments and technological achievements for DNA analysis and sequencing at single molecule level, focusing on nanopore based methods.
Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.
Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn
2013-07-01
Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.
Profiling of Sugar Nucleotides.
Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A
2017-01-01
Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.
Gusella, Milena; Bertolaso, Laura; Bolzonella, Caterina; Pasini, Felice; Padrini, Roberto
2011-10-01
Uridine monophosphate synthase (UMPS) is a fundamental enzyme in pyrimidine synthesis. A single-nucleotide polymorphism, a G-C transversion at the 638th nucleotide, was demonstrated to increase UMPS activity and suggested to have clinical effects. The aims of this study were to set up simple genotyping methods and investigate the UMPS 638G>C polymorphism in the Caucasian population. Two hundred forty-one patients with gastrointestinal cancers and 189 healthy subjects were enrolled. Genomic DNA was extracted from peripheral blood. A polymerase chain reaction-restriction fragment length polymorphism (RFLP) method was implemented using a forward primer incorporating a mismatched base to produce an artificial restriction site and BsrI restriction enzyme digestion; a denaturing high performance liquid chromatography (DHPLC) method was developed to further speed up UMPS genotyping. A 153 bp UMPS gene fragment was successfully amplified and analyzed in all samples. RFLP and DHPLC results showed a 100% match and where confirmed by direct sequencing. UMPS genotype distribution was similar in patients with cancer and control subjects. Although no association was detected between UMPS variants and gastrointestinal cancer risk in Caucasians, polymerase chain reaction-RFLP with BsrI digestion and DHPLC set up at 59°C are reliable and cost-effective methods to genotype UMPS.
Best practices for evaluating single nucleotide variant calling methods for microbial genomics
Olson, Nathan D.; Lund, Steven P.; Colman, Rebecca E.; Foster, Jeffrey T.; Sahl, Jason W.; Schupp, James M.; Keim, Paul; Morrow, Jayne B.; Salit, Marc L.; Zook, Justin M.
2015-01-01
Innovations in sequencing technologies have allowed biologists to make incredible advances in understanding biological systems. As experience grows, researchers increasingly recognize that analyzing the wealth of data provided by these new sequencing platforms requires careful attention to detail for robust results. Thus far, much of the scientific Communit’s focus for use in bacterial genomics has been on evaluating genome assembly algorithms and rigorously validating assembly program performance. Missing, however, is a focus on critical evaluation of variant callers for these genomes. Variant calling is essential for comparative genomics as it yields insights into nucleotide-level organismal differences. Variant calling is a multistep process with a host of potential error sources that may lead to incorrect variant calls. Identifying and resolving these incorrect calls is critical for bacterial genomics to advance. The goal of this review is to provide guidance on validating algorithms and pipelines used in variant calling for bacterial genomics. First, we will provide an overview of the variant calling procedures and the potential sources of error associated with the methods. We will then identify appropriate datasets for use in evaluating algorithms and describe statistical methods for evaluating algorithm performance. As variant calling moves from basic research to the applied setting, standardized methods for performance evaluation and reporting are required; it is our hope that this review provides the groundwork for the development of these standards. PMID:26217378
MultiPhyl: a high-throughput phylogenomics webserver using distributed computing
Keane, Thomas M.; Naughton, Thomas J.; McInerney, James O.
2007-01-01
With the number of fully sequenced genomes increasing steadily, there is greater interest in performing large-scale phylogenomic analyses from large numbers of individual gene families. Maximum likelihood (ML) has been shown repeatedly to be one of the most accurate methods for phylogenetic construction. Recently, there have been a number of algorithmic improvements in maximum-likelihood-based tree search methods. However, it can still take a long time to analyse the evolutionary history of many gene families using a single computer. Distributed computing refers to a method of combining the computing power of multiple computers in order to perform some larger overall calculation. In this article, we present the first high-throughput implementation of a distributed phylogenetics platform, MultiPhyl, capable of using the idle computational resources of many heterogeneous non-dedicated machines to form a phylogenetics supercomputer. MultiPhyl allows a user to upload hundreds or thousands of amino acid or nucleotide alignments simultaneously and perform computationally intensive tasks such as model selection, tree searching and bootstrapping of each of the alignments using many desktop machines. The program implements a set of 88 amino acid models and 56 nucleotide maximum likelihood models and a variety of statistical methods for choosing between alternative models. A MultiPhyl webserver is available for public use at: http://www.cs.nuim.ie/distributed/multiphyl.php. PMID:17553837
Short-read, high-throughput sequencing technology for STR genotyping
Bornman, Daniel M.; Hester, Mark E.; Schuetter, Jared M.; Kasoji, Manjula D.; Minard-Smith, Angela; Barden, Curt A.; Nelson, Scott C.; Godbold, Gene D.; Baker, Christine H.; Yang, Boyu; Walther, Jacquelyn E.; Tornes, Ivan E.; Yan, Pearlly S.; Rodriguez, Benjamin; Bundschuh, Ralf; Dickens, Michael L.; Young, Brian A.; Faith, Seth A.
2013-01-01
DNA-based methods for human identification principally rely upon genotyping of short tandem repeat (STR) loci. Electrophoretic-based techniques for variable-length classification of STRs are universally utilized, but are limited in that they have relatively low throughput and do not yield nucleotide sequence information. High-throughput sequencing technology may provide a more powerful instrument for human identification, but is not currently validated for forensic casework. Here, we present a systematic method to perform high-throughput genotyping analysis of the Combined DNA Index System (CODIS) STR loci using short-read (150 bp) massively parallel sequencing technology. Open source reference alignment tools were optimized to evaluate PCR-amplified STR loci using a custom designed STR genome reference. Evaluation of this approach demonstrated that the 13 CODIS STR loci and amelogenin (AMEL) locus could be accurately called from individual and mixture samples. Sensitivity analysis showed that as few as 18,500 reads, aligned to an in silico referenced genome, were required to genotype an individual (>99% confidence) for the CODIS loci. The power of this technology was further demonstrated by identification of variant alleles containing single nucleotide polymorphisms (SNPs) and the development of quantitative measurements (reads) for resolving mixed samples. PMID:25621315
Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici
McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.
2016-01-01
Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie
2015-06-01
Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.
Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina
2007-12-11
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-08-10
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2011-04-12
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2012-04-03
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Bailey, Swneke D; Desai, Kinjal; Kron, Ken J; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A; Treloar, Aislinn E; Dowar, Mark; Thu, Kelsie L; Cescon, David W; Silvester, Jennifer; Yang, S Y Cindy; Wu, Xue; Pezo, Rossanna C; Haibe-Kains, Benjamin; Mak, Tak W; Bedard, Philippe L; Pugh, Trevor J; Sallari, Richard C; Lupien, Mathieu
2016-10-01
Sustained expression of the estrogen receptor-α (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon estrogen stimulation to establish an oncogenic expression program. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers, suggesting that other mechanisms underlie the persistent expression of ESR1. We report significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by rs9383590, a functional inherited single-nucleotide variant (SNV) that accounts for several breast cancer risk-associated loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer.
The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.
Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W
2017-01-01
The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.
He, Fei; Zhou, Wanjun; Cai, Ren; Yan, Tizhen; Xu, Xiangmin
2018-04-01
In this study, we aimed to assess the performance of two whole-genome amplification methods, multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycle (MALBAC), for β-thalassemia genotyping and single-nucleotide polymorphism (SNP)/copy-number variant (CNV) detection using two DNA sequencing assays. We collected peripheral blood, cell lines, and discarded embryos, and carried out MALBAC and MDA on single-cell and five-cell samples. We detected and statistically analyzed differences in the amplification efficiency, positive predictive value, sensitivity, allele dropout (ADO) rate, SNPs, and CV values between the two methods. Through Sanger sequencing at the single-cell and five-cell levels, we showed that both the amplification rate and ADO rate of MDA were better than those using MALBAC, and the sensitivity and positive predictive value obtained from MDA were higher than those from MALBAC for β-thalassemia genotyping. Using next-generation sequencing (NGS) at the single-cell level, we confirmed that MDA has better properties than MALBAC for SNP detection. However, MALBAC was more stable and homogeneous than MDA using low-depth NGS at the single-cell level for CNV detection. We conclude that MALBAC is the better option for CNV detection, while MDA is better suited for SNV detection.
Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi
2004-09-20
Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.
Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Bellato, Cláudia M; Motilal, Lambert; Zhang, Dapeng
2014-01-15
Cacao (Theobroma cacao L.), the source of cocoa, is an economically important tropical crop. One problem with the premium cacao market is contamination with off-types adulterating raw premium material. Accurate determination of the genetic identity of single cacao beans is essential for ensuring cocoa authentication. Using nanofluidic single nucleotide polymorphism (SNP) genotyping with 48 SNP markers, we generated SNP fingerprints for small quantities of DNA extracted from the seed coat of single cacao beans. On the basis of the SNP profiles, we identified an assumed adulterant variety, which was unambiguously distinguished from the authentic beans by multilocus matching. Assignment tests based on both Bayesian clustering analysis and allele frequency clearly separated all 30 authentic samples from the non-authentic samples. Distance-based principle coordinate analysis further supported these results. The nanofluidic SNP protocol, together with forensic statistical tools, is sufficiently robust to establish authentication and to verify gourmet cacao varieties. This method shows significant potential for practical application.
A kernel regression approach to gene-gene interaction detection for case-control studies.
Larson, Nicholas B; Schaid, Daniel J
2013-11-01
Gene-gene interactions are increasingly being addressed as a potentially important contributor to the variability of complex traits. Consequently, attentions have moved beyond single locus analysis of association to more complex genetic models. Although several single-marker approaches toward interaction analysis have been developed, such methods suffer from very high testing dimensionality and do not take advantage of existing information, notably the definition of genes as functional units. Here, we propose a comprehensive family of gene-level score tests for identifying genetic elements of disease risk, in particular pairwise gene-gene interactions. Using kernel machine methods, we devise score-based variance component tests under a generalized linear mixed model framework. We conducted simulations based upon coalescent genetic models to evaluate the performance of our approach under a variety of disease models. These simulations indicate that our methods are generally higher powered than alternative gene-level approaches and at worst competitive with exhaustive SNP-level (where SNP is single-nucleotide polymorphism) analyses. Furthermore, we observe that simulated epistatic effects resulted in significant marginal testing results for the involved genes regardless of whether or not true main effects were present. We detail the benefits of our methods and discuss potential genome-wide analysis strategies for gene-gene interaction analysis in a case-control study design. © 2013 WILEY PERIODICALS, INC.
Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.
2014-01-01
Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945
Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A
2014-01-01
Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.
Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy
2017-03-01
Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Khrustaleva, A M; Gritsenko, O F; Klovach, N V
2013-11-01
The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.
Screening of reproduction-related single-nucleotide variations from MeDIP-seq data in sheep.
Cao, Jiaxue; Wei, Caihong; Zhang, Shuzhen; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Du, Lixin; Zhang, Hongping
2016-11-01
Extensive variation in reproduction has arisen in Chinese Mongolian sheep during recent domestication. Hu and Small-tailed Han sheep, for example, have become non-seasonal breeders and exhibit higher fecundity than Tan and Ujumqin breeds. We therefore scanned reproduction-related single-nucleotide variations from methylated DNA-immunoprecipitation sequencing data generated from each of those four breeds to uncover potential mechanisms underlying this breed variation. We generated a high-quality map of single nucleotide variations (SNVs) in DNA methylation enriched regions, and found that the majority of variants are located within non-coding regions. We identified 359 SNVs within the Sheep Quantitative Trait Locus (QTL) database. Nineteen of these SNVs associated with the Aseasonal Reproduction QTL, and 10 out of the 19 reside close to genes with known reproduction functions. We also identified the well-known FecB mutation in high-fecundity sheep (Hu and Small-tailed Han sheep). When we applied these FecB finding to our breeding system, we improved lambing rate by 175%. In summary, this study provided strong candidate SNVs associated with sheep fecundity that can serve as targets for functional testing and to enhance selective breeding strategies. Mol. Reprod. Dev. 83: 958-967, 2016 © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Allele-specific locus binding and genome editing by CRISPR at the p16INK4a locus.
Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka
2016-07-28
The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes.
Multiple testing and power calculations in genetic association studies.
So, Hon-Cheong; Sham, Pak C
2011-01-01
Modern genetic association studies typically involve multiple single-nucleotide polymorphisms (SNPs) and/or multiple genes. With the development of high-throughput genotyping technologies and the reduction in genotyping cost, investigators can now assay up to a million SNPs for direct or indirect association with disease phenotypes. In addition, some studies involve multiple disease or related phenotypes and use multiple methods of statistical analysis. The combination of multiple genetic loci, multiple phenotypes, and multiple methods of evaluating associations between genotype and phenotype means that modern genetic studies often involve the testing of an enormous number of hypotheses. When multiple hypothesis tests are performed in a study, there is a risk of inflation of the type I error rate (i.e., the chance of falsely claiming an association when there is none). Several methods for multiple-testing correction are in popular use, and they all have strengths and weaknesses. Because no single method is universally adopted or always appropriate, it is important to understand the principles, strengths, and weaknesses of the methods so that they can be applied appropriately in practice. In this article, we review the three principle methods for multiple-testing correction and provide guidance for calculating statistical power.
Apolipoprotein gene involved in lipid metabolism
Rubin, Edward [Berkeley, CA; Pennacchio, Len A [Sebastopol, CA
2007-07-03
Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.
Oligotyping analysis of the human oral microbiome
Eren, A. Murat; Borisy, Gary G.; Huse, Susan M.; Mark Welch, Jessica L.
2014-01-01
The Human Microbiome Project provided a census of bacterial populations in healthy individuals, but an understanding of the biomedical significance of this census has been hindered by limited taxonomic resolution. A high-resolution method termed oligotyping overcomes this limitation by evaluating individual nucleotide positions using Shannon entropy to identify the most information-rich nucleotide positions, which then define oligotypes. We have applied this method to comprehensively analyze the oral microbiome. Using Human Microbiome Project 16S rRNA gene sequence data for the nine sites in the oral cavity, we identified 493 oligotypes from the V1-V3 data and 360 oligotypes from the V3-V5 data. We associated these oligotypes with species-level taxon names by comparison with the Human Oral Microbiome Database. We discovered closely related oligotypes, differing sometimes by as little as a single nucleotide, that showed dramatically different distributions among oral sites and among individuals. We also detected potentially pathogenic taxa in high abundance in individual samples. Numerous oligotypes were preferentially located in plaque, others in keratinized gingiva or buccal mucosa, and some oligotypes were characteristic of habitat groupings such as throat, tonsils, tongue dorsum, hard palate, and saliva. The differing habitat distributions of closely related oligotypes suggest a level of ecological and functional biodiversity not previously recognized. We conclude that the Shannon entropy approach of oligotyping has the capacity to analyze entire microbiomes, discriminate between closely related but distinct taxa and, in combination with habitat analysis, provide deep insight into the microbial communities in health and disease. PMID:24965363
Goodin, Douglas S.; Khankhanian, Pouya
2014-01-01
Background Genome-wide association studies (GWAS) identify disease-associations for single-nucleotide-polymorphisms (SNPs) from scattered genomic-locations. However, SNPs frequently reside on several different SNP-haplotypes, only some of which may be disease-associated. This circumstance lowers the observed odds-ratio for disease-association. Methodology/Principal Findings Here we develop a method to identify the two SNP-haplotypes, which combine to produce each person’s SNP-genotype over specified chromosomal segments. Two multiple sclerosis (MS)-associated genetic regions were modeled; DRB1 (a Class II molecule of the major histocompatibility complex) and MMEL1 (an endopeptidase that degrades both neuropeptides and β-amyloid). For each locus, we considered sets of eleven adjacent SNPs, surrounding the putative disease-associated gene and spanning ∼200 kb of DNA. The SNP-information was converted into an ordered-set of eleven-numbers (subject-vectors) based on whether a person had zero, one, or two copies of particular SNP-variant at each sequential SNP-location. SNP-strings were defined as those ordered-combinations of eleven-numbers (0 or 1), representing a haplotype, two of which combined to form the observed subject-vector. Subject-vectors were resolved using probabilistic methods. In both regions, only a small number of SNP-strings were present. We compared our method to the SHAPEIT-2 phasing-algorithm. When the SNP-information spanning 200 kb was used, SHAPEIT-2 was inaccurate. When the SHAPEIT-2 window was increased to 2,000 kb, the concordance between the two methods, in both of these eleven-SNP regions, was over 99%, suggesting that, in these regions, both methods were quite accurate. Nevertheless, correspondence was not uniformly high over the entire DNA-span but, rather, was characterized by alternating peaks and valleys of concordance. Moreover, in the valleys of poor-correspondence, SHAPEIT-2 was also inconsistent with itself, suggesting that the SNP-string method is more accurate across the entire region. Conclusions/Significance Accurate haplotype identification will enhance the detection of genetic-associations. The SNP-string method provides a simple means to accomplish this and can be extended to cover larger genomic regions, thereby improving a GWAS’s power, even for those published previously. PMID:24727690
Nuotio, Joel; Pitkänen, Niina; Magnussen, Costan G; Buscot, Marie-Jeanne; Venäläinen, Mikko S; Elo, Laura L; Jokinen, Eero; Laitinen, Tomi; Taittonen, Leena; Hutri-Kähönen, Nina; Lyytikäinen, Leo-Pekka; Lehtimäki, Terho; Viikari, Jorma S; Juonala, Markus; Raitakari, Olli T
2017-06-01
Dyslipidemia is a major modifiable risk factor for cardiovascular disease. We examined whether the addition of novel single-nucleotide polymorphisms for blood lipid levels enhances the prediction of adult dyslipidemia in comparison to childhood lipid measures. Two thousand four hundred and twenty-two participants of the Cardiovascular Risk in Young Finns Study who had participated in 2 surveys held during childhood (in 1980 when aged 3-18 years and in 1986) and at least once in a follow-up study in adulthood (2001, 2007, and 2011) were included. We examined whether inclusion of a lipid-specific weighted genetic risk score based on 58 single-nucleotide polymorphisms for low-density lipoprotein cholesterol, 71 single-nucleotide polymorphisms for high-density lipoprotein cholesterol, and 40 single-nucleotide polymorphisms for triglycerides improved the prediction of adult dyslipidemia compared with clinical childhood risk factors. Adjusting for age, sex, body mass index, physical activity, and smoking in childhood, childhood lipid levels, and weighted genetic risk scores were associated with an increased risk of adult dyslipidemia for all lipids. Risk assessment based on 2 childhood lipid measures and the lipid-specific weighted genetic risk scores improved the accuracy of predicting adult dyslipidemia compared with the approach using only childhood lipid measures for low-density lipoprotein cholesterol (area under the receiver-operating characteristic curve 0.806 versus 0.811; P =0.01) and triglycerides (area under the receiver-operating characteristic curve 0.740 versus area under the receiver-operating characteristic curve 0.758; P <0.01). The overall net reclassification improvement and integrated discrimination improvement were significant for all outcomes. The inclusion of weighted genetic risk scores to lipid-screening programs in childhood could modestly improve the identification of those at highest risk of dyslipidemia in adulthood. © 2017 American Heart Association, Inc.
Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S
2017-06-26
Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C
2015-07-01
To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal cytogenetic results. Recommended recurrent pregnancy loss screening was unnecessary in almost half the patients in our study. II.
Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.
Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M
2015-08-01
Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.
Evidence for a Complex Class of Nonadenylated mRNA in Drosophila
Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.
1980-01-01
The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246
Dasgupta, R; Kaesberg, P
1982-01-01
The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941