Sample records for metilentetrahidrofolato reductasa c677t

  1. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis.

    PubMed

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-06-01

    Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT.

  2. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    PubMed Central

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  3. Association between methylenetetrahydrofolate reductase C677T polymorphism and epilepsy susceptibility: a meta-analysis.

    PubMed

    Wu, Yi-Le; Yang, Hui-Yun; Ding, Xiu-Xiu; Zhao, Xue; Chen, Jian; Bi, Peng; Sun, Ye-Huan

    2014-06-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been implicated as a potential risk factor for epilepsy. To date, many case-control studies have investigated the association between MTHFR C677T polymorphism and epilepsy susceptibility. However, those findings were inconsistent. The objective of this study is to evaluate the precise association between MTHFR C677T polymorphism and epilepsy. An electronic search of PubMed, EMBASE for papers on the MTHFR C677T polymorphism and epilepsy susceptibility was performed. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated to assess the association. Ten case-control studies containing 1713 cases and 1867 controls regarding MTHFR C677T polymorphism were selected. A significant association between the MTHFR C677T polymorphism and epilepsy susceptibility was revealed in this meta-analysis (for T vs. C: OR=1.19, 95% CI=1.08-1.32; for TT+CT vs. CC: OR=1.20, 95% CI=1.05-1.38; for TT vs. CC: OR=1.48, 95% CI=1.20-1.83; for TT vs. CT+CC: OR=1.35, 95% CI=1.12-1.64). In subgroup analysis by ethnicity, the results also indicated the association between the MTHFR C677T polymorphism and epilepsy susceptibility within the Asian populations (for T vs. C: OR=1.55, 95% CI=1.15-2.07; for TT+CT vs. CC: OR=1.67, 95% CI=1.08-2.59; for TT vs. CC: OR=2.33, 95% CI=1.30-4.20; for TT vs. CT+CC: OR=1.89, 95% CI=1.12-3.18). The results indicated that MTHFR C677T polymorphism was associated with an increased risk of epilepsy. However, further studies in various regions are needed to confirm the findings from this meta-analysis. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  4. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis

    PubMed Central

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-01-01

    Background: Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Materials and Methods: Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. Results: The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Conclusion: Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT. PMID:24250697

  5. Role of Hyperhomocysteinemia and Methylene Tetrahydrofolate Reductase C677T Polymorphism in Idiopathic Portal Vein Thrombosis

    PubMed Central

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2016-01-01

    Purpose: Portal vein thrombosis (PVT) is a rare and life-threatening vascular disorder characterized by obstruction or narrowing of the portal vein. Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been studied in PVT patients with conflicting results. In the present study the association of hyperhomocysteinemia and MTHFR C677T polymorphism with PVT risk was investigated in Iranians. Materials and Methods: Our study population consisted of 10 idiopathic PVT patients and 80 healthy control subjects matched for age and sex. MTHFR C677T polymorphism was genotyped by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) technique and plasma total homocysteine (tHcy) levels were determined by enzyme immunoassay method. Results: Mean plasma tHcy levels were significantly higher in PVT patients (20.2±6.8) than control subjects (10.9±4.7) (P=0.001). Moreover, plasma tHcy levels were significantly higher in 677T allele carriers relative to 677C allele carriers in both PVT patients (P=0.01) and control subjects (P=0.03). Neither homozygote nor heterozygote genotypes of MTHFR C677T polymorphism correlated significantly with PVT risk (P>0.05). Moreover, MTHFR C677T polymorphism didn’t increase the risk of PVT under dominant (CT+TT vs. CC) or recessive (TT vs. CC+CT) genetic models analyzed (P>0.05). The difference in frequency of minor 677T allele between PVT patients and control subjects was not statistically significant (P>0.05). Conclusion: Based on the current study, we suggest that hyperhomocysteinemia constitutes a significant and common risk factor for PVT. Also, MTHFR C677T polymorphism is not a risk factor for PVT but is a contributing factor for elevated plasma tHcy levels. PMID:27051654

  6. Role of Hyperhomocysteinemia and Methylene Tetrahydrofolate Reductase C677T Polymorphism in Idiopathic Portal Vein Thrombosis.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2016-03-01

    Portal vein thrombosis (PVT) is a rare and life-threatening vascular disorder characterized by obstruction or narrowing of the portal vein. Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been studied in PVT patients with conflicting results. In the present study the association of hyperhomocysteinemia and MTHFR C677T polymorphism with PVT risk was investigated in Iranians. Our study population consisted of 10 idiopathic PVT patients and 80 healthy control subjects matched for age and sex. MTHFR C677T polymorphism was genotyped by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) technique and plasma total homocysteine (tHcy) levels were determined by enzyme immunoassay method. Mean plasma tHcy levels were significantly higher in PVT patients (20.2±6.8) than control subjects (10.9±4.7) (P=0.001). Moreover, plasma tHcy levels were significantly higher in 677T allele carriers relative to 677C allele carriers in both PVT patients (P=0.01) and control subjects (P=0.03). Neither homozygote nor heterozygote genotypes of MTHFR C677T polymorphism correlated significantly with PVT risk (P>0.05). Moreover, MTHFR C677T polymorphism didn't increase the risk of PVT under dominant (CT+TT vs. CC) or recessive (TT vs. CC+CT) genetic models analyzed (P>0.05). The difference in frequency of minor 677T allele between PVT patients and control subjects was not statistically significant (P>0.05). Based on the current study, we suggest that hyperhomocysteinemia constitutes a significant and common risk factor for PVT. Also, MTHFR C677T polymorphism is not a risk factor for PVT but is a contributing factor for elevated plasma tHcy levels.

  7. Methylenetetrahydrofolate reductase C677T polymorphism in patients with lung cancer in a Korean population

    PubMed Central

    2011-01-01

    Background This study was designed to investigate an association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of lung cancer in a Korean population. Methods We conducted a large-scale, case-control study involving 3938 patients with newly diagnosed lung cancer and 1700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. Statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 34.5%, 48.5%, and 17% among lung cancer patients, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677CT and TT genotype showed a weak protection against lung cancer compared with the homozygous CC genotype, although the results did not reach statistical significance. The age- and gender-adjusted odds ratio (OR) of overall lung cancer was 0.90 (95% confidence interval (CI), 0.77-1.04) for MTHFR 677 CT and 0.88 (95% CI, 0.71-1.07) for MTHFR 677TT. However, after stratification analysis by histological type, the MTHFR 677CT genotype showed a significantly decreased risk for squamous cell carcinoma (age- and gender-adjusted OR, 0.78; 95% CI, 0.64-0.96). The combination of 677 TT homozygous with 677 CT heterozygous also appeared to have a protection effect on the risk of squamous cell carcinoma. We observed no significant interaction between the MTHFR C677T polymorphism and age and gender or smoking habit. Conclusions This is the first reported study focusing on the association between MTHFR C677T polymorphisms and the risk of lung cancer in a Korean population. The T allele was found to provide a weak protective association with lung squamous cell carcinoma. PMID:21342495

  8. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy

    PubMed Central

    Yigit, Serbulent; Inanir, Ahmet

    2013-01-01

    Purpose Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. Methylenetetrahydrofolate reductase (MTHFR) gene variants have been associated with vasculopathy that has been linked to diabetic neuropathy. The aim of the present study was to investigate the possible association between MTHFR gene C677T mutation and DPN and evaluate if there is an association with clinical features in a relatively large cohort of Turkish patients. Methods The study included 230 patients affected by DPN and 282 healthy controls. Genomic DNA was isolated and genotyped using the polymerase chain reaction–based restriction fragment length polymorphism assay for the MTHFR gene C677T mutation. Results The genotype and allele frequencies of the C677T mutation showed statistically significant differences between the patients with DPN and the controls (p=0.003 and p=0.002, respectively). After the patients with DPN were stratified according to clinical and demographic characteristics, a significant association was observed between the C677T mutation and history of retinopathy (p=0.039). Conclusions A high association between the MTHFR gene C677T mutation and DPN was observed in the present study. In addition, history of retinopathy was associated with the MTHFR C677T mutation in patients with DPN. PMID:23901246

  9. Coexistence of the 677C>T and 1298A>C MTHFR polymorphisms and its significance in the population of Polish women.

    PubMed

    Wolski, Hubert; Kocięcka, Maria; Mrozikiewicz, Aleksandra E; Barlik, Magdalena; Kurzawińska, Grażyna

    2015-10-01

    The aim of the study was to evaluate the frequency of the 677C>T and 1298A>C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene, as well as the coexistence of both these genetic variants in women from the Polish population. A total of 662 women from the Polish population were enrolled in the study group. The frequency of the investigated genotypes of the 677C>T and 1298A>C polymorphisms of the MTHFR gene was analyzed with the use of PCR/RFLP methods. The frequency of the 677CC, 677CT and 677TT genotypes in the studied population of women was 50.60%, 39.88% and 9.52%, respectively As to the 1298AA, 1298AC and 1298CC genotypes, the obtained results were as follows: 42.75%, 47.88% and 9.37%, respectively (Tables II and III). Simultaneous analysis revealed the most frequent coexistence of 677CC/1298AC (28.85%), 677CT/1298AA (20.85%) and 677CT/1298AC (19.03%) genotypes. The coexistence of 677CC/1298AA (12.39%), 677CC/1298CC (9.37%) and 677TT/1298AA (9.51%) genotypes was observed less frequently In the studied population of Polish women, the coexistence of 677CT/1298CC, 677TT/1298AC and 677TT/1298CC genotypes has been not observed. The frequency and coexistence of genotypes of the 677C>T and 1298A>C MTHFR gene polymorphisms in the studied population of Polish women is similar to other North-European populations. Women carriers of the mutated variants of both, 677C>T and 1298A>C polymorphisms of the MTHFR gene should receive special perinatal care in order to prevent fetal defects and thrombosis-related complications during pregnancy It is vital to emphasize the significance of proper education of folate supplementation, especially in pregnant patients and women of reproductive age.

  10. Association of Methylenetetrahydrofolate Reductase C677T Polymorphism with Hyperhomocysteinemia and Deep Vein Thrombosis in the Iranian Population.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2015-12-01

    Deep venous thrombosis (DVT) is a common but elusive condition characterized by a high morbidity and mortality rate. The aim of the present study was to investigate the correlation between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with plasma total homocysteine (tHcy) levels and DVT risk in an Iranian population. Our study population consisted of 67 patients with a diagnosis of DVT and 67 healthy subjects as controls. Genotyping of MTHFR C677T polymorphism was performed by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) and measurement of tHcy levels was done by enzyme immunoassay method. Plasma tHcy levels were significantly higher in DVT patients than controls (18.09±7.6 vs. 10.5±4.3, P=0.001). Also, plasma tHcy levels were significantly higher in MTHFR 677TT genotypes compared to 677CC genotypes in both DVT patients (P=0.016) and controls (P=0.03). Neither heterozygote nor homozygote genotypes of MTHFR C677T polymorphism was significantly correlated with DVT (P>0.05). The distribution of MTHFR C677T genotypes was similar between men and women in both DVT patients and controls (P>0.05). Moreover, the frequency of mutant 677T allele did not differ significantly between the two groups (28.3% vs. 21.6%, P=0.15). Based on this study, we propose that hyperhomocysteinemia but not homozygosity for MTHFR C677T polymorphism is a significant risk factor for DVT in the Iranian population. Also, MTHFR 677TT genotype is a determinant of elevated plasma tHcy levels.

  11. Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and susceptibility to acute lymphoblastic leukemia in a cohort of Egyptian children.

    PubMed

    Mosaad, Youssef M; Abousamra, Nashwa K; Elashery, Rasha; Fawzy, Iman M; Eldein, Omar A Sharaf; Sherief, Doaa M; El Azab, Hend M M

    2015-01-01

    This case-control study was planned to investigate the possible role of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms as a risk factor for the development of acute lymphoblastic leukemia (ALL) in a cohort of Egyptian children. Typing of MTHFR C677T and A1298C polymorphisms was done using restriction fragment length polymorphism (RFLP) for 100 children with ALL and 100 age- and sex-matched healthy controls. No significant differences were found between patients with ALL and controls for the frequency of MTHFR C677T and A1298C alleles, genotypes, combined genotypes or haplotypes. The C677T and A1298C genotype frequency was different from that in Korean and Chinese populations (p < 0.5) and was similar to that in British, French-Canadian and German-Caucasian populations (p > 0.5). Our findings suggest that MTHFR C677T and A1298C polymorphisms are unlikely to affect the development of childhood ALL in an Egyptian population from Delta.

  12. Association between the methylenetetrahydrofolate reductase c.677C>T polymorphism and bone mineral density: an updated meta-analysis.

    PubMed

    Li, Hong-Zhuo; Wang, Wei; Liu, Yi-Ling; He, Xiao-Feng

    2016-02-01

    Many studies have reported an association between the methylenetetrahydrofolate reductase (MTHFR) c.677C>T polymorphism and reduced bone mineral density (BMD), but results have been inconsistent. We, therefore, performed a meta-analysis to further explore this association. Twenty-one studies, comprising 33,045 subjects, analyzed the association of MTHFR c.677C>T with femoral neck BMD. Significant association with reduced BMD was observed in Caucasians (recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.008 to -0.006), post-menopausal women (recessive model: WMD = -0.005 g/cm(2), 95 % CI -0.007 to -0.003), men (dominant model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; TT vs. CC: WMD = -0.006 g/cm(2), 95 % CI -0.006 to -0.006; CT vs. CC: WMD = -0.003 g/cm(2), 95 % CI -0.003 to -0.003), and cohort studies (recessive model: WMD = -0.003 g/cm(2), 95 % CI -0.006 to -0.001). Twenty-two studies, which included 32,271 subjects, analyzed the MTHFR c.677C>T association with lumbar spine BMD. Significant association with reduced BMD was observed in Caucasians, women, post-menopausal women, men, and cohort studies. Seven studies, comprising 6806 subjects, analyzed the MTHFR c.677C>T association with total hip BMD, but no significant association was observed in any population. Nine studies involving 5591 subjects analyzed the association with total body BMD. Significant association with reduced BMD was observed in overall and women subgroup analyses. In summary, this meta-analysis indicates that the MTHFR c.677C>T polymorphism is associated with reduced BMD in lumbar spine and femoral neck in Caucasians, post-menopausal women, and men, and with total body BMD in women. In addition, our results suggest that new studies examining the association between MTHFR c.677C>T polymorphism and BMD of lumbar spine and femoral neck in Asians is warranted, because I (2) > 75.0 % was observed.

  13. Spectrum of MTHFR gene SNPs C677T and A1298C: a study among 23 population groups of India.

    PubMed

    Saraswathy, Kallur Nava; Asghar, Mohammad; Samtani, Ratika; Murry, Benrithung; Mondal, Prakash Ranjan; Ghosh, Pradeep Kumar; Sachdeva, Mohinder Pal

    2012-04-01

    Elevated homocysteine is a risk factor for many complex disorders. The role of methylenetetrahydrofolate reductase (MTHFR) gene in methylation of homocysteine makes it one of the most important candidate genes for these disorders. Considering the heterogeneity in its distribution in world populations, we screened MTHFR C677T and A1298C single nucleotide polymorphisms in a total of 23 Indian caste, tribal and religious population groups from five geographical regions of India and belonging to four major linguistic groups. The frequencies of MTHFR 677T and 1298C alleles were found to be 10.08 and 20.66%, respectively. MTHFR homozygous genotype 677TT was absent in eight population groups and homozygous 1298CC was absent in two population groups. 677T allele was found to be highest among north Indian populations with Indo-European tongue and 1298C was high among Dravidian-speaking tribes of east India and south India. The less common mutant haplotype 677T-1298C was observed among seven population groups and overall the frequency of this haplotype was 0.008, which is similar to that of African populations. cis configuration of 677T and 1298C was 0.94%. However, we could not find any individual with four mutant alleles which supports the earlier observation that presence of more than two mutant alleles may decrease the viability of foetus and possibly be a selective disadvantage in the population.

  14. Association between MTHFR C677T polymorphism and abdominal aortic aneurysm risk

    PubMed Central

    Liu, Jie; Jia, Xin; Li, Haifeng; Jia, Senhao; Zhang, Minhong; Xu, Yongle; Du, Xin; Zhang, Nianrong; Lu, Weihang; Guo, Wei

    2016-01-01

    Abstract Background: Abdominal aortic aneurysm (AAA) is a life-threatening condition. A number of studies reported the association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and AAA risk, but substantial controversial findings were observed and the strength of the association remains unclear. Objective: The aim of this study was to investigate the aforementioned association in the overall population and different subgroups. Methods: PUBMED and EMBASE databases were searched until March 2016 to identify eligible studies, restricted to humans and articles published in English. Summary odds ratios (ORs) and 95% confidence intervals (CIs) were used to evaluate the susceptibility to AAA. Subgroup meta-analyses were conducted on features of the population, such as ethnicity, sex of the participants, and study design (source of control). Results: Twelve case–control studies on MTHFR C677T polymorphism and AAA risk, including 3555 cases and 6568 case-free controls were identified. The results revealed no significant association between the MTHFR C677T polymorphism and AAA risk in the overall population and within Caucasian or Asian subpopulations in all 5 genetic models. Further subgroup meta-analysis indicated that significantly increased risks were observed among cases with a mean age <70 years (OR = 1.73, 95% CI = 1.10–2.12, P = 0.02), cases with prevalence of smoking <60% (OR = 1.39, 95% CI = 1.02–1.90, P = 0.04), and cases with aneurysm diameter ≥55 mm (OR = 1.55, 95% CI = 1.07–2.24, P = 0.02) in the dominant genetic model. No publication bias was detected in the present study. Conclusion: In conclusion, our comprehensive meta-analysis suggests that the MTHFR C677T polymorphism may play an important role in AAA susceptibility, especially in younger, non-smoking, larger AAA-diameter subgroups of patients PMID:27603386

  15. MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt.

    PubMed

    Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR=2.513, 95% CI: 0.722-4.086, P=0.025). No such association was shown for heterozygous 677CT (OR=1.010, 95% CI: 0.460-2.218, P=0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR=1.1816, 95% CI: 0.952-3.573, P=0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR=1.046, 95% CI: 0.740-1.759, P=0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR=1.849, 95% CI: 0.935-2.540, P=0.024; OR=1.915, 95% CI: 1.202-3.845, P=0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P=0.001, P=0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy.

  16. MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt

    PubMed Central

    Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR = 2.513, 95% CI: 0.722-4.086, P = 0.025). No such association was shown for heterozygous 677CT (OR = 1.010, 95% CI: 0.460-2.218, P = 0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR = 1.1816, 95% CI: 0.952-3.573, P = 0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR = 1.046, 95% CI: 0.740-1.759, P = 0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR = 1.849, 95% CI: 0.935-2.540, P = 0.024; OR = 1.915, 95% CI: 1.202-3.845, P = 0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P = 0.001, P = 0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy. PMID:24966971

  17. C677T polymorphism in the methylenetetrahydrofolate reductase gene is associated with primary closed angle glaucoma

    PubMed Central

    Michael, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Wajid Ali

    2008-01-01

    Purpose To determine whether or not there is an association of the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with disease in cohorts of primary open-angle glaucoma (POAG) and primary closed-angle glaucoma (PCAG) from Pakistan. Methods This was a prospective study consisting of 150 patients (90 POAG and 60 PCAG) and 70 control subjects. Genomic DNA was extracted from leukocytes of the peripheral blood. MTHFR C677T polymorphism analysis was performed by the polymerase chain reaction-restriction fragment length polymorphism (RFLP) technique. Results The prevalence of the MTHFR C/T genotype was 22.2% in POAG, 13.3% in PACG, and 18.6% in controls whereas the MTHFR T/T genotype was present solely in the PACG group (6.9%). The difference regarding the T/T genotype between PACG and controls was statistically significant (p<0.01). Conclusions The MTHFR C677T polymorphism was found to be associated with PCAG but not POAG in patients of Pakistani origin. PMID:18385801

  18. Methylenetetrahydrofolate Reductase (MTHFR) C677T Polymorphism and Alzheimer Disease Risk: a Meta-Analysis.

    PubMed

    Rai, Vandana

    2017-03-01

    Methylenetetrahydrofolate reductase (MTHFR) is key enzyme of folate/homocysteine pathway. Case control association studies on MTHFR C677T polymorphism and Alzheimer's disease (AD) have been repeatedly performed over the last two decades, but the results are inconclusive. The aim of the present study was to assess the risk of MTHFR C677T polymorphism for AD. Forty-one studies were identified by a search of PubMed, Google Scholar, Elsevier, and Springer Link databases, up to January 2015. Odds ratios (ORs) with corresponding 95 % confidence interval (CI) were calculated using fixed effect model or random effect model. The subgroup analyses based on ethnicity were performed. MTHFR C677T polymorphism had a significant association with susceptibility to AD in all genetic models (for T vs C OR = 1.29, 95 % CI = 1.07-1.56, p = 0.003; for TT + CT vs CC OR = 1.29, 95 % CI = 1.19-1.40, p = 0.0004; for TT vs CC OR = 1.31, 95 % CI = 1.16-1.48, p = 0.001; for CT vs CC OR = 1.24, 95 % CI = 1.13-1.35, p < 0.004; and for TT vs CT + CC OR = 1.13, 95 % CI = 1.00-1.28, p = 0.02). Results of present meta-analysis supported that the MTHFR C677T polymorphism was associated with an increased risk of AD.

  19. Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric and colorectal cancer in a Korean population

    PubMed Central

    2010-01-01

    Background This study was designed to investigate an association between the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of gastric and colorectal cancer in the Korean population. Methods We conducted a population-based large-scale case-control study involving 2,213 patients with newly diagnosed gastric cancer, 1,829 patients with newly diagnosed colorectal cancer, and 1,700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. The statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 35.2%, 47.5%, and 17.3% among stomach cancer, 34%, 50.5%, and 15.5% in colorectal cancer, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677TT genotype showed a weak opposite association with colorectal cancer compared to the homozygous CC genotype [adjusted age and sex odds ratio (OR) = 0.792, 95% confidence interval (CI) = 0.638-0.984, P = 0.035]. Subjects with the MTHFR 677CT showed a significantly reduced risk of gastric cancer compared whose with the 677CC genotype (age- and sex-adjusted OR = 0.810; 95% CI = 0.696-0.942, P = 0.006). We also observed no significant interactions between the MTHFR C677T polymorphism and smoking or drinking in the risk of gastric and colorectal cancer. Conclusions The T allele was found to provide a weak protective association with gastric cancer and colorectal cancer. PMID:20504332

  20. The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children

    PubMed Central

    Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S.; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

    2017-01-01

    Abstract The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry. The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes. The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes. The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. PMID:29390492

  1. Association study of methylenetetrahydrofolate reductase C677T mutation with cerebral venous thrombosis in an Iranian population.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad S

    2015-12-01

    There are limited data on the role of methylenetetrahydrofolate reductase C677T polymorphism and hyperhomocysteinemia as risk factors for cerebral venous thrombosis in Iranian population. We examined a possible association between fasting plasma homocysteine levels, methylenetetrahydrofolate reductase C677T polymorphism, and cerebral venous thrombosis in 50 patients with a diagnosis of cerebral venous thrombosis (20-63 years old) and 75 healthy controls (18-65 years old). Genotyping of the methylenetetrahydrofolate reductase C677T gene polymorphism was performed by PCR-restriction fragment length polymorphism analysis, and homocysteine levels were measured by enzyme immunoassay. Fasting plasma homocysteine levels were significantly higher in cerebral venous thrombosis patients than in controls (P = 0.015). Moreover, plasma homocysteine levels were significantly higher in methylenetetrahydrofolate reductase 677TT genotype compared to 677CT and 677CC genotypes in both cerebral venous thrombosis patients (P = 0.01) and controls (P = 0.03). Neither 677CT heterozygote genotype [odds ratio (OR) 1.35, 95% confidence interval (CI) 0.64-2.84, P = 0.556] nor 677TT homozygote genotype (OR 1.73, 95% CI 0.32-9.21, P = 0.833) was significantly associated with cerebral venous thrombosis. Additionally, no significant differences in the frequency of 677T allele between cerebral venous thrombosis patients and controls were identified (OR 1.31, 95% CI 0.69-2.50, P = 0.512). In conclusion, our study demonstrated that elevated plasma homocysteine levels are significant risk factors for cerebral venous thrombosis. Also, methylenetetrahydrofolate reductase 677TT genotype is not linked with cerebral venous thrombosis, but is a determinant of elevated plasma homocysteine levels.

  2. Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and the risk of primary Hepatocellular Carcinoma (HCC) in a Chinese population

    PubMed Central

    Cao, Wei; Zhang, Zuo-Feng; Cai, Lin; Jiang, Qing-Wu; You, Nai-Chieh; Goldstein, Binh Yang; Wei, Guo-Rong; Chen, Chuan-Wei; Lu, Qing-Yi; Zhou, Xue-Fu; Ding, Bao-Guo; Chang, Jun; Yu, Shun-Zhang

    2014-01-01

    Objectives Methylenetetrahydrofolate reductase (MTHFR), which is expressed in the liver, may be involved in both DNA methylation and DNA synthesis. It is also indicated as a potential risk factor of liver cancer in patients with chronic liver disease. To date, no study has been conducted on MTHFR and hepatocellular carcinoma (HCC) using a population-based design. The objective of this study was to evaluate the effects of polymorphisms of the MTHFR gene on the risk of primary liver cancer and their possible effect modifications on various environmental risk factors. Methods A population-based case–control study was conducted in Taixing, China. MTHFR C677T and A1298C were assayed by PCR-RFLP techniques. Results The frequency of MTHFR 677 C/C wild homo-zygotes genotype was 25.8% in cases, which was lower than that in controls (34.5%). The adjusted odds ratios (ORs) for the MTHFR 677 C/T and T/T genotype were 1.66(95% CI: 1.06–2.61), 1.21(95% CI: 0.65–2.28) respectively when compared with the MTHFR 677 C/C genotype. Subjects carrying any T genotype have the increased risk of 1.55(95% CI: 1.01–2.40) for development of primary hepatocellular carcinoma. A high degree of linkage disequilibrium was observed between the C677T and A1298C polymorphisms, with the D′ of 0.887 and p < 0.01. The MTHFR 677 any T genotype was suggested to have potentially more than multiplicative interactions with raw water drinking with p-value for adjusted interaction of 0.03. Conclusion We observed that the MTHFR 677 C/T genotype was associated with an increased risk of primary liver cancer in a Chinese population. The polymorphism of MTHFR 677 might modify the effects of raw water drinking on the risk of primary hepatocellular carcinoma. PMID:17503006

  3. The methylenetetrahydrofolate reductase (MTHFR) 677 C>T polymorphism increases the risk of developing chronic myeloid leukemia-a case-control study.

    PubMed

    Bănescu, Claudia; Iancu, Mihaela; Trifa, Adrian P; Macarie, Ioan; Dima, Delia; Dobreanu, Minodora

    2015-04-01

    The methylenetetrahydrofolate reductase (MTHFR) 677 C>T and 1298 A>C polymorphisms are associated with variations in folate levels, a phenomenon linked to the development of various malignancies. The aim of this study was to investigate the influence of the 677 C>T and 1298 A>C polymorphisms in the MTHFR gene on the risk of developing chronic myeloid leukemia (CML). Our study included 151 patients with CML and 305 controls. The MTHFR 677 C>T and 1298 A>C polymorphisms were investigated by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and allele-specific PCR techniques. The CT and TT genotypes of the MTHFR 677 C>T polymorphism were associated with an increased risk of developing CML (odds ratio (OR) = 1.556, 95% confidence interval (CI) = 1.017-2.381, p value = 0.041, and OR = 1.897, 95% CI = 1.046-3.44, p value = 0.035, respectively). No association was observed between the prognostic factors (blasts, basophils, additional chromosomal abnormalities, EUTOS score, Sokal and Hasford risk groups) and the MTHFR 677 C>T and 1298 A>C variant genotypes in CML patients. Our study shows that the MTHFR 677 C>T polymorphism is significantly associated with the risk of CML in Romanian patients.

  4. Methylenetetrahydrofolate Reductase Gene Polymorphism (C677T) as a Risk Factor for Arterial Thrombosis in Georgian Patients.

    PubMed

    Garakanidze, Sopio; Costa, Elísio; Bronze-Rocha, Elsa; Santos-Silva, Alice; Nikolaishvili, Giorgi; Nakashidze, Irina; Kakauridze, Nona; Glonti, Salome; Khukhunaishvili, Rusudan; Koridze, Marina; Ahmad, Sarfraz

    2018-01-01

    Methylenetetrahydrofolate reductase ( MTHFR) gene polymorphism (C677T)] is a well-recognized genetic risk factor for venous thrombosis; however, its association with arterial thrombosis is still under debate. Herein, we evaluated the prevalence of MTHFR C677T polymorphism in Georgian patients in comparison with healthy individuals and its association with arterial thrombosis. We enrolled 214 participants: 101 with arterial thrombosis (71.3% males; mean age: 66.3 ± 12.1 years) and 113 controls (67.3% males; mean age: 56.6 ± 11.3 years). Genomic DNA was extracted from dry blood spot on Whatman filter paper. Polymerase chain reaction was performed to determine MTHFR C677T polymorphism. Frequency of C677T allele polymorphism in controls was 21.2%, which corresponded to heterozygous and homozygous stage frequencies of 35.4% and 3.5%, respectively. In patient group, an allelic frequency of 33.2% was found, which corresponded to the presence of 48.5% of heterozygous and 8.9% of homozygous individuals. Comparing the frequency of mutated alleles between the 2 groups, a significantly high frequency of mutated alleles was found in patient group ( P < .05). In conclusion, high frequency of MTHFR C677T polymorphism found in arterial thrombosis patient group suggests that this polymorphism might increase the risk of arterial thrombosis in Georgian patients.

  5. Association between MTHFR C677T polymorphism and depression: a meta-analysis in the Chinese population.

    PubMed

    Jiang, Wei; Xu, Jun; Lu, Xiao-Jie; Sun, Yang

    2016-09-01

    Depression is a worldwide public health issue, and its prevalence increases each year. Although a number of studies have been conducted on the association between MTHFR C677T polymorphism and depression in China, this association remains elusive and controversial. To clarify the impact of MTHFR C677T polymorphism on the risk of depression, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure and Chinese Biology Medicine through May 5, 2015. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the associations. A total of 13 case-control studies including 1895 patients and 1913 controls were involved in this meta-analysis. Overall, T variant of MTHFR C677T gene polymorphism was significantly associated with an increased risk of depression in the Chinese population (T vs. C: OR = 1.52, 95% CI = 1.24-1.85; TT + CT vs. CC: OR = 1.64, 95% CI = 1.16-2.30; TT vs. CC: OR = 2.19, 95% CI = 1.49-3.24; TT vs. CC + CT: OR = 1.80, 95% CI = 1.31-2.46). In subgroup analyses stratified by geographic area and source of controls, the significant results were found in population-based studies, in hospital-based studies, in North and South China. The risk conferred by MTHFR C677T polymorphism is higher in North China than in South China. In conclusion, this meta-analysis suggests that MTHFR C677T polymorphism is associated with depression in the Chinese population, but these associations vary in different geographic locations.

  6. The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children.

    PubMed

    Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

    2017-12-01

    The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry.The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes.The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes.The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  7. Methylenetetrahydrofolate reductase C677T and overall survival in pediatric acute lymphoblastic leukemia: a systematic review.

    PubMed

    Ojha, Rohit P; Gurney, James G

    2014-01-01

    A summary of the evidence pertaining to the association between methylenetetrahydrofolate reductase (MTHFR) C677T and overall survival in pediatric acute lymphoblastic leukemia (ALL) is not currently available. We thus reviewed the literature on the association between MTFHR C677T and overall survival in pediatric ALL. We searched PubMed/MEDLINE, Scopus and ISI Web of Knowledge literature databases without language restrictions to identify observational studies among children diagnosed between ages 0 and 19 years that assessed MTHFR 677 polymorphisms in relation to ALL survival. We identified six studies comprising 909 pediatric patients with ALL. The magnitude of relative risk (RR) for pediatric ALL mortality varied by genotype comparison and study population, ranging from RR = 0.84 (95% confidence limits [CL]: 0.24, 3.0) for a TT vs. CT/CC comparison to RR = 7.0 (95% CL: 0.98, 49) for a TT vs. CC comparison. The current evidence suggests that individuals with MTHFR 677 variants (i.e. at least one T allele) may have a higher relative risk of pediatric ALL mortality, with greater statistical support for MTHFR 677TT. With more detailed supporting evidence, MTHFR 677 genotyping at diagnosis could provide an option for individualizing therapy and further reducing pediatric ALL mortality in certain populations.

  8. MTHFR polymorphisms C677T and A1298C and associations with IVF outcomes in Brazilian women.

    PubMed

    D'Elia, Priscila Queiroz; dos Santos, Aline Amaro; Bianco, Bianca; Barbosa, Caio Parente; Christofolini, Denise Maria; Aoki, Tsutomu

    2014-06-01

    The aim of this study was to investigate the association between MTHFR gene polymorphisms and IVF outcomes in Brazilian women undergoing assisted reproduction treatment. A prospective study was conducted in the Human Reproduction Department at the ABC University School of Medicine and the Ideia Fertility Institute between December 2010 and April 2012. The patient population was 82 women undergoing assisted reproduction cycles. The MTHFR polymorphisms C677T and A1298C were evaluated and compared with laboratory results and pregnancy rates. The C677T variant was associated with proportions of mature (P=0.006) and immature (P=0.003) oocytes whereas the A1298C variant was associated with number of oocytes retrieved (P=0.044). The polymorphisms, whether alone or in combination, were not associated with normal fertilization, good-quality embryo or clinical pregnancy rates. This study suggests that the number and maturity of oocytes retrieved may be related to the MTHFR polymorphisms C677T and A1298C. It is believed that folate has a crucial function in human reproduction and that folate deficiency can compromise the function of the metabolic pathways it is involved in, leading to an accumulation of homocysteine. The gene MTHFR encodes the 5-MTHFR enzyme, which is involved in folate metabolism, and C677T/A1298C polymorphisms of this gene are related to decreased enzyme activity and consequent changes in homocysteine concentration. Folate deficiency and hyperhomocysteinaemia can also compromise fertility and lead to pregnancy complications by affecting the development of oocytes, preparation of endometrial receptivity, implantation of the embryo and pregnancy. In folliculogenesis, hyperhomocysteinaemia can activate apoptosis, leading to follicular atresia and affecting the maturity of oocytes and the quality of embryos cultured in vitro. This study was performed to investigate the association between MTHFR polymorphisms and IVF outcomes in women undergoing assisted

  9. Interaction between MTHFR 677C>T and periconceptional folic acid supplementation in the risk of Hypospadias.

    PubMed

    Dokter, Elisabeth M J; van Rooij, Iris A L M; Wijers, Charlotte H W; Groothuismink, Johanne M; van der Biezen, Jan Jaap; Feitz, Wout F J; Roeleveld, Nel; van der Zanden, Loes F M

    2016-04-01

    Hypospadias is a congenital malformation with both environmental factors and genetic predisposition involved in the pathogenesis. The role of maternal periconceptional folic acid supplement use in the development of hypospadias is unclear. As folate levels may also be influenced by the C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, we hypothesize that a gene-environment interaction between this polymorphism and folic acid use is involved in the etiology of hypospadias. We conducted a case-control study among 855 hypospadias cases and 713 population-based controls from the AGORA data- and biobank. Folic acid supplement use was derived from maternal questionnaires and infant and maternal DNA was used to determine the MTHFR C677T polymorphism using Taqman assays. We performed separate analyses for different hypospadias phenotypes (anterior/middle/posterior). Hypospadias was neither associated with folic acid use or the MTHFR C677T polymorphism, nor with their interaction. However, we did find an association with middle hypospadias when no supplements were used (odds ratio = 1.6; 95% confidence interval, 1.1-2.4), especially in infants carrying the CT/TT genotype (odds ratio = 2.5; 95% confidence interval, 1.4-4.7). In addition, more infants with these genotypes seemed to have posterior hypospadias, regardless of folic acid use. Our study does not suggest a major role for folic acid supplements or the MTHFR C677T polymorphism in the etiology of hypospadias in general, but not using folic acid and/or carrying the MTHFR C677T polymorphism may be associated with middle and posterior hypospadias. Therefore, we stress the importance of studying gene-environment interactions preferably in stratified analyses for different hypospadias phenotypes. © 2016 Wiley Periodicals, Inc.

  10. Methylenetetrahydrofolate reductase C677T genetic polymorphisms and risk of leukaemia among the North Indian population.

    PubMed

    Hussain, Syed Rizwan; Naqvi, Hena; Raza, Syed Tasleem; Ahmed, Faisal; Babu, Sunil G; Kumar, Ashutosh; Zaidi, Zeashan Haider; Mahdi, Farzana

    2012-08-01

    Leukaemia is a heterogeneous disease in which haematopoietic progenitor cells acquire genetic lesions that lead to a block in differentiation, increased self-renewal, and unregulated proliferation. The enzyme 5,10-methylenetetrahydrofolate reductase (MTHFR), involved in folate metabolism, plays a crucial role in cells because folate availability is important for DNA integrity. The aim of this case-control study was to evaluate the association of the C677T MTHFR gene polymorphism with acute myeloid leukaemia (AML), acute lymphoblastic leukaemia (ALL), chronic myeloid leukaemia (CML) and chronic lymphocytic leukaemia (CLL). A total of 275 leukaemia cases - including AML (n = 112), ALL (n = 81), CML (n = 43), CLL (n = 39) - and 251 age/sex-matched healthy control individuals participated in this study. MTHFR C677T polymorphisms in the cases and controls were evaluated by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The average MTHFR 677CC, 677CT, 677TT genotype frequencies of total leukaemia cases were 68.73%, 19.64%, and 11.64% in cases, and 71.71%, 24.30%, and 3.98% in healthy controls, respectively. The average frequency of the MTHFR 677T allele was 21.45% among the cases compared to 16.13% among the controls. In the present case-control study we have observed a higher frequency of the MTHFR 677TT genotype in cases of leukaemia (AML, ALL, CML and CLL) as compared with controls; this might be due to ethnic and geographic variation. As per our findings, although the frequency of the MTHFR 677T allele is moderately high in AML, ALL and CLL, no statistically significant association was found; on the other hand statistically significant association was found in the context of CML cases. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Association between C677T and A1298C polymorphisms of the MTHFR gene and risk of male infertility: a meta-analysis.

    PubMed

    Yang, Y; Luo, Y Y; Wu, S; Tang, Y D; Rao, X D; Xiong, L; Tan, M; Deng, M Z; Liu, H

    2016-04-26

    Published studies on the association between the C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene and male infertility risk are controversial. To obtain a more precise evaluation, we performed a meta-analysis based on published case-control studies. We conducted an electronic search of PubMed, EMBASE, the Cochrane Library, the Web of Science, and the China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and male infertility risk. Pooled odds ratios (ORs) with 95% confidence intervals (95%CIs) were used to assess the strength of association in homozygote, heterozygote, dominant, recessive, and additive models. Statistical heterogeneity, test of publication bias, and sensitivity analysis were carried out using the STATA software (Version 13.0). Overall, 21 studies of C677T (4505 cases and 4024 controls) and 13 studies of A1298C (2785 cases and 3094 controls) were included in this meta-analysis. For C677T, the homozygote comparison results were OR = 1.629, 95%CI (1.215- 2.184), and the recessive model results were OR = 1.462 (1.155- 1.850). For A1298C, the homozygote comparison results were OR = 1.289 (1.029-1.616), and the recessive model results were OR = 1.288 (1.034-1.604). In conclusion, the current meta-analysis showed that the MTHFR C677T polymorphism was associated with a significantly increased male infertility risk in the Asian and overall populations, but not in the Caucasian population, and there was a significant association between the A1298C polymorphism and male infertility risk in the Asian, Caucasian, and overall groups.

  12. Association of the 5,10-methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) polymorphisms in Korean patients with adult acute lymphoblastic leukemia.

    PubMed

    Oh, Doyeun; Kim, Nam Keun; Jang, Moon Ju; Kim, Hugh Chul; Lee, Jae Hoon; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Kim, Heung Sik; Park, Seonyang; Chio, Hyun Sook; Min, Yoo Hong

    2007-01-01

    Methylenetetrahydrofolate reductase (MTHFR) plays a central role in converting folate to methyl donor for DNA methylation. Because MTHFR is a key enzyme in folate metabolism, changes in its activity resulting from polymorphisms in the MTHFR gene could modify the susceptibility to cancer. Recently, the C677T and A1298C mutations of MTHFR were discovered to be associated with susceptibility in acute lymphoblastic leukemia (ALL). The association between MTHFR polymorphisms and susceptibility and clinical outcome in ALL was studied in 118 adult ALL patients and matched healthy controls (n =427). DNA samples taken from patients with ALL and controls were analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays to detect the MTHFR C677T and A1298C mutations. No significant difference was found in the development of adult ALL among those with different MTHFR genotypes of the C677T or A1298C polymorphisms. However, the MTHFR 677CT+TT genotype showed a tendency to be associated with adult ALL [crude odds ratio (OR), 0.67; 95% confidence interval (CI), 0.44-1.02; adjusted OR, 0.74 95% CI, 0.47-1.14]. The MTHFR C677T and A1298C polymorphisms are not significant risk factors in adult acute leukemia in the Korean population.

  13. Association of Methylenetetrahydrofolate Reductase (MTHFR 677C>T and 1298A>C) Polymorphisms and Haplotypes with Silent Brain Infarction and Homocysteine Levels in a Korean Population

    PubMed Central

    Han, In Bo; Kim, Ok Joon; Ahn, Jung Yong; Oh, Doyeun; Hong, Sun Pyo; Huh, Ryoong; Chung, Sang Sup

    2010-01-01

    Purpose Methylenetetrahydrofolate reductase (MTHFR) is the main regulatory enzyme for homocysteine metabolism. In the present study, we evaluated whether the MTHFR 677C>T and 1298A>C gene polymorphisms are associated with SBI and plasma homocysteine concentration in a Korean population. Materials and Methods We enrolled 264 patients with SBI and 234 healthy controls in South Korea. Fasting plasma total homocysteine (tHcy) concentrations were measured, and genotype analysis of the MTHFR gene was carried out. Results The plasma tHcy levels were significantly higher in patients with SBI than in healthy controls. Despite a significant association between the MTHFR 677TT genotype and hyperhomocysteinemia, the MTHFR 677C>T genotypes did not appear to influence susceptibility to SBI. However, odds ratios of the 1298AC and 1298AC + CC genotypes for the 1298AA genotype were significantly different between SBI patients and normal controls. The frequencies of 677C-1298A and 677C-1298C haplotypes were significantly higher in the SBI group than in the control group. Conclusion This study demonstrates that the MTHFR 1298A>C polymorphism is a risk factor for SBI in a Korean population. The genotypes of 677C>T and 1298A>C polymorphisms interact additively, and increase the risk of SBI in Korean subjects. PMID:20191019

  14. Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

    PubMed

    Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

    2012-07-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

  15. The association between methylenetetrahydrofolate reductase C677 > T polymorphisms and risk of pediatric acute lymphoblastic leukemia in Asia.

    PubMed

    Lin, Shiguang; Liu, Qin; Zeng, Xiaoming

    2014-11-01

    The association between methylenetetrahydrofolate reductase (MTHFR) C677 > T polymorphisms and pediatric acute lymphoblastic leukemia (ALL) risk in Asia is controversial. The aim of this meta-analysis was to further assess the relationship between MTHFR C677 > T polymorphisms and pediatric ALL for Chinese children. Studies about the MTHFR C677 > T polymorphisms and pediatric ALL risk were searched in the Medline, PubMed, EMBASE, Wanfang and CNIK databases. The genotype of the case and control group were extracted and pooled by meta-analysis. The association between ALL risk and C677 > T polymorphisms was demonstrated by odds ratio (OR) and its 95% confidence interval (CI). Twelve articles were included in this study with 1803 ALL cases and 4146 controls. In recessive genetic model (TT vs. CC + CT), the OR was 0.37 (95%CI: 0.31-0.43); in dominant genetic model (TT + CT vs. CC) the OR was 0.94 (95%CI: 0.82-1.06); and in the homozygous model the OR was 0.84 (95%CI: 0.69-1.03). The results indicated that Asian children with TT genotype of MTHFR gene may have less risk of developing ALL.

  16. [Study on the association between 5,10-methylenetrahydrofolate reductase C677T polymorphism and acute lymphoblastic leukemia risk: a Meta-analysis].

    PubMed

    Li, Xiao-lei; Yu, Feng; Zhang, Yong; Qiu, Jin-chun; Liu, Si-ting; Liao, Qing-chuan

    2011-10-01

    To evaluate the association between polymorphism of 5,10-methylenetrahydrofolate reductase C677T and risk of acute lymphoblastic leukemia (ALL). Electronic search strategy was carried out among the databases from home and abroad to collect qualified research papers, according to the inclusion and exclusion criteria. Data on case-control studies on association between MTHFR C677T polymorphism and susceptibility to ALL were collected and analyzed by models of TT vs. CC + CT or TT vs. CC through Meta-analysis. Stratified analysis was carried out according to different age groups (children or adult). In systematical analysis, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.87 (0.69 - 1.09) and 0.82 (0.63 - 1.06) respectively; in children's group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.92 (0.79 - 1.08), 0.88 (0.75 - 1.05) while in adult group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.45 (0.26 - 0.77), and 0.41 (0.22 - 0.72) respectively. The MTHFR gene 677T variant might not be associated with the risk of children's ALL but might be associated with a reduced risk on adult's ALL.

  17. Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension.

    PubMed

    Cai, Weijuan; Yin, Liang; Yang, Fang; Zhang, Lei; Cheng, Jiang

    2014-11-01

    The aim of the present study was to investigate the association between the homocysteine (Hcy) levels and polymorphisms of the CBS844ins68 and MTHFR C677T genes in essential hypertension (EH). The effects of the MTHFR C677T and CBS844ins68 haploid genotypes and the combined genotypes on EH and levels of Hcy were further explored. The polymorphisms of CBS844ins68 and MTHFR C677T genes in 200 EH and 200 normal tensive (NT) patients were detected using polymerase chain reaction-restriction fragment length polymorphism and analysis of the distribution of genotypes. An automated biochemical analyzer was used to measure the plasma Hcy levels and the clinical biochemistry data. The plasma Hcy levels in EH were significantly higher than those of the NT group (P<0.05). There were no significant differences (P>0.05) between males and females. Two genotypes, deletion/deletion (DD) and deletion/insertion (DI), of the CBS844ins68 polymorphism were found in two groups with no clear differences in two genotypes and allele frequency distribution (P>0.05). There were significant differences in the three genotype frequencies (χ 2 =6.658, χ 2 =4.410, P<0.05) for MTHFR C677T locus genotypes CC, CT and TT. The Hcy levels in genotypes DD and DI had no significant differences (P>0.05) and the CT and TT types were significantly higher compared to the CC genotype (P<0.05). The CC/DD combined genotype in the two groups was significantly different (P<0.05), and the odds ratio (OR), 0.569 showed that the CC/DD genotype may be a protective factor of hypertension. In the two groups, the Hcy levels for combined genotypes CC/DD, CT/DD, TT/DD and TT/DI were significantly different (P<0.05). The SHEsis software analysis linkage disequilibrium coefficient=0.216, indicates that there is probably a weak linkage for MTHFR C677T and CBS844ins68 . Haplotype analysis suggested that the C-D haplotype was negatively correlated with EH (OR, 0.727) and that there was a positive correlation between T

  18. Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension

    PubMed Central

    CAI, WEIJUAN; YIN, LIANG; YANG, FANG; ZHANG, LEI; CHENG, JIANG

    2014-01-01

    The aim of the present study was to investigate the association between the homocysteine (Hcy) levels and polymorphisms of the CBS844ins68 and MTHFR C677T genes in essential hypertension (EH). The effects of the MTHFR C677T and CBS844ins68 haploid genotypes and the combined genotypes on EH and levels of Hcy were further explored. The polymorphisms of CBS844ins68 and MTHFR C677T genes in 200 EH and 200 normal tensive (NT) patients were detected using polymerase chain reaction-restriction fragment length polymorphism and analysis of the distribution of genotypes. An automated biochemical analyzer was used to measure the plasma Hcy levels and the clinical biochemistry data. The plasma Hcy levels in EH were significantly higher than those of the NT group (P<0.05). There were no significant differences (P>0.05) between males and females. Two genotypes, deletion/deletion (DD) and deletion/insertion (DI), of the CBS844ins68 polymorphism were found in two groups with no clear differences in two genotypes and allele frequency distribution (P>0.05). There were significant differences in the three genotype frequencies (χ2=6.658, χ2=4.410, P<0.05) for MTHFR C677T locus genotypes CC, CT and TT. The Hcy levels in genotypes DD and DI had no significant differences (P>0.05) and the CT and TT types were significantly higher compared to the CC genotype (P<0.05). The CC/DD combined genotype in the two groups was significantly different (P<0.05), and the odds ratio (OR), 0.569 showed that the CC/DD genotype may be a protective factor of hypertension. In the two groups, the Hcy levels for combined genotypes CC/DD, CT/DD, TT/DD and TT/DI were significantly different (P<0.05). The SHEsis software analysis linkage disequilibrium coefficient=0.216, indicates that there is probably a weak linkage for MTHFR C677T and CBS844ins68. Haplotype analysis suggested that the C-D haplotype was negatively correlated with EH (OR, 0.727) and that there was a positive correlation between T-D haplotype

  19. MTHFR C677T gene polymorphism and head and neck cancer risk: a meta-analysis based on 23 publications.

    PubMed

    Niu, Yu-Ming; Deng, Mo-Hong; Chen, Wen; Zeng, Xian-Tao; Luo, Jie

    2015-01-01

    Conflicting results on the association between MTHFR polymorphism and head and neck cancer (HNC) risk were reported. We therefore performed a meta-analysis to derive a more precise relationship between MTHFR C677T polymorphism and HNC risk. Three online databases of PubMed, Embase, and CNKI were researched on the associations between MTHFR C677T polymorphism and HNC risk. Twenty-three published case-control studies involving 4,955 cases and 8,805 controls were collected. Odds ratios (ORs) with 95% confidence interval (CI) were used to evaluate the relationship between MTHFR C677T polymorphism and HNC risk. Sensitivity analysis, cumulative analyses, and publication bias were conducted to validate the strength of the results. Overall, no significant association between MTHFR C677T polymorphism and HNC risk was found in this meta-analysis (T versus C: OR = 1.04, 95% CI = 0.92-1.18; TT versus CC: OR = 1.15, 95% CI = 0.90-1.46; CT versus CC: OR = 1.00, 95% CI = 0.85-1.17; CT + TT versus CC: OR = 1.01, 95% CI = 0.87-1.18; TT versus CC + CT: OR = 1.11, 95% CI = 0.98-1.26). In the subgroup analysis by HWE, ethnicity, study design, cancer location, and negative significant associations were detected in almost all genetic models, except for few significant risks that were found in thyroid cancer. This meta-analysis demonstrates that MTHFR C677T polymorphism may not be a risk factor for the developing of HNC.

  20. Association between maternal, fetal and paternal MTHFR gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss: a comprehensive evaluation.

    PubMed

    Yang, Yi; Luo, Yunyao; Yuan, Jing; Tang, Yidan; Xiong, Lang; Xu, MangMang; Rao, XuDong; Liu, Hao

    2016-06-01

    Numerous studies have investigated the associations between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss (RPL); however, the results remain controversial. The aim of this study is to drive a more precise estimation of association between MTHFR gene polymorphisms and risk of RPL. We searched PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and RPL risk. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the strength of association in the homozygous model, heterozygous model, dominant model, recessive model and an additive model. The software STATA (Version 13.0) was used for statistical analysis. Overall, 57 articles were included in the final meta-analysis. In maternal group the MTHFR C677T polymorphism showed pooled odds ratios for the homozygous comparison [OR = 2.285, 95 % CI (1.702, 3.067)] and the MTHFR A1298C polymorphism showed pooled odds ratios for recessive model [OR = 1.594, 95 % CI (1.136, 2.238)]. In fetal group the MTHFR C677T polymorphism showed pooled odds ratios for dominant model [OR = 1.037, 95 % CI (0.567, 1.894)] and the MTHFR A1298C polymorphism showed pooled odds ratios for dominant model [OR = 1.495, 95 % CI (1.102, 2.026)]. In summary, the results of our meta-analysis indicate that maternal and paternal MTHFR gene C677T and A1298C polymorphisms are associated with RPL. We also observed a significant association between fetal MTHFR A1298C polymorphism and RPL but not C677T.

  1. Association of Methylenetetrahydrofolate Reductase C677T and A1298C Gene Polymorphisms With Recurrent Pregnancy Loss in Syrian Women.

    PubMed

    Al-Achkar, Walid; Wafa, Abdulsamad; Ammar, Samer; Moassass, Faten; Jarjour, Rami A

    2017-09-01

    C677T polymorphism of the methylenetetrahydrofolate reductase ( MTHFR) gene was a risk factor for recurrent pregnancy loss (RPL), but few studies have confirmed a possible role of MTHFR A1298C polymorphism in RPL risk. This study was carried out to determine the influence of the MTHFR gene polymorphisms in RPL Syrian women. A case-control study was performed on 2 groups (106 healthy and 100 RPL women). The frequency of the MTHFR gene polymorphisms was determined by polymerase chain reaction based on restriction fragment length gene polymorphism. In the RPL group, the genotype frequencies of MTHFR C677T were CC (41%), CT (41%), and TT (18%), and in the control group, the frequencies were CC (62.2%), CT (36.7%), and TT (1%). Statistical analysis showed a homozygous TT genotype and T allele were significantly different in the RPL group ( P = .000003 and P = .000019, respectively). The genotype frequencies of MTHFR A1298C were AA (53%), AC (44%), and CC (8%) in the RPL group, whereas in the control group, these were AA (61.3%), AC (37.8%), and CC (1%). A significant difference in the CC genotype and C allelic frequencies in the RPL women was observed ( P = .014 and P = .064, respectively). The patients having compound heterozygous (677 CT/1298AC) were associated with an estimated 4.86-fold increase in risk of pregnancy loss compared to individuals with a wild type ( P = .012). Our findings indicate that RPL women with homozygous genotype for (C677T and A1298C) either alone or compound heterozygous genotypes have a high risk of pregnancy loss in Syrian women.

  2. The C677T polymorphism of the methylenetetrahydrofolate reductase gene in Mexican mestizo neural-tube defect parents, control mestizo and native populations.

    PubMed

    Dávalos, I P; Olivares, N; Castillo, M T; Cantú, J M; Ibarra, B; Sandoval, L; Morán, M C; Gallegos, M P; Chakraborty, R; Rivas, F

    2000-01-01

    The C677T mutation of the methylenetetrahydrofolate reductase (MTHFR) gene, associated with the thermolabile form of the enzyme, has reportedly been found to be increased in neural-tube defects (NTD), though this association is still unclear. A group of 107 mestizo parents of NTD children and five control populations: 101 mestizo (M), 50 Huichol (H), 38 Tarahumara (T), 21 Purepecha (P) and 20 Caucasian (C) individuals were typed for the MTHFR C677T variant by the PCR/RFLP (HinfI) method. Genotype frequencies were in agreement with the Hardy-Weinberg expectations in all six populations. Allele frequency (%) of the C677T variant was 45 in NTD, 44 in M, 56 in H, 36 in T, 57 in P, 35 in C. Pairwise inter-population comparisons of allele frequency disclosed a very similar distribution between NTD and M groups (exact test, P=0.92). Among controls, differences between M and individual native groups were NS (0.06C (P=0.29). A high frequency of the variant was found in H (56%) and P (57%). A similar allele frequency in groups M and NTD does not support a causal relationship between NTD and parental MTHFR C677T genotypes. Thus, the C677T variant cannot be regarded as a major genetic risk factor for NTD in Mexican mestizo parents. Otherwise, C677T in Mexico is very frequent, especially in Huichol and Purepecha natives, as compared with other groups world wide.

  3. The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population.

    PubMed

    Nowak, Izabela; Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

    2017-01-01

    Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms' association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms.

  4. The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population

    PubMed Central

    Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R.; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

    2017-01-01

    Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms’ association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms. PMID:29073227

  5. Lack of association between MTHFR C677T and A1298C polymorphisms and risk of childhood acute lymphoblastic leukemia in the Kurdish population from Western Iran.

    PubMed

    Azhar, Mohammad-Reza; Rahimi, Zohreh; Vaisi-Raygani, Asad; Akramipour, Reza; Madani, Hamid; Rahimi, Ziba; Parsian, Abbas

    2012-03-01

    Polymorphism in genes involved in folate metabolism may influence the susceptibility to acute lymphoblastic leukemia (ALL). The aim of the present study was to determine the role of the two most common polymorphisms of the 5, 10-methylenetetrahydrofolate reductase (MTHFR) gene, MTHFR C677T and A1298C, and their interaction on the susceptibility to ALL. Seventy-two children with ALL and 109 age- and sex-matched healthy children from Western Iran were screened for MTHFR C677T and A1298C variants by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The frequencies of MTHFR 677T and 1298C alleles in patients were 29.9% and 43.1%, respectively, that were higher than those in controls (24.8% and 38.1%, respectively). Logistic regression analysis was performed and its result in the odds ratios (ORs) for possession of either MTHFR 677T or 1298C allele was found to be 1.98 [95% confidence interval (CI) 0.72-5.4, p = 0.18] and 1.48 (95% CI 0.59-3.69, p = 0.4), respectively. Also the concomitant presence of both MTHFR 677T and 1298C alleles was not associated with the risk of ALL [OR = 2.12 (95% CI 0.8-5.7, p = 0.13)]. Our results in a homogenous population with Kurdish ethnic background indicated that neither the MTHFR 677T allele nor the MTHFR 1298C allele is associated with increased risk of ALL.

  6. MTHFR GENE C677T POLYMORPHISM AND LEVELS OF DNA METHYLTRASFERASES IN SUBCLINICAL HYPOTHYROIDISM.

    PubMed

    Kvaratskhelia, T; Kvaratskhelia, E; Kankava, K; Abzianidze, E

    2017-04-01

    The aim of our study was to investigate the link between MTHFR gene C677T polymorphism and DNMTs levels in patients with Subclinical Hypothyroidism (SCH). In this study 19 adult patients with subclinical hypothyroidism and 19 healthy controls (mean age 31±5.5 and 33±5.1 years respectively) were recruited. All patients were diagnosed based on serum levels of TSH, FT4, anti-TG and anti-TPO antibodies. Written informed consents were obtained from all study subjects. Genomic DNA was extracted using Quick-DNA Universal Kit (Zymo Research, USA). The MTHFR C677T polymorphism was genotyped by PCR-RFLP method. Levels of DNMT1 and 3a were measured in nuclear extracts of PBMC using DNMTs assay kits (Abcam). Our data indicates that the frequency of genotypes and alleles were different among the patient and the control group. There is a significant increase in CC genotype distribution in the control group when compared to the SCH patient group, while the CT as well as TT genotype distribution were not increased significantly in SCH group versus control group. However the C allele is significantly prevalent in the control group compared to the SCH group, while T allele is prevalent in patients compared to the control group with a statically significant difference. In addition, individuals with TT and CT genotypes and hypothyroidism showed elevated amount of DNMT3a in nuclear extracts of PBMC compared with controls, while no significant difference in DNMT1 levels was observed. This study indicates the MTHFR C677T variant may contribute in alteration of epigenetic regulation such as DNA methylation mediated by DNA methyltransferases in patients with subclinical hypothyroidism and also, carriers of the T allele might have an increasing risk of developing SCH.

  7. Associations of methylenetetrahydrofolate reductase C677T genotype with blood pressure levels in Chinese population with essential hypertension.

    PubMed

    Cheng, Jun; Tao, Fang; Liu, Yanhong; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

    2018-01-01

    To confirm the association between baseline blood pressure (BP) levels and the methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism in patients with essential hypertension. A total of 347 patients were enrolled from the Dongzhi community in Anhui Province, China. The C677T polymorphism of the MTHFR gene was detected using high-throughput TaqMan allelic discrimination assay. Baseline BP was measured using a standardized mercury-gravity monometer. In the whole sample, the frequency of the MTHFR C677T genotypes CC, CT, and TT were 38.6%, 48.1%, and 13.3%, respectively. In a recessive model (CC+CT versus TT genotypes), baseline diastolic blood pressure (DBP) was significantly higher in patients with the TT genotype compared to those with the CT or CC genotypes (P= 0.013). We also divided all patients into three groups based on the tertiles of the baseline BP distribution. Compared to subjects in the lowest tertile of DBP, the adjusted odds of having the TT genotype among subjects in the highest tertile was 2.6 (95% CI: 1.1 to 6.2). However, no significant associations were observed between baseline systolic blood pressure (SBP) and the MTHFR C677T polymorphism. The MTHFR gene polymorphism could be an important genetic determinant of baseline DBP levels in Chinese essential hypertensive patients.

  8. A literature review of MTHFR (C677T and A1298C polymorphisms) and cancer risk.

    PubMed

    Izmirli, Muzeyyen

    2013-01-01

    5,10-Methlenetetrahydrofolate reductase (MTHFR) is one of the most important enzymes for folate metabolism. This enzyme is mapped on chromosome 1, which is located at the end of the short arm (1p36.3). The C677T and A1298C are MTHFR polymorphisms that decrease in vitro MTHFR enzyme activity. Folate metabolism plays a key role in cell metabolism. These reactions are associated with purine-pyrimidine synthesis: DNA, RNA, and protein methylation. Polymorphism is also a factor in biodiversity, and be affected by ethnic heritage and geographic locale. In the case of unknown outcomes, not only should all geographical regions be investigated to ascertain biodiversity, but all populations as well to fully understand the variations in the effect. PUBMED was searched from January 2006 to December 2011 to develop an investigatory pursuit strategy. MTHFR, cancer, C677T, A1298C, and polymorphisms were key words used to focus the search. The literature review included all published relevant cancer types and MTHFR polymorphisms for that 5 years period. All selected polymorphisms data for cancer types was listed in tables for easy access and retrieval.

  9. Human genetic selection on the MTHFR 677C>T polymorphism

    PubMed Central

    Mayor-Olea, Álvaro; Callejón, Gonzalo; Palomares, Arturo R; Jiménez, Ana J; Gaitán, María Jesús; Rodríguez, Alfonso; Ruiz, Maximiliano; Reyes-Engel, Armando

    2008-01-01

    Background The prevalence of genotypes of the 677C>T polymorphism for the MTHFR gene varies among humans. In previous studies, we found changes in the genotypic frequencies of this polymorphism in populations of different ages, suggesting that this could be caused by an increase in the intake of folate and multivitamins by women during the periconceptional period. The aim was to analyze changes in the allelic frequencies of this polymorphism in a Spanish population, including samples from spontaneous abortions (SA). Methods A total of 1305 subjects born in the 20th century were genotyped for the 677C>T polymorphism using allele specific real-time PCR with Taqman® probes. A section of our population (n = 276) born in 1980–1989 was compared with fetal samples (n = 344) from SA of unknown etiology from the same period. Results An increase in the frequency of the T allele (0.38 vs 0.47; p < 0.001) and of the TT genotype (0.14 vs 0.24; p < 0.001) in subjects born in the last quarter of the century was observed. In the 1980–1989 period, the results show that the frequency of the wild type genotype (CC) is about tenfold lower in the SA samples than in the controls (0.03 vs 0.33; p < 0.001) and that the frequency of the TT genotype increases in the controls (0.19 to 0.27) and in the SA samples (0.20 to 0.33 (p < 0.01)); r = 0.98. Conclusion Selection in favor of the T allele has been detected. This selection could be due to the increased fetal viability in early stages of embryonic development, as is deduced by the increase of mutants in both living and SA populations. PMID:19040733

  10. Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

    PubMed

    Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

    2009-06-01

    This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

  11. A meta-analysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children.

    PubMed

    Yan, Jingrong; Yin, Ming; Dreyer, ZoAnn E; Scheurer, Michael E; Kamdar, Kala; Wei, Qingyi; Okcu, M Fatih

    2012-04-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have been implicated in childhood acute lymphoblastic leukemia (ALL) risk, but previously published studies were inconsistent and recent meta-analyses were not adequate. In a meta-analysis of 21 publications with 4,706 cases and 7,414 controls, we used more stringent inclusion method and summarized data on associations between MTHFR C677T and A1298C polymorphisms and childhood ALL risk. We found an overall association between 677T variant genotypes and reduced childhood ALL risk. Specifically, in the dominant genetic model, an association was found in a fixed-effect (TT + CT vs. CC: OR = 0.92; 95% CI = 0.85-0.99) but not random-effect model, whereas such an association was observed in both homozygote genetic model (TT vs. CC: OR = 0.80; 95% CI = 0.70-0.93 by fixed effects and OR = 0.78; 95% CI = 0.65-0.93 by random effects) and recessive genetic model (TT vs. CC + CT: OR = 0.83; 95% CI = 0.72-0.95 by fixed effects and OR = 0.84; 95% CI = 0.73-0.97 by random effects). These associations were also observed in subgroups by ethnicity: for Asians in all models except for the dominant genetic model by random effect and for Caucasians in all models except for the recessive genetic model. However, the A1298C polymorphism did not appear to have an effect on childhood ALL risk. These results suggest that the MTHFR C677T, but not A1298C, polymorphism is a potential biomarker for childhood ALL risk. Copyright © 2011 Wiley Periodicals, Inc.

  12. MTHFR C677T polymorphism, homocysteine and B-vitamins status in a sample of Chinese and Malay subjects in Universiti Putra Malaysia.

    PubMed

    Choo, S C; Loh, S P; Khor, G L; Sabariah, M N; Rozita, R

    2011-08-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T is involved in folate and homocysteine metabolism. Disruption in the activity of this enzyme will alter their levels in the body. This study assessed MTHFR C677T polymorphism and its relationship with serum homocysteine and B-vitamins levels in a sample of Chinese and Malays subjects in UPM, Serdang. One hundred subjects were randomly selected from among the university population. Folate, vitamin B12, B6, and homocysteine levels were determined using MBA, ECLIA, and HPLC, respectively. PCR coupled with HinfI digestion was used for detection of MTHFR C677T polymorphism. The frequency of T allele was higher in the Chinese subjects (0.40) compared to the Malay (0.14). Folate, vitamin B12 and B6 levels were highest in the wild genotype in both ethnic groups. Subjects with heterozygous and homozygous genotype showed the highest homocysteine levels. The serum folate and homocysteine were mainly affected by homozygous genotype. MTHFR C677T polymorphism plays an important role in influencing the folate and homocysteine metabolism.

  13. MTHFR 677C --> T genotype disrupts prefrontal function in schizophrenia through an interaction with COMT 158Val --> Met.

    PubMed

    Roffman, Joshua L; Gollub, Randy L; Calhoun, Vince D; Wassink, Thomas H; Weiss, Anthony P; Ho, Beng C; White, Tonya; Clark, Vincent P; Fries, Jill; Andreasen, Nancy C; Goff, Donald C; Manoach, Dara S

    2008-11-11

    Understanding how risk genes cumulatively impair brain function in schizophrenia could provide critical insights into its pathophysiology. Working memory impairment in schizophrenia has been associated with abnormal dopamine signaling in the prefrontal cortex, which is likely under complex genetic control. The catechol-O-methyltransferase (COMT) 158Val --> Met polymorphism (rs4680), which affects the availability of prefrontal dopamine signaling, consistently stratifies prefrontal activation during working memory performance. However, the low-dopamine COMT 158Val allele does not confer increased risk for schizophrenia, and its effects on prefrontal function are not specific to the disorder. In the setting of other genetic variants influencing prefrontal dopamine signaling, COMT 158Val --> Met genotype may exert disease-specific effects. A second polymorphism, methylenetetrahydrofolate reductase (MTHFR) 677C --> T (rs1801133), has been associated with overall schizophrenia risk and executive function impairment in patients, and may influence dopamine signaling through mechanisms upstream of COMT effects. We found that the hypofunctional 677T variant was associated with decreased working memory load-dependent activation in the prefrontal and insular cortices in 79 schizophrenia patients, but not in 75 demographically matched healthy controls. Further, significant MTHFR x COMT genotype interactions were observed, which differed by diagnostic group: Reduced prefrontal activation was associated with the 677T and 158Val alleles in patients, but with 677C/C and 158Met/Met genotype in controls. These findings are consistent with epistatic effects of the COMT and MTHFR polymorphisms on prefrontal dopamine signaling, and suggest that in schizophrenia patients, the MTHFR 677T allele exacerbates prefrontal dopamine deficiency. The findings also suggest the importance of weighing COMT effects on prefrontal function within the context of MTHFR genotype.

  14. The association between MTHFR gene C677T polymorphism and ALL risk based on a meta-analysis involving 17,469 subjects.

    PubMed

    Zhang, Beibei; Zhang, Weiming; Yan, Liang; Wang, Daogang

    2017-03-01

    The methylenetetrahydrofolate reductase (MTHFR) gene C677T polymorphism is closely related to the acute lymphoblastic leukaemia (ALL) indicated by many previous epidemiologic studies. However, their conclusions were still conflicting. Our aim is to evaluate their associations using a more comprehensive updated meta-analysis. Electronic searches were conducted to select published studies prior to February, 2016. Totally, 39 case-control studies including 6551 ALL cases and 10,918 controls were selected in current meta-analysis. The association was detected significantly between MTHFR C677T polymorphism and ALL reducing susceptibility. Our results indicate that the MTHFR C677T polymorphism may be a promising ALL biomarker and studies to explore the protein levels of the variants and their functional role are required for the definitive conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Association between MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: a meta-analysis based on 51 case-control studies.

    PubMed

    Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

    2015-03-12

    Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79-1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80-1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84-1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73-1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81-1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility.

  16. MTHFR 677C>T Polymorphism and the Risk of Breast Cancer: Evidence from an Original Study and Pooled Data for 28031 Cases and 31880 Controls

    PubMed Central

    Sekhar, Deepa; Francis, Amirtharaj; Gupta, Nishi; Konwar, Rituraj; Kumar, Sandeep; Kumar, Surender; Thangaraj, Kumarasamy; Rajender, Singh

    2015-01-01

    Background Methylenetetrahydrofolate reductase (MTHFR) acts at an important metabolic point in the regulation of cellular methylation reaction. It assists in the conversion of 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate. The latter aids in remethylation of homocysteine to de novo methionine that is required for DNA synthesis. The objective of this study was to examine the effect of MTHFR 677 C>T polymorphism on the risk of breast cancer in the Indian sub-continent. Methods and Results We genotyped 677 C>T locus in 1096 individuals that were classified into cases (N=588) and controls (N=508). Genotype data were analyzed using chi-square test. No significant difference was observed in the distribution of genotypes between cases and controls in north Indian (P = 0.932), south Indian (P = 0.865), and pooled data (P = 0.680). To develop a consensus regarding the impact of 677C>T polymorphism on breast cancer risk, we also conducted a meta-analysis on 28031 cases and 31880 controls that were pooled from sixty one studies. The overall summary estimate upon meta-analysis suggested no significant correlation between the 677C>T substitution and breast cancer in the dominant model (Fixed effect model: OR = 0.97, P=0.072, Random effects model: OR = 0.96, P = 0.084) or the recessive model (Fixed effect model: OR = 1.05, P = 0.089; Random effects model: OR= 1.08, P= 0.067). Conclusion 677 C>T substitution does not affect breast cancer risk in the Indo-European and Dravidian populations of India. Analysis on pooled data further ruled out association between the 677 C>T polymorphism and breast cancer. Therefore, 677 C>T substitution does not appear to influence the risk of breast cancer. PMID:25803740

  17. Presence of the 5,10-methylenetetrahydrofolate reductase C677T mutation in Puerto Rican patients with neural tube defects.

    PubMed

    García-Fragoso, Lourdes; García-García, Inés; de la Vega, Alberto; Renta, Jessicca; Cadilla, Carmen L

    2002-01-01

    Folic acid supplementation can reduce the incidence of neural tube defects. The first reported genetic risk factor for neural tube defects is a C677T mutation in the 5,10-methylenetetrahydrofolate reductase gene, resulting in decreased activity of the enzyme. We examined the enzyme mutation role of methylenetetrahydrofolate reductase in the etiology of neural tube defects in our population. The study group consisted of 204 Puerto Rican individuals including 37 pregnant females with a prenatal diagnosis of neural tube defects in their fetuses, 31 newborns, 36 fathers, and 100 healthy adults. The prevalence of the C677T mutation was examined. Homozygosity for the alanine to valine substitution (TT) was observed in 9% of the controls and 19% of the mothers with children with neural tube defects. Our results indicate that the presence of the T allele at the methylenetetrahydrofolate reductase 677 position may increase the risk of giving birth to an infant with a neural tube defect.

  18. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

    PubMed

    Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

  19. Methylenetetrahydrofolate reductase C677T polymorphism is associated with increased risk of coronary artery disease in young South African Indians.

    PubMed

    Ramkaran, Prithiksha; Phulukdaree, Alisa; Khan, Sajidah; Moodley, Devapregasan; Chuturgoon, Anil A

    2015-10-15

    Methylenetetrahydrofolate reductase (MTHFR) reduces 5',10'-methylenetetrahydrofolate to 5'-methyltetrahydrofolate, and is involved in remethylation of homocysteine to methionine, two important reactions involved in folate metabolism and methylation pathways. The common MTHFR C677T single nucleotide polymorphism (SNP) (rs1801133) has been associated with raised levels of homocysteine, a well known risk factor for coronary artery disease (CAD). CAD is a major cause of mortality worldwide. The age of onset of this chronic disorder is on the decline, particularly in the Indian population. Indians in South Africa (SA) have a higher prevalence of premature CAD compared to Black South Africans. The MTHFR C677T SNP has not been investigated in the SA Indian population. The present study therefore investigated the MTHFR C677T SNP in young SA Indian males with CAD compared to young Indian and Black male controls. A total of 290 subjects were recruited into this study which included 106 CAD patients (diagnosed on angiography, mean age 37.5, range 24-45 years), 100 Indian male controls (mean age 37.5, range 28-45 years), and 84 Black male controls (mean age 36.4, range 25-45). Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) was used to genotype CAD patients and healthy controls. Data for clinical markers were obtained from pathology reports. There was a significant association between the 677 MTHFR variant (T) allele and CAD patients compared to the healthy Indian controls (p=0.0353, OR=2.105 95% CI 1.077-4.114). Indian controls presented with a higher frequency of the variant allele compared to Black controls (7% vs. 2% respectively, p=0.0515 OR=3.086 95% CI 0.9958-9.564). The MTHFR C677T SNP did not influence levels of total cholesterol, LDL, HDL, triglycerides, fasting glucose, fasting insulin, HbA1c or hsCRP. The higher frequency of the MTHFR 677 variant allele in South African Indians may be a contributing factor to the higher

  20. COMT Val158Met and MTHFR C677T moderate risk of schizophrenia in response to childhood adversity.

    PubMed

    Debost, J-C; Debost, M; Grove, J; Mors, O; Hougaard, D M; Børglum, A D; Mortensen, P B; Petersen, L

    2017-07-01

    Mesolimbic dopamine sensitization has been hypothesized to be a mediating factor of childhood adversity (CA) on schizophrenia risk. Activity of catechol-O-methyltransferase (COMT) Val158Met increases mesolimbic dopamine signaling and may be further regulated by methylenetetrahydrofolate reductase (MTHFR) C677T. This study investigates the three-way interaction between CA, COMT, and MTHFR. We conducted a nested case-control study on individuals born after 1981, linking population-based registers to study the three-way interaction. We included 1699 schizophrenia cases and 1681 controls, and used conditional logistic regression to report incidence rate ratios (IRRs). Childhood adversity was robustly associated with schizophrenia. No main genetic effects were observed. MTHFR C677T increased schizophrenia risk in a dose-dependent manner per MTHFR T allele (P = 0.005) consequent upon CA exposure. After inclusion of the significant (P = 0.03) COMT × MTHFR × CA interaction, the risk was further increased per high-activity COMT Val allele. Hence, exposed COMT Val/Val and MTHFR T/T carriers had an IRR of 2.76 (95% CI, 1.66-4.61). Additional adjustments for ancestry and parental history of mental illness attenuated the results with the interaction being only marginally significant. MTHFR C677T and COMT Val158Met interact with CA to increase risk of schizophrenia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Methylenetetrahydrofolate reductase polymorphism C677T is a protective factor for pediatric acute lymphoblastic leukemia in the Chinese population: a meta-analysis.

    PubMed

    Wang, Haigang; Meng, Lujing; Zhao, Lixia; Wang, Jiali; Liu, Xinchun; Mi, Wenjie

    2012-12-01

    Two polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, were hypothesized to decrease the risk of acute lymphoblastic leukemia (ALL). Studies examining the associations between these two polymorphisms and ALL susceptibility drew inconsistent results. To obtain a reliable conclusion in a Chinese population, we carried out a meta-analysis. In total, 11 studies on C677T polymorphism (1597 cases and 2295 controls) and 10 studies on A1298C polymorphism (1553 cases and 2224 controls) were included in the meta-analysis. We found a significant association between the 677T variant and reduced ALL risk in Chinese children (Dominant model: odds ratio [OR(FE)]=0.73, 95% confidence interval [CI]: 0.63-0.86, p<0.01). Heterogeneity between the studies in the children subgroup was weak and vanished after excluding one study deviating from HWE in the control group (p>0.1). In the adult subgroup, there was no significant association between the C677T variant and ALL risk (Dominant model: OR(RE)=0.88, 95% CI: 0.45-1.72, p=0.72). Significant heterogeneity was found in the adult subgroup in all the genetic model tests (p<0.1). The A1298C polymorphism had an effect on ALL risk neither in adults (Dominant model: OR(FE)=0.95, 95% CI: 0.71-1.27, p=0.72) nor in children (Dominant model: OR(FE)=1.02, 95% CI: 0.87-1.21, p=0.77). No significant heterogeneity between studies on A1298C polymorphism was found in the meta-analysis (p>0.1). The results showed that there was a protective effect of the MTHFR C677T variant on ALL risk in Chinese children.

  2. Association between MTHFR C677T Polymorphism and Risk of Acute Lymphoblastic Leukemia: A Meta-Analysis Based on 51 Case-Control Studies

    PubMed Central

    Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

    2015-01-01

    Background Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. Material/Methods The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Results Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79–1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80–1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84–1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73–1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81–1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. Conclusions The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility. PMID:25761797

  3. Association of MTHFR C677T Genotype With Ischemic Stroke Is Confined to Cerebral Small Vessel Disease Subtype

    PubMed Central

    Traylor, Matthew; Adib-Samii, Poneh; Thijs, Vincent; Sudlow, Cathie; Rothwell, Peter M.; Boncoraglio, Giorgio; Dichgans, Martin; Meschia, James; Maguire, Jane; Levi, Christopher; Rost, Natalia S.; Rosand, Jonathan; Hassan, Ahamad; Bevan, Steve; Markus, Hugh S.

    2016-01-01

    Background and Purpose— Elevated plasma homocysteine levels are associated with stroke. However, this might be a reflection of bias or confounding because trials have failed to demonstrate an effect from homocysteine lowering in stroke patients, although a possible benefit has been suggested in lacunar stroke. Genetic studies could potentially overcome these issues because genetic variants are inherited randomly and are fixed at conception. Therefore, we tested the homocysteine levels–associated genetic variant MTHFR C677T for association with magnetic resonance imaging–confirmed lacunar stroke and compared this with associations with large artery and cardioembolic stroke subtypes. Methods— We included 1359 magnetic resonance imaging–confirmed lacunar stroke cases, 1824 large artery stroke cases, 1970 cardioembolic stroke cases, and 14 448 controls, all of European ancestry. Furthermore, we studied 3670 ischemic stroke patients in whom white matter hyperintensities volume was measured. We tested MTHFR C677T for association with stroke subtypes and white matter hyperintensities volume. Because of the established association of homocysteine with hypertension, we additionally stratified for hypertension status. Results— MTHFR C677T was associated with lacunar stroke (P=0.0003) and white matter hyperintensity volume (P=0.04), but not with the other stroke subtypes. Stratifying the lacunar stroke cases for hypertension status confirmed this association in hypertensive individuals (P=0.0002), but not in normotensive individuals (P=0.30). Conclusions— MTHFR C677T was associated with magnetic resonance imaging–confirmed lacunar stroke, but not large artery or cardioembolic stroke. The association may act through increased susceptibility to, or interaction with, high blood pressure. This heterogeneity of association might explain the lack of effect of lowering homocysteine in secondary prevention trials which included all strokes. PMID:26839351

  4. Folate intake and the MTHFR C677T genotype influence choline status in young Mexican American women☆

    PubMed Central

    Abratte, Christian M.; Wang, Wei; Li, Rui; Moriarty, David J.; Caudill, Marie A.

    2009-01-01

    Numerous studies have reported a relationship between folate status, the methylenetetrahydrofolate reductase (MTHFR) 677C→T variant and disease risk. Although folate and choline metabolism are inter-related, only limited data are available on the relationship between choline and folate status in humans. This study sought to examine the influences of folate intake and the MTHFR 677C→T variant on choline status. Mexican-American women (n =43; 14 CC, 12 CT and 17 TT) consumed 135 μg/day as dietary folate equivalents (DFE) for 7 weeks followed by randomization to 400 or 800 μg DFE/day for 7 weeks. Throughout the study, total choline intake remained unchanged at ∼350 mg/day. Plasma concentrations of betaine, choline, glycerophosphocholine, phosphatidylcholine and sphingomyelin were measured via LC-MS/MS for Weeks 0, 7 and 14. Phosphatidylcholine and sphingomyelin declined ( P=.001, P=.009, respectively) in response to folate restriction and increased ( P=.08, P=.029, respectively) in response to folate treatment. The increase in phosphatidylcholine occurred in response to 800 ( P=.03) not 400 ( P=.85) μg DFE/day (week×folate interaction, P=.017). The response of phosphatidylcholine to folate intake appeared to be influenced by MTHFR C677T genotype. The decline in phosphatidylcholine during folate restriction occurred primarily in women with the CC or CT genotype and not in the TT genotype (week×genotype interaction, P=.089). Moreover, when examined independent of folate status, phosphatidylcholine was higher ( P <.05) in the TT genotype relative to the CT genotype. These data suggest that folate intake and the MTHFR C677T genotype influence choline status in humans. PMID:17588738

  5. C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: effect on methotrexate-related toxicity in adult acute lymphoblastic leukaemia.

    PubMed

    Eissa, Deena Samir; Ahmed, Tamer Mohamed

    2013-03-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism. Two polymorphisms, C677T and A1298C, were described leading to reduced enzyme activity. Methotrexate (MTX) is an antifolate agent of consolidation and maintenance therapy of acute lymphoblastic leukaemia (ALL). Despite its clinical success, MTX can be associated with serious toxicities resulting in treatment interruption or discontinuation, impacting disease outcome. There is evidence that MTX toxicity can be affected by polymorphisms in genes encoding for drug-metabolizing enzymes such as MTHFR. Therefore, we aimed to investigate the influence of MTHFR C677T and A1298C polymorphisms on the frequency of MTX-related toxicity, disease outcome and patients' survival. MTHFR polymorphisms were assessed in 50 adult patients with de novo ALL using real-time PCR. Patients were followed-up for the development of haematologic and/or nonhaematologic toxicity and assessment of clinical outcome. Frequency of C677T polymorphisms was 42% for TT, 24% for CT and 34% for CC; A1298C polymorphisms were 28, 6 and 66% for CC, AC and AA, respectively. MTX therapy was significantly associated with neutropaenia, hepatic and gastrointestinal toxicities, unfavourable response at day 14 of induction therapy, increased relapse and mortality rates and shorter survival in patients with 677 TT genotype than in those with CC and CT, whereas 1298 CC genotype patients had lower frequency of neutropaenia, hepatic toxicity and relapse than in those with AA and AC. Our study suggests MTHFR polymorphism as an attractive predictor of MTX-related toxicity in adult ALL, considering it a potential prognostic factor influencing disease outcome.

  6. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population

    PubMed Central

    Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343

  7. Association of methylenetetrahydrofolate reductase gene C677T polymorphism with polycystic ovary syndrome risk: a systematic review and meta-analysis update.

    PubMed

    Fu, Li-yuan; Dai, Li-meng; Li, Xiao-gang; Zhang, Kun; Bai, Yun

    2014-01-01

    To re-estimate the association between methylenetetrahydrofolate reductase gene (MTHFR) C677T polymorphism and polycystic ovary syndrome (PCOS) risk by critically reviewing, analyzing and updating the current evidence. MTHFR C677T polymorphism has been studied as a possible risk factor for a variety of common conditions including heart disease, stroke and hypertension. Its association with PCOS was negative in a previous meta-analysis which had possible shortcomings. More studies have now been done but their results remain inconclusive. Available case-control studies containing genotype frequencies of MTHFR C677T were chosen, and odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of the association. Statistical analyses were performed using software Review Manager (Version 5. 2) and Stata (Version 11.0). Nine case-control studies including 638 PCOS and 759 healthy controls were identified. Meta-analysis showed a significant effect in the dominant model (TT+CT vs. CC: OR=1.65, 95%CI=1.28-2.12, P<0.0001) and heterozygote comparison (CT vs. CC: OR=1.83, 95%CI=1.17-2.87, P=0.008). In subgroup analysis stratified by ethnicity, MTHFR C677T variant was statistically significantly relevant to PCOS risk in European populations (TT+CT vs. CC: OR=2.16, 95%CI=1.50-3.12, P<0.0001; CT vs. CC: OR=2.11, 95%CI=1.15-3.87, P=0.02) but not in Asian populations (TT+CT vs. CC: OR=1.29, 95%CI=0.91-1.82, P=0.15; CT vs. CC: OR=1.31, 95%CI=0.91-1.90, P=0.15). This meta-analysis indicates that the 677T allele increases PCOS susceptibility, and this relevance seems to be more intense in Europeans than in Asians. Copyright © 2013. Published by Elsevier Ireland Ltd.

  8. Individual and Joint Associations of Methylenetetrahydrofolate Reductase C677T Genotype and Plasma Homocysteine With Dyslipidemia in a Chinese Population With Hypertension.

    PubMed

    Liu, Yanhong; Li, Kang; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

    2017-04-01

    We aimed to examine the cross-sectional associations of plasma total homocysteine (tHcy) concentrations and methylenetetrahydrofolate reductase ( MTHFR) C677T genotype with dyslipidemia. A total of 231 patients with mild-to-moderate essential hypertension were enrolled from the Huoqiu and Yuexi communities in Anhui Province, China. Plasma tHcy levels were measured by high-performance liquid chromatography. Genotyping was performed by TaqMan allelic discrimination technique. Compared with MTHFR 677 CC + CT genotype carriers, TT genotype carriers had higher odds of hypercholesterolemia (adjusted odds ratio [OR] [95% confidence interval (CI)]: 2.7 [1.4-5.2]; P = .004) and higher odds of abnormal low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.3 [1.1-4.8]; P = .030). The individuals with the TT genotype had higher concentrations of log(tHcy) than those with the 677 CC + CT genotype (adjusted β [standard error]: .2 [0.03]; P < .001). Patients with tHcy ≥ 10 μmol/L had significantly higher odds of hypercholesterolemia (adjusted OR [95% CI]: 2.4 [1.2-4.7]; P = .010). Furthermore, patients with both the TT genotype and the tHcy ≥ 10 μmol/L had the highest odds of hypercholesterolemia (adjusted OR [95% CI]: 4.1 [1.8-9.4]; P = .001) and low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.4 [1.0-6.0]; P = .064). This study suggests that both tHcy and the MTHFR C677T gene polymorphism may be important determinants of the incidence of dyslipidemia in Chinese patients with essential hypertension. Further studies are needed to confirm the role of tHcy and the MTHFR C677T mutation in the development of dyslipidemia in a larger sample.

  9. The MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: an updated meta-analysis based on 37 case-control studies.

    PubMed

    Jiang, Yuan; Hou, Jing; Zhang, Qiang; Jia, Shu-Ting; Wang, Bo-Yuan; Zhang, Ji-Hong; Tang, Wen-Ru; Luo, Ying

    2013-01-01

    The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) has been associated with acute lymphoblastic leukemia (ALL). However, results were conflicting. The aim of this study was to quantitatively summarize the evidence for the MTHFRC677T polymorphism and ALL risk. Electronic searches of PubMed and the Chinese Biomedicine database were conducted to select case-control studies containing available genotype frequencies of C677T and the odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of any association. Case-control studies including 6,371 cases and 10,850 controls were identified. The meta-analysis stratified by ethnicity showed that individuals with the homozygous TT genotype had decreased risk of ALL (OR= 0.776, 95% CI: 0.687~0.877, p< 0.001) in Caucasians (OR= 0.715, 95% CI: 0.655~0.781, p= 0.000). However, results among Asians (OR=0.711, 95% CI: 0.591~1.005, p= 0.055) and others (OR=0.913, 95% CI: 0.656~1.271, p= 0. 590) did not suggest an association. A symmetric funnel plot, the Egger's test (P=0.093), and the Begg- test (P=0.072) were all suggestive of the lack of publication bias. This meta-analysis supports the idea that the MTHFR C677T genotype is associated with risk of ALL in Caucasians. To draw comprehensive and true conclusions, further prospective studies with larger numbers of participants worldwide are needed to examine associations between the MTHFRC677T polymorphism and ALL.

  10. Methylenetetrahydrofolate reductase gene C677T and A1298C polymorphisms in patients with small cell and non-small cell lung cancer.

    PubMed

    Siemianowicz, Krzysztof; Gminski, Jan; Garczorz, Wojciech; Slabiak, Natalia; Goss, Malgorzata; Machalski, Marek; Magiera-Molendowska, Helena

    2003-01-01

    Two mutations of methylenetetrahydrofolate reductase (MTHFR) gene (C677T and A1298C) may lead to a decreased activity of the enzyme. These mutations may change a risk of some cancers. We evaluated these two polymorphisms of MTHFR in patients with small cell lung cancer (SCLC) and non-small cell lung cancer (NCSCL). All lung cancer patients had statistically significantly higher percentage of MTHFR 677TT genotype in comparison with non-cancer controls. There were no statistically significant differences in the distribution of MTHFR 1298 genotypes. Neither of the polymorphisms presented any statistically significant differences between SCLC and NSCLC.

  11. Association of methylenetetrahydrofolate reductase (MTHFR 677C>T) and thymidylate synthase (TSER and TS 1494del6) polymorphisms with premature ovarian failure in Korean women.

    PubMed

    Rah, HyungChul; Jeon, Young Joo; Choi, Youngsok; Shim, Sung Han; Yoon, Tae Ki; Choi, Dong Hee; Cha, Sun Hee; Kim, Nam Keun

    2012-11-01

    The aim of our study was to investigate whether methylenetetrahydrofolate reductase (MTHFR) gene variant (MTHFR 677C>T) and thymidylate synthase (TS) gene variants (TS enhancer region [TSER] and TS 1494del6) confer a risk for premature ovarian failure (POF). We genotyped 136 POF patients and 236 controls among Korean women for the three single nucleotide polymorphism sites using polymerase chain reaction restriction fragment length polymorphism analysis. Differences in the MTHFR 677C>T, TSER, and TS 1494del6 genotype frequencies between POF patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as a measure of the strength of the association between genotypes and POF. The MTHFR 677CT and CT + TT variant genotypes were more frequent in POF patients than in controls (OR, 2.249; 95% CI, 1.317-3.843; and OR, 2.132; 95% CI, 1.268-3.585, respectively). The combined genotype frequencies of MTHFR 677CT + TT/TSER 3R3R and 677CT + TT/TS 1494del6 del6/del6 were higher in patients than in controls (OR, 2.300; 95% CI, 1.219-4.337; and OR, 3.314; 95% CI, 1.623-6.767, respectively). The T-3R-del6 and T-2R-del6 (MTHFR 677C>T/TSER/TS 1494del6) haplotypes were more frequent in patients (OR, 1.450; 95% CI, 1.050-2.002; and OR, 2.911; 95% CI, 1.191-7.117, respectively), whereas the C-2R-del6 haplotype was less frequent in patients (OR, 0.372; 95% CI, 0.152-0.912). The T-del6 (MTHFR 677/TS 1494del6) haplotype frequency was higher among patients (OR, 1.653; 95% CI, 1.206-2.266), whereas the C-del6 haplotype frequency was lower among patients (OR, 0.700; 95% CI, 0.516-0.950). We did not find an association between TSER or TS 1494del6 polymorphisms and POF. Our data suggest that the MTHFR 677T allele may increase the risk for POF, which could lead to the development of novel genetic markers for predicting the risk of POF in patients.

  12. Effects of Maternal 5,10-Methylenetetrahydrofolate Reductase C677T and A1298C Polymorphisms and Tobacco Smoking on Infant Birth Weight in a Japanese Population

    PubMed Central

    Yila, Thamar Ayo; Sasaki, Seiko; Miyashita, Chihiro; Braimoh, Titilola Serifat; Kashino, Ikuko; Kobayashi, Sumitaka; Okada, Emiko; Baba, Toshiaki; Yoshioka, Eiji; Minakami, Hisanori; Endo, Toshiaki; Sengoku, Kazuo; Kishi, Reiko

    2012-01-01

    Background Intracellular folate hemostasis depends on the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. Because 5,10-MTHFR 677TT homozygosity and tobacco smoking are associated with low folate status, we tested the hypothesis that smoking in mothers with 5,10-MTHFR C677T or A1298C polymorphisms would be independently associated with lower birth weight among their offspring. Methods We assessed 1784 native Japanese mother-child pairs drawn from the ongoing birth cohort of The Hokkaido Study on Environment and Children’s Health. Data (demographic information, hospital birth records, and biological specimens) were extracted from recruitments that took place during the period from February 2003 to March 2006. Maternal serum folate were assayed by chemiluminescent immunoassay, and genotyping of 5,10-MTHFR C677T/A1298C polymorphisms was done using a TaqMan allelic discrimination assay. Results The prevalence of folate deficiency (<6.8 nmol/L) was 0.3%. The 5,10-MTHFR 677CT genotype was independently associated with an increase of 36.40 g (95% CI: 2.60 to 70.30, P = 0.035) in mean infant birth weight and an increase of 90.70 g (95% CI: 6.00 to 175.50, P = 0.036) among male infants of nonsmokers. Female infants of 677TT homozygous passive smokers were 99.00 g (95% CI: −190.26 to −7.56, P = 0.034) lighter. The birth weight of the offspring of smokers with 5,10-MTHFR 1298AA homozygosity was lower by 107.00 g (95% CI: −180.00 to −33.90, P = 0.004). Conclusions The results suggest that, in this population, maternal 5,10-MTHFR C677T polymorphism, but not the 5,10-MTHFR A1298C variant, is independently associated with improvement in infant birth weight, especially among nonsmokers. However, 5,10-MTHFR 1298AA might be associated with folate impairment and could interact with tobacco smoke to further decrease birth weight. PMID:22277790

  13. MTHFR gene C677T and A1298C polymorphisms and homocysteine levels in primary open angle and primary closed angle glaucoma

    PubMed Central

    Micheal, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Muhammad Imran; Khan, Wajid Ali

    2009-01-01

    Purpose To investigate the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C genotypes and plasma concentrations of total homocysteine (tHcy) in Pakistani patients with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). Methods This was a prospective case-control study. A total of 295 patients (173 POAG, 122 PCAG) and 143 age- and sex-matched controls were subdivided into two ethnic groups, Punjabis (Punjab province, central Pakistan) and Pathans (North-West Frontier Province, northern Pakistan). Genotypes of the MTHFR C677T and A1298C polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP). An enzyme-linked immunosorbent assay was used to determine the total serum homocysteine (tHcy) levels. Associations were determined by logistic regression analysis. Results Frequency distributions of genotypes and combined genotypes as well as homocysteine levels were obtained. The overall distribution of the C677T genotype was found to be significantly associated with PCAG (CC 69%, CT 21%, TT 10%; p=0.001, χ2=12.6), but not with POAG (CC 71%, CT 28%, TT 1%; p=0.98, χ2=0.02) as compared to the controls (CC 71%, CT 29%, TT 1%). The Pathan cohorts revealed no association with the disease; however, the Punjabis demonstrated a significant association with PCAG (CC 75%, CT 11%, TT 13%; p<0.001, χ2=17.2). PCAG in the Punjabi subjects was also significantly associated with the A1298C polymorphism (AA 43%, AC 54%, CC 3%; p<0.001, χ2=33.9) as compared to the controls. Combined genotype data showed no association with POAG; however, a significant association with all combined genotypes was observed in the overall PCAG subjects (p<0.05, χ2=20.1). This difference was particularly apparent in the TTAA and TTAC combinations that were completely absent in the control groups (p<0.05. χ2=49.6). Mean serum tHcy levels were found to be significantly increased in the POAG (15.2±1.28 µmol/l, p<0

  14. Prevalence of factor V leiden, MTHFR C677T and MTHFR A1298C polymorphisms in patients with deep vein thrombosis in Central Iran.

    PubMed

    Ehsani, Majid; Imani, Aida; Moravveji, Alireza

    2018-05-31

    Deep vein thrombosis (DVT) is a common disease, especially among elderly patients, which is associated with high costs of treatment and high rates of recurrence. The risk factors for venous thrombosis are primarily related to hypercoagulability, which can be genetic or acquired, or because of immobilization and venous stasis. Among relevant genetic markers are a number of common polymorphisms and mutations in the genes coding for Factor V leiden and methylenetetrahydrofolate reductase. Differential associations of these polymorphisms have been reported in different populations with DVT due to ethnic variations. However, no study has been reported with respect to these polymorphisms in DVT in Iran. Thus, the aim of the present study is to determine the prevalence of FVL, MTHFR C677T and MTHFR A1298C gene polymorphisms in patients with DVT in central Iran. In the present cross-sectional study, a total of 100 patients with first and recurrent episodes of DVT and age less than 70 years were recruited during 2016-2017. Blood sample was collected from the recruited patients and FVL mutation was screened using ARMS-PCR method, MTHFR C677T and MTHFR A1298C mutations were screened using PCR-RFLP method. The results revealed that MTHFR A1298C gene polymorphism in both homozygote and heterozygote form was found to be most frequent i.e. 77% among cases, followed by MTHFR C677T (67%) and FVL (17%). The study highlights the importance of screening of these genetic markers among patients with DVT in this region.

  15. Synergistic effect of methyltetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphism as risk modifiers of pediatric acute lymphoblastic leukemia.

    PubMed

    Kamel, Azza M; Moussa, Heba S; Ebid, Gamal T; Bu, Rong R; Bhatia, Kishor G

    2007-06-01

    ALL is the most common pediatric cancer. The causes of the majority of pediatric acute leukemia are unknown and are likely to involve an interaction between genetic and environmental factors. Therefore, unfavourable gene-environmental interactions might be involved in the genesis of ALL. The aim of this work was to evaluate, in a case-control study, whether the common polymorphisms in 5, 10-methylenetetrahydrofolate reductase (MTHFR) namely (C677T and A1298C) and methionine synthase (MS) (A2756G) genes may play a role in altering susceptibility to pediatric ALL as individual genes and in combination. DNA of 88 ALL patients (age < or = 18 years) and 311 healthy control subjects was analyzed for the polymorphisms of MTHFR and MS genes using PCR-RFLP method. The frequencies of the wild types of MTHFR 677CC, MTHFR 1298AA and MS 2756AA, the homozygous genotypes of MTHFR 677TT, MTHFR 1298CC and MS 2756GG and heterozygous genotypes of MTHFR 677CT and MS 2756AG showed no statistically significant differences between patients and controls. The frequency of the MTHFR 1298AC heterozygous genotype was 25% among patients compared to 45.0% among controls; the difference was found to be statistically significant (p value =0.001, O.R=0.382 & 95% C.I=0.222-0.658). The frequency of the MTHFR1298AC heterozygous genotype plus 1298CC homozygous genotype was 34% among patients compared to 54.3% among controls and the difference was statistically significant (p value =0.001). A synergistic effect of 677CT and1298AC (CTAC) was observed, (p value=0.002) with 3.65 fold protection (OR 0.273 & 95% C.I=0.155-0.9) compared to 2.6 folds for MTHFR 1298AC alone. This protective effect of CTAC polymorphism was abolished when combined with MS 2756AA or AG. The present study provided further evidence for the protective role of MTHFR 1298AC mutant alleles in acute lymphoblastic leukemia in children (2.6 fold protection). This suggests that folate and methionine metabolism play an important role in the

  16. Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

    PubMed

    Lee, Young Ho; Song, Gwan Gyu

    2014-04-01

    The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  17. Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population

    PubMed Central

    2014-01-01

    Background The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). Methods A case–control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. Results No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. Conclusions The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population. PMID:24476575

  18. Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population.

    PubMed

    Li, Xiaolei; Liao, Qingchuan; Zhang, Shunguo; Chen, Minling

    2014-01-29

    The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). A case-control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population.

  19. Methylenetetrahydrofolate reductase C677T polymorphism and Factor V Leiden variant in Mexican women with preeclampsia/eclampsia.

    PubMed

    Dávalos, I P; Moran, M C; Martínez-Abundis, E; González-Ortiz, M; Flores-Martínez, S E; Machorro, V; Sandoval, L; Figuera, L E; Mena, J P; Oliva, J M; Tlacuilo-Parra, J A; Sánchez-Corona, J; Salazar-Páramo, M

    2005-01-01

    The etiology of preeclampsia is still a matter of controversy. An association between hyperhomocysteinemia and preeclamptic patients has been described. A common missense mutation in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with increased plasma homocysteine concentrations. In addition, the polymorphism of gene encoding for Factor V Leiden G1691A is associated with a prothrombotic state in heterozygous subjects. Both mutations in these thrombophilic proteins appear to have different prevalence in the general population and in patients with preeclampsia/eclampsia (PE/E). We studied single nucleotide polymorphisms for MTHFR C677T and coagulation Factor V Leiden in 33 Mexican patients with PE/E as a genetic risk factor for these diseases, comparing with a normotensive pregnant control group. The genotype and allele frequencies of MTHFR C677T and Factor V Leiden mutations between Mexican women with PE/E and healthy controls were not different. We conclude that these polymorphisms do not contribute in the etiology of PE/E as it has been reported in other populations.

  20. MTHFR C677T genotype influences the isotopic enrichment of one-carbon metabolites in folate-compromised men consuming d9-choline.

    PubMed

    Yan, Jian; Wang, Wei; Gregory, Jesse F; Malysheva, Olga; Brenna, J Thomas; Stabler, Sally P; Allen, Robert H; Caudill, Marie A

    2011-02-01

    Homozygosity for the variant 677T allele in the methylenetetrahydrofolate reductase (MTHFR) gene increases the requirement for folate and may alter the metabolic use of choline. The choline adequate intake is 550 mg/d for men, although the metabolic consequences of consuming extra choline are unclear. Deuterium-labeled choline (d9-choline) as tracer was used to determine the differential effects of the MTHFR C677T genotype and the effect of various choline intakes on the isotopic enrichment of choline derivatives in folate-compromised men. Mexican American men with the MTHFR 677CC or 677TT genotype consumed a diet providing 300 mg choline/d plus supplemental choline chloride for total choline intakes of 550 (n = 11; 4 with 677CC and 7 with 677TT) or 1100 (n = 12; 4 with 677CC and 8 with 677TT) mg/d for 12 wk. During the last 3 wk, 15% of the total choline intake was provided as d9-choline. Low but measurable enrichments of the choline metabolites were achieved, including that of d3-phosphatidylcholine (d3-PtdCho)--a metabolite produced in the de novo pathway via choline-derived methyl groups. Men with the MTHFR 677TT genotype had a higher urinary enrichment ratio of betaine to choline (P = 0.041), a higher urinary enrichment of sarcosine (P = 0.041), and a greater plasma enrichment ratio of d9-betaine to d9-PtdCho with the 1100 mg choline/d intake (P = 0.033). These data show for the first time in humans that choline itself is a source of methyl groups for de novo PtdCho biosynthesis and indicate that the MTHFR 677TT genotype favors the use of choline as a methyl donor.

  1. Influence of Combined Methionine Synthase (MTR 2756A > G) and Methylenetetrahydrofolate Reductase (MTHFR 677C > T) Polymorphisms to Plasma Homocysteine Levels in Korean Patients with Ischemic Stroke

    PubMed Central

    Kim, Ok Joon; Hong, Sun Pyo; Ahn, Jung Yong; Hong, Seung Ho; Hwang, Tae Sun; Kim, Soo Ok; Yoo, Wangdon; Oh, Doyeun

    2007-01-01

    Purpose Methionine synthase (MTR) and 5,10-methylenetetrahydrofolate reductase (MTHFR) are the main regulatory enzymes for homocysteine metabolism. The present case-control study was conducted to determine whether there is an association between the MTR 2756A > G or MTHFR 677C > T polymorphism and plasma homocysteine concentration in Korean subjects with ischemic stroke. Materials and Methods DNA samples of 237 patients who had an ischemic stroke and 223 age and sex-matched controls were studied. MTR 2756A > G and MTHFR 677C > T genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results Frequencies of mutant alleles for MTR and MTHFR polymorphisms were not significantly different between the controls and cases. The patient group, however, had significantly higher homocysteine concentrations of the MTR 2756AA and MTHFR 677TT genotypes than the control group (p = 0.04 for MTR, p = 0.01 for MTHFR). The combined MTR 2756AA and MTHFR 677TT genotype (p = 0.04) and the homocysteine concentrations of the patient group were also higher than those of the controls. In addition, the genotype distribution was significant in the MTHFR 677TT genotype (p = 0.008) and combined MTR 2756AA and MTHFR 677TT genotype (p = 0.03), which divided the groups into the top 20% and bottom 20% based on their homocysteine levels. Conclusion The results of the present study demonstrate that the MTR 2756A > G and MTHFR 677C > T polymorphisms interact with elevated total homocysteine (tHcy) levels, leading to an increased risk of ischemic stroke. PMID:17461517

  2. Correlations of MTHFR 677C>T Polymorphism with Cardiovascular Disease in Patients with End-Stage Renal Disease: A Meta-Analysis

    PubMed Central

    Gao, Xian-Hui; Zhang, Guo-Yi; Wang, Ying; Zhang, Hui-Ying

    2014-01-01

    Objective This meta-analysis was conducted to evaluate the correlations of a common polymorphism (677C>T) in the methylenetetrahydrofolate reductase (MTHFR) gene with risk of cardiovascular disease (CVD) in patients with end-stage renal disease (ESRD). Method The following electronic databases were searched without language restrictions: Web of Science (1945∼2013), the Cochrane Library Database (Issue 12, 2013), MEDLINE (1966∼2013), EMBASE (1980∼2013), CINAHL (1982∼2013) and the Chinese Biomedical Database (CBM) (1982∼2013). Meta-analysis was performed using STATA statistical software. Odds ratios (ORs) with their 95% confidence intervals (95%CIs) were calculated. Results Eight cohort studies met all inclusion criteria and were included in this meta-analysis. A total of 2,292 ESRD patients with CVD were involved in this meta-analysis. Our meta-analysis results revealed that the MTHFR 677C>T polymorphism might increase the risk of CVD in ESRD patients (TT vs. CC: OR = 2.75, 95%CI = 1.35∼5.59, P = 0.005; CT+TT vs. CC: OR = 1.39, 95%CI = 1.09∼1.78, P = 0.008; TT vs. CC+CT: OR = 2.52, 95%CI = 1.25∼5.09, P = 0.010; respectively). Further subgroup analysis by ethnicity suggested that the MTHFR 677C>T polymorphism was associated with an elevated risk for CVD in ESRD patients among Asians (TT vs. CC: OR = 3.38, 95%CI = 1.11∼10.28, P = 0.032; CT+TT vs. CC: OR = 1.44, 95%CI = 1.05∼1.97, P = 0.022; TT vs. CC+CT: OR = 3.15, 95%CI = 1.02∼9.72, P = 0.046; respectively), but not among Africans or Caucasians (all P>0.05). Conclusion Our findings indicate that the MTHFR 677C>T polymorphism may be associated with an elevated risk for CVD in ESRD patients, especially among Asians. PMID:25050994

  3. Genetic polymorphism of MTHFR C677T and premature coronary artery disease susceptibility: A meta-analysis.

    PubMed

    Hou, Xiaowen; Chen, Xin; Shi, Jingpu

    2015-07-01

    The association between 5, 10-methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism and premature coronary artery disease (PCAD) is controversial. To explore a more precise estimation of the association, a meta-analysis was conducted in the present study. The relevant studies were identified by searching PubMed, EMBASE, the Web of Science, Cochrane Collaboration Database, Chinese National Knowledge Infrastructure, Wanfang Database and China Biological Medicine up to November, 2014. The meta-analysis was performed by STATA 11. 21 studies with a total of 6912 subjects, including 2972 PCAD patients and 3940 controls. The pooled analysis showed that MTHFR C677T gene polymorphism was probably associated with PCAD (CT vs. CC: OR=1.13, 95% CI=1.01-1.27; dominant model: OR=1.16, 95% CI=1.04-1.29; recessive model: OR=1.19, 95% CI=1.00-1.40; allele analysis: OR=1.17, 95% CI=1.01-1.34). Subgroup analysis by plasma homocysteine concentration showed a significant association in the homocysteine >15μmol/L subgroup (CT vs. CC: OR=1.44, 95% CI=1.10-1.88; TT vs. CC: OR=2.51, 95% CI=1.12-5.63; dominant model: OR=1.51, 95% CI=1.16-1.96; recessive model: OR=2.33, 95% CI=1.05-5.20; allele analysis: OR=1.48, 95% CI=1.18-1.87). Subgroup analysis by continent displayed a significant association among the Asian population (CT vs. CC: OR=1.51, 95% CI=1.23-1.86; TT vs. CC: OR=2.81, 95% CI=1.87-4.23; dominant model: OR=1.65, 95% CI=1.35-2.01; recessive model: OR=2.22, 95% CI=1.53-3.21; allele analysis: OR=1.61, 95% CI=1.37-1.89). The statistical stability and reliability was demonstrated by sensitivity analysis and publication bias outcomes. In conclusion, the meta-analysis suggests that MTHFR C677T gene polymorphism may be associated with PCAD. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Evidence of Paternal N5, N10 - Methylenetetrahydrofolate Reductase (MTHFR) C677T Gene Polymorphism in Couples with Recurrent Spontaneous Abortions (RSAs) in Kolar District- A South West of India

    PubMed Central

    Vanilla, Shiny; Kotur, Pushpa F; Kutty, Moideen A; Vegi, Pradeep Kumar

    2015-01-01

    Introduction: Recurrent spontaneous abortion (RSA) is a multifactorial clinical obstetrics complication commonly occurring in pregnancy. Many research studies have noted the mutations such as C677T in N5, N10 - Methylenetetrahydrofolate reductase (MTHFR)gene which is regarded as RSA risk factor. This study was carried out to determine the occurrence of frequency of C677T of the MTHFR gene mutations with RSA. Aim: The purpose of present study is to determine the frequency of MTHFR C677T polymorphisms in couples with recurrent pregnancy loss and the impact of paternal polymorphisms of MTHFR C677T in recurrent pregnancy loss in population of couples living in Kolar district of Karnataka with RSA. Design: A total of 15 couples with a history of two or more unexplained RSA were enrolled as subjects in the study and a total of 15 couples with normal reproductive history, having two or more children and no history of miscarriages were enrolled as controls. Materials and Methods: DNA extraction from samples case and control group couples and its quantification by Agarose gel electrophoresis, assessment of DNA purity, MTHFR C 677T gene mutation detection by PCR-RFLP method. Statistical analysis: Carried out by web based online SPSS tool. Results: The frequency of C677T genotype showed homozygous wild type CC (80%), heterozygous CT type (13.3%) and homozygous mutation TT type (6.67%) observed in males. Similarly from female’s homozygous wild type CC (86.6%), heterozygous type (13.3%), and homozygous type mutations TT (0%) was recorded. In couple control groups, we observed homozygous wild type CC (86.6%), heterozygous CT type (13.3%) and homozygous type mutations TT type (0%). Conclusion: We noticed a high frequency of MTHFR specifically T allele associated with paternal side.Therefore, the present study indicated the impact of paternal gene polymorphism of MTHFR C677T on screening in couples with recurrent pregnancy loss. PMID:25859445

  5. Methylenetetrahydrofolate Reductase Gene Polymorphisms (C677T and A1298C) and Hemorrhagic Stroke in Moroccan Patients.

    PubMed

    Abidi, Omar; Haissam, Mohammed; Nahili, Halima; El Azhari, Abdessamad; Hilmani, Said; Barakat, Abdelhamid

    2018-07-01

    The number of deaths from hemorrhagic strokes is about twice as high than the number of deaths from ischemic strokes. Genetic risk assessment could play important roles in preventive and therapeutic strategies. The present study was aimed to evaluate whether the MTHFR gene polymorphisms could increase the risk of cerebral hemorrhage in Moroccan patients. A total of 113 patients with hemorrhagic stroke and 323 healthy controls were included in this case-control study. The C677T (rs1801133) and A1298C (rs1801131) MTHFR gene polymorphisms were genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method in all patients and controls. The genotype and allele frequencies were compared between groups using appropriate statistical analyses. Both groups, patients and controls, were in accordance with the Hardy-Weinberg Equilibrium. For the C677T polymorphism, the frequencies of the CC, CT, and TT genotypes were 50.44% versus 46.13%, 39.82% versus 43.03, and 9.73% versus 10.84% in controls versus patients, respectively, whereas for the A1298C polymorphism, the frequencies of the AA, AC, and CC genotypes were 56.64% versus 57.59%, 40.71% versus 37.15, and 2.65% versus 5.26% in controls versus patients, respectively. No statistically significant difference has been proved between patients and controls frequencies (P >.05) for all additive, recessive, and dominant models. Additional analyses including genotypes combination, allelic frequencies, and hemorrhagic stroke patient subtypes did not show any statistically significant difference between controls and patients/subgroup patients. Our findings suggested no association between MTHFR gene polymorphisms and susceptibility to hemorrhagic strokes in Moroccan patients. Further investigations should be conducted to elucidate the roles of other gene variants in the pathogenesis of this condition. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  6. Status of vitamin B-12 and B-6 but not of folate, homocysteine and the methylenetetrahydrofolate reductase C677T polymorphism are associated with impaired cognition and depression in adults

    USDA-ARS?s Scientific Manuscript database

    The C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene differs in frequency in different ethnic groups which have differing prevalence of age-related cognitive impairments. We used a battery of neuropsychological tests to examine association of the MTHFR C677T polymorphism w...

  7. Additive Interaction of MTHFR C677T and MTRR A66G Polymorphisms with Being Overweight/Obesity on the Risk of Type 2 Diabetes.

    PubMed

    Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Li, Yongfang; He, Miao; Wang, Da; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

    2016-12-15

    Although both methylenetetrahydrofolate reductase ( MTHFR ) C677T and methionine synthase reductase ( MTRR ) A66G polymorphisms have been associated with type 2 diabetes (T2D), their interactions with being overweight/obesity on T2D risk remain unclear. To evaluate the associations of the two polymorphisms with T2D and their interactions with being overweight/obesity on T2D risk, a case-control study of 180 T2D patients and 350 healthy controls was conducted in northern China. Additive interaction was estimated using relative excess risk due to interaction (RERI), attributable proportion due to interaction (AP) and synergy index (S). After adjustments for age and gender, borderline significant associations of the MTHFR C677T and MTRR A66G polymorphisms with T2D were observed under recessive (OR = 1.43, 95% CI: 0.98-2.10) and dominant (OR = 1.43, 95% CI: 1.00-2.06) models, respectively. There was a significant interaction between the MTHFR 677TT genotype and being overweight/obesity on T2D risk (AP = 0.404, 95% CI: 0.047-0.761), in addition to the MTRR 66AG/GG genotypes (RERI = 1.703, 95% CI: 0.401-3.004; AP = 0.528, 95% CI: 0.223-0.834). Our findings suggest that individuals with the MTHFR 677TT or MTRR 66AG/GG genotypes are more susceptible to the detrimental effect of being overweight/obesity on T2D. Further large-scale studies are still needed to confirm our findings.

  8. MTHFR c.677C>T is a risk factor for non-syndromic cleft lip with or without cleft palate in Chile.

    PubMed

    Ramírez-Chau, C; Blanco, R; Colombo, A; Pardo, R; Suazo, J

    2016-10-01

    The functional variant within the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene c.677C>T, producing alterations in folate metabolism, has been associated with the risk of non-syndromic cleft lip with or without cleft palate (NSCL/P). We assessed this association in a Chilean population using a combined analysis of case-control and case-parent trio samples. Samples of 165 cases and 291 controls and 121 case-parent trios (sharing the cases) were genotyped. Odds ratio (OR) was estimated for case-control (allele and genotype frequency differences), and this result was confirmed by allele transmission distortion in trios. Due to that these samples are not independent, a combined OR was also computed. Maternal genotype effect was additionally evaluated based on a log-linear method. Borderline but not significant OR (1.28; CI 0.97-1.69) was observed for risk allele (T) in the case-control sample. However, triad sample showed a significant association (OR 1.56: CI 1.09-2.25) which was confirmed by the combined OR (1.37; CI 1.11-1.71). Maternal genotype has been also associated with the phenotype (P = 0.002). In contrast to previous reports considering Chilean subjects, our results demonstrated that the offspring and maternal genotypes for MTHFR c.677C>T variant are strongly associated with NSCL/P in this Chilean population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. DPYD*2A and MTHFR C677T predict toxicity and efficacy, respectively, in patients on chemotherapy with 5-fluorouracil for colorectal cancer.

    PubMed

    Nahid, Noor Ahmed; Apu, Mohd Nazmul Hasan; Islam, Md Reazul; Shabnaz, Samia; Chowdhury, Surid Mohammad; Ahmed, Maizbha Uddin; Nahar, Zabun; Islam, Md Siddiqul; Islam, Mohammad Safiqul; Hasnat, Abul

    2018-01-01

    Significant inter-individual variation in the sensitivity to 5-fluorouracil (5-FU) represents a major therapeutic hindrance either by impairing drug response or inducing adverse drug reactions (ADRs). This study aimed at exploring the cause behind this inter-individual alterations in consequences of 5-fluorouracil-based chemotherapy by investigating the effects of DPYD*2A and MTHFR C677T polymorphisms on toxicity and response of 5-FU in Bangladeshi colorectal cancer patients. Colorectal cancer patients (n = 161) receiving 5-FU-based chemotherapy were prospectively enrolled. DPYD and MTHFR polymorphisms were assessed in peripheral leukocytes. Multivariate analyses were applied to evaluate which variables could predict chemotherapy-induced toxicity and efficacy. Multivariate analyses showed that DPYD*2A polymorphism was a predictive factor (P = 0.023) for grade 3 and grade 4 5-fluorouracil-related toxicities. Although MTHFR C677T polymorphism might act as forecasters for grade 3 or grade 4 neutropenia, diarrhea, and mucositis, this polymorphism was found to increase significantly (P = 0.006) the response of 5-FU. DPYD*2A and MTHFR C677T polymorphisms could explain 5-FU toxicity or clinical outcome in Bangladeshi colorectal patients.

  10. High prevalence of three prothrombotic polymorphisms among Palestinians: factor V G1691A, factor II G20210A and methylenetetrahydrofolate reductase C677T.

    PubMed

    Hussein, Ayman S

    2012-10-01

    Factor V leiden G1691A/R506Q (FVL), prothrombin G20210A (FII) and methylenetetrahydrofolate reductase (MTHFR) C677T are related genetic risk factors for venous thromboembolism. Analysis for those mutations is increasingly being performed on patients exhibiting hypercoagulability. The objective of this study was to determine the prevalence of FVL, FII-G20210A and MTHFR-C677T polymorphisms and their coexistence among apparently healthy Palestinians. After institutional approval, 303 apparently healthy students from An-Najah University representative to North and South regions of West Bank with no previous history of cardiovascular diseases participated in this study. A uniform questionnaire was used to collect relevant information through personal interview with the subjects. The collected information included gender, age, smoking habits, weight and height, diseases such as diabetes, cardiovascular and family history of CVD. The frequencies of allelic distribution of the three prothrombotic polymorphisms factor V G1691A/R506Q), prothrombin G2010A, and MTHFR-C677T were 0.114, 0.050 and 0.071, respectively. The prevalence of the three thrombotic polymorphisms (FVL, FII G20210A and MTHFR-C677T) were 20.1, 9.1 and 13.8 %, respectively. Statistical analysis for factor V leiden showed no significant association between place of residence (P value = 0.953) and gender (P value >0.082). The data presented in this study showed the highest prevalence of FVL among healthy Palestinians compared to other populations and this important finding should be followed in terms of clinical significance.

  11. Association between the MTHFR C677T polymorphism and risk of cancer: evidence from 446 case-control studies.

    PubMed

    Xie, Shu-Zhe; Liu, Zhi-Zhong; Yu, Jun-hua; Liu, Li; Wang, Wei; Xie, Dao-Lin; Qin, Jiang-Bo

    2015-11-01

    Many molecular epidemiological studies have been performed to explore the association between MTHFR C677T polymorphism and cancer risk in diverse populations. However, the results were inconsistent. Hence, we performed a meta-analysis to investigate the association between cancer risk and MTHFR C677T (150,086 cases and 200,699 controls from 446 studies) polymorphism. Overall, significantly increased cancer risk was found when all eligible studies were pooled into the meta-analysis. In the further stratified and sensitivity analyses, significantly increased breast cancer risk was found in Asians and Indians, significantly decreased colon cancer risk was found, significantly decreased colorectal cancer risk was found in male population, significantly increased gastric cancer risk was found in Caucasians and Asians, significantly increased hepatocellular cancer risk was found in Asians, significantly decreased adult acute lymphoblastic leukemia (AALL) risk was found in Caucasians, significantly decreased childhood acute lymphoblastic leukemia (CALL) risk was found in Asians, and significantly increased multiple myeloma and NHL risk was found in Caucasians. In summary, this meta-analysis suggests that MTHFR C677T polymorphism is associated with increased breast cancer, gastric cancer, and hepatocellular cancer risk in Asians, is associated with increased gastric cancer, multiple myeloma, and NHL risk in Caucasians, is associated with decreased AALL risk in Caucasians, is associated with decreased CALL risk in Asians, is associated with increased breast cancer risk in Asians, is associated with decreased colon cancer risk, and is associated with decreased colorectal cancer risk in male population. Moreover, this meta-analysis also points out the importance of new studies, such as Asians of HNC, Asians of lung cancer, and Indians of breast cancer, because they had high heterogeneity in this meta-analysis (I(2) > 75%).

  12. Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

    PubMed

    Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

    2013-11-01

    Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  13. The effect of MTHFR(C677T) genotype on plasma homocysteine concentrations in healthy children is influenced by gender.

    PubMed

    Papoutsakis, C; Yiannakouris, N; Manios, Y; Papaconstantinou, E; Magkos, F; Schulpis, K H; Zampelas, A; Matalas, A L

    2006-02-01

    To explore the influence of gender, together with folate status, on the relation between the common methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and plasma total homocysteine (tHcy) concentrations in healthy children. Cross-sectional study by face-to-face interview. A total of 186 sixth-grade students participated from twelve randomly selected primary schools in Volos, Greece. Fasting tHcy, folate, and vitamin B(12) were measured in plasma. The MTHFR genotypes were determined. Anthropometric and dietary intake data by 24-h recall were collected. Geometric means for plasma tHcy, plasma folate and energy-adjusted dietary folate did not differ between females and males. The homozygous mutant TT genotype was associated with higher tHcy only in children with lower plasma folate concentrations (<19.9 nmol/l, P = 0.012). As a significant gender interaction was observed (P = 0.050), we stratified the lower plasma folate group by gender and found that the association between the genotype and tHcy was restricted to males (P = 0.026). Similar results were obtained when folate status was based on estimated dietary folate. Specifically, only TT males that reported lower dietary folate consumption (<37 microg/MJ/day) had tHcy that was significantly higher than tHcy levels of C-allele carriers (P = 0.001). Under conditions of lower folate status (as estimated by either plasma concentration or reported dietary consumption), gender modifies the association of the MTHFR(C677T) polymorphism with tHcy concentrations in healthy children. Kellog Europe.

  14. Influence of Methylenetetrahydrofolate Reductase C677T Polymorphism on the Risk of Lung Cancer and the Clinical Response to Platinum-Based Chemotherapy for Advanced Non-Small Cell Lung Cancer: An Updated Meta-Analysis

    PubMed Central

    Zhu, Ning; Gong, Yi; He, Jian; Xia, Jingwen

    2013-01-01

    Purpose Methylenetetrahydrofolate reductase (MTHFR) has been implicated in lung cancer risk and response to platinum-based chemotherapy in advanced non-small cell lung cancer (NSCLC). However, the results are controversial. We performed meta-analysis to investigate the effect of MTHFR C677T polymorphism on lung cancer risk and response to platinum-based chemotherapy in advanced NSCLC. Materials and Methods The databases of PubMed, Ovid, Wanfang and Chinese Biomedicine were searched for eligible studies. Nineteen studies on MTHFR C677T polymorphism and lung cancer risk and three articles on C677T polymorphism and response to platinum-based chemotherapy in advanced NSCLC, were identified. Results The results indicated that the allelic contrast, homozygous contrast and recessive model of the MTHFR C677T polymorphism were associated significantly with increased lung cancer risk. In the subgroup analysis, the C677T polymorphism was significantly correlated with an increased risk of NSCLC, with the exception of the recessive model. The dominant model and the variant T allele showed a significant association with lung cancer susceptibility of ever smokers. Male TT homozygote carriers had a higher susceptibility, but the allelic contrast and homozygote model had a protective effect in females. No relationship was observed for SCLC in any comparison model. In addition, MTHFR 677TT homozygote carriers had a better response to platinum-based chemotherapy in advanced NSCLC in the recessive model. Conclusion The MTHFR C677T polymorphism might be a genetic marker for lung cancer risk or response to platinum-based chemotherapy in advanced NSCLC. However, our results require further verification. PMID:24142642

  15. [677T mutation of the MTHFR gene in adenomas and colorectal cancer in a population sample from the Northeastern Mexico. Preliminary results].

    PubMed

    Delgado-Enciso, I; Martínez-Garza, S G; Rojas-Martínez, A; Ortiz-López, R; Bosques-Padilla, F; Calderón-Garcidueñas, A L; Zárate-Gómez, M; Barrera-Saldaña, H A

    2001-01-01

    Adequate intake of folates has been associated to low prevalence of colon cancer. Methylenetetrahydrofolate reductase enzyme (MTHFR) plays an important role in folate metabolism. The role of the 677 mutation at the MTHFR gene in the risk for colorectal cancer remains controversial. A recent report established that this mutation has a high prevalence in the healthy Mexican population. To analyze the prevalence of 677T MTHFR mutation in patients with colorectal cancer and controls without chronic gastrointestinal disorders. Seventy-four colorectal cancer, 32 adenomas and 110 normal samples were analyzed. Patients and controls were matched for sex and age. For each sample, DNA isolation, PCR, and mutation detection by restriction enzyme digestion were performed to determine the allele at the 677 position in the MTHFR gene. Genotype 677C/677C was found in 18.7, 20.3, and 30.9% in adenomas, cancer lesions and controls, respectively. Frequencies of the 677C/677T genotype were 59.4, 56.7, and 47.3%, in adenomas, cancer lesions, and controls, respectively. Genotype 677T/677T was found in 21.9, 23.0, and 21.8% in adenomas, cancer lesions, and controls, respectively. The odds ratio between genotypes carrying the mutation (T/T and C/T) and normal genotype (CC) was 1.81 (IC 95% 0.97-3.3), chi 2 = 3.5, p = 0.06. Our results showed that persons who carry the 677T mutation at MTHFR locus have a tendency for an increased risk for colorectal cancer. This study supports the basic concept that low levels of folic acid contribute with the colorectal cancer pathogenesis. Our lack of statistic significance may be due to reduced sample size.

  16. Gender-specific interactions of MTHFR C677T and MTRR A66G polymorphisms with overweight/obesity on serum lipid levels in a Chinese Han population.

    PubMed

    Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

    2016-10-28

    Little is known regarding the interactions of methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase reductase (MTRR) A66G polymorphisms with overweight/obesity on serum lipid profiles. The aim of the current study was to explore interactions between the two polymorphisms and overweight/obesity on four common lipid levels in a Chinese Han population and further to evaluate whether these interactions exhibit gender-specificity. A total of 2239 participants (750 females and 1489 males) were enrolled into this study. The genotypes of the MTHFR C677T and MTRR A66G were determined by a TaqMan assay. Overweight and obesity were defined as a body mass index between 24 and 27.99 and ≥ 28 kg/m 2 , respectively. The interactions were examined by factorial design covariance analysis, and further multiple comparisons were conducted by Bonferroni correction. There was no significant difference in the genotypic and allelic frequencies between females and males (MTHFR 677 T allele: 54.47 % for females and 54.40 % for males; MTRR 66G allele: 24.73 % for females and 24.71 % for males). Interaction between the MTHFR C677T polymorphism and overweight/obesity on serum triglyceride levels, and interaction between the MTRR A66G polymorphism and overweight/obesity on serum high-density lipoprotein cholesterol levels were detected in women (P = 0.015 and P = 0.056, respectively). For female subjects with overweight/obesity, the serum triglyceride levels in MTHFR 677TT genotype [1.09 (0.78-1.50) mmol/L] were significantly higher as compared with MTHFR 677CC genotype [0.90 (0.60-1.15) mmol/L, P = 0.007], and the MTRR 66GG genotype carriers had higher serum high-density lipoprotein cholesterol levels than those with MTRR 66AG genotype (1.46 ± 0.50 vs. 1.19 ± 0.31 mmol/L, P = 0.058). Furthermore, in male subjects with overweight/obesity, the MTHFR 677CT genotype carriers had higher low-density lipoprotein cholesterol levels than those

  17. The methylenetetrahydrofolate reductase C677T mutation induces cell-specific changes in genomic DNA methylation and uracil misincorporation: A possible molecular basis for the site-specific cancer risk modification

    PubMed Central

    Sohn, Kyoung-Jin; Jang, Hyeran; Campan, Mihaela; Weisenberger, Daniel J.; Dickhout, Jeffrey; Wang, Yi-Cheng; Cho, Robert C.; Yates, Zoe; Lucock, Mark; Chiang, En-Pei; Austin, Richard C.; Choi, Sang-Woon; Laird, Peter W.; Kim, Young-In

    2009-01-01

    The C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with a decreased risk of colon cancer while it may increase the risk of breast cancer. This polymorphism is associated with changes in intracellular folate cofactors, which may affect DNA methylation and synthesis via altered one-carbon transfer reactions. We investigated the effect of this mutation on DNA methylation and uracil misincorporation and its interaction with exogenous folate in further modulating these biomarkers of one-carbon transfer reactions in an in vitro model of the MTHFR 677T mutation in HCT116 colon and MDA-MB-435 breast adenocarcinoma cells. In HCT116 cells, the MTHFR 677T mutation was associated with significantly increased genomic DNA methylation when folate supply was adequate or high; however, in the setting of folate insufficiency, this mutation was associated with significantly decreased genomic DNA methylation. In contrast, in MDA-MB-435 cells, the MTHFR 677T mutation was associated with significantly decreased genomic DNA methylation when folate supply was adequate or high and with no effect when folate supply was low. The MTHFR 677T mutation was associated with a nonsignificant trend toward decreased and increased uracil misincorporation in HCT116 and MDA-MB-435 cells, respectively. Our data demonstrate for the first time a functional consequence of changes in intracellular folate cofactors resulting from the MTHFR 677T mutation in cells derived from the target organs of interest, thus providing a plausible cellular mechanism that may partly explain the site-specific modification of colon and breast cancer risks associated with the MTHFR C677T mutation. PMID:19123462

  18. Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

    PubMed

    Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

    2012-01-01

    Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

  19. Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

    PubMed

    Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

    2012-03-01

    Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

  20. Association of methylenetetrahydrofolate reductase C677T polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central

    2010-01-01

    Background The association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and serum lipid profiles is still controversial in diverse ethnics. Bai Ku Yao is an isolated subgroup of the Yao minority in China. The aim of the present study was to eveluate the association of MTHFR C677T polymorphism and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 780 subjects of Bai Ku Yao and 686 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Genotyping of the MTHFR C677T was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.05-0.001). The frequency of C and T alleles was 77.4% and 22.6% in Bai Ku Yao, and 60.9% and 39.1% in Han (P < 0.001); respectively. The frequency of CC, CT and TT genotypes was 58.7%, 37.3% and 4.0% in Bai Ku Yao, and 32.6%, 56.4% and 11.0% in Han (P < 0.001); respectively. The levels of TC and LDL-C in both ethnic groups were significant differences among the three genotypes (P < 0.05-0.01). The T allele carriers had higher serum TC and LDL-C levels than the T allele noncarriers. The levels of ApoB in Han were significant differences among the three genotypes (P < 0.05). The T allele carriers had higher serum ApoB levels as compared with the T allele noncarriers. The levels of TC, TG and LDL-C in Bai Ku Yao were correlated with genotypes (P < 0.05-0.001), whereas the levels of LDL-C in Han were associated with genotypes (P < 0.001). Serum lipid parameters were also correlated with sex, age, body mass index, alcohol consumption, cigarette smoking, and blood pressure in the both ethnic

  1. Effects of folic acid deficiency and MTHFRC677T polymorphisms on cytotoxicity in human peripheral blood lymphocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu Xiayu; Liang Ziqing; Zou Tianning

    2009-02-13

    Apoptosis (APO) and necrosis (NEC) are two different types of cell death occurring in response to cellular stress factors. Cells with DNA damage may undergo APO or NEC. Folate is an essential micronutrient associated with DNA synthesis, repair and methylation. Methylenetetrahydrofolate reductase (MTHFR) regulates intracellular folate metabolism. Folate deficiency and MTHFR C677T polymorphisms have been shown to be related to DNA damage. To verify the cytotoxic effects of folate deficiency on cells with different MTHFR C677T genotypes, 15 human peripheral lymphocyte cases with different MTHFR C677T genotypes were cultured in folic acid (FA)-deficient and -sufficient media for 9 days. Cytotoxicitymore » was quantified using the frequencies of APO and NEC as endpoints, the nuclear division index (NDI), and the number of viable cells (NVC). These results showed that FA is an important factor in reducing cytotoxicity and increasing cell proliferation. Lymphocytes with the TT genotype proliferated easily under stress and exhibited different responses to FA deficiency than lymphocytes with the CC and CT genotypes. A TT individual may accumulate more cytotoxicity under cytotoxic stress, suggesting that the effects of FA deficiency on cytotoxicity are greater than the effects in individuals with the other MTHFR C677T variants.« less

  2. MTHFR C677T mutation increased the risk of Ischemic Stroke, especially in large-artery atherosclerosis in adults: an updated meta-analysis from 38 researches.

    PubMed

    Cui, Tao

    2016-01-01

    To date, many publications have evaluated the correlation between the Ethylenetetrahydrofolate reductase gene (MTHFR) C677T and Ischemic Stroke susceptibility in adults. However, the results remain inconclusive. The meta-analysis was performed to resolve the problem. Based on 38 studies, dichotomous data were presented as the odds ratio (OR) with a 95% confidence interval (CI). This study found, the carriers of the MTHFR 677C→T variation were more likely to increase the risk of Ischemic Stroke susceptibility in all over pooled population, including Asian and European, but not in African population (Europe: TT vs. CC+TC: OR = 1.364 95% CI = 1.010-1.841 p = 0.043; Asia subgroup: T vs. C: OR = 1.245, 95% CI = 1.141-1.358, p < 0.001; Africa: T vs. C: OR = 1.202, 95% CI = 0.990-1.459, p = 0.062). Among etiology stratified analysis, only large-artery atherosclerosis subgroups had a significant different, and the p value was less than 0.01 in all genetic models (T vs. C: OR = 1.29, 95% CI = 1.09-1.52, p = 0.002; TT+TC vs. CC: OR = 1.27, 95% CI = 1.06-1.51, p = 0.009; TT vs. CC+TC: OR = 1.62, 95% CI = 1.19-2.19, p = 0.002). This meta-analysis suggests that MTHFR C677T mutation increased the risk of Ischemic Stroke in adults, especially in large-artery atherosclerosis.

  3. Genetic effect of MTHFR C677T polymorphism on the structural covariance network and white-matter integrity in Alzheimer's disease.

    PubMed

    Chang, Yu-Tzu; Hsu, Shih-Wei; Tsai, Shih-Jen; Chang, Ya-Ting; Huang, Chi-Wei; Liu, Mu-En; Chen, Nai-Ching; Chang, Wen-Neng; Hsu, Jung-Lung; Lee, Chen-Chang; Chang, Chiung-Chih

    2017-06-01

    The 677 C to T transition in the MTHFR gene is a genetic determinant for hyperhomocysteinemia. We investigated whether this polymorphism modulates gray matter (GM) structural covariance networks independently of white-matter integrity in patients with Alzheimer's disease (AD). GM structural covariance networks were constructed by 3D T1-magnetic resonance imaging and seed-based analysis. The patients were divided into two genotype groups: C homozygotes (n = 73) and T carriers (n = 62). Using diffusion tensor imaging and white-matter parcellation, 11 fiber bundle integrities were compared between the two genotype groups. Cognitive test scores were the major outcome factors. The T carriers had higher homocysteine levels, lower posterior cingulate cortex GM volume, and more clusters in the dorsal medial lobe subsystem showing stronger covariance strength. Both posterior cingulate cortex seed and interconnected peak cluster volumes predicted cognitive test scores, especially in the T carriers. There were no between-group differences in fiber tract diffusion parameters. The MTHFR 677T polymorphism modulates posterior cingulate cortex-anchored structural covariance strength independently of white matter integrities. Hum Brain Mapp 38:3039-3051, 2017. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc.

  4. Methotrexate elimination and toxicity: MTHFR 677C>T polymorphism in patients with primary CNS lymphoma treated with high-dose methotrexate.

    PubMed

    Choi, Yun Jung; Park, Hyangmin; Lee, Ji Sung; Lee, Ju-Yeon; Kim, Shin; Kim, Tae Won; Park, Jung Sun; Kim, Jeong Eun; Yoon, Dok Hyun; Suh, Cheolwon

    2017-12-01

    The genetic association of the methylenetetrahydrofolate reductase gene (MTHFR) 677C>T polymorphism with methotrexate (MTX)-associated toxicity has been evaluated and conflicting results have been reported. The substantial heterogeneity of the studied population was suggested to be a possible explanation because ethnicity, MTX dose, coadministered chemotherapeutic agents, and folinate rescue dosage regimen could alter the MTX toxicity profile. The patient population was homogenized by limiting the cancer type to primary central nervous system lymphoma and chemotherapy protocol to a high-dose MTX monotherapy regimen. A total of 111 patients with 402 chemotherapy courses were analyzed. MTHFR 677C>T polymorphism was identified as an independent predictive marker for MTX-associated hematologic toxicity (odds ratio, 2.60; 95% confidence interval, 1.32-5.09; P = .0055). Clinically significant nephrotoxicity occurred in patients without delayed elimination, suggesting roles for factors other than serum MTX levels. MTX-induced hepatotoxicity and oral mucositis occurred independently of plasma MTX levels. Copyright © 2016 John Wiley & Sons, Ltd.

  5. C677T methylenetetrahydrofolate reductase and plasma homocysteine levels among Thai vegans and omnivores.

    PubMed

    Kajanachumpol, Saowanee; Atamasirikul, Kalayanee; Tantibhedhyangkul, Phieuvit

    2013-01-01

    Hyperhomocysteinemia among vegetarians and vegans is caused mostly by vitamin B12 deficiency. A C-to-T mutation in the methylenetetrahydrofolate reductase (MTHFR) gene results in a thermolabile MTHFR, which may affect homocysteine (Hcy) levels. The importance of this gene mutation among populations depends on the T allele frequency. Blood Hcy, vitamin B12, folate, vitamin B6, and MTHFR C677T mutation status were determined in 109 vegans and 86 omnivores aged 30 - 50 years. The vegans had significantly higher Hcy levels than the omnivores, geometric means (95 % CI) 19.2 (17.0 - 21.7) µmol/L vs. 8.53 (8.12 - 8.95) µmol/L, p < 0.001. A C-to-T mutation in the vegans increased plasma Hcy, albeit insignificantly; geometric means 18.2 µmol/L, 20.4 µmol/L, and 30.0 µmol/L respectively in CC, CT, and TT MTHFR genotypes. There was also a significant decrease in serum folate; geometric means 12.1 ng/mL, 9.33 ng/mL, and 7.20 ng/mL respectively, in the CC, CT, and TT mutants, p = 0.006, and particularly, in the TT mutant compared with the CC wild type, 7.20 ng/mL vs. 12.1 ng/mL, p = 0.023. These findings were not seen in the omnivores. It was concluded that hyperhomocysteinemia is prevalent among Thai vegans due to vitamin B12 deficiency. C-to-T MTHFR mutation contributes only modestly to the hyperhomocysteinemia.

  6. Folate restriction and methylenetetrahydrofolate reductase 677T polymorphism decreases adoMet synthesis via folate-dependent remethylation in human-transformed lymphoblasts.

    PubMed

    Chiang, E-P; Wang, Y-C; Tang, F-Y

    2007-04-01

    The homozygous mutation (677TT) in the methylenetetrahydrofolate reductase (MTHFR) gene reduces enzyme activity and alters cellular folate composition. Previous epidemiological studies reported a potential protective effect of MTHFR677C --> T against acute lymphocytic leukemia and malignant lymphoma, but the mechanism remains to be determined. We investigated the biochemical impacts of MTHFR677C --> T on cellular S-adenosyl methionine (adoMet) synthesis, global DNA methylation, and de novo purine synthesis, all of which are potential regulatory pathways involved in tumorigenesis. Metabolic fluxes of homocysteine remethylation and de novo purine synthesis were compared between Epstein-Barr virus-transformed lymphoblasts expressing MTHFR 677C and MTHFR 677T using stable isotopic tracers and GCMS. MTHFR TT genotype significantly reduced folate-dependent remethylation under folate restriction, reflecting limited methylated folates under folate restriction. Data also suggested increased formylated folate pool and increased purine synthesis when folate is adequate. The impacts of MTHFR 677T polymorphism appeared closely related to folate status, and such alterations may modulate metabolic pathways involved in cancer onset/progression. The advantage of de novo purine synthesis found in the MTHFR TT genotype may account for the protective effect of MTHFR in hematological malignancies. These transformed cells are potential models for studying the consequences of human genetic variation and cancer pathogenesis.

  7. Methylenetetrahydrofolate reductase C677T polymorphism predicts response and time to progression to gemcitabine-based chemotherapy for advanced non-small cell lung cancer in a Chinese Han population*

    PubMed Central

    Hong, Wei; Wang, Kai; Zhang, Yi-ping; Kou, Jun-yan; Hong, Dan; Su, Dan; Mao, Wei-min; Yu, Xin-min; Xie, Fa-jun; Wang, Xiao-jian

    2013-01-01

    Objective: The aim of this study was to evaluate the association between the methylenetetrahydrofolate reductase (MTHFR) C677T excision repair cross-complementation group 1 (ERCC1) genetic polymorphisms and the clinical efficacy of gemcitabine-based chemotherapy in advanced non-small cell lung cancer (NSCLC). Methods: A total of 135 chemonaive patients with unresectable advanced NSCLC were treated with gemcitabine/platinum regimens. The polymorphisms of MTHFR C677T, ERCC1 C8092A, and ERCC1 C118T were genotyped using the TaqMan methods. Results: The overall response rate was 28.9%. Patients with MTHFR CC genotype had a higher rate of objective response than patients with variant genotype (TT or CT) (41.2% versus 19.1%, P=0.01). Median time to progression (TTP) of patients with MTHFR CC genotype was longer than that of patients with variant genotype (7.6 months versus 5.0 months, P=0.003). No significant associations were obtained between ERCC1 C118T and C8092A polymorphisms and both response and survival. Conclusions: Our data suggest the value of MTHFR C677T polymorphism as a possible predictive marker of response and TTP in advanced NSCLC patients treated with gemcitabine/platinum. PMID:23463763

  8. Association of PHB 1630 C>T and MTHFR 677 C>T polymorphisms with breast and ovarian cancer risk in BRCA1/2 mutation carriers: results from a multicenter study

    PubMed Central

    Jakubowska, A; Rozkrut, D; Antoniou, A; Hamann, U; Scott, R J; McGuffog, L; Healy, S; Sinilnikova, O M; Rennert, G; Lejbkowicz, F; Flugelman, A; Andrulis, I L; Glendon, G; Ozcelik, H; Thomassen, M; Paligo, M; Aretini, P; Kantala, J; Aroer, B; von Wachenfeldt, A; Liljegren, A; Loman, N; Herbst, K; Kristoffersson, U; Rosenquist, R; Karlsson, P; Stenmark-Askmalm, M; Melin, B; Nathanson, K L; Domchek, S M; Byrski, T; Huzarski, T; Gronwald, J; Menkiszak, J; Cybulski, C; Serrano, P; Osorio, A; Cajal, T R; Tsitlaidou, M; Benítez, J; Gilbert, M; Rookus, M; Aalfs, C M; Kluijt, I; Boessenkool-Pape, J L; Meijers-Heijboer, H E J; Oosterwijk, J C; van Asperen, C J; Blok, M J; Nelen, M R; van den Ouweland, A M W; Seynaeve, C; van der Luijt, R B; Devilee, P; Easton, D F; Peock, S; Frost, D; Platte, R; Ellis, S D; Fineberg, E; Evans, D G; Lalloo, F; Eeles, R; Jacobs, C; Adlard, J; Davidson, R; Eccles, D; Cole, T; Cook, J; Godwin, A; Bove, B; Stoppa-Lyonnet, D; Caux-Moncoutier, V; Belotti, M; Tirapo, C; Mazoyer, S; Barjhoux, L; Boutry-Kryza, N; Pujol, P; Coupier, I; Peyrat, J-P; Vennin, P; Muller, D; Fricker, J-P; Venat-Bouvet, L; Johannsson, O Th; Isaacs, C; Schmutzler, R; Wappenschmidt, B; Meindl, A; Arnold, N; Varon-Mateeva, R; Niederacher, D; Sutter, C; Deissler, H; Preisler-Adams, S; Simard, J; Soucy, P; Durocher, F; Chenevix-Trench, G; Beesley, J; Chen, X; Rebbeck, T; Couch, F; Wang, X; Lindor, N; Fredericksen, Z; Pankratz, V S; Peterlongo, P; Bonanni, B; Fortuzzi, S; Peissel, B; Szabo, C; Mai, P L; Loud, J T; Lubinski, J

    2012-01-01

    Background: The variable penetrance of breast cancer in BRCA1/2 mutation carriers suggests that other genetic or environmental factors modify breast cancer risk. Two genes of special interest are prohibitin (PHB) and methylene-tetrahydrofolate reductase (MTHFR), both of which are important either directly or indirectly in maintaining genomic integrity. Methods: To evaluate the potential role of genetic variants within PHB and MTHFR in breast and ovarian cancer risk, 4102 BRCA1 and 2093 BRCA2 mutation carriers, and 6211 BRCA1 and 2902 BRCA2 carriers from the Consortium of Investigators of Modifiers of BRCA1 and BRCA2 (CIMBA) were genotyped for the PHB 1630 C>T (rs6917) polymorphism and the MTHFR 677 C>T (rs1801133) polymorphism, respectively. Results: There was no evidence of association between the PHB 1630 C>T and MTHFR 677 C>T polymorphisms with either disease for BRCA1 or BRCA2 mutation carriers when breast and ovarian cancer associations were evaluated separately. Analysis that evaluated associations for breast and ovarian cancer simultaneously showed some evidence that BRCA1 mutation carriers who had the rare homozygote genotype (TT) of the PHB 1630 C>T polymorphism were at increased risk of both breast and ovarian cancer (HR 1.50, 95%CI 1.10–2.04 and HR 2.16, 95%CI 1.24–3.76, respectively). However, there was no evidence of association under a multiplicative model for the effect of each minor allele. Conclusion: The PHB 1630TT genotype may modify breast and ovarian cancer risks in BRCA1 mutation carriers. This association need to be evaluated in larger series of BRCA1 mutation carriers. PMID:22669161

  9. Evaluation of Factor V Leiden, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C gene polymorphisms in retinopathy of prematurity in a Turkish cohort.

    PubMed

    Aydin, Hatip; Gunay, Murat; Celik, Gokhan; Gunay, Betul Onal; Aydin, Umeyye Taka; Karaman, Ali

    2016-12-01

    To assess Factor V Leiden (FVL) (rs6025), Prothrombin G20210A (rs1799963), MTHFR C677T (rs1801133), and MTHFR A1298C (rs1801131) gene mutations as risk factors in the development of retinopathy of prematurity (ROP). A total of 105 children were included in this cross-sectional study. Patients were divided into two groups. The study group consisted of 55 infants with a history of ROP and the control group comprised 50 healthy infants with term birth. All subjects were screened for the presence of certain mutations (FVL, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C) by Real-Time PCR at 1 year of age. The mean gestational age (GA) and birth weight (BW) of the study group were, 28.65 ± 2.85 weeks and 1171 ± 385.74 g, respectively. There were no significant differences of genotype and allele frequency of Prothrombin G20210A, MTHFR A1298C and MTHFR C677T between the study and control groups (p > 0.05). Eight children (14.5 %) had heterozygous and one child (1.8%) had homozygous FVL mutation in the study group. One child (2%) in the control group had heterozygous FVL mutation. There was statistically significant differences of FVL allele and genotype frequencies between the groups (p < 0.05). The prevalence of FVL polymorphism (16.3 %) was higher in ROP patients than control subjects in this Turkish cohort. We suggest a possible association of FVL mutation with ROP at the end of the study.

  10. MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families

    DTIC Science & Technology

    2014-12-01

    facts that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T...allele leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

  11. Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population

    PubMed Central

    Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

    2015-01-01

    Abstract The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population. A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group). Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model. Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population. PMID:26717388

  12. Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population.

    PubMed

    Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

    2015-12-01

    The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population.A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group).Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model.Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population.

  13. The association between MTHFR 677C>T genotype and folate status and genomic and gene-specific DNA methylation in the colon of individuals without colorectal neoplasia.

    PubMed

    Hanks, Joanna; Ayed, Iyeman; Kukreja, Neil; Rogers, Chris; Harris, Jessica; Gheorghiu, Alina; Liu, Chee Ling; Emery, Peter; Pufulete, Maria

    2013-12-01

    Decreased genomic and increased gene-specific DNA methylation predispose to colorectal cancer. Dietary folate intake and the methylenetetrahydrofolate reductase polymorphism (MTHFR 677C>T) may influence risk by modifying DNA methylation. We investigated the associations between MTHFR 677C>T genotype, folate status, and DNA methylation in the colon. We conducted a cross-sectional study of 336 men and women (age 19-92 y) in the United Kingdom without colorectal neoplasia. We obtained blood samples for measurement of serum and red blood cell folate, plasma homocysteine, and MTHFR 677C>T genotype and colonic tissue biopsies for measurement of colonic tissue folate and DNA methylation (genomic- and gene-specific, estrogen receptor 1, ESR1; myoblast determination protein 1, MYOD1; insulin-like growth factor II, IGF2; tumor suppressor candidate 33, N33; adenomatous polyposis coli, APC; mut-L homolog 1, MLH1; and O(6)-methylguanine-DNA methyltransferase, MGMT) by liquid chromatography/electrospray ionization mass spectrometry and pyrosequencing, respectively. Of the 336 subjects recruited, 185 (55%) carried the CC, 119 (35%) the CT, and 32 (10%) the TT alleles. No significant differences in systemic markers of folate status and colonic tissue folate between genotypes were found. The MTHFR TT genotype was not associated with genomic or gene-specific DNA methylation. Biomarkers of folate status were not associated with genomic DNA methylation. Relations between biomarkers of folate status and gene-specific methylation were inconsistent. However, low serum folate was associated with high MGMT methylation (P = 0.001). MTHFR 677C>T genotype and folate status were generally not associated with DNA methylation in the colon of a folate-replete population without neoplasia.

  14. Normal Weight Obese syndrome: role of single nucleotide polymorphism of IL-1 5Ralpha and MTHFR 677C-->T genes in the relationship between body composition and resting metabolic rate.

    PubMed

    Di Renzo, L; Bigioni, M; Bottini, F G; Del Gobbo, V; Premrov, M G; Cianci, R; De Lorenzo, A

    2006-01-01

    We have identified a subset of metabolically obese, but normal weight individuals, with potentially increased risks of developing the metabolic syndrome, despite their normal body mass index. We determined the relationship among body fat distribution, resting metabolic rate (RMR), total body water amount (%TBW), selected gene polymorphism on interleukin-15 receptor-alpha (IL-15Ralpha) and methylenetetrahydrofolate reductase 677C-->T (MTHFR 677C-->T), to distinguish normal weight obese (NWO) from nonobese with a normal metabolic profile and obese individuals. We analysed anthropometric variables, body composition by Dual energy X-ray Absorptiometry (DXA), RMR by indirect calorimetry, %TBW by bioimpedence analysis (BIA), MTHFR 677C-->T and IL-15Ralpha genotypes of 128 clinically healthy Caucasian individuals. We compared a group of female, defined as NWO and characterised by a BMI < or = 25 kg/m(2) and FM > or = 30% with groups of others female, and males, represented by nonobese with a BMI < or = 25 kg/m(2) and FM < or = 30%, and preobese-obese individuals with BMI > or = 25 kg/m(2) and %FM > or = 30%; none of the males was classified as NWO. Significant correlations were found among body fat mass distribution, metabolic variables, percentage of total body water distribution and selected genetic variations. The variables that contributed significantly to the separation of classes were body tissue (Tissue), %TBW, RMR, the volumes of both oxygen (VO2) and carbon dioxide (VCO2). The distribution of MTHFR 677C-->T and IL-15 genotypes was significantly different between classes. Our data highlight that NWO individuals showed a significant relationship between the decrease in the basal metabolism (RMR), body fat mass increasing and total water amount. Possession of wild type homozygotes genotypes regarding IL-15Ralpha cytokine and 677C-->T MTHFR enzyme characterised NWO individuals.

  15. Association of 5, 10- methylenetetrahydrofolate reductase C677T polymorphism in susceptibility to tropical chronic pancreatitis in north Indian population.

    PubMed

    Singh, S; Choudhuri, G; Kumar, R; Agarwal, S

    2012-12-22

    MTHFR is a key enzyme in folate metabolism that catalyzes the conversion of 5, 10—methlenetetrahydrofolate (5, 10— methylene THF) to 5—methyltetrahydrofolate (5—methyl THF), a predominant circulatory form of folate and methyl donor for the remethylation of homocysteine to methionine. Some studies have shown that C667T polymorphism increases the risk of pancreatic cancer. Since MTHFR is involved in methylation, inflammation and protection against oxidative stress, the processes especially important for pancreatic homeostasis. The altered enzyme activity could play a role in pancreatic injury. The role of MTHFR C677T polymorphism in chronic pancreatitis has been explored by conducting a hospital based; case—control study involving 100 patients radiologically confirmed chronic pancreatitis and 329 healthy controls. All samples were analyzed for MTHFR C677T polymorphism using PCR—RFLP method. Restriction enzyme Hinf I was used to digest the 198 bp amplified product. The frequency of the MTHFR was 57.3%, 34.1% and 8.5% among cases compared with 87.2%,11.2% and 1.5% of controls for CC, CT and TT genotypes, respectively. The T Allele frequency was found significantly higher in patients than in controls. A significant association with T allele was observed with p—value (< 0.0001) odds ratio 4.475 and (95% CI=2.961—7.046). It could be predisposing to the traditional risk factors such as diabetes, dietary, alcohal and smoking habit that are known to be associated with chronic pancreatitis. Additionally it was observed that smoking increases the risk of chronic pancreatitis by 4.1 times. The T allele frequency of MTHFR (C667T) was found to be a significant risk factor for chronic pancreatitis playing a crucial role in altered folate metabolsim.

  16. MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families. Revision

    DTIC Science & Technology

    2013-10-01

    that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T allele...leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

  17. Supplementation with Watermelon Extract Reduces Total Cholesterol and LDL Cholesterol in Adults with Dyslipidemia under the Influence of the MTHFR C677T Polymorphism.

    PubMed

    Massa, Nayara M L; Silva, Alexandre S; de Oliveira, Caio V C; Costa, Maria J C; Persuhn, Darlene C; Barbosa, Carlos V S; Gonçalves, Maria da C R

    2016-08-01

    Dyslipidemia and genetic polymorphisms are associated with increased risk for developing cardiovascular diseases, and watermelon appears to have the potential to improve hyperlipidemia due to the presence of nutrients such as arginine and citrulline. To test the hypolipidemic effect of watermelon extract (Citrullus lanatus) and the influence of the methylenetetrahydrofolate reductase genotype (MTHFR C677T) on supplementation response. This is an experimental clinical phase II randomized and double-blind study. Forty-three subjects with dyslipidemia were randomly divided into 2 groups: experimental (n = 22) and control (n = 21) groups. The subjects were supplemented daily for 42 days with 6 g of watermelon extract or a mixture of carbohydrates (sucrose/glucose/fructose). The use of watermelon extract reduced plasma total cholesterol (p < 0.05) and low-density lipoprotein (p < 0.01) without modifying triglycerides, high-density lipoprotein, and very low-density lipoprotein values. Only carriers of the T allele (MTHFR C677T) showed decreasing concentrations of low-density lipoprotein (p < 0.01). No changes in anthropometric parameters analyzed were observed. This is the first study to demonstrate the beneficial effect of the consumption of watermelon extract in reducing plasma levels of lipids in humans. The MTHFR C677T polymorphism did not affect the plasma lipid concentration but made individuals more responsive to treatment with watermelon. The consumption of this functional food represents an alternative therapy in the combined treatment of patients with dyslipidemia, promoting health and minimizing the development of risk factors for cardiovascular diseases.

  18. MTHFR (C677T) polymorphism and PR (PROGINS) mutation as genetic factors for preterm delivery, fetal death and low birth weight: A Northeast Indian population based study.

    PubMed

    Tiwari, Diptika; Bose, Purabi Deka; Das, Somdatta; Das, Chandana Ray; Datta, Ratul; Bose, Sujoy

    2015-02-01

    Preterm delivery (PTD) is one of the most significant contributors to neonatal mortality, morbidity, and long-term adverse consequences for health; with highest prevalence reported from India. The incidence of PTD is alarmingly very high in Northeast India. The objective of the present study is to evaluate the associative role of MTHFR gene polymorphism and progesterone receptor (PR) gene mutation (PROGINS) in susceptibility to PTD, negative pregnancy outcome and low birth weights (LBW) in Northeast Indian population. A total of 209 PTD cases {extreme preterm (< 28 weeks of gestation, n = 22), very preterm (28-32 weeks of gestation, n = 43) and moderate preterm (32-37 weeks of gestation, n = 144) and 194 term delivery cases were studied for MTHFR C677T polymorphism and PR (PROGINS) gene mutation. Statistical analysis was performed using SPSS software. Distribution of MTHFR and PR mutation was higher in PTD cases. Presence of MTHFR C677T polymorphism was significantly associated and resulted in the increased risk of PTD (p < 0.001), negative pregnancy outcome (p < 0.001) and LBW (p = 0.001); more significantly in extreme and very preterm cases. Presence of PR mutation (PROGINS) also resulted in increased risk of PTD and negative pregnancy outcome; but importantly was found to increase the risk of LBW significantly in case of very preterm (p < 0.001) and moderately preterm (p < 0.001) delivery cases. Both MTHFR C677T polymorphism and PR (PROGINS) mutation are evident genetic risk factors associated with the susceptibility of PTD, negative pregnancy outcome and LBW. MTHFR C677T may be used as a prognostic marker to stratify subpopulation of pregnancy cases predisposed to PTD; thereby controlling the risks associated with PTD.

  19. MTHFR C677T Polymorphism is Associated with Tumor Response to Preoperative Chemoradiotherapy: A Result Based on Previous Reports.

    PubMed

    Zhao, Yue; Li, Xingde; Kong, Xiangjun

    2015-10-12

    Preoperative chemoradiotherapy (pRCT) followed by surgery has been widely practiced in locally advanced rectal cancer, esophageal cancer, gastric cancer and other cancers. However, the therapy also exerts some severe adverse effects and some of the patients show poor or no response. It is very important to develop biomarkers (e.g., gene polymorphisms) to identify patients who have a higher likelihood of responding to pRCT. Recently, a series of reports have investigated the association of the genetic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) and epidermal growth factor receptor (EGFR) genes with the tumor response to pRCT; however, the results were inconsistent and inconclusive. A systematic review and meta-analysis was performed by searching relevant studies about the association of MTHFR and EGFR polymorphisms with the tumor regression grade (TRG) in response to pRCT in databases of PubMed, EMBAS, Web of science, Chinese National Knowledge Infrastructure, and Wanfang database up to March 30, 2015. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (95% CIs) were calculated to assess the strength of the association under 5 genetic models. A total of 11 eligible articles were included in the present meta-analysis, of which 8 studies were performed in rectal cancer and 3 studies were performed in esophageal cancer. We finally included 8 included studies containing 839 cases for MTHFR C677T, 5 studies involving 634 cases for MTHFR A1298C, 3 studies containing 340 cases for EGFR G497A, and 4 studies containing 396 cases for EGFR CA repeat. The pooled analysis results indicated that MTHFR C677T might be correlated with the tumor response to pRCT under the recessive model (CC vs. CTTT) in overall analysis (OR=1.426(1.074-1.894), P=0.014), rectal cancer (OR=1.483(1.102-1.996), P=0.009), and TRG 1-2 vs. 3-5 group (OR=1.423(1.046-1.936), P=0.025), while other polymorphism including MTHFR A1298C, EGFR G497A, and EGFR CA repeat

  20. Methylenetetrahydrofolate reductase (MTHFR) gene 677C>T and 1298A>C polymorphisms are associated with differential apoptosis of leukemic B cells in vitro and disease progression in chronic lymphocytic leukemia.

    PubMed

    Nückel, H; Frey, U H; Dürig, J; Dührsen, U; Siffert, W

    2004-11-01

    Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. We investigated whether the two genetic MTHFR polymorphisms (677C>T and 1298A>C) are associated with an increased risk for chronic lymphocytic leukemia (CLL) or may predict disease progression. Moreover, we measured potential genotype effects on apoptosis of B-CLL cells.Allele frequencies and genotype distributions for both polymorphisms were not significantly different in 111 patients vs 92 healthy controls. While progression-free survival (PFS) was not significantly different in individuals with CLL including all stages, in patients with Binet stage A PFS was significantly longer in patients displaying the MTHFR 677CC (P=0.043) and the MTHFR 1298A/C or CC genotypes (P=0.019). In a multivariate analysis, MTHFR haplotype (677CC plus 1298CC or A/C) was the best independent prognostic factor for PFS compared with other known prognostic factors. Spontaneous apoptosis of B-CLL cells in vitro was significantly increased in the favorable risk group with MTHFR 677CC and MTHFR 1298AC, which may constitute the cellular basis of the observed associations. While MTHFR polymorphisms do not affect the risk for B-CLL, they may be independent prognostic markers that influence the PFS in patients with early-stage B-CLL.

  1. Role of treatment-modifying MTHFR677C>T and 1298A>C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy.

    PubMed

    Jiménez-Ramírez, Francisco J; Castro, Liza M; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y; Morales-Borges, Raúl H; Miranda-Massari, Jorge R; Duconge, Jorge

    2017-03-01

    The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C>T and 1298A>C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer's exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p<0.0001 and p=0.03, respectively). Results suggest that 1298A>C but not 677C>T is associated with DPN susceptibility in this cohort (p=0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN.

  2. Prevalence of MTHFR C677T and MS A2756G polymorphisms in major depressive disorder, and their impact on response to fluoxetine treatment

    USDA-ARS?s Scientific Manuscript database

    To examine the prevalence of the C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene and the A2756G polymorphism of methionine synthase (MS), and their impact on antidepressant response. We screened 224 subjects (52% female, mean age 39 +/- 11 years) with SCID-diagnosed major...

  3. Role of treatment-modifying MTHFR677C>T and 1298A > C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy

    PubMed Central

    Jiménez-Ramírez, Francisco J.; Castro, Liza M.; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y.; Morales-Borges, Raúl H.; Miranda-Massari, Jorge R.; Duconge, Jorge

    2017-01-01

    Background The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. Methods DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C > T and 1298A > C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer’s exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Results Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p < 0.0001 and p = 0.03, respectively). Results suggest that 1298A > C but not 677C > T is associated with DPN susceptibility in this cohort (p = 0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Conclusions Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN. PMID:28231061

  4. MTHFR 677C-->T and 1298A-->C polymorphisms in children with Down syndrome and acute myeloid leukemia in Brazil.

    PubMed

    Amorim, Marcia R; Zanrosso, Crisiane Wais; Magalhães, Isis Q; Pereira, Simone C; Figueiredo, Alexandre; Emerenciano, Mariana; Pinheiro, Vitoria Regia; d'Andréa, Maria Lydia; Orioli, Ieda M; Koifman, Sergio; Pombo-de-Oliveira, Maria S

    2008-12-01

    Down syndrome (DS) is an important risk factor associated with acute leukemia (AL). The presence of polymorphisms that reduce 5,10-methylenetetrahydrofolate reductase (MTHFR) activity has been linked to the multifactorial leukemogenic process. The authors have conducted a study to test whether 677C-->T and/or 1298A-->C polymorphisms of MTHFR would play an additional role in susceptibility of acute myeloid leukemia (AML) in DS children. They also verified whether any polymorphism in the MTHFR gene was associated with the risk of DS. Genetic polymorphisms determination was carried out in 248 samples from healthy individuals as controls and a total of 115 DS children (65 without leukemia and 50 with AML). The present study failed to reveal any association between these polymorphisms and risk of AML in DS children. The data also indicate that MTHFR polymorphisms are not associated with risk of being a DS child.

  5. Response of serum and red blood cell folate concentrations to folic acid supplementation depends on methylenetetrahydrofolate reductase C677T genotype: Results from a crossover trial

    PubMed Central

    Anderson, Cheryl A.M.; Beresford, Shirley A. A.; McLerran, Dale; Lampe, Johanna W.; Deeb, Samir; Feng, Ziding; Motulsky, Arno G.

    2013-01-01

    Scope By increasing blood folate concentrations, folic acid supplementation reduces risk for neural tube defect-affected pregnancies, and lowers homocysteine concentrations. We assessed response of red blood cell (RBC) and serum folate to folic acid supplementation, and examined association of response with the genetic polymorphism C677T of the methylenetetrahydrofolate NAD(P)H (MTHFR) gene. Methods and Results Randomized, controlled, crossover trial with two folic acid supplement treatment periods and a 30-week washout period. The primary outcome is blood folate (serum and RBC) concentrations. Volunteers (n=142) aged 18-69 were randomized to two of three doses (0, 200, and 400 μg) of folic acid for twelve weeks. Serum folate response depended on treatment period with significant responses to 200 μg seen only in the second treatment periods (4.4 ng/mL or 3.4 ng/mL). Additionally, serum folate increased as folic acid dose increased to 400 μg (p< 0.01) and response was greater after the washout period (8.7 ng/mL), than after a 6-week run-in (2.3 ng/mL). The differential change attributable to a daily supplement of 400 μg compared to 200 μg was 96.8 ng/mL; while the change attributable to 400 μg compared to 0 μg was 121.4. Increases in RBC folate concentrations with 400 μg occurred within MTHFR gene mutation (C677T); and in the African American group. Conclusions Serum folate concentration is responsive to modest increases in folic acid intake. Red blood cell folate increases only with higher additional doses of folic acid supplementation, and this is true for each MTHFR C677T genotype. PMID:23456769

  6. A hybrid stochastic model of folate-mediated one-carbon metabolism: Effect of the common C677T MTHFR variant on de novo thymidylate biosynthesis.

    PubMed

    Misselbeck, Karla; Marchetti, Luca; Field, Martha S; Scotti, Marco; Priami, Corrado; Stover, Patrick J

    2017-04-11

    Folate-mediated one-carbon metabolism (FOCM) is an interconnected network of metabolic pathways, including those required for the de novo synthesis of dTMP and purine nucleotides and for remethylation of homocysteine to methionine. Mouse models of folate-responsive neural tube defects (NTDs) indicate that impaired de novo thymidylate (dTMP) synthesis through changes in SHMT expression is causative in folate-responsive NTDs. We have created a hybrid computational model comprised of ordinary differential equations and stochastic simulation. We investigated whether the de novo dTMP synthesis pathway was sensitive to perturbations in FOCM that are known to be associated with human NTDs. This computational model shows that de novo dTMP synthesis is highly sensitive to the common MTHFR C677T polymorphism and that the effect of the polymorphism on FOCM is greater in folate deficiency. Computational simulations indicate that the MTHFR C677T polymorphism and folate deficiency interact to increase the stochastic behavior of the FOCM network, with the greatest instability observed for reactions catalyzed by serine hydroxymethyltransferase (SHMT). Furthermore, we show that de novo dTMP synthesis does not occur in the cytosol at rates sufficient for DNA replication, supporting empirical data indicating that impaired nuclear de novo dTMP synthesis results in uracil misincorporation into DNA.

  7. Methylenetetrahydrofolate reductase C677T polymorphism: association with risk for childhood acute lymphoblastic leukemia and response during the initial phase of chemotherapy in greek patients.

    PubMed

    Chatzidakis, Konstantinos; Goulas, Antonis; Athanassiadou-Piperopoulou, Fani; Fidani, Liana; Koliouskas, Dimitrios; Mirtsou, Vassiliki

    2006-08-01

    As of late, a number of studies have focused on the association of the gene for methyletetrahydrofolate reductase (MTHFR) with risk for acute lymphoblastic leukemia (ALL) in children and in adults, as well as with response to chemotherapy. The degree of this association may vary according to the ethnic background and geographic localization of the population under study, or the phase of treatment when response to chemotherapy is concerned. We have analyzed the MTHFR C677T polymorphism in 52 patients and 88 control individuals, all ethnic Greek residents of northern Greece, and examined the association of this polymorphism with (a) susceptibility to childhood ALL and (b) the distribution of average plasma alanine aminotransferase (ALT) levels, white blood cell counts (WBC), and hemoglobin levels (Hb) during the induction and consolidation phases of treatment. We were able to detect a statistically significant protective effect, with respect to ALL, associated with carriage of the MTHFR 677T allele [OR = 0.387 (95% CI = 0.193-0.776)]. In addition, we observed a general tendency towards lower values in all three parameters studied, associated with the MTHFR 677CC genotype, which was more evident in the transition from the induction to the consolidation phase, indicating that MTHFR genotyping may be of prognostic value in the early phase of treatment for childhood ALL, in our population.

  8. The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

    PubMed

    Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

    2018-08-01

    Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  9. A Lower Degree of PBMC L1 Methylation in Women with Lower Folate Status May Explain the MTHFR C677T Polymorphism Associated Higher Risk of CIN in the US Post Folic Acid Fortification Era

    PubMed Central

    Badiga, Suguna; Johanning, Gary L.; Macaluso, Maurizio; Azuero, Andres; Chambers, Michelle M.; Siddiqui, Nuzhat R.; Piyathilake, Chandrika J.

    2014-01-01

    Background Studies in populations unexposed to folic acid (FA) fortification have demonstrated that MTHFR C677T polymorphism is associated with increased risk of higher grades of cervical intraepithelial neoplasia (CIN 2+). However, it is unknown whether exposure to higher folate as a result of the FA fortification program has altered the association between MTHFR C677T and risk of CIN, or the mechanisms involved with such alterations. The current study investigated the following in a FA fortified population: 1) The association between MTHFR C677T polymorphism and risk of CIN 2+; 2) The modifying effects of plasma folate concentrations on this association; and 3) The modifying effects of plasma folate on the association between the polymorphism and degree of methylation of long interspersed nucleotide elements (L1s), in peripheral blood mononuclear cell (PBMC) DNA, a documented biomarker of CIN risk. Methods The study included 457 US women diagnosed with either CIN 2+ (cases) or ≤ CIN 1 (non-cases). Unconditional logistic regression models were used to test the associations after adjusting for relevant risk factors for CIN. Results The 677CT/TT MTHFR genotypes were not associated with the risk of CIN 2+. Women with CT/TT genotype with lower folate, however, were more likely to be diagnosed with CIN 2+ compared to women with CT/TT genotype with higher folate (OR = 2.41, P = 0.030). Women with CT/TT genotype with lower folate were less likely to have a higher degree of PBMC L1 methylation compared to women with CT/TT genotype with higher folate (OR = 0.28, P = 0.017). Conclusions This study provides the first evidence that the MTHFR 677CT/TT genotype-associated lower degree of PBMC L1 methylation increases the risk of CIN 2+ in women in the US post-FA fortification era. Thus, even in the post-FA fortification era, not all women have adequate folate status to overcome MTHFR 677CT/TT genotype-associated lower degree of L1 methylation. PMID:25302494

  10. Methylenetetrahydrofolate reductase (MTHFR) C677T and thymidylate synthase promoter (TSER) polymorphisms in Indonesian children with and without leukemia.

    PubMed

    Giovannetti, Elisa; Ugrasena, Dewa G; Supriyadi, Eddy; Vroling, Laura; Azzarello, Antonino; de Lange, Desiree; Peters, Godefridus J; Veerman, Anjo J P; Cloos, Jacqueline

    2008-01-01

    Genetic variations in the polymorphic tandem repeat sequence of the enhancer region of the thymidylate synthase promoter (TSER), as well as in methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, influence methotrexate sensitivity. We studied these polymorphisms in children with acute lymphoblastic leukaemia (ALL) and in subjects without malignancy in Indonesia and Holland. The frequencies of TT and CT genotypes were two-fold higher in Dutch children. The TSER 3R/3R repeat was three-fold more frequent in the Indonesian children, while the 2R/2R repeat was only 1% compared to 21% in the Dutch children. No differences of these polymorphisms were found between ALL cells and normal blood cells, indicating an ethnic rather than leukemic origin. These results may have implications for treatment of Indonesian children with ALL.

  11. Status of Vitamins B-12 and B-6 but Not of Folate, Homocysteine, and the Methylenetetrahydrofolate Reductase C677T Polymorphism Are Associated with Impaired Cognition and Depression in Adults123

    PubMed Central

    Moorthy, Denish; Peter, Inga; Scott, Tammy M.; Parnell, Laurence D.; Lai, Chao-Qiang; Crott, Jimmy W.; Ordovás, José M.; Selhub, Jacob; Griffith, John; Rosenberg, Irwin H.; Tucker, Katherine L.; Troen, Aron M.

    2012-01-01

    The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene differs in frequency in various ethnic groups that have differing prevalence of age-related cognitive impairments. We used a series of neuro-psychological tests to examine the association of the MTHFR C677T polymorphism with cognition and depression and also to assess whether genotype modifies the association of folate and homocysteine with these outcomes. This study analyzed pooled cross-sectional data from 2 ethnically diverse cohorts of community-living adults: the Boston Puerto Rican Health Study (n = 939) and the Nutrition, Aging, and Memory in Elders study (n = 1017). Individuals in both cohorts underwent anthropometric and laboratory measurements and dietary and health assessments using validated questionnaires between the years 2003 and 2007. Cognitive outcomes included measures of global cognition [Mini-Mental Status Exam (MMSE)], depression (Center for Epidemiological Studies Depression Scale), and 3 factor scores for the domains of attention, executive function, and memory that were derived from a detailed set of neuropsychological tests. Low plasma vitamin B-12 concentrations were associated with poorer MMSE scores and higher depression scores, and low vitamin B-6 concentrations were associated with lower MMSE and worse attention and executive function in the multivariate analysis. In contrast, MTHFR genotype, folate, and homocysteine were not associated with cognition or depression in either ethnicity-pooled or stratified analysis. The current study did not find evidence of an association between the MTHFR C677T TT genotype and impaired cognition or depression in a population with adequate folate status and a high prevalence of cognitive impairment and depression. PMID:22739363

  12. Clinical impact of factor V Leiden, prothrombin G20210A, and MTHFR C677T mutations among sickle cell disease patients of Central India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv

    2013-11-01

    It is known that patients with sickle cell disease (SCD) present activation of the blood coagulation and fibrinolytic systems, especially during vaso-occlusive crises and also during the steady state of the disease. We determined whether the presence of the factor prothrombin gene G20210A variant, factor V gene G1691A mutation (factor V Leiden), and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphisms may be risk factors for vascular complications in individuals with SCD. The study involved 150 patients with sickle cell anemia and 150 healthy controls of Central India. Genotyping of three thrombophilic mutations was carried out by PCR-RFLP methods using MnlI, Hind III, and Hinf I, respectively, for factor V Leiden, prothrombin, and MTHFR mutations. Patients with SCD had significantly higher prevalence of mutant variants of MTHFR gene (28.0% heterozygotes and 14.6% homozygotes) and FVL gene (14.6% heterozygotes) as compared to normal/control individuals, but complete absence of mutant variants of prothrombin gene. The patients with SCD having mutant variants of MTHFR and FVL genes showed higher incidence of pain in chest, abdomen, and bone joints along with early age of onset of clinical manifestations as well as frequent dependence on blood transfusion than those patients with SCD having wild variants of these thrombotic genes. As compared to control subjects, SCD individuals having mutant variants of FVL and MTHFR genes had significant association with higher levels of prothrombin fragment (F1+2), D-dimer, thrombin-antithrombin (TAT), and lower level of protein C. MTHFR C677T and FVL G1691A polymorphisms may be risk factors for increased vascular complications in patient with SCD. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Methotrexate-induced mucositis in acute leukemia patients is not associated with the MTHFR 677T allele in Mexico.

    PubMed

    Ruiz-Argüelles, Guillermo J; Coconi-Linares, Lucia Nancy; Garcés-Eisele, Javier; Reyes-Núñez, Virginia

    2007-10-01

    Methylenetetrahydrofolate reductase (MTHFR) has two common variants with reduced activity due to polymorphisms at nucleotides 677 and 1298. Both affect folate metabolism and thus remethylation of homocysteine, but are also thought to affect nucleotide synthesis and DNA methylation. Methotrexate (MTX), which interrupts folate metabolism, is used in the treatment of a variety of diseases including acute lymphoblastic leukemia (ALL), but exerts in some patients toxic effects on fast dividing tissues such as mucosal epithelia. The enhanced toxicity may be due to cooperative effects between MTX and MTHFR variants. Accordingly, it has been reported that carrying the 677T allele of the MTHFR is a risk factor for MTX-associated mucositis. As in the Mexican population, which is characterized by a high prevalence of the 677T MTHFR variant, several of its commonly associated defects have not been observed, we investigated the relationship between MTX toxicity and the 677T allele. Out of 28 patients with ALL (CC: 2, CT: 10, TT: 16), 16 had episodes of MTX-associated mucositis (CC: 0, CT: 6, TT: 10). Neither at the gene level nor at the genotype level was a significant association with mucositis found. It may be postulated that the risk of higher MTX toxicity in patients with decreased MTHFR activity could be neutralized by the normally folate rich diet in Mexico.

  14. ACE I/D sequence variants but not MTHFR C677T, is strongly linked to malignant glioma risk and its variant DD genotype may act as a promising predictive biomarker for overall survival of glioma patients.

    PubMed

    Pandith, Arshad A; Qasim, Iqbal; Zahoor, Wani; Shah, Parveen; Bhat, Abdul R

    2018-01-10

    ACE I/D and MTHFR C677T gene polymorphisms can be seen as candidate genes for glioma on the basis of their biological functions and their involvement in different cancers. The aim of this study was to analyze potential association and overall survival between MTHFR C677T and ACE I/D polymorphism in glioma patients in our population. We tested genotype distribution of 112 glioma patients against 141 cancer-free controls from the same region. Kaplan-Meier survival analysis was performed to evaluate overall survival of patients for both genes. No significant differences were found among MTHFR C677T wild type C and variant genotypes CT/TT with glioma patients. In ACE, the distribution of variant ID and DD was found to be significantly higher in glioma cases as compared to controls (p<0.0001). ACE DD genotypes were highly presented in glioma cases 26.8% versus 10.6% in controls (p<0.0001) and conferred 5-fold risk for predisposition in glioma cases. Per copy D allele frequency was found higher in cases than in controls (0.54 versus 0.25: p<0.0001). Interestingly we found a significant overall survival (with log rank p<0.01) in patients who presented with ACE DD genotypes had the least estimated overall survival of 13.4months in comparison to 21. 7 and 17.6months for ACE II and I/D genotypes respectively. We conclude ACE I/D polymorphism plays a vital role in predisposition of higher risk for glioma. We also suggest that ACE DD genotypes may act as an important predictive biomarker for overall survival of glioma patients. Copyright © 2017. Published by Elsevier B.V.

  15. MTHFR 677CC/1298CC genotypes are highly associated with chronic myelogenous leukemia: a case-control study in Korea.

    PubMed

    Moon, Hee Won; Kim, Tae Young; Oh, Bo Ra; Min, Hyun Chung; Cho, Han Ik; Bang, Soo Mee; Lee, Jae Hoon; Yoon, Sung Soo; Lee, Dong Soon

    2007-09-01

    Methylenetetrahydrofolate reductase (MTHFR) is an enzyme involved in folate metabolism and DNA methylation. Studies on MTHFR polymorphism in leukemia have largely focused on the protective role of MTHFR polymorphism in acute lymphoblastic leukemia (ALL). We evaluated the C677T and A1298C polymorphisms using the TaqMan allelic discrimination assay in various malignancies. The study population included 115 subjects with chronic myelogenous leukemia (CML), 200 with acute myelogenous leukemia (AML), 196 with multiple myeloma (MM) and 434 healthy control subjects. The frequency of 1298CC was statistically significantly higher in subjects with CML than that of the controls (OR=5.12, 95% CI: 1.75-14.9, P-value=.003). Of note, the frequencies of 677CC/1298CC genotype were statistically significantly higher in subjects with CML, AML and MM than that of the controls (OR=8.8, 3.5, 3.83, P-value=.002, 0.036, 0.023, respectively). Our results demonstrate that the MTHFR 1298CC homozygote variant is strongly associated with an increased risk of CML, while MTHFR C677T does not significantly affect the risk of CML. Moreover, we demonstrated that MTHFR 677CC and 1298CC genotype might have combined effect on risk of CML, AML and MM and it is inferred that the A1298C may play a different role in carcinogenesis, depending on the types of organs involved, the types of disease entities and the genotype of C677T.

  16. [C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

    PubMed

    Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

    2017-01-01

    Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

  17. The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

    PubMed

    Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

    2011-01-01

    Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

  18. Choline Intake, Plasma Riboflavin, and the Phosphatidylethanolamine N-Methyltransferase G5465A Genotype Predict Plasma Homocysteine in Folate-Deplete Mexican-American Men with the Methylenetetrahydrofolate Reductase 677TT Genotype12

    PubMed Central

    Caudill, Marie A.; Dellschaft, Neele; Solis, Claudia; Hinkis, Sabrina; Ivanov, Alexandre A.; Nash-Barboza, Susan; Randall, Katharine E.; Jackson, Brandi; Solomita, Gina N.; Vermeylen, Francoise

    2009-01-01

    We previously showed that provision of the folate recommended dietary allowance and either 300, 550, 1100, or 2200 mg/d choline for 12 wk resulted in diminished folate status and a tripling of plasma total homocysteine (tHcy) in men with the methylenetetrahydrofolate reductase (MTHFR) 677TT genotype. However, the substantial variation in tHcy within the 677TT genotype at wk 12 implied that several factors were interacting with this genotype to affect homocysteine. As an extension of this work, the present study sought to identify the main predictors of wk-12 plasma tHcy, alone and together with the MTHFR C677T genotype (29 TT, 31 CC), using linear regression analysis. A basic model explaining 82.5% of the variation (i.e. adjusted R2 = 0.825) was constructed. However, the effects of the variables within this model were dependent upon the MTHFR C677T genotype (P for interaction ≤ 0.021). Within the 677TT genotype, serum folate (P = 0.005) and plasma riboflavin (P = 0.002) were strong negative predictors (inversely related) explaining 12 and 15%, respectively, of the variation in tHcy, whereas choline intake (P = 0.003) and serum creatinine (P < 0.001) were strong positive predictors, explaining 19 and 25% of the variation. None of these variables, except creatinine (P = 0.021), correlated with tHcy within the 677CC genotype. Of the 8 additional polymorphisms tested, none appeared to influence tHcy. However, when creatinine was not in the model, the phosphatidylethanolamine N-methyltransferase 5465G→A variant predicted lower tHcy (P < 0.001); an effect confined to the MTHFR 677TT genotype. Thus, in folate-deplete men, several factors with roles in 1-carbon metabolism interact with the MTHFR C677T genotype to affect plasma tHcy. PMID:19211833

  19. ACE I/D and MTHFR C677T polymorphisms are significantly associated with type 2 diabetes in Arab ethnicity: a meta-analysis.

    PubMed

    Al-Rubeaan, Khalid; Siddiqui, Khalid; Saeb, Amr T M; Nazir, Nyla; Al-Naqeb, Dhekra; Al-Qasim, Sara

    2013-05-15

    In this meta-analysis study, SNPs were investigated for their association with type 2 diabetes (T2D) in both Arab and Caucasian ethnicities. A total of 55 SNPs were analyzed, of which 11 fulfilled the selection criteria, and were used for analysis. It was found that TCF7L2 rs7903146 was significantly associated with a pooled OR of 1.155 (95%C.I.=1.059-1.259), p<0.0001 and I(2)=78.30% among the Arab population, whereas among Caucasians, the pooled OR was 1.45 (95%C.I.=1.386-1.516), p<0.0001 and I(2)=77.20%. KCNJ11 rs5219 was significantly associated in both the populations with a pooled OR of 1.176(1.092-1.268), p<0.0001 and I(2)=32.40% in Caucasians and a pooled OR of 1.28(1.111-1.475), p=0.001 among Arabs. The ACE I/D polymorphism was found to be significantly associated with a pooled OR of 1.992 (95%C.I.=1.774-2.236), p<0.0001 and I(2)=83.20% among the Arab population, whereas among Caucasians, the pooled OR was 1.078 (95%C.I.=0.993-1.17), p=0.073 and I(2)=0%. Similarly, MTHFR C677T polymorphism was also found to be significantly associated among Arabs with a pooled OR of 1.924 (95%C.I.=1.606-2.304), p<0.0001 and I(2)=27.20%, whereas among Caucasians, the pooled OR was 0.986 (95%C.I.=0.868-1.122), p=0.835 and I(2)=0%. Meanwhile PPARG-2 Pro12Ala, CDKN2A/2B rs10811661, IGF2BP2 rs4402960, HHEX rs7923837, CDKAL1 rs7754840, EXT2 rs1113132 and SLC30A8 rs13266634 were found to have no significant association with T2D among Arabs. In conclusion, it seems from this study that both Arabs and Caucasians have different SNPs associated with T2D. Moreover, this study sheds light on the profound necessity for further investigations addressing the question of the genetic components of T2D in Arabs. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Association of MTHFR C667T polymorphism with bone mineral density and fracture risk: an updated meta-analysis.

    PubMed

    Wang, H; Liu, C

    2012-11-01

    This meta-analysis investigated the association of C677T polymorphism in MTHFR gene with bone mineral density (BMD) and fracture risk. The results suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was modestly associated with BMD of lumbar spine, femoral neck, total hip, and total body, respectively. The methylenetetrahydrofolate reductase (MTHFR) gene has been implicated in the regulation of BMD and, thus, may serve as a potential risk factor for the development of fracture. However, results have been inconsistent. In this study, a meta-analysis was performed to clarify the association of C677T polymorphism in MTHFR gene with BMD and fracture risk. Published literature from PubMed and EMBASE were searched for eligible publications. Pooled odds ratio (OR) or weighted mean difference (WMD) and 95% confidence interval (CI) were calculated using a fixed- or random-effects model. Twenty studies (3,525 cases and 17,909 controls) were included in this meta-analysis. The TT genotype of C677T polymorphism was marginally associated with an increased risk of fracture under recessive model (TT vs. TC + CC: OR = 1.23, 95% CI 1.04-1.47). Using this model, similar results were found among East Asians (OR = 1.40, 95% CI 1.07-1.83), female subpopulation (1.27, 95% CI 1.04-1.55), cohort studies (OR = 1.24, 95% CI 1.08-1.44), and subjects younger than aged 60 years (OR = 1.51, 95% CI 1.10-2.07). In addition, under homogeneous co-dominant model, there was a modest association of C677T polymorphism with BMD of lumbar spine (WMD = -0.017 g/cm(2); 95%CI, -0.030-(-0.005) g/cm(2)), femoral neck (WMD = -0.010 g/cm(2); 95% CI -0.017-(-0.003) g/cm(2)), total hip (WMD = -0.013 g/cm(2), 95% CI -0.022-(-0.004) g/cm(2)), and total body (WMD = -0.020 g/cm(2); 95% CI -0.027-(-0.013) g/cm(2)), respectively. This meta-analysis suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was

  1. Subacute methotrexate neurotoxicity and cerebral venous sinus thrombosis in a 12-year-old with acute lymphoblastic leukemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism: homocysteine-mediated methotrexate neurotoxicity via direct endothelial injury.

    PubMed

    Mahadeo, Kris M; Dhall, Girish; Panigrahy, Ashok; Lastra, Carlos; Ettinger, Lawrence J

    2010-02-01

    From as early as the 1970s methotrexate has been associated with disseminated necrotizing leukoencephalopathy and other neurotoxic sequelae. Yet, a clear mechanism for methotrexate-induced neurotoxicity has not been established. The authors describe the case of a 12-year-old male with acute lymphoblastic leukemia and a homozygous methylenetetrahydrofolate reductase C677T mutation, who developed subacute methotrexate-induced toxicity and cerebral venous thrombosis after receiving intrathecal methotrexate. The role of homocysteine as a possible mediator in methotrexate-induced neurotoxicity via direct endothelial injury is discussed.

  2. PAI-1 4G/5G and MTHFR C677T polymorphisms increased the accuracy of two prediction scores for the risk of acute lower extremity deep vein thrombosis.

    PubMed

    Pop, Tudor Radu; Vesa, Ştefan Cristian; Trifa, Adrian Pavel; Crişan, Sorin; Buzoianu, Anca Dana

    2014-01-01

    This study investigates the accuracy of two scores in predicting the risk of acute lower extremity deep vein thrombosis. The study included 170 patients [85 (50%) women and 85 (50%) men] who were diagnosed with acute lower extremity deep vein thrombosis (DVT) with duplex ultrasonography. Median age was 62 (52.75; 72) years. The control group consisted of 166 subjects [96 (57.8%) women and 70 (42.2%) men], without DVT, matched for age (± one year) to those in the group with DVT. The patients and controls were selected from those admitted to the internal medicine, cardiology and geriatrics wards within the Municipal Hospital of Cluj-Napoca, Romania, between October 2009 and June 2011. Clinical, demographic and lab data were recorded for each patient. For each patient we calculated the prior risk of DVT using two prediction scores: Caprini and Padua. According to the Padua score only 93 (54.7%) patients with DVT had been at high risk of developing DVT, while 48 (28.9%) of controls were at high risk of developing DVT. When Padua score included PAI-1 4G/5G and MTHFR C677T polymorphisms, the sensitivity increased at 71.7%. Using the Caprini score, we determined that 147 (86.4%) patients with DVT had been at high risk of developing DVT, while 103 (62%) controls were at high risk of developing DVT. A Caprini score higher than 5 was the strongest predictor of acute lower extremity DVT risk. The Caprini prediction score was more sensitive than the Padua score in assessing the high risk of DVT in medical patients. PAI-1 4G/5G and MTHFR C677T polymorphisms increased the sensitivity of Padua score.

  3. High-dose folic acid supplementation alters the human sperm methylome and is influenced by the MTHFR C677T polymorphism

    PubMed Central

    Aarabi, Mahmoud; San Gabriel, Maria C.; Chan, Donovan; Behan, Nathalie A.; Caron, Maxime; Pastinen, Tomi; Bourque, Guillaume; MacFarlane, Amanda J.; Zini, Armand; Trasler, Jacquetta

    2015-01-01

    Dietary folate is a major source of methyl groups required for DNA methylation, an epigenetic modification that is actively maintained and remodeled during spermatogenesis. While high-dose folic acid supplementation (up to 10 times the daily recommended dose) has been shown to improve sperm parameters in infertile men, the effects of supplementation on the sperm epigenome are unknown. To assess the impact of 6 months of high-dose folic acid supplementation on the sperm epigenome, we studied 30 men with idiopathic infertility. Blood folate concentrations increased significantly after supplementation with no significant improvements in sperm parameters. Methylation levels of the differentially methylated regions of several imprinted loci (H19, DLK1/GTL2, MEST, SNRPN, PLAGL1, KCNQ1OT1) were normal both before and after supplementation. Reduced representation bisulfite sequencing (RRBS) revealed a significant global loss of methylation across different regions of the sperm genome. The most marked loss of DNA methylation was found in sperm from patients homozygous for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, a common polymorphism in a key enzyme required for folate metabolism. RRBS analysis also showed that most of the differentially methylated tiles were located in DNA repeats, low CpG-density and intergenic regions. Ingenuity Pathway Analysis revealed that methylation of promoter regions was altered in several genes involved in cancer and neurobehavioral disorders including CBFA2T3, PTPN6, COL18A1, ALDH2, UBE4B, ERBB2, GABRB3, CNTNAP4 and NIPA1. Our data reveal alterations of the human sperm epigenome associated with high-dose folic acid supplementation, effects that were exacerbated by a common polymorphism in MTHFR. PMID:26307085

  4. Elevated total plasma homocysteine and 667C{r_arrow}T mutation of the 5,10-methylenetetrahydrofolate reductase gene in thrombotic vascular disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Franchis, R.; Sebastio, G.; Andria, G.

    1996-07-01

    Moderate elevation of total plasma homocysteine (tHcy) has been reported as an independent risk factor for thrombotic vascular disease, a well-known multifactorial disorder. Possible genetic causes of elevated tHcy include defects of the sulfur-containing amino acids metabolism due to deficiencies of cystathionine {Beta}-synthase, of 5,10-methylenetetrahydrofolate reductase (MTHFR), and of the enzymes of cobalamin metabolism. An impaired activity of MTHFR due to a thermolabile form of the enzyme has been observed in {le}28% of hyperhomocysteinemic patients with premature vascular disease. More recently, the molecular basis of such enzymatic thermolability has been related to a common mutation of the MTHFR gene, causingmore » a C-to-T substitution at nt 677 (677C{r_arrow}T). This mutation was found in 38% of unselected chromosomes from 57 French Canadian individuals. The homozygous state for the mutation was present in 12% of these subjects and correlated with significantly elevated tHcy. Preliminary evidence indicates that the frequency of homozygotes for the 677C{r_arrow}T mutation may vary significantly in populations from different geographic areas. 5 refs., 2 tabs.« less

  5. High-dose folic acid supplementation alters the human sperm methylome and is influenced by the MTHFR C677T polymorphism.

    PubMed

    Aarabi, Mahmoud; San Gabriel, Maria C; Chan, Donovan; Behan, Nathalie A; Caron, Maxime; Pastinen, Tomi; Bourque, Guillaume; MacFarlane, Amanda J; Zini, Armand; Trasler, Jacquetta

    2015-11-15

    Dietary folate is a major source of methyl groups required for DNA methylation, an epigenetic modification that is actively maintained and remodeled during spermatogenesis. While high-dose folic acid supplementation (up to 10 times the daily recommended dose) has been shown to improve sperm parameters in infertile men, the effects of supplementation on the sperm epigenome are unknown. To assess the impact of 6 months of high-dose folic acid supplementation on the sperm epigenome, we studied 30 men with idiopathic infertility. Blood folate concentrations increased significantly after supplementation with no significant improvements in sperm parameters. Methylation levels of the differentially methylated regions of several imprinted loci (H19, DLK1/GTL2, MEST, SNRPN, PLAGL1, KCNQ1OT1) were normal both before and after supplementation. Reduced representation bisulfite sequencing (RRBS) revealed a significant global loss of methylation across different regions of the sperm genome. The most marked loss of DNA methylation was found in sperm from patients homozygous for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, a common polymorphism in a key enzyme required for folate metabolism. RRBS analysis also showed that most of the differentially methylated tiles were located in DNA repeats, low CpG-density and intergenic regions. Ingenuity Pathway Analysis revealed that methylation of promoter regions was altered in several genes involved in cancer and neurobehavioral disorders including CBFA2T3, PTPN6, COL18A1, ALDH2, UBE4B, ERBB2, GABRB3, CNTNAP4 and NIPA1. Our data reveal alterations of the human sperm epigenome associated with high-dose folic acid supplementation, effects that were exacerbated by a common polymorphism in MTHFR. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C Polymorphisms and Disease Activity in Mexicans with Rheumatoid Arthritis Treated with Methotrexate.

    PubMed

    González-Mercado, Mirna Gisel; Rivas, Fernando; Gallegos-Arreola, M Patricia; Morán-Moguel, M Cristina; Salazar-Páramo, Mario; González-López, Laura; Gámez-Nava, J Iván; Muñoz-Valle, J Francisco; Medina-Coss Y León, Ricardo; González-Mercado, Anahí; Aceves, Mario A; Dávalos, Nory O; Macías-Chumacera, Agustín; Dávalos, Ingrid P

    2017-11-01

    To investigate the relationships of polymorphisms in genes whose protein products are related in the metabolic pathway of folic acid, particularly MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C, and disease activity in Mexican patients with rheumatoid arthritis (RA) treated with methotrexate (MTX). Sixty-eight patients with RA were included in the study who were being treated with MTX, either with or without other drugs. In addition to general data, disease activity was measured by the disease activity score 28 (DAS28). Single nucleotide polymorphisms (SNPs) genotyping was performed by allelic discrimination using real-time polymerase chain reaction. Differences in genotype (homozygotic or heterozygotic for each allele), allele distributions, and phenotype were not statistically different between the RA group and control populations. We did not find any association between the studied polymorphisms and disease activity nor with the intragroup variables (e.g., clinical activity, body mass index, and single- or combined-drug treatment) or between genetic markers; we also did not find any association within the RA group or between the RA group and control populations. Additional studies of more polymorphisms related to this or other metabolic pathways are required to determine the influence of genetics on disease activity in RA.

  7. MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C Polymorphisms and Disease Activity in Mexicans with Rheumatoid Arthritis Treated with Methotrexate

    PubMed Central

    González-Mercado, Mirna Gisel; Rivas, Fernando; Gallegos-Arreola, M. Patricia; Morán-Moguel, M. Cristina; Salazar-Páramo, Mario; González-López, Laura; Gámez-Nava, J. Iván; Muñoz-Valle, J. Francisco; Medina-Coss y León, Ricardo; González-Mercado, Anahí; Aceves, Mario A.; Dávalos, Nory O.; Macías-Chumacera, Agustín

    2017-01-01

    Aim: To investigate the relationships of polymorphisms in genes whose protein products are related in the metabolic pathway of folic acid, particularly MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C, and disease activity in Mexican patients with rheumatoid arthritis (RA) treated with methotrexate (MTX). Materials and Methods: Sixty-eight patients with RA were included in the study who were being treated with MTX, either with or without other drugs. In addition to general data, disease activity was measured by the disease activity score 28 (DAS28). Single nucleotide polymorphisms (SNPs) genotyping was performed by allelic discrimination using real-time polymerase chain reaction. Results: Differences in genotype (homozygotic or heterozygotic for each allele), allele distributions, and phenotype were not statistically different between the RA group and control populations. We did not find any association between the studied polymorphisms and disease activity nor with the intragroup variables (e.g., clinical activity, body mass index, and single- or combined-drug treatment) or between genetic markers; we also did not find any association within the RA group or between the RA group and control populations. Conclusion: Additional studies of more polymorphisms related to this or other metabolic pathways are required to determine the influence of genetics on disease activity in RA. PMID:28994615

  8. Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis

    PubMed Central

    Fryar-Williams, Stephanie

    2016-01-01

    The Mental Health Biomarker Project (2010–2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman’s correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO’s cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The

  9. Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis.

    PubMed

    Fryar-Williams, Stephanie

    2016-01-01

    The Mental Health Biomarker Project (2010-2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman's correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO's cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The two

  10. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis

    PubMed Central

    Pasta, Linda; Pasta, Francesca

    2015-01-01

    AIM: To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. METHODS: All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. RESULTS: Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ2 > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ2 = 39.3; P < 0.000 and χ2 = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. CONCLUSION: MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing

  11. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis.

    PubMed

    Pasta, Linda; Pasta, Francesca

    2015-12-18

    To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ (2) > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ (2) = 39.3; P < 0.000 and χ (2) = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing the inflammation response

  12. Combined 677CC/1298AC genotypes of methylenetetrahydrofolate reductase (MTHFR ) reduce susceptibility to precursor B lymphoblastic leukemia in a Chinese population.

    PubMed

    Lv, Ling; Wu, Cuie; Sun, Henjuan; Zhu, Saijuan; Yang, Yongchen; Chen, Xi; Fu, Hua; Bao, Liming

    2010-06-01

    The methylenetetrahydrofolate reductase (MTHFR) encodes a major enzyme in folate metabolism. It has been suggested that two MTHFR polymorphisms, 677C>T and 1298A>C, influence risk of acute lymphoblastic leukemia (ALL). Most studies on relation of MTHFR polymorphisms to ALL susceptibility have been in pediatric populations because ALL is relatively rare in adults. Here, we report a case-control study of 127 Chinese patients with adult precursor B lymphoblastic leukemia (B-ALL) to examine correlation between the MTHFR polymorphisms and B-ALL susceptibility in adults. Our data show that although the prevalence of genotype 1298CC was significantly higher in the female patients than in the controls (P = 0.04), the differences in distributions of combined genotypes of 1298CC with either 677CC or 677CT between the cases and the controls were statistically insignificant. Haplotype analysis revealed no significant difference between the cases and the controls. The prevalence for joint MTHFR genotypes 677CC/1298AC was significantly lower in the female B-ALL cases than in the controls [odds ratio (OR) = 0.06, 95% CI = 0.00-0.53, P = 0.0033] and no differences among the men [OR = 0.71, 95% CI = 0.20-2.53, P = 0.55], suggesting that protective effects of combined MTHFR 677CC/1298AC genotypes on susceptibility of adult B-ALL are gender bias toward women with 677CC/1298AC women being at a 17-fold reduced odds to develop B-ALL.

  13. 46 CFR 169.677 - Equipment protection and enclosure.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Vessels of Less Than 100 Gross Tons § 169.677 Equipment protection and enclosure. (a) Except as provided... 46 Shipping 7 2010-10-01 2010-10-01 false Equipment protection and enclosure. 169.677 Section 169.677 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL...

  14. 26 CFR 1.677(b)-1 - Trusts for support.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Trusts for support. 1.677(b)-1 Section 1.677(b... (CONTINUED) INCOME TAXES Grantors and Others Treated As Substantial Owners § 1.677(b)-1 Trusts for support. (a) Section 677(b) provides that a grantor is not treated as the owner of a trust merely because its...

  15. 27 CFR 19.677 - Large plant applications-organizational documents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Large plant applications-organizational documents. 19.677 Section 19.677 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX... Fuel Use Obtaining A Permit § 19.677 Large plant applications—organizational documents. In addition to...

  16. 36 CFR 67.7 - Standards for Rehabilitation.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... 67.7 Section 67.7 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR HISTORIC PRESERVATION CERTIFICATIONS PURSUANT TO SEC. 48(g) AND SEC. 170(h) OF THE INTERNAL... old in design, color, texture, and other visual qualities and, where possible, materials. Replacement...

  17. Thrombophilic Genetic Factors PAI-1, MTHFRC677T, V Leiden 506Q, and Prothrombin 20210A in Noncirrhotic Portal Vein Thrombosis and Budd-Chiari Syndrome in a Caucasian Population

    PubMed Central

    D'Amico, Mario; Sammarco, Pietro; Pasta, Linda

    2013-01-01

    Thrombophilic genetic factors PAI-1, MTHFRC677T, V Leiden 506Q, and Prothrombin 20210A were studied as risk factors in 235 Caucasian subjects: 85 patients with abdominal thrombosis (54 with portal vein thrombosis (PVT) and 31 with Budd-Chiari syndrome (BCS) without liver cirrhosis or hepatocellular carcinoma) and 150 blood bank donors. Seventy-five patients with PVT/BCS showed associated disease or particular clinical status (46 PVT/29 BCS): 37 myeloproliferative neoplasm (20 PVT/17 BCS), 12 abdominal surgery (10 PVT/2 BCS), 10 contraception or pregnancy (6 PVT/4 BCS), 7 abdominal acute disease (6 PVT/1 BCS), and 9 chronic disease (4 PVT/5 BCS); ten patients did not present any association (8 PVT/2 BCS). PAI-14G-4G, MTHFR677TT, and V Leiden 506Q were significantly frequent (OR 95% CI and χ 2 test with P value) in abdominal thrombosis; in these patients PAI-14G-4G and MTHFR677TT distributions deviated from that expected from a population in the Hardy-Weinberg equilibrium (PAI-1: χ 2 = 13.8, P < 0.001; MTHFR677: χ 2 = 7.1, P < 0.01), whereas the equilibrium was respected in healthy controls. V Leiden Q506 and Prothrombin 20210A were in the Hardy-Weinberg equilibrium both in patients with abdominal thrombosis and healthy controls. Our study shows an important role of PAI-14G-4G and MTHFR677TT in abdominal thrombosis without liver cirrhosis or hepatocellular carcinoma. PMID:24455271

  18. Methylenetetrahydrofolate reductase gene, homocysteine and coronary artery disease: the A1298C polymorphism does matter. Inferences from a case study (Madeira, Portugal).

    PubMed

    Freitas, Ana I; Mendonça, Isabel; Guerra, Graça; Brión, Maria; Reis, Roberto P; Carracedo, Angel; Brehm, António

    2008-01-01

    Elevated levels of plasma homocysteine, an independent risk factor and a strong predictor of mortality in patients with coronary artery disease (CAD), can result from nutritional deficiencies or genetic errors, including methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms. The contribution of these polymorphisms in the development of CAD remains controversial. We analysed the impact of MTHFR C677T and A1298C on fasting homocysteine and CAD in 298 CAD patients proved by angiography and 510 control subjects from the Island of Madeira (Portugal). After adjustment for other risk factors, plasma homocysteine remained independently correlated with CAD. Serum homocysteine was significantly higher in individuals with 677TT and 1298AA genotypes. There was no difference in the distribution of MTHFR677 genotypes between cases and controls but a significant increase in 1298AA prevalence was found in CAD patients. In spite of the clear effect of C677T mutation on elevated homocysteine levels we only found an association between 1298AA genotype and CAD in this population. The simultaneous presence of 677CT and 1298AA genotypes provides a significant risk of developing the disease, while the 1298AC genotype, combined with 677CC, shows a significant trend towards a decrease in CAD occurrence. The data shows an independent association between elevated levels of homocysteine and CAD. Both MTHFR polymorphisms are associated with increased fasting homocysteine (677TT and 1298AA genotypes), but only the 1298AA variant shows an increased prevalence in CAD group. Odds ratio seem to indicate that individuals with the MTHFR 1298AA genotype and the 677CT/1298AA compound genotype had a 1.6-fold increased risk for developing CAD suggesting a possible association of MTHFR polymorphisms with the risk of CAD in Madeira population.

  19. Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess.

    PubMed

    Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

    2018-06-01

    Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals' susceptibility to certain infections. Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p = 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p > 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p > 0.05). Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations.

  20. Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess

    PubMed Central

    Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

    2018-01-01

    Statement of the Problem: Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals’ susceptibility to certain infections. Purpose: Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). Materials and Method: There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Results: Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p= 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p> 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p> 0.05). Conclusion: Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations. PMID:29854884

  1. 14 CFR 25.677 - Trim systems.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... STANDARDS: TRANSPORT CATEGORY AIRPLANES Design and Construction Control Systems § 25.677 Trim systems. (a) Trim controls must be designed to prevent inadvertent or abrupt operation and to operate in the plane... designed to prevent creeping in flight. Trim tab controls must be irreversible unless the tab is...

  2. 14 CFR 25.677 - Trim systems.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... STANDARDS: TRANSPORT CATEGORY AIRPLANES Design and Construction Control Systems § 25.677 Trim systems. (a) Trim controls must be designed to prevent inadvertent or abrupt operation and to operate in the plane... designed to prevent creeping in flight. Trim tab controls must be irreversible unless the tab is...

  3. 14 CFR 25.677 - Trim systems.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... STANDARDS: TRANSPORT CATEGORY AIRPLANES Design and Construction Control Systems § 25.677 Trim systems. (a) Trim controls must be designed to prevent inadvertent or abrupt operation and to operate in the plane... designed to prevent creeping in flight. Trim tab controls must be irreversible unless the tab is...

  4. 14 CFR 25.677 - Trim systems.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... STANDARDS: TRANSPORT CATEGORY AIRPLANES Design and Construction Control Systems § 25.677 Trim systems. (a) Trim controls must be designed to prevent inadvertent or abrupt operation and to operate in the plane... designed to prevent creeping in flight. Trim tab controls must be irreversible unless the tab is...

  5. Vitamin B6 and homocysteine levels in carbamazepine treated epilepsy of Khyber Pakhtunkhwa.

    PubMed

    Shakir, Shakirullah; Ali, Niaz; Udin, Zia; Nazish, Haleema; Nabi, Muhammad

    2017-06-01

    The study focused on the plasma levels of vitamin B 6 and homocysteine in different genotypes of MTHFR (C677T, A1298C) and GABRG2 (C588T, C315T) genes in carbamazepine resistant epilepsy in the population of Khyber Pakhtunkhwa. Patients who were possible candidates for carbamazepine therapy were followed for six months for their seizure control. Plasma levels of vitamin B 6 and homocysteine were determined using immunoassay based techniques at baseline and after six months. MTHFR (C677T, A1298C) and GABRG2 (C588T, C315T) genes were genotyped using restriction fragment length polymorphisms. Seizure control during therapy was recorded on a standardized proforma. Low vitamin B 6 levels and hyperhomocysteinemia were found in 61.7% of resistant patients (n=34). Resistant patients had the following frequencies of variant genotypes (677CT=38.1% and 677TT=24.4%; 1298AC=42.2% and 1298CC=26.1%; 588CT= 47.6% and 315TT= 33.3%) of MTHFR (C677T and A1298C) and GABRG2 (C588T and C315T) genes. A significant decline in vitamin B 6 (P<0.0001) and hyperhomocysteinemia were found in variant genotypes of MTHFR (C677T, A1298C) and GABRG2 (C588T, C315T) genes. Following six months of carbamazepine of therapy in heterozygous variant genotypes of MTHFR (677CT and 1298AC) and GABRG2 (588CT and 315CT) genes, we observed a significant fall in vitamin B 6 levels and hyperhomocysteinemia.

  6. Methylenetetrahydrofolate reductase A1298C genotypes are associated with the risks of acute lymphoblastic leukaemia and chronic myelogenous leukaemia in the Korean population.

    PubMed

    Hur, M; Park, J Y; Cho, H C; Lee, K M; Shin, H Y; Cho, H I

    2006-06-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism, DNA methylation and synthesis. We investigated the association between MTHFR polymorphisms and the risks of acute and chronic leukaemias. MTHFR C677T and A1298C were genotyped in 396 Korean individuals using multiplex polymerase chain reaction/restriction fragment-length polymorphism. They were acute lymphoblastic leukaemia (ALL, n = 89), acute myeloid leukaemia (AML, n = 55), biphenotypic acute leukaemia (n = 12), chronic myelogenous leukaemia (CML, n = 40), and normal controls (n = 200). C677T genotypes were not associated with the risk of each disease. A1298C variants, however, significantly decreased the risks of ALL and CML compared with 1298AA. Odds ratios and 95% confidence intervals of 1298AC and 1298AC + CC were 0.53 (0.31-0.93) and 0.54 (0.31-0.93) in ALL, and 0.34 (0.14-0.80) and 0.40 (0.18-0.89) in CML, respectively, compared with 1298AA. These findings demonstrate that the development of ALL and CML is more dependent on folate status, and more susceptible to DNA instability than that of AML. In addition, A1298C rather than C677T may be a more important genetic risk modifier in leukaemogenesis at least in the Korean population.

  7. Methylenetetrahydrofolate reductase (MTHFR) genotype, smoking habit, metastasis and oral cancer in Taiwan.

    PubMed

    Tsai, Chia-Wen; Hsu, Chia-Fang; Tsai, Ming-Hsui; Tsou, Yung-An; Hua, Chun-Hung; Chang, Wen-Shin; Lin, Cheng-Chieh; Bau, Da-Tian

    2011-06-01

    The aim of this study was to evaluate the association and interaction of genotypic polymorphism in methylenetetrahydrofolate reductase (MTHFR) with smoking habits and oral cancer in Taiwan. Two well-known polymorphic variants of MTHFR, C677T (rs1801133) and A1298C (rs1801131), were analyzed in association with oral cancer risk, and their joint effects with individual smoking habits on oral cancer risk are discussed. In total, 620 oral cancer patients and 620 non-cancer controls in central Taiwan were recruited and genotyped. The MTHFR C677T genotype, but not the A1298C, was differently distributed between the oral cancer and control groups. The T allele of MTHFR C677T was significantly more frequently found in controls than in oral cancer patients. Joint effects of smoking and MTHFR C677T genotype significantly affected oral cancer susceptibility. The MTHFR C677T CT and TT genotypes in association with smoking conferred lower odds ratios of 0.66 and 0.54 (95% confidence interval=0.49-0.82 and 0.39-0.86), respectively. Those patients with MTHFR C677T CT and TT genotypes also had a lower risk of oral cancer metastasis. MTHFR C677T genotype may have joint effects with smoking on oral carcinogenesis, and may be a useful biomarker for prediction and prognosis of oral cancer.

  8. [Association between methylene-tetrahydrofolate reductase gene polymorphisms and chronic myeloid leukemia].

    PubMed

    Dorgham, Samia; Aberkane, Meriem; Boughrara, Wefa; Antar Soltan, Badra; Mehalhal, Nemra; Touhami, Hadj; Sidimansour, Noureddine; Merad Boudia, Nadia; Louhibi, Lotfi; Boudjema, Abdallah

    2014-09-01

    Methylene-tetrahydrofolate reductase (MTHFR) is a key enzyme of folate metabolism. Few studies were reported about its relationship with chronic myeloid leukemia (CML). We conducted a case-control study analyzing the prevalence of the polymorphisms MTHFR C677T and MTHFR A1298C in Algerians CML patients. Using TaqMan(®) allelic discrimination assay, we investigate MTHFR C677T and A1298C polymorphism distribution in 90 cases of CML and 100 healthy subjects. The frequencies of 677T alleles and genotypes 677TT and 677CT were significantly higher in cases than in control (P = 1E-6; OR = 6.77 [4.22-10.86]) and (P = 1E-6; OR = 10.38 [4.56-23.6]) respectively. Also, the frequencies of 1298C alleles and genotypes 1298CC and 1298AC were higher in cases (P = 9 E-6; OR = 2.65 [1.71-4.10]) and (P = 0.008; OR = 2.22 [1.21-4.06]) respectively. We report also the higher significance of the haplotype 677T/1298A and 677T/1298C in cases (P = 0.007; OR = 2.57 [1.26-5.24]) and (P = 5 E-6, OR = 6.91 [2.7646-17.2899]) respectively. Our results demonstrate that 677T and 1298C alleles are both associated with an increased risk of CML in Algeria.

  9. Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey.

    PubMed

    Oztuzcu, Serdar; Ergun, Sercan; Ulaşlı, Mustafa; Nacarkahya, Gülper; Iğci, Yusuf Ziya; Iğci, Mehri; Bayraktar, Recep; Tamer, Ali; Çakmak, Ecir Ali; Arslan, Ahmet

    2014-06-01

    Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 -675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66%, respectively. No mutation was detected in 92 (1.95%) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population.

  10. Are the methylenetetrahydrofolate reductase 1298 and 677 gene polymorphisms related to optic glioma and hamartoma risk in neurofibromatosis type 1 patients?

    PubMed

    Tanyıldız, Hikmet Gülşah; Yeşil, Şule; Bozkurt, Ceyhun; Çandır, Mehmet Onur; Akpınar-Tekgündüz, Sibel; Toprak, Şule; Yüksel, Deniz; Şahin, Gürses

    2016-01-01

    The methylenetetrahydrofolate reductase (MTHFR) gene plays a key role in carcinogenesis through its effects on DNA synthesis and methylation and also has a significant role in the etiology of many disorders, such as diabetes, migraine, and cardiovascular disease. Neurofibromatoses (NF) are autosomal dominant inherited diseases that can affect tissues such as bone and skin and predispose individuals to tumor development in various parts of the nervous system or body. Optic nerve glioma and brain tumors are common in children with NF, and leukemia and lymphoma incidence is also higher than normal. We therefore aimed to investigate the possible relationship between the MTHFR gene polymorphism and accompanying tumors such as neurofibroma, hamartoma, and optic glioma in children with NF1 found to have the MTHFR 677 and MTHFR 1298 gene polymorphism in this study. We included 55 pediatric patients diagnosed with NF1 between 2005 and 2014 in the study group. The control group included 44 healthy subjects without acute or chronic disease findings. A significant relationship was found between the MTHFR A1298C polymorphism and the incidence of optic glioma (p=0.014) (AA vs. AC: OR 11, 95% CI 1.27-95.17; AA vs. CC: OR 7.33, 95% CI 0.35-150.70). We also found a significant relationship between the MTHFR C1298C polymorphism and the incidence of hamartoma (p=0.019) (AA vs. AC: OR 2.12, 95% CI 0.662-6.809; p=0.203). Epilepsy incidence was high in subjects with MTHFR C677C. The MTHFR A1298C, C1298C, and C677C gene polymorphisms can be associated with a higher optic glioma, hamartoma, and epilepsy incidence, respectively, in patients diagnosed with neurofibromatosis type 1.

  11. MTHFR 677TT genotype and disease risk: is there a modulating role for B-vitamins?

    PubMed

    Reilly, R; McNulty, H; Pentieva, K; Strain, J J; Ward, M

    2014-02-01

    Methylenetetrahydrofolate reductase (MTHFR) is a critical folate-metabolising enzyme which requires riboflavin as its co-factor. A common polymorphism (677C→T) in the MTHFR gene results in reduced MTHFR activity in vivo which in turn leads to impaired folate metabolism and elevated homocysteine concentrations. Homozygosity for this polymorphism (TT genotype) is associated with an increased risk of a number of conditions including heart disease and stroke, but there is considerable variability in the extent of excess risk in various reports. The present review will explore the evidence which supports a role for this polymorphism as a risk factor for a number of adverse health outcomes, and the potential modulating roles for B-vitamins in alleviating disease risk. The evidence is convincing in the case which links this polymorphism with hypertension and hypertensive disorders of pregnancy, particularly preeclampsia. Furthermore, elevated blood pressure was found to be highly responsive to riboflavin intervention specifically in individuals with the MTHFR 677TT genotype. Future intervention studies targeted at these genetically predisposed individuals are required to further investigate this novel gene-nutrient interaction. This polymorphism has also been associated with an increased risk of neural tube defects (NTD) and other adverse pregnancy outcomes; however, the evidence in this area has been inconsistent. Preliminary evidence has suggested that there may be a much greater need for women with the MTHFR 677TT genotype to adhere to the specific recommendation of commencing folic acid prior to conception for the prevention of NTD, but this requires further investigation.

  12. 44 CFR 67.7 - Collection of appeal data.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... OF HOMELAND SECURITY INSURANCE AND HAZARD MITIGATION National Flood Insurance Program APPEALS FROM PROPOSED FLOOD ELEVATION DETERMINATIONS § 67.7 Collection of appeal data. (a) Appeals by private persons to... Federal Insurance Administrator's proposed flood elevation determination to the CEO or to such agency as...

  13. 44 CFR 67.7 - Collection of appeal data.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... OF HOMELAND SECURITY INSURANCE AND HAZARD MITIGATION National Flood Insurance Program APPEALS FROM PROPOSED FLOOD ELEVATION DETERMINATIONS § 67.7 Collection of appeal data. (a) Appeals by private persons to... Federal Insurance Administrator's proposed flood elevation determination to the CEO or to such agency as...

  14. Methylenetetrahydrofolate reductase polymorphisms and risk of acute lymphoblastic leukemia-evidence from an updated meta-analysis including 35 studies.

    PubMed

    Wang, Haigang; Wang, Jiali; Zhao, Lixia; Liu, Xinchun; Mi, Wenjie

    2012-09-04

    5,10-methylenetetrahydrofolate reductase (MTHFR) variants, C677T and A1298C, have been reported to be associated with decreased risk of acute lymphoblastic leukemia (ALL). However, results derived from individually underpowered studies are conflicting. We carried out an updated meta-analysis on the association between MTHFR polymorphisms and ALL risk. Relevant publications were searched through PUBMED and EMBASE databases. The associations between MTHFR C677T and A1298C polymorphisms and the risk of ALL were evaluated by odds ratios (ORs). The heterogeneity and publication bias were estimated. Meta-regression analysis was performed to evaluate the potential sources of heterogeneity. C677T polymorphism was associated with a reduced risk of ALL (allele contrast: ORRE = 0.91, 95% CI: 0.83-0.99). Subgroup analysis showed MTHFR C677T variant was associated with decreased susceptibility to ALL in children and Caucasians. Meta-regression showed the logOR for the association between T allele and ALL increased as sex ratio (M/F) in the case group increased (P = 0.01). Regarding A1298C polymorphism, no significant association was observed (allele contrast: ORRE = 1.01, 95% CI: 0.91-1.11). There was no publication bias for C677T or A1298C polymorphism. The present meta-analysis suggests that the C677T polymorphism, not A1298C, in MTHFR gene is associated with a decreased risk of ALL, particularly among children and Caucasians subjects. Our findings suggest that the influence of the C677T polymorphism on ALL susceptibility is modified by sex ratio in cases (M/F). Since folate intake may be a possible confounding factor, including this factor in future prospective studies is warranted. Further meta-analysis studies should be at least stratified for folate levels and gender to give more powerful and informative results.

  15. Methylenetetrahydrofolate reductase gene polymorphisms contribute to acute myeloid leukemia and chronic myeloid leukemia susceptibilities: evidence from meta-analyses.

    PubMed

    He, Hairong; He, Gonghao; Wang, Taotao; Cai, Jiangxia; Wang, Yan; Zheng, Xiaowei; Dong, Yalin; Lu, Jun

    2014-10-01

    The expression of methylenetetrahydrofolate reductase (MTHFR) is associated with acute myeloid leukemia (AML) and chronic myeloid leukemia (CML). Most studies have linked the common functional C677T and A1298C polymorphisms of the MTHFR gene and susceptibility to AML and CML, but the results were not consistent. The aim of the present study was to derive a more precise estimation of the relationship. Meta-analyses assessing the association of MTHFR C677T and A1298C variations with AML and CML were conducted. Eligible articles were identified from the PubMed and EMBASE databases. All statistical analyses were conducted using Review Manager Software. 10 and 10 studies were included in the meta-analysis about the role of C677T polymorphism on the AML and CML risks, respectively; 6 and 4 studies were included about the role of A1298C polymorphism on the AML and CML risks, respectively. Overall, both the C677T and A1298C polymorphisms were significantly associated with CML risk under the recessive model (P=0.04, OR=1.35, 95% CI=1.02-1.79 for C677T and P=0.003, OR=2.17, 95% CI=1.29-3.63 for A1298C). In addition, the risk of CML was higher in 1298CC genotype carriers than in 1298AA genotype carriers (P=0.004, OR=2.17, 95%=1.28-3.69). Conversely, the overall data failed to indicate a significant association of C677T or A1298C polymorphisms with AML risk under any model. The findings provide evidence that C677T and A1298C polymorphisms are risk factors for CML risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Methylenetetrahydrofolate reductase gene polymorphisms: association with risk for pediatric acute lymphoblastic leukemia in north Indians.

    PubMed

    Sood, Swati; Das, Reena; Trehan, Amita; Ahluwalia, Jasmina; Sachdeva, Man Updesh; Varma, Neelam; Bansal, Deepak; Marwaha, Ram Kumar

    2010-05-01

    Genetic polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene have been associated with the development of acute leukemias and various malignancies. We conducted a case-control study in 95 north Indian children with acute lymphoblastic leukemia (ALL) and 255 controls, to investigate the role of MTHFR C677T and A1298C polymorphisms as risk factors in the development of ALL. PCR-RFLP on genomic DNA was carried out to determine C677T and A1298C genotypes. The frequency of MTHFR C677T for the T allele was found to be 23.2% among patients and 18.2% among controls. The frequency of the C allele in MTHFR A1298C was 44.2% among cases and 48.2% in controls. Patients showed a higher frequency of heterozygosity for the MTHFR C677T polymorphism as compared to controls (40% vs 27.8%; OR = 1.73, 95% CI 1.02-2.91, p = 0.02), and the A1298C polymorphism did not show any difference in genotype frequency between cases and controls. MTHFR 677CC/1298AC genotype frequencies showed a statistically significant difference between cases and controls (OR = 0.58, 95% CI 0.34-1.01, p = 0.04). In conclusion, our study in north Indian controls and patients with pediatric ALL showed increased frequency for MTHFR C677T in the heterozygous state and no significant difference in the frequency of A1298C genotype between the two groups.

  17. Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

    PubMed Central

    Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

    2016-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

  18. 44 CFR 67.7 - Collection of appeal data.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 44 Emergency Management and Assistance 1 2013-10-01 2013-10-01 false Collection of appeal data. 67... PROPOSED FLOOD ELEVATION DETERMINATIONS § 67.7 Collection of appeal data. (a) Appeals by private persons to... he may publicly designate and shall set forth scientific or technical data that tend to negate or...

  19. 44 CFR 67.7 - Collection of appeal data.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Collection of appeal data. 67... PROPOSED FLOOD ELEVATION DETERMINATIONS § 67.7 Collection of appeal data. (a) Appeals by private persons to... he may publicly designate and shall set forth scientific or technical data that tend to negate or...

  20. Functional variants of gene encoding folate metabolizing enzyme and methotrexate-related toxicity in children with acute lymphoblastic leukemia.

    PubMed

    Kałużna, Ewelina; Strauss, Ewa; Zając-Spychała, Olga; Gowin, Ewelina; Świątek-Kościelna, Bogna; Nowak, Jerzy; Fichna, Marta; Mańkowski, Przemysław; Januszkiewicz-Lewandowska, Danuta

    2015-12-15

    Methotrexate (MTX) is commonly used agent in therapy of malignancies, including acute lymphoblastic leukemia (ALL). Based on the literature data it is known that MTX elimination and toxicity can be affected by polymorphisms in genes encoding enzymes involved in MTX metabolism. The aim of our study was to investigate the influence of C677T and A1298C polymorphisms in methylenetetrahydrofolate reductase (MTHFR) gene on MTX-induced toxicity during treatment of children with ALL. We also tried to answer the question whether simultaneous occurrence of these two polymorphisms has a clinical significance. MTHFR polymorphisms were assessed in 47 pediatric ALL patients, treated according to intensive chemotherapy for childhood ALL, ALL IC BFM 2009. Prolonged MTX elimination and higher incidence of toxicity were observed for patients with 677T-1298A haplotype. On the other hand, occurrence of 677C-1298A haplotype had protective effect on MTX clearance and toxicity, that was not observed in carriers of 677C-1298C haplotype. In patients with coexistence of studied variants 677CT/1298AC heterozygotes as well as in 677TT/1298AA homozygotes more frequently toxicity incidents were noted. The obtained results suggest that occurrence of 677T allele and coexistence of 677T and 1298C alleles may be associated with lower MTX clearance and elevated risk of adverse effects during MTX-treatment of pediatric ALL patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Prospective study of MTHFR genetic polymorphisms as a possible etiology of male infertility.

    PubMed

    Li, S-S; Li, J; Xiao, Z; Ren, A-G; Jin, L

    2014-03-24

    The aim of this study was to explore the relationship between 2 genetic polymorphisms of the methylenetetrahydrofolate reductase gene (MTHFR), C677T and A1298C, and determine the long-term reproductive outcome in infertile men. This was a prospective study conducted in an andrology clinic. Men with a 1-year history of infertility were assessed for the MTHFR polymorphisms at a 5-year follow-up. We compared the MTHFR C677T and A1298C polymorphisms by polymerase chain reaction-restriction fragment length polymorphism between men who did and did not bear children during follow-up. Of the 215 men who were infertile at 1 year, 82 (38.1%) remained infertile and 133 (61.9%) achieved natural conception during the 5-year follow-up, with the highest rate in the first year (32.6%). The MTHFR 677TT genotype (homozygote) was associated with a substantially increased risk of infertility during follow-up [odds ratio (OR) = 10.242; 95% confidence interval (CI) = 1.257-83.464] relative to the MTHFR 677CC genotype (wild-type). Risk of infertility was not increased by the MTHFR A1298C polymorphism alone, but was increased by the combination of polymorphisms MTHFR C677T and MTHFR A1298C (OR = 11.818; 95%CI = 1.415-98.674). The homozygous MTHFR C677T genotype was a risk factor for male infertility during 5-year follow-up, whereas a correlation between MTHFR A1298C and infertility was not observed. The MTHFR C677T and MTHFR A1298C polymorphisms had additive effects on male infertility.

  2. 40 CFR 52.677 - Original identification of plan section.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Idaho § 52.677 Original identification of plan section. (a) This section identifies the original “Idaho Air Quality Implementation Plan” and all revisions submitted by Idaho that were federally approved prior to November 12, 2004. (b) The...

  3. 40 CFR 52.677 - Original identification of plan section.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Idaho § 52.677 Original identification of plan section. (a) This section identifies the original “Idaho Air Quality Implementation Plan” and all revisions submitted by Idaho that were federally approved prior to November 12, 2004. (b) The...

  4. 40 CFR 52.677 - Original identification of plan section.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Idaho § 52.677 Original identification of plan section. (a) This section identifies the original “Idaho Air Quality Implementation Plan” and all revisions submitted by Idaho that were federally approved prior to November 12, 2004. (b) The...

  5. 40 CFR 52.677 - Original identification of plan section.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Idaho § 52.677 Original identification of plan section. (a) This section identifies the original “Idaho Air Quality Implementation Plan” and all revisions submitted by Idaho that were federally approved prior to November 12, 2004. (b) The...

  6. Methylenetetrahydrofolate Reductase Polymorphisms and Risk of Acute Lymphoblastic Leukemia-Evidence from an updated meta-analysis including 35 studies

    PubMed Central

    2012-01-01

    Background 5,10-methylenetetrahydrofolate reductase (MTHFR) variants, C677T and A1298C, have been reported to be associated with decreased risk of acute lymphoblastic leukemia (ALL). However, results derived from individually underpowered studies are conflicting. We carried out an updated meta-analysis on the association between MTHFR polymorphisms and ALL risk. Methods Relevant publications were searched through PUBMED and EMBASE databases. The associations between MTHFR C677T and A1298C polymorphisms and the risk of ALL were evaluated by odds ratios (ORs). The heterogeneity and publication bias were estimated. Meta-regression analysis was performed to evaluate the potential sources of heterogeneity. Results C677T polymorphism was associated with a reduced risk of ALL (allele contrast: ORRE = 0.91, 95% CI: 0.83-0.99). Subgroup analysis showed MTHFR C677T variant was associated with decreased susceptibility to ALL in children and Caucasians. Meta-regression showed the logOR for the association between T allele and ALL increased as sex ratio (M/F) in the case group increased (P = 0.01). Regarding A1298C polymorphism, no significant association was observed (allele contrast: ORRE = 1.01, 95% CI: 0.91-1.11). There was no publication bias for C677T or A1298C polymorphism. Conclusions The present meta-analysis suggests that the C677T polymorphism, not A1298C, in MTHFR gene is associated with a decreased risk of ALL, particularly among children and Caucasians subjects. Our findings suggest that the influence of the C677T polymorphism on ALL susceptibility is modified by sex ratio in cases (M/F). Since folate intake may be a possible confounding factor, including this factor in future prospective studies is warranted. Further meta-analysis studies should be at least stratified for folate levels and gender to give more powerful and informative results. PMID:22943282

  7. Meta-analysis reveals PTPN22 1858C/T polymorphism confers susceptibility to rheumatoid arthritis in Caucasian but not in Asian population.

    PubMed

    Nabi, Gowher; Akhter, Naseem; Wahid, Mohd; Bhatia, Kanchan; Mandal, Raju Kumar; Dar, Sajad Ahmad; Jawed, Arshad; Haque, Shafiul

    2016-01-01

    The PTPN22 1858C/T polymorphism is associated with rheumatoid arthritis (RA). However, reports from the Asian populations are conflicting in nature and lacks consensus. The aim of our study was to evaluate the association between the PTPN22 1858C/T polymorphism and RA in Asian and Caucasian subjects by carrying out a meta-analysis of Asian and Caucasian data. A total of 27 205 RA cases and 27 677 controls were considered in the present meta-analysis involving eight Asian and 35 Caucasian studies. The pooled odds ratios (ORs) were performed for the allele, dominant, and recessive genetic model. No statistically significant association was found between the PTPN22 1858C/T polymorphism and risk of RA in Asian population (allele genetic model: OR = 1.217, 95% confidence interval (CI) = 0.99-1.496, p value 0.061; dominant genetic model: OR = 1.238, 95% CI = 0.982-1.562, p value 0.071; recessive genetic model: OR = 1.964, 95% CI = 0.678-5.693, p value 0.213). A significant association with risk of RA in Caucasian population suggesting that T-- allele does confer susceptibility to RA in this subgroup was observed (allele genetic model: OR = 1.638, 95% CI = 1.574-1.705, p value < 0.0001; dominant genetic model: OR = 1.67, 95% CI = 1.598-1.745, p value < 0.0001; recessive genetic model: OR = 2.65, 95% CI = 2.273-3.089, p value < 0.0001). The PTPN22 1858C/T polymorphism is not associated with RA risk in Asian populations. However, our meta-analysis confirms that the PTPN22 1858C/T polymorphism is associated with RA susceptibility in Caucasians.

  8. t {r_arrow} cWW and WW {r_arrow} {anti t}c + t{anti c} in extended models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    David Atwood; Marc Sher

    Jenkins has pointed out that the process t {r_arrow} cW{sup +}W{sup {minus}}is GIM suppressed in the standard model. In this note, the authors calculate the branching ratio for a wide range of models, in which the decay occurs at tree level through exchange of a scalar, fermion or vector. In the case of scalar exchange, a scalar mass between 2m{sub W} and 200 GeV leads to a resonant enhancement, giving a branching ratio as high as a few tenths of a percent. They then note that all of these models will also allow W{sup +}W{sup {minus}} {r_arrow} {anti t}c +more » t{anti c}, and they calculate the single-top/single-charm production rate at the LHC. The rates aren't negligibly small, but the background from single-top/single-bottom production will probably swamp the signal.« less

  9. Methylene tetrahydrofolate reductase (MTHFR) gene polymorphisms in chronic myeloid leukemia: an Egyptian study.

    PubMed

    Khorshied, Mervat Mamdooh; Shaheen, Iman Abdel Mohsen; Abu Khalil, Reham E; Sheir, Rania Elsayed

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) gene plays a pivotal role in folate metabolism. Several genetic variations in MTHFR gene as MTHFR-C677T and MTHFR-A1298C result in decreased MTHFR activity, which could influence efficient DNA methylation and explain susceptibility to different cancers. The etiology of chronic myeloid leukemia (CML) is obscure and little is known about individual's susceptibility to CML. In order to assess the influence of these genetic polymorphisms on the susceptibility to CML and its effect on the course of the disease among Egyptians, we performed an age-gender-ethnic matched case-control study. The study included 97 CML patients and 130 healthy controls. Genotyping of MTHFR-C677T and -A1298C was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. The results showed no statistical difference in the distribution of MTHFR-C677T and -A1298C polymorphic genotypes between CML patients and controls. The frequency of MTHFR 677-TT homozygous variant was significantly higher in patients with accelerated/blastic transformation phase when compared to those in the chronic phase of the disease. In conclusion, our study revealed that MTHFR-C677T and -A1298C polymorphisms could not be considered as genetic risk factors for CML in Egyptians. However, MTHFR 677-TT homozygous variant might be considered as a molecular predictor for disease progression.

  10. Association between decreased vitamin levels and MTHFR, MTR and MTRR gene polymorphisms as determinants for elevated total homocysteine concentrations in pregnant women.

    PubMed

    Barbosa, P R; Stabler, S P; Machado, A L K; Braga, R C; Hirata, R D C; Hirata, M H; Sampaio-Neto, L F; Allen, R H; Guerra-Shinohara, E M

    2008-08-01

    To examine the association between methylenetetrahydrofolate reductase (MTHFR) (C677T and A1298C), methionine synthase (MTR) A2756G and methionine synthase reductase (MTRR) A66G gene polymorphisms and total homocysteine (tHcy), methylmalonic acid (MMA) and S-adenosylmethionine/S-adenosylhomocysteine (SAM/SAH) levels; and to evaluate the potential interactions with folate or cobalamin (Cbl) status. Two hundred seventy-five healthy women at labor who delivered full-term normal babies. Cbl, folate, tHcy, MMA, SAM and SAH were measured in serum specimens. The genotypes for polymorphisms were determined by PCR-restriction fragment length polymorphism (RFLP). Serum folate, MTHFR 677T allele and MTR 2756AA genotypes were the predictors of tHcy levels in pregnant women. Serum Cbl and creatinine were the predictors of SAM/SAH ratio and MMA levels, respectively. The gene polymorphisms were not determinants for MMA levels and SAM/SAH ratios. Low levels of serum folate were associated with elevated tHcy in pregnant women, independently of the gene polymorphisms. In pregnant women carrying MTHFR 677T allele, or MTHFR 1298AA or MTRR 66AA genotypes, lower Cbl levels were associated with higher levels of tHcy. Lower SAM/SAH ratio was found in MTHFR 677CC or MTRR A2756AA genotypes carriers when Cbl levels were lower than 142 pmol/l. Serum folate and MTHFR C677T and MTR A2576G gene polymorphisms were the determinants for tHcy levels. The interaction between low levels of serum Cbl and MTHFR (C677T or A1298C) or MTRR A66G gene polymorphisms was associated with increased tHcy.

  11. [Study on the relationship of MTHFR polymorphisms with unexplained recurrent spontaneous abortion].

    PubMed

    Li, Xiao-mei; Zhang, You-zhong; Xu, Yan-xue; Jiang, Sen

    2004-02-01

    To assess the relationship of methylenetetrahydrofolate reductase (MTHFR) C677T genotypes to unexplained recurrent spontaneous abortion (URSA). This study included two groups:57 currently non-pregnant women with a history of URSA (URSA group), and 50 currently non-pregnant women with a history of having given birth to at least one live baby and without any history of spontaneous abortion, still-born fetus, placental thrombosis and intrauterine growth retardation(IUGR)(control group). The fasting serum-Hcy was measured with high pressure liquid chromatography. Folic acid and vitamin B(12) were detected by radioimmune assay; antiphospholipid antibody (ACA) was detected by ELISA. MTHFR C677T gene polymorphisms were detected by the technique of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). C/C genotype in URSA group was significantly lower than that in control group, the total mutant T allele frequency was significantly higher than that in control group. There was no significant difference in respect of "age, rural area/city, period, primary/secondary abortion" between the genotype distributions of MTHFR C677T. The T/T genotype and C/T+T/T genotypes frequencies for "abortion times>or=3" were higher than those for "abortion time <3". MTHFR C677T gene polymorphism is a genetic risk factor for URSA.

  12. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

    2012-04-15

    The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

  13. Erythrocyte volume, folate levels, and the presence of methylenetetrahydrofolate reductase polymorphism.

    PubMed

    García-García, Inés; García-Fragoso, Lourdes; Renta, Jessicca; Arce, Sylvia; Cadilla, Carmen L

    2002-03-01

    Homozygosity for a common polymorphism in the 5,10 methylenetetrahydrofolate reductase (MTHFR) gene (C677T) has been associated to an increased risk of neural tube defects as well as derangements in folate, homocysteine, and hematological parameters. This study analyzed the relationship between folate levels, the erythrocyte volume, and the presence of homozygosity for the C677T polymorphism in a group of 126 Puerto Rican healthy women of childbearing age. Blood samples were analyzed for erythrocyte mean corpuscular volume (MCV), mean erythrocyte hemoglobin content (MCH), folate, and RBC folate. Homozygosity for the C677T mutation was determined by PCR. Thirty-two percent (32%) of women used a folic acid supplement during the three months prior to sampling. Mean folate and RBC folate levels were within the normal range. Individuals homozygous for the MTHFR C677T polymorphism had no elevation of MCV (p = 0.70) or MCH (p = 0.68). Women in the lower quartile of folate levels did not show differences in their MCV or MCH. In this sample of Puerto Rican women, homozygosity for the C677T MTHFR polymorphism was not associated to elevations of MCV or MCH even in the presence of lower folate levels.

  14. The association of methylenetetrahydrofolate reductase genotypes with the risk of childhood leukemia in Taiwan.

    PubMed

    Pei, Jen-Sheng; Hsu, Chin-Mu; Tsai, Chia-Wen; Chang, Wen-Shin; Ji, Hong-Xue; Hsiao, Chieh-Lun; Miao, Chia-En; Hsu, Yuan-Nian; Bau, Da-Tian

    2015-01-01

    Acute lymphoblastic leukemia (ALL) is the most prevalent type of pediatric cancer, the causes of which are likely to involve an interaction between genetic and environmental factors. To evaluate the effects of the genotypic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) on childhood ALL risk in Taiwan, two well-known polymorphic genotypes of MTHFR, C677T (rs1801133) and A1298C (rs1801131), were analyzed to examine the extent of their associations with childhood ALL susceptibility and to discuss the MTHFR genotypic contribution to childhood ALL risk among different populations. In total, 266 patients with childhood ALL and an equal number of non-cancer controls recruited were genotyped utilizing PCR-RFLP methodology. The MTHFR C677T genotype, but not the A1298C, was differently distributed between childhood ALL and control groups. The CT and TT of MTHFR C677T genotypes were significantly more frequently found in controls than in childhood ALL patients (odds ratios=0.60 and 0.48, 95% confidence intervals=0.42-0.87 and 0.24-0.97, respectively). As for gender, the boys carrying the MTHFR C677T CT or TT genotype conferred a lower odds ratio of 0.51 (95% confidence interval=0.32-0.81, P=0.0113) for childhood ALL. As for age, those equal to or greater than 3.5 years of age at onset of disease carrying the MTHFR C677T CT or TT genotype were of lower risk (odds ratio= 0.43 and 95% confidence interval=0.26-0.71, P=0.0016). Our results indicated that the MTHFR C677T T allele was a protective biomarker for childhood ALL in Taiwan, and the association was more significant in male patients and in patients 3.5 years of age or older at onset of disease.

  15. Association between methylenetetrahydrofolate reductase polymorphisms and the relapse of acute lymphoblastic leukemia: a meta-analysis.

    PubMed

    He, H-R; Chen, S-Y; You, H-S; Hu, S-S; Sun, J-Y; Dong, Y-L; Lu, J

    2014-10-01

    Relapse is a threat in patients treated for acute lymphoblastic leukemia (ALL). Methylenetetrahydrofolate reductase (MTHFR) activity may affect the sensitivity of patients to folate-based chemotherapeutic drugs, thus influencing the relapse risk. Two polymorphisms of the gene encoding MTHFR, C677T and A1298C, alter MTHFR enzyme activity and may be associated with ALL relapse. The aim of this meta-analysis was to clarify the correlation between the C677T and A1298C polymorphisms and ALL relapse. To this end, data were collected from studies of the association between these two polymorphisms and ALL relapse. Analysis of the data revealed a serious contradiction among the results. A recessive model demonstrated that the ALL relapse risk was significantly increased in carriers of the 677 TT genotype, especially for pediatric ALL, but was unaffected by the A1298C polymorphism. These findings confirm that the MTHFR C677T polymorphism could be considered as a good marker of the pediatric ALL relapse risk.

  16. Association between VEGF polymorphisms (936c/t, -460t/c and -634g/c) with haplotypes and coronary heart disease susceptibility.

    PubMed

    Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang

    2015-01-01

    Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.

  17. Methylenetetrahydrofolate reductase gene haplotypes affect toxicity during maintenance therapy for childhood acute lymphoblastic leukemia in Japanese patients.

    PubMed

    Tanaka, Yoichi; Manabe, Atsushi; Nakadate, Hisaya; Kondoh, Kensuke; Nakamura, Kozue; Koh, Katsuyoshi; Kikuchi, Akira; Komiyama, Takako

    2014-05-01

    Abstract The aim of this study was to investigate the influence of daily 6-mercaptopurine (6-MP) and low-dose weekly methotrexate (MTX) combination treatment and methylenetetrahydrofolate reductase (MTHFR) haplotypes on toxicity during maintenance therapy in Japanese childhood acute lymphoblastic leukemia (ALL). We retrospectively analyzed the MTHFR C677T and A1298C polymorphisms and influence of haplotypes on toxicity in 73 patients. Patients with the MTHFR 677TT and 677CT + 1298AC were associated with severe liver toxicity (p = 0.014, odds ratio [OR] = 3.82, 95% confidence interval [CI] = 1.27-11.46) and more rapid onset of liver toxicity (p = 0.010). Patients with MTHFR 677TT and 677CT + 1298AC were associated with lower frequency of 6-MP and MTX dose reduction due to leukopenia (p < 0.05). No difference was observed in average drug doses in the MTHFR genotypes. In conclusion, the MTHFR C677T and A1298C haplotypes might be useful for monitoring adverse effects in childhood ALL maintenance therapy in Japanese patients.

  18. Meta-Prediction of MTHFR Gene Polymorphisms and Air Pollution on the Risk of Hypertensive Disorders in Pregnancy Worldwide.

    PubMed

    Yang, Ya-Ling; Yang, Hsiao-Ling; Shiao, S Pamela K

    2018-02-13

    Hypertensive disorders in pregnancy (HDP) are devastating health hazards for both women and children. Both methylenetetrahydrofolate reductase ( MTHFR ) gene polymorphisms and air pollution can affect health status and result in increased risk of HDP for women. The major objective of this study was to investigate the effect of MTHFR polymorphisms, air pollution, and their interaction on the risk of HDP by using meta-predictive analytics. We searched various databases comprehensively to access all available studies conducted for various ethnic populations from countries worldwide, from 1997 to 2017. Seventy-one studies with 8064 cases and 13,232 controls for MTHFR C677T and 11 studies with 1425 cases and 1859 controls for MTHFR A1298C were included. MTHFR C677T homozygous TT (risk ratio (RR) = 1.28, p < 0.0001) and CT plus TT (RR = 1.07, p = 0.0002) were the risk genotypes, while wild-type CC played a protective role (RR = 0.94, p = 0.0017) for HDP. The meta-predictive analysis found that the percentage of MTHFR C677T TT plus CT ( p = 0.044) and CT ( p = 0.043) genotypes in the HDP case group were significantly increased with elevated levels of air pollution worldwide. Additionally, in countries with higher air pollution levels, the pregnant women with wild-type CC MTHFR 677 had a protection effect against HDP ( p = 0.014), whereas, the homozygous TT of MTHFR C677T polymorphism was a risk genotype for developing HDP. Air pollution level is an environmental factor interacting with increased MTHFR C677T polymorphisms, impacting the susceptibility of HDP for women.

  19. Meta-Prediction of MTHFR Gene Polymorphisms and Air Pollution on the Risk of Hypertensive Disorders in Pregnancy Worldwide

    PubMed Central

    Yang, Ya-Ling; Yang, Hsiao-Ling; Shiao, S. Pamela K.

    2018-01-01

    Hypertensive disorders in pregnancy (HDP) are devastating health hazards for both women and children. Both methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and air pollution can affect health status and result in increased risk of HDP for women. The major objective of this study was to investigate the effect of MTHFR polymorphisms, air pollution, and their interaction on the risk of HDP by using meta-predictive analytics. We searched various databases comprehensively to access all available studies conducted for various ethnic populations from countries worldwide, from 1997 to 2017. Seventy-one studies with 8064 cases and 13,232 controls for MTHFR C677T and 11 studies with 1425 cases and 1859 controls for MTHFR A1298C were included. MTHFR C677T homozygous TT (risk ratio (RR) = 1.28, p < 0.0001) and CT plus TT (RR = 1.07, p = 0.0002) were the risk genotypes, while wild-type CC played a protective role (RR = 0.94, p = 0.0017) for HDP. The meta-predictive analysis found that the percentage of MTHFR C677T TT plus CT (p = 0.044) and CT (p = 0.043) genotypes in the HDP case group were significantly increased with elevated levels of air pollution worldwide. Additionally, in countries with higher air pollution levels, the pregnant women with wild-type CC MTHFR 677 had a protection effect against HDP (p = 0.014), whereas, the homozygous TT of MTHFR C677T polymorphism was a risk genotype for developing HDP. Air pollution level is an environmental factor interacting with increased MTHFR C677T polymorphisms, impacting the susceptibility of HDP for women. PMID:29438331

  20. Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

    2018-02-05

    Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

  1. Involvement of MTHFR and TPMT genes in susceptibility to childhood acute lymphoblastic leukemia (ALL) in Mexicans.

    PubMed

    Gutiérrez-Álvarez, Ossyneidee; Lares-Asseff, Ismael; Galaviz-Hernández, Carlos; Reyes-Espinoza, Elio-Aarón; Almanza-Reyes, Horacio; Sosa-Macías, Martha; Chairez Hernández, Isaías; Salas-Pacheco, José-Manuel; Bailón-Soto, Claudia E

    2016-03-01

    Folate metabolism plays an essential role in the processes of DNA synthesis and methylation. Deviations in the folate flux resulting from single-nucleotide polymorphisms in genes encoding folate-dependent enzymes may affect the susceptibility to leukemia. This case-control study aimed to assess associations among MTHFR (C677T, A1298C) and TPMT (*2, *3A) mutations as well as to evaluate the synergistic effects of combined genotypes for both genes. Therefore, these genetic variants may lead to childhood acute lymphoblastic leukemia (ALL) susceptibility, in a Mexican population study. DNA samples obtained from 70 children with ALL and 152 age-matched controls (range, 1-15 years) were analyzed by real-time reverse transcription polymerase chain reaction (RT-qPCR) to detect MTHFR C677T and A1298C and TPMT*2 and TPMT*3A genotypes. The frequency of the MTHFR A1298C CC genotype was statistically significant (odds ratio [OR], 6.48; 95% 95% confidence intervals [CI], 1.26-33.2; p=0.025). In addition, the combined 677CC+1298AC genotype exhibited a statistically significant result (OR, 0.23; 95% CI, 0.06-0.82; p=0.023). No significant results were obtained from the MTHFR (C677T CT, C677T TT) or TPMT (*2, *3A) genotypes. More importantly, no association between the synergistic effects of either gene (MTHFR and/or TPMT) and susceptibility to ALL was found. The MTHFR A1298C CC genotype was associated with an increased risk of developing childhood ALL. However, a decreased risk to ALL with the combination of MTHFR 677CC+1298AC genotypes was found.

  2. The Association of Methylenetetrahydrofolate Reductase Genotypes with the Risk of Childhood Leukemia in Taiwan

    PubMed Central

    Chang, Wen-Shin; Ji, Hong-Xue; Hsiao, Chieh-Lun; Miao, Chia-En; Hsu, Yuan-Nian; Bau, Da-Tian

    2015-01-01

    Background Acute lymphoblastic leukemia (ALL) is the most prevalent type of pediatric cancer, the causes of which are likely to involve an interaction between genetic and environmental factors. To evaluate the effects of the genotypic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) on childhood ALL risk in Taiwan, two well-known polymorphic genotypes of MTHFR, C677T (rs1801133) and A1298C (rs1801131), were analyzed to examine the extent of their associations with childhood ALL susceptibility and to discuss the MTHFR genotypic contribution to childhood ALL risk among different populations. Methodology/Principal Findings In total, 266 patients with childhood ALL and an equal number of non-cancer controls recruited were genotyped utilizing PCR-RFLP methodology. The MTHFR C677T genotype, but not the A1298C, was differently distributed between childhood ALL and control groups. The CT and TT of MTHFR C677T genotypes were significantly more frequently found in controls than in childhood ALL patients (odds ratios=0.60 and 0.48, 95% confidence intervals=0.42–0.87 and 0.24–0.97, respectively). As for gender, the boys carrying the MTHFR C677T CT or TT genotype conferred a lower odds ratio of 0.51 (95% confidence interval=0.32–0.81, P=0.0113) for childhood ALL. As for age, those equal to or greater than 3.5 years of age at onset of disease carrying the MTHFR C677T CT or TT genotype were of lower risk (odds ratio= 0.43 and 95% confidence interval=0.26–0.71, P=0.0016). Conclusions Our results indicated that the MTHFR C677T T allele was a protective biomarker for childhood ALL in Taiwan, and the association was more significant in male patients and in patients 3.5 years of age or older at onset of disease. PMID:25793509

  3. The rs4846049 polymorphism in the 3'UTR region of the MTHFR gene increases the migraine susceptibility in an Iranian population.

    PubMed

    Salehi, Mohaddeseh; Amin-Beidokhti, Mona; Safarpour Lima, Behnam; Gholami, Milad; Javadi, Gholam-Reza; Mirfakhraie, Reza

    2018-01-01

    Migraine is a painful complex neurovascular disease characterized by recurrent moderate-to-severe headaches. Increased level of homocysteine is related to dilation of cerebral vessels and endothelial injury that could trigger migraine attacks. Functional polymorphisms in the MTHFR gene affect homocysteine metabolism and, therefore, play an important role in the etiology of the disease. We aimed to investigate the possible association between MTHFR gene rs4846049, C677T, and A1298C polymorphisms and the risk of migraine in Iranian population. In this genetic association study, 498 individuals were enrolled, including 223 migraine patients and 275 healthy controls. Genotyping was performed using tetra-primer ARMS-PCR for rs4846049 and PCR-restriction fragment length polymorphism for C677T and A1298C polymorphisms. The association between rs4846049 and C677T polymorphisms and migraine was observed. For the rs4846049 polymorphism, the association was detected under a dominant model ( P =0.007; odds ratio [OR] =0.60; 95% confidence interval [CI], 0.41-0.87), and for the C677T polymorphism, the TT genotype frequency was significantly different in the studied groups ( P =0.009; OR =2.48; 95% CI, 1.25-4.92). No significant differences in the genotype or allele frequencies were found for the A1298C polymorphism between the migraineurs and controls. Present data provide evidence for the association of rs4846049 and C677T polymorphisms in the MTHFR gene and migraine. Further studies are required to validate the significance of the studied genetic variations in diverse ethnic populations.

  4. APOC3 promoter polymorphisms C-482T and T-455C are associated with the metabolic syndrome.

    PubMed

    Miller, Michael; Rhyne, Jeffrey; Chen, Hegang; Beach, Valerie; Ericson, Richard; Luthra, Kalpana; Dwivedi, Manjari; Misra, Anoop

    2007-05-01

    Despite the growing epidemic of the metabolic syndrome (MetS), few studies have evaluated genetic polymorphisms associated with the MetS phenotype. One candidate, APOC3, modulates lipid and lipoprotein metabolism and the promoter polymorphisms C-482T/T-455C are associated with loss of insulin downregulation. One hundred twenty two consecutive MetS cases were matched by age, sex and race in a 1:1 case-control design to evaluate the prevalence of common polymorphisms in the following candidate genes: APOC3, APOE, B3AR, FABP2, GNB3, LPL, and PPARalpha and PPARgamma. Compared to controls, MetS subjects exhibited a greater prevalence of APOC3 promoter polymorphisms. Specifically, the frequency of the variant C-482T and T-455C alleles was 70.5 and 81.9% of cases compared to 43.4 and 54.1% in controls, respectively (p <0.0001). Overall, APOC3 promoter variants were associated with a greater likelihood of MetS compared to wild type [C-482T (OR: 4.3; 95% CI: 2.2, 8.6 [p <0.0001]), T-455C (OR: 3.6; 95% CI: 2.0, 6.7 [p <0.0001])]. No material differences were identified between the other genetic variants tested and prevalence of MetS. These data, therefore, suggest that the APOC3 promoter polymorphisms C-482T and T-455C are associated with the MetS.

  5. Inverse correlation between quasiparticle mass and T c in a cuprate high-T c superconductor.

    PubMed

    Putzke, Carsten; Malone, Liam; Badoux, Sven; Vignolle, Baptiste; Vignolles, David; Tabis, Wojciech; Walmsley, Philip; Bird, Matthew; Hussey, Nigel E; Proust, Cyril; Carrington, Antony

    2016-03-01

    Close to a zero-temperature transition between ordered and disordered electronic phases, quantum fluctuations can lead to a strong enhancement of electron mass and to the emergence of competing phases such as superconductivity. A correlation between the existence of such a quantum phase transition and superconductivity is quite well established in some heavy fermion and iron-based superconductors, and there have been suggestions that high-temperature superconductivity in copper-oxide materials (cuprates) may also be driven by the same mechanism. Close to optimal doping, where the superconducting transition temperature T c is maximal in cuprates, two different phases are known to compete with superconductivity: a poorly understood pseudogap phase and a charge-ordered phase. Recent experiments have shown a strong increase in quasiparticle mass m* in the cuprate YBa2Cu3O7-δ as optimal doping is approached, suggesting that quantum fluctuations of the charge-ordered phase may be responsible for the high-T c superconductivity. We have tested the robustness of this correlation between m* and T c by performing quantum oscillation studies on the stoichiometric compound YBa2Cu4O8 under hydrostatic pressure. In contrast to the results for YBa2Cu3O7-δ, we find that in YBa2Cu4O8, the mass decreases as T c increases under pressure. This inverse correlation between m* and T c suggests that quantum fluctuations of the charge order enhance m* but do not enhance T c.

  6. UV-associated decline in systemic folate: implications for human nutrigenetics, health, and evolutionary processes.

    PubMed

    Lucock, Mark; Beckett, Emma; Martin, Charlotte; Jones, Patrice; Furst, John; Yates, Zoe; Jablonski, Nina G; Chaplin, George; Veysey, Martin

    2017-03-01

    The purpose of this study was to examine whether UV exposure alters folate status according to C677T-MTHFR genotype, and to consider the relevance of this to human health and the evolutionary model of skin pigmentation. Total Ozone Mapping Spectrometer (TOMS) satellite data were used to examine surface UV-irradiance, as a marker of UV exposure, in a large (n = 649) Australian cross-sectional study population. PCR/RFLP analysis was used to genotype C677T-MTHFR. Overall, cumulative UV-irradiance (42 and 120 days pre-clinic) was significantly negatively related to red cell folate (RCF) levels. When the cohort was stratified by MTHFR-C677T genotype, the relationship between UV-irradiance (42 days pre-clinic) and RCF remained significant only in the cohorts containing carriers of the T allele. Statistically significant z-score statistics and interaction terms from genotype and UV-irradiance (p-interaction) demonstrated that genotype did modify the effect of UV-irradiance on RCF, with the largest effect of UV being demonstrated in the 677TT-MTHFR subjects. Data provide strong evidence that surface UV-irradiance reduces long-term systemic folate levels, and that this is influenced by the C677T-MTHFR gene variant. We speculate this effect may be due to 677TT-MTHFR individuals containing more 5,10CH 2 -H 4 PteGlu, and that this folate form may be particularly UV labile. Since UV-irradiance lowers RCF in an MTHFR genotype-specific way, there are likely implications for human health and the evolution of skin pigmentation. © 2016 Wiley Periodicals, Inc.

  7. More severe toxicity of genetic polymorphisms on MTHFR activity in osteosarcoma patients treated with high-dose methotrexate

    PubMed Central

    Xie, Lu; Guo, Wei; Yang, Yi; Ji, Tao; Xu, Jie

    2018-01-01

    5,10-Methylenetrahydrofolate reductase (MTHFR), a key enzyme for folate metabolism, catalyses the irreversible conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, which is located at the end of the short arm (1p36.3). Two common non-synonymous variants, the C677T (Ala222Val) and A1298C (Glu429Ala), were mainly described with decreased enzymatic activity and an alteration of intracellular folate distribution. Osteosarcomas are currently treated with high dose of methotrexate (MTX). The decreased enzyme activity of MTHFR theoretically could increase the drug action of MTX and at the same time increase toxic and side effect. Germline variants of C677T and A1298C were studied in 59 osteosarcoma patients, with whom the A1298C is detected with particularly low rate of mutant genotype (N = 1, 0.8%) and could not proceed with statistical calculations. 15 patients were wild type of C677T (CC, 25.4%), 20 were heterozygous mutant genotype (CT, 33.9%) and 24 were homozygous mutant genotype (TT, 40.7%). Patients harboring the TT/CT genotype had the same progression-free survival and tumor necrosis rate in comparison with patients having the CC genotype (P = 0.349 and P = 0.465 respectively). And the C677T polymorphisms had no significant correlation with MTX initial plasma concentration (P = 0.867; r = 0.024) and delayed elimination (P = 0.305; r = −0.136). However patients with mutant genotype of C677T were associated with higher degree of liver toxicity (P = 0.043) and fever reaction of MTX (P = 0.050) while G3/G4 hematologic toxicity were more likely to be noticed with TT than CT/CC (P = 0.095). The study suggests that genetic polymorphism of MTHFR C677T in the MTX metabolic pathway seems to be associated with the trend for more side effects statistically, but has no obvious effect on histologic response and survival. PMID:29545912

  8. 47 CFR 90.677 - Reconfiguration of the 806-824/851-869 MHz band in order to separate cellular systems from non...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... relocation agreement. Sprint Nextel and relocating incumbents may agree to conduct face-to-face negotiations...-55. Sprint Nextel and relocating incumbents may agree to conduct face-to-face negotiations or either... in order to separate cellular systems from non-cellular systems. 90.677 Section 90.677...

  9. APOC3 Promoter Polymorphisms C-482T and T-455C Are Associated with the Metabolic Syndrome1

    PubMed Central

    Miller, Michael; Rhyne, Jeffrey; Chen, Hegang; Beach, Valerie; Ericson, Richard; Luthra, Kalpana; Dwivedi, Manjari; Misra, Anoop

    2007-01-01

    Background Despite the growing epidemic of the metabolic syndrome (MetS), few studies have evaluated genetic polymorphisms associated with the MetS phenotype. One candidate, APOC3, modulates lipid and lipoprotein metabolism and the promoter polymorphisms C-482T/T-455C are associated with loss of insulin downregulation. Methods One hundred twenty two consecutive MetS cases were matched by age, sex and race in a 1:1 case-control design to evaluate the prevalence of common polymorphisms in the following candidate genes: APOC3, APOE, B3AR, FABP2, GNB3, LPL, and PPARα and PPARγ. Results Compared to controls, MetS subjects exhibited a greater prevalence of APOC3 promoter polymorphisms. Specifically, the frequency of the variant C-482T and T-455C alleles was 70.5 and 81.9% of cases compared to 43.4 and 54.1% in controls, respectively ( p <0.0001). Overall, APOC3 promoter variants were associated with a greater likelihood of MetS compared to wild type [C-482T (OR: 4.3; 95% CI: 2.2, 8.6 [p <0.0001]), T-455C (OR: 3.6; 95% CI: 2.0, 6.7 [p <0.0001])]. No material differences were identified between the other genetic variants tested and prevalence of MetS. Conclusions These data, therefore, suggest that the APOC3 promoter polymorphisms C-482T and T-455C are associated with the MetS. PMID:17416293

  10. Methylenetetrahydrofolate reductase gene polymorphisms and risk of acute lymphoblastic leukemia in children.

    PubMed

    Sadananda Adiga, M N; Chandy, S; Ramachandra, N; Appaji, L; Aruna Kumari, B S; Ramaswamy, G; Savithri, H S; Krishnamoorthy, L

    2010-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. Genetic polymorphisms of this enzyme have been shown to impact several diseases, including cancer. Leukemias are malignancies arising from rapidly proliferating hematopoietic cells having great requirement of DNA synthesis. This case-control study was undertaken to analyze the association of the MTHFR gene polymorphisms 677 C"T and 1298 A"C and the risk of acute lymphoblastic leukemia in children. Eighty-six patients aged below 15 years with a confirmed diagnosis of acute lymphoblastic leukemia (ALL) and 99 matched controls were taken for this study. Analysis of the polymorphisms was done using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Frequency of MTHFR 677 CC and CT were 85.9% and 14.1% in the controls, and 84.9% and 15.1% in the cases. The 'T' allele frequency was 7% and 7.5% in cases and controls respectively. The frequency of MTHFR 1298 AA, AC, and CC were 28.3%, 55.6% and 16.1% for controls and 23.3%, 59.3% and 17.4% for cases respectively. The 'C' allele frequency for 1298 A-->C was 43.9% and 47% respectively for controls and cases. The odds ratio (OR) for C677T was 1.08 (95% CI 0.48-2.45, p = 0.851) and OR for A1298C was 1.29 (95% CI 0.65-2.29, p = 0.46) and OR for 1298 CC was 1.31 (95% CI 0.53-3.26, p = 0.56). The OR for the combined heterozygous status (677 CT and 1298 AC) was 1.94 (95% CI 0.58-6.52, p = 0.286). The prevalence of 'T' allele for 677 MTHFR polymorphism was low in the population studied. There was no association between MTHFR 677 C-->T and 1298 A-->C gene polymorphisms and risk of ALL, which may be due to the small sample size.

  11. The relationship between methylenetetrahydrofolate reductase polymorphism and hematological malignancy.

    PubMed

    Jiang, Ni; Zhu, Xishan; Zhang, Hongmei; Wang, Xiaoli; Zhou, Xinna; Gu, Jiezhun; Chen, Baoan; Ren, Jun

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is the key enzyme for folate metabolism. Previous studies suggest a relationship between its single nucleotide polymorphisms (SNP) of C677T and A1298C with a variety of tumor susceptibility including hematological malignancy. SNP frequency distribution in different ethnic populations might lead to differences in disease susceptibility. There has been little research in Chinese people on the MTHFR SNP with the susceptibility of the hematological malignancy. Therefore, this study investigated the relationship between MTHFR SNPs and hematological malignancy in Jiangsu province in China. Gene microarray was used to detect MTHFR C677T and A1298C single nucleotide polymorphism loci on 157 healthy controls and 127 patients from Jiangsu province with hematological malignancies (30 with multiple myeloma, 28 with non-Hodgkin's lymphoma, 22 with acute lymphoblastic leukemia, 40 with acute myeloid leukemia, and seven with chronic myeloid leukemia). The allele frequency of 677T was 41.3% in patients and 33.1% in controls, showed significant difference (chi2 = 4.08, p = 0.043); 677TT genotype with a high susceptibility to hematological malignancy (OR 1.96, 95% CI 1.01 - 4.45, p = 0.041). In subgroup analyses, the genotypes 677TT and 1298CC were associated with significantly increased multiple myeloma risk (TT vs. CC: OR 8.92, 95% CI 1.06 - 75.24, p = 0.006; CC vs. AA: OR = 4.80, 95% CI 1.56 - 14.73, p = 0.044). No associations were found between polymorphisms and susceptibilities to acute lymphoblastic leukemia, acute myeloid leukemia, or non-Hodgkin's lymphoma. MTHFRC677T polymorphisms influence the risk of hematological malignancy among the population in Jiangsu province. Both MTHFR 677TT and MTHFR 1298CC genotypes increase susceptibility to myeloid leukemia.

  12. 1236 C/T and 3435 C/T polymorphisms of the ABCB1 gene in Mexican breast cancer patients.

    PubMed

    Gutierrez-Rubio, S A; Quintero-Ramos, A; Durán-Cárdenas, A; Franco-Topete, R A; Castro-Cervantes, J M; Oceguera-Villanueva, A; Jiménez-Pérez, L M; Balderas-Peña, L M A; Morgan-Villela, G; Del-Toro-Arreola, A; Daneri-Navarro, A

    2015-02-13

    MDR1, which is encoded by the ABCB1 gene, is involved in multidrug resistance (hydrophobic), as well as the elimination of xenotoxic agents. The association between ABCB1 gene polymorphisms and breast cancer risk in different populations has been described previously; however, the results have been inconclusive. In this study, we examined the association between polymorphisms 3435 C/T and 1236 C/T in the ABCB1 gene and breast cancer development in Mexican women according to their menopausal status and molecular classification. Molecular subtypes as well as allele and genotype frequencies were analyzed. A total of 248 women with initial breast cancer diagnosis and 180 ethnically matched, healthy, unrelated individuals were enrolled. Polymerase chain reaction-restriction fragment length polymorphism was performed to detect polymorphisms 3435 C/T and 1236 C/T in the ABCB1 gene. Premenopausal T allele carriers of the 3435 C/T polymorphism showed a 2-fold increased risk of breast cancer with respect to the reference and postmenopausal groups, as well as triple-negative expression regarding the luminal A/B molecular subrogated subtypes. In contrast, the CT genotype of the 1236 polymorphism was a protective factor against breast cancer. We conclude that the T allele carrier of the 3435 C/T polymorphism in the ABCB1 gene in combination with an estrogen receptor-negative status may be an important risk factor for breast cancer development in premenopausal women.

  13. A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

    PubMed

    Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

    2013-12-01

    Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

  14. Automated Formal Testing of C API Using T2C Framework

    NASA Astrophysics Data System (ADS)

    Khoroshilov, Alexey V.; Rubanov, Vladimir V.; Shatokhin, Eugene A.

    A problem of automated test development for checking basic functionality of program interfaces (API) is discussed. Different technologies and corresponding tools are surveyed. And T2C technology developed in ISPRAS is presented. The technology and associated tools facilitate development of "medium quality" (and "medium cost") tests. An important feature of T2C technology is that it enforces that each check in a developed test is explicitly linked to the corresponding place in the standard. T2C tools provide convenient means to create such linkage. The results of using T2C are considered by example of a project for testing interfaces of Linux system libraries defined by the LSB standard.

  15. Prediction of Methotrexate Clinical Response in Portuguese Rheumatoid Arthritis Patients: Implication of MTHFR rs1801133 and ATIC rs4673993 Polymorphisms

    PubMed Central

    Lima, Aurea; Monteiro, Joaquim; Bernardes, Miguel; Sousa, Hugo; Azevedo, Rita; Seabra, Vitor; Medeiros, Rui

    2014-01-01

    Objective. Methotrexate (MTX), the most used drug in rheumatoid arthritis (RA) treatment, showing variability in clinical response, is often associated with genetic polymorphisms. This study aimed to elucidate the role of methylenetetrahydrofolate reductase (MTHFR) C677T and aminoimidazole carboxamide adenosine ribonucleotide transformylase (ATIC) T675C polymorphisms and clinicopathological variables in clinical response to MTX in Portuguese RA patients. Methods. Study included 233 RA patients treated with MTX for at least six months. MTHFR C677T and ATIC T675C polymorphisms were genotyped and clinicopathological variables were collected. Statistical analyses were performed and binary logistic regression method adjusted to possible confounding variables. Results. Multivariate analyses demonstrated that MTHFR 677TT (OR = 4.63; P = 0.013) and ATIC 675T carriers (OR = 5.16; P = 0.013) were associated with over 4-fold increased risk for nonresponse. For clinicopathological variables, noncurrent smokers (OR = 7.98; P = 0.001), patients positive to anti-cyclic citrullinated peptide (OR = 3.53; P = 0.004) and antinuclear antibodies (OR = 2.28; P = 0.045), with higher health assessment questionnaire score (OR = 2.42; P = 0.007), and nonsteroidal anti-inflammatory drug users (OR = 2.77; P = 0.018) were also associated with nonresponse. Contrarily, subcutaneous administration route (OR = 0.11; P < 0.001) was associated with response. Conclusion. Our study suggests that MTHFR C677T and ATIC T675C genotyping combined with clinicopathological data may help to identify patients whom will not benefit from MTX treatment and, therefore, assist clinicians in personalizing RA treatment. PMID:24967362

  16. [Homocysteinemia and its relationship with the methylentetrahydrofolate reductase polymorphism in various ethnic groups from western Venezuela].

    PubMed

    Vizcaíno, Gilberto; Diez-Ewald, María; Herrmann, Falko H; Schuster, Gudrun; Torres-Guerra, Enrique; Arteaga-Vizcaíno, Melvis

    2005-12-01

    The prevalence of hyperhomocysteinemia and C677T MTHFR polymorphism was studied in various ethnic groups from Western Venezuela (60 Wayuu Indians, 42 italian immigrants and 77 Venezuelan mestizos) in relation with the prevalence of hyperhomocysteinemia and the C677T MTHFR polymorphism. Homocysteinemia was determined by polarized fluorescence immunoassay in an IMX system, serum folate was measured by radioimmunoanalysis and the MTHFR genotype was determined by PCR and restriction analysis. Hyperhomocysteinemia was defined as a value over 2 SD above the mean value for normal MTHFR (CC677) in each group. The prevalence of MTHFR variants (C677T and 677TT) was elevated in all ethnic groups (78% among the wayuu, 76% among Italians and 63% among mestizos) with a significant association between the concentrations of homocysteine and the levels of serum folate among the wayuu (p < 0.0001) and the mestizos (p < 0.001) only. Hyperhomocysteinemia was associated with MTHFR variants in 23% of the wayuu (OR: 6.17, CI 95: 0.74-51.36), 9.5% of the Italians (OR: 0.93, CI 95: 0.085-10.10) and 20.7 of the Venezuelans mestizos (OR: 5.2, CI 95: 1.08-24.90, p > 0.03). There was no relationship between hyperhomocysteinemia and folate deficiency in any of the groups studied. In conclusion, despite a high prevalence of C677T MTHFR variants in these ethnic groups of western Venezuela, the lack of no evidence of hyperhomocysteinemia combined with folate deficiency may imply that the nutritional status of these groups plays an important role in the control of hyperhomocysteinemia as a risk factor for cardiovascular disease.

  17. 5,10-Methylenetetrahydrofolate reductase polymorphisms and acute lymphoblastic leukemia risk: a meta-analysis.

    PubMed

    Pereira, Tiago Veiga; Rudnicki, Martina; Pereira, Alexandre Costa; Pombo-de-Oliveira, Maria S; Franco, Rendrik França

    2006-10-01

    There is evidence supporting a role for 5-10 methylenetetrahydrofolate reductase (MTHFR) gene variants in acute lymphoblastic leukemia (ALL). To provide a more robust estimate of the effect of MTHFR polymorphisms on the risk of ALL, we did a meta-analysis to reevaluate the association between the two most commonly studied MTHFR polymorphisms (C677T and A1298C) and ALL risk. All case-control studies investigating an association between the C677T or A1298C polymorphisms and risk of ALL were included. We applied both fixed-effects and random-effects models to combine odds ratio (OR) and 95% confidence intervals (95% CI). Q-statistic was used to evaluate the homogeneity and both Egger and Begg-Mazumdar tests were used to assess publication bias. The meta-analysis of the C677T polymorphism and risk of childhood ALL included 13 studies with a total of 4,894 individuals. Under a fixed-effects model, the TT genotype failed to be associated with a statistically significant reduction of childhood ALL risk (TT versus CT + CC: OR, 0.88; 95% CI, 0.73-1.06; P = 0.18). However, individuals homozygous for the 677T allele exhibited a 2.2-fold decrease in risk of adult ALL (TT versus CT + CC: OR, 0.45; 95% CI, 0.26-0.77; P = 0.004). In both cases, no evidence of heterogeneity was observed. No association between the A1298C variant and susceptibility to both adult and childhood ALL was disclosed. Our findings support the proposal that the common genetic C677T polymorphism in the MTHFR contributes to the risk of adult ALL, but not to the childhood ALL susceptibility.

  18. The association of RANK gene C421T and C575T polymorphisms with bone mineral density in postmenopausal Turkish women.

    PubMed

    Işleten, Banu; Durmaz, Burak; Durmaz, Berrin; Onay, Hüseyin; Ozkınay, Ferda; Durmaz, Asude; Turan, Volkan; Oztekin, Kemal

    2013-10-01

    To investigate the association between C421T polymorphism within exon 4, C575T polymorphism within exon 6 of the RANK gene and bone mineral density (BMD) variations in postmenopausal Turkish women. One hundred seventy-eight postmenopausal women (patients = 100 and controls = 78) who applied to Ege University Faculty of Medicine, Department of Physical Medicine and Rehabilitation, for osteoporosis examination were analyzed. BMDs of the lumbar spine and femoral sites were measured. Patient and control groups were established based on their T-score values being above and/or below -1. After venous blood sampling, C421T and C575T polymorphisms of the RANK gene were assessed through PCR process following DNA extraction. Genotype frequencies for the C421T and C575T polymorphisms were compared between the control group and the patient group. No significant difference was detected between the two groups for both polymorphisms. There was also no significant difference between the control and patient groups in terms of the combined genotype (p = 0.752) and the combined haplotype analysis of the C421T and C575T polymorphisms (p = 0.723). In the control and patient groups separately, no significant differences in BMD values either at the femoral sites or at the lumbar spine were detected between the combined genotypes of the two polymorphisms. The genotypes, combined genotypes and allele frequencies of C421T and C575T polymorphisms of the RANK gene have not been found to be associated with BMD in Turkish women. Further studies including both sexes and more cases are required.

  19. Effects of Common Polymorphisms in the MTHFR and ACE Genes on Diabetic Peripheral Neuropathy Progression: a Meta-Analysis.

    PubMed

    Wu, Shuai; Han, Yan; Hu, Qiang; Zhang, Xiaojie; Cui, Guangcheng; Li, Zezhi; Guan, Yangtai

    2017-05-01

    Diabetic peripheral neuropathy (DPN) is a microvascular complication of diabetes mellitus. The aim of this meta-analysis was to evaluate the effects of methylenetetrahydrofolate reductase (MTHFR) 677 C>T and ACE I/D polymorphisms in the development of DPN. We systematically reviewed published studies on MTHFR 677 C>T and ACE I/D polymorphisms and DPN found in various types of electronic databases. Strengthening the Reporting of Observational studies in Epidemiology (STROBE) quality score systems were used to determine the quality of the articles selected for inclusion. Odds ratios (ORs) and its corresponding 95 % confidence interval (95 % CI) were calculated. We used STATA statistical software (version 12.0, Stata Corporation, College Station, TX, USA) to deal with statistical data. Our results indicated an association of ACE D>I mutation (OR = 1.43, 95 % CI 1.12-1.83, P = 0.004) and MTHFR 677 C>T mutation (OR = 1.43, 95 % CI 1.08-1.90, P = 0.014) with DPN under the allele model, and similar results were also found under the dominant model (all P < 0.05). Subgroup analysis by country indicated that the MTHFR 677 C>T polymorphism may be the main risk factor for DPN in Turkey under four genetic models. ACE D>I mutation was correlated with DPN in Japanese and Pakistani populations in the majority of groups. The relationships of MTHFR 677 C>T and ACE I/D polymorphisms with DPN patients presented in this meta-analyses support the view that the MTHFR and ACE genes might play an important role in the development of DPN.

  20. 26 CFR 1.677(a)-1 - Income for benefit of grantor; general rule.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... in the masculine and feminine genders, respectively, but if the grantor is a woman the reference to... under a statutory right of election or a similar right. (d) Discharge of legal obligation of grantor or...) Exception for certain discretionary rights affecting income. The last sentence of section 677(a) provides...

  1. Meta-Prediction of the Effect of Methylenetetrahydrofolate Reductase Polymorphisms and Air Pollution on Alzheimer's Disease Risk.

    PubMed

    Wu, Suh-Mian; Chen, Zhao-Feng; Young, Lufei; Shiao, S Pamela K

    2017-01-11

    Background : Alzheimer's disease (AD) is a significant public health issue. AD has been linked with methylenetetrahydrofolate reductase ( MTHFR ) C677T polymorphism, but the findings have been inconsistent. The purpose of this meta-predictive analysis is to examine the associations between MTHFR polymorphisms and epigenetic factors, including air pollution, with AD risk using big data analytics approaches. Methods and Results : Forty-three studies (44 groups) were identified by searching various databases. MTHFR C677T TT and CT genotypes had significant associations with AD risk in all racial populations (RR = 1.13, p = 0.0047; and RR = 1.12, p < 0.0001 respectively). Meta-predictive analysis showed significant increases of percentages of MTHFR C677T polymorphism with increased air pollution levels in both AD case group and control group ( p = 0.0021-0.0457); with higher percentages of TT and CT genotypes in the AD case group than that in the control group with increased air pollution levels. Conclusions : The impact of MTHFR C677T polymorphism on susceptibility to AD was modified by level of air pollution. Future studies are needed to further examine the effects of gene-environment interactions including air pollution on AD risk for world populations.

  2. Meta-Prediction of the Effect of Methylenetetrahydrofolate Reductase Polymorphisms and Air Pollution on Alzheimer’s Disease Risk

    PubMed Central

    Wu, Suh-Mian; Chen, Zhao-Feng; Young, Lufei; Shiao, S. Pamela K.

    2017-01-01

    Background: Alzheimer’s disease (AD) is a significant public health issue. AD has been linked with methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, but the findings have been inconsistent. The purpose of this meta-predictive analysis is to examine the associations between MTHFR polymorphisms and epigenetic factors, including air pollution, with AD risk using big data analytics approaches. Methods and Results: Forty-three studies (44 groups) were identified by searching various databases. MTHFR C677T TT and CT genotypes had significant associations with AD risk in all racial populations (RR = 1.13, p = 0.0047; and RR = 1.12, p < 0.0001 respectively). Meta-predictive analysis showed significant increases of percentages of MTHFR C677T polymorphism with increased air pollution levels in both AD case group and control group (p = 0.0021–0.0457); with higher percentages of TT and CT genotypes in the AD case group than that in the control group with increased air pollution levels. Conclusions: The impact of MTHFR C677T polymorphism on susceptibility to AD was modified by level of air pollution. Future studies are needed to further examine the effects of gene-environment interactions including air pollution on AD risk for world populations. PMID:28085050

  3. Hyperhomocysteinaemia is an independent risk factor of abdominal aortic aneurysm in a Chinese Han population

    PubMed Central

    Liu, Jie; Wei Zuo, Shang; Li, Yue; Jia, Xin; Jia, Sen Hao; Zhang, Tao; Xiang Song, Yu; Qi Wei, Ying; Xiong, Jiang; Hua Hu, Yong; Guo, Wei

    2016-01-01

    The associations between hyperhomocysteinaemia (HHcy), methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, and abdominal aortic aneurysm (AAA) remain controversial, with only few studies focused on these associations within the Chinese population. We performed subgroup and interaction analyses in a Chinese Han population to investigate these associations. In all, 155 AAA patients and 310 control subjects were evaluated for serum total homocysteine levels and MTHFR C677T polymorphisms. Multiple logistic regression models were used to evaluate the aforementioned associations. Interaction and stratified analyses were conducted according to age, sex, smoking status, drinking status, and chronic disease histories. The multiple logistic analyses showed a significant association between HHcy and AAA but no significant association between MTHFR C677T polymorphism and AAA. The interaction analysis showed that age and peripheral arterial disease played an interactive role in the association between HHcy and AAA, while drinking status played an interactive role in the association between MTHFR C677T polymorphism and AAA. In conclusion, HHcy is an independent risk factor of AAA in a Chinese Han population, especially in the elderly and peripheral arterial disease subgroups. Longitudinal studies and clinical trials aimed to reduce homocysteine levels are warranted to assess the causal nature of these relationships PMID:26865327

  4. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population.

    PubMed

    Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

    2005-05-27

    Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population.

  5. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population

    PubMed Central

    Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

    2005-01-01

    Background Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. Methods We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. Results No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Conclusion Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population. PMID:15921520

  6. T-34C in flight

    NASA Image and Video Library

    1997-03-21

    A NASA T-34C aircraft, used for safety chase, is shown flying above the Dryden Flight Research Center, Edwards, California in March 1997. The aircraft was previously used at the Lewis Research Center in propulsion experiments involving turboprop engines, and was used as a chase aircraft at Dryden for smaller and slower research projects. Chase aircraft accompany research flights for photography and video purposes, and also as support for safety and research. At Dryden, the T-34 is used mainly for smaller remotely piloted vehicles which fly slower than NASA's F-18's, used for larger scale projects. This aircraft was returned to the U.S. Navy in May of 2002. The T-34C, built by Beech, carries a crew of 2 and is nicknamed the Mentor.

  7. Mid-Pliocene Planktic Foraminifer Census Data and Alkenone Unsaturation Indices from Ocean Drilling Program Hole 677A

    USGS Publications Warehouse

    Robinson, Marci; Caballero, Rocio; Pohlman, Emily; Herbert, Timothy; Peck, Victoria; Dowsett, Harry

    2008-01-01

    The U.S. Geological Survey is conducting a long-term study of mid-Pliocene climatic and oceanographic conditions. One of the key elements of the study involves the use of quantitative composition of planktic foraminifer assemblages in conjunction with other proxies to constrain estimates of sea-surface temperature (SST) and to identify major oceanographic boundaries and water masses. Raw census data are made available as soon as possible after analysis through a series of reports that provide the basic data for future work. In this report we present raw census data (table 1) for planktic foraminifer assemblages in 14 samples from Ocean Drilling Program (ODP) Hole 677A. We also present alkenone unsaturation index (UK'37) analyses for 89 samples from ODP Hole 677A (table 2). ODP Hole 677A is located in the Panama basin, due west of Ecuador at 1?12.138'N., 83?44.220'W., in 3461.2 meters of water (fig. 1). A variety of statistical methods have been developed to transform foraminiferal census data in Pliocene sequences into quantitative estimates of Pliocene SST. Details of statistical techniques, taxonomic groupings, and oceanographic interpretations are presented in more formal publications (Dowsett and Poore, 1990, 1991; Dowsett, 1991, 2007a,b; Dowsett and Robinson, 1998, 2007; Dowsett and others, 1996, 1999).

  8. The role of methylenetetrahydrofolate reductase in acute lymphoblastic leukemia in a Brazilian mixed population.

    PubMed

    Zanrosso, Crisiane Wais; Hatagima, Ana; Emerenciano, Mariana; Ramos, Flávio; Figueiredo, Alexandre; Félix, Têmis Maria; Segal, Sandra L; Giugliani, Roberto; Guigliani, Roberto; Muniz, Maria Tereza Cartaxo; Pombo-de-Oliveira, Maria S

    2006-04-01

    The polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene are associated with leukemogenesis. In order to investigate the influence of two polymorphisms in the MTHFR gene, 677C>T and 1298A>C, on the risk of acute lymphoblastic leukemia (ALL) we performed a case-control study in children from different Brazilians' regions. Genotyping of 176 ALL and 199 unselected healthy subjects was performed using PCR-RFLP assay. There was no association between the 677C>T or 1298A>C and risk of ALL in total case-control sample. However, 677T allele was linked to a decrease risk of ALL [odds ratio (OR), 0.43; 95% confidence interval (CI), 0.22-0.86], whereas the 1298A>C polymorphism presents an elevated risk factor [OR, 2.01; 95% CI, 1.01-3.99] in non-White children. Our investigation provides interesting data concerning the opposite effect of A1298C polymorphisms, particularly in the light of relatively scarce data regarding the MTHFR role in leukemia susceptibility in different populations.

  9. Reduced T(sub c) Niobium Superconducting HEB Mixers

    NASA Technical Reports Server (NTRS)

    Siddiqi, I.; Prober, D. E.; Bumble, B.; LeDuc, H. G.

    2001-01-01

    A reduction in the mixer noise is expected when using superconductors with a lower transition temperature (T(sub c)) since the thermal noise components of the mixer noise should scale with T(sub c). Also, the local oscillator (LO) power required for a diffusion-cooled device should decrease as T(sub c) when T(sub bath) << T(sub c). We previously studied mixing in aluminum based hot-electron bolometers (HEBs) at microwave frequencies (approximately 30 GHz), and observed a significant improvement in noise performance, and a reduction in LO power as predicted. However, the bias voltage range over which good mixer performance was observed was approximately 5 - 10 microV. These devices are thus susceptible to saturation effects, in particular output saturation. In the present work, we have investigated Nb HEBs whose T(sub c) is lowered by applying a magnetic field. The goal is to study a case intermediate between Nb and Al, and hopefully to find properties that will allow use in practical receivers. A 15 kOe perpendicular magnetic field was applied to a Nb HEB (L = 0.16 micrometers, W = 0.08 micrometers, R(sub N) = 90 ohms) to reduce T(sub c) from 5.2 K to 2.4 K. The mixer noise, as inferred from the output noise and the conversion efficiency, decreased from 390 K, DSB to 171 K, DSB. The LO power required for near optimum mixer conversion efficiency (eta(sub mixer) = -9 dB in this device) was 8 nW in zero field, and approximately 2 nW when T(sub c) was reduced to 2.4 K. T(sub bath) = 0.22 K. The conversion bandwidth was previously measured to be 2.4 GHz and the same bandwidth was observed in the presence of a magnetic field. By lowering T(sub c), the voltage range over which good mixing was observed also decreased. However, even with T(sub c) reduced to 2.4 K, the conversion efficiency dropped by 3 dB from its maximum value only when the bias voltage was changed by approximately 90 microV. Saturation effects should thus be much less of a concern in these devices than in

  10. Relation of polymorphism C1236T and C3435T in ABCB1 gene with bone marrow suppression in chemotherapy-treated breast cancer patients

    NASA Astrophysics Data System (ADS)

    Syarifah, S.; Hamdi, T.; Widyawati, T.; Sari, M. I.; Anggraini, D. R.

    2018-03-01

    ABCB1 is agene that encoded P-glycoprotein (P-gp), a transmembrane active efflux pump for a variety of carcinogens and cytostatics.ABCB1 polymorphisms C1236T and C3435T contribute to the variability oftherapeutic outcome and side effects.The present study was conducted to investigatethe relation of C1236T and C3435T polymorphisms in ABCB1 gene with bone marrow suppression in breast cancer patients treated withchemotherapy72 Indonesian womens isolated DNA sampleswere amplified using the PCR method. The analysis process of ABCB1 C1236T and C3435T polymorphism was by using thePCR-RFLP method. The frequencies of ABCB1 C1236T genotype for homozygous CC,heterozygous CT and variant TT was 11(15.28%), 42(58.33%), 19(26.39%), respectively. No associationwas between ABCB1 C1236T and C3435T polymorphisms in both individually and haplotypes with bone marrow suppression event (p > 0.05). There was no specific deviation of allele and genotype frequency from Hardy-Weinberg Equilibrium. There was a linkage between heterozygous CT-heterozygous CT in position 1236 and 3435 within 25 people (35%).

  11. 5,10 Methylenetetrahydrofolate reductase genetic polymorphism as a risk factor for neural tube defects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ou, C.Y.; Brown, V.K.; Khoury, M.J.

    1996-06-28

    Persons with a thermolabile form of the enzyme 5,10 methylenetetrahydrofolate reductase (MTHFR) have reduced enzyme activity and increased plasma homocysteine which can be lowered by supplemental folic acid. Thermolability of the enzyme has recently been shown to be caused by a common mutation (677C{sup {r_arrow}}T) in the MTHFR gene. We studied 41 fibroblast cultures from NTD-affected fetuses and compared their genotypes with those of 109 blood specimens from individuals in the general population. 677C{sup {r_arrow}}T homozygosity was associated with a 7.2 fold increased risk for NTDs (95% confidence interval: 1.8-30.3; p value: 0.001). These preliminary data suggest that the 677C{supmore » {r_arrow}}T polymorphism of the MTHFR gene is a risk factor for spina bifida and anencephaly that may provide a partial biologic explanation for why folic acid prevents these types of NTD. 13 refs., 1 fig., 1 tab.« less

  12. APOA5 -1131T>C and APOC3 -455T>C polymorphisms are associated with an increased risk of coronary heart disease.

    PubMed

    Sun, Y; Zhou, R B; Chen, D M

    2015-12-28

    The aim of this study was to investigate correlations between apolipoprotein A-V (APOA5) -1131T>C and apolipoprotein C-III (APOC3) -455T>C polymorphisms and coronary heart disease (CHD). PubMed, Ovid, Cochrane Library, Embase, China National Knowledge Infrastructure, and Wanfang databases were searched using combinations of keywords relating to these polymorphisms and CHD. Studies retrieved from database searches were screened using our stringent inclusion and exclusion criteria, and Comprehensive Meta-Analysis Version 2.0 software was used for statistical analyses. In total, 115 studies were initially retrieved and after further selection, 11 were included in the meta-analysis. These 11 articles comprised 4840 patients with CHD in the case group and 4913 healthy participants in the control group. Meta-analysis revealed that APOA5 -1131T>C and APOC3 -455T>C polymorphisms increased CHD risk. In addition, subgroup analysis by ethnicity showed that while the -1131T>C polymorphism elevated the risk of CHD in the Caucasian population under both allelic and dominant models, this increased risk was observed only under a dominant model in the Asian population. The results of our meta-analysis point to a strong link between both APOA5 -1131T>C and APOC3 -455T>C polymorphisms and an increased risk of CHD. Thus, these polymorphisms constitute important predictive indicators of CHD susceptibility.

  13. Search for t Z' associated production induced by t c Z' couplings at the LHC

    NASA Astrophysics Data System (ADS)

    Hou, Wei-Shu; Kohda, Masaya; Modak, Tanmoy

    2017-07-01

    The P5' and RK anomalies, recently observed by the LHCb Collaboration in B →K(*) transitions, may indicate the existence of a new Z' boson, which may arise from gauged Lμ-Lτ symmetry. Flavor-changing neutral current Z' couplings, such as t c Z', can be induced by the presence of extra vector-like quarks. In this paper we study the LHC signatures of the induced right-handed t c Z' coupling that is inspired by, but not directly linked to, the B →K(*) anomalies. The specific processes studied are c g →t Z' and its conjugate process, each followed by Z'→μ+μ-. By constructing an effective theory for the t c Z' coupling, we first explore in a model-independent way the discovery potential of such a Z' at the 14 TeV LHC with 300 and 3000 fb-1 integrated luminosities. We then reinterpret the model-independent results within the gauged Lμ-Lτ model. In connection with t c Z', the model also implies the existence of a flavor-conserving c c Z' coupling, which can drive the c c ¯→Z'→μ+μ- process. Our study shows that existing LHC results for dimuon resonance searches already constrain the c c Z' coupling, and that the Z' can be discovered in either or both of the c g →t Z' and c c ¯→Z' processes. We further discuss the sensitivity to the left-handed t c Z' coupling and find that the coupling values favored by the B →K(*) anomalies lie slightly below the LHC discovery reach even with 3000 fb-1 .

  14. TNFalpha -308 C-->t and -863 C-->a polymorphisms and spermiogram characteristics.

    PubMed

    Kurz, Christine; Bentz, Eva-Katrin; Denschlag, Dominik; Berner, Isabel; Keck, Christoph; Tempfer, Clemens B; Pietrowski, Detlef

    2008-01-01

    Genetic factors may play a role in male infertility. In a prospective case-control study, we assessed the allele and genotype frequencies of the TNFalpha -308 C-->T and -863 C-->A polymorphisms, detected by PCR of sperm DNA, of 577 Caucasian men recruited in an infertility clinic. Semen sampling was performed and spermiogram results were correlated to genetic data. The allele frequencies of the TNFalpha -308 C-->T and -863 C-->A polymorphisms were not significantly different between non-normozoospermic (n = 447) and normozoospermic (n = 130) men [758/894 (85%) and 134/894 (15%) vs. 213/269 (82%) and 43/260 (18%), p = 0.5, odds ratio (OR) 1.1, 95% confidence interval (CI) 0.74-1.76, and 749/894 (84%) and 145/894 (16%) vs. 212/260 (82%) and 48/260 (18%), p = 0.4, OR 1.2, 95% CI 0.78-1.76, respectively]. The genotype frequencies of the TNFalpha -308 C-->T and -863 C-->A polymorphisms were also not significantly different between non-normozoospermic and normozoospermic men. In addition, mutant alleles were not overrepresented in subgroups of men with the oligoasthenoteratozoospermia syndrome and asthenozoospermia. The TNFalpha -308 C-->T and -863 C-->A polymorphisms are not associated with spermiogram characteristics and do not represent molecular markers for genetic susceptibility to male infertility. Copyright 2008 S. Karger AG, Basel.

  15. Methotrexate toxicity and efficacy during the consolidation phase in paediatric acute lymphoblastic leukaemia and MTHFR polymorphisms as pharmacogenetic determinants.

    PubMed

    D'Angelo, Velia; Ramaglia, Maria; Iannotta, Adriana; Crisci, Stefania; Indolfi, Paolo; Francese, Matteo; Affinita, Maria Carmen; Pecoraro, Giulia; Napolitano, Addolorata; Fusco, Claudia; Oreste, Matilde; Indolfi, Cristiana; Casale, Fiorina

    2011-11-01

    Folate-metabolizing single-nucleotide polymorphisms (SNPs) are emerging as important pharmacogenetic prognostic determinants of the response to chemotherapy. With high doses of methotrexate (MTX) in the consolidation phase, methylenetetrahydrofolate reductase (MTHFR) polymorphisms could be potential modulators of the therapeutic response to antifolate chemotherapeutics in identifying a possible correlation with the outcome. This study aims to analyse the potential role of the MTHFR C677T and A1298C genetic variants in modulating the clinical toxicity and efficacy of high doses of MTX in a cohort of paediatric ALL patients (n = 151) treated with AIEOP protocols. This work includes DNA extraction by slides and RFLP-PCR. The first observation relative to early toxicities (haematological and non-haematological), after the first doses of MTX in all protocols, was an association between the 677T and 1298C carriers and global toxicity. We found that in the 2 g/m(2) MTX group, patients harbouring 677TT homozygously exhibited a substantial 12-fold risk of developing toxicity. In this study, we demonstrate that the MTHFR 677TT variant is associated with an increased risk of relapse when compared to other genotypes. The Kaplan-Meier analysis showed that the 677TT variant had a lower 7-year DFS(disease-free survival) probability compared to the 677C carrier genotype (log-rank test P = 0.003) and OS (overall survival) and also confirms the lower probability of survival for patients with the 677TT variant (log-rank test, P = 0.006). Our study provides further evidence of the critical role played by folate pathway enzymes in the outcome of ALL, possibly through the interference of MTX.

  16. TGFB1 Functional Gene Polymorphisms (C-509T and T869C) in the Maternal Susceptibility to Pre-eclampsia in South Indian Women.

    PubMed

    Deepthi, Goske; Chaithri, Ponnaluri Kamakshi; Latha, Prasanna; Rani, Vital Usha; Rahman, Police Fazul; Jahan, Parveen

    2015-10-01

    Pre-eclampsia (PE), a pregnancy-specific vascular disorder characterized by hypertension and proteinuria, is hypothesized to be the result of inadequate placental angiogenesis with attendant systemic inflammation. The pleiotropic cytokine, Transforming Growth Factor-β1 (TGF-β1), is considered to be a key candidate gene in the molecular pathogenesis of PE by virtue of its ability to not only regulate angiogenesis and apoptosis of target cells, but also by acting as a master controller of Th1/Th2 cytokine balance and production of the anti-inflammatory peripheral regulatory T cells (FOXP3+ Tregs). Based on this presumption, we screened a total of 469 pregnant women from South India that include 239 patients with PE and 230 healthy controls for the two functional polymorphisms of TGFB1 gene (C-509T and T869C). The genotype frequencies of these two polymorphisms differed significantly between the PE and control groups (P = 0.01 and P = 0.002, for the TGFB1 C-509T and T869C polymorphisms, respectively). Under the over-dominant model, the CT genotype of the TGFB1 C509T polymorphism showed a high protective effect (P = 3e-04), while the TT genotype of the same variant appeared to be the predisposing genotype (P = 0.003). The T-T and C-C haplotypes were found to be the risk haplotypes blocks towards PE (OR = 4.72; P = 0.031, OR = 5.39; P = 0.03), respectively. Strong linkage disequilibrium was seen between the two polymorphisms. Our investigations revealed a significant influence of TGFB1 C-509T and T869C polymorphisms on the PE risk in South Indian women. The study represents one of the first of its kind from the Indian subcontinent. © 2015 The Foundation for the Scandinavian Journal of Immunology.

  17. Association of neural tube defects in children of mothers with MTHFR 677TT genotype and abnormal carbohydrate metabolism risk: a case-control study.

    PubMed

    Cadenas-Benitez, N M; Yanes-Sosa, F; Gonzalez-Meneses, A; Cerrillos, L; Acosta, D; Praena-Fernandez, J M; Neth, O; Gomez de Terreros, I; Ybot-González, P

    2014-03-26

    Abnormalities in maternal folate and carbohydrate metabolism have both been shown to induce neural tube defects (NTD) in humans and animal models. However, the relationship between these two factors in the development of NTDs remains unclear. Data from mothers of children with spina bifida seen at the Unidad de Espina Bífida del Hospital Infantil Virgen del Rocío (case group) were compared to mothers of healthy children with no NTD (control group) who were randomly selected from patients seen at the outpatient ward in the same hospital. There were 25 individuals in the case group and 41 in the control group. Analysis of genotypes for the methylenetetrahydrofolate reductase (MTHFR) 677CT polymorphism in women with or without risk factors for abnormal carbohydrate metabolism revealed that mothers who were homozygous for the MTHFR 677TT polymorphism and at risk of abnormal carbohydrate metabolism were more likely to have offspring with spina bifida and high levels of homocysteine, compared to the control group. The increased incidence of NTDs in mothers homozygous for the MTHFR 677TT polymorphism and at risk of abnormal carbohydrate metabolism stresses the need for careful metabolic screening in pregnant women, and, if necessary, determination of the MTHFR 677CT genotype in those mothers at risk of developing abnormal carbohydrate metabolism.

  18. Association of MTHFR polymorphism and periodontitis’ severity in Indonesian males

    NASA Astrophysics Data System (ADS)

    Auerkari, E. I.; Purwandhita, R.; Kim, K. R.; Djamal, N.; Masulili, S. L. C.; Suryandari, D. A.; Talbot, C.

    2018-05-01

    Periodontitis is an oral disease with a complex etiology and pathogenesis, but with a suspected contribution by genetic factors. This study aimed to assess the association of polymorphism in MTHFR (methylene tetrahydrofolate reductase, C677T) gene and the severity of periodontitis in Indonesian males. Severity of periodontitis was classified as mild, moderate or severe for 100 consenting, 25 to 60 years old male Indonesians. Using PCR amplification for DNA extracted from blood serum samples, the variation at the SNP polymorphism of the MTHFR (C677T) gene was evaluated by using RFLP, cutting by the restriction enzyme HinfI and subjecting the fragments to electrophoresis on agarose gel. Chi-square testing was mainly used for statistical assessment of the results. The CC genotype (wild type) of the tested polymorphism was the most common variant (78%) and TT (mutant) genotype relatively rare (2%), so that C-allele appeared in 88% of the cases and T-allele in 12% of the cases. The results suggest that there is no significant association between MTHFR C677T polymorphism and the severity of periodontitis in the tested Indonesian males.

  19. Methylxanthines do not affect rhythmogenic preBötC inspiratory network activity but impair bursting of preBötC-driven motoneurons.

    PubMed

    Panaitescu, B; Kuribayashi, J; Ruangkittisakul, A; Leung, V; Iizuka, M; Ballanyi, K

    2013-01-01

    Clinical stimulation of preterm infant breathing with methylxanthines like caffeine and theophylline can evoke seizures. It is unknown whether underlying neuronal hyperexcitability involves the rhythmogenic inspiratory active pre-Bötzinger complex (preBötC) in the brainstem or preBötC-driven motor networks. Inspiratory-related preBötC interneuronal plus spinal (cervical/phrenic) or cranial hypoglossal (XII) motoneuronal bursting was studied in newborn rat en bloc brainstem-spinal cords and brainstem slices, respectively. Non-respiratory bursting perturbed inspiratory cervical nerve activity in en bloc models at >0.25mM theophylline or caffeine. Rhythm in the exposed preBötC of transected en bloc preparations was less perturbed by 10mM theophylline than cervical root bursting which was more affected than phrenic nerve activity. In the preBötC of slices, even 10mM methylxanthine did not evoke seizure-like bursting whereas >1mM masked XII rhythm via large amplitude 1-10Hz oscillations. Blocking A-type γ-aminobutyric (GABAA) receptors evoked seizure-like cervical activity whereas in slices neither XII nor preBötC rhythm was disrupted. Methylxanthines (2.5-10mM), but not blockade of adenosine receptors, phosphodiesterase-4 or the sarcoplasmatic/endoplasmatic reticulum ATPase countered inspiratory depression by muscimol-evoked GABAA receptor activation that was associated with a hyperpolarization and input resistance decrease silencing preBötC neurons in slices. The latter blockers did neither affect preBötC or cranial/spinal motor network bursting nor evoke seizure-like activity or mask corresponding methylxanthine-evoked discharges. Our findings show that methylxanthine-evoked hyperexcitability originates from motor networks, leaving preBötC activity largely unaffected, and suggest that GABAA receptors contribute to methylxanthine-evoked seizure-like perturbation of spinal motoneurons whereas non-respiratory XII motoneuron oscillations are of different

  20. Association of ACE and MTHFR genetic polymorphisms with type 2 diabetes mellitus: Susceptibility and complications.

    PubMed

    Settin, Ahmad; El-Baz, Rizk; Ismaeel, Azza; Tolba, Wafaa; Allah, Wafaa A

    2015-12-01

    Polymorphisms of angiotensin converting enzyme (ACE) and methylene-tetrahydrofolate reductase (MTHFR) genes have been proposed to be associated with type 2 diabetes mellitus (T2DM) with conflicting results. This work was planned in order to check for the association of these polymorphisms with the susceptibility for and complications of T2DM among Egyptian cases. This is a case controlled study involving 203 patients with T2DM and 311 healthy controls. Polymorphic variants of ACE I>D and MTHFR (677 C>T and 1298 A>C) were determined using the polymerase chain reaction (PCR) restriction analysis technique. The susceptibility to T2DM was higher among subjects having the MTHFR 677TT (odds ratio (OR)=2.2, p=0.01), MTHFR 1298 AA (OR=1.84, p=0.001) and ACE (ID+II) (OR=2.0, p=0.0007) genotypes. Logistic regression analysis showed that MTHFR 677T allele was a risk factor for diabetic retinopathy (DR) (OR=3.47, p<0.001), diabetic polyneuropathy (DPN) (OR=5.2, p<0.0001) and ischemic heart disease (IHD) (OR=2.9, p<0.05), while MTHFR 1298 C allele was a risk factor for DR (OR=4.2, p<0.001) and the ACE DD genotype was a risk factor for DPN (OR=3.1, p<0.001). The MTHFR 677 TT genotype was associated with T2DM susceptibility and complications (DR, DPN and IHD). The MTHFR 1298 CC, AC and ACE DD genotypes were associated with DR and DPN. © The Author(s) 2014.

  1. 5,10-methylenetetrahydrofolate reductase (MTHFR) polymorphisms and the risk of acute lymphoblastic leukemia (ALL) in Filipino children.

    PubMed

    Alcasabas, Patricia; Ravindranath, Yaddanapudi; Goyette, Gerard; Haller, Andrew; Del Rosario, Luz; Lesaca-Medina, Maria Ysabel; Darga, Linda; Ostrea, Enrique M; Taub, Jeffrey W; Everson, Richard B

    2008-08-01

    5,10-Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism. Polymorphisms at the C677T and A1298C loci are associated with reduced activity; consequently more folate substrates are shunted toward thymidylate and DNA synthesis. Several studies have reported a reduced risk of developing ALL in children with MTHFR polymorphisms. The objective of this study was to determine the association between MTHFR polymorphisms and ALL in Filipino children. We conducted a case control study in children diagnosed with ALL at the Philippine General Hospital from 1/2001 through 12/2005. Bone marrow aspirate slides were reviewed by two expert hematologists to verify the morphologic diagnosis of ALL. DNA was isolated from the slides and MTHFR polymorphisms, C677T and A1298C, were determined using Taqman real-time PCR. Cord blood of healthy Filipino newborns served as control. There were a total of 191 ALL and 394 controls genotyped. The distribution of C677T polymorphisms was similar in the two groups (P = 1.0). However, for A1298C, there was significantly more AC and CC genotypes in the ALL compared to controls (P = 0.02; OR 1.57; CI: 1.08-2.28). The 1298C allele frequency for the control group was 36.8% and 677T allele frequency was 9.9%. A1298C polymorphisms is associated with an increased risk for ALL in Filipino children. This may be due to a difference in leukemia biology or to a high prevalence of folate deficiency in Filipinos. Our study reiterates the gene and environment interaction in leukemogenesis.

  2. [Serum folate levels in adolescent population in Madrid, Spain].

    PubMed

    Gil, Ruth; Esteban, Jesús; Hernández, Valentín; Cano, Beatriz; de Oya, Manuel; Gil, Angel

    2008-10-25

    Serum folate concentrations in children are essential to establish values which allow to compare different regions or countries, and raise the possibility of fortifying diet with group B vitamins and folic acid as a secondary prevention against cardiovascular diseases. A cross-sectional epidemiological study was performed to assess serum folate levels in school children, aged 13-15 years, in Madrid. Folate and vitamin B12 determinations were determined in blood samples of fasting children. Genotype C677T of methylentetrahydrofolate reductase (MTHFR) enzyme was determined by polymerase chain reaction. Average folate levels obtained in our study were 7.83 nmol/l (95% confidence interval, 7.42 to 8.23 nmol/l). Median was 6.89 nmol/l (interquartilic range: 5.30 to -9.30 nmol/l). No statistically significant differences were found by gender, age or presence of menstruation. Serum folate concentration decreased significantly with the mutation of the C677T genotype for MTHFR. Prevalence of deficits of folate (< 5.3 nmol/l) was 23.8% and raised significantly with the mutation of the C677T genotype for MTHFR: 18.8% for CC, 20.4% for CT, and 46.7% for TT. This effect was mainly observed in girls after menstruation. Homozygosis mutation in C677T genotype of the enzyme MTHFR induces lower folate levels, mainly in girls after menstruation. 5.3 nmol/l is proposed as a threshold to define deficient serum folate levels in the Spanish adolescent population.

  3. c-MPL provides tumor-targeted T-cell receptor-transgenic T cells with costimulation and cytokine signals.

    PubMed

    Nishimura, Christopher D; Brenner, Daniel A; Mukherjee, Malini; Hirsch, Rachel A; Ott, Leah; Wu, Meng-Fen; Liu, Hao; Dakhova, Olga; Orange, Jordan S; Brenner, Malcolm K; Lin, Charles Y; Arber, Caroline

    2017-12-21

    Adoptively transferred T-cell receptor (TCR)-engineered T cells depend on host-derived costimulation and cytokine signals for their full and sustained activation. However, in patients with cancer, both signals are frequently impaired. Hence, we developed a novel strategy that combines both essential signals in 1 transgene by expressing the nonlymphoid hematopoietic growth factor receptor c-MPL (myeloproliferative leukemia), the receptor for thrombopoietin (TPO), in T cells. c-MPL signaling activates pathways shared with conventional costimulatory and cytokine receptor signaling. Thus, we hypothesized that host-derived TPO, present in the tumor microenvironment, or pharmacological c-MPL agonists approved by the US Food and Drug Administration could deliver both signals to c-MPL-engineered TCR-transgenic T cells. We found that c-MPL + polyclonal T cells expand and proliferate in response to TPO, and persist longer after adoptive transfer in immunodeficient human TPO-transgenic mice. In TCR-transgenic T cells, c-MPL activation enhances antitumor function, T-cell expansion, and cytokine production and preserves a central memory phenotype. c-MPL signaling also enables sequential tumor cell killing, enhances the formation of effective immune synapses, and improves antileukemic activity in vivo in a leukemia xenograft model. We identify the type 1 interferon pathway as a molecular mechanism by which c-MPL mediates immune stimulation in T cells. In conclusion, we present a novel immunotherapeutic strategy using c-MPL-enhanced transgenic T cells responding to either endogenously produced TPO (a microenvironment factor in hematologic malignancies) or c-MPL-targeted pharmacological agents. © 2017 by The American Society of Hematology.

  4. High T(c) superconductors: Technical and commercial challenge

    NASA Technical Reports Server (NTRS)

    Kirschner, I.; Horvath, E.; Vajda, I.; Bencze, L.; Goebl, N.

    1995-01-01

    Some basic questions of the way which leads from the discovery of high-T(c) superconductors to their applications is surveyed. The influence of high-T(c) superconducting technology on the industrial and social development is also briefly analyzed.

  5. Methylenetetrahydrofolate reductase gene polymorphisms and the risk of colorectal carcinoma in a sample of Egyptian individuals.

    PubMed

    El Awady, Mostafa K; Karim, Amr M; Hanna, Laila S; El Husseiny, Lamia A; El Sahar, Medhat; Menem, Hanan A Abdel; Meguid, Nagwa A

    2009-01-01

    The study was planned as a pilot study to investigate two common polymorphisms in the MTHFR gene c.677C > T and c.1298A > C and their association with enhanced risk of colorectal cancer (CRC) in a sample of Egyptian individuals. Venous blood samples were withdrawn from 35 cases of CRC and 68 healthy controls. Specimens from colonic and rectal carcinoma tissues in addition to cancer free tissues were obtained from all cases. Frequencies of MTHFR677T and 1298C alleles were significantly higher among cases of CRC tumor tissues (50% and 56%, respectively) than germ line alleles in CRC patients (33% and 41%, respectively) and healthy controls (21% and 35%, respectively). Frequencies of heterozygous and homoyzgous polymorphisms of MTHFR at positions 677 and 1298 in carcinoma tissues were always the highest. At position 677, TT and CT genotype frequencies were 17% and 66% with an odds ratio {OR} of 11 [95% confidence interval {CI} 2.39-50.59] and OR 8.34 [95%CI 2.97-23.92], respectively, in carcinoma tissues. While in the germ line of patients the genotype frequencies of 677TT and CT were 6% and 54% with OR 1.57 [95%CI 0.26-9.51] and 2.99 [95%CI 1.25-7.12], respectively, compared to controls (6% and 29%, respectively). The combined genotype MTHFR 1298CC + AC frequencies were 86% with OR 3.71 [95%CI 1.28-10.78] in carcinoma tissues, 69% with OR 1.35 [95%CI 0.57-3.21] in germ line of patients and 62% in controls. The combined genotype 677CT plus any of the following genotypes 1298AA, AC or CC enhanced risk of CRC, when comparing germ line DNA polymorphism of patients versus peripheral blood DNA of control subjects with OR 4.5 [95%CI 0.94-21.56], OR 3.12 [95%CI 0.79-12.36] and OR 18 [95%CI 1.56-207.5], respectively, suggesting strong genetic predisposition of certain Egyptian population to CRC. These results suggested that at least one C to T polymorphism at 677MTHFR gene is required to significantly increase the risk for CRC development. Further large scale studies are

  6. Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

    PubMed

    Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

    2017-07-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

  7. INTERNATIONAL REPORT: Revised Values for (t90 - t68) from 630°C to 1064°C

    NASA Astrophysics Data System (ADS)

    Rusby, R. L.; Hudson, R. P.; Durieux, M.

    1994-01-01

    A revised table of differences (t90 - t68) between values of temperature on the International Temperature Scale of 1990, ITS-90, and the corresponding values on the International Practical Temperature Scale of 1968, IPTS-68, is published at the request of the Comité Consultatif de Thermométrie (CCT). The revision affects only the range 630°C to 1064°C, where the IPTS-68 specified the use of platinum-10% rhodium versus platinum thermocouples. It follows from new intercomparisons of thermocouples carrying IPTS-68 calibrations with platinum resistance thermometers and radiation thermometers calibrated in accordance with the ITS-90. The largest change occurs at 760°C, where the difference formerly tabulated as 0,36°C is now 0,04°C. The revision concerns only the assessment of the differences between the ITS-90 and the IPTS-68, and does not affect the ITS-90 in any way.

  8. Germline variation in the MTHFR and MTRR genes determines the nadir of bone density in pediatric acute lymphoblastic leukemia: a prospective study.

    PubMed

    te Winkel, M L; de Muinck Keizer-Schrama, S M P F; de Jonge, R; van Beek, R D; van der Sluis, I M; Hop, W C J; Pieters, R; van den Heuvel-Eibrink, M M

    2011-03-01

    This study aims to identify folate-metabolism-related genetic risk factors for low bone mineral density (BMD) during/after pediatric acute lymphoblastic leukemia (ALL) treatment. We investigated the influence of methylenetetrahydrofolate reductase (MTHFR 677C > T and 1298A > C) and methionine synthase reductase (MTRR 66A > G) single nucleotide polymorphisms (SNPs) on total body BMD (BMD(TB)) and lumbar spine BMD (BMD(LS)) in 83 patients. Homocysteine, folate and vitamin B12 were determined. BMD was measured repeatedly using dual-energy X-ray absorptiometry in patients ≥ 4 years (n = 68). Carriers of the MTHFR 677 T-allele showed a lower baseline BMD(TB) than non-carriers (-0.38 SDS vs. +0.55 SDS, p = 0.01) and BMD(TB) remained lower during/after treatment. MTHFR 677C>T did not influence treatment-related loss of BMD(TB) (p = 0.39). The MTRR 66 G-allele carriers showed a trend towards a lower BMD(TB) compared with non-carriers. Combining these two SNPs, patients carrying ≥ 2 risk alleles had a significantly lower BMD(TB) (-1.40 SDS) than patients with one (-0.80 SDS) or no risk alleles (-0.31 SDS). Although carriers of the MTHFR 1298A > C had higher homocysteine levels, this SNP was not related to BMD(TB). BMD(LS) of carriers was similar to non-carriers of the investigated SNPs. The MTHFR 677C>T SNP and the MTRR 66A >G SNP were identified as determinants of impaired BMD(TB) in childhood ALL patients. Crown Copyright © 2010. Published by Elsevier Inc. All rights reserved.

  9. High-T C superconductivity in Cs3C60 compounds governed by local Cs-C60 Coulomb interactions

    NASA Astrophysics Data System (ADS)

    Harshman, Dale R.; Fiory, Anthony T.

    2017-04-01

    Unique among alkali-doped A 3C60 fullerene compounds, the A15 and fcc forms of Cs3C60 exhibit superconducting states varying under hydrostatic pressure with highest transition temperatures at T\\text{C}\\text{meas}   =  38.3 and 35.2 K, respectively. Herein it is argued that these two compounds under pressure represent the optimal materials of the A 3C60 family, and that the C60-associated superconductivity is mediated through Coulombic interactions with charges on the alkalis. A derivation of the interlayer Coulombic pairing model of high-T C superconductivity employing non-planar geometry is introduced, generalizing the picture of two interacting layers to an interaction between charge reservoirs located on the C60 and alkali ions. The optimal transition temperature follows the algebraic expression, T C0  =  (12.474 nm2 K)/ℓζ, where ℓ relates to the mean spacing between interacting surface charges on the C60 and ζ is the average radial distance between the C60 surface and the neighboring Cs ions. Values of T C0 for the measured cation stoichiometries of Cs3-x C60 with x  ≈  0 are found to be 38.19 and 36.88 K for the A15 and fcc forms, respectively, with the dichotomy in transition temperature reflecting the larger ζ and structural disorder in the fcc form. In the A15 form, modeled interacting charges and Coulomb potential e2/ζ are shown to agree quantitatively with findings from nuclear-spin relaxation and mid-infrared optical conductivity. In the fcc form, suppression of T\\text{C}\\text{meas} below T C0 is ascribed to native structural disorder. Phononic effects in conjunction with Coulombic pairing are discussed.

  10. Mutation of A677 in histone methyltransferase EZH2 in human B-cell lymphoma promotes hypertrimethylation of histone H3 on lysine 27 (H3K27)

    PubMed Central

    McCabe, Michael T.; Graves, Alan P.; Ganji, Gopinath; Diaz, Elsie; Halsey, Wendy S.; Jiang, Yong; Smitheman, Kimberly N.; Ott, Heidi M.; Pappalardi, Melissa B.; Allen, Kimberly E.; Chen, Stephanie B.; Della Pietra, Anthony; Dul, Edward; Hughes, Ashley M.; Gilbert, Seth A.; Thrall, Sara H.; Tummino, Peter J.; Kruger, Ryan G.; Brandt, Martin; Schwartz, Benjamin; Creasy, Caretha L.

    2012-01-01

    Trimethylation of histone H3 on lysine 27 (H3K27me3) is a repressive posttranslational modification mediated by the histone methyltransferase EZH2. EZH2 is a component of the polycomb repressive complex 2 and is overexpressed in many cancers. In B-cell lymphomas, its substrate preference is frequently altered through somatic mutation of the EZH2 Y641 residue. Herein, we identify mutation of EZH2 A677 to a glycine (A677G) among lymphoma cell lines and primary tumor specimens. Similar to Y641 mutant cell lines, an A677G mutant cell line revealed aberrantly elevated H3K27me3 and decreased monomethylated H3K27 (H3K27me1) and dimethylated H3K27 (H3K27me2). A677G EZH2 possessed catalytic activity with a substrate specificity that was distinct from those of both WT EZH2 and Y641 mutants. Whereas WT EZH2 displayed a preference for substrates with less methylation [unmethylated H3K27 (H3K27me0):me1:me2 kcat/Km ratio = 9:6:1] and Y641 mutants preferred substrates with greater methylation (H3K27me0:me1:me2 kcat/Km ratio = 1:2:13), the A677G EZH2 demonstrated nearly equal efficiency for all three substrates (H3K27me0:me1:me2 kcat/Km ratio = 1.1:0.6:1). When transiently expressed in cells, A677G EZH2, but not WT EZH2, increased global H3K27me3 and decreased H3K27me2. Structural modeling of WT and mutant EZH2 suggested that the A677G mutation acquires the ability to methylate H3K27me2 through enlargement of the lysine tunnel while preserving activity with H3K27me0/me1 substrates through retention of the Y641 residue that is crucial for orientation of these smaller substrates. This mutation highlights the interplay between Y641 and A677 residues in the substrate specificity of EZH2 and identifies another lymphoma patient population that harbors an activating mutation of EZH2. PMID:22323599

  11. Mutation of A677 in histone methyltransferase EZH2 in human B-cell lymphoma promotes hypertrimethylation of histone H3 on lysine 27 (H3K27).

    PubMed

    McCabe, Michael T; Graves, Alan P; Ganji, Gopinath; Diaz, Elsie; Halsey, Wendy S; Jiang, Yong; Smitheman, Kimberly N; Ott, Heidi M; Pappalardi, Melissa B; Allen, Kimberly E; Chen, Stephanie B; Della Pietra, Anthony; Dul, Edward; Hughes, Ashley M; Gilbert, Seth A; Thrall, Sara H; Tummino, Peter J; Kruger, Ryan G; Brandt, Martin; Schwartz, Benjamin; Creasy, Caretha L

    2012-02-21

    Trimethylation of histone H3 on lysine 27 (H3K27me3) is a repressive posttranslational modification mediated by the histone methyltransferase EZH2. EZH2 is a component of the polycomb repressive complex 2 and is overexpressed in many cancers. In B-cell lymphomas, its substrate preference is frequently altered through somatic mutation of the EZH2 Y641 residue. Herein, we identify mutation of EZH2 A677 to a glycine (A677G) among lymphoma cell lines and primary tumor specimens. Similar to Y641 mutant cell lines, an A677G mutant cell line revealed aberrantly elevated H3K27me3 and decreased monomethylated H3K27 (H3K27me1) and dimethylated H3K27 (H3K27me2). A677G EZH2 possessed catalytic activity with a substrate specificity that was distinct from those of both WT EZH2 and Y641 mutants. Whereas WT EZH2 displayed a preference for substrates with less methylation [unmethylated H3K27 (H3K27me0):me1:me2 k(cat)/K(m) ratio = 9:6:1] and Y641 mutants preferred substrates with greater methylation (H3K27me0:me1:me2 k(cat)/K(m) ratio = 1:2:13), the A677G EZH2 demonstrated nearly equal efficiency for all three substrates (H3K27me0:me1:me2 k(cat)/K(m) ratio = 1.1:0.6:1). When transiently expressed in cells, A677G EZH2, but not WT EZH2, increased global H3K27me3 and decreased H3K27me2. Structural modeling of WT and mutant EZH2 suggested that the A677G mutation acquires the ability to methylate H3K27me2 through enlargement of the lysine tunnel while preserving activity with H3K27me0/me1 substrates through retention of the Y641 residue that is crucial for orientation of these smaller substrates. This mutation highlights the interplay between Y641 and A677 residues in the substrate specificity of EZH2 and identifies another lymphoma patient population that harbors an activating mutation of EZH2.

  12. The impact of MTHFR 677C → T risk knowledge on changes in folate intake: findings from the Food4Me study.

    PubMed

    O'Donovan, Clare B; Walsh, Marianne C; Forster, Hannah; Woolhead, Clara; Celis-Morales, Carlos; Fallaize, Rosalind; Macready, Anna L; Marsaux, Cyril F M; Navas-Carretero, Santiago; San-Cristobal, Rodrigo; Kolossa, Silvia; Mavrogianni, Christina; Lambrinou, Christina P; Moschonis, George; Godlewska, Magdalena; Surwillo, Agnieszka; Bouwman, Jildau; Grimaldi, Keith; Traczyk, Iwona; Drevon, Christian A; Daniel, Hannelore; Manios, Yannis; Martinez, J Alfredo; Saris, Wim H M; Lovegrove, Julie A; Mathers, John C; Gibney, Michael J; Brennan, Lorraine; Gibney, Eileen R

    2016-01-01

    It is hypothesised that individuals with knowledge of their genetic risk are more likely to make health-promoting dietary and lifestyle changes. The present study aims to test this hypothesis using data from the Food4Me study. This was a 6-month Internet-based randomised controlled trial conducted across seven centres in Europe where individuals received either general healthy eating advice or varying levels of personalised nutrition advice. Participants who received genotype-based personalised advice were informed whether they had the risk (CT/TT) ( n  = 178) or non-risk (CC) ( n  = 141) alleles of the methylenetetrahydrofolate reductase ( MTHFR ) gene in relation to cardiovascular health and the importance of a sufficient intake of folate. General linear model analysis was used to assess changes in folate intake between the MTHFR risk, MTHFR non-risk and control groups from baseline to month 6 of the intervention. There were no differences between the groups for age, gender or BMI. However, there was a significant difference in country distribution between the groups ( p  = 0.010). Baseline folate intakes were 412 ± 172, 391 ± 190 and 410 ± 186 μg per 10 MJ for the risk, non-risk and control groups, respectively. There were no significant differences between the three groups in terms of changes in folate intakes from baseline to month 6. Similarly, there were no changes in reported intake of food groups high in folate. These results suggest that knowledge of MTHFR 677C → T genotype did not improve folate intake in participants with the risk variant compared with those with the non-risk variant. ClinicalTrials.gov NCT01530139.

  13. An alternative explanation of the change in T-dependence of the effective Debye-Waller factor at T{sub c} or T{sub B}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ngai, K. L.; CNR-IPCF, Largo Bruno Pontecorvo 3, I-56127 Pisa; Habasaki, J.

    The cusp-like temperature dependence of the Debye-Waller factor or non-ergodicity parameter f{sub Q}(T) at some temperature T{sub c} above T{sub g} found by experiments in several fragile glassformers has been considered as critical evidence for validity of the ideal Mode Coupling Theory (MCT). A comprehensive review of experimental data of f{sub Q}(T) and beyond brings out various problems of the MCT predictions. For example, the molten salt, 0.4Ca(NO{sub 3}){sub 2}-0.6KNO{sub 3} (CKN), was the first glassformer measured by neutron scattering to verify the cusp-like behavior of f{sub Q}(T) at T{sub c} predicted by ideal MCT. While the fits of themore » other scaling laws of MCT to viscosity, light scattering, and dielectric relaxation data all give T{sub c} in the range from 368 to 375 K, there is no evidence of cusp-like behavior of f{sub Q}(T) at T{sub c} from more accurate neutron scattering data obtained later on by Mezei and Russina [J. Phys.: Condens. Matter 11, A341 (1999)] at temperatures below 400 K. In several molecular glass-formers, experiments have found at temperatures below T{sub c} that [1−f{sub Q}(T)] is manifested as nearly constant loss (NCL) in the frequency dependent susceptibility. The NCL persists down to below T{sub g} and is not predicted by the ideal MCT. No clear evidence of the change of T-dependence of f{sub Q}(T) at any T{sub c} was found in intermediate and strong glassformers, although ideal MCT does not distinguish fragile and strong glassformers in predicting the critical behavior of f{sub Q}(T) a priori. Experiments found f{sub Q}(T) changes T-dependence not only at T{sub c} but also at the glass transition temperature T{sub g}. The changes of T-dependence of f{sub Q}(T) at T{sub c} and T{sub g} are accompanied by corresponding changes of dynamic variables and thermodynamic quantities at T{sub B} ≈ T{sub c} and at T{sub g}. The dynamic variables include the relaxation time τ{sub α}(T), the non-exponentiality parameter n(T

  14. Genetic variation throughout the folate metabolic pathway influences negative symptom severity in schizophrenia.

    PubMed

    Roffman, Joshua L; Brohawn, David G; Nitenson, Adam Z; Macklin, Eric A; Smoller, Jordan W; Goff, Donald C

    2013-03-01

    Low serum folate levels previously have been associated with negative symptom risk in schizophrenia, as has the hypofunctional 677C>T variant of the MTHFR gene. This study examined whether other missense polymorphisms in folate-regulating enzymes, in concert with MTHFR, influence negative symptoms in schizophrenia, and whether total risk allele load interacts with serum folate status to further stratify negative symptom risk. Medicated outpatients with schizophrenia (n = 219), all of European origin and some included in a previous report, were rated with the Positive and Negative Syndrome Scale. A subset of 82 patients also underwent nonfasting serum folate testing. Patients were genotyped for the MTHFR 677C>T (rs1801133), MTHFR 1298A>C (rs1801131), MTR 2756A>G (rs1805087), MTRR 203A>G (rs1801394), FOLH1 484T>C (rs202676), RFC 80A>G (rs1051266), and COMT 675G>A (rs4680) polymorphisms. All genotypes were entered into a linear regression model to determine significant predictors of negative symptoms, and risk scores were calculated based on total risk allele dose. Four variants, MTHFR 677T, MTR 2756A, FOLH1 484C, and COMT 675A, emerged as significant independent predictors of negative symptom severity, accounting for significantly greater variance in negative symptoms than MTHFR 677C>T alone. Total allele dose across the 4 variants predicted negative symptom severity only among patients with low folate levels. These findings indicate that multiple genetic variants within the folate metabolic pathway contribute to negative symptoms of schizophrenia. A relationship between folate level and negative symptom severity among patients with greater genetic vulnerability is biologically plausible and suggests the utility of folate supplementation in these patients.

  15. Relationship of MTHFR gene polymorphisms with renal and cardiac disease

    PubMed Central

    Trovato, Francesca M; Catalano, Daniela; Ragusa, Angela; Martines, G Fabio; Pirri, Clara; Buccheri, Maria Antonietta; Di Nora, Concetta; Trovato, Guglielmo M

    2015-01-01

    AIM: To investigate the effects of different methylenetetrahydrofolate reductase (MTHFR) 677C>T gene polymorphism and hyperhomocysteinemia for the development of renal failure and cardiovascular events, which are controversial. METHODS: We challenged the relationship, if any, of MTHFR 677C>T and MTHFR 1298A>C polymorphisms with renal and heart function. The present article is a reappraisal of these concepts, investigating within a larger population, and including a subgroup of dialysis patients, if the two most common MTHFR polymorphisms, C677T and A1298C, as homozygous, heterozygous or with a compound heterozygous state, show different association with chronic renal failure requiring hemodialysis. MTHFR polymorphism could be a favorable evolutionary factor, i.e., a protective factor for many ominous conditions, like cancer and renal failure. A similar finding was reported in fatty liver disease in which it is suggested that MTHFR polymorphisms could have maintained and maintain their persistence by an heterozygosis advantage mechanism. We studied a total of 630 Italian Caucasian subject aged 54.60 ± 16.35 years, addressing to the increased hazard of hemodialysis, if any, according to the studied MTHFR genetic polymorphisms. RESULTS: A favorable association with normal renal function of MTHFR polymorphisms, and notably of MTHFR C677T is present independently of the negative effects of left ventricular hypertrophy, increased Intra-Renal arterial Resistance and hyperparathyroidism. CONCLUSION: MTHFR gene polymorphisms could have a protective role on renal function as suggested by their lower frequency among our dialysis patients in end-stage renal failure; differently, the association with left ventricular hypertrophy and reduced left ventricular relaxation suggest some type of indirect, or concurrent mechanism. PMID:25664255

  16. Influence of Nitrous Oxide Anesthesia, B-Vitamins, and MTHFR gene polymorphisms on Perioperative Cardiac Events: The Vitamins in Nitrous Oxide (VINO) Randomized Trial

    PubMed Central

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G.; Gage, Brian F.; Miller, J. Philip

    2013-01-01

    Background Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the MTHFR C677T or A1298C gene variant. In this randomized controlled trial we sought to determine if patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and if this risk could be mitigated by B-vitamins. Methods We randomized adult patients with cardiac risk factors undergoing noncardiac surgery to receive nitrous oxide plus intravenous B-vitamins before and after surgery or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I elevation within the first 72 hours after surgery. Results A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T or A1298C gene variant (n= 98; 19.6%) had no increased rate of postoperative cardiac troponin I elevation compared to wild-type and heterozygous patients (11.2% vs. 14.0%; relative risk 0.96, 95% CI 0.85 to 1.07, p=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I elevation compared to patients receiving placebo (13.2% vs. 13.6%; relative risk 1.02, 95% CI 0.78 to 1.32, p=0.91). Conclusions Neither MTHFR C677T and A1298C gene variant nor acute homocysteine increase are associated with perioperative cardiac troponin elevation after nitrousoxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin elevation. PMID:23856660

  17. MTHFR gene polymorphism in acute lymphoblastic leukemia among North Indian children: a case-control study and meta-analysis updated from 2011.

    PubMed

    Roy Moulik, Nirmalya; Parveen, Farah; Kumar, Archana; Awasthi, Shally; Agrawal, Suraksha

    2014-07-01

    Studies on the association of methylenetetrahydrofolate reductase (MTHFR) genotype in childhood acute lymphoblastic leukemia (ALL) have yielded conflicting results. The present study examines this association in north Indian children with ALL and includes an updated meta-analysis. MTHFR (677 and 1298) genotype of children with ALL and healthy adult controls were done by the PCR-restriction fragment length polymorphism (PCR-RFLP) method and were compared using various models of inheritance. A total of 150 patients and 300 controls were included. The 677T allele was found protective (odds ratio (OR) 0.21, 95% confidence interval (CI) 0.04-0.94), whereas 1298C allele led to an increase in risk (OR 4.44, 95% CI 2.19-8.99) of childhood ALL. Meta-analysis included 31 and 27 studies examining the association of 677 and 1298 genotypes, respectively. The 677 C -> T polymorphism was protective (OR 0.90, 95% CI 0.82-0.99). Protection was more pronounced in folate-sufficient populations as compared with those not covered by folate fortification guidelines. The 1298A->C polymorphism was associated with a marginal increase in risk (OR 1.19, 95% CI 1.01-1.40).

  18. Associations between Methylenetetrahydrofolate Reductase (MTHFR) Polymorphisms and Non-Alcoholic Fatty Liver Disease (NAFLD) Risk: A Meta-Analysis

    PubMed Central

    Sun, Man-Yi; Zhang, Li; Shi, Song-Li; Lin, Jing-Na

    2016-01-01

    Background C677T and A1298C are the most common allelic variants of Methylenetetrahydrofolate Reductase (MTHFR) gene. The association between MTHFR polymorphisms and the occurrence of non-alcoholic fatty liver disease (NAFLD) remains controversial. This study was thus performed to examine whether MTHFR mutations are associated with the susceptibility to NAFLD. Methods A first meta-analysis on the association between the MTHFR polymorphisms and NAFLD risks was carried out via Review Manager 5.0 and Stata/SE 12.0 software. The on-line databases, such as PubMed, EMBASE, CENTRAL, WOS, Scopus and EBSCOhost (updated to April 1st, 2016), were searched for eligible case-control studies. The odd radio (OR), 95% confidence interval (CI) and P value were calculated through Mantel-Haenszel statistics under random- or fixed-effect model. Results Eight articles (785 cases and 1188 controls) contributed data to the current meta-analysis. For C677T, increased NAFLD risks were observed in case group under homozygote model (T/T vs C/C, OR = 1.49, 95% CI = 1.03~2.15, P = 0.04) and recessive model (T/T vs C/C+C/T, OR = 1.42, 95% CI = 1.07~1.88, P = 0.02), but not the other genetics models, compared with control group. For A1298C, significantly increased NAFLD risks were detected in allele model (C vs A, OR = 1.53, 95% CI = 1.13~2.07, P = 0.006), homozygote model (C/C vs A/A, OR = 2.81, 95% CI = 1.63~4.85, P = 0.0002), dominant model (A/C+C/C vs A/A, OR = 1.60, 95% CI = 1.06~2.41, P = 0.03) and recessive model (C/C vs A/A+A/C, OR = 2.08, 95% CI = 1.45~3.00, P<0.0001), but not heterozygote model. Conclusion T/T genotype of MTHFR C677T polymorphism and C/C genotype of MTHFR A1298C are more likely to be associated with the susceptibility to NAFLD. PMID:27128842

  19. Chemical vapor deposition of high T sub c superconductors

    NASA Technical Reports Server (NTRS)

    Webb, G. W.; Engelhardt, J. J.

    1978-01-01

    The results are reported of an investigation into the synthesis and properties of high temperature superconducting materials. A chemical vapor deposition apparatus was designed and built which is suitable for the preparation of multicomponent metal films This apparatus was used to prepare a series of high T sub c A-15 structure superconducting films in the binary system Nb-Ge. The effect on T sub c of a variety of substrate materials was investigated. An extensive series of ternary alloys were also prepared. Conditions allowing the brittle high T sub c (approximately 18 K) A-15 structure superconductor Nb3A1 to be prepared in a low T sub c but ductile form were found. Some of the ways that the ductile (bcc) form can be cold worked or machined are described. Measurements of rate of transformation of cold worked bcc material to the high T sub c A-15 structure with low temperature annealing are given. Preliminary measurements indicate that this material has attractive high field critical current densities.

  20. Dynamic Equilibrium of Cardiac Troponin C's Hydrophobic Cleft and Its Modulation by Ca2+ Sensitizers and a Ca2+ Sensitivity Blunting Phosphomimic, cTnT(T204E).

    PubMed

    Schlecht, William; Dong, Wen-Ji

    2017-10-18

    Several studies have suggested that conformational dynamics are important in the regulation of thin filament activation in cardiac troponin C (cTnC); however, little direct evidence has been offered to support these claims. In this study, a dye homodimerization approach is developed and implemented that allows the determination of the dynamic equilibrium between open and closed conformations in cTnC's hydrophobic cleft. Modulation of this equilibrium by Ca 2+ , cardiac troponin I (cTnI), cardiac troponin T (cTnT), Ca 2+ -sensitizers, and a Ca 2+ -desensitizing phosphomimic of cTnT (cTnT(T204E) is characterized. Isolated cTnC contained a small open conformation population in the absence of Ca 2+ that increased significantly upon the addition of saturating levels of Ca 2+ . This suggests that the Ca 2+ -induced activation of thin filament arises from an increase in the probability of hydrophobic cleft opening. The inclusion of cTnI increased the population of open cTnC, and the inclusion of cTnT had the opposite effect. Samples containing Ca 2+ -desensitizing cTnT(T204E) showed a slight but insignificant decrease in open conformation probability compared to samples with cardiac troponin T, wild type [cTnT(wt)], while Ca 2+ sensitizer treated samples generally increased open conformation probability. These findings show that an equilibrium between the open and closed conformations of cTnC's hydrophobic cleft play a significant role in tuning the Ca 2+ sensitivity of the heart.

  1. TPMT and MTHFR genotype is not associated with altered risk of thioguanine-related sinusoidal obstruction syndrome in pediatric acute lymphoblastic leukemia: a report from the Children's Oncology Group.

    PubMed

    Wray, Lisa; Vujkovic, Marijana; McWilliams, Thomas; Cannon, Shannon; Devidas, Meenakshi; Stork, Linda; Aplenc, Richard

    2014-11-01

    Sinusoidal obstruction syndrome is a complication of therapy for pediatric ALL and may be modified by thiopurine methyltransferase activity as well as by MTHFR genotype. We assessed TPMT *3A, *3B, *3C, and MTHFR C677T and A1298C germline genetic polymorphisms among 351 patients enrolled in the thioguanine treatment arm of CCG-1952 clinical trial. TPMT and MTHFR C677T genotypes were not associated with SOS risk. The combination of MTHFR and TPMT variant genotypes was not associated with SOS risk. These suggest that germline genetic variation in TPMT and MTHFR do not significantly alter SOS risk in patients exposed to thioguanine. © 2014 Wiley Periodicals, Inc.

  2. Association between MTHFR Polymorphisms and Acute Myeloid Leukemia Risk: A Meta-Analysis

    PubMed Central

    Su, Yan; Lu, Ge-Ning; Wang, Ren-Sheng

    2014-01-01

    Previous observational studies investigating the association between methylenetetrahydrofolate reductase (MTHFR) polymorphisms and acute myeloid leukemia risk (AML) have yielded inconsistent results. The aim of this study is to derive a more precise estimation of the association between MTHFR (C677T and A1298C) polymorphisms and acute myeloid leukemia risk. PubMed and Embase databases were systematically searched to identify relevant studies from their inception to August 2013. Odds ratios (ORs) with 95% confidence intervals (CIs) were the metric of choice. Thirteen studies were selected for C677T polymorphism (1838 cases and 5318 controls) and 9 studies (1335 patients and 4295 controls) for A1298C polymorphism. Overall, pooled results showed that C677T polymorphism was not significant associated with AML risk(OR, 0.98–1.04; 95% CI, 0.86–0.92 to 1.09–1.25). Similar results were observed for the A1298C polymorphism and in subgroup analysis. All comparisons revealed no substantial heterogeneity nor did we detect evidence of publication bias. In summary, this meta-analysis provides evidence that MTHFR polymorphisms were not associated with AML risk. Further investigations are needed to offer better insight into the role of these polymorphisms in AML carcinogenesis. PMID:24586405

  3. Association between MTHFR polymorphisms and acute myeloid leukemia risk: a meta-analysis.

    PubMed

    Qin, Yu-Tao; Zhang, Yong; Wu, Fang; Su, Yan; Lu, Ge-Ning; Wang, Ren-Sheng

    2014-01-01

    Previous observational studies investigating the association between methylenetetrahydrofolate reductase (MTHFR) polymorphisms and acute myeloid leukemia risk (AML) have yielded inconsistent results. The aim of this study is to derive a more precise estimation of the association between MTHFR (C677T and A1298C) polymorphisms and acute myeloid leukemia risk. PubMed and Embase databases were systematically searched to identify relevant studies from their inception to August 2013. Odds ratios (ORs) with 95% confidence intervals (CIs) were the metric of choice. Thirteen studies were selected for C677T polymorphism (1838 cases and 5318 controls) and 9 studies (1335 patients and 4295 controls) for A1298C polymorphism. Overall, pooled results showed that C677T polymorphism was not significant associated with AML risk(OR, 0.98-1.04; 95% CI, 0.86-0.92 to 1.09-1.25). Similar results were observed for the A1298C polymorphism and in subgroup analysis. All comparisons revealed no substantial heterogeneity nor did we detect evidence of publication bias. In summary, this meta-analysis provides evidence that MTHFR polymorphisms were not associated with AML risk. Further investigations are needed to offer better insight into the role of these polymorphisms in AML carcinogenesis.

  4. Depositing High-T(sub c) Superconductors On Normal-Conductor Wires

    NASA Technical Reports Server (NTRS)

    Kirlin, Peter S.

    1994-01-01

    Experiments have demonstrated feasibility of depositing thin layers of high-T(sub c) superconductor on normally electrically conductive wires. Superconductivity evident at and below critical temperature (T{sub c}) of 71 K. OMCVD, organometallic vapor deposition, apparatus coats Ag wire with layer high-T(sub c) superconductor. Superconductive phase of this material formed subsequently by annealing under controlled conditions.

  5. CD4+ Foxp3+ T cells promote aberrant immunoglobulin G production and maintain CD8+ T-cell suppression during chronic liver disease.

    PubMed

    Tedesco, Dana; Thapa, Manoj; Gumber, Sanjeev; Elrod, Elizabeth J; Rahman, Khalidur; Ibegbu, Chris C; Magliocca, Joseph F; Adams, Andrew B; Anania, Frank; Grakoui, Arash

    2017-02-01

    Persistent hepatotropic viral infections are a common etiologic agent of chronic liver disease. Unresolved infection can be attributed to nonfunctional intrahepatic CD8+ T-cell responses. In light of dampened CD8 + T-cell responses, liver disease often manifests systemically as immunoglobulin (Ig)-related syndromes due to aberrant B-cell functions. These two opposing yet coexisting phenomena implicate the potential of altered CD4 + T-cell help. Elevated CD4 + forkhead box P3-positive (Foxp3+) T cells were evident in both human liver disease and a mouse model of chemically induced liver injury despite marked activation and spontaneous IgG production by intrahepatic B cells. While this population suppressed CD8 + T-cell responses, aberrant B-cell activities were maintained due to expression of CD40 ligand on a subset of CD4 + Foxp3+ T cells. In vivo blockade of CD40 ligand attenuated B-cell abnormalities in a mouse model of liver injury. A phenotypically similar population of CD4 + Foxp3+, CD40 ligand-positive T cells was found in diseased livers explanted from patients with chronic hepatitis C infection. This population was absent in nondiseased liver tissues and peripheral blood. Liver disease elicits alterations in the intrahepatic CD4 + T-cell compartment that suppress T-cell immunity while concomitantly promoting aberrant IgG mediated manifestations. (Hepatology 2017;65:661-677). © 2016 by the American Association for the Study of Liver Diseases.

  6. Measurement of the t $$\\bar{t}$$ Cross-Section Using the Dimuon Channel in p$$\\bar{p}$$ Collisions at √s = 1.96-TeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCroskey, Robert Crampton

    2004-01-01

    The author has measured the tmore » $$\\bar{t}$$ production cross section at √s = 1.96 TeV using data collected by the D0 experiment at Fermilab. The integrated luminosity of the data set is 140 pb -1 and a total of four candidate events are seen, with an expected background of 2.61 events. The measured cross section of σ t$$\\bar{t}$$ = 11.1$$+22.1\\atop{-9.3}$$(stat.)$$+4.3\\atop{-4.5}$$(sys.) pb is in agreement with a NNLO calculation of 6.77 pb.« less

  7. Association of the methylenetetrahydrofolate reductase polymorphism in Korean patients with childhood acute lymphoblastic leukemia.

    PubMed

    Kim, Nam Keun; Chong, So Young; Jang, Moon Ju; Hong, Seung Ho; Kim, Heung Sik; Cho, Eun Kyung; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Oh, Doyeun

    2006-01-01

    Methylenetetrahydrofolate reductase plays a central role in converting folate to methyl donor for DNA methylation. Recently, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) mutations were discovered to be associated with childhood acute lymphoblastic leukemia (ALL), as well as colon cancer, lymphoma, esophageal and stomach cancer. Therefore, it was hypothesized that the MTHFR polymorphisms are associated with the risk of childhood ALL in the Korean population. DNA samples taken from 66 patients with ALL and 100 age-matched controls were analyzed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay for detection of MTHFR C677T and A1298C mutations. The frequency of the AC genotype for MTHFR A1298C polymorphism was significantly different between the controls and the cases (OR, 2.22; CI, 95% 1.09-4.51, p=0.03). The 1298AC+CC genotype was also significantly different (OR, 2.11; 95% CI, 1.06-4.22; p=0.049). There was, however, no significant difference for MTHFR C677T polymorphism and combined genotype frequencies between the two groups. Although no consistent results on associations between MTHFR A 1298C polymorphism and ALL in the populations studied were obtained, the A1298C polymorphism, at least in Koreans, may be a genetic determinant among childhood ALL patients.

  8. Thrombophilic genetic factors PAI-1 4G-4G and MTHFR 677TT as risk factors of alcohol, cryptogenic liver cirrhosis and portal vein thrombosis, in a Caucasian population.

    PubMed

    D'Amico, Mario; Pasta, Francesca; Pasta, Linda

    2015-08-15

    The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and Prothrombin 20210A, were studied as risk factors in 865 Caucasian patients with liver cirrhosis, consecutively enrolled from June 2008 to January 2014. A total of 582 HCV, 80 HBV, 94 alcohol, (82 with more than one etiologic factor) and 191 cryptogenic patients with liver cirrhosis had been consecutively enrolled; 243 patients showed portal vein thrombosis (PVT). At least one of the above THRGFs was present in 339/865 patients (39.2%). PAI-1 4G-4G and MTHFR 677TT were the most frequent THRGFs, statistically significant in patients with alcohol, cryptogenic liver cirrhosis, and PVT: respectively 24 and 28, 50 and 73, and 65 and 83 (all chi-square tests>3.84, and p values<0.05). Two logistic regression analysis, using PAI-1 4G-4G and MTHFR 677TT, as dependent variable, confirmed the independent significant relationship of these THRGFs with alcohol, cryptogenic liver cirrhosis and PVT. PAI 1 and MTHFR 677 genotypes, deviated from those expected in populations in Hardy-Weinberg equilibrium (all p values<0.05), in the subgroups of patients with alcohol, cryptogenic liver cirrhosis and presence of PVT. Our study shows the pivotal role of PAI-1 4G-4G and MTHFR 677TT in patients with alcohol, cryptogenic liver cirrhosis, and PVT, in a Caucasian population. In conclusion, thrombo and fibro-genetic mechanisms of PAI-1 4G-4G and MTHFR 677TT, could have a role in the development of liver cirrhosis, mainly in patients without HCV and HBV, and PVT. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Evidence for Biomass Burning from 14C and 13C/12C Measurements at T-0 and T-1 during MILAGRO.

    NASA Astrophysics Data System (ADS)

    Gaffney, J. S.; Marley, N. A.; Tackett, M. J.; Sturchio, N. C.; Heraty, L. J.; Martinez, N.; Hardy, K.; Guilderson, T.

    2007-12-01

    Both stable carbon isotopic and radiocarbon characterizations of aerosols can yield important information regarding the sources of carbonaceous aerosols in urban and regional environments. Biomass derived materials are labeled due to their recent photochemical activity in radiocarbon and vary depending upon the photochemical pathway (either C-4 or C-3) in stable carbon-13 content. C-4 being enriched over C-3. During the MILAGRO campaign, quartz filter samples were taken at 12 hour intervals from 5 am to 5 pm (day) and from 5 pm to 5 am (night) during the month of March 2006. These samples were taken at the two super-sites, T-0 (Instituto Mexicano de Petroleo in Mexico City) and T-1 (Universidad Technologica de Tecamac, State of Mexico). The total carbon content was analyzed for stable carbon isotopic composition as well as for radiocarbon. Stable isotope mass spectroscopy was used to determine the carbon-13 to carbon-12 isotopic ratios on carbon dioxide. The carbon dioxide was then converted to graphite for analysis by accelerator mass spectrometry at the Center for Accelerator Mass Spectrometry at Lawrence Livermore National Laboratory. Results are presented for the carbon-13 content relative to the PDB standard and radiocarbon is given relative to recent carbon. The results for total radiocarbon content show that the carbonaceous aerosol content in Mexico City has more than half of the carbon coming from biomass derived sources. These can include inflow of biomass burning aerosols into the T-0 site as well as the input from local burning of biofuels and trash containing biomass derived materials (paper, boxes, etc.). Data also indicate that at the T-1 site biomass burning of C-4 grasses appears to be significant in that the carbon-13 values observed are enriched. Also at T-1 the radiocarbon levels are also found to be slightly higher indicating regional biomass burning as a significant contributor to aerosol carbon in the 0.1 to 1.0 micron size fraction. Some day

  10. T lymphocyte mediated lysis of mitomycin C treated Tenon's capsule fibroblasts.

    PubMed

    Crowston, J G; Chang, L H; Daniels, J T; Khaw, P T; Akbar, A N

    2004-03-01

    To evaluate the effect of T cell co-culture on mitomycin C treated and untreated Tenon's capsule fibroblasts. IL-2 dependent allogeneic T cells were incubated over a monolayer of mitomycin C treated or control fibroblasts. Fibroblast numbers were evaluated by direct counts using phase contrast microscopy. To determine whether T cell mediated lysis was a consequence of MHC mismatch, co-culture experiments were repeated with autologous T cells. The effect of Fas receptor blockade was established by co-incubation with a Fas blocking (M3) antibody. T cell co-culture resulted in a dramatic reduction in fibroblast survival compared to mitomycin C treatment alone (p = 0.032). T cell killing required fibroblast/lymphocyte cell to cell contact and was observed in both allogeneic and autologous co-culture experiments. Fas blocking antibodies did not significantly inhibit T cell killing (p = 0.39). T cells augment mitomycin C treated fibroblast death in vitro. Similar mechanisms may contribute to the cytotoxic effect of mitomycin C in vivo and account for the largely hypocellular drainage blebs that are observed clinically.

  11. The thermolabile variant of MTHFR is associated with depression in the British Women's Heart and Health Study and a meta-analysis.

    PubMed

    Lewis, S J; Lawlor, D A; Davey Smith, G; Araya, R; Timpson, N; Day, I N M; Ebrahim, S

    2006-04-01

    Low dietary folate intake has been implicated as a risk factor for depression. However, observational epidemiological studies are plagued by problems of confounding, reverse causality and measurement error. A common polymorphism (C677T) in MTHFR is associated with methyltetrahydrofolate reductase (MTHFR) activity and circulating folate and homocysteine levels and offers insights into whether the association between low folate and depression is causal. We genotyped this polymorphism in 3,478 women in the British Women's Heart and Health Study. In these women, we looked at the association between genotype and three indicators of depression; ever diagnosed as depressed, currently taking antidepressants and the EuroQol mood question. We also carried out a systematic review and meta-analysis of all published studies which have looked at the association between MTHFR C677T genotype and depression. In the British Women's Heart and Health Study, we found evidence of an increased risk of ever being diagnosed as depressed in MTHFR C677T TT individuals compared with CC individuals, odds ratio (OR) 1.35(95% CI: 1.01, 1.80). Furthermore, we identified eight other studies, which have examined the association between depression and MTHFR C677T. We were able to include all of these studies in our meta-analysis together with our results, obtaining an overall summary OR of 1.36 (95% CI: 1.11, 1.67, P=0.003). Since this genotype influences the functioning of the folate metabolic pathway, these findings suggest that folate or its derivatives may be causally related to risk of depression. Molecular Psychiatry (2006) 11, 352-360. doi:10.1038/sj.mp.4001790; published online 10 January 2006.

  12. Methylenetetrahydrofolate reductase polymorphisms and therapy response in pediatric acute lymphoblastic leukemia.

    PubMed

    Aplenc, Richard; Thompson, Jennifer; Han, Peggy; La, Mei; Zhao, Huaqing; Lange, Beverly; Rebbeck, Timothy

    2005-03-15

    A significant portion of patients treated for pediatric acute lymphoblastic leukemia (ALL) relapse. We hypothesized that common polymorphisms with moderate effect sizes and large attributive risks could explain an important fraction of ALL relapses. Methylenetetrahydrofolate reductase (MTHFR) is central to folate metabolism and has two common functional polymorphisms (C677T and A1298G). Methotrexate (MTX), which interrupts folate metabolism, is a mainstay of pediatric ALL therapy. MTX inhibits the synthesis of dTMP needed for DNA replication by blocking the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate by MTHFR. We hypothesized that a deactivating MTHFR allele would increase ALL relapse risk by potentially increasing 5,10-methylenetetrahydrofolate and dTMP, enhancing DNA synthesis and thus opposing MTX. To test this hypothesis, we genotyped 520 patients on the Children's Cancer Study Group ALL study, CCG-1891. The MTHFR C677T variant allele was statistically significantly associated with relapse (chi2 = 4.38, P = 0.036). This association remained significant (hazard ratio = 1.82, P = 0.008), controlling for important covariates, and was more predictive of relapse than other predictors, including day 7 bone marrow response. The MTHFR C677T variant allele was not associated with an increased risk of toxicity or infection. The MTHFR A1298G polymorphism was not associated with altered risks of relapse, toxicity, or infection. Haplotype analysis showed six common haplotypes that did not provide additional information predictive for relapse. These data provide evidence that the MTHFR C677T polymorphism is a common genetic variant conferring a moderate relative risk and a high attributable risk for relapse in pediatric ALL patients.

  13. Statistical inference for tumor growth inhibition T/C ratio.

    PubMed

    Wu, Jianrong

    2010-09-01

    The tumor growth inhibition T/C ratio is commonly used to quantify treatment effects in drug screening tumor xenograft experiments. The T/C ratio is converted to an antitumor activity rating using an arbitrary cutoff point and often without any formal statistical inference. Here, we applied a nonparametric bootstrap method and a small sample likelihood ratio statistic to make a statistical inference of the T/C ratio, including both hypothesis testing and a confidence interval estimate. Furthermore, sample size and power are also discussed for statistical design of tumor xenograft experiments. Tumor xenograft data from an actual experiment were analyzed to illustrate the application.

  14. The aging correlation (RH + t): Relative humidity (%) + temperature (deg C)

    NASA Technical Reports Server (NTRS)

    Cuddihy, E. F.

    1986-01-01

    An aging correlation between corrosion lifetime, and relative humidity RH (%) and temperature t (C) has been reported in the literature. This aging correlation is a semi-log plot of corrosion lifetime on the log scale versus the interesting summation term RH(%) + t(C) on the linear scale. This empirical correlation was derived from observation of experimental data trends and has been referred to as an experimental law. Using electrical resistivity data of polyvinyl butyral (PVB) measured as a function of relative humidity and temperature, it was found that the electrical resistivity could be expressed as a function of the term RH(%) t(C). Thus, if corrosion is related to leakage current through an organic insulator, which, in turn, is a function of RH and t, then some partial theoretical validity for the correlation is indicated. This article describes the derivation of the term RH(%) t(C) from PVB electrical resistivity data.

  15. Cutting Edge: c-Maf Is Required for Regulatory T Cells To Adopt RORγt+ and Follicular Phenotypes.

    PubMed

    Wheaton, Joshua D; Yeh, Chen-Hao; Ciofani, Maria

    2017-12-15

    Regulatory T cells (Tregs) adopt specialized phenotypes defined by coexpression of lineage-defining transcription factors, such as RORγt, Bcl-6, or PPARγ, alongside Foxp3. These Treg subsets have unique tissue distributions and diverse roles in maintaining organismal homeostasis. However, despite extensive functional characterization, the factors driving Treg specialization are largely unknown. In this article, we show that c-Maf is a critical transcription factor regulating this process in mice, essential for generation of both RORγt + Tregs and T follicular regulatory cells, but not for adipose-resident Tregs. c-Maf appears to function primarily in Treg specialization, because IL-10 production, expression of other effector molecules, and general immune homeostasis are not c-Maf dependent. As in other T cells, c-Maf is induced in Tregs by IL-6 and TGF-β, suggesting that a combination of inflammatory and tolerogenic signals promote c-Maf expression. Therefore, c-Maf is a novel regulator of Treg specialization, which may integrate disparate signals to facilitate environmental adaptation. Copyright © 2017 by The American Association of Immunologists, Inc.

  16. [Features of allele polymorphism of genes involved in homocysteine and folate metabolism in patients with atherosclerosis of the lower extremity arteries].

    PubMed

    Klenkova, N A; Kapustin, S I; Saltykova, N B; Shmeleva, V M; Blinov, M N

    2009-01-01

    Under study were features of allele polymorphism of genes of methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MS A 2756G), methionine synthase reductase (MTRR A66G) and methylenetetrahydrofolate dehydrogenase (MTHFD G1958A) in patients with atherosclerosis of the lower extremity arteries (ALEA). Patients with hyperhomocysteinemia (HHcy) had statistically significant increase of allele MTHFR 677T and MTRR 66GG as compared both with the control group and with the group of patients without HHcy. It suggests that polymorphism of genes involved in homocystein and folate metabolism might affect the risk of HHcy in patients with ALEA.

  17. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function

    PubMed Central

    Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Alvarez, Xavier; Rasmussen, Kelsi K.; Lackner, Andrew A.; Veazey, Ronald S.

    2012-01-01

    The common γc subunit molecule is shared among all γc cytokines and clearly involved in T-cell function, but its role in HIV infection and immunity is not well understood. Here, we examined expression and function of γc on T cells during SIV infection in Rhesus macaques. Surface γc distribution was differentially expressed on CD4+ and CD8+ T cells, and CD4+ naive/memory cell populations in various lymphoid tissues of normal macaques. However, surface γc expression was rapidly and significantly down-regulated on T cells in acute infection with pathogenic SIV, compared to infection with a less virulent SHIV or controls and did not recover on CD8+ T cells in the chronic stage. Moreover, the peripheral and CD4+T cell loss was inversely correlated with γc+ CD8+ T cells in individual tissues. γc+ T cells were mainly functional as evidenced by higher cytokine secretion and proliferative capacity. Further in vitro experiments found that surface γc expression could be down-regulated following high level of IL-7 treatment by both internalization and shedding. Down-regulation of γc during early HIV/SIV infection may inhibit T-cell function, particularly of CD8+ T cells, and, may be linked with immune failure and loss of viral containment.—Xu, H., Wang, X., Pahar, B., Alvarez, X., Rasmussen, K. K., Lackner, A. A., Veazey, R. S. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function. PMID:22375017

  18. Analytical evaluation of point of care cTnT and clinical performances in an unselected population as compared with central laboratory highly sensitive cTnT.

    PubMed

    Dupuy, Anne Marie; Sebbane, Mustapha; Roubille, François; Coste, Thibault; Bargnoux, Anne Sophie; Badiou, Stéphanie; Kuster, Nils; Cristol, Jean Paul

    2015-03-01

    To report the analytical performances of the Radiometer AQT90 FLEX® cTnT assay (Neuilly-Plaisance, France) and to evaluate the concordance with hs-cTnT results from central laboratory for the diagnosis of acute myocardial infarction (AMI) at baseline and during a short follow-up among unselected patients admitted in emergency room or cardiology department. Analytical performances of AQT90 FLEX® cTnT immunoassay included imprecision study with determination of a coefficient of variation at 10% and 20%, linearity, and limit of detection. The concordance study was based on samples obtained from 170 consecutive patients with chest pain suggestive of acute coronary syndrome (ACS) admitted in the emergency room or cardiology department. The kinetic study (within 62 additional samples 3h later) was based on absolute delta criterion and the combination of relative change of 30% with absolute change of 7ng/L. The cTnT assay from Radiometer was evaluated as clinically usable, although less sensitive than the Roche hs-cTnT assay as demonstrated by the concordance and the kinetic studies. In non-selected population, the cTnT AQT Flex© assay on AQT90© with kinetic change at 3h, provides similar clinical classification of patients, particularly for AMI group as compared to central laboratory hs-cTnT assay and could be suitable for clinical use. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  19. Regulatory T cells facilitate the nuclear accumulation of inducible cAMP early repressor (ICER) and suppress nuclear factor of activated T cell c1 (NFATc1)

    PubMed Central

    Vaeth, Martin; Gogishvili, Tea; Bopp, Tobias; Klein, Matthias; Berberich-Siebelt, Friederike; Gattenloehner, Stefan; Avots, Andris; Sparwasser, Tim; Grebe, Nadine; Schmitt, Edgar; Hünig, Thomas; Serfling, Edgar; Bodor, Josef

    2011-01-01

    Inducible cAMP early repressor (ICER) is a transcriptional repressor, which, because of alternate promoter use, is generated from the 3′ region of the cAMP response modulator (Crem) gene. Its expression and nuclear occurrence are elevated by high cAMP levels in naturally occurring regulatory T cells (nTregs). Using two mouse models, we demonstrate that nTregs control the cellular localization of ICER/CREM, and thereby inhibit IL-2 synthesis in conventional CD4+ T cells. Ablation of nTregs in depletion of regulatory T-cell (DEREG) mice resulted in cytosolic localization of ICER/CREM and increased IL-2 synthesis upon stimulation. Direct contacts between nTregs and conventional CD4+ T cells led to nuclear accumulation of ICER/CREM and suppression of IL-2 synthesis on administration of CD28 superagonistic (CD28SA) Ab. In a similar way, nTregs communicated with B cells and induced the cAMP-driven nuclear localization of ICER/CREM. High levels of ICER suppressed the induction of nuclear factor of activated T cell c1 (Nfatc1) gene in T cells whose inducible Nfatc1 P1 promoter bears two highly conserved cAMP-responsive elements to which ICER/CREM can bind. These findings suggest that nTregs suppress T-cell responses by the cAMP-dependent nuclear accumulation of ICER/CREM and inhibition of NFATc1 and IL-2 induction. PMID:21262800

  20. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function.

    PubMed

    Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Alvarez, Xavier; Rasmussen, Kelsi K; Lackner, Andrew A; Veazey, Ronald S

    2012-06-01

    The common γ(c) subunit molecule is shared among all γ(c) cytokines and clearly involved in T-cell function, but its role in HIV infection and immunity is not well understood. Here, we examined expression and function of γ(c) on T cells during SIV infection in Rhesus macaques. Surface γ(c) distribution was differentially expressed on CD4(+) and CD8(+) T cells, and CD4(+) naive/memory cell populations in various lymphoid tissues of normal macaques. However, surface γ(c) expression was rapidly and significantly down-regulated on T cells in acute infection with pathogenic SIV, compared to infection with a less virulent SHIV or controls and did not recover on CD8(+) T cells in the chronic stage. Moreover, the peripheral and CD4(+)T cell loss was inversely correlated with γ(c)(+) CD8(+) T cells in individual tissues. γ(c)(+) T cells were mainly functional as evidenced by higher cytokine secretion and proliferative capacity. Further in vitro experiments found that surface γ(c) expression could be down-regulated following high level of IL-7 treatment by both internalization and shedding. Down-regulation of γ(c) during early HIV/SIV infection may inhibit T-cell function, particularly of CD8(+) T cells, and, may be linked with immune failure and loss of viral containment.

  1. Controlling T c of Iridium films using interfacial proximity effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hennings-Yeomans, R; Chang, CL; Ding, J

    High precision calorimetry using superconducting transition edge sensors requires the use of superconducting films with a suitable T c, depending on the application. To advance high-precision macrocalorimetry, we require low-T c films that are easy to fabricate. A simple and effective way to suppress T c of superconducting Iridium through the proximity effect is demonstrated by using Ir/Pt bilayers as well as Au/Ir/Au trilayers. While Ir/Au films fabricated by applying heat to the substrate during Ir deposition have been used in the past for superconducting sensors, we present results of T c suppression on Iridium by deposition at room temperature in Au/Ir/Au trilayers and Ir/Pt bilayers in the range ofmore » $$\\sim$$20-100~mK. Measurements of the relative impedance between the Ir/Pt bilayers and Au/Ir/Au trilayers fabricated show factor of $$\\sim$$10 higher values in the Ir/Pt case. These new films could play a key role in the development of scalable superconducting transition edge sensors that require low-T c films to minimize heat capacity and maximize energy resolution, while keeping high-yield fabrication methods.« less

  2. Solute Carrier Family 19, member 1 (SLC19A1) polymorphisms (-43T>C, 80G>A, and 696C>T), and haplotypes in idiopathic recurrent spontaneous abortion in a Korean population.

    PubMed

    Rah, HyungChul; Choi, Yi Seul; Jeon, Young Joo; Choi, Youngsok; Cha, Sun Hee; Choi, Dong Hee; Ko, Jung Jae; Shim, Sung Han; Kim, Nam Keun

    2012-05-01

    The objective was to investigate the association between idiopathic recurrent spontaneous abortion (RSA) and 3 SLC19A1 polymorphisms (-43T>C, 80G>A, and 696C>T). DNA from 269 patients with RSA and 125 controls were genotyped for the 3 SLC19A1 single nucleotide polymorphisms (SNPs) by polymerase chain reaction-restriction fragment length polymorphism. Homocysteine and folate levels of 100 patients with RSA were available for analysis. The combination genotypes of SLC19A1 -43TC/80GG, -43TC/80AA, and -43CC/80GA; 80GA/696TT, 80AA/696CC; and -43TC/696CC were less frequent in patients with RSA compared to controls (P < .05 for each). The -43C/80A/696 T and -43T/80G/696C haplotypes were more frequent in patients than controls, whereas -43T/80A/696C, -43C/80A/696C, -43C/80G/696C, -43C/80G/696T, and -43T/80G/696T haplotypes were less frequent in patients (P < .05 for each). The -43T/80G and 80A/696T haplotypes were more frequent in patients, while -43T/80A, -43C/80G, 80A/696C, 80G/696T, and -43C/696C haplotypes occurred less frequently in patients (P < .05 for each). The associations between idiopathic RSA occurrence and SLC19A1 -43T>C/80G>A/696C>T polymorphisms were identified and can be developed as biomarkers for RSA risk.

  3. T-34C back seat instrument panel

    NASA Image and Video Library

    1997-05-15

    The back seat instrument panel on the NASA T-34C chase plane. In its role as a military trainer, the instructor pilot would ride in the back seat, while the student would be in the front seat. As a chase plane, the back seat would be occupied by a photographer. The aircraft was previously used at the Lewis Research Center in propulsion experiments involving turboprop engines, and was used as a chase aircraft at Dryden for smaller and slower research projects. Chase aircraft accompany research flights for photography and video purposes, and also as support for safety and research. At Dryden, the T-34 is used mainly for smaller remotely piloted vehicles which fly slower than NASA's F-18's, used for larger scale projects. This aircraft was returned to the U.S. Navy in May of 2002. The T-34C, built by Beech, carries a crew of 2 and is nicknamed the Mentor.

  4. [Association of single nucleotide polymorphism of methylenetetrahydrofolate reductase gene with susceptibility to acute leukemia].

    PubMed

    Zheng, Miao-miao; Yue, Li-jie; Zhang, Hong-hong; Yang, Chun-lan; Xie, Cai

    2013-08-01

    To assess whether polymorphisms of methylenetetrahydrofolate reductase (MTHFR) gene is associated with susceptibility to acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML) in Chinese Han children. The study has included 87 patients with ALL, 22 patients with AML and 120 healthy controls. All subjects were analyzed with reverse transcriptase-polymerase chain reaction-denaturing gradient gel electrophoresis and sequencing. A 677CT genotype of the MTHFR gene was associated with decreased risk of ALL (OR=0.23, 95%CI: 0.07-0.79). However, MTHFR A1298C genotypes were not associated with the risk of either disease. 677TT/1298AA and 677CC/1298AC genotypes were associated with increased risk of ALL(OR=3.78, 95% CI: 1.38-10.40; OR=3.17, 95% CI: 1.18-8.53, respectively), whereas the genotype 677CT/1298AA was associated with susceptibility to AML (OR=0.23, 95% CI: 0.06-0.97). Our data suggested that C677T polymorphism of MTHFR gene may increase the risk of childhood AML.

  5. Installation Restoration Program (IRP) Stage 3. McClellan Air Force Base. Operable Unit B. Preliminary Assessment Summary Report. Volume 3. Appendices C, D & E

    DTIC Science & Technology

    1991-10-01

    ks C-12 GATE 660 DUDLEY I 0S813OAO63SBO 111 UUOAISSITE 30 30SAP1 5 A N-N0SRADP19 FNC Q0A1 AAT 3AiO BANG WEB Ll SHALLOW A 3AS 62 AR1L AOIN07AP SCSAPO...SCALE I FEET CHI~AN LINK/SAAMED WIRE FENCE SA29 Figtrio C-GG. Mep o0F SA 29 and Vicinity. C-228 iOrM pOrN AT 1 0 j B. Activity/Area: BUILDING 677...ground water extraction system near Building 666. Furthermore, is a deep boring warranted at each location t4here shallow contamination is found? 3. Site

  6. The Trypanosoma cruzi Satellite DNA OligoC-TesT and Trypanosoma cruzi Kinetoplast DNA OligoC-TesT for Diagnosis of Chagas Disease: A Multi-cohort Comparative Evaluation Study

    PubMed Central

    De Winne, Koen; Büscher, Philippe; Luquetti, Alejandro O.; Tavares, Suelene B. N.; Oliveira, Rodrigo A.; Solari, Aldo; Zulantay, Ines; Apt, Werner; Diosque, Patricio; Monje Rumi, Mercedes; Gironès, Nuria; Fresno, Manuel; Lopez-Velez, Rogelio; Perez-Molina, José A.; Monge-Maillo, Begoña; Garcia, Lineth; Deborggraeve, Stijn

    2014-01-01

    Background The Trypanosoma cruzi satellite DNA (satDNA) OligoC-TesT is a standardised PCR format for diagnosis of Chagas disease. The sensitivity of the test is lower for discrete typing unit (DTU) TcI than for TcII-VI and the test has not been evaluated in chronic Chagas disease patients. Methodology/Principal Findings We developed a new prototype of the OligoC-TesT based on kinetoplast DNA (kDNA) detection. We evaluated the satDNA and kDNA OligoC-TesTs in a multi-cohort study with 187 chronic Chagas patients and 88 healthy endemic controls recruited in Argentina, Chile and Spain and 26 diseased non-endemic controls from D.R. Congo and Sudan. All specimens were tested in duplicate. The overall specificity in the controls was 99.1% (95% CI 95.2%–99.8%) for the satDNA OligoC-TesT and 97.4% (95% CI 92.6%–99.1%) for the kDNA OligoC-TesT. The overall sensitivity in the patients was 67.9% (95% CI 60.9%–74.2%) for the satDNA OligoC-TesT and 79.1% (95% CI 72.8%–84.4%) for the kDNA OligoC-Test. Conclusions/Significance Specificities of the two T. cruzi OligoC-TesT prototypes are high on non-endemic and endemic controls. Sensitivities are moderate but significantly (p = 0.0004) higher for the kDNA OligoC-TesT compared to the satDNA OligoC-TesT. PMID:24392177

  7. SU-E-T-677: Reproducibility of Production of Ionization Chambers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kukolowicz, P; Bulski, W; Ulkowski, P

    Purpose: To compare the reproducibility of the production of several cylindrical and plane-parallel chambers popular in Poland in terms of a calibration coefficient. Methods: The investigation was performed for PTW30013 (20 chambers), 30001 (10 chambers), FC65-G (17 chambers) cylindrical chambers and for PPC05 (14 chambers), Roos 34001 (8 chambers) plane parallel chambers. The calibration factors were measured at the same accredited secondary standard laboratory in terms of a dose to water. All the measurements were carried out at the same laboratory, by the same staff, in accordance with the same IAEA recommendations. All the chambers were calibrated in the Co60more » beam. Reproducibility was described in terms of the mean value, its standard deviation and the ratio of the maximum and minimum value of calibration factors for each set of chambers separately. The combined uncertainty budged (1SD) calculated according to the IAEA-TECDOC-1585 of the calibration factor was of 0.25%. Results: The calibration coefficients for PTW30013, 30001, and FC65-G chambers were 5.36±0.03, 5.28±0.06, 4.79±0.015 nC/Gy respectively and for PPC05, and Roos chambers were 59±2, 8.3±0.1 nC/Gy respectively. The maximum/minimum ratio of calibration factors for PTW30013, 30001, FC65-G, and for PPC05, Roos chambers were 1.03, 1.03, 1.01, 1.14 and 1.03 respectively. Conclusion: The production of all ion chambers was very reproducible except the Markus type PPC05 for which the ratio of maximum/minimum calibration coefficients of 1.14 was obtained.« less

  8. The single-nucleotide polymorphisms +936 C/T VEGF and -710 C/T VEGFR1 are associated with breast cancer protection in a Spanish population.

    PubMed

    Rodrigues, Patricia; Furriol, Jessica; Tormo, Eduardo; Ballester, Sandra; Lluch, Ana; Eroles, Pilar

    2012-06-01

    Vascular endothelial growth factor (VEGF) is a potent regulator of angiogenesis and thereby involved in the development and progression of solid tumours. The association between polymorphisms of angiogenesis pathway genes and risk of breast cancer (BC) has been widely studied, but the results are not conclusive. This information is especially limited in Spanish women, so we decided to conduct a case-control study. Here, we selected four commonly studied polymorphisms in VEGF, rs3025039 (known as +936 C/T), rs1109324, rs154765 and rs833052, one polymorphism at the promoter of the VEGFR1 (-710 C/T) and another in the FGF2, rs1449683, gene to explore their association with BC susceptibility. Genotyping was performed by TaqMan SNP assays and polymerase chain reaction-restriction fragment length polymorphis (PCR-RFLP) on 453 patients and 461 controls in a population from Valencia (Spain). We observed that women carriers of +936 CT + TT VEGF genotypes have a protective effect concerning this disease (p = 0.014; OR 0.67, 95% CI 0.48-0.92) in the global group of patients. The haplotype TGAC of VEGF (rs3025039, rs1109324, rs154764 and rs833052) shows a reduction of the risk to develop BC (p = 3e-04; OR 0.48, 95% CI 0.32-0.72). Furthermore, we found that carriers of -710 CT + TT VEGFR1 genotypes have also a protective effect (p = 0.039; OR 0.55, 95% CI 0.31-0.98). When we stratified by groups of ages these associations were maintained. Our data report for the first time the association of the polymorphism -710 C/T VEGFR1 with BC. Additional experiments focused on VEGF-A, VEGFR1 and sVEGFR1 gene expression demonstrated that carriers of T allele at -710 C/T VEGFR1 genotype have higher levels of sVEGFR1/VEGF-A than the C/C genotype carriers. This was consistent with the hypothesis that this polymorphism may act as low penetrance risk factor. The data provided suggest that +936 C/T VEGF and -710 C/T VEGFR1 genotypes are likely important genetic markers of susceptibility to BC.

  9. T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis.

    PubMed

    Valdivieso, Paola; Toigo, Marco; Hoppeler, Hans; Flück, Martin

    2017-01-01

    Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise.

  10. Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

    PubMed Central

    Pilch, D S; Brousseau, R; Shafer, R H

    1990-01-01

    We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

  11. Inherited Thrombophilias Could Influence the Reproductive Outcome in Women with Systemic Lupus Erythematosus.

    PubMed

    Robeva, R; Tanev, D; Andonova, S; Nikolova, M; Tomova, A; Kumanov, Ph; Savov, A; Rashkov, R; Kolarov, Zl

    2017-06-30

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease associated with different reproductive complications in the affected women. Inherited thrombophilias are genetic factors increasing the risk for thromboembolism and recurrent pregnancy loss, but their influence on other reproductive disturbances in SLE patients has not been completely clarified. Two hundred and twenty-three Caucasian women (112 with SLE and 111 controls) were included in the study. Complete reproductive history of all SLE patients was carefully obtained. Genotyping for the FV Leiden , FII G20210A , and MTHFR C677T polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. No significant differences in the prevalence of the FV Leiden , FII G20210A , and MTHFR C677T polymorphisms between patients and controls were established. Patients with FV Leiden had fewer pregnancies (0.57 ± 0.98 vs . 2.18 ± 1.58; p = 0.007) than the others, while no significant differences in the reproductive history of FII G20210A carriers and non-carriers were observed ( p >0.05). In the SLE group, 41.67% of women with the MTHFR C677T TT genotype had at least one miscarriage in comparison to only 14.00% of the other female patients ( p = 0.030). While the prevalence of the investigated thrombophilias was similar in patients with SLE and healthy women, a substantial influence of the inherited prothrombotic factors on the reproductive history of patients was revealed. The investigations of the FV Leiden and MTHFR C677T polymorphisms in SLE patients could help to identify women at highest risk for reproductive failure and thus, further studies in other ethnic groups would be of strong clinical importance.

  12. High circulating folate and vitamin B-12 concentrations in women during pregnancy are associated with increased prevalence of atopic dermatitis in their offspring.

    PubMed

    Kiefte-de Jong, Jessica C; Timmermans, Sarah; Jaddoe, Vincent W V; Hofman, Albert; Tiemeier, Henning; Steegers, Eric A; de Jongste, Johan C; Moll, Henriette A

    2012-04-01

    Recent studies suggest that in utero exposure of methyl donors influences programming of the fetal immune system in favor of development of allergic disease. The aim of this study was to assess whether the MTHFR C677T polymorphism, folic acid supplementation, and circulating folate and vitamin B-12 concentrations during pregnancy were associated with wheezing, shortness of breath, and atopic dermatitis in offspring. The study was a population-based birth cohort from fetal life until 48 mo (n = 8742). The use of folic acid supplementation during pregnancy was assessed by questionnaire. Plasma folate and serum vitamin B-12 concentrations and the MTHFR C677T polymorphism were available from blood collected in early pregnancy. Atopic dermatitis, wheezing, and shortness of breath in the offspring were assessed by parental-derived questionnaires at 12, 24, 36, and 48 mo. Maternal folate >16.2 nmol/L and vitamin B-12 >178 pmol/L were positively associated with the development of atopic dermatitis [adjusted OR: 1.18 (95% CI: 1.05-1.33) and adjusted OR: 1.30 (95% CI: 1.06-1.60) for the highest quartiles of folate and vitamin B-12 concentrations, respectively] but not with wheezing and shortness of breath. Maternal MTHFR C677T polymorphism and folic acid supplementation were not associated with wheezing, shortness of breath, and atopic dermatitis. No interactions were found by age, family history of atopy, folic acid supplementation, MTHFR C677T polymorphism, or maternal smoking (P-interaction > 0.10). High folate and vitamin B-12 levels during pregnancy are associated with increased prevalence of atopic dermatitis in the offspring. Potential risks of high folate and vitamin B-12 concentrations on allergic outcomes should be evaluated when discussing mandatory fortification programs.

  13. Positive association of the hepatic lipase gene polymorphism c.514C > T with estrogen replacement therapy response

    PubMed Central

    2011-01-01

    Background Hepatic lipase (HL), an enzyme present in the hepatic sinusoids, is responsible for the lipolysis of lipoproteins. Human HL contains four polymorphic sites: G-250A, T-710C, A-763G, and C-514T single-nucleotide polymorphism (SNPs). The last polymorphism is the focus of the current study. The genotypes associated with the C-514T polymorphism are CC (normal homozygous - W), CT (heterozygous - H), and TT (minor-allele homozygous - M). HL activity is significantly impaired in individuals of the TT and CT genotypes. A total of 58 post-menopausal women were studied. The subjects were hysterectomized women receiving hormone replacement therapy consisting of 0.625 mg of conjugated equine estrogen once a day. The inclusion criteria were menopause of up to three years and normal blood tests, radiographs, cervical-vaginal cytology, and densitometry. DNA was extracted from the buccal and blood cells of all 58 patients using a commercially available kit (GFX® - Amersham-Pharmacia, USA). Results Statistically significant reductions in triglycerides (t = 2.16; n = 58; p = 0.03) but not in total cholesterol (t = 0.14; n = 58; p = 0.89) were found after treatment. This group of good responders were carriers of the T allele; the CT and TT genotypes were present significantly more frequently than in the group of non-responders (p = 0.02 or p = 0.07, respectively). However, no significant difference in HDL-C (t = 0.94; n = 58; p = 0.35) or LDL-C (t = -0.83; n = 58; p = 0.41) was found in these patients. Conclusions The variation in lipid profile associated with the C-514T polymorphism is significant, and the T allele is associated with the best response to ERT. PMID:22047520

  14. Estimation of ground and excited state dipole moment of laser dyes C504T and C521T using solvatochromic shifts of absorption and fluorescence spectra.

    PubMed

    Basavaraja, Jana; Suresh Kumar, H M; Inamdar, S R; Wari, M N

    2016-02-05

    The absorption and fluorescence spectra of laser dyes: coumarin 504T (C504T) and coumarin 521T (C521T) have been recorded at room temperature in a series of non-polar and polar solvents. The spectra of these dyes showed bathochromic shift with increasing in solvent polarity indicating the involvement of π→π⁎ transition. Kamlet-Taft and Catalan solvent parameters were used to analyze the effect of solvents on C504T and C521T molecules. The study reveals that both general solute-solvent interactions and specific interactions are operative in these two systems. The ground state dipole moment was estimated using Guggenheim's method and also by quantum mechanical calculations. The solvatochromic data were used to determine the excited state dipole moment (μ(e)). It is observed that dipole moment value of excited state (μ(e)) is higher than that of the ground state in both the laser dyes indicating that these dyes are more polar in nature in the excited state than in the ground state. Copyright © 2015. Published by Elsevier B.V.

  15. Oxygen stabilization induced enhancement in J(sub c) and T(sub c) of superconducting oxides

    NASA Technical Reports Server (NTRS)

    Wu, M. K.; Chen, J. T.; Huang, C. Y.

    1990-01-01

    In an attempt to enhance the electrical and mechanical properties of the high temperature superconducting oxides, high T(sub c) composites were prepared composed of the 123 compounds and AgO. The presence of extra oxygen due to the decomposition of AgO at high temperature is found to stabilize the superconducting 123 phase. Ag is found to serve as clean flux for grain growth and precipitates as pinning center. Consequently, almost two orders of magnitude enhancement in critical current densities were also observed in these composites. In addition, these composites also show much improvement in workability and shape formation. On the other hand, proper oxygen treatment of Y5Ba6Cu11Oy was found to possibly stabilize superconducting phase with T(sub c) near 250 K. I-V, ac susceptibility, and electrical resistivity measurements indicate the existence of this ultra high T(sub c) phase in this compound. Detailed structure, microstructure, electrical, magnetic and thermal studies of the superconducting composites and the ultra high T(sub c) compound are presented and discussed.

  16. Plasma Homocysteine, Serum Folic Acid, Serum Vitamin B12, Serum Vitamin B6, MTHFR, and Risk of Normal-Tension Glaucoma.

    PubMed

    Li, Jinmiao; Xu, Fan; Zeng, Rui; Gong, Haijun; Lan, Yuqing

    2016-02-01

    This meta-analysis aims to comprehensively evaluate the association between total homocysteine (tHcy) levels, serum folic acid, vitamin B12, vitamin B6 levels, methylenetetrahydrofolate reductase (MTHFR) C677T genotype, and risk of normal-tension glaucoma (NTG). A systematic search of the EMBASE and PubMed databases was performed to evaluate plasma tHcy levels, serum folic acid, B vitamins' mean difference, and odds ratios of MTHFR C677T genotype between cases and controls. A total of 7 studies including 458 cases and 555 controls meeting the inclusion criteria were involved in this meta-analysis. There were 4 studies for tHcy (149 cases and 148 controls), 2 studies for vitamin B6, vitamin B12, and folate (90 cases and 82 controls), and 4 studies for MTHFR (343 cases and 449 controls). Overall, the mean plasma tHcy levels, serum folic acids, vitamin B12, and vitamin B6 levels were 1.16 μmol/L [95% confidence interval (CI), -0.13, 2.45], -0.62 μmol/L (95% CI, -1.98, 0.74), 5.81 μmol/L (95% CI, -3.53, 15.14), and -16.79 μmol/L (95% CI, -86.09, 52.51). MTHFR TT genotype was found to be unrelated to NTG risk (odds ratio=1.08; 95% CI, 0.69, 1.69). NTG is not associated with elevated plasma tHcy, serum folic acid, serum vitamin B12, serum vitamin B6, and MTHFR C677T genotype.

  17. VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

    PubMed Central

    Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

    2001-01-01

    BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and

  18. Association between MTHFR variant and diabetic neuropathy.

    PubMed

    Kakavand Hamidi, Armita; Radfar, Mania; Amoli, Mahsa M

    2018-02-01

    Methylene-tetrahydrofolate reductase (MTHFR) gene variant may play an important role in the pathophysiology of diabetes and its complications due to its influence on plasma homocysteine levels and also its effect on scavenging peroxynitrite radicals. Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. The aim of this study was to investigate the relationship between diabetic neuropathy and MTHFR gene C677T and 1298A ⁄C polymorphisms. Patients with type 2 diabetes N=248 were enrolled in the study, consisting of patients with neuropathy (N=141) and patients without neuropathy (N=107). MTHFR C677T polymorphism was analyzed using polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) of genomic DNA for genotyping of samples. 1298A/C polymorphism was evaluated using ARMS-PCR. There was a significant difference in MTHFR polymorphism between the groups with and without neuropathy. Our results suggest that MTHFR 677 variant confer risk for diabetic neuropathy among Iranian patients with type 2 diabetes. Copyright © 2017 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier B.V. All rights reserved.

  19. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    PubMed

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  20. T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis

    PubMed Central

    Toigo, Marco; Hoppeler, Hans

    2017-01-01

    Background Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Methods Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Results Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Conclusion Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise. PMID:28384286

  1. The effect of Na+/taurocholate cotransporting polypeptide (NTCP) c.800C > T polymorphism on rosuvastatin pharmacokinetics in Chinese healthy males.

    PubMed

    Lou, Xiao-Ya; Zhang, Wei; Wang, Guo; Hu, Dong-Li; Guo, Dong; Tan, Zhi-Rong; Zhou, Hong-Hao; Chen, Yao; Bao, Hei-Hua

    2014-10-01

    This study was designed to investigate the potential association between NTCP c.800C >T polymorphism and rosuvastatin pharmacokinetics in Chinese healthy males. 305 individuals were enrolled to identify NTCP c.800C > T, OATP1B1 c.521T > C and BCRP c.421C > A genotypes by direct sequencing and pyrosequencing methods, respectively. 17 healthy volunteers who were OATP1B1 c.521TT and BCRP c.421CC wild-type homozygotes with different NTCP c.800C > T genotype were selected to participate in this pharmacokinetic study. Nine were NTCP c.800CC wild-type homozygotes and the other eight subjects were carriers with at least one c.800T variant allele (seven subjects with c.800CT genotype and one was homozygote of c.800TT). All the subjects received a single oral dose of 10 mg rosuvastatin. The plasma concentrations of rosuvastatin were measured up to 72 h by a LC-MS method. NTCP c.800C > T genetic polymorphism markedly effected rosuvastatin pharmacokinetics. The AUC(o-72) and AUC(0 --> ∞) in subjects with NTCP c.800CT + TT genotype were 56% (162.64 ± 37.55 vs. 103.99 ± 28.15 ng x h/ml, P = 0.016) and 57% greater (178.51 ± 42.75 vs. 113.60 ± 33.73 ng x h/ml, P = 0.020) than those in the c.800CC wild-type subjects, respectively. In the c.800CT + TT mutant group, the C(max) was about 78% higher than those in c.800CC genotype (14.31 ± 3.63 vs. 8.04 ± 1.72 ng x h/ml, P = 0.004). The oral clearance (CL/F) of rosuvastatin in subjects with the c.800CT+TT genotype was only 63% of those in the c.800CC genotype (58.32 ± 12.16 vs. 93.04 ± 20.61 ng x h/ml, P = 0.009). The half-time (T1/2) and the T(max) had no significant difference between two groups (p = 0.466 and 0.713, respectively). NTCP c.800C > T polymorphism play a critical role in the individual variability of rosuvastatin pharmacokinetics in Chinese healthy males after excluding the impact of OATP1B1 c.521T > C and BCRP c.421C > A polymorphisms.

  2. c-Abl-Mediated Tyrosine Phosphorylation of the T-bet DNA-Binding Domain Regulates CD4+ T-Cell Differentiation and Allergic Lung Inflammation ▿

    PubMed Central

    Chen, An; Lee, Sang-Myeong; Gao, Beixue; Shannon, Stephen; Zhu, Zhou; Fang, Deyu

    2011-01-01

    The tyrosine kinase c-Abl is required for full activation of T cells, while its role in T-cell differentiation has not been characterized. We report that c-Abl deficiency skews CD4+ T cells to type 2 helper T cell (Th2) differentiation, and c-Abl−/− mice are more susceptible to allergic lung inflammation. c-Abl interacts with and phosphorylates T-bet, a Th1 lineage transcription factor. c-Abl-mediated phosphorylation enhances the transcriptional activation of T-bet. Interestingly, three tyrosine residues within the T-bet DNA-binding domain are the predominant sites of phosphorylation by c-Abl. Mutation of these tyrosine residues inhibits the promoter DNA-binding activity of T-bet. c-Abl regulates Th cell differentiation in a T-bet-dependent manner because genetic deletion of T-bet in CD4+ T cells abolishes c-Abl-deficiency-mediated enhancement of Th2 differentiation. Reintroduction of T-bet-null CD4+ T cells with wild-type T-bet, but not its tyrosine mutant, rescues gamma interferon (IFN-γ) production and inhibits Th2 cytokine production. Therefore, c-Abl catalyzes tyrosine phosphorylation of the DNA-binding domain of T-bet to regulate CD4+ T cell differentiation. PMID:21690296

  3. Methylenetetrahydrofolate reductase polymorphisms, serum methylenetetrahydrofolate reductase levels, and risk of childhood acute lymphoblastic leukemia in a Chinese population.

    PubMed

    Tong, Na; Fang, Yongjun; Li, Jie; Wang, Meilin; Lu, Qin; Wang, Shizhi; Tian, Yuanyuan; Rong, Liucheng; Sun, Jielin; Xu, Jianfeng; Zhang, Zhengdong

    2010-03-01

    Methylenetetrahydrofolate reductase (MTHFR), involved in DNA methylation and nucleotide synthesis, is thought to be associated with a decreased risk of adult and childhood acute lymphoblastic leukemia (ALL). Accumulating evidence has indicated that two common genetic variants, C677T and A1298C, are associated with cancer risk. We hypothesized that these two variants were associated with childhood ALL susceptibility and influence serum MTHFR levels. We genotyped these two polymorphisms and detected MTHFR levels in a case-control study of 361 cases and 508 controls. Compared with the 677CC and 677CC/CT genotypes, the 677TT genotype was associated with a statistically significantly decreased risk of childhood ALL (odds ratio = 0.53, 95% confidence interval = 0.32-0.88, and odds ratio = 0.55, 95% confidence interval = 0.35-0.88, respectively). In addition, a pronounced reduced risk of ALL was observed among low-risk ALL and B-phenotype ALL. Moreover, the mean serum MTHFR level was 8.01 ng/mL (+/-4.38) in cases and 9.27 ng/mL (+/-4.80) in controls (P < 0.001). MTHFR levels in subjects with 677TT genotype was significantly higher than those with 677CC genotype (P = 0.010) or 677CT genotype (P = 0.043) in controls. In conclusion, our results provide evidence that the MTHFR polymorphisms might contribute to reduced childhood ALL risk in this population.

  4. Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek women.

    PubMed

    Chatzidimitriou, M; Chatzidimitriou, D; Mavridou, M; Anetakis, C; Chatzopoulou, F; Lialiaris, T; Mitka, S

    2017-12-01

    Recurrent pregnancy loss (RPL) is a multifactorial disorder. The aim of this study was the detection of various genetic polymorphisms and their correlation to RPL, in Greek women. The impact of 12 thrombophilic polymorphisms was evaluated, among 48 Greek women with a history of RPL, vs 27 healthy parous women. Multiplex PCR and in situ hybridization on nitrocellulose films were performed, to investigate 12 genetic polymorphisms previously reported as risk factors for RPL. Heterozygous FV Leiden, homozygous PAI-1 4G/4G, heterozygous MTHFR C677T, homozygous MTHFR A1298C, as much as the combined thrombophilic genotypes MTHFR 677T + ACE Ι/D, MTHFR 677T/1298C + ACE D/D, ACE I/D + b-fibrinogen -455 G/A, FV HR2 + b-fibrinogen -455 G/A showed a correlation as risk factors for RPL, whereas the rest of the investigated polymorphisms and their combinations did not render statistically significant differences between the two groups in study. The results of this study, as well as those of similar studies, concerning the detection of genetic, environmental, and physiological factors underlying RPL, will prove of critical significance in the investigation and treatment of thrombophilic predisposition, in cases of RPL. © 2017 John Wiley & Sons Ltd.

  5. The Transforming Growth Factor-β1 (TGF-β1) Gene Polymorphisms (TGF-β1 T869C and TGF-β1 T29C) and Susceptibility to Postmenopausal Osteoporosis

    PubMed Central

    Sun, Jiajia; Zhang, Chi; Xu, Lei; Yang, Mingyuan; Yang, Huilin

    2015-01-01

    Abstract The aim of the present study was to integrate all the eligible studies and investigate whether the transforming growth factor-β1 (TGF-β1) gene polymorphisms (TGF-β1 T869C and TGF-β1 T29C) are correlated with postmenopausal osteoporosis (PMOP) risk. PMOP is a common skeletal disease and several genetic factors play an important role in the development and progression of PMOP. Significant associations between TGF-β1 gene polymorphisms (TGF-β1 T869C and TGF-β1 T29C) and PMOP risk have been reported; however, some of these results are controversial. A systematic online search was performed using PubMed, EMBASE, Web of Science, and the Cochrane Library to identify case–control studies investigating the relationship between TGF-β1 T869C and TGF-β1 T29C polymorphisms and the susceptibility of PMOP. The pooled odds ratio (OR) with 95% confidence interval (95% CI) was calculated to assess the associations, and subgroup meta-analyses were performed according to the ethnicity of the study populations. Eight studies involving 1851 cases and 2247 controls met the inclusion criteria after assessment by 2 reviewers. Overall, there were significant associations between TGF-β1 T869C and TGF-β1 T29C polymorphisms and PMOP (TGF-β1 T869C—C vs T: OR = 1.18, 95% CI = 1.02–1.36, P = 0.030; CC vs TT: OR = 1.38, 95% CI = 1.01–1.88, P = 0.042; CC vs CT/TT: OR = 1.39, 95% CI = 1.09–1.76, P = 0.008; TGF-β1 T29C—CT vs TT: OR = 1.25, 95% CI = 1.02–1.53, P = 0.032; CT/CC vs TT: OR = 1.37, 95% CI = 1.02–1.84, P = 0.035). In the subgroup analysis of ethnicity, significant association was observed between TGF-β1 T869C polymorphism and PMOP risk in Asian population (C vs T: OR = 1.18, 95% CI = 1.01–1.38, P = 0.043; CC vs TT: OR = 1.41, 95% CI = 1.01–1.97, P = 0.047; CT/CC vs TT: OR = 1.31, 95% CI = 1.03–1.66, P = 0.026; CC vs CT/TT: OR = 1.35, 95% CI

  6. T lymphocyte mediated lysis of mitomycin C treated Tenon’s capsule fibroblasts

    PubMed Central

    Crowston, J G; Chang, L H; Daniels, J T; Khaw, P T; Akbar, A N

    2004-01-01

    Aims: To evaluate the effect of T cell co-culture on mitomycin C treated and untreated Tenon’s capsule fibroblasts. Methods: IL-2 dependent allogeneic T cells were incubated over a monolayer of mitomycin C treated or control fibroblasts. Fibroblast numbers were evaluated by direct counts using phase contrast microscopy. To determine whether T cell mediated lysis was a consequence of MHC mismatch, co-culture experiments were repeated with autologous T cells. The effect of Fas receptor blockade was established by co-incubation with a Fas blocking (M3) antibody. Results: T cell co-culture resulted in a dramatic reduction in fibroblast survival compared to mitomycin C treatment alone (p = 0.032). T cell killing required fibroblast/lymphocyte cell to cell contact and was observed in both allogeneic and autologous co-culture experiments. Fas blocking antibodies did not significantly inhibit T cell killing (p = 0.39). Conclusion: T cells augment mitomycin C treated fibroblast death in vitro. Similar mechanisms may contribute to the cytotoxic effect of mitomycin C in vivo and account for the largely hypocellular drainage blebs that are observed clinically. PMID:14977777

  7. Identification and association of the single nucleotide polymorphisms, C-509T, C+466T and T+869C, of the TGF-β1 gene in patients with asthma and their influence on the mRNA expression level of TGF-β1.

    PubMed

    Panek, Michał; Pietras, Tadeusz; Fabijan, Artur; Zioło, Jan; Wieteska, Lukasz; Małachowska, Beata; Fendler, Wojciech; Szemraj, Janusz; Kuna, Piotr

    2014-10-01

    Transforming growth factor-β1 (TGF-β1) is an important fibrogenic and immunomodulatory cytokine participating in the pathogenesis of a number of illnesses related to the growth, differentiation and migration of cells. It also plays a key role in inflammation, atherosclerosis, vascular inflammation and asthma. The aim of the present study was to evaluate the association between the expression of the TGF-β1 gene and its genetic polymorphisms, and the disease phenotype. The study comprised 173 patients with asthma, as well as 163 healthy volunteers as a control group. The gender profiles of the groups were similar (p=0.8415). Genotyping was performed by polymerase chain reaction (PCR)-high resolution melting (HRM). The results were verified by sequencing. Gene expression was evaluated by RT-PCR. This study evaluated the role and frequency of genetic polymorphisms (C-509T, C+466T and T+869C) of the TGF-β1 gene in the study group (patients with asthma) and the control group (healthy volunteers). The results obtained for the patients and healthy controls were as follows: C-509T single nucleotide polymorphism (SNP) (controls, TT/CT/CC-0.4444/0.5309/0.0247; patients, TT/CT/CC-0.3699/0.6012/0.0289), C+466T SNP (controls, TT/CT/CC-1.000/0.000/0.000; patients, TT/CT/CC-1.000/0.000/0.000) and T+869C SNP (controls, TT/CT/CC-1.000/0.000/0.000; patients, TT/CT/CC-1.000/0.000/0.000). Only the C-509T polymorphism was found to play a significant role in the pathogenesis of asthma, as well as a risk factor in the loss of the clinical control of the disease [TT vs. CC/CT, odds ratio (OR) 2.38; confidence interval (CI) 1.22-4.66; p=0.0103]. A significant difference was noted between the study and control groups with regard to the mRNA expression of TGF-β1 (p=0.0133). A higher level of expression of the TGF-β1 gene correlated with the time of diagnosis of patients over 16 years of age (p=0.0255). This study demonstrates that the C-509T SNP is a significant clinical risk factor for

  8. Genetic Variation of Methylenetetrahydrofolate Reductase (MTHFR) and Thymidylate Synthase (TS) Genes Is Associated with Idiopathic Recurrent Implantation Failure.

    PubMed

    Choi, Youngsok; Kim, Jung Oh; Shim, Sung Han; Lee, Yubin; Kim, Ji Hyang; Jeon, Young Joo; Ko, Jung Jae; Lee, Woo Sik; Kim, Nam Keun

    2016-01-01

    The one-carbon metabolism pathway disorder was important role in successful pregnancy. The MTHFR and TS protein were crucial factor in one-carbon metabolism. To investigate the association between recurrent implantation failure (RIF) and enzymes in the one-carbon metabolism pathway. A total of 120 women diagnosed with RIF and 125 control subjects were genotyped for MTHFR 677C>T, 1298A>C, TSER 2R/3R and TS 1494del/ins by a polymerase chain reaction-restriction fragment length polymorphism assay. According to the gene-gene combination analysis, the MTHFR 677/MTHFR 1298 (TT/AA) and MTHFR 677/TS 1494 (TT/6bp6bp) genetic combinations were associated with relatively higher risks [adjusted odds ratio (AOR), 2.764; 95% CI, 1.065-7.174; P = 0.037 and AOR, 3.186; 95% CI, 1.241-8.178; P = 0.016] in RIF patients compared to the CC/AA (MTHFR 677/MTHFR 1298) and TT/6bp6bp (MTHFR 677/TS 1494) combinations, respectively. The results suggested that the combined MTHFR 677/MTHFR 1298 genotype might be associated with increased risk of RIF. To the best of our knowledge, this study is the first to elucidate the potential association of MTHFR, TS and TSER polymorphisms with RIF risk in Korean patients.

  9. Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

    PubMed

    An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

    2015-06-01

    Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Biosynthesis of t-anethole in anise: characterization of t-anol/isoeugenol synthase and an O-methyltransferase specific for a C7-C8 propenyl side chain.

    PubMed

    Koeduka, Takao; Baiga, Thomas J; Noel, Joseph P; Pichersky, Eran

    2009-01-01

    The phenylpropene t-anethole imparts the characteristic sweet aroma of anise (Pimpinella anisum, family Apiaceae) seeds and leaves. Here we report that the aerial parts of the anise plant accumulate t-anethole as the plant matures, with the highest levels of t-anethole found in fruits. Although the anise plant is covered with trichomes, t-anethole accumulates inside the leaves and not in the trichomes or the epidermal cell layer. We have obtained anise cDNA encoding t-anol/isoeugenol synthase 1 (AIS1), an NADPH-dependent enzyme that can biosynthesize t-anol and isoeugenol (the latter not found in anise) from coumaryl acetate and coniferyl acetate, respectively. In addition, we have obtained a cDNA encoding S-[methyl-14C]adenosyl-l-methionine:t-anol/isoeugenol O-methyltransferase 1 (AIMT1), an enzyme that can convert t-anol or isoeugenol to t-anethole or methylisoeugenol, respectively, via methylation of the para-OH group. The genes encoding AIS1 and AIMT1 were expressed throughout the plant and their transcript levels were highest in developing fruits. The AIS1 protein is 59% identical to petunia (Petunia hybrida) isoeugenol synthase 1 and displays apparent Km values of 145 microm for coumaryl acetate and 230 microm for coniferyl acetate. AIMT1 prefers isoeugenol to t-anol by a factor of 2, with Km values of 19.3 microm for isoeugenol and 54.5 microm for S-[methyl-14C]adenosyl-l-methionine. The AIMT1 protein sequence is approximately 40% identical to basil (Ocimum basilicum) and Clarkia breweri phenylpropene O-methyltransferases, but unlike these enzymes, which do not show large discrimination between substrates with isomeric propenyl side chains, AIMT1 shows a 10-fold preference for t-anol over chavicol and for isoeugenol over eugenol.

  11. mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Chengye; Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091; Graduate University of the Chinese Academy of Sciences, Beijing 100039

    2006-09-22

    Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To testmore » this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL.« less

  12. Prognostic impact of KRAS mutation subtypes in 677 patients with metastatic lung adenocarcinomas

    PubMed Central

    Yu, Helena A.; Sima, Camelia S.; Shen, Ronglai; Kass, Samantha; Gainor, Justin; Shaw, Alice; Hames, Megan; Iams, Wade; Aston, Jonathan; Lovly, Christine M.; Horn, Leora; Lydon, Christine; Oxnard, Geoffrey R.; Kris, Mark G.; Ladanyi, Marc; Riely, Gregory J.

    2015-01-01

    Background We previously demonstrated that patients with metastatic KRAS mutant lung cancers have a shorter survival compared to patients with KRAS wild type cancers. Recent reports have suggested different clinical outcomes and distinct activated signaling pathways depending on KRAS mutation subtype. To better understand the impact of KRAS mutation subtype, we analyzed data from 677 patients with KRAS mutant metastatic lung cancer. Methods We reviewed all patients with metastatic or recurrent lung cancers found to have KRAS mutations over a 6 year time period. We evaluated the associations between KRAS mutation type, clinical factors, and overall survival in univariate and multivariate analyses. Any significant findings were validated in an external multi-institution patient data set. Results Among 677 patients with KRAS mutant lung cancers (53 at codon 13, 624 at codon 12), there was no difference in overall survival for patients when comparing KRAS transition versus transversion mutations (p=0.99), smoking status (p=0.33) or when comparing specific amino acid substitutions (p=0.20). In our data set, patients with KRAS codon 13 mutant tumors (n=53) had shorter overall survival compared to patients with codon 12 mutant tumors (n=624)( 1.1 vs 1.3 years, respectively, p=0.009), and the findings were confirmed in a multivariate Cox model controlling for age, sex and smoking status (HR 1.52 95% CI 1.11-2.08, p=0.008). In an independent validation set of tumors from 682 patients with stage IV KRAS mutant lung cancers, there was no difference in survival between patients with KRAS codon 13 versus codon 12 mutations (1.0 vs 1.1 years respectively, p=0.41). Conclusions Among individuals with KRAS mutant metastatic lung cancers treated with conventional therapy, there are apparent differences in outcome based on KRAS mutation subtype PMID:25415430

  13. Olanzapine-induced weight gain is associated with the -759C/T and -697G/C polymorphisms of the HTR2C gene.

    PubMed

    Godlewska, B R; Olajossy-Hilkesberger, L; Ciwoniuk, M; Olajossy, M; Marmurowska-Michałowska, H; Limon, J; Landowski, J

    2009-08-01

    Weight gain, a serious problem associated with some antipsychotic drugs, notably olanzapine and clozapine, was suggested to be associated with -759C/T polymorphism of the 5-HT2C receptor gene. This study aimed to examine a potential association of two functional polymorphisms of the promoter region of this gene: -759C/T (rs3813929) and -697G/C (rs518147), with weight gain after 6 weeks of olanzapine monotherapy. It included 107 patients with schizophrenia; among them 36 are first-episode drug-naive patients. Analysis was carried out by PCR-restriction fragment length polymorphism. A protective effect of -759T and -697C alleles was found: significantly less patients with -697C (3/51) and no patient with -759T (0/28) alleles experienced body mass index increase >or=10% (P=0.0006 and 0.002, respectively). The same was true for drug-naive patients possessing any of the variant alleles. There was a significant association of haplotypes with a >or=10% body mass index increase (P=0.001). On the basis of the additional statistical analysis, the more important role of -697C allele was suggested.

  14. PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q, and Prothrombin 20210A in Splanchnic Vein Thrombosis: Analysis of Individual Patient Data From Three Prospective Studies

    PubMed Central

    Pasta, Linda; Pasta, Francesca; D’Amico, Mario

    2016-01-01

    Background There are no univocal opinions on the role of genetic thrombophilia on splanchnic vein thrombosis (SVT). We defined genetic thrombophilia the presence of one of these thrombophilic genetic factors (THRGFs): PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q, and prothrombin 20210A. Objectives To evaluate the frequencies of these THRGFs in SVT patients, we analyzed individual data of 482 Caucasian patients, recruited from 2000 to 2014 in three prospective studies. SVT was defined as the presence of thrombosis of portal (PVT), mesenteric (MVT), splenic (SPVT), cava (CT), and hepatic vein (Budd Chiari syndrome, BCS). Pre-hepatic SVT (pre-HSVT) was defined as PVT with or without MVT/SPVT, without BCS. Post-hepatic SVT (post-HSVT) was BCS with or without PVT/MVT/SPVT. Methods We compared 350 patients with liver cirrhosis (LC), 47 hepatocellular carcinoma (HCC), 37 myeloproliferative neoplasm (MPN), 38 associated disease (AD), 10 without any associated disease (WAD), vs 150 healthy controls (HC); 437 patients showed pre-HSVT and 45 post-HSVT. Results Thrombophilia was present in 294/482 (60.9%) patients: 189/350 LC (54.0%), 31/47 (66.0%) HCC, 29/39 (74.4%) MPN, 35/38 AD (92.1%), and 10/10 (100%) WAD, and 54/150 (36.0%) in HC. In the total group, we found 175 PAI-1 4G-4G, 130 MTHFR 677TT, 42V Leiden 506Q, and 27 prothrombin 20210A; 75 patients showed presence of >1 TRHGF; the more frequent association was PAI-1 4G-4G/MTHFR 677TT, in 36 patients. PAI-1 4G-4G and MTHFR 677TT were significantly more frequent in patients with SVT (P values <0.005), whereas V Leiden Q506 and prothrombin G20210A were not. PAI-1 4G-4G and MTHFR 677TT distributions deviated significantly from that expected from a population in Hardy–Weinberg equilibrium. Thrombophilia was significantly less frequent in patients with pre-HSVT (250/437, 57.2%) than in patients with post-HSVT (44/45, 97.8%). Conclusions Our study shows the significant prevalence of PAI-1 4G-4G and MTHFR 677TT in SVT, mainly in

  15. Depletion of Saccharomyces cerevisiae tRNAHis Guanylyltransferase Thg1p Leads to Uncharged tRNAHis with Additional m5C

    PubMed Central

    Gu, Weifeng; Hurto, Rebecca L.; Hopper, Anita K.; Grayhack, Elizabeth J.; Phizicky, Eric M.

    2005-01-01

    The essential Saccharomyces cerevisiae tRNAHis guanylyltransferase (Thg1p) is responsible for the unusual G−1 addition to the 5′ end of cytoplasmic tRNAHis. We report here that tRNAHis from Thg1p-depleted cells is uncharged, although histidyl tRNA synthetase is active and the 3′ end of the tRNA is intact, suggesting that G−1 is a critical determinant for aminoacylation of tRNAHis in vivo. Thg1p depletion leads to activation of the GCN4 pathway, most, but not all, of which is Gcn2p dependent, and to the accumulation of tRNAHis in the nucleus. Surprisingly, tRNAHis in Thg1p-depleted cells accumulates additional m5C modifications, which are delayed relative to the loss of G−1 and aminoacylation. The additional modification is likely due to tRNA m5C methyltransferase Trm4p. We developed a new method to map m5C residues in RNA and localized the additional m5C to positions 48 and 50. This is the first documented example of the accumulation of additional modifications in a eukaryotic tRNA species. PMID:16135808

  16. cFLIP overexpression in T cells in thymoma-associated myasthenia gravis

    PubMed Central

    Belharazem, Djeda; Schalke, Berthold; Gold, Ralf; Nix, Wilfred; Vitacolonna, Mario; Hohenberger, Peter; Roessner, Eric; Schulze, Torsten J; Saruhan-Direskeneli, Güher; Yilmaz, Vuslat; Ott, German; Ströbel, Philipp; Marx, Alexander

    2015-01-01

    Objective The capacity of thymomas to generate mature CD4+ effector T cells from immature precursors inside the tumor and export them to the blood is associated with thymoma-associated myasthenia gravis (TAMG). Why TAMG(+) thymomas generate and export more mature CD4+ T cells than MG(−) thymomas is unknown. Methods Unfixed thymoma tissue, thymocytes derived thereof, peripheral blood mononuclear cells (PBMCs), T-cell subsets and B cells were analysed using qRT-PCR and western blotting. Survival of PBMCs was measured by MTT assay. FAS-mediated apoptosis in PBMCs was quantified by flow cytometry. NF-κB in PBMCs was inhibited by the NF-κB-Inhibitor, EF24 prior to FAS-Ligand (FASLG) treatment for apoptosis induction. Results Expression levels of the apoptosis inhibitor cellular FLICE-like inhibitory protein (c-FLIP) in blood T cells and intratumorous thymocytes were higher in TAMG(+) than in MG(−) thymomas and non-neoplastic thymic remnants. Thymocytes and PBMCs of TAMG patients showed nuclear NF-κB accumulation and apoptosis resistance to FASLG stimulation that was sensitive to NF-κB blockade. Thymoma removal reduced cFLIP expression in PBMCs. Interpretation We conclude that thymomas induce cFLIP overexpression in thymocytes and their progeny, blood T cells. We suggest that the stronger cFLIP overexpression in TAMG(+) compared to MG(−) thymomas allows for the more efficient generation of mature CD4+ T cells in TAMG(+) thymomas. cFLIP overexpression in thymocytes and exported CD4+ T cells of patients with TAMG might contribute to the pathogenesis of TAMG by impairing central and peripheral T-cell tolerance. PMID:26401511

  17. Methylenetetrahydrofolate reductase polymorphisms and susceptibility to acute lymphoblastic leukemia in a Chinese population: a meta-analysis.

    PubMed

    Xiao, Yi; Deng, Tao-Ran; Su, Chang-Liang; Shang, Zhen

    2014-01-01

    Although many epidemiologic studies have investigated the methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and their association with acute lymphoblastic leukemia (ALL), definitive conclusions cannot be drawn. To clarify the effects of MTHFR polymorphisms on the risk of ALL, a meta-analysis was performed in a Chinese population. A computerized literature search was carried out in PubMed, the Chinese Biomedicine (CBM) database, China National Knowledge Infrastructure (CNKI) platform, and the Wanfang database (Chinese) to collect relevant articles. A total of 11 articles including 1,738 ALL cases and 2,438 controls were included in this meta-analysis. Overall, a significantly decreased association was found between the MTHFR C677T polymorphism and ALL risk when all studies in Chinese populations were pooled into the meta-analysis. In subgroup analyses stratified by age, ethnicity, and source of controls, the same results were observed in children, in population-based studies, and in people with no stated ethnicity. However, a significantly increased association was also found for MTHFR C677T in hospital-based studies, and for MTHFR A1298C in people with no stated ethnicity. Our results suggest that the MTHFR C677T and A1298C polymorphisms may be potential biomarkers for ALL risk in Chinese populations, and studies with a larger sample size and wider population spectrum are required before definitive conclusions can be drawn. © 2014 S. Karger GmbH, Freiburg.

  18. Prothrombotic gene variants as risk factors of acute myocardial infarction in young women

    PubMed Central

    2012-01-01

    Background Acute myocardial infarction (AMI) in young women represent an extreme phenotype associated with a higher mortality compared with similarly aged men. Prothrombotic gene variants could play a role as risk factors for AMI at young age. Methods We studied Factor V Leiden, FII G20210A, MTHFR C677T and beta-fibrinogen -455G>A variants by real-time PCR in 955 young AMI (362 females) and in 698 AMI (245 females) patients. The data were compared to those obtained in 909 unrelated subjects (458 females) from the general population of the same geographical area (southern Italy). Results In young AMI females, the allelic frequency of either FV Leiden and of FII G20210A was significantly higher versus the general population (O.R.: 3.67 for FV Leiden and O.R.: 3.84 for FII G20210A; p<0.001). Among AMI patients we showed only in males that the allelic frequency of the MTHFR C677T variant was significantly higher as compared to the general population. Such difference was due to a significantly higher frequency in AMI males of the MTHFR C677T variant homozygous genotype (O.R. 3.05). Discussion and conclusion Our data confirm that young AMI in females is a peculiar phenotype with specific risk factors as the increased plasma procoagulant activity of FV and FII. On the contrary, the homozygous state for the 677T MTHFR variant may cause increased levels of homocysteine and/or an altered folate status and thus an increased risk for AMI, particularly in males. The knowledge of such risk factors (that may be easily identified by molecular analysis) may help to improve prevention strategies for acute coronary diseases in specific risk-group subjects. PMID:23171482

  19. Association analysis of COMT/MTHFR polymorphisms and major depressive disorder in Chinese Han population.

    PubMed

    Shen, Xinhua; Wu, Yanfeng; Guan, Tiefeng; Wang, Xiaoquan; Qian, Mincai; Lin, Min; Shen, Zhongxia; Sun, Jushui; Zhong, Hua; Yang, Jianhong; Li, Liang; Yuan, Yonggui

    2014-06-01

    In several previous biochemical and genetic studies, the Val158Met polymorphism of the gene encoding catechol-O-methyltransferase (COMT) and the C677T polymorphism of Methylenetetrahydrofolate reductase (MTHFR) have been suggested to be involved in the pathogenesis as well as the treatment response of major depressive disorder (MDD), but the results have been inconsistent. In this study, we investigate the association of COMT/MTHFR and their interactions with MDD and antidepressant response in Chinese Han population. Three hundred and sixty eight depressed patients who met DSM-IV criteria for MDD were recruited for the study. Two hundred and nineteen normal controls were recruited from the local community. Patients and normal controls were genotyped for the functional COMT val158met and MTHFR C677T polymorphisms. Patients were characterized for clinical response to antidepressant treatment as measured by intra-individual changes of Hamilton Depression (HAMD-17) scores over 6 weeks. The T allele (OR=1.81; CI95%=1.40-2.34, P<0.001) and C/T genotype (OR=3.66; CI95% =2.53-5.28, P<0.001) of MTHFR C677T were significantly different between case and control groups. The COMT Met/Val genotype was more common among depressed individuals than among controls (OR=1.52, CI95%=1.04-2.21, P=0.02). There is disequilibrium in age and sex between case and control groups. Though we control the two variables in the statistic analysis, to be more accurate, we need to increase sample size in further study. Individuals with the genotype COMT Met/Val and MTHFR C/T have more probability of suffering from MDD. However, there is no association between gene polymorphism and treatment response. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Impact of methylenetetrahydrofolate reductase (MTHFR) polymorphisms on methotrexate-induced toxicities in acute lymphoblastic leukemia: a meta-analysis.

    PubMed

    Yang, Lin; Hu, Xin; Xu, Luhang

    2012-10-01

    The associations between methylenetetrahydrofolate reductase (MTHFR) polymorphism and methotrexate (MTX)-induced toxicities in patients with acute lymphoblastic leukemia (ALL) have been evaluated in various populations, with the results remained conflicting. Therefore, we conducted a meta-analysis by combining available data to derive a more precise estimation of the association. PubMed, Embase, and China National Knowledge Infrastructure were searched until 21 September 2011 to identify eligible studies. A total of 14 studies were included, with all studies investigating MTHFR C677T polymorphism while nine of them investigating MTHFR A1298C polymorphism only. Results suggested that MTHFR C677T polymorphism was associated with significantly increased risk of MTX-induced toxicity, specifically liver toxicity (TT/CT vs. CC: odds ratio (OR) = 1.70, 95 % confidence interval (CI) = 1.05-2.75), myelosuppression (TT vs. CT/CC: OR = 2.82, 95 %CI = 1.25-6.34), oral mucositis (TT/CT vs. CC: OR = 3.68, 95 %CI = 1.73-7.85), gastrointestinal toxicity (TT/CT vs. CC: OR = 2.36, 95 %CI = 1.36-4.11), and skin toxicity (T vs. C: OR = 2.26, 95 %CI = 1.07-4.74). MTHFR A1298C polymorphism was found to be associated with decreased risk of skin toxicity (CC/AC vs. AA: OR = 0.11, 95 %CI = 0.01-0.85). Genotyping of MTHFR polymorphism, C677T particularly, prior to treatment for ALL is likely to be useful with the aim of tailoring MTX therapy and thus reducing the MTX-related toxicities. However, further studies with larger data set and well-designed models are required to validate our findings.

  1. Plasma folate, methylenetetrahydrofolate reductase (MTHFR), and colorectal cancer risk in three large nested case-control studies

    USDA-ARS?s Scientific Manuscript database

    Few prospective studies have examined the associations between blood levels of folate, in conjunction with methylenetetrahydrofolate reductase (MTHFR) polymorphisms, and colorectal cancer. We evaluated the associations between plasma folate, MTHFR C677T, and A1298C, and colorectal cancer in three la...

  2. Anomalous scaling of Δ C versus T c in the Fe-based superconductors: the $${S}_{\\pm }$$-wave pairing state model

    DOE PAGES

    Bang, Yunkyu; Stewart, G. R.

    2016-02-01

    The strong power law behavior of the specific heat jumpmore » $${\\rm{\\Delta }}C\\;$$ versus T c $$({\\rm{\\Delta }}C/{T}_{{\\rm{c}}}\\sim {T}_{{\\rm{c}}}^{\\alpha },\\alpha \\approx 2)$$, first observed by Bud'ko et al (2009 Phys. Rev. B 79 220516), has been confirmed with several families of the Fe-based superconducting compounds with various dopings. We tested a minimal two band BCS model to understand this anomalous behavior and showed that this non-BCS relation between $${\\rm{\\Delta }}C\\;$$ versus T c is a generic property of the multiband superconducting state paired by a dominant interband interaction ($${V}_{\\mathrm{inter}}\\gt {V}_{\\mathrm{intra}}$$) reflecting the relation $$\\frac{{{\\rm{\\Delta }}}_{{\\rm{h}}}}{{{\\rm{\\Delta }}}_{{\\rm{e}}}}\\sim \\sqrt{\\frac{{N}_{{\\rm{e}}}}{{N}_{{\\rm{h}}}}}$$ near T c, as in the $${S}_{\\pm }$$-wave pairing state. We also found that this $${\\rm{\\Delta }}C\\;$$ versus T c power law can continuously change from the ideal BNC scaling to a considerable deviation by a moderate variation of the impurity scattering rate $${{\\rm{\\Gamma }}}_{0}$$ (non-pair-breaking). Finally, as a result, our model provides a consistent explanation why the electron-doped Fe-based superconductors follow the ideal BNC scaling very well while the hole-doped systems often show varying degree of deviations.« less

  3. Identification of an inducible regulator of c-myb expression during T-cell activation.

    PubMed Central

    Phan, S C; Feeley, B; Withers, D; Boxer, L M

    1996-01-01

    Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

  4. TS Gene Polymorphisms Correlate with Susceptibility to Acute Lymphocytic Leukemia in Children.

    PubMed

    Zou, Runyin; He, Xiangling; Wu, Yanpeng; Tian, Xin; You, Yalan; Zheng, Mincui; Li, Wanli; Zou, Hui; Liu, Hua; Zhu, Xiujuan; Zhu, Chengguang

    2017-06-24

    BACKGROUND Acute lymphocytic leukemia (ALL) in children is a clonal disease of bone marrow hematopoietic stem cells. This study aimed to explore the associations between MTHFR or TS genetic polymorphisms and susceptibility to acute lymphocytic leukemia (ALL) in children. MATERIAL AND METHODS This case-control study included 79 ALL patients (case group) and 102 non-ALL patients (control group). Post-PCR genomic DNA sequencing revealed MTHFR C677T and MTHFR A1298C genotypes and TS polymorphisms. The χ² test was used to compare differences in MTHFR and TS polymorphisms (including genotypic and allelic distributions) between groups. Logistic regression analysis was used to determine genetic polymorphisms and ALL risk associations. RESULTS The results indicated that TS 3R allele frequency was significantly higher in the case group than in the control group (χ²=7.45, P<0.05). The MTHFR C677T and MTHFR A1298C polymorphisms were not associated with ALL risk. Compared to the TS 2R/2R genotype, subjects carrying TS 2R/3R were twice as likely to develop ALL, and the TS 3R/3R+3R/4R genotype carried a 4-fold higher risk of developing ALL (OR=1.96, CI: 1.14-3.36). CONCLUSIONS The TS genetic polymorphisms increase the ALL risk. The TS 3R allele was a risk factor for ALL. There were no associations between MTHFR C677T or MTHFR A1298C polymorphisms and ALL susceptibility.

  5. CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

    PubMed

    Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

    2018-03-29

    Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

  6. Prevalence of genetic thrombophilic polymorphisms in the Sri Lankan population--implications for association study design and clinical genetic testing services.

    PubMed

    Dissanayake, Vajira H W; Weerasekera, Lakshini Y; Gammulla, C Gayani; Jayasekara, Rohan W

    2009-10-01

    We investigated the prevalence of genotypes/alleles of single nucleotide polymorphisms (SNP) and haplotypes defined by them in three genes in which variations are associated with venous thromboembolism in 80 Sinhalese, 80 Sri Lankan Tamils and 80 Moors in the Sri Lankan population and compared the SNP data with that of other populations in Southern India and haplotype data with that of HapMap populations. The genes and polymorphisms investigated were Methylenetetrahydrofolate reductase (MTHFR) - 677C>T (rs1801133), 1298A>C (rs1801131), 1317T>C, 1793G>A (rs2274976); Factor V (F5) - 1691G>A (rs6025) and 4070A>G (rs1800595); and prothrombin (F2) - 20210G>A (rs1799963). The polymorphisms were genotyped using PCR/RFLP methods. The prevalence of the variant alleles of each polymorphism in the Sinhalese, Tamils, and Moors was MTHFR 677T: Sinhalese - 13%, Tamils - 9%, Moors - 9%. 1317T>C: Sinhalese - 0%; Tamils - 0%; Moors - 0%. 1793A: Sinhalese - 19%, Tamils - 19%, Moors - 19%. F5 1691A: Sinhalese - 2%, Tamils - 3%, Moors - 2%. 4070G: Sinhalese - 6%, Tamils - 5%, Moors - 8%. F2 20210A: Sinhalese - 0%, Tamils - 0%, Moors - 0%. The frequencies observed were similar to data from other South Indian populations; the haplotype data showed haplotypes unique to the Sri Lankan population when compared to HapMap populations. rs9651118 was identified as a SNP that splits the haplotypes harbouring the functionally significant 677T allele in the MTHFR gene. This data would be useful in planning genetic association studies in the Sri Lankan population and in deciding on which genetic variants should be tested in a clinical genetic testing service.

  7. Absence of PDGF-induced, PKC-independent c-fos expression in a chemically transformed C3H/10T1/2 cell clone.

    PubMed

    Vassbotn, F S; Skar, R; Holmsen, H; Lillehaug, J R

    1992-09-01

    The effect of platelet-derived growth factor (PDGF) on c-fos mRNA transcription was studied in the immortalized mouse embryo fibroblast C3H/10T1/2 Cl 8 (10T1/2) cells and the chemically transformed, tumorigenic subclone C3H/10T1/2 Cl 16 (Cl 16). In the 10T1/2 cells as well as the Cl 16 subclone, the dose-dependent PDGF stimulation of c-fos mRNA synthesis was similar in both logarithmically growing and confluent cultures. c-fos mRNA was induced severalfold by 12-O-tetradecanoylphorbol-13-acetate (TPA) in both 10T1/2 and Cl 16. Down-regulation of protein kinase C (PKC) activity by TPA pretreatment inhibited PDGF-stimulated c-fos mRNA expression in Cl 16 cells but did not affect this induction in the 10T1/2 cells. This inhibition was not a general phenomenon of 3-methylcholanthrene-mediated transformation of 10T1/2 cells since experiments with another transformed 10T1/2 cell clone, C3H/10T1/2 TPA 482, gave qualitatively the same results as the 10T1/2 cells. Receptor binding experiments showed that the nontransformed and transformed cells had a comparable number of PDGF receptors, 1.3 x 10(5) and 0.7 x 10(5) receptors per cell, respectively. Furthermore, cAMP-induced c-fos expression induced by forskolin is formerly shown to be independent of PKC down-regulation. In our experiments, forskolin induced c-fos expression in both clones. However, PKC down-regulation inhibited the forskolin-induced c-fos expression in Cl 16 cells. This apparently demonstrates cross talk between PKC and PKA in the c-fos induction pathway. The present results provide evidence for an impaired mechanism for activating c-fos expression through PKC-independent, PDGF-induced signal transduction in the chemically transformed Cl 16 fibroblasts compared to that in nontransformed 10T1/2 cells.

  8. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  9. Frequency of APOE, MTHFR and ACE polymorphisms in the Zambian population

    PubMed Central

    2014-01-01

    Background Polymorphisms within the apolipoprotein-E (APOE), Methylenetetrahydrofolate reductase (MTHFR) and Angiotensin I-converting enzyme (ACE) genes has been associated with cardiovascular and cerebrovascular disorders, Alzheimer’s disease and other complex diseases in various populations. The aim of the study was to analyze the allelic and genotypic frequencies of APOE, MTHFR C677T and ACE I/D gene polymorphisms in the Zambian population. Results The allele frequencies of APOE polymorphism in the Zambian populations were 13.8%, 59.5% and 26.7% for the ε2, ε3 and ε4 alleles respectively. MTHFR C677T and ACE I/D allele frequencies were 8.6% and 13.8% for the T and D minor alleles respectively. The ε2ε2 genotype and TT genotype were absent in the Zambian population. The genetic distances between Zambian and other African and non-African major populations revealed an independent variability of these polymorphisms. Conclusion We found that the APOE ε3 allele and the I allele of the ACE were significantly high in our study population while there were low frequencies observed for the MTHFR 677 T and ACE D alleles. Our analysis of the APOE, MTHFR and ACE polymorphisms may provide valuable insight into the understanding of the disease risk in the Zambian population. PMID:24679048

  10. Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family.

    PubMed

    Zhai, Wei; Jin, Xin; Gong, Yan; Qu, Ling-Hui; Zhao, Chen; Li, Zhao-Hui

    2015-01-01

    To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2). The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing. The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls. We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

  11. Effect of genetic polymorphisms involved in folate metabolism on the concentration of serum folate and plasma total homocysteine (p-tHcy) in healthy subjects after short-term folic acid supplementation: a randomized, double blind, crossover study.

    PubMed

    Cabo, Rona; Hernes, Sigrunn; Slettan, Audun; Haugen, Margaretha; Ye, Shu; Blomhoff, Rune; Mansoor, M Azam

    2015-05-01

    Data on the effect of combined genetic polymorphisms, involved in folate metabolism, on the concentration of serum folate after folic acid supplementation are scarce. Therefore, we investigated the impact of seven gene polymorphisms on the concentration of serum folate and p-tHcy in healthy subjects after short-term folic acid supplementation. In a randomized, double blind, crossover study, apparently healthy subjects were given either 0.8 mg folic acid per day (n = 46) or placebo (n = 45) for 14 days. The washout period was 14 days. Fasting blood samples were collected on day 1, 15, 30 and 45. Data on subjects on folic acid supplementation (n = 91) and on placebo (n = 45) were used for the statistical analysis. The concentration of serum folate increased higher in subjects with higher age (53.5 ± 7.0 years) than in subjects with lower age (24.3 ± 3.2 years) after folic acid supplementation (p = 0.006). The baseline concentration of serum folate in subjects with polymorphism combination, reduced folate carrier protein, RFC1-80 GA and methylenetetrahydrofolate reductase, MTHFR677 CT+TT, was lower than RFC1-80 AA and MTHFR677 CT+TT (p = 0.002). After folic acid supplementation, a higher increase in the concentration of serum folate was detected in subjects with polymorphism combination RFC1-80 GA and MTHFR677 CC than RFC1-80 GG and MTHFR CT+TT combination (p < 0.0001). The baseline concentration of plasma total homocysteine (p-tHcy) was altered by combined polymorphisms in genes associated with folate metabolism. After folic acid supplementation, in subjects with combined polymorphisms in methylenetetrahydrofolate dehydrogenase, MTHFD1-1958 and MTHFR-677 genes, the concentration of p-tHcy was changed (p = 0.002). The combination of RFC1-80 and MTHFR-677 polymorphisms had a profound affect on the concentration of serum folate in healthy subjects before and after folic acid supplementation.

  12. Detection of Hb Rothschild HBB: c.[112T>A or 112T>C], Through High Index of Suspicion on Abnormal Pulse Oximetry.

    PubMed

    Alli, Nazeer A; Wessels, Piet; Rampersad, Narisha; Clark, Barnaby E; Thein, Swee Lay

    2017-03-01

    We describe a case with a low oxygen affinity hemoglobin (Hb) variant who presented with cyanosis in the absence of cardiopulmonary disease. The patient, a 27-year-old pregnant female (P1G2), complained of a productive cough and bluish discoloration of the lips that started 3 days prior to seeking attention. She had no previous episodes and has generally been in good health. A positive family history of cyanosis was obtained in one sibling. Systematic examination, notably the cardiorespiratory system, revealed no abnormalities. The arterial Hb oxygen saturation (SpO 2 ) on pulse oximetry was 81.0% and Hb separation studies revealed an Hb variant identified as Hb Rothschild [β37(C3)Trp→Arg] (HBB: c.[112 T>A or 112 T>C]) by gene sequencing. The amino acid substitution (Trp→Arg) is an important contact point at the α1β2 interface and favors a T-quaternary state of the Hb tetramer. This leads to a low oxygen affinity state, which results in premature release of oxygen and drop in oxygen saturation. In the absence of cardiopulmonary disease, a decreased oxygen saturation reading, with or without cyanosis, should arouse suspicion for a possible dysHb.

  13. Genetic polymorphisms of methylenetetrahydrofolate reductase and aldehyde dehydrogenase 2, alcohol use and risk of colorectal adenomas: Self-Defense Forces Health Study.

    PubMed

    Hirose, Maho; Kono, Suminori; Tabata, Shinji; Ogawa, Shinsaku; Yamaguchi, Keizo; Mineshita, Masamichi; Hagiwara, Tomoko; Yin, Guang; Lee, Kyong-Yeon; Tsuji, Akiko; Ikeda, Noriaki

    2005-08-01

    Methylenetetrahydrofolate reductase is a key enzyme in folate metabolism, which affects DNA synthesis and methylation and is possibly linked to colorectal carcinogenesis. Alcohol and acetaldehyde have an adverse effect on folate metabolism. This study investigated the relationship of functional MTHFR C677T and ALDH2 polymorphisms to colorectal adenomas with reference to alcohol consumption in a case-control study of male officials in the Self-Defense Forces (SDF) who received a preretirement health examination at two SDF hospitals. The study subjects were 452 cases of colorectal adenoma and 1050 controls with no polyp who underwent total colonoscopy. Genotypes were determined by the PCR-RFLP method using genomic DNA extracted from the buffy coat. Statistical adjustment was made for age, hospital, rank in the SDF, body mass index, cigarette-years and alcohol intake. Neither MTHFR C677T nor ALDH2 showed a measurable association with colorectal adenoma. While high alcohol consumption was associated with a moderately increased risk of colorectal adenoma, neither of the two polymorphisms showed a significant effect on the association between alcohol and colorectal adenoma. Individuals with the variant alleles ALDH2*2 and MTHFR 677T had a decreased risk of colorectal adenomas, showing adjusted odds ratios of 0.70 (95% confidence interval 0.49-1.00) for all adenomas and 0.57 (0.34-0.95) for large adenomas (> or = 5 mm), as compared to individuals with ALDH2*1/1 and MTHFR 677CC genotypes combined. The findings may be interpreted as suggesting that folate inhibits the growth of colorectal adenomas, but further confirmation is needed.

  14. Systematics in position annihilation lifetime analysis of high T c superconducting transitions

    NASA Astrophysics Data System (ADS)

    Howell, R. H.; Radousky, H. B.; Wachs, A. L.; Fluss, M. J.; Turchi, P. E. A.; Jean, Y. C.; Sundar, C. S.; Chu, C. W.; Peng, J. L.; Folkerts, T. J.; Shelton, R. N.; Hinks, D. G.

    1989-12-01

    Values of the positron lifetime have previously been observed to change with temperature below T c in high T c superconducting oxides. We report new measurements on Ba .6K .4BiO 3 and Nd 1.85Ce .15CuO 4.

  15. Extension of the N-point Padé approximants solution of the Eliashberg equations to T ˜ T c

    NASA Astrophysics Data System (ADS)

    Leavens, C. R.; Ritchie, D. S.

    1985-01-01

    Vidberg and Serene introduced a very useful technique for calculating the low temperature (T « T c) gap function of a superconductor which bypasses the real-frequency singular integral equations of Eliashberg. Blashke and Blocksdorf recognized and resolved a difficulty with the technique thereby extending it to higher temperatures. We present a much simpler method of doing essentially the same thing and, for a strong-coupling superconductor at a temperature near T c, compare the gap functions calculated using these methods with the accurate one computed directly from the real-frequency equations.

  16. Inherited thrombophilia in pregnant women with intrauterine growth restriction.

    PubMed

    Coriu, Letitia; Copaciu, Elena; Tulbure, Dan; Talmaci, Rodica; Secara, Diana; Coriu, Daniel; Cirstoiu, Monica

    2014-12-01

    Intrauterine growth restriction (IUGR) is a major cause of fetal morbidity and mortality during pregnancy. The role of mutation in the factor V gene, prothrombin gene, MTHFR gene, as risk factors for intrauterine growth restriction during pregnancy, is not very well known so far. This is a retrospective study of 151 pregnant women with a history of complicated pregnancy: intrauterine growth restriction, preeclampsia, recurrent pregnancy loss or maternal venous thromboembolism, who were admitted in Bucharest Emergency University Hospital, during the period January 2010 to July 2014. Genetic testing was performed for all the cases to detect: factor V Leiden mutation, G20210A mutation in the prothrombin gene, C677T mutation and A1298C mutation in methylenetetrahydrofolate reductase (MTHFR) gene. Blood samples were obtained as soon as the diagnosis of intrauterine growth restriction was established with ultrasonography. The following gene mutations were associated with increased risk of IUGR: G20210A prothrombin gene mutation (OR 4.81, 95% CI 1.05 - 2.22, p= 0.043), G1691A factor V gene mutation (factor V Leiden) (OR 1.58, 95% CI 0.61 - 4.080, p= 0.347), C677T MTHFR gene mutation (OR 1.61, 95% CI 0.79 to 3.26, p= 0.186), compound heterozygous MTHFR C677T and A1298C (OR 1.66, 95% CI 0.81- 3.42, p= 0.169). Particularly, for G20210A prothrombin gene mutation we found statistically significant risk (p≤0.05) of IUGR.

  17. Myeloid Conditioning with c-kit-Targeted CAR-T Cells Enables Donor Stem Cell Engraftment.

    PubMed

    Arai, Yasuyuki; Choi, Uimook; Corsino, Cristina I; Koontz, Sherry M; Tajima, Masaki; Sweeney, Colin L; Black, Mary A; Feldman, Steven A; Dinauer, Mary C; Malech, Harry L

    2018-05-02

    We report a novel approach to bone marrow (BM) conditioning using c-kit-targeted chimeric antigen receptor T (c-kit CAR-T) cells in mice. Previous reports using anti-c-kit or anti-CD45 antibody linked to a toxin such as saporin have been promising. We developed a distinctly different approach using c-kit CAR-T cells. Initial studies demonstrated in vitro killing of hematopoietic stem cells by c-kit CAR-T cells but poor expansion in vivo and poor migration of CAR-T cells into BM. Pre-treatment of recipient mice with low-dose cyclophosphamide (125 mg/kg) together with CXCR4 transduction in the CAR-T cells enhanced trafficking to and expansion in BM (<1%-13.1%). This resulted in significant depletion of the BM c-kit + population (9.0%-0.1%). Because congenic Thy1.1 CAR-T cells were used in the Thy1.2-recipient mice, anti-Thy1.1 antibody could be used to deplete CAR-T cells in vivo before donor BM transplant. This achieved 20%-40% multilineage engraftment. We applied this conditioning to achieve an average of 28% correction of chronic granulomatous disease mice by wild-type BM transplant. Our findings provide a proof of concept that c-kit CAR-T cells can achieve effective BM conditioning without chemo-/radiotherapy. Our work also demonstrates that co-expression of a trafficking receptor can enhance targeting of CAR-T cells to a designated tissue. Published by Elsevier Inc.

  18. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  19. Methylenetetrahydrofolate reductase gene polymorphisms and recurrent pregnancy loss in China: a systematic review and meta-analysis.

    PubMed

    Chen, Hui; Yang, Xiaorong; Lu, Ming

    2016-02-01

    Recurrent pregnancy loss (RPL) is defined as two or more consecutive pregnancy losses before the 20th week of gestation with the same partner. Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms were reported to have an effect on embryonic development and pregnancy success. To clarify the effects of MTHFR polymorphisms on the risk of RPL in the Chinese population, a meta-analysis was performed. Related studies were identified from Medline, Embase, Web of Science, and Chinese Databases up to March 7th, 2015. We extracted the number of both C677T and A1298C genotypes in the cases and controls. Odds ratios (ORs) and 95 % confidence intervals (95 % CIs) were used to estimate the associations. Data analysis was performed using Stata 13.1. Sixteen articles involving 1420 RPL cases and 1408 controls were included in this meta-analysis. MTHFR C677T polymorphism was significantly associated with RPL risk under dominant (TT + CT vs. CC; OR 2.10, 95 % CI 1.76-2.50), recessive (TT vs. CC + CT; OR 2.36, 95 % CI 1.92-2.90), heterozygote (CT vs. CC; OR 1.77, 95 % CI 1.32-2.37), homozygote (TT vs. CC; OR 3.55, 95 % CI 2.76-4.56), and additive (T vs. C; OR 1.83, 95 % CI 1.64-2.05) model. Sensitivity analyses excluding studies that deviated from HWE did not change the direction of effect. For the A1298C mutation, no significant association was found. The Egger's regression asymmetry test showed no significant publication bias. Identification of MTHFR C677T mutation would have some implication for primary prevention of RPL and screening of high-risk individuals in China. Large well-designed researches are needed to fully describe the associations.

  20. P, C and T: Different Properties on the Kinematical Level

    NASA Astrophysics Data System (ADS)

    Dvoeglazov, Valeriy V.

    2018-04-01

    We study the discrete symmetries (P,C and T) on the kinematical level within the extended Poincaré Group. On the basis of the Silagadze research, we investigate the question of the definitions of the discrete symmetry operators both on the classical level, and in the secondary-quantization scheme. We study the physical contents within several bases: light-front formulation, helicity basis, angular momentum basis, and so on, on several practical examples. We analize problems in construction of the neutral particles in the the (1/2, 0) + (0, 1/2) representation, the (1, 0) + (0, 1) and the (1/2, 1/2) representations of the Lorentz Group. As well known, the photon has the quantum numbers 1‑, so the (1, 0) + (0, 1) representation of the Lorentz group is relevant to its description. We have ambiguities in the definitions of the corresponding operators P, C; T, which lead to different physical consequences. It appears that the answers are connected with the helicity basis properties, and commutations/anticommutations of the corresponding operators, P, C, T, and C 2, P 2, (CP)2 properties. This contribution is the review paper of my previous work [2, 3].

  1. Anisotropic H c 2 , thermodynamic and transport measurements, and pressure dependence of T c in K 2 Cr 3 As 3 single crystals

    DOE PAGES

    Kong, Tai; Bud'ko, Sergey L.; Canfield, Paul C.

    2015-01-30

    We present a detailed study of single crystalline K 2Cr 3As 3 and analyze its thermodynamic and transport properties, anisotropic H c2(T), and initial pressure dependence of T c. In zero field, the temperature-dependent resistivity is metallic. Deviation from a linear temperature dependence is evident below 100 K and a T 3 dependence is roughly followed from just above T c (~10K) to ~40K. Anisotropic H c2(T) data were measured up to 140 kOe with field applied along and perpendicular to the rodlike crystals. For the applied field perpendicular to the rod, H c2(T) is linear with a slope ~–70more » kOe/K. For field applied along the rod, the slope is about –120 kOe/K below 70 kOe. Above 70 kOe, the magnitude of the slope decreases to ~–70 kOe/K. The electronic specific heat coefficient γ, just above T c, is 73 mJ/mol K 2; the Debye temperature Θ D is 220 K. As a result, the specific heat jump at the superconducting transition ΔC~2.2γT c. Finally, for hydrostatic pressures up to ~7 kbar, T c decreases under pressure linearly at a rate of –0.034K/kbar.« less

  2. Electronic properties of T graphene-like C-BN sheets: A density functional theory study

    NASA Astrophysics Data System (ADS)

    Majidi, R.

    2015-11-01

    We have used density functional theory to study the electronic properties of T graphene-like C, C-BN and BN sheets. The planar T graphene with metallic property has been considered. The results show that the presence of BN has a considerable effect on the electronic properties of T graphene. The T graphene-like C-BN and BN sheets show semiconducting properties. The energy band gap is increased by enhancing the number of BN units. The possibility of opening and controlling band gap opens the door for T graphene in switchable electronic devices.

  3. MTHFR polymorphisms in Puerto Rican children with isolated congenital heart disease and their mothers

    PubMed Central

    García-Fragoso, Lourdes; García-García, Inés; Leavitt, Gloria; Renta, Jessicca; Ayala, Miguel A.; Cadilla, Carmen L.

    2010-01-01

    Congenital heart defects (CHD) are among the most common birth defects. There is evidence suggesting that polymorphisms in folate metabolism could alter susceptibility to CHD. The MTHFR 677TT genotype has been associated with the development of structural congenital heart malformations. The objective of this study was to identify common polymorphisms in the MTHFR gene in children with isolated CHD and their mothers. The DNA analysis for the C677T and A1298C mutations was performed. The study group included 27 mothers, 27 children with CHD, and 220 controls. The prevalence of the TT polymorphism was higher in mothers (22%) than in controls (10%). Compound heterozygosity for both polymorphisms was 3.7 times more common in children with CHD than in the newborn controls. Mothers of children with CHD were more likely to be compound heterozygotes. The higher prevalence of C677T polymorphisms in mothers of children with CHD and of compound heterozygosity for both polymorphisms suggests the possible role of folic acid in the prevention of CHD. Due to the relation of this enzyme to folate metabolism, current folate recommendations for women in childbearing age in Puerto Rico to reduce neural tube defects may need to be extended to the prevention of CHD. PMID:20657745

  4. MTHFR polymorphisms in Puerto Rican children with isolated congenital heart disease and their mothers.

    PubMed

    García-Fragoso, Lourdes; García-García, Inés; Leavitt, Gloria; Renta, Jessicca; Ayala, Miguel A; Cadilla, Carmen L

    2010-03-01

    Congenital heart defects (CHD) are among the most common birth defects. There is evidence suggesting that polymorphisms in folate metabolism could alter susceptibility to CHD. The MTHFR 677TT genotype has been associated with the development of structural congenital heart malformations. The objective of this study was to identify common polymorphisms in the MTHFR gene in children with isolated CHD and their mothers. The DNA analysis for the C677T and A1298C mutations was performed. The study group included 27 mothers, 27 children with CHD, and 220 controls. The prevalence of the TT polymorphism was higher in mothers (22%) than in controls (10%). Compound heterozygosity for both polymorphisms was 3.7 times more common in children with CHD than in the newborn controls. Mothers of children with CHD were more likely to be compound heterozygotes. The higher prevalence of C677T polymorphisms in mothers of children with CHD and of compound heterozygosity for both polymorphisms suggests the possible role of folic acid in the prevention of CHD. Due to the relation of this enzyme to folate metabolism, current folate recommendations for women in childbearing age in Puerto Rico to reduce neural tube defects may need to be extended to the prevention of CHD.

  5. Biosynthesis of t-Anethole in Anise: Characterization of t-Anol/Isoeugenol Synthase and an O-Methyltransferase Specific for a C7-C8 Propenyl Side Chain1[W][OA

    PubMed Central

    Koeduka, Takao; Baiga, Thomas J.; Noel, Joseph P.; Pichersky, Eran

    2009-01-01

    The phenylpropene t-anethole imparts the characteristic sweet aroma of anise (Pimpinella anisum, family Apiaceae) seeds and leaves. Here we report that the aerial parts of the anise plant accumulate t-anethole as the plant matures, with the highest levels of t-anethole found in fruits. Although the anise plant is covered with trichomes, t-anethole accumulates inside the leaves and not in the trichomes or the epidermal cell layer. We have obtained anise cDNA encoding t-anol/isoeugenol synthase 1 (AIS1), an NADPH-dependent enzyme that can biosynthesize t-anol and isoeugenol (the latter not found in anise) from coumaryl acetate and coniferyl acetate, respectively. In addition, we have obtained a cDNA encoding S-[methyl-14C]adenosyl-l-methionine:t-anol/isoeugenol O-methyltransferase 1 (AIMT1), an enzyme that can convert t-anol or isoeugenol to t-anethole or methylisoeugenol, respectively, via methylation of the para-OH group. The genes encoding AIS1 and AIMT1 were expressed throughout the plant and their transcript levels were highest in developing fruits. The AIS1 protein is 59% identical to petunia (Petunia hybrida) isoeugenol synthase 1 and displays apparent Km values of 145 μm for coumaryl acetate and 230 μm for coniferyl acetate. AIMT1 prefers isoeugenol to t-anol by a factor of 2, with Km values of 19.3 μm for isoeugenol and 54.5 μm for S-[methyl-14C]adenosyl-l-methionine. The AIMT1 protein sequence is approximately 40% identical to basil (Ocimum basilicum) and Clarkia breweri phenylpropene O-methyltransferases, but unlike these enzymes, which do not show large discrimination between substrates with isomeric propenyl side chains, AIMT1 shows a 10-fold preference for t-anol over chavicol and for isoeugenol over eugenol. PMID:18987218

  6. The Maximum Levitation Force of High- T c Superconductors

    NASA Astrophysics Data System (ADS)

    Zhao, Xian-Feng; Liu, Yuan

    2007-11-01

    In this paper we present the dependence of the maximum levitation force ( F {/z max }) of a high- T c superconductor (HTS) on the structural factors of high- T c superconducting systems based on the Bean critical state model and Ampère’s law. A transition point of the surface magnetic field ( B s ) of a permanent magnet (PM) is found at which the relation between F {/z max } and B s changes: while the surface magnetic field is less than the transition value the dependence is subject to a nonlinear function, otherwise it is a linear one. The two different relations are estimated to correspond to partial penetration of the shielding currents inside the superconductor below the transition point and complete penetration above it respectively. The influence of geometric properties of superconductors on the dependence is also investigated. In addition, the relation between F {/z max } and the critical current density ( J c ) of the HTS is discussed. The maximum levitation force saturates at high J c . An optimum function of the J c and the B s is presented in order to achieve large F {/z max }.

  7. Dissociable Genetic Contributions to Error Processing: A Multimodal Neuroimaging Study

    PubMed Central

    Agam, Yigal; Vangel, Mark; Roffman, Joshua L.; Gallagher, Patience J.; Chaponis, Jonathan; Haddad, Stephen; Goff, Donald C.; Greenberg, Jennifer L.; Wilhelm, Sabine; Smoller, Jordan W.; Manoach, Dara S.

    2014-01-01

    Background Neuroimaging studies reliably identify two markers of error commission: the error-related negativity (ERN), an event-related potential, and functional MRI activation of the dorsal anterior cingulate cortex (dACC). While theorized to reflect the same neural process, recent evidence suggests that the ERN arises from the posterior cingulate cortex not the dACC. Here, we tested the hypothesis that these two error markers also have different genetic mediation. Methods We measured both error markers in a sample of 92 comprised of healthy individuals and those with diagnoses of schizophrenia, obsessive-compulsive disorder or autism spectrum disorder. Participants performed the same task during functional MRI and simultaneously acquired magnetoencephalography and electroencephalography. We examined the mediation of the error markers by two single nucleotide polymorphisms: dopamine D4 receptor (DRD4) C-521T (rs1800955), which has been associated with the ERN and methylenetetrahydrofolate reductase (MTHFR) C677T (rs1801133), which has been associated with error-related dACC activation. We then compared the effects of each polymorphism on the two error markers modeled as a bivariate response. Results We replicated our previous report of a posterior cingulate source of the ERN in healthy participants in the schizophrenia and obsessive-compulsive disorder groups. The effect of genotype on error markers did not differ significantly by diagnostic group. DRD4 C-521T allele load had a significant linear effect on ERN amplitude, but not on dACC activation, and this difference was significant. MTHFR C677T allele load had a significant linear effect on dACC activation but not ERN amplitude, but the difference in effects on the two error markers was not significant. Conclusions DRD4 C-521T, but not MTHFR C677T, had a significant differential effect on two canonical error markers. Together with the anatomical dissociation between the ERN and error-related dACC activation

  8. Solar cycle predicts folate-sensitive neonatal genotypes at discrete phases of the first trimester of pregnancy: a novel folate-related human embryo loss hypothesis.

    PubMed

    Lucock, Mark; Glanville, Tracey; Yates, Zoë; Walker, James; Furst, John; Simpson, Nigel

    2012-08-01

    Folate, a key periconceptional nutrient, is ultraviolet light (UV-R) sensitive. We therefore hypothesise that a relationship exists between sunspot activity, a proxy for total solar irradiance (particularly UV-R) reaching Earth, and the occurrence of folate-sensitive, epigenomic-related neonatal genotypes during the first trimester of pregnancy. Limited data is provided to support the hypothesis that the solar cycle predicts folate-related human embryo loss: 379 neonates born at latitude 54°N between 1998 and 2000 were examined for three folate-sensitive, epigenome-related polymorphisms, with solar activity for trimester one accessed via the Royal Greenwich Observatory-US Air force/National Oceanic and Atmospheric Administration Sunspot Database (34,110 total observation days). Logistic regression showed solar activity predicts C677T-methylenetetrahydrofolate reductase (C677T-MTHFR) and A66G-methionine synthase reductase (A66G-MSR) genotype at discrete phases of trimester one. Total and maximal sunspot activity predicts C677T-MTHFR genotype for days 31-60 of trimester one (p=0.0181 and 0.0366, respectively) and A66G-MSR genotype for days 61-90 of trimester one (p=0.0072 and 0.0105, respectively). Loss of UV-R sensitive folate associated with the sunspot cycle might therefore interact with variant folate genes to perturb DNA methylation and/or elaboration of the primary base sequence (thymidylate synthesis), as well as increase embryo-toxic homocysteine. We hypothesise that this may influence embryo viability leading to 677CC-MTHFR and 66GG-MSR embryo loss at times of increased solar activity. This provides an interesting and plausible link between well recognised 'folate gene originated developmental disorders' and 'solar activity/seasonality modulated developmental disorders'. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Association of CYP2D6*10 (c.100C>T) polymorphisms with clinical outcome of breast cancer after tamoxifen adjuvant endocrine therapy in Chinese population.

    PubMed

    Lei, Lei; Wang, Xian; Wu, Xiao-Dan; Wang, Zeng; Chen, Zhan-Hong; Zheng, Ya-Bin; Wang, Xiao-Jia

    2016-01-01

    Tamoxifen is the most widely used adjuvant endocrine therapy for breast cancer. However, the pharmacogenetic effect of CYP2D6 on its efficacy remains unclear. Therefore, this study aimed to evaluate the association of CYP2D6*10 (c.100C>T) polymorphisms with clinical outcome in Chinese breast cancer patients. A total of 72 tamoxifen-treated early breast cancer patients were included in this study. CYP2D6*10 (c.100C>T) polymorphisms (C/C: wild type; T/T: homozygous mutant genotype T; C/T: heterozygote genotype C) were detected by pyrosequencing. The plasma concentrations of tamoxifen and its two major active metabolites were determined by liquid chromatography tandem mass spectrometry (LC-MS). Disease-free survival (DFS) and overall survival (OS) were assessed by Kaplan-Meier analysis, while the Cox proportional hazards model was used in multivariate tests for prognostic significance. We found that T/T carrier showed the lowest serum concentration of endoxifen as compared to C/C and C/T carriers (p<0.01). In the subgroup of patients below 40 years of age, T/T carriers appeared to have the shortest DFS and OS as compared to other genotype carriers (p<0.01). When genotypes (C/C, C/T and T/T carriers) and other clinical characteristics were adjusted, tumor size (>2 cm) and grades were independent prognostic factors for DFS but not OS (tumor size >2 cm: HR: 3.870, 95% CI: 1.045-14.330, P = 0.043; tumor grades: HR: 2.230, 95% CI: 1.090-4.562, P = 0.028). In conclusion, the T/T genotype is a negative prognostic factor in young breast cancer patients using tamoxifen. Tumor size (>2 cm) and grades are independent prognostic factors for DFS, when genotype of CYP2D6*10 (c.100C>T) is adjusted.

  10. Survey of P-3C Mission Profiles for Development of the T56-A-14 Duty Cycle.

    DTIC Science & Technology

    1982-01-01

    Pilot Training (FAM) 3. Logistics (LOG) 4. Post Maintenance Check Flight ( PMCF ) 5. Minelaying and Torpedo Certification (MAT) MISSION FREQUENCY DATA...998 649 675 43 FAM 715 800 585 610 677 43 LOG 95 62 209 132 124 8 PMCF 35 48 46 18 37 2 MAT 89 36 1 75 33 58 4 3 4 N ADC-83026 -60 These data show an

  11. Association of APOA5 -1131T>C polymorphism and serum lipid levels in patients with type 2 diabetes.

    PubMed

    Celap, Ivana; Simundic, Ana-Maria; Nikolac, Nora; Kackov, Sanja; Katalinic, Darko

    2013-10-01

    Significant abnormalities in lipid metabolism are frequently present in patients with type 2 diabetes mellitus (T2DM). Hypertriglyceridemia, a highly proatherogenic state, is associated with increased risk of coronary artery disease. Genetic polymorphism APOA5 -1131T>C has been recognized as a significant contributor to hypertriglyceridemia in both healthy and diabetic populations. The aim of the study was to investigate the association of APOA5 -1131T>C polymorphism with the serum levels of triglycerides, total cholesterol, high-density lipoprotein (HDL) cholesterol, and low-density lipoprotein (LDL) cholesterol in patients with T2DM. In total, 234 DNA samples from patients with T2DM were genotyped using the PCR-RFLP method. Serum lipid levels were measured using standard laboratory methods. Obtained APOA5 -1131T>C genotype frequencies were 89% (T/T) and 11% (T/C+C/C). There was no significant association between APOA5 -1131T>C genotypes and triglyceride levels (1.90 mM [1.32-2.74] vs. 1.78 mM [1.54-3.05] for T/T vs. T/C+C/C genotype; p=0.553), HDL cholesterol levels (1.30 mM [1.10-1.40] vs. 1.30 mM [1.05-1.40] for T/T vs. T/C+C/C; p=0.534), and LDL cholesterol levels (3.1 mM [2.3-3.8] vs. 3.0 mM [2.2-3.5] for T/T vs. T/C+C/C; p=0.313). Our results suggest that hypertriglyceridemia in patients with T2DM is not likely to be associated with the APOA5 -1131T>C polymorphism.

  12. cTnT can be a useful marker for early detection of anthracycline cardiotoxicity.

    PubMed

    Kilickap, S; Barista, I; Akgul, E; Aytemir, K; Aksoyek, S; Aksoy, S; Celik, I; Kes, S; Tekuzman, G

    2005-05-01

    The level of serum cardiac troponin-T (cTnT) increases with myocardial damage. We sought to assess whether cTnT level could be a useful marker for the early detection of anthracycline cardiotoxicity. Forty-one patients who had been scheduled to receive anthracycline-containing combination chemotherapy were included in the study. Serum cTnT levels were measured before (baseline) and after the first cycle of chemotherapy, and again, after the last cycle of chemotherapy. In all patients, the left ventricular ejection fraction (LVEF), fractional shortening (FS), early peak flow/atrial flow velocity (E/A) ratio, and the isovolemic relaxation time (IRT) were measured echocardiographically, both before and after the completion of chemotherapy. LVEF and FS did not change in any patients. In 21 patients (49%), the E/A ratio decreased after therapy as compared to the pre-treatment values. The decrease in E/A ratio was more prominent in patients who were older than the mean age of our study group, which was 44 years. The post-treatment IRT was prolonged compared with the pretreatment IRT (94.0 +/- 2.0 versus 85.6 +/- 10.5 ms, respectively). cTnT levels after completion of therapy were elevated in 14 (34%) patients, and exceeded the upper limit of the normal range (>0.1 ng/ml) in only one patient. cTnT levels measured after completion of therapy were significantly higher, compared with those measured at baseline and after the first cycle of therapy. In the younger age group (< or =44 years old), there was a two-fold decrease in the E/A ratio in those patients whose cTnT levels increased during the therapy, when compared with those whose cTnT levels did not change (21% versus 43%, respectively). Increased serum cTnT level can be detected in the early stages of anthracycline therapy and it is associated with diastolic dysfunction of the left ventricle. Therefore, serum cTnT level could be a useful measure for early detection of anthracycline-induced cardiotoxicity.

  13. Josephson junctions in high-T/sub c/ superconductors

    DOEpatents

    Falco, C.M.; Lee, T.W.

    1981-01-14

    The invention includes a high T/sub c/ Josephson sperconducting junction as well as the method and apparatus which provides the junction by application of a closely controlled and monitored electrical discharge to a microbridge region connecting two portions of a superconducting film.

  14. Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

    PubMed

    Zhu, L

    2015-07-28

    We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion.

  15. MTHFR Gene and Serum Folate Interaction on Serum Homocysteine Lowering: Prospect for Precision Folic Acid Treatment.

    PubMed

    Huang, Xiao; Qin, Xianhui; Yang, Wenbin; Liu, Lishun; Jiang, Chongfei; Zhang, Xianglin; Jiang, Shanqun; Bao, Huihui; Su, Hai; Li, Ping; He, Mingli; Song, Yun; Zhao, Min; Yin, Delu; Wang, Yu; Zhang, Yan; Li, Jianping; Yang, Renqang; Wu, Yanqing; Hong, Kui; Wu, Qinhua; Chen, Yundai; Sun, Ningling; Li, Xiaoying; Tang, Genfu; Wang, Binyan; Cai, Yefeng; Hou, Fan Fan; Huo, Yong; Wang, Hong; Wang, Xiaobin; Cheng, Xiaoshu

    2018-03-01

    This post hoc analysis of the CSPPT (China Stroke Primary Prevention Trial) assessed the individual variation in total homocysteine (tHcy)-lowering response after an average 4.5 years of 0.8 mg daily folic acid therapy in Chinese hypertensive adults and evaluated effect modification by methylenetetrahydrofolate reductase ( MTHFR ) C677T genotypes and serum folate levels. This analysis included 16 413 participants from the CSPPT, who were randomly assigned to 2 double-blind treatment groups: either 10-mg enalapril+0.8-mg folic acid or 10-mg enalapril, daily and had individual measurements of serum folate and tHcy levels at baseline and exit visits and MTHFR C677T genotypes. Mean baseline tHcy levels were comparable between the 2 treatment groups (14.5±8.5 versus 14.4±8.1 μmol/L; P =0.561). After 4.5 years of treatment, mean tHcy levels were reduced to 12.7±6.1 μmol/L in the enalapril+folic acid group, but almost stayed the same in the enalapril group (14.4±7.9 μmol/L, group difference: 1.61 μmol/L; 11% reduction). More importantly, tHcy lowering varied by MTHFR genotypes and serum folate levels. Compared with CC and CT genotypes, participants with the TT genotype had a more prominent L-shaped curve between tHcy and serum folate levels and required higher folate levels (at least 15 ng/mL) to eliminate the differences in tHcy by genotypes. Compared with CC or CT, tHcy in the TT group manifested a heightened L-shaped curve from low to high folate levels, but this difference in tHcy by genotype was eliminated when plasma folate levels reach ≈15 ng/mL or higher. Our data raised the prospect to tailor folic acid therapy according to individual MTHFR C677T genotype and folate status. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00794885. © 2018 American Heart Association, Inc.

  16. Craving for alcohol and food during treatment for alcohol dependence: modulation by T allele of 1519T>C GABAAalpha6.

    PubMed

    Han, Doug Hyun; Bolo, Nicholas; Daniels, Melissa A; Lyoo, In Kyoon; Min, Kyung Joon; Kim, Chang Hyun; Renshaw, Perry F

    2008-09-01

    Craving for alcohol and food has been studied in association with alcohol dependence and eating disorders, respectively. One subclass of the gamma-aminobutyric acid (GABA) receptor, 1519T>C GABA(A)alpha6 has been reported to be associated with both alcohol dependence and weight gain. In this study, we hypothesized that patients being treated for alcohol dependence would report decreased craving for alcohol, but an increased craving for food during a 4-week treatment period. We further hypothesized that the T allele of the 1519T>C GABA(A)alpha6 gene would modulate the extent of changes in craving for alcohol and food. This study included 98 male inpatients being treated for alcohol dependence. A 7-point visual analog scale was applied to evaluate relative levels of alcohol and food craving at baseline and again 4 weeks later. Body weight was also checked at the same periods. Genotyping of the 1519T>C SNP in GABA(A)alpha6 was carried out by restriction fragment length polymorphism. There were significant changes in craving for alcohol and food in all patients with alcohol dependence. During the treatment period, body weight increased in all patients with alcohol dependence. Changes in alcohol and food craving in T-allele carriers (CT + TT) of 1519T>C GABA(A)alpha6 were greater than those observed in CC homozygotes. In T-allele carriers, body weight significantly increased and the changes in weight showed a negative correlation with the change in the craving for alcohol and a positive correlation with the changes in craving for food. The current results suggest that in T-allele carriers the change in craving for alcohol during treatment for alcohol dependence is negatively associated with changes in craving for food. The T allele of the 1519T>C GABA(A)alpha6 gene may be one of the modulating factors associated with changes in craving for alcohol and food during treatment of patients with alcohol dependence.

  17. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  18. 60. C.J.T., photographer December 23, 1955 KLAMATH RIVER BRIDGE, DEL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    60. C.J.T., photographer December 23, 1955 KLAMATH RIVER BRIDGE, DEL NORTE COUNTY, SECTION A, HIGHWAY 1. DN-1-A #538, KLAMATH RIVER BR. FROM SO. END, 12/23/55, C.J.T. - Redwood National & State Parks Roads, California coast from Crescent City to Trinidad, Crescent City, Del Norte County, CA

  19. Plasma visfatin, associated with a genetic polymorphism -1535C>T, is correlated with C-reactive protein in Chinese Han patients with traumatic brain injury.

    PubMed

    Weng, Jian-Feng; Chen, Jun; Hong, Wei-Cong; Luo, Li-Feng; Yu, Wei; Luo, Shi-Da

    2013-02-01

    Visfatin is a newly identified pro-inflammatory adipokine and a genetic polymorphism -1535 C>T located in the visfatin gene promoter has been suggested to be associated with the regulation of visfatin expression in some inflammatory illness. However, there were some conflicting results regarding whether this variant is functional or not. This study aimed to examine the relations of the -1535 C>T single nucleotide polymorphism (SNP) of visfatin gene to the plasma visfatin and C-reactive protein concentrations in traumatic brain injury (TBI). 318 Chinese Han patients with TBI were recruited in this study. Plasma visfatin and C-reactive protein levels were significantly different between the genotypes in the SNP-1535 C>T even after adjustment for age, sex and body mass index. The genotype C-C had the highest plasma visfatin and C-reactive protein concentrations. The plasma visfatin and C-reactive protein concentrations between the variant genotypes C-T and T-T did not differ significantly. Plasma visfatin level was significantly associated with plasma C-reactive protein level using multivariate linear regression. Thus, the SNP-1535 C>T of visfatin gene seemed to be potentially involved in the inflammatory component of TBI through a decreased production of visfatin. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. c-MAF-dependent regulatory T cells mediate immunological tolerance to a gut pathobiont.

    PubMed

    Xu, Mo; Pokrovskii, Maria; Ding, Yi; Yi, Ren; Au, Christy; Harrison, Oliver J; Galan, Carolina; Belkaid, Yasmine; Bonneau, Richard; Littman, Dan R

    2018-02-15

    Both microbial and host genetic factors contribute to the pathogenesis of autoimmune diseases. There is accumulating evidence that microbial species that potentiate chronic inflammation, as in inflammatory bowel disease, often also colonize healthy individuals. These microorganisms, including the Helicobacter species, can induce pathogenic T cells and are collectively referred to as pathobionts. However, how such T cells are constrained in healthy individuals is not yet understood. Here we report that host tolerance to a potentially pathogenic bacterium, Helicobacter hepaticus, is mediated by the induction of RORγt + FOXP3 + regulatory T (iT reg ) cells that selectively restrain pro-inflammatory T helper 17 (T H 17) cells and whose function is dependent on the transcription factor c-MAF. Whereas colonization of wild-type mice by H. hepaticus promoted differentiation of RORγt-expressing microorganism-specific iT reg cells in the large intestine, in disease-susceptible IL-10-deficient mice, there was instead expansion of colitogenic T H 17 cells. Inactivation of c-MAF in the T reg cell compartment impaired differentiation and function, including IL-10 production, of bacteria-specific iT reg cells, and resulted in the accumulation of H. hepaticus-specific inflammatory T H 17 cells and spontaneous colitis. By contrast, RORγt inactivation in T reg cells had only a minor effect on the bacteria-specific T reg and T H 17 cell balance, and did not result in inflammation. Our results suggest that pathobiont-dependent inflammatory bowel disease is driven by microbiota-reactive T cells that have escaped this c-MAF-dependent mechanism of iT reg -T H 17 homeostasis.

  1. [Association between the methylenetetrahydrofolate reductase gene polymorphisms and haplotype with toxicity response of high dose methotrexate chemotherapy].

    PubMed

    Liao, Qing-Chuan; Li, Xiao-Lei; Liu, Si-Ting; Zhang, Yong; Li, Tian-Yuan; Qiu, Jin-Chun

    2012-07-01

    To investigate the association between single nucleotide polymorphisms (SNP) and its haplotypes of methylenetetrahydrofolate reductase (MTHFR) gene with high dose methotrexate (HDMTX)-induced toxicity in children with acute lymphoblastic leukemia (ALL). HDMTX-treated children with ALL (1.2 to 14-years old) were selected from inpatient and followed for a retrospective study. The toxicity response of HDMTX chemotherapy was evaluated using WHO common toxicity criteria. Sixty-one patients with therapy-related toxicity and 36 patients without therapy-related toxicity were genotyped for 2 SNP (677C > T and 1298A > C) of the MTHFR gene by polymerase chain reaction-restriction fragment length polymorphism. Frequency of haplotypes and linkage disequilibrium of MTHFR gene were analyzed by SHEsis program. The distribution of MTHFR gene 677C > T polymorphism did not appeare different between groups with or without toxicity response (χ(2) = 4.609, P = 0.100), but the 1298A > C polymorphism was significantly different (χ(2) = 10.192, P = 0.006). Individuals who carried C allele (AC + CC genotype) had a decreased risk of toxicity response compared to AA genotype (OR = 0.245, 95%CI: 0.099 - 0.607, P = 0.002). 677C > T and 1298A > C polymorphisms showed strong linkage disequilibrium (D' = 0.895). The CC haplotype was significantly associated with decreased risk of toxicity response (OR = 0.338, 95%CI: 0.155 - 0.738, P = 0.005), while the TA haplotype was significantly associated with the increased risk of toxicity response (OR = 1.907, 95%CI: 1.045 - 3.482, P = 0.035). MTHFR gene 1298C allele and CC haplotype might serve as protective factors while TA haplotype as a risk factor for the susceptibility to toxicity response of HDMTX chemotherapy in children with ALL.

  2. NAMPT -3186C/T polymorphism affects repaglinide response in Chinese patients with Type 2 diabetes mellitus.

    PubMed

    Sheng, Fei-Feng; Dai, Xing-Ping; Qu, Jian; Lei, Guang-Hua; Lu, Hong-Bin; Wu, Jing; Xu, Xiao-Jing; Pei, Qi; Dong, Min; Liu, Ying-Zi; Zhou, Hong-Hao; Liu, Zhao-Qian

    2011-08-01

    1. In the present study, we investigated the associations of nicotinamide phosphoribosyltransferase (NAMPT)-3186 C/T and -948G/T polymorphisms with the risk of Type 2 diabetes mellitus (T2DM) and their impact on the efficacy of repaglinide in Chinese Han T2DM patients. 2. In all, 170 patients with T2DM and 129 healthy controls were genotyped for NAMPT-948G>T and -3186C>T polymorphisms. Thirty-five patients with different NAMPT -3186 C/T genotypes and the same organic anion-transporting polypeptide 1B1 (OATP1B1521) T/C genotype were randomly selected to undergo 8 weeks preprandial repaglinide treatment (1 mg, three times daily). Serum fasting plasma glucose (FPG), post-prandial plasma glucose (PPG), glycated haemoglobin (HbAlc), fasting serum insulin (FINS), post-prandial serum insulin (PINS), triglyceride (TG), total cholesterol (CHO), homeostasis model assessment of insulin resistance (HOMA-IR), low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol (HDL-C) were determined before and after repaglinide treatment. 3. After repaglinide treatment for 8 consecutive weeks, there were significantly decreases in PFG, PPG, HbAlc, CHO and LDL-C, and increases in FINS, HDL-C and the HDL-C : LDL-C ratio, in T2DM patients. The elevated PINS value in patients with CT genotypes was significantly lower than that in patients with the CC and TT genotypes (P < 0.05) and there were significant differences in CHO between patients with the CT genotype and the CC or TT genotype (P < 0.05). 4. The data suggest that the NAMPT -3186C>T polymorphism is significantly associated with plasma levels of PINS and CHO in Chinese T2DM patients with repaglinide monotherapy. © 2011 The Authors. Clinical and Experimental Pharmacology and Physiology © 2011 Blackwell Publishing Asia Pty Ltd.

  3. Passive microwave device applications of high T(c) superconducting thin films

    NASA Astrophysics Data System (ADS)

    Lyons, W. G.; Withers, R. S.

    1990-11-01

    Superconductors with a transition temperature T(c) from 40 K to 125 K are analyzed, with focus placed on their behavior around the boiling point of liquid nitrogen (77 K). It is shown that high-T(c) superconductors are similar to conventional type-II superconductors with paired holes instead of paired electrons. The nature of the electromagnetic response of a superconductor is illustrated with a two-fluid model, and surface resistance and conductor loss are assessed. Several microwave applications of high-T(c) superconductors are outlined including a six-pole dielectric loaded cavity filter used in multiplexers on current communication satellites and a four-pole superconducting filter. An implementation of a chirp filter using superconducting striplines with a cascaded array of backward-wave couplers to achieve a downchirp is presented as well as a 60-GHz phased antenna utilizing microstrip lines in the feed network.

  4. Monoamine receptor interaction profiles of 4-thio-substituted phenethylamines (2C-T drugs).

    PubMed

    Luethi, Dino; Trachsel, Daniel; Hoener, Marius C; Liechti, Matthias E

    2018-05-15

    4-Thio-substituted phenethylamines (2C-T drugs) are potent psychedelics with poorly defined pharmacological properties. Because of their psychedelic effects, 2C-T drugs are sometimes sold as new psychoactive substances (NPSs). The aim of the present study was to characterize the monoamine receptor and transporter interaction profiles of a series of 2C-T drugs. We determined the binding affinities of 2C-T drugs at monoamine receptors and transporters in human cells that were transfected with the respective receptors or transporters. We also investigated the functional activation of serotonergic 5-hydroxytryptamine 2A (5-HT 2A ) and 5-HT 2B receptors, activation of human trace amine-associated receptor 1 (TAAR 1 ), and inhibition of monoamine uptake transporters. 2C-T drugs had high affinity for 5-HT 2A and 5-HT 2C receptors (1-54 nM and 40-350 nM, respectively). With activation potencies of 1-53 nM and 44-370 nM, the drugs were potent 5-HT 2A receptor and 5-HT 2B receptor, respectively, partial agonists. An exception to this were the benzylthiophenethylamines, which did not potently activate the 5-HT 2B receptor (EC 50  > 3000 nM). Furthermore, the compounds bound to serotonergic 5-HT 1A and adrenergic receptors. The compounds had high affinity for the rat TAAR 1 (5-68 nM) and interacted with the mouse but not human TAAR 1 . The 2C-T drugs did not potently interact with monoamine transporters (K i  > 4000 nM). The receptor binding profile of 2C-T drugs predicts psychedelic effects that are mediated by potent 5-HT 2 receptor interactions. This article is part of the Special Issue entitled 'Designer Drugs and Legal Highs.' Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. delta opioid receptors stimulate Akt-dependent phosphorylation of c-jun in T cells.

    PubMed

    Shahabi, Nahid A; McAllen, Kathy; Sharp, Burt M

    2006-02-01

    Activation of naive T cells markedly up-regulates the expression of delta opioid receptors (DORs). These receptors are bound by DOR peptides released by T cells, modulating T cell functions such as interleukin-2 production, cellular proliferation, and chemotaxis. Previous studies have shown that DOR agonists [e.g., [D-Ala(2)-D-Leu(5)]-enkephalin (DADLE)] modulate T cell antigen receptor signaling through mitogen-activated protein kinases (MAPKs; i.e., extracellular signal-regulated kinases 1 and 2) and that DORs directly induce phosphorylation of activating transcription factor-2 (implicated in cytokine gene transcription) and its association with the MAPK c-jun1 NH(2)-terminal kinase (JNK). Such observations suggest that DORs may induce the phosphorylation of c-jun. These experiments were performed to test this hypothesis and determine the potential roles of phosphoinositide 3-kinase (PI3K) and Akt (protein kinase B). DADLE (10(-10) to 10(-6) M) dose-dependently induced c-jun phosphorylation. This was blocked by pertussis toxin and the DOR-specific antagonist naltindole. Fluorescence flow cytometry showed that DADLE significantly stimulated c-jun phosphorylation by T cells. DADLE stimulated phosphorylation of membrane-associated Akt; wortmannin and LY294002 ([2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one]), specific inhibitors of PI3K, abolished the DADLE-induced phosphorylation of c-jun. Finally, inhibitors of Akt and JNK blocked DADLE-induced phosphorylation of c-jun. Thus, activated DORs directly stimulate c-jun phosphorylation through a PI3K-dependent pathway in T cells, apparently involving Akt. This implies that DORs activate JNK through a novel pathway dependent on PI3K and Akt, thereby regulating the function of activator protein-1 transcription complexes containing c-jun and other transcription partners.

  6. LINC00673 rs11655237 C>T confers neuroblastoma susceptibility in Chinese population

    PubMed Central

    Zhang, Zhuorong; Chang, Yitian; Jia, Wei; Zhang, Jiao; Zhang, Ruizhong; Zhu, Jinhong; Yang, Tianyou

    2018-01-01

    Neuroblastoma, which accounts for approximately 10% of all pediatric cancer-related deaths, has become a therapeutic challenge and global burden attributed to poor outcomes and mortality rates of its high-risk form. Previous genome-wide association studies (GWASs) identified the LINC00673 rs11655237 C>T polymorphism to be associated with the susceptibility of several malignant tumors. However, the association between this polymorphism and neuroblastoma susceptibility is not clear. We genotyped LINC00673 rs11655237 C>T in 393 neuroblastoma patients in comparison with 812 age-, gender-, and ethnicity-matched healthy controls. We found a significant association between the LINC00673 rs11655237 C>T polymorphism and neuroblastoma risk (TT compared with CC: adjusted odds ratio (OR) =1.80, 95% confidence interval (CI) =1.06–3.06, P=0.029; TT/CT compared with CC: adjusted OR =1.31, 95% CI =1.02–1.67, P=0.033; and T compared with C: adjusted OR =1.29, 95% CI =1.06–1.58, P=0.013). Furthermore, stratified analysis indicated that the rs11655237 T allele carriers were associated with increased neuroblastoma risk for patients with tumor originating from the adrenal gland (adjusted OR =1.51, 95% CI =1.06–2.14, P=0.021) and International Neuroblastoma Staging System (INSS) stage IV disease (adjusted OR =1.60, 95% CI =1.12–2.30, P=0.011). In conclusion, we verified that the LINC00673 rs11655237 C>T polymorphism might be associated with neuroblastoma susceptibility. Prospective studies with a large sample size and different ethnicities are needed to validate our findings. PMID:29339420

  7. LINC00673 rs11655237 C>T confers neuroblastoma susceptibility in Chinese population.

    PubMed

    Zhang, Zhuorong; Chang, Yitian; Jia, Wei; Zhang, Jiao; Zhang, Ruizhong; Zhu, Jinhong; Yang, Tianyou; Xia, Huimin; Zou, Yan; He, Jing

    2018-02-28

    Neuroblastoma, which accounts for approximately 10% of all pediatric cancer-related deaths, has become a therapeutic challenge and global burden attributed to poor outcomes and mortality rates of its high-risk form. Previous genome-wide association studies (GWASs) identified the LINC00673 rs11655237 C>T polymorphism to be associated with the susceptibility of several malignant tumors. However, the association between this polymorphism and neuroblastoma susceptibility is not clear. We genotyped LINC00673 rs11655237 C>T in 393 neuroblastoma patients in comparison with 812 age-, gender-, and ethnicity-matched healthy controls. We found a significant association between the LINC00673 rs11655237 C>T polymorphism and neuroblastoma risk (TT compared with CC: adjusted odds ratio (OR) =1.80, 95% confidence interval (CI) =1.06-3.06, P =0.029; TT/CT compared with CC: adjusted OR =1.31, 95% CI =1.02-1.67, P =0.033; and T compared with C: adjusted OR =1.29, 95% CI =1.06-1.58, P =0.013). Furthermore, stratified analysis indicated that the rs11655237 T allele carriers were associated with increased neuroblastoma risk for patients with tumor originating from the adrenal gland (adjusted OR =1.51, 95% CI =1.06-2.14, P =0.021) and International Neuroblastoma Staging System (INSS) stage IV disease (adjusted OR =1.60, 95% CI =1.12-2.30, P =0.011). In conclusion, we verified that the LINC00673 rs11655237 C>T polymorphism might be associated with neuroblastoma susceptibility. Prospective studies with a large sample size and different ethnicities are needed to validate our findings. © 2018 The Author(s).

  8. Methotrexate pharmacogenetics in Uruguayan adults with hematological malignant diseases.

    PubMed

    Giletti, Andrea; Vital, Marcelo; Lorenzo, Mariana; Cardozo, Patricia; Borelli, Gabriel; Gabus, Raúl; Martínez, Lem; Díaz, Lilian; Assar, Rodrigo; Rodriguez, María Noel; Esperón, Patricia

    2017-11-15

    Individual variability is among the causes of toxicity and interruption of treatment in acute lymphoblastic leukemia (ALL) and severe non-Hodgkin lymphoma (NHL) patients under protocols including Methotrexate (MTX): 2,4-diamino-N10-methyl propyl-glutamic acid. 41 Uruguayan patients were recruited. Gene polymorphisms involved in MTX pathway were analyzed and their association with treatment toxicities and outcome was evaluated. Genotype distribution and allele frequency were determined for SLC19A1 G 80 A, MTHFR C 677 T and A 1298 C, TYMS 28bp copy number variation, SLCO1B1 T 521 C, DHFR C -1610 G/T, DHFR C -680 A, DHFR A -317 G and DHFR 19bp indel. Multivariate analysis showed that DHFR -1610 G/T (OR=0.107, p=0.018) and MTHFR 677 T alleles (OR=0.12, p=0.026) had a strong protective effect against hematologic toxicity, while DHFR -1610 CC genotype increased this toxicity (OR=9, p=0.045). No more associations were found. The associations found between gene polymorphisms and toxicities in this small cohort are encouraging for a more extensive research to gain a better dose individualization in adult ALL and NHL patients. Besides, genotype distribution showed to be different from other populations, reinforcing the idea that genotype data from other populations should not be extrapolated to ours. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The influence of folate pathway polymorphisms on high-dose methotrexate-related toxicity and survival in children with non-Hodgkin malignant lymphoma

    PubMed Central

    Erculj, Nina; Kotnik, Barbara Faganel; Debeljak, Marusa; Jazbec, Janez; Dolzan, Vita

    2014-01-01

    Background We evaluated the influence of folate pathway polymorphisms on high-dose methotrexate (HD-MTX) related toxicity in paediatric patients with T-cell non-Hodgkin lymphoma (NHL). Patients and methods In total, 30 NHL patients were genotyped for selected folate pathway polymorphisms. Results Carriers of at least one MTHFR 677T allele had significantly higher MTX area under the time-concentration curve levels at third MTX cycle (P = 0.003). These patients were also at higher odds of leucopoenia (P = 0.006) or thrombocytopenia (P = 0.041) and had higher number of different HD-MTX-related toxicity (P = 0.035) compared to patients with wild-type genotype. Conclusions Our results suggest an important role of MTHFR 677C>T polymorphism in the development of HD-MTX-related toxicity in children with NHL. PMID:25177243

  10. MMP-8 C-799T and MMP-8 C+17G polymorphisms in mild and severe preeclampsia: Association between MMP-8 C-799T with susceptibility to severe preeclampsia.

    PubMed

    Rahimi, Ziba; Zangeneh, Maryam; Rezaeyan, Arezoo; Shakiba, Ebrahim; Rahimi, Zohreh

    2018-01-01

    The aim of present study was to determine the role of matrix metalloproteinase-8 (MMP-8) C-799T (rs11225395) and C+17 (rs2155052) polymorphisms in susceptibility to preeclampsia. In a case-control study, 256 pregnant women including 152 women with preeclampsia (86 women with mild preeclampsia and 66 women with severe preeclampsia) and 104 women with normal pregnancy from Western Iran with Kurdish ethnic background were investigated for MMP-8 C-799T and C + 17G polymorphisms using polymerase chain reaction-restriction fragment length polymorphism method. Comparing the MMP-8 TT genotype with the combined genotype of CC+CT (recessive model) indicated a significantly higher frequency of the MMP-8 TT genotype (47%) in severe preeclamptic patients than that in healthy pregnant women (30.8%) that was associated with 1.99-fold increased risk of severe preeclampsia (95% CI = 1.05-3.77, p = 0.034). The frequency of MMP-8 G allele was 27.3% in all preeclamptic patients compared to 30.2% in controls (p = 0.56). Also, no significant difference was detected comparing the frequency of G allele in mild (26.6%, p = 0.46) and severe preeclamptic patients (28.4%, p = 0.75) with controls (30.2%). Our study demonstrated that the MMP-8 C-799T is associated with the risk of developing severe preeclampsia during pregnancy. However, the MMP-8 C + 17G polymorphism might not be a risk factor for susceptibility to preeclampsia.

  11. Association of -31T>C and -511 C>T polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients.

    PubMed

    Kim, So-Hee; Mok, Jee-Won; Kim, Hyun-Seok; Joo, C K

    2008-01-01

    To investigate the genetic association between unrelated Korean keratoconus patients and interleukin 1 alpha (IL1A), interleukin 1 beta (IL1B), and IL1 receptor antagonist (IL1RN) gene polymorphisms. We investigated the association between IL1A (rs1800587, rs2071376, and rs17561), IL1B (rs1143627, rs16944, rs1143634, and rs1143633), and IL1RN (rs419598, rs423904, rs424078, and rs315952, variable number tandem repeat [VNTR]) polymorphisms in 100 unrelated Korean keratoconus patients. One hundred control individuals without any corneal disease were selected from the general population. Polymerase chain reaction (PCR) - restriction fragment length polymorphism (RFLP) analysis and direct sequencing were used to screen for genetic variations in the IL1 gene cluster. Haplotypes for the IL1 gene cluster were constructed using Haploview version 4.0. We analyzed a total of 12 polymorphic sites in the IL1 gene cluster. Among them, the -511 (rs16944) and -31 (rs1143627) positions in the promoter region of IL1B were significantly different between patient and control groups. The C allele of rs16944 (-511C>T, p=0.022, odds ratio of risk [OR]=1.46, 95% confidence intervals [CI] 0.94<2.27) and the T allele of rs1143627 (-31T>C, p=0.025, OR=1.43, 95% CI 0.92<2.22) were associated with a significantly increased risk of keratoconus in Korean patients. Linkage of the two alleles, -31*C and -511*T, was associated with an increased risk for keratoconus with OR=2.38 (p=0.012, 95% CI=1.116-5.046). The *C/*A genotype of rs2071376 in IL1A intron 6 was significantly different between the keratoconus patients and control subjects (p=0.034, OR=0.59, 95% CI 0.32<1.11). Other polymorphisms did not show an association with keratoconus risk. This is the first report of IL1 gene cluster mutation screening in Korean keratoconus patients. Significant differences in allelic frequency of IL1B between keratoconus patients and the control group suggest that IL1B polymorphisms may play a role in the

  12. T cell cytokine synthesis at the single-cell level in BALB/c and C57BL/6 mice infected with ectromelia virus.

    PubMed

    Szulc, Lidia; Gieryńska, Małgorzata; Winnicka, Anna; Martyniszyn, Lech; Boratyńska-Jasińska, Anna; Niemiałtowski, Marek

    2012-04-20

    The purpose of the study was to evaluate synthesis of IFN-γ, IL-2, TNF-α (Th1/Tc1) and IL-4 (Th2/Tc2) at CD4+ T and CD8+ T cell level in BALB/c and C57BL/6 mice in the course of infection with ectromelia virus Moscow strain (ECTV-MOS). Synthesis of IFN-γ, IL-2, TNF-α and IL-4 in CD4+ T and CD8+ T cells in draining lymph nodes (DLNs) and spleens of BALB/c and C57BL/6 mice was detected by intracellular staining and flow cytometry analysis. Our results showed an increase in percentage of IFN-γ -synthesizing CD8+ T cells only in DLNs and spleens of C57BL/6 mice at the early stages of infection. Moreover, synthesis of IL-2 by CD4+ and CD8+ T cells occurred earlier and was stronger in C57BL/6 mice compared to BALB/c mice. The increase in TNF-α synthesis by CD4+ T and CD8+ T cells was detected mainly in DLNs of infected animals. We did not observe any changes in the percentage of IL-4-synthesizing T cells (Th2 and Tc2) during ECTV-MOS infection in both strains of mice. Results presented in this study confirmed that during the early phase of infection, C57BL/6 mice mounted a strong Th1 and Tc1 immune response against ECTV-MOS. BALB/c mice that survived the acute stage of mousepox, were able to mount an adequate cellular response to ECTV-MOS, however successful elimination of the virus in susceptible mice may occur more slowly compared to resistant strains of mice. Intracellular detection of IL-4 by flow cytometry was not sensitive enough to distinguish the differences in IL-4-synthesizing Th2 and Tc2 cells between susceptible and resistant strains of mice during ECTV-MOS infection.

  13. Reflective limiters based on self-induced violation of C T symmetry

    NASA Astrophysics Data System (ADS)

    Makri, Eleana; Thomas, Roney; Kottos, Tsampikos

    2018-04-01

    Non-Hermitian bipartite photonic lattices with charge-conjugation (C T ) symmetry can support resonant defect modes which are resilient to bipartite losses and structural imperfections. When, however, a (self-)induced violation of the C T symmetry occurs via tiny permittivity variations, the resonant mode is exposed to the bipartite losses and it is destroyed. Consequently, the transmission peak is suppressed while the reflectance becomes (almost) unity. We propose the use of such photonic systems as power switches, limiters, and sensors.

  14. Methylenetetrahydrofolate reductase gene polymorphism and risk of chronic myelogenous leukemia: a meta-analysis.

    PubMed

    Li, Chen; Yichao, Jin; Jiaxin, Lin; Yueting, Zhang; Qin, Lu; Tonghua, Yang

    2015-01-01

    Reported evidence supports a role for methylenetetrahydrofolate reductase (MTHFR) in the risk of chronic myelogenous leykemia (CML). However, these reports arrived at non-conclusive and even conflicting results regarding the association between two common MTHFR polymorphisms (C677T and A1298C) and CML risk. Thus, a meta-analysis was carried out to clarify a more precise association between these two polymorphisms and the CML risk by updating the available publications. Pooled odds ratios (OR) with corresponding 95% confidence interval (95% CI) and stratification analysis were performed to estimate the relationship between MTHFR polymorphisms and the risk of CML under different genetic comparison models. Data from the meta-analysis showed no significant association between MTHFR C677T polymorphism and CML risk. However, significant associations were found between MTHFR A1298C variants and CML risk under homozygous comparison model (CC vs AA, OR=1.62, 95% CI=1.11-2.36, p=0.01) and dominant comparison model (CC+AC vs AA, OR=1.68, 95% CI=1.17-2.43, p=0.005) in overall population; especially more obvious impacts were noticed for Asian populations in subgroup analysis for homozygous model (CC vs AA, OR=2.00, 95% CI=1.25-3.21, p=0.004) and dominant model (CC+AC vs AA, OR=2.49, 95% CI=1.42-4.36, p=0.001), but this did not apply in Caucasian populations. The results of this meta-analysis suggested no significant association between MTHFR C677T polymorphism and CML risk, while an increased CML risk was noticed for 1298C variant carriers, especially in Asian populations but not in Caucasian populations, which suggested ethnicity differences between MTHFR A1298C polymorphisms and risk of CML.

  15. The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

    PubMed

    Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

    2017-06-01

    The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Comparative evaluation of three obturation techniques in primary incisors using digital intra-oral receptor and C.B.C.T-an in vitro study.

    PubMed

    Akhil, Jose E J; Prashant, Babaji; Shashibushan, K K

    2018-05-10

    Successful pulpectomy in primary teeth depends on quality of obturation. It can be evaluated using digital intra-oral receptor (D.I.O.R) and cone beam computed tomography (C.B.C.T). The purposes of this study were to compare 3 different obturation techniques such as lentulospiral, insulin syringe, and endodontic plugger in primary incisors and to evaluate its quality of obturation using D.I.O.R and C.B.C.T technique. Thirty-three extracted primary incisors were biomechanically prepared and obturated with zinc oxide eugenol cement by 3 different obturation techniques. The obturation was evaluated for length of obturation and voids using D.I.O.R and C.B.C.T methods. There was a statistically significant difference between all the groups in length of obturation (P = 0.02) in both D.I.O.R and C.B.C.T. Significant differences (P = 0.03) were present in number of voids among 3 obturation techniques in C.B.C.T. Statistically more voids were observed with D.I.O.R in lentulospiral (P = 0.04) group and in insulin syringe (P = 0.02) group. Acceptable result was obtained with lentulospiral in length of obturation compared to insulin syringe and endodontic plugger technique. Insulin syringe technique resulted in increased underfilling with least number of voids. More number of voids were seen in middle one-third and least number of voids were observed at apical one third of the root among all the 3 techniques of obturation. The study concluded that void identification is improved with D.I.O.R compared to C.B.C.T. Lentulospiral reported effective length of obturation, while insulin syringe with least number of voids. D.I.O.R (2-Dimensional) is efficient in detecting voids compared to C.B.C.T (3-Dimensional) in obturated primary teeth.

  17. Methylenetetrahydrofolate reductase gene polymorphisms and acute lymphoblastic leukemia risk: a meta-analysis based on 28 case-control studies.

    PubMed

    Tong, Na; Sheng, Xiaojing; Wang, Meilin; Fang, Yongjun; Shi, Danni; Zhang, Zhizhong; Zhang, Zhengdong

    2011-10-01

    Methylenetetrahydrofolate reductase (MTHFR) is involved in DNA methylation and nucleotide synthesis. Accumulated evidence has demonstrated that C677T and A1298C polymorphisms of the MTHFR gene are associated with acute lymphoblastic leukemia (ALL) risk, but the results have been inconclusive. To determine a more precise estimation, we performed a meta-analysis of 28 studies with 4240 cases and 9289 controls. We found that the 677TT genotype showed a reduced risk of ALL compared with the 677CC genotype in the overall population (odds ratio [OR] 0.76, 95% confidence interval [CI] 0.61-0.92). The reduced risk was pronounced only among the Caucasian population (OR 0.68, 95% CI 0.51-0.90), not the Asian (OR 0.89, 95% CI 0.75-1.05). For the MTHFR A1298C polymorphism, no significant association with ALL susceptibility was observed in the pooled analyses. However, significantly increased ALL risk was found in childhood in the comparison of 1298CA versus AA genotype. This study provides evidence that MTHFR polymorphisms may play an important role in the development of ALL.

  18. Maternal MTHFR polymorphisms and risk of spontaneous abortion.

    PubMed

    Rodríguez-Guillén, María del Rosario; Torres-Sánchez, Luisa; Chen, Jia; Galván-Portillo, Marcia; Blanco-Muñoz, Julia; Anaya, Miriam Aracely; Silva-Zolezzi, Irma; Hernández-Valero, María A; López-Carrillo, Lizbeth

    2009-01-01

    To asses the association between intake of folate and B vitamins and the incidence of spontaneous abortion (SA) according to the maternal methylenetetrahydrofolate reductase (MTHFR) polymorphisms (677 C>T and 1298 A>C). We conducted a nested case-control study within a perinatal cohort of women recruited in the state of Morelos, Mexico. Twenty-three women with SA were compared to 74 women whose pregnancy survived beyond week 20th. Intake of folate and B vitamins respectively, was estimated using a validated food frequency questionnaire. Maternal MTHFR polymorphisms were determined by PCR-RFLP and serum homocysteine levels by HPLC. Carriers of MTHFR 677TT and 1298AC genotypes respectively showed an increased risk of SA (OR 677TT vs. CC/CT=5.0; 95% CI: 1.2, 20.9 and OR 1298 AC vs. AA=5.5; 95% CI: 1.1, 26.6). Our results support the role of MTHFR polymorphisms as a risk factor for SA, regardless of dietary intake of B vitamins.

  19. Methylene tetrahydrofolate reductase gene polymorphism in Egyptian children with acute lymphoblastic leukemia.

    PubMed

    Tantawy, Azza A G; El-Bostany, Eman A; Adly, Amira A M; Abou El Asrar, Mohammed; El-Ghouroury, Eman A; Abdulghaffar, Esmat E

    2010-01-01

    Genetic variations of the enzymes involved in chemotherapy metabolism in cancer patients may play a role in determining relapse and toxicity risks. Methotrexate is a key drug in acute lymphoblastic leukemia (ALL) treatment; it inhibits DNA replication by blocking the conversion of 5,10 methylene tetrahydrofolate to 5-methylene tetrahydrofolate by methylene tetrahydrofolate reductase (MTHFR). MTHFR is central to folate metabolism and has two common functional polymorphisms (C677>T and A1298>C). The present study aimed to assess the prevalence of MTHFR polymorphisms C677>T and A1298>C in Egyptian children with ALL and the relation to the frequency of drug-induced complications and relapse rate. Forty ALL patients were included in the study. They were treated according to modified ALL-BFM 90 protocol, and were followed up for 3.1-6.5 years. The severity and duration of hepatic, mucosal and infectious complications during therapy were reported. MTHFR genotyping was done with a PCR-based restriction fragment length polymorphism assay. The MTHFR C677>T polymorphic allele frequencies were 40, 27.5, and 32.5% for TT, CT, and CC genotypes, respectively among the studied ALL patients. The MTHFR A1298>C polymorphic allele frequencies were 40, 35, and 25% for AA, AC, and CC genotypes, respectively. Methotrexate therapy was significantly associated with increased grade III/IV toxicity in TT genotype: diarrhea in 81.3%, oral mucositis in 81.3%, elevated transaminases in 87.5%, neutropenia in 78.7% compared to values of 7.7, 7.7, 15.3, and 7.7% in CC genotype, respectively (P < 0.0001, P < 0.0001, P < 0.0001, and P = 0.03). The 677 TT genotype was significantly associated with relapse in 5 years in 56.3%, compared to 18.2% in CT and 0% in CC alleles. The overall 5 years survival was significantly lower in 677 TT (50%) compared with CC genotypes (92.3%) (P = 0.001). No significant relation was found between MTHFR A1298C polymorphism and the risks of therapy induced complications

  20. Methylenetetrahydrofolate reductase and thymidylate synthase genotypes and risk of acute graft-versus-host disease following hematopoietic cell transplantation for chronic myelogenous leukemia.

    PubMed

    Robien, Kim; Bigler, Jeannette; Yasui, Yutaka; Potter, John D; Martin, Paul; Storb, Rainer; Ulrich, Cornelia M

    2006-09-01

    Methylenetetrahydrofolate reductase (MTHFR) and thymidylate synthase (TS) play key roles in intracellular folate metabolism. Polymorphisms in these enzymes have been shown to modify toxicity of methotrexate (MTX) after hematopoietic cell transplantation. In this study, we evaluated the risk of acute graft-versus-host disease (GVHD) associated with genetic variation in recipient and donor MTHFR and TS genotypes to assess whether genotype alters the efficacy of MTX in acute GVHD prophylaxis. Data on the transplantation course were abstracted from medical records for 304 adults who received allogeneic hematopoietic cell transplants. MTHFR (C677T and A1298C) and TS (enhancer-region 28-base pair repeat, TSER, and 1494del6) genotypes were determined using polymerase chain reaction/restriction fragment length polymorphism and TaqMan assays. Multivariable logistic regression was used to assess the associations between genotypes and risk of acute GVHD. Compared with recipients with the wild-type MTHFR 677CC genotype, those with the variant 677T allele showed a decreased risk of detectable acute GVHD (677CT: odds ratio, 0.8; 95% confidence interval, 0.4-1.6; 677TT: odds ratio, 0.4; 95% confidence interval, 0.2-0.8; P for trend = .01). The variant MTHFR 1298C allele in recipients was associated with an increased risk of acute GVHD compared with the wild-type MTHFR 1298AA genotype (1298AC: odds ratio, 2.0; 95% confidence interval, 1.1-3.9; 1298CC: odds ratio, 3.6; 95% confidence interval, 1.0-12.7; P for trend < .01). No association with risk of acute GVHD was observed for donor MTHFR genotypes or for recipient or donor TS genotypes, with the exception of an increase in acute GVHD among recipients whose donors had the TSER 3R/2R genotype (odds ratio, 3.0; 95% confidence interval, 1.3-7.2). These findings indicate that host, but not donor, MTHFR genotypes modify the risk of acute GVHD in recipients receiving MTX, in a manner consistent with our previously reported associations

  1. No evidence of association of methylenetetrahydrofolate reductase polymorphism with occurrence of second neoplasms after treatment of childhood leukemia.

    PubMed

    Jazbec, Janez; Kitanovski, Lidija; Aplenc, Richard; Debeljak, Marusa; Dolzan, Vita

    2005-06-01

    Methylenetetrahydrofolate reductase (MTHFR) polymorphisms have been associated not only with the risk for acute lymphoblastic leukemia (ALL) in adults and children, but also with increased methotrexate toxicity. The present study aimed to investigate whether MTHFR polymorphisms modify the risk for development of secondary malignancies in children treated for ALL with protocols that included high-dose methotrexate. MTHFR genotypes were determined in DNA samples isolated from archived bone marrow smears of 15 patients with a second malignancy and a matched control group of 30 patients who did not developed a second malignancy after the treatment for ALL. The frequencies of MTHFR C677T and A1298C genotypes in all patients were: C677T: CC 40%, CT 46.7% and TT 13.3% and A1298C: AA 46.7%, AC 44.4% and CC 8.9%. The relative risk for second malignancy was not significantly increased in ALL patients having at least one polymorphic C667T [odds ratio (OR) 1.51; 95% confidence interval (CI) 0.43-5.31] or one polymorphic A1298C allele (OR 1; 95% CI 0.29?-?3.46). Our study suggests that MTHFR polymorphisms are not associated with increased risk of second cancer in children treated with high-dose methotrexate.

  2. Hepatitis C Virus Induces Regulatory T Cells by Naturally Occurring Viral Variants to Suppress T Cell Responses

    PubMed Central

    Cusick, Matthew F.; Schiller, Jennifer J.; Gill, Joan C.; Eckels, David D.

    2011-01-01

    Regulatory T cell markers are increased in chronically infected individuals with the hepatitis C virus (HCV), but to date, the induction and maintenance of Tregs in HCV infection has not been clearly defined. In this paper, we demonstrate that naturally occurring viral variants suppress T cell responses to cognate NS3358-375 in an antigen-specific manner. Of four archetypal variants, S370P induced regulatory T cell markers in comparison to NS3358-375-stimulated CD4 T cells. Further, the addition of variant-specific CD4 T cells back into a polyclonal culture in a dose-dependent manner inhibited the T cell response. These results suggest that HCV is able to induce antigen-specific regulatory T cells to suppress the antiviral T cell response in an antigen-specific manner, thus contributing to a niche within the host that could be conducive to HCV persistence. PMID:21197453

  3. T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

    PubMed

    Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

    1994-04-12

    The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

  4. Synthesis and structure of the extended phosphazane ligand [(1,4-C6H4){N(μ-PN(t)Bu)2N(t)Bu}2](4).

    PubMed

    Sevilla, Raquel; Less, Robert J; García-Rodríguez, Raúl; Bond, Andrew D; Wright, Dominic S

    2016-02-07

    The reaction of the phenylene-bridged precursor (1,4-C6H4)[N(PCl2)2]2 with (t)BuNH2 in the presence of Et3N gives the new ligand precursor (1,4-C6H4)[N(μ-N(t)Bu)2(PNH(t)Bu)2]2, deprotonation of which with Bu2Mg gives the novel tetraanion [(1,4-C6H4){N(μ-N(t)Bu)2(PN(t)Bu)2}2](4-).

  5. Capacitance of Ti 3C 2T x MXene in Ionic Liquid Electrolyte

    DOE PAGES

    Lin, Zifeng; Barbara, Daffos; Taberna, Pierre-Louis; ...

    2016-04-14

    Ti 3C 2T x MXene, a two-dimensional (2D) early transition metal carbide, has shown an extremely high volumetric capacitance in aqueous electrolytes, but in a narrow voltage window (less than 1.23 V). The utilization of MXene materials in ionic liquid electrolytes with a large voltage window has never been addressed. Here, we report the preparation of the Ti 3C 2T x MXene ionogel film by vacuum filtration for use as supercapacitor electrodes operating in 1-Ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EMI-TFSI) neat ionic liquid electrolyte. Due to the disordered structure of the Ti 3C 2T x hydrogel film and a stable spacing after vacuummore » drying, achieved through ionic liquid electrolyte immersion of the Ti 3C 2T x hydrogel film, the Ti 3C 2T x surface became accessible to EMI + and TFSI - ions. A capacitance of 70 F g -1 together with a large voltage window of 3 V was obtained at a scan rate of 20 mV s -1 in neat EMI-TFSI electrolyte. The electrochemical signature indicates a capacitive behavior even at a high scan rate (500 mV s -1) and a high power performance. This work opens up the possibilities of using MXene materials with various ionic liquid electrolytes.« less

  6. Testing Lorentz and C P T invariance with ultracold neutrons

    NASA Astrophysics Data System (ADS)

    Martín-Ruiz, A.; Escobar, C. A.

    2018-05-01

    In this paper we investigate, within the standard model extension framework, the influence of Lorentz- and C P T -violating terms on gravitational quantum states of ultracold neutrons. Using a semiclassical wave packet, we derive the effective nonrelativistic Hamiltonian which describes the neutrons vertical motion by averaging the contributions from the perpendicular coordinates to the free falling axis. We compute the physical implications of the Lorentz- and C P T -violating terms on the spectra. The comparison of our results with those obtained in the GRANIT experiment leads to an upper bound for the symmetries-violation cμν n coefficients. We find that ultracold neutrons are sensitive to the ain and ein coefficients, which thus far are unbounded by experiments in the neutron sector. We propose two additional problems involving ultracold neutrons which could be relevant for improving our current bounds; namely, gravity-resonance spectroscopy and neutron whispering gallery wave.

  7. Significance of 5,10-methylenetetrahydrofolate reductase gene variants in acute lymphoblastic leukemia in Indian population: an experimental, computational and meta-analysis.

    PubMed

    Bellampalli, Ravishankara; Phani, Nagaraja M; Bhat, Kamalakshi G; Prasad, Krishna; Bhaskaranand, Nalini; Guruprasad, Kanive P; Rai, Padmalatha S; Satyamoorthy, Kapaettu

    2015-05-01

    Acute lymphoblastic leukemia (ALL) arises due to several genetic alterations in progenitor cells, and methotrexate is frequently used as part of the treatment regimen. Although there is evidence for an effect of 5,10-methylenetetrahydrofolate reductase gene (MTHFR) C677T and A1298C variations on drug response in ALL, its risk association for ALL is still unresolved. In a case-control study of 203 patients with ALL and 246 controls and meta-analysis in the Indian population, we showed an insignificant association of MTHFR C677T and A1298C genotypes with childhood and adult ALL. Comprehensive in silico characterization of non-synonymous single nucleotide polymorphisms (nsSNPs) and SNPs of the 3' untranslated region (UTR) revealed nine nsSNPs as deleterious, and three SNPs in the 3'UTR could possibly alter the binding of miRNAs. The study revealed that several overlooked SNPs may contribute to the risk of ALL susceptibility and further studies of these SNPs with functional characterization in a large sample size are required to understand the significant role of MTHFR in ALL development.

  8. C2C12 myotubes inhibit the proliferation and differentiation of 3T3-L1 preadipocytes by reducing the expression of glucocorticoid receptor gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chu, Weiwei; Wei, Wei; Yu, Shigang

    Obesity is a well-established risk factor to health for its relationship with insulin resistance, diabetes and metabolic syndrome. Myocyte-adipocyte crosstalk model plays a significant role in studying the interaction of muscle and adipose development. Previous related studies mainly focus on the effects of adipocytes on the myocytes activity, however, the influence of myotubes on the preadipocytes development remains unclear. The present study was carried out to settle this issue. Firstly, the co-culture experiment showed that the proliferation, cell cycle, and differentiation of 3T3-L1 preadipocytes were arrested, and the apoptosis was induced, by differentiated C2C12 myotubes. Next, the sensitivity of 3T3-L1more » preadipocytes to glucocorticoids (GCs), which was well known as cell proliferation, differentiation, apoptosis factor, was decreased after co-cultured with C2C12 myotubes. What's more, our results showed that C2C12 myotubes suppressed the mRNA and protein expression of glucocorticoid receptor (GR) in 3T3-L1 preadipocytes, indicating the potential mechanism of GCs sensitivity reduction. Taken together, we conclude that C2C12 myotubes inhibited 3T3-L1 preadipocytes proliferation and differentiation by reducing the expression of GR. These data suggest that decreasing GR by administration of myokines may be a promising therapy for treating patients with obesity or diabetes. - Highlights: • C2C12 myotubes inhibited proliferation and differentiation of 3T3-L1 preadipocytes. • C2C12 myotubes arrested cell cycle of 3T3-L1 preadipocytes. • C2C12 myotubes induced apoptosis of 3T3-L1 preadipocytes. • C2C12 inhibit 3T3-L1 cells by reducing the expression of glucocorticoid receptor gene.« less

  9. YrdC exhibits properties expected of a subunit for a tRNA threonylcarbamoyl transferase.

    PubMed

    Harris, Kimberly A; Jones, Victoria; Bilbille, Yann; Swairjo, Manal A; Agris, Paul F

    2011-09-01

    The post-transcriptional nucleoside modifications of tRNA's anticodon domain form the loop structure and dynamics required for effective and accurate recognition of synonymous codons. The N(6)-threonylcarbamoyladenosine modification at position 37 (t(6)A(37)), 3'-adjacent to the anticodon, of many tRNA species in all organisms ensures the accurate recognition of ANN codons by increasing codon affinity, enhancing ribosome binding, and maintaining the reading frame. However, biosynthesis of this complex modification is only partially understood. The synthesis requires ATP, free threonine, a single carbon source for the carbamoyl, and an enzyme yet to be identified. Recently, the universal protein family Sua5/YciO/YrdC was associated with t(6)A(37) biosynthesis. To further investigate the role of YrdC in t(6)A(37) biosynthesis, the interaction of the Escherichia coli YrdC with a heptadecamer anticodon stem and loop of lysine tRNA (ASL(Lys)(UUU)) was examined. YrdC bound the unmodified ASL(Lys)(UUU) with high affinity compared with the t(6)A(37)-modified ASL(Lys)(UUU) (K(d) = 0.27 ± 0.20 μM and 1.36 ± 0.39 μM, respectively). YrdC also demonstrated specificity toward the unmodified versus modified anticodon pentamer UUUUA and toward threonine and ATP. The protein did not significantly alter the ASL architecture, nor was it able to base flip A(37), as determined by NMR, circular dichroism, and fluorescence of 2-aminopuine at position 37. Thus, current data support the hypothesis that YrdC, with many of the properties of a putative threonylcarbamoyl transferase, most likely functions as a component of a heteromultimeric protein complex for t(6)A(37) biosynthesis.

  10. Origin of the emergence of higher T c than bulk in iron chalcogenide thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seo, Sehun; Kang, Jong-Hoon; Oh, Myeong Jun

    Fabrication of epitaxial FeSe xTe 1-x thin films using pulsed laser deposition (PLD) enables improving their superconducting transition temperature (T c) by more than ~40% than their bulk T c. Intriguingly, T c enhancement in FeSe xTe 1-x thin films has been observed on various substrates and with different Se content, x. To date, various mechanisms for T c enhancement have been reported, but they remain controversial in universally explaining the T c improvement in the FeSe xTe 1-x films. In this report, we demonstrate that the controversies over the mechanism of T c enhancement are due to the abnormalmore » changes in the chalcogen ratio (Se:Te) during the film growth and that the previously reported T c enhancement in FeSe 0.5Te 0.5 thin films is caused by a remarkable increase of Se content. Although our FeSe xTe 1-x thin films were fabricated via PLD using a Fe 0.94Se 0.45Te 0.55 target, the precisely measured composition indicates a Se-rich FeSe xTe 1-x (0.6 < x < 0.8) as ascertained through accurate compositional analysis by both wavelength dispersive spectroscopy (WDS) and Rutherford backscattering spectrometry (RBS). We suggest that the origin of the abnormal composition change is the difference in the thermodynamic properties of ternary FeSe xTe 1-x, based on first principle calculations.« less

  11. Origin of the emergence of higher T c than bulk in iron chalcogenide thin films

    DOE PAGES

    Seo, Sehun; Kang, Jong-Hoon; Oh, Myeong Jun; ...

    2017-08-30

    Fabrication of epitaxial FeSe xTe 1-x thin films using pulsed laser deposition (PLD) enables improving their superconducting transition temperature (T c) by more than ~40% than their bulk T c. Intriguingly, T c enhancement in FeSe xTe 1-x thin films has been observed on various substrates and with different Se content, x. To date, various mechanisms for T c enhancement have been reported, but they remain controversial in universally explaining the T c improvement in the FeSe xTe 1-x films. In this report, we demonstrate that the controversies over the mechanism of T c enhancement are due to the abnormalmore » changes in the chalcogen ratio (Se:Te) during the film growth and that the previously reported T c enhancement in FeSe 0.5Te 0.5 thin films is caused by a remarkable increase of Se content. Although our FeSe xTe 1-x thin films were fabricated via PLD using a Fe 0.94Se 0.45Te 0.55 target, the precisely measured composition indicates a Se-rich FeSe xTe 1-x (0.6 < x < 0.8) as ascertained through accurate compositional analysis by both wavelength dispersive spectroscopy (WDS) and Rutherford backscattering spectrometry (RBS). We suggest that the origin of the abnormal composition change is the difference in the thermodynamic properties of ternary FeSe xTe 1-x, based on first principle calculations.« less

  12. High- T c Superconductivity in FeSe at High Pressure: Dominant Hole Carriers and Enhanced Spin Fluctuations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, J. P.; Ye, G. Z.; Shahi, P.

    The importance of electron-hole interband interactions is widely acknowledged for iron-pnictide superconductors with high transition temperatures (T c). However, high-T c superconductivity without hole carriers has been suggested in FeSe single-layer films and intercalated iron-selenides, raising a fundamental question whether iron pnictides and chalcogenides have different pairing mechanisms. Here, we study the properties of electronic structure in another high-T c phase induced by pressure in bulk FeSe from magneto-transport measurements and first-principles calculations. With increasing pressure, the low-T c superconducting phase transforms into high-T c phase, where we find the normal-state Hall resistivity changes sign from negative to positive, demonstratingmore » dominant hole carriers in striking contrast to other FeSe-derived high-T c systems. Moreover, the Hall coefficient is remarkably enlarged and the magnetoresistance exhibits anomalous scaling behaviours, evidencing strongly enhanced interband spin fluctuations in the high-T c phase. These results in FeSe highlight similarities with high-T c phases of iron pnictides, constituting a step toward a unified understanding of iron-based superconductivity.« less

  13. High- T c Superconductivity in FeSe at High Pressure: Dominant Hole Carriers and Enhanced Spin Fluctuations

    DOE PAGES

    Sun, J. P.; Ye, G. Z.; Shahi, P.; ...

    2017-04-07

    The importance of electron-hole interband interactions is widely acknowledged for iron-pnictide superconductors with high transition temperatures (T c). However, high-T c superconductivity without hole carriers has been suggested in FeSe single-layer films and intercalated iron-selenides, raising a fundamental question whether iron pnictides and chalcogenides have different pairing mechanisms. Here, we study the properties of electronic structure in another high-T c phase induced by pressure in bulk FeSe from magneto-transport measurements and first-principles calculations. With increasing pressure, the low-T c superconducting phase transforms into high-T c phase, where we find the normal-state Hall resistivity changes sign from negative to positive, demonstratingmore » dominant hole carriers in striking contrast to other FeSe-derived high-T c systems. Moreover, the Hall coefficient is remarkably enlarged and the magnetoresistance exhibits anomalous scaling behaviours, evidencing strongly enhanced interband spin fluctuations in the high-T c phase. These results in FeSe highlight similarities with high-T c phases of iron pnictides, constituting a step toward a unified understanding of iron-based superconductivity.« less

  14. MAOA, MTHFR, and TNF-β genes polymorphisms and personality traits in the pathogenesis of migraine.

    PubMed

    Ishii, Masakazu; Shimizu, Shunichi; Sakairi, Yuki; Nagamine, Ayumu; Naito, Yuika; Hosaka, Yukiko; Naito, Yuko; Kurihara, Tatsuya; Onaya, Tomomi; Oyamada, Hideto; Imagawa, Atsuko; Shida, Kenji; Takahashi, Johji; Oguchi, Katsuji; Masuda, Yutaka; Hara, Hajime; Usami, Shino; Kiuchi, Yuji

    2012-04-01

    Migraine is a multifactorial disease with various factors, such as genetic polymorphisms and personality traits, but the contribution of those factors is not clear. To clarify the pathogenesis of migraine, the contributions of genetic polymorphisms and personality traits were simultaneously investigated using multivariate analysis. Ninety-one migraine patients and 119 non-headache healthy volunteers were enrolled. The 12 gene polymorphisms analysis and NEO-FFI personality test were performed. At first, the univariate analysis was performed to extract the contributing factors to pathogenesis of migraine. We then extracted the factors that independently contributed to the pathogenesis of migraine using multivariate stepwise logistic regression analysis. Using the multivariate analysis, three gene polymorphisms including monoamine oxidase A (MAOA) T941G, methylenetetrahydrofolate reductase (MTHFR) C677T, and tumor necrosis factor beta (TNF-β) G252Α, and the neuroticism and conscientiousness scores in NEO-FFI were selected as significant factors that independently contributed to the pathogenesis of migraine. Their odds ratios were 1.099 (per point of neuroticism score), 1.080 (per point of conscientiousness score), 2.272 (T and T/T or T/G vs G and G/G genotype of MAOA), 1.939 (C/T or T/T vs C/C genotype of MTHFR), and 2.748 (G/A or A/A vs G/G genotype of TNF-β), respectively. We suggested that multiple factors, such as gene polymorphisms and personality traits, contribute to the pathogenesis of migraine. The contribution of polymorphisms, such as MAOA T941G, MTHFR C677T, and TNF-β G252A, were more important than personality traits in the pathogenesis of migraine, a multifactorial disorder.

  15. Evolutions structurales et effets de pression dans des céramiques supraconductrices à haute T_c

    NASA Astrophysics Data System (ADS)

    Gavarri, J. R.; Carel, C.; Monnereau, O.; Vacquier, G.; Vettier, C.; Hewat, A. W.

    1991-11-01

    Using structural evolution data and a method permitting the calculation of elastic constants and Grüneisen parameters, the thermal expansion of two high T_c superconductors is interpreted. It is shown that the superconductors YBaCuO (123) and BiSrCaCuO (2212) present strongly different elastic and anharmonic properties. En appliquant une méthode déjà mise au point sur d'autres composés (Gavarri, 1981), l'évolution structurale de deux supraconducteurs à haute T_c est interprétée par le biais de leurs compressibilités anisotropes et de leurs coefficients de Grüneisen, obtenus par diffraction de neutrons et de rayons X. On montre ici que les supraconducteurs YBaCuO (123) et BiSrCaCuO (2212) diffèrent considérablement par leurs compressibilités anisotropes et par leurs coefficients de Grüneisen.

  16. The m.3291T>C mt-tRNALeu(UUR) mutation is definitely pathogenic and causes multisystem mitochondrial disease

    PubMed Central

    Yarham, John W.; Blakely, Emma L.; Alston, Charlotte L.; Roberts, Mark E.; Ealing, John; Pal, Piyali; Turnbull, Douglass M.; McFarland, Robert; Taylor, Robert W.

    2013-01-01

    Mitochondrial tRNA point mutations are important causes of human disease, and have been associated with a diverse range of clinical phenotypes. Definitively proving the pathogenicity of any given mt-tRNA mutation requires combined molecular, genetic and functional studies. Subsequent evaluation of the mutation using a pathogenicity scoring system is often very helpful in concluding whether or not the mutation is causing disease. Despite several independent reports linking the m.3291T>C mutation to disease in humans, albeit in association with several different phenotypes, its pathogenicity remains controversial. A lack of conclusive functional evidence and an over-emphasis on the poor evolutionary conservation of the affected nucleotide have contributed to this controversy. Here we describe an adult patient who presented with deafness and lipomas and evidence of mitochondrial abnormalities in his muscle biopsy, who harbours the m.3291T > C mutation, providing conclusive evidence of pathogenicity through analysis of mutation segregation with cytochrome c oxidase (COX) deficiency in single muscle fibres, underlining the importance of performing functional studies when assessing pathogenicity. PMID:23273904

  17. The folic acid endophenotype and depression in an elderly population.

    PubMed

    Naumovski, N; Veysey, M; Ng, X; Boyd, L; Dufficy, L; Blades, B; Travers, C; Lewis, P; Sturm, J; Townley-Jones, M; Yates, Z; Roach, P; Lucock, M

    2010-12-01

    Folate status and/or genes have been linked to depression in a number of studies. This may be via a direct action (or actions) on neuronal membranes or indirect effects through the metabolism of methyl groups involved in neurotransmitter synthesis. This study examines folate and related thiol metabolism that might underpin either phenomenon. Cohort study describing the relationship between several genetic and nutritional aspects of folic acid homeostasis and depression assessed by the HADS psychometric index in an elderly cohort. New South Wales (Australia) retirement village. 118 elderly participants (age 65-90 years). Stepwise multiple regression was used to determine the best statistical model to predict depression; C677T-MTHFR (p=0.0103) was found to be positively associated with depression, while the thiol dipeptide Cys-Gly was negatively associated (p=0.0403). The statistical models used accounted for the major folate related indices (genetic and biochemical) that are most often evaluated in the context of health and disease. When only genetic data were examined for interactions, C677T-MTHFR was found to be negatively associated with the HADS Depression Index Score (p=0.0191). The potential influence of Cys-Gly on this phenotype is novel, and of considerable interest given that it has been linked to altered spontaneous activity and sedation in an animal model. Cys-Gly is a recognised ligand at the N-methyl-D-aspartatic acid (NMDA) subclass of glutamate receptor, a system associated with depression. In addition, the C677T-MTHFR association adds further support to existing findings underscoring the potential role of folate in depression.

  18. Influence of methylenetetrahydrofolate reductase genotype, exercise and other risk factors on endothelial function in healthy individuals.

    PubMed

    Pullin, Catherine H; Wilson, John F; Ashfield-Watt, Pauline A L; Clark, Zoë E; Whiting, Jenny M; Lewis, Malcolm J; McDowell, Ian F W

    2002-01-01

    Cardiovascular disease has a multifactorial aetiology that is influenced by both genetic and environmental factors. Endothelial dysfunction is a key event in the pathogenesis of vascular disease that occurs before structural vascular changes or clinical symptoms are evident. Conventional risk factors, for example hypertension and diabetes mellitus, are associated with endothelial dysfunction, but the influence of other putative risk factors is not clear. The methylenetetrahydrofolate reductase (MTHFR) C677T genotype, a common polymorphism that induces hyperhomocysteinaemia, has been proposed as being a genetic risk factor for cardiovascular disease. A total of 126 healthy adults recruited by MTHFR C677T genotype (42 of each genotype, i.e. CC, CT and TT) underwent assessment of endothelial function. Brachial artery endothelium-dependent flow-mediated dilatation (FMD) was measured using high-resolution ultrasonic vessel "wall-tracking". Using multiple regression analysis, MTHFR genotype and 21 other subject and subject-lifestyle variables were investigated as potential predictors of endothelial function. FMD was influenced positively by frequency of aerobic exercise and by hormone replacement therapy, and negatively by increases in systolic blood pressure. MTHFR C677T genotype and the associated variation in plasma homocysteine levels did not influence FMD. Additionally, other factors, including plasma cholesterol and self-supplementation with either antioxidant vitamins or cod liver oil, showed no significant relationship with FMD, although these findings are compromised by the narrow range studied for cholesterol and the small number of subjects taking supplements. These observations have implications for risk factor management in the primary prevention of cardiovascular disease in healthy individuals.

  19. Hyperhomocysteinemia and MTHFR polymorphisms as antenatal risk factors of white matter abnormalities in two cohorts of late preterm and full term newborns.

    PubMed

    Marseglia, Lucia M; Nicotera, Antonio; Salpietro, Vincenzo; Giaimo, Elisa; Cardile, Giovanna; Bonsignore, Maria; Alibrandi, Angela; Caccamo, Daniela; Manti, Sara; D'Angelo, Gabriella; Mamì, Carmelo; Di Rosa, Gabriella

    2015-01-01

    Higher total homocysteine (tHcy) levels, and C677T and A1298C methylenetetrahydrofolate (MTHFR) polymorphisms, have been reported in preterm or full term newborns with neonatal encephalopathy following perinatal hypoxic-ischemic insult. This study investigated the causal role of tHcy and MTHFR polymorphisms together with other acquired risk factors on the occurrence of brain white matter abnormalities (WMA) detected by cranial ultrasound scans (cUS) in a population of late preterm and full term infants. A total of 171 newborns (81 M, 47.4%), 45 (26.3%) born <37 wks, and 126 (73.7%) born ≥37 wks were recruited in the study. cUS detected predominant WMA pattern in 36/171 newborns (21.1%) mainly characterized by abnormal periventricular white matter signal and mild-to-moderate periventricular white matter volume loss with ventricular dilatation (6/36, 16.6%). WMA resulted in being depending on tHcy levels (P < 0.014), lower GA (P < 0.000), lower Apgar score at 1 minutes (P < 0.000) and 5 minutes (P < 0.000), and 1298AC and 677CT/1298AC genotypes (P < 0.000 and P < 0.000). In conclusion, both acquired and genetic predisposing antenatal factors were significantly associated with adverse neonatal outcome and WMA. The role of A1298C polymorphism may be taken into account for prenatal assessment and treatment counseling.

  20. Association between LRP1 C766T polymorphism and Alzheimer's disease susceptibility: a meta-analysis.

    PubMed

    Wang, Yun; Liu, Shengyuan; Wang, Jingjing; Zhang, Jie; Hua, Yaqiong; Li, Hua; Tan, Huibiao; Kuai, Bin; Wang, Biao; Sheng, Sitong

    2017-08-16

    Low density lipoprotein receptor-related protein 1 (LRP1) C766T polymorphism (rs1799986) has been extensively investigated for Alzheimer's disease (AD) susceptibility. However, results in different studies have been contradictory. Therefore, we conducted a meta-analysis containing 6455 AD cases and 6304 controls from 26 independent case-control studies to determine whether there was an association between the LRP1 C766T polymorphism and AD susceptibility. The combined analysis showed that there was no significant association between LRP1 C766T polymorphism and AD susceptibility (TT + CT versus CC: OR = 0.920, 95% CI = 0.817-1.037, P = 0.172). In subgroup analysis, significant decreased AD susceptibility was found among Asian population in allele model (T versus C: OR = 0.786, 95% CI = 0.635-0.974, P = 0.028) and dominant model (TT + CT versus CC: OR = 0.800, 95% CI = 0.647-0.990, P = 0.040). Moreover, T allele of LRP1 C766T was statistically associated with late onset of AD (LOAD) (T versus C: OR = 0.858, 95% CI = 0.748-0.985, P = 0.029; TT + CT versus CC: OR = 0.871, 95% CI = 0.763-0.994, P = 0.040). In conclusion, our meta-analysis suggested that LRP1 C766T polymorphism was associated with lower risk of AD in Asian, and could reduce LOAD risk especially. Considering some limitations of our meta-analysis, further large-scale studies should be done to reach a more comprehensive understanding.

  1. Bean--Livingston barriers and first field for flux penetration in high- T sub c crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burlachkov, L.; Konczykowski, M.; Yeshurun, Y.

    We present evidence for the importance of Bean--Livingston (BL) barriers for field penetration into high-{ital T}{sub {ital c}} crystals. The magnetization curves {ital M}({ital H}) and the first field {ital H}{sub {ital p}} for flux penetration were measured near the transition temperature {ital T}{sub {ital c}} of untwinned Y-Ba-Cu-O crystal by using a miniature Hall probe. There are three observations that serve as evidence for the efficiency of BL barriers: (1) the magnetization was found to be almost zero on the descending branch of the magnetization loop; (2) The slope of {ital H}{sub {ital p}}({ital T}) exhibits a clear changemore » close to {ital T}{sub {ital c}}, being largest at {ital T}{sub {ital c}}; (3) after introducing damage by irradiating the sample, both the field {ital H}{sub {ital p}} and the width of the {ital M}({ital H}) loops reduce significantly, showing almost reversible behavior for the sample. We explain these observations in terms of BL barriers which are shown to be especially important in high-{ital T}{sub {ital c}} superconductors, and these could be responsible for the controversy of the {ital H}{sub {ital c}1} values reported previously in the literature.« less

  2. C -P -T anomaly matching in bosonic quantum field theory and spin chains

    NASA Astrophysics Data System (ADS)

    Sulejmanpasic, Tin; Tanizaki, Yuya

    2018-04-01

    We consider the O (3 ) nonlinear sigma model with the θ term and its linear counterpart in 1+1D. The model has discrete time-reflection and space-reflection symmetries at any θ , and enjoys the periodicity in θ →θ +2 π . At θ =0 ,π it also has a charge-conjugation C symmetry. Gauging the discrete space-time reflection symmetries is interpreted as putting the theory on the nonorientable R P2 manifold, after which the 2 π periodicity of θ and the C symmetry at θ =π are lost. We interpret this observation as a mixed 't Hooft anomaly among charge-conjugation C , parity P , and time-reversal T symmetries when θ =π . Anomaly matching implies that in this case the ground state cannot be trivially gapped, as long as C ,P , and T are all good symmetries of the theory. We make several consistency checks with various semiclassical regimes, and with the exactly solvable XYZ model. We interpret this anomaly as an anomaly of the corresponding spin-half chains with translational symmetry, parity, and time reversal [but not involving the SO(3)-spin symmetry], requiring that the ground state is never trivially gapped, even if SO(3) spin symmetry is explicitly and completely broken. We also consider generalizations to C PN -1 models and show that the C -P -T anomaly exists for even N .

  3. The contribution of the SPINK1 c.194+2T>C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients.

    PubMed

    Sun, Chang; Liao, Zhuan; Jiang, Lili; Yang, Fu; Xue, Geng; Zhou, Qi; Chen, Ruiwen; Sun, Shuhan; Li, Zhaoshen

    2013-01-01

    Recent data suggest that the serine protease inhibitor Kazal type 1 (SPINK1) gene mutation is associated with idiopathic chronic pancreatitis. However, few studies have focused on the serine protease inhibitor Kazal type 1 c.194+2T>C mutation. Therefore, our goal was to study the prevalence and impact of serine protease inhibitor Kazal type 1 mutations on the clinical profile of idiopathic chronic pancreatitis patients in China. A retrospective-cohort study of 118 Chinese patients with idiopathic chronic pancreatitis was performed, and genetic tests were carried out to detect SPINK1 mutations. Subjects without pancreatitis were used as controls. In total, 118 idiopathic chronic pancreatitis patients and 100 control subjects were evaluated. The serine protease inhibitor Kazal type 1 c.194+2T>C variant was present in 44.9% of patients with idiopathic chronic pancreatitis. The frequency of diabetes in idiopathic chronic pancreatitis patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (39.6%) was higher than that of patients without the mutation (9.2%). The time to occurrence of diabetes mellitus after idiopathic chronic pancreatitis symptom onset is significantly influenced by the c.194+2T>C mutation (p<0.001). In addition, the mean age of diabetes onset in patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (38.33 ± 9.50) was significantly younger than that of patients without this mutation (49.67 ± 6.74). The presence of the serine protease inhibitor Kazal type 1 c.194+2T>C mutation seems to be associated with idiopathic chronic pancreatitis and could predispose individuals to pancreatic diabetes onset at an earlier age. Copyright © 2012 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  4. T-kininogen can either induce or inhibit proliferation in Balb/c 3T3 fibroblasts, depending on the route of administration.

    PubMed

    Aravena, M; Pérez, C; Pérez, V; Acuña-Castillo, C; Gómez, C; Leiva-Salcedo, E; Nishimura, S; Sabaj, V; Walter, R; Sierra, F

    2005-03-01

    T-kininogen (T-KG) is a precursor of T-kinin, the most abundant kinin in rat serum, and also acts as a strong and specific cysteine proteinase inhibitor. Its expression is strongly induced during aging in rats, and expression of T-KG in Balb/c 3T3 fibroblasts results in inhibition of cell proliferation. However, T-KG is a serum protein produced primarily in the liver, and thus, most cells are only exposed to the protein from the outside. To test the effect of T-KG on fibroblasts exposed to exogenous T-KG, we purified the protein from the serum of K-kininogen-deficient Katholiek rats. In contrast to the results obtained by transfection, exposure of Balb/c 3T3 fibroblasts to exogenously added T-KG leads to a dose-dependent increase in [3H]-thymidine incorporation. This response does not require kinin receptors, but it is clearly mediated by activation of the ERK pathway. As a control, we repeated the transfection experiments, using a different promoter. The results are consistent with our published data showing that, under these circumstances, T-KG inhibits cell proliferation. We conclude that T-KG exerts opposite effects on fibroblast proliferation, depending exclusively on the way that it is administered to the cells (transfection versus exogenous addition).

  5. Single nucleotide polymorphisms of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) in Iranian patients with TB.

    PubMed

    Beiranvand, Elham; Abediankenari, Saeid; Valiyari, Samira; Rezaei, Mohammad Sadegh; Rostamian, Mosayeb; Beiranvand, Behnoush; Khaligh, Ali; Khani, Soghra

    2016-12-01

    Two important genes for controlling TB are IFNγ and IFNγR1. However, little information exists regarding genetic susceptibility of the Iranian TB population. We investigated the single nucleotide polymorphisms (SNPs) in genes of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) and serum level of IFNγ and their influence on TB in patients; 300 patients with TB and 300 healthy controls were enrolled in this study. PCR-restriction fragment length polymorphism was used to identify SNPs and serum level of IFNγ was measured by ELISA. The allelic and the genotypic form of IFNγ+874 A/T SNP of the studied population were not significant (p>0.05). Allele T frequencies of IFNγR1 -56 C/T promoter region in patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were significantly greater than allele C. The -56 TT motif of IFNγR1 is associated with both forms of TB (p<0.05). The serum level of IFNγ was significantly higher in patients with TB than in controls, but there was no significant difference between serum level of IFNγ and the studied genotypes (p>0.05). The cause of active TB in the patients seems to be due to the lack of effective IFNγ function or the lack of effective signaling connection between IFNγ and its receptor in presence of -56 C/T polymorphism in promoter region of IFNγR1 gene. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Association of MTHFR polymorphisms and chromosomal abnormalities in leukemia.

    PubMed

    Sinthuwiwat, Thivaratana; Poowasanpetch, Phanasit; Wongngamrungroj, Angsana; Soonklang, Kamonwan; Promso, Somying; Auewarakul, Chirayu; Tocharoentanaphol, Chintana

    2012-01-01

    Genetic variation in MTHFR gene might explain the interindividual differences in the reduction of DNA repaired and the increase of chromosome breakage and damage. Nowadays, chromosomal rearrangement is recognized as a major cause of lymphoid malignancies. In addition, the association of MTHFR polymorphisms with aneuploidy was found in several studies, making the MTHFR gene as a good candidate for leukemia etiology. Therefore, in this study, we investigated the common sequence variation, 677C>T and 1298A>C in the MTHFR gene of 350 fixed cell specimens archived after chromosome analysis. The distribution of the MTHFR polymorphisms frequency was compared in leukemic patients with structural chromosome abnormality and chromosome aneuploidy, as well as in those with no evidence of chromosome abnormalities. We observed a significant decrease in the distribution of T allele in 677C>T polymorphisms among patients with chromosomal abnormalities including both structural aberration and aneuploidy. The same significance result also found in patients with structural aberration when compare with the normal karyotype patients. Suggesting that polymorphism in the MTHFR gene was involved in chromosome abnormalities of leukemia. However, further investigation on the correlation with the specific types of chromosomal aberrations is needed.

  7. Candidate gene study of genetic thrombophilic polymorphisms in pre-eclampsia and recurrent pregnancy loss in Sinhalese women.

    PubMed

    Dissanayake, Vajira H W; Sirisena, Nirmala D; Weerasekera, Lakshini Y; Gammulla, Chumithri G; Seneviratne, Harshalal R; Jayasekara, Rohan W

    2012-09-01

    Genetic thrombophilias are known to contribute to adverse pregnancy outcomes. Studies in Western populations show that 5, 10-methylenetetrahydrofolate reductase (MTHFR) 677C>T and Factor V (F5) 1691G>A (Leiden) polymorphisms are commonly associated with pre-eclampsia and recurrent spontaneous pregnancy loss. The objective of this study was to investigate the association of MTHFR 677C>T (rs1801133); 1298A>C (rs1801131) and F5 1691G>A (rs6025); 4070A>G (rs1800595) polymorphisms with pre-eclampsia and recurrent pregnancy loss among Sinhalese women in Sri Lanka. Genotype and allele frequencies at each polymorphic site in the MTHFR and F5 genes and the haplotypes defined by them were determined in 175 Sinhalese women with pre-eclampsia, 171 normotensive controls, 200 Sinhalese women with two or more recurrent pregnancy losses and 200 controls with two or more living children and no pregnancy losses. Genotyping was done by polymerase chain reaction/restriction fragment length polymorphism. Odds ratios and χ(2) -testing were performed to compare genotype/haplotype frequencies at each polymorphic site for both cases and controls. The genotype frequencies at each polymorphic site in the MTHFR 677C>T; 1298A>C; F5 1691G>A and 4070A>G genes and the haplotypes defined by them were not significantly associated with either pre-eclampsia or recurrent pregnancy loss. There was no significant association of genetic thrombophilia with either early or late pregnancy losses. The MTHFR and F5 polymorphisms and the haplotypes defined by them were not significantly associated with either pre-eclampsia or recurrent pregnancy loss in this group of Sinhalese women. © 2012 The Authors. Journal of Obstetrics and Gynaecology Research © 2012 Japan Society of Obstetrics and Gynecology.

  8. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

    PubMed Central

    Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

    2002-01-01

    DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

  9. Reinterpretation of the Vibrational Spectroscopy of the Medicinal Bioinorganic Synthon c,c,t-[Pt(NH3)2Cl2(OH)2]†

    PubMed Central

    Johnstone, Timothy C.

    2014-01-01

    The Pt(IV) complex c,c,t-[Pt(NH3)2Cl2(OH)2] is an important intermediate in the synthesis of Pt(IV) anticancer prodrugs and has been investigated as an anticancer agent in its own right. An analysis of the vibrational spectroscopy of this molecule was previously reported [Faggiani et al., 1982, Can. J. Chem. 60, 529] in which crystallographic determination of the structure of the complex permitted a site group approach. The space group, however, was incorrectly assigned. In the present study we have redetermined at high resolution crystal structures of c,c,t-[Pt(NH3)2Cl2(OH)2] and c,c,t-[Pt(NH3)2Cl2(OH)2]·H2O2, which enable discussion of the effect of hydrogen bonding on the N–H and O–H vibrational bands. The correct crystallographic site symmetry of the platinum complex in the c,c,t-[Pt(NH3)2Cl2(OH)2] structure is employed to conduct a new vibrational analysis using both group theoretical and modern DFT methods. This analysis reveals the nature and symmetry of the “missing band” described in the original publication and suggests a possible explanation for its disappearance. PMID:24515615

  10. MERRF/MELAS overlap syndrome due to the m.3291T>C mutation.

    PubMed

    Liu, Kaiming; Zhao, Hui; Ji, Kunqian; Yan, Chuanzhu

    2014-03-01

    We report the case of a 19-year-old Chinese female harboring the m.3291T>C mutation in the MT-TL1 gene encoding the mitochondrial transfer RNA for leucine. She presented with a complex phenotype characterized by progressive cerebellar ataxia, frequent myoclonus seizures, recurrent stroke-like episodes, migraine-like headaches with nausea and vomiting, and elevated resting lactate blood level. It is known that the myoclonus epilepsy with ragged-red fibers (MERRF) is characterized by cerebellar ataxia and myoclonus epilepsy, while that the mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is characterized by recurrent stroke-like episodes, migraine-like headaches, and elevated resting lactate blood level. So the patient's clinical manifestations suggest the presence of a MERRF/MELAS overlap syndrome. Muscle biopsy of the patient showed the presence of numerous scattered ragged-red fibers, some cytochrome c oxidase-deficient fibers, and several strongly succinate dehygrogenase-reactive vessels, suggestive of a mitochondrial disorder. Direct sequencing of the complete mitochondrial genome of the proband revealed no mutations other than the T-to-C transition at nucleotide position 3291. Restriction fragment length polymorphism analysis of the proband and her family revealed maternal inheritance of the mutation in a heteroplasmic manner. The analysis of aerobic respiration and glycolysis demonstrated that the fibroblasts from the patient had mitochondrial dysfunction. Our results suggest that the m.3291T>C is pathogenic. This study is the first to describe the m.3291T>C mutation in association with the MERRF/MELAS overlap syndrome.

  11. Conserved Region C Functions To Regulate PD-1 Expression and Subsequent CD8 T Cell Memory.

    PubMed

    Bally, Alexander P R; Tang, Yan; Lee, Joshua T; Barwick, Benjamin G; Martinez, Ryan; Evavold, Brian D; Boss, Jeremy M

    2017-01-01

    Expression of programmed death 1 (PD-1) on CD8 T cells promotes T cell exhaustion during chronic Ag exposure. During acute infections, PD-1 is transiently expressed and has the potential to modulate CD8 T cell memory formation. Conserved region C (CR-C), a promoter proximal cis-regulatory element that is critical to PD-1 expression in vitro, responds to NFATc1, FoxO1, and/or NF-κB signaling pathways. Here, a CR-C knockout mouse was established to determine its role on PD-1 expression and the corresponding effects on T cell function in vivo. Deletion of CR-C decreased PD-1 expression on CD4 T cells and Ag-specific CD8 T cells during acute and chronic lymphocytic choriomeningitis virus challenges, but did not affect the ability to clear an infection. Following acute lymphocytic choriomeningitis virus infection, memory CD8 T cells in the CR-C knockout mouse were formed in greater numbers, were more functional, and were more effective at responding to a melanoma tumor than wild-type memory cells. These data implicate a critical role for CR-C in governing PD-1 expression, and a subsequent role in guiding CD8 T cell differentiation. The data suggest the possibility that titrating PD-1 expression during CD8 T cell activation could have important ramifications in vaccine development and clinical care. Copyright © 2016 by The American Association of Immunologists, Inc.

  12. Impact of C-rel inhibition of cord blood-derived B-, T-, and NK cells.

    PubMed

    Fallahi, Shirin; Mohammadi, Seyede Momeneh; Tayefi Nasrabadi, Hamid; Alihemmati, Alireza; Samadi, Naser; Gholami, Sanaz; Shanehbandi, Dariush; Nozad Charoudeh, Hojjatollah

    2017-12-01

    The c-Rel transcription factor is a unique member of the nuclear factor (NF)-κB family that has a role in curtailing the proliferation, differentiation, cytokine production, and overall activity of B- and T-cells. In addition, c-Rel is a key regulator of apoptosis in that it influences the expression of anti-apoptotic genes such as Bcl-2 and Bcl-xL; conversely, inhibition of c-Rel increases cell apoptosis. To better understand the relationship between c-Rel expression and effects on B- and T-cell expansion, the current study evaluated c-Rel expression in cord blood mononuclear cells. This particular source was selected as cord blood is an important source of cells used for transplantation and immunotherapy, primarily in treating leukemias. As stem cell factor (SCF) and FLT3 are important agents for hematopoietic stem cell expansion, and cytokines like interleukin (IL)-2, -7, and -15 are essential for T- and B- (and also NK) cell development and proliferation, the current study evaluated c-Rel expression in cord blood mononuclear cells and CD34 +  cells, as well as effects on B-, T-, and NK cells associated with alterations in c-Rel expression, using flow cytometry and PCR. The results showed c-Rel expression increased among cells cultured in the presence of SCF and FLT3 but was reduced when IL-2, IL-7, and IL-15 were used all together. Further, inhibition of c-Rel expression by siRNA reduced cord blood-derived B-, T-, and NK cell differentiation and expansion. These results indicated that with cells isolated from cord blood, c-Rel has an important role in B-, T-, and NK cell differentiation and, further, that agents (select cytokines/growth factors) that could impact on its expression might not only affect immune cell profiles in a host but could potentially also limit apoptotic activities in (non-)immune cells in that host. In the context of cancer (immuno)therapy, in particular, when cord blood is used an important source in stem cell transplantation in

  13. Methylenetetrahydrofolate reductase polymorphisms and interaction with smoking and alcohol consumption in lung cancer risk: a case-control study in a Japanese population.

    PubMed

    Kiyohara, Chikako; Horiuchi, Takahiko; Takayama, Koichi; Nakanishi, Yoichi

    2011-10-25

    Cigarette smoking is an established risk factor of lung cancer development while the current epidemiological evidence is suggestive of an increased lung cancer risk associated with alcohol consumption. Dietary folate, which is present in a wide range of fresh fruits and vegetables, may be a micronutrient that has a beneficial impact on lung carcinogenesis. Methylenetetrahydrofolate reductase (MTHFR) plays a crucial role in regulating folate metabolism, which affects both DNA synthesis/repair and methylation. We examined if smoking or alcohol consumption modify associations between MTHFR polymorphisms and lung cancer risk. We evaluated the role of the MTHFR C677T (rs1801133) and A1298C (rs1801131) polymorphisms in a case-control study comprised of 462 lung cancer cases and 379 controls in a Japanese population. Logistic regression was used to assess the adjusted odds ratios (OR) and 95% confidence intervals (95% CI). The TT genotype of the C677T polymorphism was significantly associated with an increased risk of lung cancer (OR = 2.27, 95% CI = 1.42 - 3.62, P < 0.01) while the A1298C polymorphism was not associated with lung cancer risk. The minor alleles of both polymorphisms behaved in a recessive fashion. The highest risks were seen for 677TT-carriers with a history of smoking or excessive drinking (OR = 6.16, 95% CI = 3.48 - 10.9 for smoking; OR = 3.09, 95% CI = 1.64 - 5.81 for drinking) compared with C-carriers without a history of smoking or excessive drinking, but no interactions were seen. The 1298CC genotype was only associated with increased risk among non-smokers (P < 0.05), and smoking was only associated with increased risks among 1298A-carriers (P < 0.01), but no significant interaction was seen. There was a synergistic interaction between the A1298C polymorphism and drinking (P < 0.05). The highest risk was seen for the CC-carriers with excessive drinking (OR = 7.24, 95% CI = 1.89 - 27.7) compared with the A-carriers without excessive drinking). The C

  14. Development of mRuby2-Transfected C3H10T1/2 Fibroblasts for Musculoskeletal Tissue Engineering

    PubMed Central

    Yang, Yunzhi Peter

    2015-01-01

    Mouse C3H10T1/2 fibroblasts are multipotent, mesenchymal stem cell (MSC)-like progenitor cells that are widely used in musculoskeletal research. In this study, we have established a clonal population of C3H10T1/2 cells stably-transfected with mRuby2, an orange-red fluorescence reporter gene. Flow cytometry analysis and fluorescence imaging confirmed successful transfection of these cells. Cell counting studies showed that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells proliferated at similar rates. Adipogenic differentiation experiments demonstrated that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells stained positive for Oil Red O and showed increased expression of adipogenic genes including adiponectin and lipoprotein lipase. Chondrogenic differentiation experiments demonstrated that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells stained positive for Alcian Blue and showed increased expression of chondrogenic genes including aggrecan. Osteogenic differentiation experiments demonstrated that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells stained positive for alkaline phosphatase (ALP) as well as Alizarin Red and showed increased expression of osteogenic genes including alp, ocn and osf-1. When seeded on calcium phosphate-based ceramic scaffolds, mRuby2-transfected C3H10T1/2 cells maintained even fluorescence labeling and osteogenic differentiation. In summary, mRuby2-transfected C3H10T1/2 cells exhibit mRuby2 fluorescence and showed little-to-no difference in terms of cell proliferation and differentiation as untransfected C3H10T1/2 cells. These cells will be available from American Type Culture Collection (ATCC; CRL-3268™) and may be a valuable tool for preclinical studies. PMID:26407291

  15. Development of mRuby2-Transfected C3H10T1/2 Fibroblasts for Musculoskeletal Tissue Engineering.

    PubMed

    Ker, Dai Fei Elmer; Sharma, Rashmi; Wang, Evelyna Tsi Hsin; Yang, Yunzhi Peter

    2015-01-01

    Mouse C3H10T1/2 fibroblasts are multipotent, mesenchymal stem cell (MSC)-like progenitor cells that are widely used in musculoskeletal research. In this study, we have established a clonal population of C3H10T1/2 cells stably-transfected with mRuby2, an orange-red fluorescence reporter gene. Flow cytometry analysis and fluorescence imaging confirmed successful transfection of these cells. Cell counting studies showed that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells proliferated at similar rates. Adipogenic differentiation experiments demonstrated that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells stained positive for Oil Red O and showed increased expression of adipogenic genes including adiponectin and lipoprotein lipase. Chondrogenic differentiation experiments demonstrated that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells stained positive for Alcian Blue and showed increased expression of chondrogenic genes including aggrecan. Osteogenic differentiation experiments demonstrated that untransfected C3H10T1/2 cells and mRuby2-transfected C3H10T1/2 cells stained positive for alkaline phosphatase (ALP) as well as Alizarin Red and showed increased expression of osteogenic genes including alp, ocn and osf-1. When seeded on calcium phosphate-based ceramic scaffolds, mRuby2-transfected C3H10T1/2 cells maintained even fluorescence labeling and osteogenic differentiation. In summary, mRuby2-transfected C3H10T1/2 cells exhibit mRuby2 fluorescence and showed little-to-no difference in terms of cell proliferation and differentiation as untransfected C3H10T1/2 cells. These cells will be available from American Type Culture Collection (ATCC; CRL-3268™) and may be a valuable tool for preclinical studies.

  16. Potential tuning in the S-W system. (i) Bringing T c,2 to ambient pressure, and (ii) colliding T c,2 with the liquid-vapor spinodal

    NASA Astrophysics Data System (ADS)

    Angell, C. Austen; Kapko, Vitaliy

    2016-09-01

    Following Vasisht et al’s identification of the second critical point (T c2, P c2) for liquid silicon in the Stillinger-Weber (S-W) model for silicon, we study the variation of T c2, P c2 with tetrahedral repulsion parameter in an extension of the earlier ‘potential tuning’ study of this system. We use the simple isochore crossing approach to identify the location of the second critical point (before any crystallization can occur) as a function of the ‘tuning’ or ‘tetrahedrality’, parameter λ, and identify two phenomena of high interest content. The first is that the second critical point pressure P c2, becomes less negative as λ decreases from the silicon value (meaning the drive to high tetrahedrality is decreased) and reaches zero pressure at the same value of lambda found to mark the onset of glassforming ability in an earlier study of this tunable system. The second is that, as the T c,2 approaches the temperature of the liquid-gas spinodal, λ  >  22, the behavior of the temperature of maximum density (TMD) switches from the behavior seen in most current water pair potential models (locus of TMDs has a maximum), to the behavior seen in empirical engineering multiparameter equations of state (EoS) (and also by two parameter Speedy isothermal expansion EoS) for water, according to which the locus of TMDs of HDL phase has no maximum, and the EoS for HDL has no second critical point. At λ  =  23 the behavior is isomorphic with that of the mW model of water, which is now seen to conform, at least closely, to the ‘critical point free’ scenario for water.

  17. Kinetics of the R + NO2 reactions (R = i-C3H7, n-C3H7, s-C4H9, and t-C4H9) in the temperature range 201-489 K.

    PubMed

    Rissanen, Matti P; Arppe, Suula L; Eskola, Arkke J; Tammi, Matti M; Timonen, Raimo S

    2010-04-15

    The bimolecular rate coefficients of four alkyl radical reactions with NO(2) have been measured in direct time-resolved experiments. Reactions were studied under pseudo-first-order conditions in a temperature-controlled tubular flow reactor coupled to a laser photolysis/photoionization mass spectrometer (LP-PIMS). The measured reaction rate coefficients are independent of helium bath gas pressure within the experimental ranges covered and exhibit negative temperature dependence. For i-C(3)H(7) + NO(2) and t-C(4)H(9) + NO(2) reactions, the dependence of ordinate (logarithm of reaction rate coefficients) on abscissa (1/T or log(T)) was nonlinear. The obtained results (in cm(3) s(-1)) can be expressed by the following equations: k(n-C(3)H(7) + NO(2)) = ((4.34 +/- 0.08) x 10(-11)) (T/300 K)(-0.14+/-0.08) (203-473 K, 1-7 Torr), k(i-C(3)H(7) + NO(2)) = ((3.66 +/- 2.54) x 10(-12)) exp(656 +/- 201 K/T)(T/300 K)(1.26+/-0.68) (220-489 K, 1-11 Torr), k(s-C(4)H(9) + NO(2)) = ((4.99 +/- 0.16) x 10(-11))(T/300 K)(-1.74+/-0.12) (241-485 K, 2 - 12 Torr) and k(t-C(4)H(9) + NO(2)) = ((8.64 +/- 4.61) x 10(-12)) exp(413 +/- 154 K/T)(T/300 K)(0.51+/-0.55) (201-480 K, 2-11 Torr), where the uncertainties shown refer only to the 1 standard deviations obtained from the fitting procedure. The estimated overall uncertainty in the determined bimolecular rate coefficients is about +/-20%.

  18. C-reactive protein gene C1444T polymorphism and risk of recurrent ischemic events in patients with symptomatic intracranial atherostenoses.

    PubMed

    Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan

    2009-01-01

    High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.

  19. Polymorphisms in the methylene tetrahydrofolate reductase gene and their unique combinations are associated with an increased susceptibility to the renal cancers.

    PubMed

    Ajaz, Sadia; Khaliq, Shagufta; Hashmi, Altaf; Naqvi, Syed Ali Anwar; Rizvi, Syed Adib-ul-Hassan; Mehdi, Syed Qasim

    2012-05-01

    Two single nucleotide polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) gene, 677C/T and 1298A/C, encode the thermolabile isoforms of the MTHFR enzyme that adversely affect the folic acid metabolic pathway. In the present study, these polymorphisms were investigated for their associations with the risk and prognosis of the renal cell carcinomas (RCCs) in Pakistani patients. The study included 168 RCC patients and 178 controls. The polymorphisms were analyzed by the polymerase chain reaction-restriction fragment length polymorphism method. Statistical analysis revealed that the C-allele and homozygous C genotype of the MTHFR 1298A/C polymorphism were significantly correlated with the risk of RCCs (odds ratio [OR]=1.60; 95% confidence interval [CI]=1.1-2.34 and OR=3.26; 95% CI=1.27-8.37, respectively). The combined genotype analysis showed that the 677CC+1298CC combination greatly increased the susceptibility to RCCs (OR=8.34; 95% CI=2.7-25.7). The 677CT+1298AA and 677CC+1298CA combinations were also associated with an increased risk of RCC (OR=3.21; 95% CI=1.3-7.8 and OR=2.45; 95% CI=1.3-4.6, respectively). The combined genotype effects were also evident in a semiparametric expectation-maximization-based haplotype analysis. The results presented here indicate that the two MTHFR gene polymorphisms are significantly associated with the risk of RCCs in a cohort of Pakistani patients and may be useful as susceptibility markers in other populations of the world as well.

  20. T-38C Optimal Landing Technique Determination (Project Talon Spot)

    DTIC Science & Technology

    2010-05-01

    USAF TPS, Class 09B. All objectives of the test were met. 15. SUBJECT TERMS T-38 Aircraft , T-38C Aircraft , J85-GE-5 engine, landing performance... aircraft crossed the threshold. The requesting agency was Headquarters AETC/A3FV, through the USAF TPS. The responsible test organization was the 412...13197 (Figure 1) instrumented test aircraft were flown. The USAF TPS personnel performed all testing at USAF Plant 42 in Palmdale, CA and Edwards

  1. MTHFR genetic polymorphisms may contribute to the risk of chronic myelogenous leukemia in adults: a meta-analysis of 12 genetic association studies.

    PubMed

    Li, Bin; Zhang, Jian; Wang, Lei; Li, Yan; Jin, Juping; Ai, Limei; Li, Chong; Li, Zhe; Mao, Shudan

    2014-05-01

    Chronic myelogenous leukemia (CML) is a complex disease with a genetic basis. The genetic association studies (GASs) that have investigated the association between adult CML and 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have produced contradictory and inconclusive results. The aim of this meta-analysis is to provide a relatively comprehensive assessment of the association of these polymorphisms with adult CML risk. A literature search for eligible GAS published before September 15, 2013 was conducted in PubMed, Embase, Web of Science, Cochrane Library, and China National Knowledge Infrastructure (CNKI) databases. Pooled odds ratios (ORs) with their corresponding 95% confidence intervals (95% CIs) were used to evaluate the strength of the association under a fixed or random effect model according to heterogeneity test results. All analyses were performed using the Stata software, version 12.0. Twelve case-control studies were included in this meta-analysis with a total of 932 CML patients and 3,465 healthy controls. For MTHFR C677T (dbSNP: rs1801133, C>T), though the pooled ORs were not significant in the overall population, all the ORs greater than 1 suggested an increased risk of CML for carriers of the risk allele. However, stratified analysis based on genotyping method revealed a significant association in the PCR-restriction fragment length polymorphism (RFLP) subgroup, possibly as a result of heterogeneity. For MTHFR A1298C (dbSNP: rs1801131, A>C), the combined results showed that carriers of the C allele may be associated with a decreased risk of adult CML. Stratified analysis showed that the magnitude of this effect was especially significant among Asians, indicating ethnicity differences in adult CML susceptibility. This meta-analysis shows that the C allele of MTHFR A1298C may be associated with a decreased risk in adult CML, especially among Asians, while MTHFR C677T may not be associated with adult CML risk. However

  2. 78 FR 7395 - Foreign-Trade Zone 129-Bellingham, WA; Notification of Proposed Production Activity; T.C. Trading...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-01

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-8-2013] Foreign-Trade Zone 129--Bellingham, WA; Notification of Proposed Production Activity; T.C. Trading Company, Inc. (Eyeglass Assembly and Kitting... activity on behalf of T.C. Trading Company, Inc. (T.C. Trading), located in Blaine, Washington. The...

  3. CT and 3-T MRI accurately identify T3c disease in colon cancer, which strongly predicts disease-free survival.

    PubMed

    Hunter, C; Siddiqui, M; Georgiou Delisle, T; Blake, H; Jeyadevan, N; Abulafi, M; Swift, I; Toomey, P; Brown, G

    2017-04-01

    To compare the preoperative staging accuracy of computed tomography (CT) and 3-T magnetic resonance imaging (MRI) in colon cancer, and to investigate the prognostic significance of identified risk factors. Fifty-eight patients undergoing primary resection of their colon cancer were prospectively recruited, with 53 patients included for final analysis. Accuracy of CT and MRI were compared for two readers, using postoperative histology as the reference standard. Patients were followed-up for a median of 39 months. Risk factors were compared by modality and reader in terms of metachronous metastases and disease-free survival (DFS), stratified for adjuvant chemotherapy. Accuracy for the identification of T3c+ disease was non-significantly greater on MRI (75% and 79%) than CT (70% and 77%). Differences in the accuracy of MRI and CT for identification of T3+ disease (MRI 75% and 57%, CT 72% and 66%) and N+ disease (MRI 62% and 63%, CT 62% and 56%) were also non-significant. Identification of extramural venous invasion (EMVI+) disease was significantly greater on MRI (75% and 75%) than CT (79% and 54%) for one reader (p=0.029). T3c+ disease at histopathology was the only risk factor that demonstrated a significant difference in rate of metachronous metastases (odds ratio [OR] 8.6, p=0.0044) and DFS stratified for adjuvant therapy (OR=4, p=0.048). T3c or greater disease is the strongest risk factor for predicting DFS in colon cancer, and is accurately identified on imaging. T3c+ disease may therefore be the best imaging entry criteria for trials of neoadjuvant treatment. Copyright © 2017 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  4. Lack of Association between Recurrent Pregnancy Loss and Inherited Thrombophilia in a Group of Colombian Patients

    PubMed Central

    Cardona, Henry; Castañeda, Serguei A.; Cardona Maya, Wálter; Alvarez, Leonor; Gómez, Joaquín; Gómez, Jorge; Torres, José; Tobón, Luis; Bedoya, Gabriel; Cadavid, Ángela P.

    2012-01-01

    Studies have shown an association between recurrent pregnancy loss and inherited thrombophilia in Caucasian populations, but there is insufficient knowledge concerning triethnic populations such as the Colombian. The aim of this study was to evaluate whether inherited thrombophilia is associated with recurrent pregnancy loss. Methods. We conducted a case-control study of 93 patients with recurrent pregnancy loss (cases) and 206 healthy multiparous women (controls) in a Colombian subpopulation. Three single nucleotide polymorphisms (SNPs) markers of the inherited thrombophilias factor V Leiden, prothrombin G20210A, and methylenetetrahydrofolate reductase C677T were genotyped by PCR-RFLP. Activated protein C resistance and plasma levels of antithrombin, protein C, and protein S were also measured. Results. The frequency of thrombophilia-associated SNPs, activated protein C resistance, and anticoagulant protein deficiencies, was low overall, except for the methylenetetrahydrofolate reductase C677T SNP. The differences between patients and controls had no statistical significance. Conclusion. Our study confirms the low prevalence of inherited thrombophilias in non-Caucasian populations and it is unlikely that the tested thrombophilias play a role in the pathogenesis of recurrent pregnancy loss in this Colombian population. PMID:22577540

  5. SOCS1 and SOCS3 Are Targeted by Hepatitis C Virus Core/gC1qR Ligation To Inhibit T-Cell Function

    PubMed Central

    Yao, Zhi Qiang; Waggoner, Stephen N.; Cruise, Michael W.; Hall, Caroline; Xie, Xuefang; Oldach, David W.; Hahn, Young S.

    2005-01-01

    T cells play an important role in the control of hepatitis C virus (HCV) infection. We have previously demonstrated that the HCV core inhibits T-cell responses through interaction with gC1qR. We show here that core proteins from chronic and resolved HCV patients differ in sequence, gC1qR-binding ability, and T-cell inhibition. Specifically, chronic core isolates bind to gC1qR more efficiently and inhibit T-cell proliferation as well as gamma interferon (IFN-γ) production more profoundly than resolved core isolates. This inhibition is mediated by the disruption of STAT phosphorylation through the induction of SOCS molecules. Silencing either SOCS1 or SOCS3 by small interfering RNA dramatically augments the production of IFN-γ in T cells, thereby abrogating the inhibitory effect of core. Additionally, the ability of core proteins from patients with chronic infections to induce SOCS proteins and suppress STAT activation greatly exceeds that of core proteins from patients with resolved infections. These results suggest that the HCV core/gC1qR-induced T-cell dysfunction involves the induction of SOCS, a powerful inhibitor of cytokine signaling, which represents a novel mechanism by which a virus usurps the host machinery for persistence. PMID:16306613

  6. C-reactive protein (+1444C>T) polymorphism influences CRP response following a moderate inflammatory stimulus.

    PubMed

    D'Aiuto, Francesco; Casas, Juan P; Shah, Tina; Humphries, Steve E; Hingorani, Aroon D; Tonetti, Maurizio S

    2005-04-01

    Elevations in C-reactive protein (CRP) concentration are associated with an increased risk of future coronary events in prospective studies and it has been suggested that CRP could be used to aid risk prediction. A +1444C>T polymorphism in the CRP gene has been associated with differences in CRP concentration. We investigated the effect of this polymorphism on the CRP response to periodontal therapy, an intermediate inflammatory stimulus. Clinical parameters, CRP, and interleukin-6 (IL-6) concentrations were evaluated in 55 consecutive patients suffering from periodontitis at baseline, 1, 7 and 30 days after an intensive course of periodontal treatment. In a multivariate analysis individuals homozygous for the +1444T allele showed higher CRP concentrations (day 1, 21.10+/-4.81 mg/L and day 7, 4.89+/-0.74 mg/L) compared with C-allele carriers (day 1, 12.37+/-1.61 mg/L and day 7, 3.08+/-2.00 mg/L). This effect was independent of conventional cardiovascular risk factors and inflammatory factors known to affect CRP concentrations. CRP genotype may need to be considered when CRP values are used in coronary risk prediction.

  7. c-Myc-Induced Survivin Is Essential for Promoting the Notch-Dependent T Cell Differentiation from Hematopoietic Stem Cells

    PubMed Central

    Haque, Rizwanul; Song, Jianyong; Haque, Mohammad; Lei, Fengyang; Sandhu, Praneet; Ni, Bing; Zheng, Songguo; Fang, Deyu; Yang, Jin-Ming; Song, Jianxun

    2017-01-01

    Notch is indispensable for T cell lineage commitment, and is needed for thymocyte differentiation at early phases. During early stages of T cell development, active Notch prevents other lineage potentials including B cell lineage and myeloid cell (e.g., dendritic cell) lineage. Nevertheless, the precise intracellular signaling pathways by which Notch promotes T cell differentiation remain unclear. Here we report that the transcription factor c-Myc is a key mediator of the Notch signaling–regulated T cell differentiation. In a well-established in vitro differentiation model of T lymphocytes from hematopoietic stem cells, we showed that Notch1 and 4 directly promoted c-Myc expression; dominant-negative (DN) c-Myc inhibited early T cell differentiation. Moreover, the c-Myc expression activated by Notch signaling increased the expression of survivin, an inhibitor of apoptosis (IAP) protein. We further demonstrated that over-expression of c-Myc increased the abundance of survivin and the T cell differentiation thereof, whereas dn c-Myc reduced survivin levels and concomitantly retarded the differentiation. The c-Myc–dependent survivin induction is functionally germane, because Notch-dependent T cell differentiation was canceled by the depletion of survivin. These results identify both c-Myc and survivin as important mediators of the Notch signaling–regulated differentiation of T lymphocytes from hematopoietic stem cells. PMID:28272325

  8. Antenna-coupled high T.sub.c superconducting microbolometer

    DOEpatents

    Hu, Qing

    1992-01-01

    A device is provided for measuring radiant energy, the device comprising a substrate; a bolometer formed from a high T.sub.c superconducting material disposed on the substrate in an area that is about 1.times.5 .mu.m.sup.2 and about 0.02 .mu.m in depth; and a planar antenna disposed on the substrate and coupled to receive radiation and to impart the received radiation to the bolometer.

  9. Mycoplasma-induced BALB/c 3T3 collagenase is a mammalian enzyme.

    PubMed Central

    Kluve, B; Merrick, W C; Gershman, H

    1983-01-01

    A collagenase previously reported to accumulate in the medium of cultures of BALB/c 3T3 cells on infection with Mycoplasma orale [Kluve, Merrick, Stanbridge & Gershman (1981) Nature (London) 292, 855-857] was partially purified and characterized. With regard to purification properties, activation, sensitivity to inhibitors and relative molecular mass the enzyme was similar to previously reported vertebrate collagenases, but could not be unequivocally distinguished from bacterial collagenases. With regard to substrate-specificity and reaction products, however, the collagenase was typical of vertebrate collagenases and distinct from bacterial collagenases. Specifically, the enzyme displayed a preference for type III collagen and type I collagen, a somewhat decreased ability to degrade type II collagen, and a very limited ability to degrade type IV collagen. The initial products of the action of the collagenase on type I collagen were characterized as fragments one-quarter and three-quarters of the length of the intact collagen molecule. Because the properties of the collagenase produced by cultures of mycoplasma-infected BALB/c 3T3 cells are those of a mammalian-type (vertebrate-type) enzyme, we have concluded that the collagenase is a product of the mouse (BALB/c 3T3) genome, and is not produced by the mycoplasma. Therefore it appears that infection of BALB/c 3T3 mouse fibroblasts with Mycoplasma orale induces the mouse cells to produce and secrete collagenase. PMID:6309150

  10. Methionine Regulates mTORC1 via the T1R1/T1R3-PLCβ-Ca2+-ERK1/2 Signal Transduction Process in C2C12 Cells.

    PubMed

    Zhou, Yuanfei; Ren, Jiao; Song, Tongxing; Peng, Jian; Wei, Hongkui

    2016-10-11

    The mammalian target of rapamycin complex 1 (mTORC1) integrates amino acid (AA) availability to support protein synthesis and cell growth. Taste receptor type 1 member (T1R) is a G protein-coupled receptor that functions as a direct sensor of extracellular AA availability to regulate mTORC1 through Ca 2+ stimulation and extracellular signal-regulated kinases 1 and 2 (ERK1/2) activation. However, the roles of specific AAs in T1R1/T1R3-regulated mTORC1 are poorly defined. In this study, T1R1 and T1R3 subunits were expressed in C2C12 myotubes, and l-AA sensing was accomplished by T1R1/T1R3 to activate mTORC1. In response to l-AAs, such as serine (Ser), arginine (Arg), threonine (Thr), alanine (Ala), methionine (Met), glutamine (Gln), and glycine (Gly), Met induced mTORC1 activation and promoted protein synthesis. Met also regulated mTORC1 via T1R1/T1R3-PLCβ-Ca 2+ -ERK1/2 signal transduction. Results revealed a new role for Met-regulated mTORC1 via an AA receptor. Further studies should be performed to determine the role of T1R1/T1R3 in mediating extracellular AA to regulate mTOR signaling and to reveal its mechanism.

  11. Association between the methylenetetrahydrofolate reductase polymorphisms and risk of acute lymphoblastic leukemia in Serbian children.

    PubMed

    Damnjanovic, Tatjana; Milicevic, Radomir; Novkovic, Tanja; Jovicic, Olivera; Bunjevacki, Vera; Jekic, Biljana; Lukovic, Ljiljana; Novakovic, Ivana; Redzic, Danka; Milasin, Jelena

    2010-05-01

    Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. Polymorphisms in the MTHFR gene have been associated with susceptibility to some types of cancer. We investigated a possible association of MTHFR polymorphisms (677C>T and 1298A>C) and increased risk for acute lymphoblastic leukemia in 78 affected children. The frequencies of both MTHFR 677 genotypes and alleles were significantly different between patients and controls. A significant association between CT/TT individuals and reduced risk of acute lymphoblastic leukemia was found. The odds ratios were 0.53 (95% confidence interval, 032-0.89) and 0.30 (95% confidence interval, 0.12-0.81). Polymorphism 1298 did not show statistical difference between patients and controls.

  12. In Vitro Selective Anti-Proliferative Effect of Zinc Oxide Nanoparticles Against Co-Cultured C2C12 Myoblastoma Cancer and 3T3-L1 Normal Cells.

    PubMed

    Chandrasekaran, Murugesan; Pandurangan, Muthuraman

    2016-07-01

    The zinc oxide (ZnO) nanoparticle has been widely used in biomedical applications and cancer therapy and has been reported to induce a selective cytotoxic effect on cancer cell proliferation. The present study investigated the cytotoxicity of ZnO nanoparticles against co-cultured C2C12 myoblastoma cancer cells and 3T3-L1 adipocytes. Our results showed that the ZnO nanoparticles could be cytotoxic to C2C12 myoblastoma cancer cells than 3T3-L1 cells. The messenger RNA (mRNA) expressions of p53 and bax were significantly increased 114.3 and 118.2 % in the C2C12 cells, whereas 42.5 and 40 % were increased in 3T3-L1 cells, respectively. The mRNA expression of bcl-2 was reduced 38.2 and 28.5 % in the C2C12 and 3T3-L1 cells, respectively, whereas the mRNA expression of caspase-3 was increased 80.7 and 51.6 % in the C2C12 and 3T3-L1 cells, respectively. The protein expressions of p53, bax, and caspase-3 were significantly increased 40, 81.8, and 80 % in C2C12 cells, whereas 20.3, 28.2, and 37.9 % were increased in 3T3-L1 cells, respectively. The mRNA expression of bcl-2 was significantly reduced 32.2 and 22.7 % in C2C12 and 3T3-L1 cells, respectively. Caspase-3 enzyme activity and reactive oxygen species (ROS) were increased in co-cultured C2C12 cells compared to 3T3-L1 cells. Taking all these data together, it may suggest that ZnO nanoparticles severely induce apoptosis in C2C12 myoblastoma cancer cells than 3T3-L1 cells.

  13. Polymorphisms in folate-metabolizing enzymes and response to 5-fluorouracil among patients with stage II or III rectal cancer (INT-0144; SWOG 9304).

    PubMed

    Ulrich, Cornelia M; Rankin, Cathryn; Toriola, Adetunji T; Makar, Karen W; Altug-Teber, Özge; Benedetti, Jacqueline K; Holmes, Rebecca S; Smalley, Stephen R; Blanke, Charles D; Lenz, Heinz-Josef

    2014-11-01

    Recurrence and toxicity occur commonly among patients with rectal cancer who are treated with 5-fluorouracil (5-FU). The authors hypothesized that genetic variation in folate-metabolizing genes could play a role in interindividual variability. The objective of the current study was to evaluate the associations between genetic variants in folate-metabolizing genes and clinical outcomes among patients with rectal cancer treated with 5-FU. The authors investigated 8 functionally significant polymorphisms in 6 genes (methylenetetrahydrofolate reductase [MTHFR] [C677T, A1298C], SLC19A1 [G80A], SHMT1 [C1420T], dihydrofolate reductase [DHFR] [Del19bp], TS 1494del,and TSER) involved in folate metabolism in 745 patients with TNM stage II or III rectal cancer enrolled in a phase 3 adjuvant clinical trial of 3 regimens of 5-FU and radiotherapy (INT-0144 and SWOG 9304). There were no statistically significant associations noted between polymorphisms in any of the genes and overall survival, disease-free survival (DFS), and toxicity in the overall analyses. Nevertheless, there was a trend toward worse DFS among patients with the variant allele of MTHFR C677T compared with wild-type, particularly in treatment arm 2, in which patients with the MTHFR C677T TT genotype had worse overall survival (hazards ratio, 1.76; 95% confidence interval, 1.06-2.93 [P = .03]) and DFS (hazards ratio, 1.84; 95% confidence interval, 1.12-3.03 [P = .02]) compared with those with homozygous wild-type. In addition, there was a trend toward reduced hematological toxicity among patients with variants of SLC19A1 G80A in treatment arm 1 (P for trend, .06) and reduced esophagitis/stomatitis noted among patients with variants of TSER in treatment arm 3 (P for trend, .06). Genetic variability in folate-metabolizing enzymes was found to be associated only to a limited degree with clinical outcomes among patients with rectal cancer treated with 5-FU. © 2014 American Cancer Society.

  14. Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang, Min; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

    2009-06-05

    We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicatesmore » that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.« less

  15. Stabilization of high T(sub c) phase in bismuth cuprate superconductor by lead doping

    NASA Technical Reports Server (NTRS)

    Gupta, Ram. P.; Pachauri, J. P.; Khokle, W. S.; Nagpal, K. C.; Date, S. K.

    1990-01-01

    It has widely been ascertained that doping of lead in Bi:Sr:Ca:Cu:O systems promotes the growth of high T(sub c) (110 K) phase, improves critical current density, and lowers processing temperature. A systematic investigation is undertaken to determine optimum lead content and processing conditions to achieve these. A large number of samples with cationic compositions of Bi(2-x)Pb(x)Sr2Ca2Cu3 (x = 0.2 to 2.0) were prepared by conventional solid state reaction technique. Samples of all compositions were annealed together at a temperature and characterized through resistance-temperature (R-T) measurements and x ray diffraction (XRD) to determine the zero resistance temperature, T(sub c)(0) and to identify presence of phases, respectively. The annealing temperature was varied between 790 C to optimize processing parameters. Results are given. In brief, an optimum process is reported along with composition of leaded bismuth cuprate superconductor which yields nearly a high T(sub c) single phase with highly stable superconducting properties.

  16. Dietary consumption of B vitamins, maternal MTHFR polymorphisms and risk for spontaneous abortion

    PubMed Central

    Rodríguez-Guillén, María del Rosario; Torres-Sánchez, Luisa; Chen, Jia; Galván-Portillo, Marcia; Silva-Zolezzi, Irma; Blanco-Muñoz, Julia; Hernández-Valero, María A.; López-Carrillo, Lizbeth

    2010-01-01

    Objective To asses he association between intake of folate and B vitamins and the incidence of spontaneous abortion (SA) according to the maternal methylenetetrahydrofolate reductase (MTHFR) polymorphisms (677 C>T and 1298 A>C). Material and Methods We conducted a nested case-control study within a perinatal cohort of women recruited in the state of Morelos, Mexico. Twenty-three women with SA were compared to 74 women whose pregnancy survived beyond week 20th. Intake of folate and B vitamins respectively, was estimated using a validated food frequency questionnaire. Maternal MTHFR polymorphisms were determined by PCR-RFLP and serum homocysteine levels by HPLC. Results Carriers of MTHFR 677TT and 1298AC genotypes respectively showed an increased risk of SA (OR 677TT vs. CC/CT=5.0; 95% CI: 1.2, 20.9 and OR 1298 AC vs. AA=5.5; 95% CI: 1.1, 26.6). Conclusions Our results support the role of MTHFR polymorphisms as a risk factor for SA, regardless of dietary intake of B vitamins. PMID:19180309

  17. Electron energy spectrum and magnetic interactions in high-T(sub c) superconductors

    NASA Technical Reports Server (NTRS)

    Turshevski, S. A.; Liechtenstein, A. I.; Antropov, V. P.; Gubanov, V. A.

    1990-01-01

    The character of magnetic interactions in La-Sr-Cu-O and Y-Ba-Cu-O systems is of primary importance for analysis of high-T(sub c) superconductivity in these compounds. Neutron diffraction experiments showed the antiferromagnetic ground state for nonsuperconducting La2CuO4 and YBa2Cu3O6 with the strongest antiferromagnetic superexchange being in the ab plane. The nonsuperconducting '1-2-3' system has two Neel temperatures T sub N1 and T sub N2. The first one corresponds to the ordering of Cu atoms in the CuO2 planes; T sub N2 reflects the antiferromagnetic ordering of magnetic moments in CuO chains relatively to the moments in the planes T sub N1 and T sub N2 depend strongly on the oxygen content. Researchers describe magnetic interactions in high-T superconductors based on the Linear Muffin-Tin Orbitals (LMTO) band structure calculations. Exchange interaction parameters can be defined from the effective Heisenberg hamiltonian. When the magnetic moments are not too large, as copper magnetic moments in superconducting oxides, J sub ij parameters can be defined through the non-local magnetic susceptibility of spin restricted solution for the crystal. The results of nonlocal magnetic susceptibility calculations and the values of exchange interaction parameters for La CuO and YBa2Cu3O7 systems are given in tabular form. Strong anisotropy of exchange interactions in the ab plane and along the c axis in La2CuO4 is obviously seen. The value of Neel temperature found agrees well with the experimental data available. In the planes of '1-2-3' system there are quite strong antiferromagnetic Cu-O and O-O interaction which appear due to holes in oxygen subbands. These results are in line with the magnetic model of oxygen holes pairing in high-T(sub c) superconductors.

  18. Antenna-coupled high T[sub c] superconducting microbolometer

    DOEpatents

    Hu, Q.

    1992-12-15

    A device is provided for measuring radiant energy, the device comprising a substrate; a bolometer formed from a high T[sub c] superconducting material disposed on the substrate in an area that is about 1[times]5 [mu]m[sup 2] and about 0.02 [mu]m in depth; and a planar antenna disposed on the substrate and coupled to receive radiation and to impart the received radiation to the bolometer. 5 figs.

  19. Evaluation of Effect CAT -262C/T, SOD + 35A/C, GPx1 Pro197Leu Polymorphisms in Patients with IBD in the Polish Population.

    PubMed

    Mrowicki, Jerzy; Mrowicka, Małgorzata; Majsterek, Ireneusz; Mik, Michał; Dziki, Adam; Dziki, Łukasz

    2016-12-01

    Inflammatory bowel disease (IBD) are a heterogeneous group of disorders in the course dominated by chronic, recurrent gastrointestinal inflammation. It is believed that the activation of IBD occurs in patients with a genetic predisposition to their development. Chronic inflammation develops as a result of an excessive reaction of the immune system principally under the influence of environmental risk factors. Among them, it has been shown that the mechanism of oxidative stress is associated with the pathophysiology of inflammatory bowel disease, responsible for the commencement and progress of these diseases. The aim of the study was the relationship between single nucleotide polymorphisms (SNPs) of individual antioxidant enzymes, and the prevalence of inflammatory bowel disease that may be associated with increased levels of oxidative stress. A total of 111 IBD patients, including 65 patients with ulcerative colitis (UC) and 46 with Crohn's disease (CD) and 125 healthy controls recruited from the Polish population, were genotyped for CAT -262C / T (rs1001179), SOD + 35A / C (rs2234694), GPx Pro 197 Leu polymorphisms. Genotyping of CAT, SOD, GPx gene polymorphism was performed by a RFLP-PCR. The performed analysis of genetic polymorphisms of antioxidant enzymes showed that polymorphic variant of the CAT -262 C / T may have protective effects in patients with ulcerative colitis in the range of genotype C / T; OR = 0.49 (0.25-0.99), p = 0.044. Trend protective, but statistically unrelated, it was also observed for genotype T / T and T allele of the same polymorphism and genotypes and alleles + 35A / C SOD1 in UC as well as polymorphic variants CAT -262 C / T, Pro197Leu of GPx1, + 35A / C SOD1 in CD. The results were compared with a control group of potentially healthy individuals without such diseases. It has been shown that the polymorphism of antioxidant enzymes CAT gene -262 C / T may have protective effects in patients who are carriers of a genotype C / T at the

  20. Regulatory T cells control HIV replication in activated T cells through a cAMP-dependent mechanism

    PubMed Central

    Moreno-Fernandez, Maria E.; Rueda, Cesar Mauricio; Rusie, Laura K.

    2011-01-01

    We hypothesized that regulatory T cells (Tregs) could play a beneficial role during HIV infection by controlling HIV replication in conventional T cells (Tcons). Purified Tregs and Tcons from healthy donors were activated separately. Tcons were infected with the X4 or R5 HIV strains and cultured with or without autologous Tregs. Coculture of Tcons and Tregs resulted in a dose-dependent inhibition of Tcon infection, which was significant when a 1:1 Treg:Tcon ratio was used. Treg suppression of HIV infection was largely mediated by contact-dependent mechanisms. Blockage of cytotoxic T-lymphocyte–associated antigen-4 did not significantly reduce Treg function. In contrast, Tregs acted through cAMP-dependent mechanisms, because the decrease of cAMP levels in Tregs, the blockade of gap junction formation between Tregs and Tcons, the blockage of CD39 activity, and the blockage of protein kinase A in Tcons all abolished Treg-mediated suppression of HIV replication. Our data suggest a complex role for Tregs during HIV infection. Although Tregs inhibit specific immune responses, their inhibition of HIV replication in Tcons may play a beneficial role, particularly during early HIV infection, when the effector immune cells are not yet activated. Such a protective role of Tregs could have a profound impact on infection outcome. PMID:21436067

  1. Bi-2212/1T-TaS2 Van der Waals junctions: Interplay of proximity induced high-T c superconductivity and CDW order.

    PubMed

    Li, Ang J; Zhu, Xiaochen; Stewart, G R; Hebard, Arthur F

    2017-07-05

    Understanding the coexistence, competition and/or cooperation between superconductivity and charge density waves (CDWs) in the transition metal dichalcogenides (TMDs) is an elusive goal which, when realized, promises to reveal fundamental information on this important class of materials. Here, we use four-terminal current-voltage measurements to study the Van der Waals interface between freshly exfoliated flakes of the high-T c superconductor, Bi-2212, and the CDW-dominated TMD layered material, 1T-TaS 2 . For highly transparent barriers, there is a pronounced Andreev reflection feature providing evidence for proximity-induced high-T c superconductivity in 1T-TaS 2 with a surprisingly large energy gap (~20 meV) equal to half that of intrinsic Bi-2212 (~40 meV). Our systematic study using conductance spectroscopy of junctions with different transparencies also reveals the presence of two separate boson modes, each associated with a "dip-hump" structure. We infer that the proximity-induced high-T c superconductivity in the 1T-TaS 2 is driven by coupling to the metastable metallic phase coexisting within the Mott commensurate CDW (CCDW) phase and associated with a concomitant change of the CCDW order parameter in the interfacial region.

  2. Serine Protease Inhibitor Kazal Type 1 (SPINK1) c.194+2T > C Mutation May Predict Long-term Outcome of Endoscopic Treatments in Idiopathic Chronic Pancreatitis.

    PubMed

    Sun, Chang; Liu, Mu-Yun; Liu, Xiao-Gang; Hu, Liang-Hao; Xia, Tian; Liao, Zhuan; Li, Zhao-Shen

    2015-11-01

    Endoscopic interventional is a commonly used treatment method for idiopathic chronic pancreatitis. Serine protease inhibitor Kazal type 1 (SPINK1) 194+2T>C mutation is most frequently observed in Chinese pancreatitis patients and influences the clinical course of idiopathic chronic pancreatitis patients. We conducted this study to determine the impacts of this mutation on the outcome of endoscopic treatments.In this study, we enrolled 423 patients. Among them, 101 idiopathic chronic pancreatitis patients without other relevant mutations had a successful endoscopic procedure and completed follow-up. Clinical characteristics including Izbicki pain score, exocrine and endocrine function, were evaluated. Genetic sequencing was conducted to detect SPINK1 194+2T>C mutations.The c.194+2T>C mutation was found in 58 (57.43%) patients. Factors relevant to pain relief are c.194+2T>C mutation (P = 0.011), severe pain before treatment (P = 0.005), and necessary subsequent endoscopic treatments (P < 0.001). More patients with the intronic mutation had deteriorated endocrine function (P = 0.001) relative to those patients without the mutation.Patients carrying the c.194+2T>C mutation were less likely to achieve pain relief through endoscopic treatments. They also have a higher risk of endocrine function deterioration. SPINK1 c.194+2T>C mutation may be applied as a pretreatment predictor in idiopathic chronic pancreatitis patients.

  3. No effect of folic acid supplementation on global DNA methylation in men and women with moderately elevated homocysteine.

    PubMed

    Jung, Audrey Y; Smulders, Yvo; Verhoef, Petra; Kok, Frans J; Blom, Henk; Kok, Robert M; Kampman, Ellen; Durga, Jane

    2011-01-01

    A global loss of cytosine methylation in DNA has been implicated in a wide range of diseases. There is growing evidence that modifications in DNA methylation can be brought about by altering the intake of methyl donors such as folate. We examined whether long-term daily supplementation with 0.8 mg of folic acid would increase global DNA methylation compared with placebo in individuals with elevated plasma homocysteine. We also investigated if these effects were modified by MTHFR C677T genotype. Two hundred sixteen participants out of 818 subjects who had participated in a randomized double-blind placebo-controlled trial were selected, pre-stratified on MTHFR C677T genotype and matched on age and smoking status. They were allocated to receive either folic acid (0.8 mg/d; n = 105) or placebo treatment (n = 111) for three years. Peripheral blood leukocyte DNA methylation and serum and erythrocyte folate were assessed. Global DNA methylation was measured using liquid chromatography-tandem mass spectrometry and expressed as a percentage of 5-methylcytosines versus the total number of cytosine. There was no difference in global DNA methylation between those randomized to folic acid and those in the placebo group (difference = 0.008, 95%CI = -0.05,0.07, P = 0.79). There was also no difference between treatment groups when we stratified for MTHFR C677T genotype (CC, n = 76; CT, n = 70; TT, n = 70), baseline erythrocyte folate status or baseline DNA methylation levels. In moderately hyperhomocysteinemic men and women, long-term folic acid supplementation does not increase global DNA methylation in peripheral blood leukocytes.ClinicalTrials.gov NCT00110604.

  4. Determinants of the cytotoxicity of PrrC anticodon nuclease and its amelioration by tRNA repair

    PubMed Central

    Meineke, Birthe; Shuman, Stewart

    2012-01-01

    Breakage of tRNALys(UUU) by the Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies a host antiviral response to phage T4 infection that is ultimately thwarted by a virus-encoded RNA repair system. PrrC homologs are prevalent in other bacteria, but their activities and substrates are not defined. We find that induced expression of EcoPrrC is toxic in Saccharomyces cerevisiae and E. coli, whereas the Neisseria meningitidis PrrC (NmePrrC) is not. PrrCs consist of an N-terminal NTPase module and a C-terminal nuclease module. Domain swaps identified the EcoPrrC nuclease domain as decisive for toxicity when linked to either the Eco or Nme NTPase. Indeed, a single arginine-to-tryptophan change in the NmePrrC nuclease domain (R316W) educed a gain-of-function and rendered NmePrrC toxic to yeast, with genetic evidence for tRNALys(UUU) being the relevant target. The reciprocal Trp-to-Arg change in EcoPrrC (W335R) abolished its toxicity. Further mutagenesis of the EcoPrrC nuclease domain highlighted an ensemble of 15 essential residues and distinguished between hypomorphic alleles and potential nuclease-nulls. We report that the RNA repair phase of the bacterial virus-host dynamic is also portable to yeast, where coexpression of the T4 enzymes Pnkp and Rnl1 ameliorated the toxicity of NmePrrC-R316W. Plant tRNA ligase AtRNL also countered NmePrrC-R316W toxicity, in a manner that depended on AtRNL's 5′-kinase and ligase functions. PMID:22101242

  5. Determinants of the cytotoxicity of PrrC anticodon nuclease and its amelioration by tRNA repair.

    PubMed

    Meineke, Birthe; Shuman, Stewart

    2012-01-01

    Breakage of tRNA(Lys(UUU)) by the Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies a host antiviral response to phage T4 infection that is ultimately thwarted by a virus-encoded RNA repair system. PrrC homologs are prevalent in other bacteria, but their activities and substrates are not defined. We find that induced expression of EcoPrrC is toxic in Saccharomyces cerevisiae and E. coli, whereas the Neisseria meningitidis PrrC (NmePrrC) is not. PrrCs consist of an N-terminal NTPase module and a C-terminal nuclease module. Domain swaps identified the EcoPrrC nuclease domain as decisive for toxicity when linked to either the Eco or Nme NTPase. Indeed, a single arginine-to-tryptophan change in the NmePrrC nuclease domain (R316W) educed a gain-of-function and rendered NmePrrC toxic to yeast, with genetic evidence for tRNA(Lys(UUU)) being the relevant target. The reciprocal Trp-to-Arg change in EcoPrrC (W335R) abolished its toxicity. Further mutagenesis of the EcoPrrC nuclease domain highlighted an ensemble of 15 essential residues and distinguished between hypomorphic alleles and potential nuclease-nulls. We report that the RNA repair phase of the bacterial virus-host dynamic is also portable to yeast, where coexpression of the T4 enzymes Pnkp and Rnl1 ameliorated the toxicity of NmePrrC-R316W. Plant tRNA ligase AtRNL also countered NmePrrC-R316W toxicity, in a manner that depended on AtRNL's 5'-kinase and ligase functions.

  6. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    PubMed

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  7. Novel Nonsense Variants c.58C>T (p.Q20X) and c.256G>T (p.E85X) in the CHEK2 Gene Identified in Breast Cancer Patients from Balochistan.

    PubMed

    Baloch, Abdul Hameed; Khosa, Ahmad Nawaz; Bangulzai, Nasrullah; Shuja, Jamila; Naseeb, Hafiz Khush; Jan, Mohammad; Marghazani, Illahi Bakhsh; Kakar, MasoodulHaq; Baloch, Dost Mohammad; Cheema, Abdul Majeed; Ahmad, Jamil

    2016-01-01

    Breast cancer is very common and the leading cause of cancer deaths among women globally. Hereditary cases account for 510% of the total burden and CHEK2, which plays crucial role in response to DNA damage to promote cell cycle arrest and repair or induce apoptosis, is considered as a moderate penetrance breast cancer risk gene. Our objective in the current study was to analyze mutations in related to breast cancer. A total of 271 individuals including breast cancer patients and normal subjects were enrolled and all 14 exons of CHEK2 were amplified and sequenced. The majority of the patients (>95%) were affected with invasive ductal carcinoma (IDC), 52.1% were diagnosed with grade III tumors and 56.2% and 27.5% with advanced stages III and IV. Two novel nonsense variants i.e. c.58C>T (P.Q20X) and c.256G>T (p.E85X) at exon 1 and 2 in two breast cancer patients were identified, both novel and not reported elsewhere.

  8. Gender- and obesity-specific effect of apolipoprotein C3 gene (APOC3) -482C>T polymorphism on triglyceride concentration in Turkish adults.

    PubMed

    Coban, Neslihan; Onat, Altan; Guclu-Geyik, Filiz; Komurcu-Bayrak, Evrim; Sansoy, Vedat; Hergenc, Gulay; Can, Günay; Erginel-Unaltuna, Nihan

    2011-10-18

    Apolipoprotein C3 (APOC3) gene polymorphisms are associated with cardiometabolic risk factors, varying in ethnicities. This study aimed to investigate such association between the APOC3 -482C>T polymorphism and cardiometabolic risk factors in the turkish adult risk factor (TARF) study cohort, stratifying by gender and obesity. Randomly selected 1548 individuals (757 male and 791 female, mean age 49.9±11.8 years) were genotyped for -482C>T polymorphism using hybridization probes in a Real-Time PCR LC480 device. The -482TT genotype prevailed 9.9% in men and 11.5% in women. Association between 482C>T polymorphism and dyslipidemia (p=0.036, OR=1.42, 95%Cl=1.02-1.97) was found only in men. Analysis of variance showed that anthropometric and metabolic variables were not differently distributed in APOC3 -482C>T genotypes in the study population. In relation to dyslipidemia and obesity, the -482C>T polymorphism showed significant gender-by-genotype interactions (p<0.01). When the study population was stratified according to gender and obesity, homozygotes for the T allele were associated strongly with (by 45%) elevated fasting triglyceride concentrations in obese men (p=0.009) and homeostatic model assessment (HOMA) index in non-obese women (p=0.013). Furthermore, in the same subgroups, the associations of the fasting triglyceride concentrations and HOMA index with the TT genotype remained after adjustment for risk factors (p<0.05). APOC3 -482TT genotype is independently associated with elevated fasting triglyceride concentrations in obese men. Presence of obesity seems to be required for this genotype to induce markedly elevated triglycerides. Furthermore, it is associated with the dyslipidemia in men, without requirement of obesity.

  9. Association between Thrombophilic Genes Polymorphisms and Recurrent Pregnancy Loss Susceptibility in the Iranian Population: a Systematic Review and Meta-Analysis

    PubMed Central

    Kamali, Mahdieh; Hantoushzadeh, Sedigheh; Borna, Sedigheh; Neamatzadeh, Hossein; Mazaheri, Mahta; Noori-Shadkam, Mahmood; Haghighi, Fatemeh

    2018-01-01

    Studies have indicated that thrombophilic genes polymorphisms are associated with recurrent pregnancy loss (RPL) in the Iranian population. We aimed to evaluate the precise association between thrombophilic genes polymorphisms (MTHFR C677T, MTHFR A1298C, Prothrombin G20210A, FVL G1691A, and PAI-1 4G/5G) and RPL risk in the Iranian population. PubMed, Web of Science, Google Scholar, and ISC were searched for eligible articles published up to April 1, 2017. In total, 37 case-control studies in 18 relevant publications were selected: 1,199, 1,194, 630, 830, and 955 RPL cases and 1,079, 1079, 594, 794, and 499 controls for MTHFR C677T, MTHFR A1298C,Prothrombin G20210A, FVL G1691A, and PAI-1 4G/5G, respectively. The results indicated a significant increased risk of RPL in all genetic models in the population. Also, Prothrombin G20210A and FVL G1691A as well as PAI-1 4G/5G polymorphisms were associated with RPL risk in the Iranian population. Hence, thrombophilic genes polymorphisms are associated with an increased RPL risk in the Iranian population. PMID:28734273

  10. The importance of folate, vitamins B6 and B12 for the lowering of homocysteine concentrations for patients with recurrent pregnancy loss and MTHFR mutations.

    PubMed

    Serapinas, Danielius; Boreikaite, Evelina; Bartkeviciute, Agne; Bandzeviciene, Rita; Silkunas, Mindaugas; Bartkeviciene, Daiva

    2017-09-01

    In patients with MTHFR (methylenetetrahydrofolate reductase) mutations and hyperhomocysteinemia, recurrent pregnancy loss is a frequent feature. The aim of the study was to evaluate the impact of folic acid, vitamins B6 and B12 supplementation for the lowering of total homocysteine concentrations and pregnancy. 16 patients who had had 3 or more miscarriages and MTHFR mutations were used in the study. They received methylfolate (5mg/day), vitamin B6 (50mg/day) and vitamin B12 (1mg/week). Supplementation induced a decrease in homocysteine from 19.4±5.3μmol/L to 6.9±2.2μmol/L after folate supplementation (p<0.05). During one year 7 women became pregnant and delivered. Two women delivered from the homozygous C677T mutations group (7 patients) and combined heterozygous C677T/A1298C mutations group (5 patients), while 3 deliveries were in A1298C homozygous mutations group (4 patients). In conclusion, supraphysiologic methylfolate, vitamins B6 and B12 supplementation in woman with MTHFR mutations has a beneficial effect on pregnancy outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family.

    PubMed

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam

    2016-09-01

    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β 0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  12. Association of lactase 13910 C/T polymorphism with bone mineral density and fracture risk: a meta-analysis.

    PubMed

    Wu, Yougen; Li, Yinghua; Cui, Yunqing; Zhou, Yunjiao; Qian, Qingqing; Hong, Yang

    2017-12-01

    A number of studies have investigated the association of lactase (LCT,C/T-13910) gene polymorphismwith bonemineral density (BMD) and fracture risk, but previous results were inconclusive. In this study, a meta-analysis was performed to quantify the association of LCT (C/T-13910) polymorphism with BMD and fracture risk. Eligible publications were searched in the PubMed, Web of Science, Embase databases, Google Scholar, Yahoo and Baidu. Pooled weighed mean difference (WMD) or odds ratio (OR) with their 95% confidence interval (CI) were calculated using a fixed-effects or random-effects model. A total of nine articles with 8871 subjects were investigated in the presentmeta-analysis. Overall, the TT/TC genotypes of LCT 13910 C/T polymorphism showed significantly higher BMD than those with the CC genotype at femur neck (FN) (WMD = 0.011 g/cm 2 , 95% CI = 0.004-0.018, P = 0.003). Besides, LCT 13910 C/T polymorphism may decrease the risk of any site fractures (for TT versus TC+CC, OR = 0.813, 95% CI = 0.704-0.938, P = 0.005; for T allele versus C allele, OR = 0.885, 95% CI = 0.792-0.989, P = 0.032). However, there was no significant association of LCT 13910 C/T polymorphism with BMD at lumbar spine and risk of vertebral fractures under all genetic contrast models (all P values were >0.05). The meta-analysis suggests that there are significant effects of LCT 13910 C/T polymorphism on BMD and fracture risk. Large-scale studies with different ethnic populations will be needed to further investigate the possible race-specific effect of LCT 13910 C/T polymorphism on BMD and fracture risk.

  13. Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Fuxin; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

    2009-11-20

    We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visualmore » impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.« less

  14. High Resolution 13C MRI With Hyperpolarized Urea: In Vivo T2 Mapping and 15N Labeling Effects

    PubMed Central

    Reed, Galen D.; von Morze, Cornelius; Bok, Robert; Koelsch, Bertram L.; Van Criekinge, Mark; Smith, Kenneth J.; Shang, Hong; Larson, Peder E. Z.; Kurhanewicz, John; Vigneron, Daniel B.

    2014-01-01

    13C steady state free precession (SSFP) magnetic resonance imaging and effective spin-spin relaxation time (T2) mapping were performed using hyperpolarized [13C] urea and [13C, 15N2] urea injected intravenously in rats. 15N labeling gave large T2 increases both in solution and in vivo due to the elimination of a strong scalar relaxation pathway. The T2 increase was pronounced in the kidney, with [13C, 15N2] urea giving T2 values of 6.3±1.3 s in the cortex and medulla, and 11±2 s in the renal pelvis. The measured T2 in the aorta was 1.3±0.3 s. [13C] urea showed shortened T2 values in the kidney of 0.23±0.03 s compared to 0.28±0.03 s measured in the aorta. The enhanced T2 of [13C, 15N2] urea was utilized to generate large signal enhancement by SSFP acquisitions with flip angles approaching the fully refocused regime. Projection images at 0.94 mm in-plane resolution were acquired with both urea isotopes, with [13C, 15N2] urea giving a greater than four-fold increase in signal-to-noise ratio [13C] over urea. PMID:24235273

  15. ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

    PubMed

    Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

    2018-02-20

    Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  16. 10 CFR Appendix C to Subpart T of... - Certification Report for Distribution Transformers

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Certification Report for Distribution Transformers C..., App. C Appendix C to Subpart T of Part 431—Certification Report for Distribution Transformers All...: For Existing, New, or Modified Models: 1 Prepare tables that will list distribution transformer...

  17. Matrix metalloproteinase-9 functional promoter polymorphism 1562C>T increased risk of early-onset coronary artery disease.

    PubMed

    Saedi, Massoud; Vaisi-Raygani, Asad; Khaghani, Shahnaz; Shariftabrizi, Ahmad; Rezaie, M; Pasalar, Parvin; Rahimi, Zohreh; Pourmotabbed, Tayebeh

    2012-01-01

    The Matrix metalloproteinase-9 functional promoter polymorphism 1562C>T may be considered an important genetic determinant of early-onset coronary artery disease (ECAD). In this study, association between MMP-9 1562C>T allele with plasma MMP-9 activity, homocysteine and lipid-lipoproteins level and ECAD in Iranian subjects was investigated. This case-control study consisted of 53 ECAD patients (age < 55 years) and unrelated late-onsets CAD (age>70 years) who angiographically had at least 50% stenosis. MMP-9 1562C>T polymorphism was detected by PCRRFLP, plasma MMP-9 activity, serum lipid and homocysteine levels were determined by gelatin gel zymography, enzyme assay and by HPLC, respectively. The presence of MMP-9 1562C>T allele was found to be associated with ECAD (OR=3.2, P=0.001). The ECAD patients with MMP-9 1562C>T allele had higher MMP-9 activity (P=0.001), LDL-C (P=0.045), TC (P=0.02) and homocysteine (P=0.01) levels than the LCAD subjects. MMP-9 1562C>T allele is a risk factor for ECAD. The carriers of this allele have high levels of MMP-9 activity, LDL-C, TC and homocysteine (P=0.01), thus, are more likely to develop myocardial infarction and CAD at young age (less than 55 years).

  18. T cell autoreactivity directed toward CD1c itself rather than toward carried self lipids.

    PubMed

    Wun, Kwok S; Reijneveld, Josephine F; Cheng, Tan-Yun; Ladell, Kristin; Uldrich, Adam P; Le Nours, Jérôme; Miners, Kelly L; McLaren, James E; Grant, Emma J; Haigh, Oscar L; Watkins, Thomas S; Suliman, Sara; Iwany, Sarah; Jimenez, Judith; Calderon, Roger; Tamara, Kattya L; Leon, Segundo R; Murray, Megan B; Mayfield, Jacob A; Altman, John D; Purcell, Anthony W; Miles, John J; Godfrey, Dale I; Gras, Stephanie; Price, David A; Van Rhijn, Ildiko; Moody, D Branch; Rossjohn, Jamie

    2018-04-01

    The hallmark function of αβ T cell antigen receptors (TCRs) involves the highly specific co-recognition of a major histocompatibility complex molecule and its carried peptide. However, the molecular basis of the interactions of TCRs with the lipid antigen-presenting molecule CD1c is unknown. We identified frequent staining of human T cells with CD1c tetramers across numerous subjects. Whereas TCRs typically show high specificity for antigen, both tetramer binding and autoreactivity occurred with CD1c in complex with numerous, chemically diverse self lipids. Such extreme polyspecificity was attributable to binding of the TCR over the closed surface of CD1c, with the TCR covering the portal where lipids normally protrude. The TCR essentially failed to contact lipids because they were fully seated within CD1c. These data demonstrate the sequestration of lipids within CD1c as a mechanism of autoreactivity and point to small lipid size as a determinant of autoreactive T cell responses.

  19. Apolipoprotein C3 (-455T>C) polymorphism confers susceptibility to nonalcoholic fatty liver disease in the Southern Han Chinese population

    PubMed Central

    Li, Min-Rui; Zhang, Sheng-Hong; Chao, Kang; Liao, Xian-Hua; Yao, Jia-Yan; Chen, Min-Hu; Zhong, Bi-Hui

    2014-01-01

    AIM: To investigate the relationship between Apolipoprotein C3 (APOC3) (-455T>C) polymorphism and nonalcoholic fatty liver disease (NAFLD) in the Southern Chinese Han population. METHODS: In this prospective case-control study, we recruited 300 NAFLD patients and 300 healthy controls to a cohort representing Southern Chinese Han population at The First Affiliated Hospital, Sun Yat-sen University, from January to December 2012. Polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing were used to genotype the APOC3 (-455T>C) variants. RESULTS: After adjusting for age, gender, and body-mass index, TC and CC genotypes were found to increase the susceptibility to NAFLD compared to the TT genotype, with adjusted odds ratios (ORs) of 1.77 (95%CI: 1.16-2.72) and 2.80 (95%CI: 1.64-4.79), respectively. Further stratification analysis indicated that carriers of the CC genotype was more susceptible to insulin resistance (IR) than those of the TT genotype, with an OR of 3.24 (95%CI: 1.52-6.92). The CC genotype also was associated with a significantly higher risk of hypertension, hypertriglyceridemia, and low levels of high-density lipoprotein cholesterol (HDL) (P < 0.05). No association was found between the APOC3 (-455T>C) polymorphism and obesity, impaired glucose tolerance, hyperuricemia, hypercholesterolemia, or high levels of low-density lipoprotein cholesterol (LDL) (P > 0.05). CONCLUSION: APOC3 (-455T>C) genetic variation is involved in the susceptibility to developing NAFLD, IR, hypertension, hypertriglyceridemia, and low HDL in the Southern Chinese Han population. PMID:25320541

  20. Conserved region C functions to regulate PD-1 expression and subsequent CD8 T cell memory1

    PubMed Central

    Bally, Alexander P. R.; Tang, Yan; Lee, Joshua T.; Barwick, Benjamin G.; Martinez, Ryan; Evavold, Brian D.; Boss, Jeremy M.

    2016-01-01

    Expression of programmed death 1 (PD-1) on CD8 T cells promotes T cell exhaustion during chronic antigen exposure. During acute infections, PD-1 is transiently expressed and has the potential to modulate CD8 T cell memory formation. Conserved Region C (CR-C), a promoter proximal cis-regulatory element that is critical to PD-1 expression in vitro, responds to NFATc1, FoxO1, and/or NF-κB signaling pathways. Here, a CR-C knockout mouse (CRC−) was established to determine its role on PD-1 expression and corresponding effects on T cell function in vivo. Deletion of CR-C decreased PD-1 expression on CD4 T cells and antigen-specific CD8 T cells during acute and chronic lymphocytic choriomeningitis virus (LCMV) challenges, but did not affect the ability to clear an infection. Following acute LCMV infection, memory CD8 T cells in the CRC− mouse were formed in greater numbers, were more functional, and were more effective at responding to a melanoma tumor than wild-type memory cells. These data implicate a critical role for CR-C in governing PD-1 expression, and a subsequent role in guiding CD8 T cell differentiation. The data suggest the possibility that titrating PD-1 expression during CD8 T cell activation could have important ramifications in vaccine development and clinical care. PMID:27895178

  1. Effect of pressure on the superconducting {ital T}{sub {ital c}} of lanthanum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tissen, V.G.; Ponyatovskii, E.G.; Nefedova, M.V.

    1996-04-01

    The effect of pressure on the superconducting transition temperature {ital T}{sub {ital c}} of La was studied up to 50 GPa. {ital T}{sub {ital c}}({ital P}) shows a rather complicated variation with a discontinuous increase in {ital T}{sub {ital c}} at about 2.2 GPa due to the first-order phase transition from dhcp to fcc structure. At about 5.4 GPa a sharp peak is observed due to the soft-mode phase transition from fcc to the distorted fcc structure and two broad maxima are found within the stability region of the distorted fcc structure around 12 and 39 GPa. Some differences betweenmore » these and previous low-pressure data for metastable fcc La are noticed. The results are discussed in connection with pressure-induced structural phase transitions found in earlier x-ray-diffraction experiments and band-structure calculations giving evidences for van Hove singularities in the density of states. {copyright} {ital 1996 The American Physical Society.}« less

  2. miR-181c-BRK1 axis plays a key role in actin cytoskeleton-dependent T cell function.

    PubMed

    Lim, Shok Ping; Ioannou, Nikolaos; Ramsay, Alan G; Darling, David; Gäken, Joop; Mufti, Ghulam J

    2018-05-01

    MicroRNAs are short endogenous noncoding RNAs that play pivotal roles in a diverse range of cellular processes. The miR-181 family is important in T cell development, proliferation, and activation. In this study, we have identified BRK1 as a potential target of miR-181c using a dual selection functional assay and have showed that miR-181c regulates BRK1 by translational inhibition. Given the importance of miR-181 in T cell function and the potential role of BRK1 in the involvement of WAVE2 complex and actin polymerization in T cells, we therefore investigated the influence of miR-181c-BRK1 axis in T cell function. Stimulation of PBMC derived CD3 + T cells resulted in reduced miR-181c expression and up-regulation of BRK1 protein expression, suggesting that miR-181c-BRK1 axis is important in T cell activation. We further showed that overexpression of miR-181c or suppression of BRK1 resulted in inhibition of T cell activation and actin polymerization coupled with defective lamellipodia generation and immunological synapse formation. Additionally, we found that BRK1 silencing led to reduced expressions of other proteins in the WAVE2 complex, suggesting that the impairment of T cell actin dynamics was a result of the instability of the WAVE2 complex following BRK1 depletion. Collectively, we demonstrated that miR-181c reduces BRK1 protein expression level and highlighted the important role of miR-181c-BRK1 axis in T cell activation and actin polymerization-mediated T cell functions. ©2018 Society for Leukocyte Biology.

  3. CYP96T1 of Narcissus sp. aff. pseudonarcissus Catalyzes Formation of the Para-Para' C-C Phenol Couple in the Amaryllidaceae Alkaloids

    PubMed Central

    Kilgore, Matthew B.; Augustin, Megan M.; May, Gregory D.; Crow, John A.; Kutchan, Toni M.

    2016-01-01

    The Amaryllidaceae alkaloids are a family of amino acid derived alkaloids with many biological activities; examples include haemanthamine, haemanthidine, galanthamine, lycorine, and maritidine. Central to the biosynthesis of the majority of these alkaloids is a C-C phenol-coupling reaction that can have para-para', para-ortho', or ortho-para' regiospecificity. Through comparative transcriptomics of Narcissus sp. aff. pseudonarcissus, Galanthus sp., and Galanthus elwesii we have identified a para-para' C-C phenol coupling cytochrome P450, CYP96T1, capable of forming the products (10bR,4aS)-noroxomaritidine and (10bS,4aR)-noroxomaritidine from 4′-O-methylnorbelladine. CYP96T1 was also shown to catalyzed formation of the para-ortho' phenol coupled product, N-demethylnarwedine, as less than 1% of the total product. CYP96T1 co-expresses with the previously characterized norbelladine 4′-O-methyltransferase. The discovery of CYP96T1 is of special interest because it catalyzes the first major branch in Amaryllidaceae alkaloid biosynthesis. CYP96T1 is also the first phenol-coupling enzyme characterized from a monocot. PMID:26941773

  4. Anderson localization and ''universal'' degradation of T/sub c/ in high-temperature superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leavens, C.R.

    Anderson, Muttalib, and Ramakrishnan (AMR) showed that strong disorder leads to a frequency (..omega..) dependent increase of the Coulomb repulsion in a three-dimensional superconductor. Their one-free-parameter theory agrees nicely with the experimentally observed decrease in T/sub c/ but only for a fitted critical resistivity (rho/sub c/) that is very much smaller than the free-electron-gas estimate (rho/sup f//sub c/). We reexamine the effect of AMR's disorder-enhanced Coulomb repulsion using the Eliashberg equations for T/sub c/ rather than the simple two-square-well aproximation to them which is suspect when there are more than two characteristic frequencies involved. The most important modification of themore » original calculation is the inclusion of the Coulomb contribution to the renormalization function Z(..omega..).« less

  5. Transcriptional deregulation of oncogenic myocyte enhancer factor 2C in T-cell acute lymphoblastic leukemia.

    PubMed

    Nagel, Stefan; Venturini, Letizia; Meyer, Corinna; Kaufmann, Maren; Scherr, Michaela; Drexler, Hans G; Macleod, Roderick A F

    2011-02-01

    Myocyte enhancer factor 2C (MEF2C) encodes a transcription factor which is ectopically expressed in T-cell acute lymphoblastic leukemia (T-ALL) cell lines, deregulated directly by ectopically expressed homeodomain protein NKX2-5 or by loss of promoter regions via del(5)(q14). Here, we analyzed the MEF2C 5'-region, thus identifying potential regulatory binding sites for GFI1B, basic helix-loop-helix proteins, STAT5, and HOXA9/HOXA10. Chromatin immunoprecipitation and overexpression analyses demonstrated direct activation by GFI1B and LYL1 and inhibition by STAT5. HOXA9/HOXA10 activated expression of NMYC which in turn mediated MEF2C repression, indicating an indirect mode of regulation via NMYC interactor (NMI) and STAT5. Lacking comma: Chromosomal deletion of the STAT5 binding site in LOUCY cells reduced protein levels of STAT5 in some MEF2C-positve T-ALL cell lines, and the presence of inhibitory IL7-JAK-STAT5 signaling highlighted the repressive impact of this factor in MEF2C regulation. Taken together, our results indicate that the expression of MEF2C in T-ALL cells is principally deregulated via activating leukemic transcription factors GFI1B or NKX2-5 and by escaping inhibitory developmental STAT5 signaling.

  6. The SPO11-C631T gene polymorphism and male infertility risk: a meta-analysis.

    PubMed

    Ren, Zheng-Ju; Ren, Peng-Wei; Yang, Bo; Liao, Jian; Liu, Sheng-Zhuo; Fang, Kun; Ren, Shang-Qing; Liu, Liang-Ren; Dong, Qiang

    2017-11-01

    To evaluate the association between the SPO11 gene C631T polymorphism and the risk of male infertility. We conducted a search on PubMed, Embase, Web of Science, Chinese National Knowledge Infrastructure (CNKI), China biology medical literature database (CBM), VIP, and Chinese literature database (Wan Fang) on 31 March 2016. Odds ratio (OR) and 95% confidence interval (95%CI) were used to assess the strength of associations. A total of five studies including 542 cases and 510 controls were involved in this meta-analysis. The pooled results indicated that the SPO11 gene C631T polymorphism was significantly associated with increased risk of male infertility (TT + CT vs. CC: OR = 4.14, 95%CI = 2.48-6.89; CT vs. CC: OR = 4.34, 95%CI = 2.56-7.34; T vs. C: OR = 4.35, 95%CI = 2.58-7.34). Subgroup analysis of different countries proved the relationship between SPO11 gene C631T polymorphism and male infertility risk in Chinese, but not in Iranian peoples. In conclusion, this study suggested that SPO11 gene C631T polymorphism may contribute as a genetic factor susceptible to cause male infertility. Furthermore, more large sample and representative population-based cases and well-matched controls are needed to validate our results.

  7. c-Maf controls immune responses by regulating disease-specific gene networks and repressing IL-2 in CD4+ T cells.

    PubMed

    Gabryšová, Leona; Alvarez-Martinez, Marisol; Luisier, Raphaëlle; Cox, Luke S; Sodenkamp, Jan; Hosking, Caroline; Pérez-Mazliah, Damián; Whicher, Charlotte; Kannan, Yashaswini; Potempa, Krzysztof; Wu, Xuemei; Bhaw, Leena; Wende, Hagen; Sieweke, Michael H; Elgar, Greg; Wilson, Mark; Briscoe, James; Metzis, Vicki; Langhorne, Jean; Luscombe, Nicholas M; O'Garra, Anne

    2018-05-01

    The transcription factor c-Maf induces the anti-inflammatory cytokine IL-10 in CD4 + T cells in vitro. However, the global effects of c-Maf on diverse immune responses in vivo are unknown. Here we found that c-Maf regulated IL-10 production in CD4 + T cells in disease models involving the T H 1 subset of helper T cells (malaria), T H 2 cells (allergy) and T H 17 cells (autoimmunity) in vivo. Although mice with c-Maf deficiency targeted to T cells showed greater pathology in T H 1 and T H 2 responses, T H 17 cell-mediated pathology was reduced in this context, with an accompanying decrease in T H 17 cells and increase in Foxp3 + regulatory T cells. Bivariate genomic footprinting elucidated the c-Maf transcription-factor network, including enhanced activity of NFAT; this led to the identification and validation of c-Maf as a negative regulator of IL-2. The decreased expression of the gene encoding the transcription factor RORγt (Rorc) that resulted from c-Maf deficiency was dependent on IL-2, which explained the in vivo observations. Thus, c-Maf is a positive and negative regulator of the expression of cytokine-encoding genes, with context-specific effects that allow each immune response to occur in a controlled yet effective manner.

  8. A winged helix forkhead (FOXD2) tunes sensitivity to cAMP in T lymphocytes through regulation of cAMP-dependent protein kinase RIalpha.

    PubMed

    Johansson, C Christian; Dahle, Maria K; Blomqvist, Sandra Rodrigo; Grønning, Line M; Aandahl, Einar M; Enerbäck, Sven; Taskén, Kjetil

    2003-05-09

    Forkhead/winged helix (FOX) transcription factors are essential for control of the cell cycle and metabolism. Here, we show that spleens from Mf2-/- (FOXD2-/-) mice have reduced mRNA (50%) and protein (35%) levels of the RIalpha subunit of the cAMP-dependent protein kinase. In T cells from Mf2-/- mice, reduced levels of RIalpha translates functionally into approximately 2-fold less sensitivity to cAMP-mediated inhibition of proliferation triggered through the T cell receptor-CD3 complex. In Jurkat T cells, FOXD2 overexpression increased the endogenous levels of RIalpha through induction of the RIalpha1b promoter. FOXD2 overexpression also increased the sensitivity of the promoter to cAMP. Finally, co-expression experiments demonstrated that protein kinase Balpha/Akt1 work together with FOXD2 to induce the RIalpha1b promoter (10-fold) and increase endogenous RIalpha protein levels further. Taken together, our data indicate that FOXD2 is a physiological regulator of the RIalpha1b promoter in vivo working synergistically with protein kinase B to induce cAMP-dependent protein kinase RIalpha expression, which increases cAMP sensitivity and sets the threshold for cAMP-mediated negative modulation of T cell activation.

  9. Expression of fusion IL2-B7.1(IgV+C) and effects on T lymphocytes.

    PubMed

    Kong, Linghong; Li, Yaochen; Yang, Ye; Li, Kangsheng

    2007-12-01

    The search for an effective immunotherapeutic treatment for tumors is an important area of cancer research. To prepare a more effective form of the bifunctional fusion protein IL2-B7.1(IgV+C) and analyze its effect on the stimulation of T lymphocyte proliferation, we used DNAStar 5.03 software to predict the structural diversity and biochemical character of IL2-B7.1(IgV+C). We then prepared fusion protein IL2-B7.1(IgV+C) by establishing its prokaryotic expression system, and tested its effect on the stimulation of T lymphocytes in vitro. The results indicated that IL2-B7.1(IgV+C) correctly formed a secondary structure in which both IL2 and B7.1(IgV+C) maintained their original hydrophilicity and epitopes. Western blot analysis revealed that IL2-B7.1(IgV+C) was efficiently expressed. Our analysis of CTLL-2 and T-cell proliferation showed that recombinant human (rh) IL2-B7.1(IgV+C) exerted the combined stimulating effects of both rhIL2 and rh B7.1(IgV+C) on cell proliferation, and that these effects could be blocked by adding either anti-IL2 or anti-B7.1 monoclonal antibodies. A >2-fold increase in [3H]TdR incorporation compared with that of cells treated with recombinant protein IL2, or B7.1(IgV+C) alone, revealed that rhIL2-B7.1(IgV+C) had dose-dependent synergetic effects on T-cell activation in the presence of anti-CD3 monoclonal antibody. We concluded that the augmented potency of rhIL2-B7.1(IgV+C) resulted in a stronger stimulation of T-cell proliferation than either rhB7.1(IgV+C) or rhIL2 alone.

  10. Is there any relationship between Toll-like receptor 3 c.1377C/T and -7C/A polymorphisms and susceptibility to Crimean Congo hemorrhagic fever?

    PubMed

    Engin, Aynur; Arslan, Serdal; Özbilüm, Nil; Bakir, Mehmet

    2016-10-01

    Crimean-Congo hemorrhagic fever (CCHF) is an infectious disease that is caused by CCHF virus. A family of transmembrane receptors called as Toll-like receptors (TLRs) selectively acts in recognizing a wide range of microbial components and endogenous molecules released by damaged tissue and have been preserved throughout evolution. TLRs initiate some signaling cascades which activate the innate immune system. Mainly four TLRs act in protection against viral infections; TLR3 is one of them. TLR3 identifies dsRNA. By producing inflammatory cytokines and type I interferons, it generates an antiviral immune response. Proper response to TLR ligands may be impaired by single nucleotide polymorphisms (SNPs) within TLR genes in some indviduals, and this can cause varied susceptibility to infections. In the present work, polymerase chain reaction-based restriction fragment length polymorphism is used to analyze the frequencies of TLR3 (c.1377C/T and -7C/A) polymorphisms in 149 CCHF patients and 171 healthy adults as controls, in Cumhuriyet University, Sivas/Turkey. We also investigated the relation between these polymorphisms and severity or mortality of CCHF disease. This is the first study investigating the TLR3 SNPs in patients with CCHF. In the present study, the frequency of the TLR3 (c.1377C/T and -7A/C) genotypes in fatal and non-fatal cases were comparable, however, the homozygous mutant (TT) genotype frequency of TLR3 c.1377C/T in CCHF patients was significantly higher than that of the healthy controls. In conclusion, presence of TLR3 c.1377 TT genotype may have a role in the susceptibility to CCHF. J. Med. Virol. 88:1690-1696, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. T-bet-mediated Tim-3 expression dampens monocyte function during chronic hepatitis C virus infection.

    PubMed

    Yi, Wenjing; Zhang, Peixin; Liang, Yan; Zhou, Yun; Shen, Huanjun; Fan, Chao; Moorman, Jonathan P; Yao, Zhi Q; Jia, Zhansheng; Zhang, Ying

    2017-03-01

    Hepatitis C virus (HCV) induces a high rate of chronic infection via dysregulation of host immunity. We have previously shown that T-cell immunoglobulin and mucin domain protein-3 (Tim-3) is up-regulated on monocyte/macrophages (M/Mφ) during chronic HCV infection; little is known, however, about the transcription factor that controls its expression in these cells. In this study, we investigated the role of transcription factor, T-box expressed in T cells (T-bet), in Tim-3 expression in M/Mφ in the setting of HCV infection. We demonstrate that T-bet is constitutively expressed in resting CD14 + M/Mφ in the peripheral blood. M/Mφ from chronically HCV-infected individuals exhibit a significant increase in T-bet expression that positively correlates with an increased level of Tim-3 expression. Up-regulation of T-bet is also observed in CD14 + M/Mφ incubated with HCV + Huh7.5 cells, as well as in primary M/Mφ or monocytic THP-1 cells exposed to HCV core protein in vitro, which is reversible by blocking HCV core/gC1qR interactions. Moreover, the HCV core-induced up-regulation of T-bet and Tim-3 expression in M/Mφ can be abrogated by incubating the cells with SP600125 - an inhibitor for the c-Jun N-terminal kinase (JNK) signalling pathway. Importantly, silencing T-bet gene expression decreases Tim-3 expression and enhances interleukin-12 secretion as well as signal transducer and activator of transcription 1 phosphorylation. These data suggest that T-bet, induced by the HCV core/gC1qR interaction, enhances Tim-3 expression via the JNK pathway, leading to dampened M/Mφ function during HCV infection. These findings reveal a novel mechanism for Tim-3 regulation via T-bet during HCV infection, providing new targets to combat this global epidemic viral disease. © 2016 John Wiley & Sons Ltd.

  12. 807C/T polymorphism of platelet glycoprotein Ia gene is associated with cerebral hemorrhage in a Chinese population.

    PubMed

    Zeng, Yi; Zhang, Le; Hu, Zhiping; Yang, Qidong; Ma, Mingming; Liu, Baoqiong; Xia, Jian; Xu, Hongwei; Liu, Yunhai; Du, Xiaoping

    2016-08-01

    Platelet glycoprotein (GP) mediated the role of platelet in coagulation. Platelet GP Ia 807C/T is the only GP polymorphism associated with the expression levels of GP Ia/IIa (the platelet collagen receptor). Recently, the GP Ia 807C/T polymorphism has been reported to have no association with cerebral hemorrhage (CH) in two studies pertained to Caucasian populations. The purpose of this study is to evaluate the association between platelet GP Ia 807C/T polymorphism and CH in a Han Chinese population. We performed genotype analysis for platelet GP Ia 807C/T polymorphism in a case-control study involving 195 patients with CH and 116 age- and sex-matched controls. In contrast to previous reports, we found that the frequencies of GP Ia 807C/T T allele, CT and TT genotype were much higher in CH patients than in controls (33.9% vs. 22.8%, p = 0.004; 45.5% and 11.1% vs. 40.4% and 2.6%, p = 0.022). Logistic regression analysis revealed that the presence of GP Ia 807C/T C allele and CC genotype were both associated with a decreased risk of CH compared with T allele, CT and TT genotypes, respectively (adjusted odds ratio [OR] = 0.565, 95% CI: 0.384-0.887, p = 0.005; adjusted OR = 0.172, 95% CI: 0.043-0.639, p = 0.009; adjusted OR = 0.254, 95% CI: 0.085-0.961, p = 0.041, respectively). These findings indicated that platelet GP Ia 807C/T polymorphism could be a protective factor of CH in the Chinese population.

  13. Folate supplementation in schizophrenia: a possible role for MTHFR genotype.

    PubMed

    Hill, Michele; Shannahan, Kelsey; Jasinski, Sarah; Macklin, Eric A; Raeke, Lisa; Roffman, Joshua L; Goff, Donald C

    2011-04-01

    Folate deficiency and the methylenetetrahydrofolate reductase (MTHFR) 677C>T polymorphism have been linked to negative symptoms in schizophrenia both independently and synergistically. This study examined the effect of folate supplementation on negative symptoms overall and in relation to MTHFR 677C>T genotype. Forty-six stable adult schizophrenia outpatients were enrolled and 32 were randomised, double-blind, in a parallel-group, twelve week add-on trial of folate 2mg/d or matching placebo. The primary outcome measure was change from baseline to week 12 on the modified SANS total score using a mixed-model analysis. In addition, we measured the effect of MTHFR genotype on treatment effects and on changes in serum folate by grouping participants with T/T genotype together with C/T genotype and comparing their interactions to patients with C/C genotype. Twenty-eight participants completed the trial. Folate supplementation did not significantly affect negative symptoms compared to placebo across the entire cohort. However, there was a significant genotype×treatment effect on negative symptoms (F=7.13, df=1,39, p=0.01). In addition, MTHFR status significantly moderated the relationship between change in serum folate and change in negative symptoms: among participants with at least one copy of the T allele negative symptoms were more likely to improve with increased serum folate (p=0.03). We did not detect a therapeutic benefit of folate supplementation in a sample of patients with residual negative symptoms. However, a possible association between genotypes associated with reduced MTHFR activity and benefit from folate supplementation should be investigated further. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Molecular genetic analysis in mild hyperhomocysteinemia: A common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kluijtmans, L.A.J.; Heuvel, L.P.W.J. van den; Stevens, E.M.B.

    1996-01-01

    Mild hyperhomocysteinemia is an established risk factor for cardiovascular disease. Genetic aberrations in the cystathionine P-synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) genes may account for reduced enzyme activities and elevated plasma homocysteine levels. In 15 unrelated Dutch patients with homozygous CBS deficiency, we observed the 833T{yields}C (1278T) mutation in 50% of the alleles. Very recently, we identified a common mutation (677C{yields}T; A{yields}V) in the MTHFR gene, which, in homozygous state, is responsible for the thermolabile phenotype and which is associated with decreased specific MTHFR activity and elevated homocysteine levels. We screened 60 cardiovascular patients and 111 controls for these twomore » mutations, to determine whether these mutations are risk factors for premature cardiovascular disease. Heterozygosity for the 833T{yields}C mutation in the CBS gene was observed in one individual of the control group but was absent in patients with premature cardiovascular disease. Homozygosity for the 677C-{yields}T mutation in the MTHFR gene was found in 9 (15%) of 60 cardiovascular patients and in only 6 ({approximately}5%) of 111 control individuals (odds ratio 3.1 [95% confidence interval 1.0-9.21]). Because of both the high prevalence of the 833T-{yields}C mutation among homozygotes for CBS deficiency and its absence in 60 cardiovascular patients, we may conclude that heterozygosity for CBS deficiency does not appear to be involved in premature cardiovascular disease. However, a frequent homozygous mutation in the MTHFR gene is associated with a threefold increase in risk for premature cardiovascular disease. 35 refs., 3 figs., 1 tab.« less

  15. H T P21/ c- C2/ c phase transition and kinetics of Fe2+-Mg order-disorder of an Fe-poor pigeonite: implications for the cooling history of ureilites

    NASA Astrophysics Data System (ADS)

    Alvaro, Matteo; Cámara, Fernando; Domeneghetti, M. Chiara; Nestola, Fabrizio; Tazzoli, Vittorio

    2011-09-01

    A natural Ca-poor pigeonite (Wo6En76Fs18) from the ureilite meteorite sample PCA82506-3, free of exsolved augite, was studied by in situ high-temperature single-crystal X-ray diffraction. The sample, monoclinic P21/ c, was annealed up to 1,093°C to induce a phase transition from P21/ c to C2/ c symmetry. The variation with increasing temperature of the lattice parameters and of the intensity of the b-type reflections ( h + k = 2 n + 1, present only in the P21/ c phase) showed a displacive phase transition P21/ c to C2/ c at a transition temperature T Tr = 944°C, first order in character. The Fe-Mg exchange kinetics was studied by ex situ single-crystal X-ray diffraction in a range of temperatures between the closure temperature of the Fe-Mg exchange reaction and the transition temperature. Isothermal disordering annealing experiments, using the IW buffer, were performed on three crystals at 790, 840 and 865°C. Linear regression of ln k D versus 1/ T yielded the following equation: ln k_{{D}} = - 3717( ± 416)/T(K) + 1.290( ± 0.378);quad (R2 = 0.988) . The closure temperature ( T c) calculated using this equation was ˜740(±30)°C. Analysis of the kinetic data carried out taking into account the e.s.d.'s of the atomic fractions used to define the Fe-Mg degree of order, performed according to Mueller's model, allowed us to retrieve the disordering rate constants C 0 K {dis/+} for all three temperatures yielding the following Arrhenius relation: ln ( {C0 K_{{dis}}^{ + } } ) = ln K0 - Q/(RT) = 20.99( ± 3.74) - 26406( ± 4165)/T(K);quad (R2 = 0.988) . An activation energy of 52.5(±4) kcal/mol for the Fe-Mg exchange process was obtained. The above relation was used to calculate the following Arrhenius relation modified as a function of X Fe (in the range of X Fe = 0.20-0.50): ln ( {C0 K_{{dis}}^{ + } } ) = (21.185 - 1.47X_{{Fe}} ) - {{(27267 - 4170X_{{Fe}} )}/T(K)} . The cooling time constant, η = 6 × 10-1 K-1 year-1 calculated on the PCA82506-3 sample, provided

  16. Licochalcone C induces apoptosis via B-cell lymphoma 2 family proteins in T24 cells.

    PubMed

    Wang, Penglong; Yuan, Xuan; Wang, Yan; Zhao, Hong; Sun, Xiling; Zheng, Qiusheng

    2015-11-01

    The current study investigated the mechanisms by which licochalcone C induces apoptosis of T24 human malignant bladder cancer cells. Cell viability was evaluated using an MTT assay. Apoptosis was investigated using a morphological assay, flow cytometry and a caspase‑3 activity assay. Alterations in the gene expression levels of Bcl‑2 family members were measured by semi‑quantitative reverse transcription‑polymerase chain reaction assays. The protein levels of pro‑caspase‑3 and cleaved poly(ADP ribose) polymerase were measured using western blotting. The results indicated that licochalcone C induced T24 cell apoptosis in a concentration‑dependent manner. Licochalcone C treatment reduced the levels of the anti‑apoptotic mRNAs (Bcl‑2, Bcl‑w and Bcl‑XL) and increased expression of the pro‑apoptotic mRNAs (Bax and Bim). The Bcl‑2 family inhibitor (ABT‑737) reduced apoptosis induced by licochalcone C in T24 cells. The current study demonstrated that licochalcone C may be a potential adjuvant therapeutic agent for bladder cancer.

  17. Clean to dirty limit and T c suppression in NdFeAsO0.7F0.3 studied by H c2 analysis

    NASA Astrophysics Data System (ADS)

    Pallecchi, I.; Tarantini, C.; Shen, Y.; Singh, R. K.; Newman, N.; Cheng, P.; Jia, Y.; Wen, H.-H.; Putti, M.

    2018-07-01

    In this work, we investigate the temperature dependence of the upper critical field, dH c2/dT, in an increasingly disordered NdFeAsO0.7F0.3 (NdFeAs(O,F)) single crystal that has been progressively irradiated up to a 5.25 × 1016 cm- 2 total α-particle dose. For the H∣∣ab-plane, dH c2/dT does not vary remarkably with irradiation, while for the H∣∣c-axis it increases sharply after the first irradiation of 3.60 × 1015 cm-2 and then more gradually with further irradiation doses. Focusing on the H∣∣c-axis, we develop a phenomenological analysis of the H c2 slope which allows us to inspect the crossover from the clean to the dirty regime. From the H c2 slope normalized to the critical temperature and to its clean limit value, we extract the ratio of the coherence length ξ BCS to the mean free path {\\ell } and we find that when T c is reduced by a factor of four from its pristine value, ξ BCS/{\\ell } becomes as large as ˜7 and {\\ell } reaches values of ˜1.8 nm, indicating that NdFeAs(O,F) is well into the dirty regime. Our analysis of the H c2 slope also allows us to compare the pair-breaking effectiveness of scattering in different superconductors, showing similarity between unconventional NdFeAs(O,F) and moderate-T c phonon-mediated devices, such as MgB2 and A15 compounds, but much a stronger difference with YBa2Cu3O7-δ . This work thus shows that dH c2/dT is a reliable parameter, providing an alternative to residual resistivity, for investigating the pair-breaking mechanism induced by impurity scattering in superconductors.

  18. Hyperpolarized 13C NMR lifetimes in the liquid-state: relating structures and T1 relaxation times

    NASA Astrophysics Data System (ADS)

    Parish, Christopher; Niedbalski, Peter; Hashami, Zohreh; Fidelino, Leila; Kovacs, Zoltan; Lumata, Lloyd

    Among the various attempts to solve the insensitivity problem in nuclear magnetic resonance (NMR), the physics-based technique dissolution dynamic nuclear polarization (DNP) is probably the most successful method of hyperpolarization or amplifying NMR signals. Using this technique, liquid-state NMR signal enhancements of several thousand-fold are expected for low-gamma nuclei such as carbon-13. The lifetimes of these hyperpolarized 13C NMR signals are directly related to their 13C spin-lattice relaxation times T1. Depending upon the 13C isotopic location, the lifetimes of hyperpolarized 13C compounds can range from a few seconds to minutes. In this study, we have investigated the hyperpolarized 13C NMR lifetimes of several 13C compounds with various chemical structures from glucose, acetate, citric acid, naphthalene to tetramethylallene and their deuterated analogs at 9.4 T and 25 deg C. Our results show that the 13C T1s of these compounds can range from a few seconds to more than 60 s at this field. Correlations between the chemical structures and T1 relaxation times will be discussed and corresponding implications of these results on 13C DNP experiments will be revealed. US Dept of Defense Award No. W81XWH-14-1-0048 and Robert A. Welch Foundation Grant No. AT-1877.

  19. APOC3 -482C>T polymorphism, circulating apolipoprotein C-III and smoking: interrelation and roles in predicting type-2 diabetes and coronary disease.

    PubMed

    Onat, Altan; Erginel-Unaltuna, Nihan; Coban, Neslihan; Ciçek, Gökhan; Yüksel, Hüsniye

    2011-04-01

    We determined the relationship of smoking status on APOC3 -482C>T polymorphism and apolipoprotein C-III (apoC-III) concentrations and the latter two parameters' influence on risk of diabetes and coronary heart disease (CHD). Prediction of incident cases was assessed at 5.5years' follow-up in unselected 519 individuals of a general population genotyped for -482C>T polymorphism. Female sex and current smoking were significantly associated with low circulating apoC-III in subjects without (p≤0.033) than with abdominal obesity (p=0.053) or than insulin resistant -482TT homozygotes (p=0.034) who had 20-30% higher serum apoC-III. Multi-adjusted serum apoC-III was log-linearly associated with fasting triglycerides. ApoC-III levels determined the development of diabetes [RR 1.56 (95%CI 1.21; 2.01)] and CHD [RR 1.38 (1.10; 1.72) for an increment of 14%], after adjustment for confounders. APOC3 -482TT genotype is associated with high apoC-III concentrations only in the presence of abdominal obesity or insulin resistance, but not in current smokers who remain lean or insulin-sensitive. Rather than APOC3 -482C>T polymorphism, circulating apoC-III determines cardiometabolic risk. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  20. Changes in the superconducting properties of high-T(sub c) ceramics produced by applied electric fields

    NASA Technical Reports Server (NTRS)

    Smirnov, B. I.; Orlova, T. S.; Kaufmann, H.-J.

    1995-01-01

    Effect of an electrostatic field in the electrode-insulator-superconductor system on the current-voltage characteristics of high-T(sub c) ceramics with various composition and different preparation technology has been studied at 77 K. Ceramics of Y-Ba-Cu-O (123) and Bi-Pb-Sr-Ca-Cu-O (2223) systems and also ones doped by Ag have been used. Electric field strength has been up to 140 MV/m. It has been shown that there are reversible changes in the critical current I(sub c) and in the conductivity in electric field at the currents somewhat more than I(sub c) at T is less than T(sub c), while at T is greater than T(sub c) the noticeable electric field effect has not been found. These effects are qualitatively similar in both ceramic systems. High negative and positive gate voltages result in an increase of the conductivity. The electric field effect is modified by magnetic field H. The field effect decreases with increasing magnetic field and disappears at H is greater than 30 Oe. In Y-Ba-Cu-O/Ag (10 wt. percent) ceramics the field effect is practically absent. It may be supposed that in the ceramics the field-induced effect is consistent with weak links at grain boundaries.

  1. Antitumor Activity Associated with Prolonged Persistence of Adoptively Transferred NY-ESO-1c259T cells in Synovial Sarcoma.

    PubMed

    D'Angelo, Sandra P; Melchiori, Luca; Merchant, Melinda S; Bernstein, Donna B; Glod, John; Kaplan, Rosandra N; Grupp, Stephan A; Tap, William D; Chagin, Karen; Binder, Gwendolyn K; Basu, Samik; Lowther, Daniel E; Wang, Ruoxi; Bath, Natalie; Tipping, Alex; Betts, Gareth; Ramachandran, Indu; Navenot, Jean-Marc; Zhang, Hua; Wells, Daniel K; Van Winkle, Erin; Kari, Gabor; Trivedi, Trupti; Holdich, Tom; Pandite, Lini N; Amado, Rafael; Mackall, Crystal L

    2018-06-11

    We evaluated safety and activity of autologous T cells expressing NY-ESO-1c259, an affinity-enhanced T cell receptor (TCR) recognizing an HLA-A2-restricted NY-ESO-1/LAGE-1a-derived peptide, in patients with metastatic synovial sarcoma (NY-ESO-1c259T cells). Confirmed antitumor responses occurred in 50% of patients (6/12) and were characterized by tumor shrinkage over several months. Circulating NY-ESO-1c259T cells were present post-infusion in all patients and persisted for at least 6 months in all responders. Most infused NY-ESO-1c259T cells exhibited an effector memory phenotype following the ex vivo expansion, but the persisting pools comprised largely central memory and stem cell memory subsets, which remained polyfunctional and showed no evidence for T cell exhaustion despite persistent tumor burdens. Next generation sequencing of endogenous TCRs in CD8+ NY-ESO-1c259T cells revealed clonal diversity without contraction over time. These data suggest that regenerative pools of NY-ESO-1c259T cells produced a continuing supply of effector cells to mediate sustained, clinically meaningful antitumor effects. Copyright ©2018, American Association for Cancer Research.

  2. Effects of methylenetetrahydrofolate reductase gene polymorphisms on toxicities during consolidation therapy in pediatric acute lymphoblastic leukemia in a Chinese population.

    PubMed

    Liu, Shu-Guang; Li, Zhi-Gang; Cui, Lei; Gao, Chao; Li, Wei-Jing; Zhao, Xiao-Xi

    2011-06-01

    This study aimed to investigate whether there was a correlation between the genotype or haplotype of the methylenetetrahydrofolate reductase gene (MTHFR) and toxicities during consolidation therapy or plasma methotrexate (MTX) levels at 48 h after the first dose of MTX infusion. We retrospectively genotyped 181 children with newly diagnosed acute lymphoblastic leukemia (ALL) who were treated with the Chinese Children's Leukemia Group protocol. In standard- and medium-risk treatment branches, the 677T carriers (CT + TT) had a higher risk of developing thrombocytopenia when compared with carriers of the CC genotype (odds ratio [OR] 5.21, 95% confidence interval [CI] 1.18-23.01, p = 0.017). The 1298AC/CC genotypes were associated with a decrease in skin toxicity, as compared with the common AA genotype (p = 0.037). An estimation of haplotype frequencies showed that there was no 677T-1298C haplotype in the population. A lower frequency of anemia (OR 0.44, 95% CI 0.21-0.90, p = 0.025) and lower MTX level (p = 0.044) were observed in patients with the 677C-1298C haplotype than in those without. High plasma MTX level was correlated with anemia (p = 0.011) and neutropenia (p = 0.044). In the high-risk group, the polymorphisms or plasma MTX levels were not correlated with any toxicity. Taken together, our data demonstrate that genotyping of MTHFR and measurement of plasma MTX levels might be useful to optimize MTX therapy.

  3. Pilot Ed Lewis with T-34C aircraft on ramp

    NASA Image and Video Library

    1998-03-04

    NASA pilot Ed Lewis with the T-34C aircraft on the Dryden Flight Research Center Ramp. The aircraft was previously used at the Lewis Research Center in propulsion experiments involving turboprop engines, and was used as a chase aircraft at Dryden for smaller and slower research projects. Chase aircraft accompany research flights for photography and video purposes, and also as support for safety and research. At Dryden, the T-34 is used mainly for smaller remotely piloted vehicles which fly slower than NASA's F-18's, used for larger scale projects. This aircraft was returned to the U.S. Navy in May of 2002.

  4. Annealing temperature and O2 partial pressure dependence of T(sub c) in HgBa2CuO(4+delta)

    NASA Technical Reports Server (NTRS)

    Xiong, Q.; Cao, Y.; Chen, F.; Xue, Y. Y.; Chu, C. W.

    1994-01-01

    Samples of HgBa2CuO(4+delta) (Hg-1201) were annealed under various conditions. After carefully controlling annealing time, annealing temperature (T(sub a)) and O2 partial pressure (P(sub 0)), we were able to find the reversible annealing conditions for Hg-1201. Under 1 atm O2 at 260 C less than or equal to T(sub a) less than or equal to 400 C, the obtained T(sub c) is nearly the same (approximately 97 K). However, it decreases quickly with T(sub a) greater than 300 C in high vacuum (P(sub 0) approximately 10(exp -8) atm), and reaches zero at T(sub a) = 400 C. On the other hand, T(sub c) decreases with the decrease of T(sub a) in high-pressure O2 (approximately 500 atm) and reaches approximately 20 K at about 240 C. In the entire annealing region, the oxygen surplus varies significantly from 0.03 to 0.4, and a wide range of T(sub c) variation (0 goes to 97 K goes to 20 K) was obtained with anion doping alone.

  5. 78 FR 30269 - Foreign-Trade Zone 129-Bellingham, Washington; Authorization of Production Activity; T.C. Trading...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-22

    ... proposed production activity to the Foreign-Trade Zones (FTZ) Board on behalf of T.C. Trading Company, Inc... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-8-2013] Foreign-Trade Zone 129--Bellingham, Washington; Authorization of Production Activity; T.C. Trading Company, Inc. (Eyeglass Assembly and Kitting...

  6. Measurement of Levitation Forces of High-"T[subscript c] Superconductors

    ERIC Educational Resources Information Center

    Becker, M.; Koblischka, M. R.; Hartmann, U.

    2010-01-01

    We show the construction of a so-called levitation balance which is capable of measuring the levitation forces between a permanent magnet and a superconducting high-T[subscript c] thin film sample. The underlying theoretical basis is discussed in detail. The experiment is performed as an introductory physics experiment for school students as well…

  7. A case of recurrent pancytopenia in a patient with acute promyelocytic leukemia on maintenance chemotherapy and concomitant methyltetrahydrofolate reductase and thiopurine S-methyltransferase mutation - review of literature.

    PubMed

    Keung, Yi-Kong; Keung, Lap-Woon; Hong-Lung Hu, Eddie

    2016-06-01

    Pharmacogenetics is a study of how genetic variation of an individual affects the drug response. We report a case of recurrent pancytopenia resulting from maintenance chemotherapy in a patient with acute promyelocytic leukemia and two pharmacogenetic mutations, namely, methylene tetrahydrofolate reductase C677T homozygous mutation and thiopurine methyltransferase mutation. © The Author(s) 2015.

  8. Influence of restraint and thermal exposure on welds in T-111 and ASTAR-811C

    NASA Technical Reports Server (NTRS)

    Gold, R. E.; Lessmann, G. G.

    1971-01-01

    The notched-tensile, tensile, and bend properties of GTA welds in T-111 and ASTAR-811C sheet were determined following a wide range of thermal exposures in order to define changes in ductility and mechanical property behavior due to weld aging response. No notch sensitivity or unusual tensile response was noted for any of the conditions evaluated. An aging response was noted for the bend ductile-brittle transition temperature determinations on both T-111 and ASTAR-811C welds. A tentative explanation for the observed response of each alloy is presented. In addition, the interrelationship of mechanical and chemical factors leading to underbead cracking in T-111 was investigated. The problem was shown to be amenable primarily to chemical solutions, such as alloy compositional changes. This was demonstrated by the improved performance of ASTAR-811C over T-111 in plate weld studies. Only modest success was achieved using procedural techniques as a means of eliminating underbead cracking.

  9. Amplitude analysis of elastic p-p scattering at 6 GeV/c at all t's

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghahramany, N.; Goldstein, G.R.; Moravcsik, M.J.

    1983-09-01

    The extensive set of polarization data obtained at the Argonne Zero Gradient Synchro- p tron for elastic proton-proton scattering at 6 GeV/c at a full set of values of t is used to determine the five complex reaction amplitudes, using the optimal formalism. The determination is easiest in the transversity formalism, and from that the ''planar'' amplitudes (including the helicity amplitudes) are obtained. A complete determination is made at 20 different values of t, from -0.1 to -1.0 (GeV/c)/sup 2/, using data interpolated in t. In addition, a less complete set of data permits the determination of the five magnitudesmore » (but not of the four phases) in the range from t = -1.0 to t = -2.0 (GeV/c)/sup 2/. The magnitudes of the five amplitudes can be obtained without any ambiguity, but for the four relative phases several distinct solutions exist, one of which is selected on the basis of continuity in t and minimum chi/sup 2/. There continues to be evidence that in the planar system in which the orientation axes are 90/sup 0/ from the helicity axes, all amplitudes tend to be either pure real or pure imaginary.« less

  10. Association of Elevated High Sensitivity Cardiac Troponin T(hs-cTnT) Levels with Hemorrhagic Transformation and 3-Month Mortality in Acute Ischemic Stroke Patients with Rheumatic Heart Disease in China

    PubMed Central

    Xiong, Yao; Liu, Bian; Hao, Zilong; Tao, Wendan; Liu, Ming

    2016-01-01

    Background and Objective Elevated levels of high sensitivity cardiac troponin T (hs-cTnT) occur in a substantial proportion of patients with acute ischemic stroke (AIS) and can predict poor outcome and mortality after stroke. Whether elevated hs-cTnT levels can also predict hemorrhagic transformation (HT) or prognosis in AIS patients with rheumatic heart disease (RHD) remains unclear. Methods Data from the Chengdu Stroke Registry on consecutive AIS patients with RHD admitted to West China Hospital within1 month of stroke onset from October 2011 to February 2014 were examined. Clinico-demographic characteristics, HT, functional outcomes and stroke recurrence were compared between patients with elevated hs-cTnT levels(≥14ng/L) and patients with normal hs-cTnT levels (<14ng/L). Results The final analysis involved 84 patients (31 males; mean age, 61.6±12.2years), of whom serum hs-cTnT levels were elevated in 58.3%. Renal impairment was independently associated with elevated hs-cTnT levels (OR 4.184, 95%CI 1.17 to 15.01, P = 0.028), and patients with elevated hs-cTnT levels were at significantly higher risk of HT, 3-month mortality and 3-month disability/mortality (all P≤0.029). After controlling for age, sex, hypertension, renal impairment and National Institutes of Health Stroke Scale score on admission, the risk of HT and 3-month mortality was, respectively, 4.0- and 5.5-fold higher in patients with elevated hs-cTnT levels than in patients with normal hs-cTnT levels. Conclusion Elevated hs-cTnT levels are independently associated with HT and 3-month mortality in AIS patients with RHD. These results with a small cohort should be verified and extended in large studies. PMID:26849554

  11. Association of Elevated High Sensitivity Cardiac Troponin T(hs-cTnT) Levels with Hemorrhagic Transformation and 3-Month Mortality in Acute Ischemic Stroke Patients with Rheumatic Heart Disease in China.

    PubMed

    Liu, Junfeng; Wang, Deren; Xiong, Yao; Liu, Bian; Hao, Zilong; Tao, Wendan; Liu, Ming

    2016-01-01

    Elevated levels of high sensitivity cardiac troponin T (hs-cTnT) occur in a substantial proportion of patients with acute ischemic stroke (AIS) and can predict poor outcome and mortality after stroke. Whether elevated hs-cTnT levels can also predict hemorrhagic transformation (HT) or prognosis in AIS patients with rheumatic heart disease (RHD) remains unclear. Data from the Chengdu Stroke Registry on consecutive AIS patients with RHD admitted to West China Hospital within 1 month of stroke onset from October 2011 to February 2014 were examined. Clinico-demographic characteristics, HT, functional outcomes and stroke recurrence were compared between patients with elevated hs-cTnT levels (≥14 ng/L) and patients with normal hs-cTnT levels (<14 ng/L). The final analysis involved 84 patients (31 males; mean age, 61.6±12.2 years), of whom serum hs-cTnT levels were elevated in 58.3%. Renal impairment was independently associated with elevated hs-cTnT levels (OR 4.184, 95%CI 1.17 to 15.01, P = 0.028), and patients with elevated hs-cTnT levels were at significantly higher risk of HT, 3-month mortality and 3-month disability/mortality (all P≤0.029). After controlling for age, sex, hypertension, renal impairment and National Institutes of Health Stroke Scale score on admission, the risk of HT and 3-month mortality was, respectively, 4.0- and 5.5-fold higher in patients with elevated hs-cTnT levels than in patients with normal hs-cTnT levels. Elevated hs-cTnT levels are independently associated with HT and 3-month mortality in AIS patients with RHD. These results with a small cohort should be verified and extended in large studies.

  12. Novel Nonsense Variants c.58C>T (p.Q20X) and c.256G>T (p.E85X) in the CHEK2 Gene Identified dentified in Breast Cancer Patients from Balochistan.

    PubMed

    Baloch, Abdul Hameed; Khosa, Ahmad Nawaz; Bangulzai, Nasrullah; Shuja, Jamila; Naseeb, Hafiz Khush; Jan, Mohammad; Marghazani, Illahi Bakhsh; Kakar, Masood-Ul-Haq; Baloch, Dost Mohammad; Cheema, Abdul Majeed; Ahmad, Jamil

    2016-01-01

    Breast cancer is the most commonly occurring and leading cause of cancer deaths among women globally. Hereditary cases account 5-10% of all the cases and CHEK2 is considered as a moderate penetrance breast cancer risk gene. CHEK2 plays a crucial role in response to DNA damage to promote cell cycle arrest and repair DNA damage or induce apoptosis. Our objective in the current study was to analyze mutations in the CHEK2 gene related to breast cancer in Balochistan. A total of 271 individuals including breast cancer patients and normal subjects were enrolled. All 14 exons of CHEK2 were amplified and sequenced. The majority of the patients (>95%) had invasive ductal carcinomas (IDCs), 52.1% were diagnosed with tumor grade III and 56.1% and 27.5% were diagnosed with advance stages III and IV. Two novel nonsense variants i.e. c.58C>T (P.Q20X) and c.256G>T (p.E85X) at exon 1 and 2 in two breast cancer patients were identified in the current study. Both the variants identified were novel and have not been reported elsewhere.

  13. Prevalence of c.2268dup and detection of two novel alterations, c.670_672del and c.1186C>T, in the TPO gene in a cohort of Malaysian–Chinese with thyroid dyshormonogenesis

    PubMed Central

    Lee, Ching Chin; Harun, Fatimah; Jalaludin, Muhammad Yazid; Heh, Choon Han; Othman, Rozana; Junit, Sarni Mat

    2015-01-01

    Objectives The c.2268dup mutation in the thyroid peroxidase (TPO) gene is the most common TPO alteration reported in Taiwanese patients with thyroid dyshormonogenesis. The ancestors of these patients are believed to originate from the southern province of China. Our previous study showed that this mutation leads to reduced abundance of the TPO protein and loss of TPO enzyme activity in a Malaysian–Chinese family with goitrous hypothyroidism. The aim of our study was to provide further data on the incidence of the c.2268dup mutation in a cohort of Malaysian–Chinese and its possible phenotypic effects. Setting Cohort study. Participants Twelve biologically unrelated Malaysian–Chinese patients with congenital hypothyroidism were recruited in this study. All patients showed high thyrotropin and low free thyroxine levels at the time of diagnosis with proven presence of a thyroid gland. Primary outcome measure Screening of the c.2268dup mutation in the TPO gene in all patients was carried out using a PCR–direct DNA sequencing method. Secondary outcome measure Further screening for mutations in other exonic regions of the TPO gene was carried out if the patient was a carrier of the c.2268dup mutation. Results The c.2268dup mutation was detected in 4 of the 12 patients. Apart from the c.2268dup and a previously documented mutation (c.2647C>T), two novel TPO alterations, c.670_672del and c.1186C>T, were also detected in our patients. In silico analyses predicted that the novel alterations affect the structure/function of the TPO protein. Conclusions The c.2268dup mutation was detected in approximately one-third of the Malaysian–Chinese patients with thyroid dyshormonogenesis. The detection of the novel c.670_672del and c.1186C>T alterations expand the mutation spectrum of TPO associated with thyroid dyshormonogenesis. PMID:25564141

  14. Influence of 5,10-methylenetetrahydrofolate reductase polymorphism on whole-blood folate concentrations measured by LC-MS/MS, microbiologic assay, and bio-rad radioassay.

    PubMed

    Fazili, Zia; Pfeiffer, Christine M; Zhang, Mindy; Jain, Ram B; Koontz, Deborah

    2008-01-01

    The 5,10-methylenetetrahydrofolate reductase (NADPH) (MTHFR) C677T polymorphism may affect whole-blood folate pattern measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and total folate measured by LC-MS/MS, microbiologic assay, and Bio-Rad radioassay (BR). We analyzed 171 whole blood hemolysates from 2 blood banks for folate pattern and total folate concentrations using these 3 methods and determined MTHFR genotype. The median (range) total folate concentration by LC-MS/MS was higher in the US set [378 (228-820) nmol/L; n = 96] than in the European set [250 (122-582) nmol/L; n = 75]. The whole-blood folate pattern [median (range)] was similar for individuals with C/C (n = 73) and C/T (n = 66) genotype: 88% (71%-91%) and 86% (50%-91%), respectively, for 5-methyltetrahydrofolic acid (5CH(3)THF) vs 12% (9%-29%) and 14% (9%-51%) for forms other than 5-methyltetrahydrofolic acid (non-5CH(3)THF). Individuals with T/T (n = 32) genotype had 58% (22%-87%) 5CH(3)THF vs 42% (13%-78%) non-5CH(3)THF. Compared with microbiologic assay results, LC-MS/MS (r = 0.94) and BR (r = 0.87) results were significantly lower (-10% and -45%, respectively); however, these differences were concentration dependent and also genotype dependent for the BR assay (-48% for C/C+C/T and -31% for T/T). The microbiologic assay completely recovered [mean (SD)] folates added to a whole blood hemolysate, except for tetrahydrofolic acid (THF) [46.4% (8.1%)]. The BR assay under-recovered 5CH(3)THF [51% (4.1%)] and 5-formyltetrahydrofolic acid [18% (0.1%)], and over-recovered THF [152% (19%)]. MTHFR C677T polymorphism influences the folate pattern in whole blood. The agreement between total folate by LC-MS/MS and microbiologic assay, independent of the MTHFR genotype, allows the use of one regression equation. Because BR results are genotype dependent, different regression equations should be used.

  15. Global DNA hypomethylation in peripheral blood mononuclear cells as a biomarker of cancer risk.

    PubMed

    Friso, Simonetta; Udali, Silvia; Guarini, Patrizia; Pellegrini, Camilla; Pattini, Patrizia; Moruzzi, Sara; Girelli, Domenico; Pizzolo, Francesca; Martinelli, Nicola; Corrocher, Roberto; Olivieri, Oliviero; Choi, Sang-Woon

    2013-03-01

    Global DNA hypomethylation is an early molecular event in carcinogenesis. Whether methylation measured in peripheral blood mononuclear cells (PBMCs) DNA is a clinically reliable biomarker for early detection or cancer risk assessment is to be established. From an original sample-set of 753 male and female adults (ages 64.8 ± 7.3 years), PBMCs DNA methylation was measured in 68 subjects with history of cancer at time of enrollment and 62 who developed cancer during follow-up. Age- and sex-matched controls for prevalent and incident cancer cases (n = 68 and 58, respectively) were also selected. Global DNA methylation was assessed by liquid chromatography/mass spectrometry (LC/MS). Methylenetetrahydrofolate reductase (MTHFR) 677C>T genotype and plasma folate concentrations were also determined for the known gene-nutrient interaction affecting DNA methylation. Cancer subjects had significantly lower PBMCs-DNA methylation than controls [4.39 (95% confidence intervals (CI), 4.25-4.53) vs. 5.13 (95% CI, 5.03-5.21) %mCyt/(mCyt+Cyt); P < 0.0001]. A DNA methylation threshold of 4.74% clearly categorized patients with cancer from controls so that those with DNA methylation less than 4.74% showed an increased prevalence of cancer than those with higher levels (91.5% vs. 19%; P < 0.001). Subjects with cancer at follow-up had, already at enrollment, reduced DNA methylation as compared with controls [4.34 (95% CI, 4.24-4.51) vs. 5.08 (95% CI, 5.05-5.22) %mCyt/(mCyt+Cyt); P < 0.0001]. Moreover, MTHFR677C>T genotype and folate interact for determining DNA methylation, so that MTHFR677TT carriers with low folate had the lowest DNA methylation and concordantly showed a higher prevalence of cancer history (OR, 7.04; 95% CI, 1.52-32.63; P = 0.013). Genomic PBMCs-DNA methylation may be a useful epigenetic biomarker for early detection and cancer risk estimation. This study identifies a threshold for PBMCs-DNA methylation to detect cancer-affected from cancer-free subjects and an at

  16. Methylenetetrahydrofolate reductase (MTHFR) polymorphisms and risk of molecularly defined subtypes of childhood acute leukemia

    PubMed Central

    Wiemels, Joseph L.; Smith, Rosalyn N.; Taylor, G. Malcolm; Eden, Osborn B.; Alexander, Freda E.; Greaves, Mel F.

    2001-01-01

    Low folate intake as well as alterations in folate metabolism as a result of polymorphisms in the enzyme methylenetetrahydrofolate reductase (MTHFR) have been associated with an increased incidence of neural tube defects, vascular disease, and some cancers. Polymorphic variants of MTHFR lead to enhanced thymidine pools and better quality DNA synthesis that could afford some protection from the development of leukemias, particularly those with translocations. We now report associations of MTHFR polymorphisms in three subgroups of pediatric leukemias: infant lymphoblastic or myeloblastic leukemias with MLL rearrangements and childhood lymphoblastic leukemias with either TEL-AML1 fusions or hyperdiploid karyotypes. Pediatric leukemia patients (n = 253 total) and healthy newborn controls (n = 200) were genotyped for MTHFR polymorphisms at nucleotides 677 (C→T) and 1,298 (A→C). A significant association for carriers of C677T was demonstrated for leukemias with MLL translocations (MLL+, n = 37) when compared with controls [adjusted odd ratios (OR) = 0.36 with a 95% confidence interval (CI) of 0.15–0.85; P = 0.017]. This protective effect was not evident for A1298C alleles (OR = 1.14). In contrast, associations for A1298C homozygotes (CC; OR = 0.26 with a 95% CI of 0.07–0.81) and C677T homozygotes (TT; OR = 0.49 with a 95% CI of 0.20–1.17) were observed for hyperdiploid leukemias (n = 138). No significant associations were evident for either polymorphism with TEL-AML1+ leukemias (n = 78). These differences in allelic associations may point to discrete attributes of the two alleles in their ability to alter folate and one-carbon metabolite pools and impact after DNA synthesis and methylation pathways, but should be viewed cautiously pending larger follow-up studies. The data provide evidence that molecularly defined subgroups of pediatric leukemias have different etiologies and also suggest a role of folate in the development of childhood leukemia. PMID:11274424

  17. [Evaluation of central lymph node dissection for papillary thyroid carcinoma in cN0 T1/T2].

    PubMed

    Zhao, S Y; Ma, Y H; Yin, Z; Zhan, X X; Cheng, R C; Qian, J

    2018-02-07

    Objective: To evaluate the application of the central lymph node dissection (CLND) for papillary thyroid carcinoma (PTC) in cN0 T1/T2. Methods: Retrospective analysis of 532 cases with PTC in cN0 T1/T2 who underwent CLND between October 2014 and September 2016 in the Department of Thyroid Surgery, the First Affiliated Hospital of the Kunming Medical University. The incidence of central lymph node (CLN) metastasis and risk factors were analyzed. Results: CLN metastasis rates: 41.2% (42/102) in males vs 34.9% (150/430) in females, P =0.252; 33.9% (116/342) in single focal carcinoma vs 40.4% (74/183) in multifocal carcinoma, P =0.157; 44.0% (125/284) in patients with 45 years old or less vs 27.0% (67/248) in patients more than 45 years old, P =0.000; 30.3% (113/373) in microcarcinoma vs 50.9% (81/159) in non-microcarcinoma, P =0.000.In unilateral lesions, ipsilateral CLN metastasis was correlated with the tumor diameter ( P =0.012), but not with the number of lesions ( P =0.653). also contralateral CLN metastasis was correlated with the tumor diameter ( P =0.000), but not with the number of lesions ( P =0.815). For the left or right unilateral single focal lesion, the tumor diameter was not correlated with the metastasis of the posterior to right recurrent laryngeal nerve central lymph nodes (LN-prRLN-CLN) ( P =0.652, P =0.088). But in bilateral multifocal carcinoma the tumor diameter was correlated with metastasis of LN-prRLN-CLN ( P =0.039). Conclusions: Prophylactic CLND is reasonable for PTC in cN0 T1/T2. A bilateral CLND should be conducted for patients with bilateral multi-focus cancer and unilateral or bilateral non-microcarcinoma, especially in patients more than 45 years old. For unilateral single focal microcarcinoma on the right, the content of CLND should be from laryngeal nerve on right center to posterior branche; for unilateral single focal microcarcinoma on the left side, the left CLND should be conducted. An ipsilateral CLND can be considered in

  18. Precision half-life measurement of 11C: The most precise mirror transition F t value

    NASA Astrophysics Data System (ADS)

    Valverde, A. A.; Brodeur, M.; Ahn, T.; Allen, J.; Bardayan, D. W.; Becchetti, F. D.; Blankstein, D.; Brown, G.; Burdette, D. P.; Frentz, B.; Gilardy, G.; Hall, M. R.; King, S.; Kolata, J. J.; Long, J.; Macon, K. T.; Nelson, A.; O'Malley, P. D.; Skulski, M.; Strauss, S. Y.; Vande Kolk, B.

    2018-03-01

    Background: The precise determination of the F t value in T =1 /2 mixed mirror decays is an important avenue for testing the standard model of the electroweak interaction through the determination of Vu d in nuclear β decays. 11C is an interesting case, as its low mass and small QE C value make it particularly sensitive to violations of the conserved vector current hypothesis. The present dominant source of uncertainty in the 11CF t value is the half-life. Purpose: A high-precision measurement of the 11C half-life was performed, and a new world average half-life was calculated. Method: 11C was created by transfer reactions and separated using the TwinSol facility at the Nuclear Science Laboratory at the University of Notre Dame. It was then implanted into a tantalum foil, and β counting was used to determine the half-life. Results: The new half-life, t1 /2=1220.27 (26 ) s, is consistent with the previous values but significantly more precise. A new world average was calculated, t1/2 world=1220.41 (32 ) s, and a new estimate for the Gamow-Teller to Fermi mixing ratio ρ is presented along with standard model correlation parameters. Conclusions: The new 11C world average half-life allows the calculation of a F tmirror value that is now the most precise value for all superallowed mixed mirror transitions. This gives a strong impetus for an experimental determination of ρ , to allow for the determination of Vu d from this decay.

  19. Spin Seebeck effect in a simple ferromagnet near T c: a Ginzburg-Landau approach

    NASA Astrophysics Data System (ADS)

    Adachi, Hiroto; Yamamoto, Yutaka; Ichioka, Masanori

    2018-04-01

    A time-dependent Ginzburg-Landau theory is used to examine the longitudinal spin Seebeck effect in a simple ferromagnet in the vicinity of the Curie temperature T c. It is shown analytically that the spin Seebeck effect is proportional to the magnetization near T c, whose result is in line with the previous numerical finding. It is argued that the present result can be tested experimentally using a simple magnetic system such as EuO/Pt or EuS/Pt.

  20. Characterization of the T-cell response to Dau c 1, the Bet v 1-homolog in carrot.

    PubMed

    Zulehner, N; Nagl, B; Briza, P; Roulias, A; Ballmer-Weber, B; Zlabinger, G J; Ferreira, F; Bohle, B

    2017-02-01

    In contrast to other Bet v 1-related food allergens, the major carrot allergen, Dau c 1, has been suggested to induce food allergy independently from Bet v 1. As T cells are crucial in the sensitization process, we sought to characterize the T-cell response to Dau c 1 and its cross-reactivity with Bet v 1. Dau c 1-specific T-cell lines (TCL) and clones (TCC) established from PBMC of birch pollen-allergic patients with carrot allergy were analyzed for reactivity to Bet v 1, epitope specificity, allergen-induced cytokine secretion, and expression of integrins α4β7 and α4β1, critical for gut and lung homing, respectively. mRNA expression of GATA3 and Tbet was analyzed in sorted CD3 + CD4 + CFSE low cells proliferating upon stimulation of PBMC with Dau c 1 or Bet v 1. Dau c 1 was incubated with endolysosomal proteases, and the resulting fragments were identified by mass spectrometry. Among 14 distinct T-cell-activating regions, Dau c 1 139-153 was recognized by 55% of the patients. Only 6 of 15 (40%) Dau c 1-specific TCL and 9 of 21 (43%) TCC reacted with Bet v 1. Bet v 1-nonreactive TCC were mainly Th1-like and showed a higher expression of the integrin β7 and a significantly lower expression of the integrin β1 than Bet v 1-positive TCC. A Th1-like response was also detected in Dau c 1-reactive CD3 + CD4 + CFSE low cells. Full-length Dau c 1 was still detectable after 48 h of endolysosomal degradation. Proteolytic fragments of Dau c 1 matched its T-cell-activating regions. Dau c 1 displays several characteristics of sensitizing allergens, namely a major T-cell-activating region, low susceptibility to endolysosomal degradation, and induction of a Bet v 1-independent T-cell response. These cellular insights confirm that the major carrot allergen has a special status among Bet v 1-related food allergens. © 2016 The Authors. Allergy Published by John Wiley & Sons Ltd.