Sample records for mexican mestizo patients

  1. Amylin S20G mutation in Mexican population.

    PubMed

    Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

    2007-04-01

    Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

  2. DD genotype of angiotensin-converting enzyme in type 2 diabetes mellitus with renal disease in Mexican Mestizos.

    PubMed

    Palomo-Piñón, Silvia; Gutiérrez-Rodríguez, Margarita E; Díaz-Flores, Margarita; Sánchez-Barrera, Reyna; Valladares-Salgado, Adán; Utrera-Barillas, Dolores; Durán-Reyes, Genoveva; Galván-Duarte, Rosa E; Trinidad-Ramos, Pedro; Cruz, Miguel

    2009-04-01

    The DD genotype of angiotensin-converting enzyme (ACE) has been suggested as a major contributor of diabetic nephropathy in several populations. The purpose of the present study was to determine whether micro/macroalbuminuria is associated with ACE insertion/deletion (I/D) polymorphism in Mexican Mestizos with type 2 diabetes mellitus. A total of 435 patients with type 2 diabetes mellitus, of whom 233 had albuminuria, were characterized for the ACE I/D polymorphism by the polymerase chain reaction method. Clinical and biochemical characteristics and frequencies according to DD, ID and II genotypes in patients with and without albuminuria showed no significant differences. However, only females with micro/macroalbuminuria showed higher frequency of a DD genotype than those without albuminuria (27.9%, 21.2% and 10.5%, respectively; P

  3. Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

    PubMed

    Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha

    2010-01-01

    Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.

  4. Genetic Epidemiology of Type 2 Diabetes in Mexican Mestizos.

    PubMed

    García-Chapa, Eiralí Guadalupe; Leal-Ugarte, Evelia; Peralta-Leal, Valeria; Durán-González, Jorge; Meza-Espinoza, Juan Pablo

    2017-01-01

    There are currently about 415 million people with diabetes worldwide, a figure likely to increase to 642 million by 2040. In 2015, Mexico was the second Latin American country and sixth in the world in prevalence of this disorder with nearly 11.5 million of patients. Type 2 diabetes (T2D) is the main kind of diabetes and its etiology is complex with environmental and genetic factors involved. Indeed, polymorphisms in several genes have been associated with this disease worldwide. To estimate the genetic epidemiology of T2D in Mexican mestizos a systematic bibliographic search of published articles through PubMed, Scopus, Google Scholar, and Web of Science was conducted. Just case-control studies of candidate genes about T2D in Mexican mestizo inhabitants were included. Nineteen studies that met the inclusion criteria were found. In total, 68 polymorphisms of 41 genes were assessed; 26 of them were associated with T2D risk, which were located in ABCA1, ADRB3, CAPN10, CDC123/CAMK1D, CDKAL1, CDKN2A/2B, CRP, ELMO1, FTO, HHEX, IGF2BP2, IRS1, JAZF1, KCNQ1, LOC387761, LTA, NXPH1, SIRT1, SLC30A8, TCF7L2, and TNF-α genes. Overall, 21 of the 41 analyzed genes were associated with T2D in Mexican mestizos. Such a genetic heterogeneity compares with findings in other ethnic groups.

  5. Toxoplasmosis gondii and schizophrenia: a case control study in a low Toxoplasma gondii seroprevalence Mexican population

    USDA-ARS?s Scientific Manuscript database

    There are conflicting reports concerning the association of T. gondii infection and schizophrenia. Therefore, we determined such association in a Mexican population of Mestizo ethnicity. Through a case-control study design, 50 schizophrenic patients and 150 control subjects matched by gender, age, r...

  6. Contribution of Common Genetic Variants to Obesity and Obesity-Related Traits in Mexican Children and Adults

    PubMed Central

    Villalobos-Comparán, Marisela; Villarreal-Molina, Teresa; Romero-Hidalgo, Sandra; López-Contreras, Blanca; Gutiérrez-Vidal, Roxana; Vega-Badillo, Joel; Jacobo-Albavera, Leonor; Posadas-Romeros, Carlos; Canizalez-Román, Adrián; Río-Navarro, Blanca Del; Campos-Pérez, Francisco; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel

    2013-01-01

    Background Several studies have identified multiple obesity-associated loci mainly in European populations. However, their contribution to obesity in other ethnicities such as Mexicans is largely unknown. The aim of this study was to examine 26 obesity-associated single-nucleotide polymorphisms (SNP) in a sample of Mexican mestizos. Methods 9 SNPs in biological candidate genes showing replications (PPARG, ADRB3, ADRB2, LEPR, GNB3, UCP3, ADIPOQ, UCP2, and NR3C1), and 17 SNPs in or near genes associated with obesity in first, second and third wave GWAS (INSIG2, FTO, MC4R, TMEM18, FAIM2/BCDIN3, BDNF, SH2B1, GNPDA2, NEGR1, KCTD15, SEC16B/RASAL2, NPC1, SFRF10/ETV5, MAF, PRL, MTCH2, and PTER) were genotyped in 1,156 unrelated Mexican-Mestizos including 683 cases (441 obese class I/II and 242 obese class III) and 473 normal-weight controls. In a second stage we selected 12 of the SNPs showing nominal associations with obesity, to seek associations with quantitative obesity-related traits in 3 cohorts including 1,218 Mexican Mestizo children, 945 Mexican Mestizo adults, and 543 Indigenous Mexican adults. Results After adjusting for age, sex and admixture, significant associations with obesity were found for 6 genes in the case-control study (ADIPOQ, FTO, TMEM18, INSIG2, FAIM2/BCDIN3 and BDNF). In addition, SH2B1 was associated only with class I/II obesity and MC4R only with class III obesity. SNPs located at or near FAIM2/BCDIN3, TMEM18, INSIG2, GNPDA2 and SEC16B/RASAL2 were significantly associated with BMI and/or WC in the combined analysis of Mexican-mestizo children and adults, and FTO locus was significantly associated with increased BMI in Indigenous Mexican populations. Conclusions Our findings replicate the association of 8 obesity-related SNPs with obesity risk in Mexican adults, and confirm the role of some of these SNPs in BMI in Mexican adults and children. PMID:23950976

  7. Risk factors and impact on bone mineral density in postmenopausal Mexican mestizo women.

    PubMed

    Rojano-Mejía, David; Aguilar-Madrid, Guadalupe; López-Medina, Guillermo; Cortes-Espinosa, Leticia; Hernández-Chiu, Maria C; Canto-Cetina, Thelma; Vergara-López, Alma; Coral-Vázquez, Ramon M; Canto, Patricia

    2011-03-01

    Considering that the Mexican mestizo population seems to be the result of a genetic admixture, we proposed that further research is needed to evaluate the role of ethnicity in conjunction with health-related factors to better understand ethnic differences in bone mineral density (BMD). The aim of this study was to analyze several risk factors related to the development of osteoporosis in postmenopausal Mexican mestizo women. We included 567 postmenopausal Mexican mestizo women. A structured questionnaire for risk factors was applied and BMD was measured in total hip and lumbar spine by dual-energy x-ray absorptiometry. Nonconditional logistic regression was used to estimate crude and adjusted odds ratio. Using World Health Organization criteria, 28.7% of postmenopausal women had osteoporosis, 46.4% had osteopenia, and 24.9% had normal BMD. Each clinical risk factor had a different significance for osteopenia/osteoporosis; however, duration of total breast-feeding, body mass index, and number of years since menopause remained significantly associated with osteopenia/osteoporosis after bone density was added to the nonconditional model. Interestingly, extended periods of accumulated breast-feeding for 24 and 36 months were, in both cases, significantly associated with osteopenia/osteoporosis. Our results confirm the importance of considering the duration of breast-feeding as an important risk factor for osteopenia/osteoporosis. In addition, we find that body mass index is positively associated with BMD. Because of the heterogeneity of the Mexican mestizo population, the risk factor for osteoporosis may not be the same in different ethnic groups.

  8. Epidemiology of diabetes mellitus in Mexico.

    PubMed

    Bello-Chavolla, Omar Y; Rojas-Martinez, Rosalba; Aguilar-Salinas, Carlos A; Hernández-Avila, Mauricio

    2017-01-01

    Type 2 diabetes is the main health problem in Mexico. The large and growing number of cases and the remarkable economic impact of the disease support this statement. The condition is expressed at an earlier age and at a lower body mass index in Mexican mestizos compared with the age and body mass index reported in Caucasians. In addition, Mexican mestizos have an increased susceptibility to developing diabetic nephropathy. The Mexican health system needs major adjustments in order to prevent and treat type 2 diabetes. Treatment is not currently based on the needs and expectations of the patient. As a result, it is insufficient, belated, and costly. Close to 20% of the preventable deaths in Mexico are caused by diabetes and related metabolic diseases. Even a small decrease in this rate could result in substantial savings for the Mexican healthcare system. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Polymorphisms of APLN-APLNR system are associated with essential hypertension in Mexican-Mestizo individuals.

    PubMed

    Esteban-Martínez, Rosa Lilia; Pérez-Razo, Juan Carlos; Vargas-Alarcón, Gilberto; Martínez-Rodríguez, Nancy; Cano-Martínez, Luis Javier; López-Hernández, Luz Berenice; Rojano-Mejía, David; Canto, Patricia; Coral-Vazquez, Ramón Mauricio

    2016-08-01

    The aim of this study was to evaluate if polymorphisms of APLN and APLNR genes may play a role as susceptibility markers for hypertension in a group of Mexican-Mestizo patients. A case-control study was carried out including normotensive and hypertensive individuals. For these, two polymorphisms of APLN (rs3761581 and rs56204867) and two of APLNR () genes were genotyped by 5' exonuclease TaqMan assay in 400 normotensive individuals and 383 patients. The results showed that, under an additive model adjusted by BMI, HDL, triglycerides, glucose and family history of essential hypertension, the rs7119375 and rs10501367 polymorphisms of APLNR gene were associated significantly with a decreased risk of essential hypertension (P=0.039 and P=0.029, respectively). Besides, the haplotypes analysis of these polymorphisms showed that H1 haplotype was associated with an increased risk of essential hypertension (P=0.026), while the H2 haplotype was associated with a decreased risk (P=0.032). Contrary, the rs3761581 and rs56204867 polymorphisms of APLN gene were not associated with essential hypertension (P=0.1707 and P=0.0769, respectively). The data suggest that APLNR rs7119375 and rs10501367 are associated with a decreased risk of essential hypertension in our Mexican-Mestizo studied group, but further studies are warranted. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Forensic parameters and admixture in Mestizos from five geographic regions of Mexico based on 20 autosomal STRs (Powerplex 21 system).

    PubMed

    Aguilar-Velázquez, J A; Martínez-Cortés, G; Inclán-Sánchez, A; Favela-Mendoza, A F; Velarde-Félix, J S; Rangel-Villalobos, H

    2018-03-01

    We analyzed Mestizo (admixed) population samples from different geographic regions of Mexico (n = 1283) with 20 autosomal STRs (PowerPlex® 21, Promega Corp.). Allele frequencies and forensic parameters from the Northwest, Northeast, West, Center, and Southeast regions are reported, as well as from the pooled Mexican population sample. The combined PD and PE for this 20 STR system were > 0.9999999999 and > 0.99999996593% in all five population samples, respectively. Analysis of molecular variance (AMOVA) of these Mexican population samples, plus Monterrey (Northeast) and Mexico (Center) Cities, showed low but significant differences among Mexican-Mestizos from the seven populations (Fst = 0.20%; p = 0.0000). Structure analysis showed the highest proportion of Native American ancestry in Mexico City, Center, and Southeast regions, respectively, which was in agreement with the estimated genetic distances represented in a MDS plot and a NJ tree. The best fit of population clusters (K = 4) obtained with the Structure software indicates that Mexican-Mestizos are mainly composed by European, African, and two Native American ancestries. The European and Native American ancestries displayed a contrary gradient, increasing toward the North-West and South-Southeast, respectively. These 20 autosomal STR loci improved the admixture estimation regarding previous studies with the 13 CODIS-STRs, as supported by the higher similarity with previous estimates based on genome-wide SNP. In brief, this study validates the confident use of the PowerPlex® 21 system for human identification purposes in Mestizo populations throughout the Mexican territory.

  11. Nasal valve evaluation in the Mexican-Hispanic (mestizo) nose.

    PubMed

    Jasso-Ramírez, Elizabeth; Sánchez Y Béjar, Fernando; Arcaute Aizpuru, Fernando; Maulen Radován, Irene E; de la Garza Hesles, Héctor

    2018-04-01

    Our aim in this study was to determine the angle of the internal nasal valve in Mexican patients with the "mestizo nose" feature and without nasal obstructive symptoms. The work was prospective, comparative, and observational in nature and included patients >14 years of age who were seen in the Otolaryngology Department at the Los Angeles Lomas Hospital between April and May 2016. The angle of the internal nasal valve was measured in 30 patients without obstructive symptoms. Endoscopic examination was performed with a 0° endoscope framed with tape at a 13-mm distance from the endoscope's tip, and digital photographs of the internal nasal valve were taken. The measurement of the angle of the internal nasal valve was made in sexagesimal degrees using Golden Ratio v3.1 (2012) software. Statistical analysis was performed using Excel v15.13.3. The angles of the internal nasal valve of the patients were (mean ± standard deviation) 24.07 ± 4.8° for the right nasal cavity and 25.07 ± 5.0° for the left nasal cavity, wider than the angle reported in the normal Caucasian nose established in the literature. According to our results, the Mexican-Hispanic mestizo nose has a wider angle in the internal nasal valve than that considered normal in the literature (10°-15°). We believe it is necessary to undertake a second study and add an airflow resistance measurement with a rhinomanometry procedure so we can compare the results with those in the Caucasian population. © 2018 ARS-AAOA, LLC.

  12. Genetic structure and forensic parameters of 38 Indels for human identification purposes in eight Mexican populations.

    PubMed

    Martínez-Cortés, G; Gusmão, L; Pereira, R; Salcido, V H; Favela-Mendoza, A F; Muñoz-Valle, J F; Inclán-Sánchez, A; López-Hernández, L B; Rangel-Villalobos, H

    2015-07-01

    Insertion-deletions for human identification purposes (HID-Indels) offer advantages to solve particular forensic situations and complex paternity cases. In Mexico, admixed population known as Mestizos is the largest (∼90%), plus a number of Amerindian groups (∼10%), which have not been studied with HID-Indels. For this reason, allele frequencies and forensic parameters for 38 HID-Indels were estimated in 531 unrelated individuals from one Amerindian (Purépecha) and seven Mestizo populations from different regions of the country. Genotype distribution was in agreement with Hardy-Weinberg expectations in almost all loci/populations. The linkage disequilibrium (LD) test did not reveal possible associations between loci pairs in all eight Mexican populations. The combined power of discrimination was high in all populations (PD >99.99999999998%). However, the power of exclusion of the 38 HID-Indel system (PE >99.6863%) was reduced regarding most of autosomal STR kits. The assessment of genetic structure (AMOVA) and relationships between populations (FST) demonstrated significant differences among Mexican populations, mainly of the Purépecha Amerindian group. Among Mexican-Mestizos, three population clusters consistent with geography were defined: (i) North-West region: Chihuahua, Sinaloa, and Jalisco; (ii) Central-Southern region: Mexico City, Veracruz and Yucatan; (iii) South region: Chiapas. In brief, this report validates the inclusion of the 38 HID-Indel system in forensic casework and paternity cases in seven Mexican-Mestizo populations from different regions, and in one Mexican Amerindian group. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Mexican mestizo population sub-structure: effects on genetic and forensic statistical parameters.

    PubMed

    Noris, Gino; Santana, Carla; Meraz-Ríos, Marco Antonio; de Lourdes Munoz, María; Majluf-Cruz, Abraham; Magaña, Jonathan J; Granados, Julio; Quezada, Rosa; Revilla, María Cristina; Martínez-Salas, Sergio; Xihuitl, Salvador; Martínez de la Escalera, Gonzalo; Díaz-Badillo, Alvaro; Calderon-Aranda, Emma S; Gómez, Rocío

    2012-12-01

    Since Mexican mestizos are an admixed population, it is necessary to determine the effects that the substructure of the population has on genetic and forensic parameters. With this aim, a study was performed with 15 STR loci (CODIS plus D2S1338 and D19S433) on 1,640 unrelated Mexican mestizos. We determine allele and genotypic frequencies observing departure from Hardy-Weinberg expectation (12 out of 15 loci, with an excess of homozygotes, Fis > 0), as well as pairs of loci in an apparent linkage disequilibrium (13 of 92 loci). We conducted a test for genetic population stratification, the results show that the Mexican mestizo population is substructured into three subgroups, which are in HW and linkage equilibrium. The combination of the 15 loci in the whole population has high forensic efficiency with the capacity to genetically discriminate one individual in one quintillion (1/10(18)). Our data potentially validates the use of these 15 STR loci to establish forensic identity and parentage testing for legal purposes, and offers a powerful tool for genetic variation analysis. However, given that the population is stratified, we highly recommend applying a correction with the inbreeding coefficient in calculations of paternity and forensic studies to avoid erroneous assumptions.

  14. EBV+ lymphoepithelial carcinoma of the parotid gland in Mexican Mestizo patients with chronic autoimmune diseases.

    PubMed

    Saqui-Salces, Milena; Martinez-Benitez, Braulio; Gamboa-Dominguez, Armando

    2006-01-01

    Lymphoepithelial carcinomas of the salivary gland are rare tumors constantly associated with Epstein-Barr virus (EBV) and mainly identified in Asiatic and Greenlander population. Four cases have been described in Caucasians, only two with EBV infection. We describe two cases of parotid gland lymphoepithelial carcinomas in Mexican mestizo women in which chronic latent EBV infection was documented by immunohistochemistry and in situ hybridization. One patient had primary Sjögren's syndrome and the other systemic lupus erythematosus of six and three years of evolution, respectively. Epithelial neoplastic cells showed latency pattern II (LMP1+, EBNA-2-, EBER+) with a dense inflammatory infiltrate composed mainly by CD8+ T lymphocytes. Follow-up excluded nasopharyngeal involvement in both patients. This report expands the ethnic groups in which salivary lymphoepithelial carcinomas associated with chronic latent EBV infection have been described, and illustrates for the first time its association with autoimmune diseases in two women living in a region non-endemic for this unusual neoplasm.

  15. Comparison of statin eligibility according to the Adult Treatment Panel III, ACC/AHA blood cholesterol guideline, and presence of carotid plaque by ultrasound in Mexican mestizo patients with rheumatoid arthritis.

    PubMed

    Galarza-Delgado, Dionicio A; Azpiri-Lopez, Jose R; Colunga-Pedraza, Iris J; Cardenas-de la Garza, Jesus A; Vera-Pineda, Raymundo; Garcia-Colunga, Judith I; Arvizu-Rivera, Rosa I; Martinez-Moreno, Adrian; Villarreal-Perez, Jesus Z; Elizondo-Riojas, Guillermo; Garza Elizondo, Mario A

    2016-11-01

    Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death in rheumatoid arthritis (RA) patients. Guidelines of the American College of Cardiology and the American Heart Association (ACC/AHA) 2013 and the Adult Treatment Panel III (ATP-III) differ in their strategies to recommend initiation of statin therapy. The presence of carotid plaque (CP) by carotid ultrasound is an indication to begin statin therapy. We aimed to compare the recommendation to initiate statin therapy according to the ACC/AHA 2013 guidelines, ATP-III guidelines, and CP by carotid ultrasound. We then carried out an observational, cross-sectional study of 62 statin-naive Mexican mestizo RA patients, aged 40 to 75, who fulfilled the 1987 or 2010 ACR/European League Against Rheumatism (EULAR) classification criteria. CP was evaluated with B-mode ultrasound. Cohen's kappa (k) was used to assess agreement between ACC/AHA 2013 guidelines, ATP-III guidelines, and the presence of CP, considering a p < 0.05 as statistically significant. Agreement was classified as slight (0.01-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and an almost perfect agreement (0.81-1.00). Slight agreement (k = 0.096) was found when comparing statin recommendation between CP and ATP-III. Fair agreement (k = 0.242) was revealed between ACC/AHA 2013 and ATP-III. Comparison between ACC/AHA 2013 and CP showed moderate agreement (k = 0.438). ACC/AHA 2013 guidelines could be an adequate and cost-effective tool to evaluate the need of statin therapy in Mexican mestizo RA patients, with moderate agreement with the presence of CP by ultrasound.

  16. Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

    PubMed

    López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

    2017-12-01

    This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

  17. Cultural and social determinants of health among indigenous Mexican migrants in the United States.

    PubMed

    Lee, Junghee; Donlan, William; Cardoso, Edgar Ezequiel Orea; Paz, Juan Jesus

    2013-01-01

    Despite growing numbers, indigenous Mexican migrants are relatively invisible to health practitioners who group them with nonindigenous, mestizo Mexican-origin populations. Associations between indigenous and mestizo cultural identifications with psychosocial characteristics and health indicators among indigenous Mexican migrants were examined. Results revealed gender differences in cultural identifications, perceived discrimination, self-esteem, self-efficacy, and various health indicators including depression severity, culture-bound syndromes, and self-rated health. Multivariate regression and structural equation path modeling demonstrated how indigenous cultural identification and perceived discrimination affects health. Findings suggest that interventions should utilize indigenous community-based activities designed to promote self-esteem and the value of indigenous culture, with a focus on females.

  18. Forensic efficiency parameters of the Investigator Argus X-12 kit in women from two Mestizo and seven Amerindian populations from Mexico.

    PubMed

    Cortés-Trujillo, I; Ramos-González, B; Salas-Salas, O; Zuñiga-Chiquette, F; Zetina Hernández, A; Martínez-Cortés, G; Ruiz-Hernández, M; González-Martín, A; Ferragut, J F; Rangel-Villalobos, H

    2017-05-01

    Allele frequency distribution and statistical parameters of forensic efficiency concerning the Investigator Argus X-12 kit (Qiagen, Hilden, Germany) were determined in a total sample of 641 unrelated Mexican females, including two Mestizo-admixed- populations (n=309) and seven Amerindian groups (n=332) from the main regions of the country. Most of the 12 X-STRs were in agreement with Hardy-Weinberg expectations in all nine Mexican populations. The power of discrimination in females (PD) and Median exclusion chance for trios (MEC T ) and duos (MEC D ) of this genetic system based on X-STRs were >99.99%. Although Mexican populations showed significant pairwise differentiation, a closer relationship was evident between Amerindian groups and nearby Mestizos, in agreement with historical records, previous genetic studies, and X-linked inheritance pattern expectations. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. PPARGC1A and ADIPOQ polymorphisms are associated with aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity.

    PubMed

    Canto, Patricia; Granados, Jesús Benítez; Feria-Bernal, Guillermo; Coral-Vázquez, Ramón Mauricio; García-García, Eduardo; Tejeda, María Elena; Tapia, André; Rojano-Mejía, David; Méndez, Juan Pablo

    2017-07-04

    Obesity constitutes a risk factor for the development of aggressive forms of prostate cancer. It has been proposed, that prostate cancer has a genetic predisposition and that PPARGC1A and ADIPOQ polymorphisms play a role in the development of this condition. To analyse the association of two PPARGC1A and ADIPOQ polymorphisms as well as their haplotypes, with the development of aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity. Two hundred fifty seven men with prostate cancer of Mexican-Mestizo origin were included. Body mass index (BMI) was determined and the degree of prostate cancer aggressiveness by the D'Amico classification. DNA was obtained. Rs7665116 and rs2970870 of PPARGC1A, and rs266729 and rs1501299 of ADIPOQ were studied by real-time PCR allelic discrimination. Pairwise linkage disequilibrium, between single nucleotide polymorphisms was calculated and haplotype analysis was performed. A higher-risk (D'Amico classification) was observed in 21.8% of patients. An association of cancer aggressiveness with rs2970870 of PPARGC1A, and rs501299 of ADIPOQ, as well as with one haplotype of ADIPOQ was documented. This is the first study regarding the relationship of PPARGC1A and ADIPOQ polymorphisms, and the aggressiveness of prostate cancer in men with overweight or obesity.

  20. The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

    PubMed Central

    Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

    2013-01-01

    Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

  1. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  2. Genetic Obesity Risk and Attenuation Effect of Physical Fitness in Mexican-Mestizo Population: a Case-Control Study.

    PubMed

    Costa-Urrutia, Paula; Abud, Carolina; Franco-Trecu, Valentina; Colistro, Valentina; Rodríguez-Arellano, Martha Eunice; Vázquez-Pérez, Joel; Granados, Julio; Seelaender, Marilia

    2017-05-01

    We analyzed commonly reported European and Asian obesity-related gene variants in a Mexican-Mestizo population through each single nucleotide polymorphism (SNP) and a genetic risk score (GRS) based on 23 selected SNPs. Study subjects were physically active Mexican-Mestizo adults (n  =  608) with body mass index (BMI) values from 18 to 55 kg/m 2 . For each SNP and for the GRS, logistic models were performed to test for simple SNP associations with BMI, fat mass percentage (FMP), waist circumference (WC), and the interaction with VO 2max and muscular endurance (ME). To further understand the SNP or GRS*physical fitness components, generalized linear models were performed. Obesity risk was significantly associated to 6 SNPs (ADRB2 rs1042713, APOB rs512535, PPARA rs1800206, TNFA rs361525, TRHR rs7832552 and rs16892496) after adjustment by gender, age, ancestry, VO 2max , and ME. ME attenuated the influence of APOB rs512535 and TNFA rs361525 on obesity risk in FMP. WC was significantly associated to GRS. Both ME and VO 2max attenuated GRS effect on WC. We report associations for 6 out of 23 SNPs and for the GRS, which confer obesity risk, a novel finding for Mexican-Mestizo physically active population. Also, the importance of including physical fitness components variables in obesity genetic risk studies is highlighted, with special regard to intervention purposes. © 2017 John Wiley & Sons Ltd/University College London.

  3. Admixture and genetic relationships of Mexican Mestizos regarding Latin American and Caribbean populations based on 13 CODIS-STRs.

    PubMed

    Salazar-Flores, J; Zuñiga-Chiquette, F; Rubi-Castellanos, R; Álvarez-Miranda, J L; Zetina-Hérnandez, A; Martínez-Sevilla, V M; González-Andrade, F; Corach, D; Vullo, C; Álvarez, J C; Lorente, J A; Sánchez-Diz, P; Herrera, R J; Cerda-Flores, R M; Muñoz-Valle, J F; Rangel-Villalobos, H

    2015-02-01

    Short tandem repeats (STRs) of the combined DNA index system (CODIS) are probably the most employed markers for human identification purposes. STR databases generated to interpret DNA profiles are also helpful for anthropological purposes. In this work, we report admixture, population structure, and genetic relationships of Mexican Mestizos with respect to Latin American and Caribbean populations based on 13 CODIS-STRs. In addition, new STR population data were included from Tijuana, Baja California (Northwest, Mexico), which represents an interesting case of elevated genetic flow as a bordering city with the USA. Inter-population analyses included CODIS-STR data from 11 Mexican Mestizo, 12 Latin American and four Caribbean populations, in addition to European, Amerindian, and African genetic pools as ancestral references. We report allele frequencies and statistical parameters of forensic interest (PD, PE, Het, PIC, typical PI), for 15 STRs in Tijuana, Baja California. This Mexican border city was peculiar by the increase of African ancestry, and by presenting three STRs in Hardy-Weinberg disequilibrium, probably explained by recurrent gene flow. The Amerindian ancestry in Central and Southeast of Mexico was the greatest in Latin America (50.9-68.6%), only comparable with the North of Central America and Ecuador (48.8-56.4%), whereas the European ancestry was prevalent in South America (66.7-75%). The African ancestry in Mexico was the smallest (2.2-6.3%) in Latin America (≥ 2.6%), particularly regarding Brazil (21%), Honduras (62%), and the Caribbean (43.2-65.2%). CODIS-STRs allowed detecting significant population structure in Latin America based on greater presence of European, Amerindian, and African ancestries in Central/South America, Mexican Mestizos, and the Caribbean, respectively. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Differences in idiopathic inflammatory myopathy phenotypes and genotypes between Mesoamerican Mestizos and North American Caucasians: ethnogeographic influences in the genetics and clinical expression of myositis.

    PubMed

    Shamim, Ejaz A; Rider, Lisa G; Pandey, Janardan P; O'Hanlon, Terrance P; Jara, Luis J; Samayoa, Eduardo A; Burgos-Vargas, Ruben; Vazquez-Mellado, Janitzia; Alcocer-Varela, Jorge; Salazar-Paramo, Mario; Kutzbach, Abraham Garcia; Malley, James D; Targoff, Ira N; Garcia-De la Torre, Ignacio; Miller, Frederick W

    2002-07-01

    As part of a larger, worldwide study of the ethnogeography of myositis, we evaluated the clinical, serologic, and immunogenetic features of Mestizo (Mexican and Guatemalan) and North American Caucasian patients with idiopathic inflammatory myopathy (IIM). Clinical manifestations, autoantibodies, HLA-DRB1 and DQA1 alleles, and immunoglobulin Gm/Km allotypes were compared between 138 Mestizos with IIM and 287 Caucasians with IIM, using the same classification criteria and standardized questionnaires. IIM in Mestizo patients was characterized by a higher proportion of dermatomyositis (69% of adult Mestizos versus 35% of adult Caucasians; P < 0.001) and anti-Mi-2 autoantibodies (30% versus 7% of adults, respectively, and 32% versus 4% of children, respectively; P < 0.01). Genetic risk factors also differed in these populations. Whereas Mestizos had no HLA risk factors for IIM, HLA-DRB1*0301, the linked allele DQA1*0501, and DRB1 alleles sharing the first hypervariable region motif (9)EYSTS(13) were major risk factors in Caucasian patients with IIM. Furthermore, different HLA-DRB1 and DQA1 alleles were associated with anti-Mi-2 autoantibodies (DRB1*04 and DQA1*03 in Mestizos and DRB1*07 and DQA1*02 in Caucasians). Immunoglobulin gamma-chain allotypes Gm(1), Gm(17) (odds ratio for both 11.3, P = 0.008), and Gm(21) (odds ratio 7.3, P = 0.005) and kappa-chain allotype Km(3) (odds ratio 7.3, P = 0.005) were risk factors for IIM in Mestizos; however, no Gm or Km allotypes were risk or protective factors in Caucasians. In addition, Gm and Km phenotypes were unique risk factors (Gm 1,3,17 5,13,21 and Gm 1,17 23 21 and Km 3,3) or protective factors (Km 1,1) for the development of myositis and anti-Mi-2 autoantibodies (Gm 1,2,3,17 23 5,13,21) in adult Mestizos. IIM in Mesoamerican Mestizos differs from IIM in North American Caucasians in the frequency of phenotypic features and in the immune-response genes predisposing to and protecting from myositis and anti-Mi-2 autoantibodies at 4 chromosomal loci. These and other data suggest the likelihood that the expression of IIM is modulated by different genes and environmental exposures around the world.

  5. Analysis of Polymorphisms in Interleukin-10, Interleukin-6, and Interleukin-1 Receptor Antagonist in Mexican-Mestizo Women with Pre-eclampsia

    PubMed Central

    Valencia Villalvazo, Elith Yazmin; Canto-Cetina, Thelma; Romero Arauz, Juan Fernando; Coral-Vázquez, Ramón Mauricio; Canizales-Quinteros, Samuel; Coronel, Agustín; Carlos Falcón, Juan; Hernández Rivera, Jaime; Ibarra, Roberto; Polanco Reyes, Lucila

    2012-01-01

    Due to the fact that studies seeking associations of polymorphisms in regulatory regions of cytokine genes with pre-eclampsia (PE) have not always been consistent in different population analyses, the aim of this study was to investigate the possible association between rs1800896 of interleukin-10 (IL-10), rs1800795 of interleukin-6 (IL-6), and the variable number of tandem repeats (VNTR) in intron 2 of interleukin-1 receptor antagonist (IL-1Ra), as well as gene–gene interactions between these three polymorphisms with the presence of PE in Mexican-Mestizo women and one Amerindian population from México (Maya). A case–control study was performed where 411 pre-eclamptic cases and 613 controls were genotyped. For the rs1800896 of IL-10 and rs1800795 of IL-6, we used real-time polymerase chain reaction (PCR) allelic discrimination and for the VNTR of IL-1Ra, PCR. Allele frequency differences were assessed by Chi-squared test; logistic regression was used to test for associations; a gene–gene interaction was conducted. Genotypic and allelic distribution of the polymorphisms was similar in our population. The estimated of the gene–gene interaction between the polymorphisms did not differ significantly. However, we observed important differences in the distribution of the alleles and genotypes of the three polymorphisms analyzed between Mestiza-Mexicanas and Maya-Mestizo women. In conclusion, we did not find an association between polymorphisms in IL-10, IL-6, and IL-1Ra and PE in Mexican-Mestizo and Maya-Mestizo women. To our knowledge, this is the first time that these three polymorphisms were analyzed together with gene–gene interaction in women with PE. PMID:23013217

  6. Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

    PubMed

    Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

    2016-11-03

    Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

  7. Metabolic effects of the contraceptive skin patch and subdermal contraceptive implant in Mexican women: A prospective study

    PubMed Central

    2014-01-01

    Background The contraceptive skin patch (CSP) accepted by the U.S. FDA in 2001 includes ethinylestradiol and norelgestromine, whereas the subdermal contraceptive implant (SCI) has etonogestrel and is also approved by the FDA. In Mexico, both are now widely used for contraception but their effects on Mexican population are unknown. The objective of the study was to evaluate if these treatments induce metabolic changes in a sample of indigenous and mestizo Mexican women. Methods An observational, prospective, longitudinal, non-randomized study of women between 18 and 35 years of age assigned to CSP or SCI. We performed several laboratory tests: clinical chemistry, lipid profile, and liver and thyroid function tests. Also, serum levels of insulin, C-peptide, IGF-1, leptin, adiponectin, and C reactive protein were assayed. Results Sixty-two women were enrolled, 25 used CSP (0 indigenous; 25 mestizos) and 37 used SCI (18 indigenous; 19 mestizos). Clinical symptoms were relatively more frequent in the SCI group. Thirty-four contraceptive users gained weight without other clinical significant changes. After 4 months of treatment, significant changes were found in some biochemical parameters in both treatment groups. Most were clinically irrelevant. Interestingly, the percentage of users with an abnormal atherogenic index diminished from 75% to 41.6% after follow-up. Conclusions The CSP slightly modified the metabolic variables. Most changes were nonsignificant, whereas for SCI users changes were more evident and perhaps beneficial. Results of this attempt to evaluate the effects of contraceptives in mestizo and native-American populations show that clinical symptoms are frequent in Mexican users of CSP and SCI. Although these medications may affect some metabolic variables, these changes seem clinically irrelevant. Induction of abnormalities in other physiological pathways cannot be ruled out. PMID:24767248

  8. Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations.

    PubMed

    Cardoso-Saldaña, G; De La Peña-Díaz, A; Zamora-González, J; Gomez-Ortega, R; Posadas-Romero, C; Izaguirre-Avila, R; Malvido-Miranda, E; Morales-Anduaga, M E; Anglés-Cano, E

    2006-01-01

    Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin binding with plasminogen, inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a) have been reported in several populations. The study examined the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin binding by immuno-enzymatic assay and short tandem repeat (STR) polymorphic marker genetic analysis by capillary electrophoresis. Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg dL(-1)) relative to Mazahuas (8.2 mg dL(-1)), Mayas (8.25 mg dL(-1)) and Mayos (6.5 mg dL(-1)). Phenotype distribution was different in Mayas and Mazahuas as compared with the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in the Native Mexican and the Mestizo group.

  9. Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations

    PubMed Central

    Cardoso-Saldaña, Guillermo; De La Peña-Díaz, Aurora; Zamora-González, José; Gomez-Ortega, Rocio; Posadas-Romero, Carlos; Izaguirre-Avila, Raul; Malvido-Miranda, Elsa; Morales-Anduaga, Maria Elena; Angles-Cano, Eduardo

    2006-01-01

    Background Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin-binding with plasminogen inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a), have been reported in several populations. Aim To study the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. Methods We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin-binding by immuno-enzymatic assay and STR polymorphic markers genetic analysis by capillary electrophoresis. Results Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg/dL) relative to Mazahuas (8.2 mg/dL), Mayas (8.25 mg/dL) and Mayos (6.5 mg/dL). Phenotype distribution was different in Mayas and Mazahuas as compared to the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. Conclusion There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in Native Mexican and the Mestizo group. PMID:16684693

  10. Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

    PubMed Central

    Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

    2016-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

  11. A Pilot Genome-Wide Association Study in Postmenopausal Mexican-Mestizo Women Implicates the RMND1/CCDC170 Locus Is Associated with Bone Mineral Density

    PubMed Central

    Villalobos-Comparán, Marisela; Estrada, Karol; Parra-Torres, Alma Y.; González-Mercado, Anahí; Patiño, Nelly; Castillejos-López, Manuel; Quiterio, Manuel; Fernandez-López, Juan Carlos; Ibarra, Bertha; Romero-Hidalgo, Sandra; Salmerón, Jorge

    2017-01-01

    To identify genetic variants influencing bone mineral density (BMD) in the Mexican-Mestizo population, we performed a GWAS for femoral neck (FN) and lumbar spine (LS) in Mexican-Mestizo postmenopausal women. In the discovery sample, 300,000 SNPs were genotyped in a cohort of 411 postmenopausal women and seven SNPs were analyzed in the replication cohort (n = 420). The combined results of a meta-analysis from the discovery and replication samples identified two loci, RMND1 (rs6904364, P = 2.77 × 10−4) and CCDC170 (rs17081341, P = 1.62 × 10−5), associated with FN BMD. We also compared our results with those of the Genetic Factors for Osteoporosis (GEFOS) Consortium meta-analysis. The comparison revealed two loci previously reported in the GEFOS meta-analysis: SOX6 (rs7128738) and PKDCC (rs11887431) associated with FN and LS BMD, respectively, in our study population. Interestingly, rs17081341 rare in Caucasians (minor allele frequency < 0.03) was found in high frequency in our population, which suggests that this association could be specific to non-Caucasian populations. In conclusion, the first pilot Mexican GWA study of BMD confirmed previously identified loci and also demonstrated the importance of studying variability in diverse populations and/or specific populations. PMID:28840121

  12. The Genetics of Mexico Recapitulates Native American Substructure and Affects Biomedical Traits

    PubMed Central

    Moreno-Estrada, Andrés; Gignoux, Christopher R.; Fernández-López, Juan Carlos; Zakharia, Fouad; Sikora, Martin; Contreras, Alejandra V.; Acuña-Alonzo, Victor; Sandoval, Karla; Eng, Celeste; Romero-Hidalgo, Sandra; Ortiz-Tello, Patricia; Robles, Victoria; Kenny, Eimear E.; Nuño-Arana, Ismael; Barquera-Lozano, Rodrigo; Macín-Pérez, Gastón; Granados-Arriola, Julio; Huntsman, Scott; Galanter, Joshua M.; Via, Marc; Ford, Jean G.; Chapela, Rocío; Rodriguez-Cintron, William; Rodríguez-Santana, Jose R.; Romieu, Isabelle; Sienra-Monge, Juan José; Navarro, Blanca del Rio; London, Stephanie J.; Ruiz-Linares, Andrés; Garcia-Herrera, Rodrigo; Estrada, Karol; Hidalgo-Miranda, Alfredo; Jimenez-Sanchez, Gerardo; Carnevale, Alessandra; Soberón, Xavier; Canizales-Quinteros, Samuel; Rangel-Villalobos, Héctor; Silva-Zolezzi, Irma; Burchard, Esteban Gonzalez; Bustamante, Carlos D.

    2014-01-01

    Mexico harbors great cultural and ethnic diversity, yet fine-scale patterns of human genome-wide variation from this region remain largely uncharacterized. We studied genomic variation within Mexico from over 1,000 individuals representing 20 indigenous and 11 mestizo populations. We found striking genetic stratification among indigenous populations within Mexico at varying degrees of geographic isolation. Some groups were as differentiated as Europeans are from East Asians. Pre-Columbian genetic substructure is recapitulated in the indigenous ancestry of admixed mestizo individuals across the country. Furthermore, two independently phenotyped cohorts of Mexicans and Mexican Americans showed a significant association between sub-continental ancestry and lung function. Thus, accounting for fine-scale ancestry patterns is critical for medical and population genetic studies within Mexico, in Mexican-descent populations, and likely in many other populations worldwide. PMID:24926019

  13. HPV-16 and HLA-DRB1 alleles are associated with cervical carcinoma in Mexican Mestizo women.

    PubMed

    Alaez-Verson, Carmen; Berumen-Campos, Jaime; Munguía-Saldaña, Andrea; Flores-Aguilar, Hilario; Guardado-Estrada, Mariano; Rodríguez-Gomez, Araceli; Gorodezky-Lauferman, Clara

    2011-07-01

    The aim of this report was to investigate the contribution of HLA-DRB1/DQB1 alleles to the expression of cervical cancer (CC) and squamous intraepithelial lesion (SIL) in Mexican patients. A total of 257 women were included in the study: 61with low-grade squamous intraepithelial lesions (LSIL), 30 with high-grade (HSIL), 73 with CC and 93 healthy females. All were Mexican Mestizos. For HLA class II typing, PCR-SSOP methodology was used. HPV-16 viral DNA was detected by PCR with specific primers for E6-E7 region. HPV-16 was found in 52% of the patients with CC as well as in 19% of women with HSIL and in 12.5% of females with LSIL. HLA-DRB1∗04:03 (OR = 5.88) was found increased in patients with HSIL as compared with controls, although significance (p = 0.04) was lost after correction (pc =NS). HLA-DRB1∗04:03 seems to influence the risk for developing HSIL, disregarding the presence of HPV-16. HLA-DRB1∗01:01 (OR = 0.12; p = 0.01) may confer protection to the development of CC. An analysis performed stratifying by the presence of HPV-16 infection showed that the frequency of HLA-DRB1∗04:07 (OR = 2.71) was increased in CC patients infected with HPV-16, confirming that the HLA association is HPV dependent. These results shed light on the influence that this virus may have in the expression of CC in the susceptible host. Genetic background is, therefore, a crucial factor in understanding the etiopathogenesis of CC in HPV-positive patients. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

  14. Intestinal microbiota assessment in cirrhotic patients from a Mexican mestizo population.

    PubMed

    Pérez-Monter, C; Escalona-Nandez, I; Estanes-Hernández, A; Noriega-López, L G; Torre-Delgadillo, A

    2018-06-11

    The intestinal microbiota is significantly altered in cirrhotic patients, but the composition of the intestinal microbiota in Mexican patients with the pathology has not been reported. The present study is an attempt to determine the type of intestinal microbiota in healthy subjects and in patients of Mexican mestizo origin that present with cirrhosis of the liver. Biochemical liver function parameters (ALT, AST, GGT, BIL-T, etc.) were determined in 23 cirrhotic patients and 21 control subjects. The intestinal microbiota was established through 16S ribosomal RNA gene sequencing. The cirrhotic patients had elevated levels of ALT, AST, GGT (105.2±77.7 vs. 20.99±8.5UI/L, 110±68.6 vs. 23.39±5.2, and 119.1±79.1 vs. 19.3±15.2UI/L, respectively), IL-6 (1.64±0.38pg/ml, P<.001), or TNFα (1.78±0.3, P<.05). The intestinal microbiota of the cirrhotic patients was less diverse, compared with that of the control subjects. At the level of the phylum, there was a significant increase in Proteobacteria and Bacteroidetes in the patients with cirrhosis, compared with the controls (6.2 vs. 4.9% and 44 vs. 46%, respectively, P<.01). In contrast, there was a decrease in Firmicutes, Actinobacteria, and Fusobacteria in the cirrhotic patients. There was an increase in the Campylobacter and Gemella families in the cirrhotic patients, whereas Streptococcus and Veillonella had a positive association with serum ALT or AST levels. To the best of our knowledge, the present study is the first to demonstrate the type of intestinal microbiota in Mexican patients with cirrhosis of the liver. The extension of the findings in a larger cohort of subjects and the metagenome analysis will enable the creation of data that can have relevant treatment implications for this group of patients in Mexico. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

  15. Ultrasound, histopathological, and genetic features of uveal melanoma in a Mexican-Mestizo population.

    PubMed

    Delgado, S; Rodriguez Reyes, A; Mora Rios, L; Dueñas-González, A; Taja-Chayeb, L; Moragrega Adame, E

    2018-01-01

    To describe the ultrasound, histopathological and genetic characteristics of uveal melanoma in a Mexican-Mestizo population. A total of 39 enucleated eyes with a histopathological diagnosis of uveal melanoma were assessed by describing the clinical findings, and ultrasound, histopathological and genetic features. A high correlation was observed between tumour height measurement using ultrasound and histopathology. In our cases, tumour size and reflectivity were higher compared with those reported in the literature. The preliminary data on the molecular assessment of the tumours show the presence of an unreported polymorphism (T>C IVS5+34) and one sample with GNAQ mutation (A>C CAA>CCA Gln 209 Pro). Ultrasound is a reliable method to identify the size of the tumour. Furthermore, knowledge of the molecular mechanisms promises new perspectives for the development of new targeted therapeutics. Fortunately this leads to progress in the treatment of patients with metastatic disease or prevents it in those at high risk. Copyright © 2017 Sociedad Española de Oftalmología. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. Genetic structure of Mexican Mestizo women with breast cancer based on three STR loci.

    PubMed

    Calderón-Garcidueñas, Ana L; Rivera-Prieto, Roxana A; Ortíz-Lopez, Rocio; Rivas, Fernando; Barrera-Saldaña, Hugo A; Peñaloza-Espinosa, Rosenda I; Cerda-Flores, Ricardo M

    2008-01-01

    The aim of this population genetics study was to compare the genetic structure of Mexican women with breast cancer (BrCa) with previously reported data of four random populations (Nuevo León, Hispanics, Chihuahua, and Central Region of Mexico). A sample of 115 unrelated women with BrCa and whose four grandparents were born in five zones of Mexico were interviewed at a reference hospital in Northeastern Mexico. Noncodifying STRs D7S820, D13S317, and D16S39 were analyzed; genotype distribution was in agreement with Hardy-Weinberg expectations for all three markers. Similar allele frequencies among four random populations and this selected population were found. According with this and previous studies using molecular and nonmolecular nuclear DNA markers not associated with any disease, Mexican Mestizo population is genetically homogeneous and therefore, genetic causes of BrCa are less heterogeneous, simplifying genetic epidemiologic studies.

  17. Phenotype-genotype analysis of CYP2C19 in Colombian mestizo individuals

    PubMed Central

    Isaza, Carlos; Henao, Julieta; Martínez, José H Isaza; Arias, Juan C Sepúlveda; Beltrán, Leonardo

    2007-01-01

    Background Omeprazole is metabolized by the hepatic cytochrome P450 (CYP) 2C19 enzyme to 5-hydroxyomeprazole. CYP2C19 exhibits genetic polymorphisms responsible for the presence of poor metabolizers (PMs), intermediate metabolizers (IMs) and extensive metabolizers (EMs). The defective mutations of the enzyme and their frequencies change between different ethnic groups; however, the polymorphism of the CYP2C19 gene has not been studied in Colombian mestizos. The aim of this study was to evaluate the genotype and phenotype status of CYP2C19 in Colombian mestizos, in order to contribute to the use of appropriate strategies of drug therapy for this population. Methods 189 subjects were genotyped using the multiplex SNaPshot technique and a subgroup of 44 individuals received 20 mg of omeprazole followed by blood collection at 3 hours to determine the omeprazole hydroxylation index by HPLC. Results 83.6%, 15.3% and 1.1% of the subjects were genotyped as EMs, IMs and PMs, respectively. The frequencies of the CYP2C29*1 and CYP2C19*2 alleles were 91.3% and 8.7% respectively whereas the *3, *4, *5, *6 and *8 alleles were not found. No discrepancies were found between the genotype and phenotype of CYP2C19. Conclusion The frequency of poor metabolizers (1.1%) in the Colombian mestizos included in this study is similar to that in Bolivian mestizos (1%) but lower than in Mexican-Americans (3.2%), West Mexicans (6%), Caucasians (5%) and African Americans (5.4%). The results of this study will be useful for drug dosage recommendations in Colombian mestizos. PMID:17623107

  18. More Evidence for the Genetic Susceptibility of Mexican Population to Nonalcoholic Fatty Liver Disease through PNPLA3.

    PubMed

    Chinchilla-López, Paulina; Ramírez-Pérez, Oscar; Cruz-Ramón, Vania; Canizales-Quinteros, Samuel; Domínguez-López, Aarón; Ponciano-Rodríguez, Guadalupe; Sánchez-Muñoz, Fausto; Méndez-Sánchez, Nahum

    2018-03-01

    The gene for patatin-like phospholipase domain containing 3 (PNPLA3) is associated with nonalcoholic fatty liver disease (NAFLD) development. We previously found that Mexican indigenous population had the highest frequency reported of the PNPLA3 148M risk allele. Further, we observed a relationship between M148M genotype with elevated ALT levels in individuals with normal weight, overweight and obese. We sought to investigate whether PNPLA3 polymorphism is associated with NAFLD development in Mexicans. We enrolled 189 Mexican patients with NAFLD and 201 healthy controls. Anthropometric, metabolic, and biochemical variables were measured, and rs738409 (Ile148Met substitution) polymorphism was genotyped by sequencing. Logistic regression analysis, using a recessive model, suggested that PNPLA3 polymorphism in Mexican population is significantly associated (OR = 1.711, 95% CI: 1.014-2.886; P = 0.044) with NAFLD. The PNPLA3 gene is associated with NAFLD in Mexican population. More studies are required to explain the high prevalence of PNPLA3 polymorphism in Mexican-Americans, Mexican-Indians, and Mexican-Mestizos.

  19. Genetic variations in toll-like receptor 4 in Mexican-Mestizo patients with intra-abdominal infection and/or pneumonia.

    PubMed

    Rodriguez-Osorio, Carlos A; Lima, Guadalupe; Herrera-Caceres, Jaime O; Villegas-Torres, Beatriz E; Zuñiga, Joaquin; Ponce-de-Leon, Sergio; Llorente, Luis; Sifuentes-Osornio, Jose

    2013-06-01

    Sepsis is a leading cause of death around the world, and 73-83% of all sepsis cases requiring attention in intensive care units are linked to intra-abdominal infection (IAI) or pneumonia. The activation of innate immunity is central to the manifestation of sepsis, and toll-like receptor (TLR) 4 plays an important role in this activation process. The 299G and 399I alleles of TLR4 have been linked with an increased risk of Gram-negative bacteria (GNB) infections and septic shock in some populations. This case-control study evaluated the prevalence of D299G/T399I polymorphisms in Mexican patients with IAI and/or pneumonia and in healthy controls. Genotyping revealed that 1 in 44 patients (2.3%; CI 95%: 0.05-12.0%) and 4 in 126 controls (3.2%; CI 95%: 0.9-7.9%) were heterozygous for both the D299G and T399l polymorphisms (OR: 0.71, CI 95%: 0.01-7.44, p = NS), confirming the co-segregation of these alleles in this population. Furthermore, the patients with a GNB infection and severe sepsis were not carriers of the risk alleles. In summary, this report shows that the frequency of the D299G and T399I polymorphisms in Mexican-Mestizos is lower than anticipated in comparison with other ethnic groups, emphasizing the variable distribution of TLR4 polymorphisms among different populations. Consequently, this study was not able to detect associations between TLR4 polymorphisms and sepsis in this population. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Distribution of CYP2D6 and CYP2C19 Polymorphisms Associated with Poor Metabolizer Phenotype in Five Amerindian Groups and Western Mestizos from Mexico

    PubMed Central

    Salazar-Flores, Joel; Torres-Reyes, Luis A.; Martínez-Cortés, Gabriela; Rubi-Castellanos, Rodrigo; Sosa-Macías, Martha; Muñoz-Valle, José F.; González-González, César; Ramírez, Angélica; Román, Raquel; Méndez, José L.; Barrera, Andrés; Torres, Alfredo; Medina, Rafael

    2012-01-01

    Background: The distribution of polymorphisms in the CYP2D6 and CYP2C19 genes allows inferring the potential risk for specific adverse drug reactions and lack of therapeutic effects in humans. This variability shows differences among human populations. The aim of this study was to analyze single-nucleotide polymorphisms related to a poor metabolizer (PM) phenotype in nonpreviously studied Amerindian groups and Mestizos (general admixed population) from Mexico. Methods: We detected by SNaPshot® different polymorphisms located in CYP2D6 (*3, *4, *6, *7, and *8) and CYP2C19 (*2, *3, *4 and *5) in western Mestizos (n=145) and five Amerindian groups from Mexico: Tarahumaras from the North (n=88); Purépechas from the Center (n=101); and Tojolabales (n=68), Tzotziles (n=88), and Tzeltales (n=20) from the Southeast. Genotypes were observed by capillary electrophoresis. The genetic relationships among these populations were estimated based on these genes. Results and Discussion: The wild-type allele (*1) of both genes was predominant in the Mexican populations studied. The most widely observed alleles were CYP2C19*2 (range, 0%–31%) and CYP2D6*4 (range, 1.2%–7.3%), whereas CYP2D6*3 was exclusively detected in Mestizos. Conversely, CYP2C19*4 and *5, as well as CYP2D6*3, *6, *7, and *8, were not observed in the majority of the Mexican populations. The Tarahumaras presented a high frequency of the allele CYP2C19*2 (31%) and of homozygotes *2/*2 (10.7%), which represent a high frequency of potentially PM phenotypes in this Amerindian group. The genetic distances showed high differentiation of Tarahumaras (principally for CYP2C19 gene). In general, a relative proximity was observed between most of the Amerindian, Mexican-Mestizo, and Latin-American populations. Conclusion: In general, the wild-type allele (*1) predominates in Mexican populations, outlining a relatively homogeneous distribution for CYP2C19 and CYP2D6. The exception is the Tarahumara group that displays a potentially increased risk for adverse reactions to CYP2C19-metabolized drugs. PMID:22913530

  1. The C677T polymorphism of the methylenetetrahydrofolate reductase gene in Mexican mestizo neural-tube defect parents, control mestizo and native populations.

    PubMed

    Dávalos, I P; Olivares, N; Castillo, M T; Cantú, J M; Ibarra, B; Sandoval, L; Morán, M C; Gallegos, M P; Chakraborty, R; Rivas, F

    2000-01-01

    The C677T mutation of the methylenetetrahydrofolate reductase (MTHFR) gene, associated with the thermolabile form of the enzyme, has reportedly been found to be increased in neural-tube defects (NTD), though this association is still unclear. A group of 107 mestizo parents of NTD children and five control populations: 101 mestizo (M), 50 Huichol (H), 38 Tarahumara (T), 21 Purepecha (P) and 20 Caucasian (C) individuals were typed for the MTHFR C677T variant by the PCR/RFLP (HinfI) method. Genotype frequencies were in agreement with the Hardy-Weinberg expectations in all six populations. Allele frequency (%) of the C677T variant was 45 in NTD, 44 in M, 56 in H, 36 in T, 57 in P, 35 in C. Pairwise inter-population comparisons of allele frequency disclosed a very similar distribution between NTD and M groups (exact test, P=0.92). Among controls, differences between M and individual native groups were NS (0.06

  2. Contribution of Common Genetic Variation to the Risk of Type 2 Diabetes in the Mexican Mestizo Population

    PubMed Central

    Gamboa-Meléndez, Marco Alberto; Huerta-Chagoya, Alicia; Moreno-Macías, Hortensia; Vázquez-Cárdenas, Paola; Ordóñez-Sánchez, María Luisa; Rodríguez-Guillén, Rosario; Riba, Laura; Rodríguez-Torres, Maribel; Guerra-García, María Teresa; Guillén-Pineda, Luz Elizabeth; Choudhry, Shweta; del Bosque-Plata, Laura; Canizales-Quinteros, Samuel; Pérez-Ortiz, Gustavo; Escobedo-Aguirre, Fernando; Parra, Adalberto; Lerman-Garber, Israel; Aguilar-Salinas, Carlos Alberto; Tusié-Luna, María Teresa

    2012-01-01

    Several studies have identified nearly 40 different type 2 diabetes susceptibility loci, mainly in European populations, but few of them have been evaluated in the Mexican population. The aim of this study was to examine the extent to which 24 common genetic variants previously associated with type 2 diabetes are associated in Mexican Mestizos. Twenty-four single nucleotide polymorphisms (SNPs) in or near genes (KCNJ11, PPARG, TCF7L2, SLC30A8, HHEX, CDKN2A/2B, CDKAL1, IGF2BP2, ARHGEF11, JAZF1, CDC123/CAMK1D, FTO, TSPAN8/LGR5, KCNQ1, THADA, ADAMTS9, NOTCH2, NXPH1, RORA, UBQLNL, and RALGPS2) were genotyped in Mexican Mestizos. A case-control association study comprising 1,027 type 2 diabetic individuals and 990 control individuals was conducted. To account for population stratification, a panel of 104 ancestry-informative markers was analyzed. Association to type 2 diabetes was found for rs13266634 (SLC30A8), rs7923837 (HHEX), rs10811661 (CDKN2A/2B), rs4402960 (IGF2BP2), rs12779790 (CDC123/CAMK1D), and rs2237892 (KCNQ1). In addition, rs7754840 (CDKAL1) was associated in the nonobese type 2 diabetic subgroup, and for rs7903146 (TCF7L2), association was observed for early-onset type 2 diabetes. Lack of association for the rest of the variants may have resulted from insufficient power to detect smaller allele effects. PMID:22923468

  3. The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population.

    PubMed

    Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

    2015-01-01

    The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly- phenotype. Subjects with PPARG2 Ala- phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased.

  4. The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population

    PubMed Central

    Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

    2015-01-01

    The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly− phenotype. Subjects with PPARG2 Ala− phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased. PMID:26185753

  5. Bone mineral density in postmenopausal Mexican-Mestizo women with normal body mass index, overweight, or obesity.

    PubMed

    Méndez, Juan Pablo; Rojano-Mejía, David; Pedraza, Javier; Coral-Vázquez, Ramón Mauricio; Soriano, Ruth; García-García, Eduardo; Aguirre-García, María Del Carmen; Coronel, Agustín; Canto, Patricia

    2013-05-01

    Obesity and osteoporosis are two important public health problems that greatly impact mortality and morbidity. Several similarities between these complex diseases have been identified. The aim of this study was to analyze if different body mass indexes (BMIs) are associated with variations in bone mineral density (BMD) among postmenopausal Mexican-Mestizo women with normal weight, overweight, or different degrees of obesity. We studied 813 postmenopausal Mexican-Mestizo women. A structured questionnaire for risk factors was applied. Height and weight were used to calculate BMI, whereas BMD in the lumbar spine (LS) and total hip (TH) was measured by dual-energy x-ray absorptiometry. We used ANCOVA to examine the relationship between BMI and BMDs of the LS, TH, and femoral neck (FN), adjusting for confounding factors. Based on World Health Organization criteria, 15.13% of women had normal BMI, 39.11% were overweight, 25.96% had grade 1 obesity, 11.81% had grade 2 obesity, and 7.99% had grade 3 obesity. The higher the BMI, the higher was the BMD at the LS, TH, and FN. The greatest differences in size variations in BMD at these three sites were observed when comparing women with normal BMI versus women with grade 3 obesity. A higher BMI is associated significantly and positively with a higher BMD at the LS, TH, and FN.

  6. Forensic parameters for 15 autosomal STRs in Mestizo population from the state of Guerrero (South, Mexico).

    PubMed

    Locia-Aguilar, G J; López-Saucedo, B; Deheza-Bautista, S; Salado-Beltrán, O V; Martínez-Sevilla, V M; Rangel-Villalobos, H

    2018-03-31

    Allele distribution and forensic parameters were estimated for 15 STR loci (AmpFlSTR Identifiler kit) in 251 Mexican-Mestizos from the state of Guerrero (South, Mexico). Genotype distribution was in agreement with Hardy-Weinberg expectations for all 15 STRs. Similarly, linkage disequilibrium test demonstrated no association between pair of loci. The power of exclusion and power of discrimination values were 99.999634444% and >99.99999999%, respectively. Genetic relationship analysis regarding Mestizo populations from the main geographic regions of Mexico suggests that the Center and the present South regions conform one population cluster, separated from the Southeast and Northwest regions. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Tailoring Nutritional Advice for Mexicans Based on Prevalence Profiles of Diet-Related Adaptive Gene Polymorphisms

    PubMed Central

    Ojeda-Granados, Claudia; Panduro, Arturo; Gonzalez-Aldaco, Karina; Sepulveda-Villegas, Maricruz; Rivera-Iñiguez, Ingrid

    2017-01-01

    Diet-related adaptive gene (DRAG) polymorphisms identified in specific populations are associated with chronic disorders in carriers of the adaptive alleles due to changes in dietary and lifestyle patterns in recent times. Mexico’s population is comprised of Amerindians (AM) and Mestizos who have variable AM, European (EUR) and African genetic ancestry and an increased risk of nutrition-related chronic diseases. Nutritional advice based on the Mexican genome and the traditional food culture is needed to develop preventive and therapeutic strategies. Therefore, we aimed to provide a prevalence profile of several DRAG polymorphisms in the Mexican population, including Central West (CW) Mexico subpopulations. Geographic heat maps were built using ArcGIS10 (Esri, Redlands, CA, USA) software, based on the published data of the MTHFR C677T (rs1801133), ABCA1 Arg230Cys (rs9282541), APOE T388C (rs429358)/C526T (rs7412), LCT C-13910T (rs4988235) polymorphisms and AMY1 copy number variation (CNV). Also, new data obtained by allelic discrimination-real-time polymerase chain reaction (RT-PCR) assays for the MTHFR, ABCA1, and APOE polymorphisms as well as the AMY1 CNV in the CW Mexico subpopulations with different proportions of AM and EUR ancestry were included. In the CW region, the highest frequency of the MTHFR 677T, ABCA1 230C and APOE ε4 adaptive alleles was observed in the AM groups, followed by Mestizos with intermediate AM ancestry. The LCT-13910T allele frequency was highest in Mestizos-EUR but extremely low in AM, while the AMY1 diploid copy number was 6.82 ± 3.3 copies. Overall, the heat maps showed a heterogeneous distribution of the DRAG polymorphisms, in which the AM groups revealed the highest frequencies of the adaptive alleles followed by Mestizos. Given these genetic differences, genome-based nutritional advice should be tailored in a regionalized and individualized manner according to the available foods and Mexican traditional food culture that may lead to a healthier dietary pattern. PMID:29125573

  8. Peritoneal dialysis in Mexico.

    PubMed

    Cueto-Manzano, Alfonso M

    2003-02-01

    While Mexico has the thirteenth largest economy, a large portion of the population is impoverished. About 90% of the population is Mestizo, the result of the admixture of Mexican Indians and Spaniards, with the Indigenous peoples concentrated in the southeastern region. Treatment for end-stage renal disease (estimated 268 patients per million population) is largely determined by the limited healthcare system and the individual's access to resources such as private insurance ( approximately 15%) and governmental sources ( approximately 85%). With only 5% of the gross national product spent on healthcare and most treatment providers being public health institutions that are often under severe economic restrictions, it is not surprising that many Mexican patients do not receive renal replacement therapy. Mexico uses proportionately more peritoneal dialysis than other countries; 1% of the patients are on automated peritoneal dialysis, 19% on hemodialysis and 80% on CAPD. Malnutrition and diabetes, important risk factors for poor outcome, are prevalent among the patients in CAPD programs.

  9. Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

    PubMed

    Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

    2012-01-01

    Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

  10. Genetic structure of Mexican Mestizos with type 2 diabetes mellitus based on three STR loci.

    PubMed

    Cerda-Flores, Ricardo M; Rivera-Prieto, Roxana A; Pereyra-Alférez, Benito; Calderón-Garcidueñas, Ana L; Barrera-Saldaña, Hugo A; Gallardo-Blanco, Hugo L; Ortiz-López, Rocío; Flores-Peña, Yolanda; Cárdenas-Villarreal, Velia M; Rivas, Fernando; Figueroa, Andrés; Kshatriya, Gautam

    2013-08-01

    The aims of this population genetics study were: 1) to ascertain whether Mexicans with type 2 diabetes mellitus (DM) were genetically homogeneous and 2) to compare the genetic structure of this selected population with the previously reported data of four random populations (Nuevo León, Hispanics, Chihuahua, and Central Region of Mexico). A sample of 103 unrelated individuals with DM and whose 4 grandparents were born in five zones of Mexico was interviewed in 32 Medical Units in the Mexican Institute of Social Security (IMSS). The non-coding STRs D16S539, D7S820, and D13S317 were analyzed. Genotype distribution was in agreement with Hardy-Weinberg expectations for all three markers. Allele frequencies were found to be similar between the selected population and the four random populations. Gene diversity analysis suggested that more than 99.57% of the total gene diversity could be attributed to variation between individuals within the population and 0.43% between the populations. According to the present and previous studies using molecular and non-molecular nuclear DNA markers not associated with any disease, the Mexican Mestizo population is found to be genetically homogeneous and therefore the genetic causes of DM are less heterogeneous, thereby simplifying genetic epidemiological studies as has been found in a previous study with the same design in Mexican women with breast cancer. Published by Elsevier B.V.

  11. Aldehyde dehydrogenase polymorphism in North American, South American, and Mexican Indian populations.

    PubMed Central

    Goedde, H W; Agarwal, D P; Harada, S; Rothhammer, F; Whittaker, J O; Lisker, R

    1986-01-01

    While about 40% of the South American Indian populations (Atacameños, Mapuche, Shuara) were found to be deficient in aldehyde dehydrogenase isozyme I (ALDH2 or E2), preliminary investigations showed very low incidence of isozyme deficiency among North American natives (Sioux, Navajo) and Mexican Indians (mestizo). Possible implications of such trait differences on cross-cultural behavioral response to alcohol drinking are discussed. PMID:3953578

  12. CFH haplotypes and ARMS2, C2, C3, and CFB alleles show association with susceptibility to age-related macular degeneration in Mexicans

    PubMed Central

    Zenteno, Juan Carlos; Fernández-López, Juan Carlos; Rodríguez-Corona, Ulises; Falfán-Valencia, Ramcés; Sebastian, Leticia; Morales, Fabiola; Ochoa-Contreras, Daniel; Carnevale, Alessandra; Silva-Zolezzi, Irma

    2014-01-01

    Purpose To evaluate the contribution of genetic variants of complement factor H (CFH), complement component 2 and 3 (C2 and C3), complement factor B (CFB), and age-related maculopathy susceptibility 2 (ARMS2) to age-related macular degeneration (AMD) risk in the Mexican Mestizo population. Methods Analysis included 282 unrelated Mexican patients with advanced AMD, 205 healthy controls, and 280 population controls. Stereoscopic fundus images were graded on the Clinical Age-Related Maculopathy System (CARMS). We designed a resequencing strategy using primers with M13 adaptor for the 23 exons of the CFH gene in a subgroup of 96 individuals clinically evaluated: 48 AMD cases and 48 age- and sex-matched healthy controls. Single nucleotide polymorphisms (SNPs) in C3 (Arg80Gly and Pro292Leu), C2 (rs547154), CFB (Leu9His), and ARMS2 (Ala69Ser) were genotyped in all patients, healthy and population controls using TaqMan assay. Results All evaluated individuals were Mexican Mestizos, and their genetic ancestry was validated using 224 ancestry informative markers and calculating Fst values. The CFH resequencing revealed 19 SNPs and a common variant in the intron 2 splice acceptor site; three CFH haplotypes inferred from individual genotypes, showed significant differences between cases and controls. The risk alleles in C3 (rs1047286, odds ratio [OR]=2.48, 95% confidence interval [CI]=1.64–3.75, p=1.59E-05; rs2230199, OR=2.15, 95% CI=1.48–3.13, p=6.28E-05) and in ARMS2 (rs10490924, OR=3.09, 95% CI=2.48–3.86, p=5.42E-23) were strongly associated with risk of AMD. The protective effect of alleles in C2 (rs547154) and CFB (rs4151667) showed a trend but was not significantly associated after correction for multiple testing. Conclusions Our results show that ARMS2 and C3 are major contributors to advanced AMD in Mexican patients, while the contributions of CFH, C2, and CFB are minor to those of other populations, reveling significant ethnic differences in minor allele frequencies. We provide evidence that two specific common haplotypes in the CFH gene predispose individuals to AMD, while another may confer reduced risk of disease in this admixed population. PMID:24453474

  13. Calpain-10 gene polymorphisms and risk of type 2 diabetes mellitus in Mexican mestizos.

    PubMed

    Picos-Cárdenas, V J; Sáinz-González, E; Miliar-García, A; Romero-Zazueta, A; Quintero-Osuna, R; Leal-Ugarte, E; Peralta-Leal, V; Meza-Espinoza, J P

    2015-03-27

    The calpain-10 gene is expressed primarily in tissues important in glucose metabolism; thus, some of its polymorphisms have been associated with type 2 diabetes. In this study, we examined the association between the calpain-10 single-nucleotide polymorphism (SNP)-43, SNP-19, and SNP-63 and type 2 diabetes in Mexican mestizos. We included 211 patients and 152 non-diabetic subjects. Polymerase chain reaction was used to identify alleles. We compared allele, genotype, haplotype, and diplotype frequencies between both groups and used the chi-square test to calculate the risk. The allele frequency of SNP-43 allele 1 was 70% in controls and 72% in patients; the GG, GA, and AA genotype frequencies were 48.7, 42.8, and 8.5% in controls and 51.2, 41.7, and 7.1% in patients, respectively. For SNP- 19, the prevalence of allele 1 (2R) was 32% in controls and 39% in patients. In controls, homozygosity (2R/2R) was 10.5%, heterozygosity was 42.8%, and 3R/3R was 46.7%; in cases, these values were 13.3, 50.7, and 36.0%, respectively. For SNP-63, the frequency of allele 1 was 87% in controls and 83% in patients; genotype frequencies in controls were 75.7% (CC), 23% (CT), and 1.3% (TT), and were 69.7, 27.5, and 2.8%, respectively for the cases. Genotype distributions were consistent with Hardy-Weinberg equilibrium. No significant intergroup differences for allele, genotype, haplotype, or diplotype frequencies were observed. We found no association between these polymorphisms and diabetes. However, our sample size was small, so the role of calpain-10 risk alleles should be further examined.

  14. Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components

    PubMed Central

    Martínez-Hernández, Angélica; Córdova, Emilio J.; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

    2015-01-01

    Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals. PMID:25933176

  15. Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components.

    PubMed

    Martínez-Hernández, Angélica; Córdova, Emilio J; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

    2015-01-01

    Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals.

  16. Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

    PubMed

    González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

    2013-07-30

    We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

  17. Disparities in stroke type and vascular risk factors between 2 Hispanic populations in Miami and Mexico city.

    PubMed

    Romano, Jose G; Arauz, Antonio; Koch, Sebastian; Dong, Chuanhui; Marquez, Juan M; Artigas, Carol; Merlos, Marlon; Hernandez, Bernardo; Roa, Luis F; Rundek, Tatjana; Sacco, Ralph L

    2013-08-01

    The heterogeneous nature and determinants of stroke among different Hispanic groups was examined by comparing hospitalized Hispanic stroke patients in Miami, where the Hispanic population is largely of Caribbean origin, to a Mestizo population in Mexico City. Consecutive Hispanic patients who were admitted with stroke or transient ischemic attack (TIA) and included in the prospective stroke registries of 2 tertiary care teaching hospitals were studied. Demographic factors, stroke subtypes, vascular risk factors, stroke severity, and outcomes were compared. Vascular risk factor definitions were standardized. A total of 928 patients (520 Mexicans and 408 Miami Hispanics) were analyzed. Mexicans were younger, with a greater proportion of women. More cerebral venous thromboses (CVTs) were admitted in Mexico, while TIA and stroke mimics were more commonly admitted in Miami; cardioembolic strokes were more commonly ascertained in Miami, and more cryptogenic strokes in Mexico. Stroke severity was similar for intracerebral hemorrhages, but more severe ischemic strokes and CVTs were included in the Mexican registry. Outcome at 1 and 3 months was similar in both registries after adjusting for age and baseline stroke severity. After adjusting for age and sex, hypertension, dyslipidemia, and atrial fibrillation were more frequent, and diabetes mellitus was less frequent, among Miami Hispanics compared to Mexicans. We found significant differences in the frequency of hypertension, diabetes, dyslipidemia, and atrial fibrillation in Miami Hispanics and Mexican stroke patients, highlighting the heterogeneity of the Hispanic ethnic group. Future studies are needed to clarify the relative contribution of genetic and environmental disparities amongst Mexican and Caribbean Hispanic stroke patients. Copyright © 2013 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  18. IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

    PubMed

    Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

    2016-01-01

    In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

  19. Mexico: The Crisis of Identity.

    ERIC Educational Resources Information Center

    Ewen, Alexander

    1994-01-01

    Examines the place of Indian people in Mexican society and politics, from the conquest to the 1994 Zapatista uprising in Chiapas (fueled by the threat to rural indigenous communal lands posed by economic reforms). Although Indianness is celebrated as contributing to the idealized mestizo "race," self-identification as Indian threatens…

  20. Teaching English Critically to Mexican Children

    ERIC Educational Resources Information Center

    López-Gopar, Mario E.

    2014-01-01

    The purpose of this article is to present one significant part of a large-scale critical-ethnographic-action-research project (CEAR Project) carried out in Oaxaca, Mexico. The overall CEAR Project has been conducted since 2007 in different Oaxacan elementary schools serving indigenous and mestizo (mixed-race) children. In the CEAR Project, teacher…

  1. Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population

    PubMed Central

    Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

    2017-01-01

    Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (KATP). Single nucleotide polymorphisms (SNPs) of the KATP coding genes, potassium voltage-gated channel subfamily J member 11 (KCNJ11) and ATP binding cassette subfamily C member 8 (ABCC8) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (−3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0.397, TT=0.097; 95% confidence interval (CI); P≤0.05]; except for South Asian and Iberian populations, which may reflect the admixture origins of the present Mexican population. This genetic similarity has not been observed in the other Latin-American groups. To the best of our knowledge, this is the first study of ABCC8 rs757110 and rs1799854 SNP frequencies in any Mexican population and, specifically with diabetic Mexicans. Knowledge of the genetic structure of different populations is key to understanding the interindividual responses to drugs, such as SU and whether genotypic differences affect clinical outcome. PMID:28685055

  2. Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population.

    PubMed

    Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

    2017-07-01

    Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (K ATP ). Single nucleotide polymorphisms (SNPs) of the K ATP coding genes, potassium voltage-gated channel subfamily J member 11 ( KCNJ11 ) and ATP binding cassette subfamily C member 8 ( ABCC8 ) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (-3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0.397, TT=0.097; 95% confidence interval (CI); P≤0.05]; except for South Asian and Iberian populations, which may reflect the admixture origins of the present Mexican population. This genetic similarity has not been observed in the other Latin-American groups. To the best of our knowledge, this is the first study of ABCC8 rs757110 and rs1799854 SNP frequencies in any Mexican population and, specifically with diabetic Mexicans. Knowledge of the genetic structure of different populations is key to understanding the interindividual responses to drugs, such as SU and whether genotypic differences affect clinical outcome.

  3. Association of Lactase Persistence Genotypes with High Intake of Dairy Saturated Fat and High Prevalence of Lactase Non-Persistence among the Mexican Population.

    PubMed

    Ojeda-Granados, Claudia; Panduro, Arturo; Rebello Pinho, João Renato; Ramos-Lopez, Omar; Gleyzer, Ketti; Malta, Fernanda de Mello; Gonzalez-Aldaco, Karina; Roman, Sonia

    2016-01-01

    Lactase (LCT) -13910 C>T and -22018 G>A polymorphisms associated with the lactase non-persistence (LNP)/persistence (LP) phenotypes vary globally. LP has been associated with obesity in Europeans. However, it has not been genetically evaluated in Mexico, a country with admixed population, recent introduction of dairy, and a high prevalence of obesity. Thus, we aimed to determine the distribution of the LCT polymorphisms and their association with the nutritional profile of West Mexico's populations. Genotyping of 1,196 individuals (natives and mestizos) was carried out by a Taqman allelic discrimination assay. Descriptive statistics and interpopulation analyzes were performed by SPSS, Arlequin, and Structure software. Demographic, anthropometric, biochemical and dietary data were analyzed in 212 mestizos. LNP genotypes mainly prevailed (CC 68.7% and GG 68.2%); both predominated in native Huicholes and Nahuas (>97.7%). Among the mestizos, the LP genotypes were associated with a higher intake of saturated fat (9.9 ± 3.9% vs. 8.5 ± 4.0%, p = 0.018; OR = 2.55, 95% CI 1.29-5.03, p = 0.006) and a daily/more frequent consumption of dairy (88.8 vs. 78.0%; p = 0.049) than LNP genotypes. The LNP trait was predominant in Mexicans with a major Amerindian ancestry. A daily consumption of dairy was associated with a higher intake of saturated fat in LP individuals. © 2016 S. Karger AG, Basel.

  4. Susceptibility background for type 2 diabetes in eleven Mexican Indigenous populations: HNF4A gene analysis.

    PubMed

    Granados-Silvestre, M A; Ortiz-López, M G; Granados, J; Canizales-Quinteros, S; Peñaloza-Espinosa, Rosenda I; Lechuga, C; Acuña-Alonzo, V; Sánchez-Pozos, K; Menjivar, M

    2017-12-01

    The genetic risk of developing type 2 diabetes (T2D) increases in parallel with the proportion of Native American ancestry. Mestizo Mexicans have a 70% Native Amerindian genetic background. The T130I polymorphism in the HNF4A gene has been associated with early-onset T2D in mestizo Mexicans. Thus, the aim of the present study was to evaluate the frequency and relationship of the T130I variant in the HNF4A gene with risk factors for developing T2D in eleven indigenous groups from Mexico. In two groups, all exons of the HNF4A gene were directly sequenced; in the remaining the T130I polymorphism was analyzed by restriction fragment length polymorphism. Ancestry informative markers were assessed to confirm the Amerindian component. An additional analysis of EHH was carried out. Interestingly, HNF4A gene screening revealed only the presence of the T130I polymorphism. The range frequency of the risk allele (T) in the indigenous groups was from 2.7 to 16%. Genotypic frequencies (T130I/I130I) were higher and significantly different from those of all of the populations included in the HapMap Project (P < 0.005). EHH scores suggest a positive selection for T130I polymorphism. Metabolic traits indicate a relationship between the T130I/I130I genotypes with high triglyceride concentrations in the indigenous groups (P < 0.005). These results strongly suggest that the high frequency of the T130I polymorphism and its biological relationship with dysfunction in lipid metabolism in Mexican indigenous groups is a risk factor for the developing of T2D in Mexicans.

  5. Hepatitis B virus infection in Latin America: A genomic medicine approach

    PubMed Central

    Roman, Sonia; Jose-Abrego, Alexis; Fierro, Nora Alma; Escobedo-Melendez, Griselda; Ojeda-Granados, Claudia; Martinez-Lopez, Erika; Panduro, Arturo

    2014-01-01

    Hepatitis B virus (HBV) infection is the leading cause of severe chronic liver disease. This article provides a critical view of the importance of genomic medicine for the study of HBV infection and its clinical outcomes in Latin America. Three levels of evolutionary adaptation may correlate with the clinical outcomes of HBV infection. Infections in Latin America are predominantly of genotype H in Mexico and genotype F in Central and South America; these strains have historically circulated among the indigenous population. Both genotypes appear to be linked to a benign course of disease among the native and mestizo Mexicans and native South Americans. In contrast, genotypes F, A and D are common in acute and chronic infections among mestizos with Caucasian ancestry. Hepatocellular carcinoma is rare in Mexicans, but it has been associated with genotype F1b among Argentineans. This observation illustrates the significance of ascertaining the genetic and environmental factors involved in the development of HBV-related liver disease in Latin America, which contrast with those reported in other regions of the world. PMID:24966588

  6. Association between -174G/C and -572G/C interleukin 6 gene polymorphisms and severe radiographic damage to the hands of Mexican patients with rheumatoid arthritis: a preliminary report.

    PubMed

    Zavaleta-Muñiz, S A; Gonzalez-Lopez, L; Murillo-Vazquez, J D; Saldaña-Cruz, A M; Vazquez-Villegas, M L; Martín-Márquez, B T; Vasquez-Jimenez, J C; Sandoval-Garcia, F; Ruiz-Padilla, A J; Fajardo-Robledo, N S; Ponce-Guarneros, J M; Rocha-Muñoz, A D; Alcaraz-Lopez, M F; Cardona-Müller, D; Totsuka-Sutto, S E; Rubio-Arellano, E D; Gamez-Nava, J I

    2016-12-19

    Several interleukin 6 gene (IL6) polymorphisms are implicated in susceptibility to rheumatoid arthritis (RA). It has not yet been established with certainty if these polymorphisms are associated with the severe radiographic damage observed in some RA patients, particularly those with the development of joint bone ankylosis (JBA). The objective of the present study was to evaluate the association between severe radiographic damage in hands and the -174G/C and -572G/C IL6 polymorphisms in Mexican Mestizo people with RA. Mestizo adults with RA and long disease duration (>5 years) were classified into two groups according to the radiographic damage in their hands: a) severe radiographic damage (JBA and/or joint bone subluxations) and b) mild or moderate radiographic damage. We compared the differences in genotype and allele frequencies of -174G/C and -572G/C IL6 polymorphisms (genotyped using polymerase chain reaction-restriction fragment length polymorphism) between these two groups. Our findings indicated that the -174G/C polymorphism of IL6 is associated with severe joint radiographic damage [maximum likelihood odds ratios (MLE_OR): 8.03; 95%CI 1.22-187.06; P = 0.03], whereas the -572G/C polymorphism of IL6 exhibited no such association (MLE_OR: 1.5; 95%CI 0.52-4.5; P = 0.44). Higher anti-cyclic citrullinated peptide antibody levels were associated with more severe joint radiographic damage (P = 0.04). We conclude that there is a relevant association between the -174G/C IL6 polymorphism and severe radiographic damage. Future studies in other populations are required to confirm our findings.

  7. [Polymorphism g.37190613 G>A of the ELMO1 gene in the Mexican population: potential marker for clinical-surgical pathology].

    PubMed

    Topete-González, Luz Rosalba; Ramirez-Garcia, Sergio Alberto; Charles-Niño, Claudia; Villa-Ruano, Nemesio; Mosso-González, Clemente; Dávalos-Rodríguez, Nory Omayra

    2014-01-01

    ELMO1 is a gene located at locus 7p14.2-14.1 that codifies a regulatory protein involved in fibrogenesis, cell migration, phagocytosis and apoptosis. This gene presents a single nucleotide polymorphism, which appears to be linked with the development of diabetic nephropathy. Currently, there are no studies in regard to the presence of such polymorphism in the Mexican population. Therefore, the aim of this work was to estimate the frequency rate of alleles and genotypes of polymorphism rs1345365 from ELMO1 in Mexican mestizos who inhabit the west and the southeast regions of Mexico in order to generate reliable data for further association studies. There were 322 individuals who were screened for the identification of polymorphism rs1345365 using genomic DNA from leucocytes as a template for PCR-PASA reactions. Amplicons were separated in 7% PAGE and visualized after staining with silver nitrate. The reference allele (A) was the most frequent in both western and southeastern populations of Mexico. In addition, a different genotype distribution was found with respect to other populations. The results of this study indicate that both populations are in Hardy-Weinberg equilibrium. This study also reveals a low frequency rate of the ancestral genotype for the polymorphism rs1345365 in mestizos from the western and southeastern regions of Mexico.

  8. Analysis of Polymorphisms in Genes (AGT, MTHFR, GPIIIa, and GSTP1) Associated with Hypertension, Thrombophilia and Oxidative Stress in Mestizo and Amerindian Populations of México

    PubMed Central

    Juárez-Velázquez, Rocio; Canto, Patricia; Canto-Cetina, Thelma; Rangel-Villalobos, Hector; Rosas-Vargas, Haydee; Rodríguez, Maricela; Canizales-Quinteros, Samuel; Velázquez Wong, Ana Claudia; Ordoñez-Razo, Rosa María; Vilchis-Dorantes, Guadalupe; Coral-Vázquez, Ramón Mauricio

    2010-01-01

    Several polymorphisms related to hypertension, thrombophilia, and oxidative stress has been associated with the development of cardiovascular disease. We analyzed the frequency of M235T angiotensinogen (AGT), A222V 5,10 methylenete-trahydrofolate reductase (MTHFR), L33P glycoprotein IIIa (GPIIIa), and I105V glutathione S-transferase P1 (GSTP1) polymorphisms in 285 individuals belonging to Mexican-Mestizo and five Amerindian population from México, by real time PCR allelic discrimination. Allele and genotype frequencies were compared using χ2 tests. All populations followed the Hardy Weinberg equilibrium for assay markers with the exception of the Triki, whose were in Hardy Weinberg dysequilibrium for the glutathione S-transferase P1 polymorphism. Interestingly, according to all the analyzed single nucleotide polymorphisms (SNPs), the Triki population was the most differentiated and homogeneous group of the six populations analyzed. A comparison of our data with those previously published for some Caucasian, Asian and Black populations showed quite significant differences. These differences were remarkable with all the Mexican populations having a lower frequency of the 105V allele of the glutathione S-transferase P1 and reduced occurrence of the 222A allele of the 5,10 methylenetetrahydrofolate reductase. Our results show the genetic diversity among different Mexican populations and with other racial groups. PMID:20592457

  9. Tetany caused by chronic diarrhea in a child with celiac disease: A case report

    PubMed Central

    Hurtado-Valenzuela, Jaime Gabriel; Sotelo-Cruz, Norberto; López-Cervantes, Guillermo; de la Barca, Ana María Calderón

    2008-01-01

    There is no awareness about celiac disease (CD) in Mexico. A 2.9 year old mestizo boy was admitted to a Mexican hospital with muscle cramps and fine tremors. He suffered chronic diarrhea, abdominal distention, hypotrophic limbs, stunting and wasting, and presented hypocalcemia, anemia and high titers of serological markers. Diagnosis of CD was confirmed by a duodenal biopsy. After replacement of calcium and a gluten-free diet, the symptoms resolved within 6 weeks. After 2-months, serum analyses, anthropometric data as well as antibodies titers were normal after 4 years. CD screening tests are needed in chronic diarrhea for any ethnicity patients. PMID:18811963

  10. Association between STR -794 CATT5-8 and SNP -173 G/C polymorphisms in the MIF gene and Lepromatous Leprosy in Mestizo patients of western Mexico.

    PubMed

    Martinez-Guzman, M A; Alvarado-Navarro, A; Pereira-Suarez, A L; Muñoz-Valle, J F; Fafutis-Morris, M

    2016-10-01

    Lepromatous Leprosy (LL) is the most common presentation of leprosy in Mexico. LL patients are unable to activate an effective inflammatory response against Mycobacterium leprae probably due to the genetics of the host. Macrophage Migration Inhibitory Factor (MIF) is important to trigger inflammation processes. Two polymorphisms have been reported for human MIF: STR -794 CATT5-8 and SNP -173 G/C. 7-8 CATT repeats at -794 and the C allele at -173 increase the expression of MIF. We aim to determine the association between the polymorphisms in MIF gene and LL. We carried a case and controls study with 100 Mexican LL patients and 100 healthy subjects (HS). PCR was used for genotyping of STR -794 CATT5-8 polymorphism and PCR-RFLP for -173 G/C. We found that LL patients possess high -794 CATT repeats (47.1%) more often than HS (32.7%). In conclusion, a MIF polymorphism is associated with susceptibility to LL in Western Mexican population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  11. HLA Alleles are Genetic Markers for Susceptibility and Resistance towards Leprosy in a Mexican Mestizo Population.

    PubMed

    Aguilar-Medina, Maribel; Escamilla-Tilch, Monica; Frías-Castro, Luis Octavio; Romero-Quintana, Geovanni; Estrada-García, Iris; Estrada-Parra, Sergio; Granados, Julio; Arambula Meraz, Eliakym; Sánchez-Schmitz, Guzman; Khader, Shabaana Abdul; Rangel-Moreno, Javier; Ramos-Payán, Rosalío

    2017-01-01

    Despite the use of multidrug therapy, leprosy remains endemic in some countries. The association of several human leucocyte antigen (HLA) alleles and gene polymorphisms with leprosy has been demonstrated in many populations, but the major immune contributors associated to the spectrum of leprosy have not been defined yet. In this study, genotyping of HLA-A, -B, -DR, and -DQ alleles was performed in leprosy patients (n = 113) and control subjects (n = 117) from the region with the highest incidence for the disease in México. The odds of developing leprosy and lepromatous subtype were 2.12- and 2.74-fold higher in carriers of HLA-A*28, and 2.48- and 4.14-fold higher for leprosy and dimorphic subtype in carriers of DQB1*06. Interestingly, DQB1*07 was overrepresented in healthy individuals, compared to patients with leprosy (OR = 0.08) and the lepromatous subtype (OR = 0.06). These results suggest that HLA-A*28 is a marker for predisposition to leprosy and the lepromatous subtype and DQB1*06 to leprosy and the dimorphic subtype, while DQB1*07 might be a resistance marker in this Mestizo population. © 2016 John Wiley & Sons Ltd/University College London.

  12. Present status and perspective of pharmacogenetics in Mexico.

    PubMed

    Cuautle-Rodríguez, Patricia; Llerena, Adrián; Molina-Guarneros, Juan

    2014-01-01

    Drug costs account for up to 24% of the country's health expenditure and there are 13,000 registered drugs being prescribed. Diabetes is the main cause of death in the country, with over 85% of diabetic patients currently under drug treatment. The importance of knowing interindividual variability in drug metabolism on Mexican populations is thus evident. The purpose of this article is to provide an overlook of the current situation of pharmacogenetic research in Mexico, focusing on drug-metabolizing enzymes, and the possibility of developing a phenotyping cocktail for Mexican populations. So far, 21 pharmacogenetic studies on Mexican population samples (Mestizos and Amerindian) have been published. These have reported interindividual variability through phenotyping and/or genotyping cytochromes: CYP2D6, 2C19, 2C9, 2E1, and phase II enzymes UGT and NAT2. Some cytochromes with important clinical implications have not yet been phenotyped in Mexican populations. The development of a cocktail adapted to them could be a significant contribution to a larger knowledge on drug response variability at a lower price and shorter time. There are validated phenotyping cocktails that present several practical advantages, being valuable, safe, and inexpensive tools in drug metabolism characterization, which require only a single experiment to provide information on several cytochrome activities.

  13. Whole Genome Sequence and Phylogenetic Analysis Show Helicobacter pylori Strains from Latin America Have Followed a Unique Evolution Pathway

    PubMed Central

    Muñoz-Ramírez, Zilia Y.; Mendez-Tenorio, Alfonso; Kato, Ikuko; Bravo, Maria M.; Rizzato, Cosmeri; Thorell, Kaisa; Torres, Roberto; Aviles-Jimenez, Francisco; Camorlinga, Margarita; Canzian, Federico; Torres, Javier

    2017-01-01

    Helicobacter pylori (HP) genetics may determine its clinical outcomes. Despite high prevalence of HP infection in Latin America (LA), there have been no phylogenetic studies in the region. We aimed to understand the structure of HP populations in LA mestizo individuals, where gastric cancer incidence remains high. The genome of 107 HP strains from Mexico, Nicaragua and Colombia were analyzed with 59 publicly available worldwide genomes. To study bacterial relationship on whole genome level we propose a virtual hybridization technique using thousands of high-entropy 13 bp DNA probes to generate fingerprints. Phylogenetic virtual genome fingerprint (VGF) was compared with Multi Locus Sequence Analysis (MLST) and with phylogenetic analyses of cagPAI virulence island sequences. With MLST some Nicaraguan and Mexican strains clustered close to Africa isolates, whereas European isolates were spread without clustering and intermingled with LA isolates. VGF analysis resulted in increased resolution of populations, separating European from LA strains. Furthermore, clusters with exclusively Colombian, Mexican, or Nicaraguan strains were observed, where the Colombian cluster separated from Europe, Asia, and Africa, while Nicaraguan and Mexican clades grouped close to Africa. In addition, a mixed large LA cluster including Mexican, Colombian, Nicaraguan, Peruvian, and Salvadorian strains was observed; all LA clusters separated from the Amerind clade. With cagPAI sequence analyses LA clades clearly separated from Europe, Asia and Amerind, and Colombian strains formed a single cluster. A NeighborNet analyses suggested frequent and recent recombination events particularly among LA strains. Results suggests that in the new world, H. pylori has evolved to fit mestizo LA populations, already 500 years after the Spanish colonization. This co-adaption may account for regional variability in gastric cancer risk. PMID:28293542

  14. [C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

    PubMed

    Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

    2017-01-01

    Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

  15. Genetic variants in COL13A1, ADIPOQ and SAMM50, in addition to the PNPLA3 gene, confer susceptibility to elevated transaminase levels in an admixed Mexican population.

    PubMed

    Larrieta-Carrasco, Elena; Flores, Yvonne N; Macías-Kauffer, Luis R; Ramírez-Palacios, Paula; Quiterio, Manuel; Ramírez-Salazar, Eric G; León-Mimila, Paola; Rivera-Paredez, Berenice; Cabrera-Álvarez, Guillermo; Canizales-Quinteros, Samuel; Zhang, Zuo-Feng; López-Pérez, Tania V; Salmerón, Jorge; Velázquez-Cruz, Rafael

    2018-02-01

    Non-alcoholic fatty liver disease (NAFLD) is the accumulation of extra fat in liver cells not caused by alcohol. Elevated transaminase levels are common indicators of liver disease, including NAFLD. Previously, we demonstrated that PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), and GCKR (rs780094) are associated with elevated transaminase levels in overweight/obese Mexican adults. We investigated the association between 288 SNPs identified in genome-wide association studies and risk of elevated transaminase levels in an admixed Mexican-Mestizo sample of 178 cases of NAFLD and 454 healthy controls. The rs2896019, rs12483959, and rs3810622 SNPs in PNPLA3 and rs1227756 in COL13A1 were associated with elevated alanine aminotransferase (ALT, ≥40IU/L). A polygenic risk score (PRS) based on six SNPs in the ADIPOQ, COL13A1, PNPLA3, and SAMM50 genes was also associated with elevated ALT. Individuals carrying 9-12 risk alleles had 65.8% and 48.5% higher ALT and aspartate aminotransferase (AST) levels, respectively, than those with 1-4 risk alleles. The PRS showed the greatest risk of elevated ALT levels, with a higher level of significance than the individual variants. Our findings suggest a significant association between variants in COL13A1, ADIPOQ, SAMM50, and PNPLA3, and risk of NAFLD/elevated transaminase levels in Mexican adults with an admixed ancestry. This is the first study to examine high-density single nucleotide screening for genetic variations in a Mexican-Mestizo population. The extent of the effect of these variations on the development and progression of NAFLD in Latino populations requires further analysis. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Hernan Cortes; Conquistador and Colonizer. The Tinker Pamphlet Series for the Teaching of Mexican American Heritage.

    ERIC Educational Resources Information Center

    Miller, Hubert J.

    The conquest and colonization of Mexico initiated by Hernan Cortes resulted in the fusion of the Indian and Hispanic cultures. This fusion led to the "mestizo" culture. Cortes was the bearer of the Hispanic heritage just as the Aztecs and other Indians in Mexico and the Southwest were the carriers of the Indian heritage. In studying the…

  17. Lack of Association of the Polymorphisms IL-17A (−197G/A) and IL-17F (+7488A/G) with Multibacillary Leprosy in Mexican Patients

    PubMed Central

    Escamilla-Tilch, Mónica; Estrada-García, Iris; Granados, Julio; Arenas-Guzmán, Roberto; Ramos-Payan, Rosalio; Pérez-Suárez, Thalía Gabriela; Salazar, Ma. Isabel; Pérez-Lucas, Riky Luis; Estrada-Parra, Sergio; Torres-Carrillo, Nora Magdalena

    2014-01-01

    Background. Leprosy is a chronic infectious disease caused by the intracellular acid-fast bacilli Mycobacterium leprae; it has been determined that genetic factors of the host play an important role in the disease susceptibility. Thus, in this case-control study, we evaluated the possible association between the IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs and susceptibility to leprosy disease in Mexican population. Methods. Seventy-five leprosy patients and sixty-nine control subjects were included. Both SNPs were genotyped with the polymerase chain reaction-restriction fragment length polymorphism technique. Results. We found nonsignificant differences in genotype and allele frequencies related to IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs in MB as well as subclinical forms of leprosy disease versus healthy individuals. Conclusions. Since the sample size is not large enough, it is difficult to sustain an association of susceptibility to leprosy with genotypes or allele frequencies of IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780), suggesting that IL-17 polymorphisms have no significant role in the genetic susceptibility to development of this disease in the Mexican Mestizo population. PMID:25431761

  18. CCL2 Serum Levels and Adiposity Are Associated with the Polymorphic Phenotypes -2518A on CCL2 and 64ILE on CCR2 in a Mexican Population with Insulin Resistance.

    PubMed

    Guzmán-Ornelas, Milton-Omar; Petri, Marcelo Heron; Vázquez-Del Mercado, Mónica; Chavarría-Ávila, Efraín; Corona-Meraz, Fernanda-Isadora; Ruíz-Quezada, Sandra-Luz; Madrigal-Ruíz, Perla-Monserrat; Castro-Albarrán, Jorge; Sandoval-García, Flavio; Navarro-Hernández, Rosa-Elena

    2016-01-01

    Genetic susceptibility has been described in insulin resistance (IR). Chemokine (C-C motif) ligand-2 (CCL2) is overexpressed in white adipose tissue and is the ligand of C-C motif receptor-2 (CCR2). The CCL2 G-2518A polymorphism is known to regulate gene expression, whereas the physiological effects of the CCR2Val64Ile polymorphism are unknown. The aim of the study is to investigate the relationship between these polymorphisms with soluble CCL2 levels (sCCL2), metabolic markers, and adiposity. In a cross-sectional study we included 380 Mexican-Mestizo individuals, classified with IR according to Stern criteria. Polymorphism was identified using PCR-RFLP/sequence-specific primers. Anthropometrics and metabolic markers were measured by routine methods and adipokines and sCCL2 by ELISA. The CCL2 polymorphism was associated with IR (polymorphic A+ phenotype frequencies were 70.9%, 82.6%, in individuals with and without IR, resp.). Phenotype carriers CCL2 (A+) displayed lower body mass and fat indexes, insulin and HOMA-IR, and higher adiponectin levels. Individuals with IR presented higher sCCL2 compared to individuals without IR and was associated with CCR2 (Ile+) phenotype. The double-polymorphic phenotype carriers (A+/Ile+) exhibited higher sCCL2 than double-wild-type phenotype carriers (A-/Ile-). The present findings suggest that sCCL2 production possibly will be associated with the adiposity and polymorphic phenotypes of CCL2 and CCR2, in Mexican-Mestizos with IR.

  19. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients.

    PubMed

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients.

  20. Forensic-paternity effectiveness and genetics population analysis of six non-CODIS mini-STR loci (D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and SE33 in Mestizo and Amerindian populations from Mexico.

    PubMed

    Burguete-Argueta, Nelsi; Martínez De la Cruz, Braulio; Camacho-Mejorado, Rafael; Santana, Carla; Noris, Gino; López-Bayghen, Esther; Arellano-Galindo, José; Majluf-Cruz, Abraham; Antonio Meraz-Ríos, Marco; Gómez, Rocío

    2016-11-01

    STRs are powerful tools intensively used in forensic and kinship studies. In order to assess the effectiveness of non-CODIS genetic markers in forensic and paternity tests, the genetic composition of six mini short tandem repeats-mini-STRs-(D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and the microsatellite SE33 in Mestizo and Amerindian populations from Mexico were studied. Using multiplex polymerase chain reactions and capillary electrophoresis, this study genotyped all loci from 870 chromosomes and evaluated the statistical genetic parameters. All mini-STRs studied were in agreement with HW and linkage equilibrium; however, an important HW departure for SE33 was found in the Mestizo population (p ≤ 0.0001). Regarding paternity and forensic statistical parameters, high values of combined power discrimination and mean power of exclusion were found using these seven markers. The principal co-ordinate analysis based on allele frequencies of three mini-STRs showed the complex genetic architecture of the Mestizo population. The results indicate that this set of loci is suitable to genetically identify individuals in the Mexican population, supporting its effectiveness in human identification casework. In addition, these findings add new statistical values and emphasise the importance of the use of non-CODIS markers in complex populations in order to avoid erroneous assumptions.

  1. Process and dynamics of traditional selling wild edible mushrooms in tropical Mexico

    PubMed Central

    Ruán-Soto, Felipe; Garibay-Orijel, Roberto; Cifuentes, Joaquín

    2006-01-01

    Background More than twelve temperate-inhabitant Mexican ethnic groups are considered to be mycophilic and to have extensive traditional mycological knowledge. In contrast, inhabitants of tropical lands have been studied only superficially and their mycological knowledge is less well known. In this paper, we report the results of an ethnomycological research in markets of a wide area of the Mexican tropics. Our aims were to describe the dynamics related to the traditional selling process of wild mushrooms and to determine the tendencies of informants toward mushrooms (mycophily vs. mycophoby). Methods We visited 25 markets of 12 different settlements in the states of Oaxaca, Tabasco and Veracruz and collected information by participant observation as well as by 291 non-structured and semi-structured interviews. Results Mushroom selling was observed in four towns in Oaxaca and in two in Tabasco. Women represented 81.82% of sellers, while indigenous people (Chinantecos, Chontales, Ch'oles and Zoques) comprised 68.18%. Mushroom commercialization took place in secondary mobile markets and only in peasant stands. Mushroom collectors gather the resource in places with secondary vegetation, farmed areas and cattle fields. Because of land tenure restrictions mushroom sellers did not normally collect mushrooms themselves. In Oaxaca, we observed economic dynamics not based on capitalism, such as exchange, reciprocity and barter. Conclusion The sale of some wild edible mushrooms, the large amounts of commercialization of Schizophyllum commune, the complicated intermediary process, as well as the insertion of mushrooms into different informal economic practices are all evidence of an existent mycophily in a sector of the population of this region of the Mexican tropics. Among our informants, urban mestizo people were mycophobic, rural mestizo people were non-mycophilic and indigenous people were true mycophilic. PMID:16393345

  2. Differences in lipid profiles in two Hispanic ischemic stroke populations.

    PubMed

    Arauz, A; Romano, J G; Ruiz-Franco, A; Shang, T; Dong, C; Rundek, T; Koch, S; Hernández-Curiel, B; Pacheco, J; Rojas, P; Ruiz-Navarro, F; Katsnelson, M; Sacco, R L

    2014-06-01

    The study aims to compare lipid profiles among ischemic stroke patients in a predominantly Caribbean-Hispanic population in Miami and a Mestizo Hispanic population in Mexico City. We analyzed ischemic stroke Hispanic patients with complete baseline fasting lipid profile enrolled contemporaneously in the prospective registries of two tertiary care teaching hospitals in Mexico City and Miami. Demographic characteristics, risk factors, medications, ischemic stroke subtype, and first fasting lipid profile were compared. Vascular risk factor definitions were standardized. Multiple linear regression analysis was performed to compare lipid fractions. A total of 324 patients from Mexico and 236 from Miami were analyzed. Mexicans were significantly younger (58 · 1 vs. 67 · 4 years), had a lower frequency of hypertension (53 · 4% vs. 79 · 7%), and lower body mass index (27 vs. 28 · 5). There was a trend toward greater prevalence of diabetes in Mexicans (31 · 5 vs. 24 · 6%, P = 0 · 07). Statin use at the time of ischemic stroke was more common in Miami Hispanics (18 · 6 vs. 9 · 4%). Mexicans had lower total cholesterol levels (169 · 9 ± 46 · 1 vs. 179 · 9 ± 48 · 4 mg/dl), lower low-density lipoprotein (92 · 3 ± 37 · 1 vs. 108 · 2 ± 40 · 8 mg/dl), and higher triglyceride levels (166 · 9 ± 123 · 9 vs. 149 · 2 ± 115 · 2 mg/dl). These differences remained significant after adjusting for age, gender, hypertension, diabetes, body mass index, smoking, ischemic stroke subtype, and statin use. We found significant differences in lipid fractions in Hispanic ischemic stroke patients, with lower total cholesterol and low-density lipoprotein, and higher triglyceride levels in Mexicans. These findings highlight the heterogeneity of dyslipidemia among the Hispanic race-ethnic group and may lead to different secondary prevention strategies. © 2013 The Authors. International Journal of Stroke © 2013 World Stroke Organization.

  3. Population data of 24 STRs in Mexican-Mestizo population from Monterrey, Nuevo Leon (Northeast, Mexico) based on Powerplex(®) Fusion and GlobalFiler(®) kits.

    PubMed

    Ramos-González, Benito; Aguilar-Velázquez, José Alonso; Chávez-Briones, María de Lourdes; Delgado-Chavarría, Juan Ramón; Alfaro-Lopez, Elizabeth; Rangel-Villalobos, Héctor

    2016-03-01

    The STR loci included into new commercial human identification kits compels geneticists estimating forensic parameters for interpretation purposes in forensic casework. Therefore, we studied for the first time in Mexico the GlobalFiler(®) and Powerplex(®) Fusion systems in 326 and 682 unrelated individuals, respectively. These individuals are resident of the Monterrey City of the Nuevo Leon state (Northeast, Mexico). Population data from 23 autosomal STRs and the Y-STR locus DYS391 are reported and compared against available STR data from American ethnic groups and the unique Mexican population studied with Powerplex(®) Fusion. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

    PubMed

    Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

    2017-08-01

    Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

  5. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

    PubMed

    de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

    2016-10-01

    Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

  6. The mutation profile of JAK2, MPL and CALR in Mexican patients with Philadelphia chromosome-negative myeloproliferative neoplasms.

    PubMed

    Labastida-Mercado, Nancy; Galindo-Becerra, Samantha; Garcés-Eisele, Javier; Colunga-Pedraza, Perla; Guzman-Olvera, Valeria; Reyes-Nuñez, Virginia; Ruiz-Delgado, Guillermo J; Ruiz-Argüelles, Guillermo J

    2015-03-01

    By using molecular markers, it is possible to gain information on both the classification and etiopathogenesis of chronic myeloproliferative neoplasias (MPN). In a group of 27 Mexican mestizo patients with MPNs, we studied seven molecular markers: the BCR/ABL1 fusion gene, the JAK2 V617F mutation, the JAK2 exon 12 mutations, the MPL W515L mutation, the MPL W515K mutation, and the calreticulin (CALR) exon 9 deletion or insertion. Patients with the BCR/ABL1 fusion gene were excluded. We studied 14 patients with essential thrombocythemia (ET), eight with polycythemia vera (PV), four with primary myelofibrosis (MF), and one with undifferentiated MPN. We found twelve individuals with the JAK2 V617F mutation; five of them had been clinically classified as PV, five as ET, and one as MF. One patient with the MPL W515L was identified with a clinical picture of ET. Five patients with the CALR mutation were identified, four ET and one MF. No individuals with either the MPL W515K mutation or the JAK2 exon 12 mutations were identified. The most consistent relationship was that between PV and the JAK2 V617F mutation (p=.01). Despite its small size, the study shows much less prevalence of JAK2 mutation in PV, ET and MF, which does not match international data. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

  7. Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

    PubMed

    Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

    2015-11-01

    Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of this marker in SLE pathogenesis.

  8. Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population

    PubMed Central

    Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aldrete, Maria Elena Aguilar; Oregon-Romero, Edith; Mercado, Monica Vazquez-Del; Navarro-Hernandez, Rosa-Elena

    2012-01-01

    Purpose Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. Subjects and methods In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. Results sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson’s r = −0.169 to −0.465) were found. Conclusion In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels. PMID:23118546

  9. Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population.

    PubMed

    Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aguilar Aldrete, Maria Elena; Oregon-Romero, Edith; Vazquez-Del Mercado, Monica; Navarro-Hernandez, Rosa-Elena

    2012-01-01

    Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson's r = -0.169 to -0.465) were found. In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels.

  10. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  11. -383 A/C tumor necrosis factor receptor 1 polymorphism and ankylosing spondylitis in Mexicans: a preliminary study.

    PubMed

    Corona-Sanchez, Esther Guadalupe; Muñoz-Valle, José Francisco; Gonzalez-Lopez, Laura; Sanchez-Hernandez, Julia Dolores; Vazquez-Del Mercado, Monica; Ontiveros-Mercado, Heriberto; Huerta, Miguel; Trujillo, Xochitl; Rocha-Muñoz, Alberto Daniel; Celis, Alfredo; Ortega-Flores, Ricardo; Gamez-Nava, Jorge Ivan

    2012-08-01

    The objective of this study was to evaluate the differences in allele and genotype frequencies of -383 tumor necrosis factor receptor 1 (TNFR1) polymorphism between ankylosing spondylitis (AS) and controls. Mexican Mestizos with AS were matched by gender, age, and ethnicity with healthy controls and compared in allele and genotype frequencies of the -383 TNFR1 polymorphism. Polymorphisms were genotyped using PCR-RFLP. The AA genotype occurred at a higher frequency in the AS group (92%) compared with controls (79%, P = 0.03). A allele was increased in AS (96% vs. 88%, P = 0.015) and was associated with genetic susceptibility for AS (odds ratio = 3.48, 95% CI = 1.23-10.61). This preliminary study is the first assessing the association of the -383 A/C TNFR1 polymorphism with AS, although it has the limitation of a small sample size. These data are of interest for the genetic epidemiology of AS in the Mexican population, requiring further investigation in other countries.

  12. Genetic polymorphisms of matrix metalloproteinases and protein levels in chronic obstructive pulmonary disease in a Mexican population.

    PubMed

    Hernández-Montoya, Jazmín; Pérez-Ramos, Julia; Montaño, Martha; Ramírez-Venegas, Alejandra; Sansores, Raúl H; Pérez-Rubio, Gloria; Velázquez-Uncal, Mónica; Camarena, Angel; Ramos, Carlos; Falfán-Valencia, Ramcés

    2015-01-01

    To evaluate association of single nucleotide polymorphisms (SNPs) in the MMP1, MMP2, MMP9 and MMP12 genes and serum MMP-2 and MMP-9 levels in smoking chronic obstructive pulmonary disease (COPD) patients. Genotyping using real-time PCR in 330 smokers with COPD (COPD), 658 smokers without COPD (SNC) and 150 nonsmokers (NCNS), the analysis of samples used was χ(2) test. Using ELISA, the proteins were evaluated. Multiple comparisons were made by ANOVA. rs243864 (OR: 7.44; 95% CI: 3.62-15.26) and rs11646643 (OR: 1.58; 95% CI: 1.07-2.34) of the MMP-2 gene and rs3918253 (OR: 1.72; 95% CI: 1.08-2.71) of the MMP-9 gene, were associated with the risk of COPD. Serum MMP-2 level in the COPD group was lower compared with SNC (p < 0.05). Serum MMP-9 level was elevated in the COPD group compared with SNC (p < 0.05). Polymorphisms in MMP2 and MMP9 but not in MMP1 and MMP12 are associated with the risk of COPD in the Mexican mestizo population.

  13. [Evolution of type 2 diabetes and carbohydrate intolerance following bariatric surgery in a Mexican mestizo population].

    PubMed

    Ramírez-Avilés, Eva; Espinosa-González, Omar; Amado-Galván, Mónica; Maydón-González, Hernán; Sepúlveda-Guerrero, Elisa; Zerrweck-López, Carlos

    Bariatric surgery continues to be the best treatment for weight loss and control of obesity related comorbidities. Gastric bypass and sleeve gastrectomy have demonstrated to be the most effective surgeries, but this has not been established in a Mexican (non-American) population. To analyse the improvement in type 2 diabetes mellitus and carbohydrate intolerance in obese patients after bariatric surgery. A retrospective analysis was performed on the data collected prospectively between 2013 and 2015 on every obese patient with diabetes and carbohydrate intolerance submitted for bariatric surgery. Analysis was performed at baseline, and at 1, 3, 6, 9 and 12 months, and included metabolic, clinical, lipid, and anthropometrical parameters. A peri-operative and morbidity and mortality analysis was also performed. Remission rates for patients with diabetes were also established. The analysis included 73 patients, 46 with diabetes and 27 with carbohydrate intolerance. Sixty-two patients were female with a mean age of 42 years. Baseline glucose and glycosylated haemoglobin were 123±34mg/dl and 6.8±1.6%, and at 12 months they were 90.1±8mg/dl and 5.4±0.3%, respectively. Diabetes remission was observed in 68.7% of patients, including 9.3% with partial remission and 21.8% with an improvement. There was also a significant improvement in all metabolic and non-metabolic parameters. Bariatric surgery safely improves the metabolic status of patients with diabetes mellitus or carbohydrate intolerance during the first year, inducing high rates of complete remission. It has also shown a significant improvement on blood pressure, lipid, and anthropometric parameters during the first year of follow-up. Copyright © 2017 Academia Mexicana de Cirugía A.C. Publicado por Masson Doyma México S.A. All rights reserved.

  14. Analysis of betaS and betaA genes in a Mexican population with African roots.

    PubMed

    Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

    2002-01-01

    To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

  15. Treatment protocol for "Mestizo nose" with open rhinoplasty.

    PubMed

    de la Peña-Salcedo, Jose Abel; Soto-Miranda, Miguel Angel; Lopez-Salguero, Jose Fernando

    2011-12-01

    The aim of this study was to develop an operative sequence to guide plastic surgeons on how to handle the challenges of "Mestizo nose" during rhinoplasty. This type of nose has characteristics quite different from the Caucasian nose. Rhinoplasties on Mestizo nose represent a surgical challenge because of the anatomical characteristics of a weak frame and thick skin. The Hispanic population has grown, and nowadays a large number of patients requesting rhinoplasty within the US belong to this ethnic group. We have developed an operative sequence for the treatment of Mestizo nose. This operative sequence has been tested in 879 rhinoplasties (92.37% females and 7.62% males, aged 15-63 years, mean age = 39 years). All were primary cases. An algorithm on how to approach the different types of Mestizo nose is presented. We had overall good results using our algorithm, with an improvement in the nasal aesthetics of about 54.75%. Complications were postoperative bleeding (1.37%), pain (0.57%), septal hematoma (0.23%), unaesthetic scars (0.34%), and cartilage extrusion (0.11%). Our revision rate was 5%. We present ten complete cases to show our surgical results. This operative sequence has allowed us to get predictable and reliable surgical outcomes when used in Mestizo rhinoplasty operations. We think it can be very useful for every plastic surgeon who performs Mestizo nose rhinoplasty, although not all steps need to be performed in every case.

  16. Hypocholesterolemia is an independent risk factor for depression disorder and suicide attempt in Northern Mexican population.

    PubMed

    Segoviano-Mendoza, Marcela; Cárdenas-de la Cruz, Manuel; Salas-Pacheco, José; Vázquez-Alaniz, Fernando; La Llave-León, Osmel; Castellanos-Juárez, Francisco; Méndez-Hernández, Jazmín; Barraza-Salas, Marcelo; Miranda-Morales, Ernesto; Arias-Carrión, Oscar; Méndez-Hernández, Edna

    2018-01-15

    Cholesterol has been associated as a risk factor for cardiovascular disease. Recently, however, there is growing evidence about crucial requirement of neuron membrane cholesterol in the organization and function of the 5-HT 1A serotonin receptor. For this, low cholesterol level has been reported to be associated with depression and suicidality. However there have been inconsistent reports about this finding and the exact relationship between these factors remains controversial. Therefore, we investigated the link between serum cholesterol and its fractions with depression disorder and suicide attempt in 467 adult subjects in Mexican mestizo population. Plasma levels of total cholesterol, triglycerides, and high-density lipoprotein cholesterol (HDL-c) and low density lipoprotein cholesterol (LDL-c) were determined in 261 MDD patients meeting the DSM-5 criteria for major depressive disorder (MDD), 59 of whom had undergone an episode of suicide attempt, and 206 healthy controls. A significant decrease in total cholesterol, LDL-cholesterol, VLDL-cholesterol and triglyceride serum levels was observed in the groups of MDD patients and suicide attempt compared to those without suicidal behavior (p < 0.05). After adjusting for covariates, lower cholesterol levels were significantly associated with MDD (OR 4.229 CI 95% 2.555 - 7.000, p<.001) and suicide attempt (OR 5.540 CI 95% 2.825 - 10.866, p<.001) CONCLUSIONS: These results support the hypothesis that lower levels of cholesterol are associated with mood disorders like MDD and suicidal behavior. More mechanistic studies are needed to further explain this association.

  17. Genetic polymorphisms in CYP2A6 are associated with a risk of cigarette smoking and predispose to smoking at younger ages.

    PubMed

    Pérez-Rubio, Gloria; López-Flores, Luis Alberto; Ramírez-Venegas, Alejandra; Noé-Díaz, Valeri; García-Gómez, Leonor; Ambrocio-Ortiz, Enrique; Sánchez-Romero, Candelaria; Hernández-Zenteno, Rafael De Jesús; Sansores, Raúl Humberto; Falfán-Valencia, Ramcés

    2017-09-10

    Nicotine is the main component of cigarettes that causes addiction, which is considered a complex disease, and genetic factors have been proposed to be involved in the development of addiction. The CYP2A6 gene encodes the main enzyme responsible for nicotine metabolism. Depending on the study population, different genetic variants of CYP2A6 associated with cigarette smoking have been described. Therefore, we evaluated the possible association between SNPs in CYP2A6 with cigarette smoking and nicotine addiction-related variables in Mexican mestizo smokers. We performed a genetic association study comparing light smokers (LS, n=349), heavy smokers (HS, n=351) and never-smokers (NS, n=394). SNPs rs1137115, rs4105144, rs1801272 and rs28399433 were genotyped in the CYP2A6 gene. We found that the A allele of rs1137115 (OR=1.41) in exon 1 of CYP2A6 and the T allele of rs4105144 (OR=1.32) in the 5' UTR of the gene are associated with the risk of cigarette smoking (p<0.05); rs1137115 affects the level of alternative splicing, resulting in a CYP2A6 isoform with low enzymatic activity, whereas rs4105144 is likely to be in a binding site for the transcription factor for glucocorticoids receptor (GR) and regulates the expression of CYP2A6. In addition, having a greater number of risk alleles (rs1137115 (A), rs4105144 (T) and rs28399433 (G)) is associated with a younger age at onset. The present study shows that in Mexican mestizos, the analyzed SNPs confer greater risk in terms of consumption and age of onset. Copyright © 2017. Published by Elsevier B.V.

  18. The -174G/C Interleukin-6 Gene Promoter Polymorphism as a Genetic Marker of Differences in Therapeutic Response to Methotrexate and Leflunomide in Rheumatoid Arthritis.

    PubMed

    Ruiz-Padilla, A J; Gamez-Nava, J I; Saldaña-Cruz, A M; Murillo-Vazquez, J D; Vazquez-Villegas, M L; Zavaleta-Muñiz, S A; Martín-Márquez, B T; Ponce-Guarneros, J M; Rodriguez Jimenez, N A; Flores-Chavez, A; Sandoval-Garcia, F; Vasquez-Jimenez, J C; Cardona-Muñoz, E G; Totsuka-Sutto, S E; Gonzalez-Lopez, L

    2016-01-01

    Objective . To evaluate the association of -174G/C IL-6 polymorphism with failure in therapeutic response to methotrexate (MTX) or leflunomide (LEF). This prospective, observational cohort included 96 Mexican-Mestizo patients with moderate or severe rheumatoid arthritis (RA), initiating MTX or LEF, genotyped for IL-6 -174G/C polymorphism by PCR-RFLP. Therapeutic response was strictly defined: only if patients achieved remission or low disease activity (DAS-28 < 3.2). Results . Patients with MTX or LEF had significant decrement in DAS-28 ( p < 0.001); nevertheless, only 14% and 12.5% achieved DAS-28 < 3.2 at 3 and 6 months. After 6 months with any of these drugs the -174G/G genotype carriers (56%) had higher risk of therapeutic failure compared with GC (RR: 1.19, 95% CI: 1.07-1.56). By analyzing each drug separately, after 6 months with LEF, GG genotype confers higher risk of therapeutic failure than GC (RR = 1.56; 95% CI = 1.05-2.3; p = 0.003), or CC (RR = 1.83; 95% CI = 1.07-3.14; p = 0.001). This risk was also observed in the dominant model (RR = 1.33; 95% CI = 1.03-1.72; p = 0.02). Instead, in patients receiving MTX no genotype was predictor of therapeutic failure. We concluded that IL-6 -174G/G genotype confers higher risk of failure in therapeutic response to LEF in Mexicans and if confirmed in other populations this can be used as promissory genetic marker to differentiate risk of therapeutic failure to LEF.

  19. Genetic and environmental determinants of the susceptibility of Amerindian derived populations for having hypertriglyceridemia

    PubMed Central

    Aguilar-Salinas, Carlos A.; Tusie-Luna, Teresa; Pajukanta, Päivi

    2014-01-01

    Here, we discuss potential explanations for the higher prevalence of hypertriglyceridemia in populations with an Amerindian background. Although environmental factors are the triggers, the search for the ethnic related factors that explains the increased susceptibility of the Amerindians is a promising area for research. The study of the genetics of hypertriglyceridemia in Hispanic populations faces several challenges. Ethnicity could be a major confounding variable to prove genetic associations. Despite that, the study of hypertriglyceridemia in Hispanics has resulted in significant contributions. Two GWAS reports have exclusively included Mexican mestizos. Fifty percent of the associations reported in Caucasians could be generalized to the Mexicans, but in many cases the Mexican lead SNP was different than that reported in Europeans. Both reports included new associations with apo B or triglycerides concentrations. The frequency of susceptibility alleles in Mexicans is higher than that found in Europeans for several of the genes with the greatest effect on triglycerides levels. An example is the SNP rs964184 in APOA5. The same trend was observed for ANGPTL3 and TIMD4 variants. In summary, we postulate that the study of the genetic determinants of hypertriglyceridemia in Amerindian populations which have major changes in their lifestyle, may prove to be a great resource to identify new genes and pathways associated with hypertriglyceridemia. PMID:24768220

  20. Association of vWA and TPOX Polymorphisms with Venous Thrombosis in Mexican Mestizos

    PubMed Central

    Meraz-Ríos, Marco Antonio; Majluf-Cruz, Abraham; Santana, Carla; Noris, Gino; Camacho-Mejorado, Rafael; Acosta-Saavedra, Leonor C.; Calderón-Aranda, Emma S.; Hernández-Juárez, Jesús; Magaña, Jonathan J.; Gómez, Rocío

    2014-01-01

    Objective. Venous thromboembolism (VTE) is a multifactorial disorder and, worldwide, the most important cause of morbidity and mortality. Genetic factors play a critical role in its aetiology. Microsatellites are the most important source of human genetic variation having more phenotypic effect than many single nucleotide polymorphisms. Hence, we evaluate a possible relationship between VTE and the genetic variants in von Willebrand factor, human alpha fibrinogen, and human thyroid peroxidase microsatellites to identify possible diagnostic markers. Methods. Genotypes were obtained from 177 patients with VTE and 531 nonrelated individuals using validated genotyping methods. The allelic frequencies were compared; Bayesian methods were used to correct population stratification to avoid spurious associations. Results. The vWA-18, TPOX-9, and TPOX-12 alleles were significantly associated with VTE. Moreover, subjects bearing the combination vWA-18/TPOX-12 loci exhibited doubled risk for VTE (95% CI = 1.02–3.64), whereas the combination vWA-18/TPOX-9 showed an OR = 10 (95% CI = 4.93–21.49). Conclusions. The vWA and TPOX microsatellites are good candidate biomarkers in venous thromboembolism diseases and could help to elucidate their origins. Additionally, these polymorphisms could become useful markers for genetic studies of VTE in the Mexican population; however, further studies should be done owing that this data only show preliminary evidence. PMID:25250329

  1. Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary

    PubMed Central

    Pons-Estel, Guillermo J.; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K.; Pons-Estel, Bernardo A.; Alarcón-Riquelme, Marta; Alarcón, Graciela S.

    2016-01-01

    Objective. To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Methods. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student’s t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. Results. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. Conclusion. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. PMID:26412809

  2. Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico.

    PubMed

    Beltrán-Rodríguez, Leonardo; Ortiz-Sánchez, Amanda; Mariano, Nestor A; Maldonado-Almanza, Belinda; Reyes-García, Victoria

    2014-01-27

    Worldwide, mestizo communities' ethnobotanical knowledge has been poorly studied. Based on a mestizo group in Mexico, this study assesses a) the use value (UV) of the local flora, b) gendered differences in plant species, and c) the association between socio-economic variables and ethnobotanical knowledge. To assess the degree of knowledge of plant resources, we conducted 41 interviews collecting information on knowledge of local plant resources and the socio-economic situation of the informant. We also collected free listings of useful plants by category of use to identify the UV of each species. With the support of key informants, we photographed and collected the plant material recorded during the interviews and free listings on five different habitats. Paired t-tests and a Wilcoxon signed rank test were used to determine differences in the number of species known by men and women. Differences in distribution were analyzed by means of the Shapiro-Wilk's W normality tests. To determine the association of socio-economic factors and ethnobotanical knowledge, we used a non-metric multidimensional scaling analysis (NMDS). Informants listed 185 species. Medicinal plants constituted the most diverse group (90 species). Tropical deciduous forest is the habitat that concentrates the highest proportion of plant resources (80 species). The use-values were classified into three groups: A (4-6 UV; three species), B (0.35-1.37 UV; 39 species) and C (0-0.29 UV; 143 species). High-quality wood species and those associated to religious ceremonies had the highest UV. Women's and men's knowledge of plant species showed statistically significant differences at the interspecific and the intracategorical levels (Student's test, T15 = 4.8, p < 0.001). Occupation, gender and age were statistically significant associated to ethnobotanical knowledge (p < 0.05), whereas income, education level, and place of origin were not. This research improves our understanding of the socio-economic activities associated with the intracultural distribution of ethnobotanical knowledge among mestizo Mexican communities. It also provides information on plant resources and habitats and how local peasants value them. This information could help in the development of proposals to improve biocultural conservation and strengthen traditional knowledge systems for effective forest management.

  3. Autoimmune vitiligo in rheumatic disease in the mestizo Mexican population.

    PubMed

    Avalos-Díaz, Esperanza; Pérez-Pérez, Elena; Rodríguez-Rodríguez, Mayra; Pacheco-Tovar, María-Guadalupe; Herrera-Esparza, Rafael

    2016-08-01

    Vitiligo is a chronic disease characterized by the dysfunction or destruction of melanocytes with secondary depigmentation. The aim of the present study was to determine the prevalence of vitiligo associated with autoimmune rheumatic diseases. The clinical records from a 10-year database of patients with rheumatic diseases and associated vitiligo was analysed, with one group of patients having autoimmune rheumatic disease and another non-autoimmune rheumatic disease. Available serum samples were used to assess the anti-melanocyte antibodies. A total of 5,251 individual clinical files were archived in the last 10 years, and these patients underwent multiple rheumatology consultations, with 0.3% of the group presenting with vitiligo. The prevalence of vitiligo in the autoimmune rheumatic disease group was 0.672%, which was mainly associated with lupus and arthritis. However, patients with more than one autoimmune disease had an increased relative risk to develop vitiligo, and anti-melanocyte antibodies were positive in 92% of these patients. By contrast, the prevalence was 0.082% in the group that lacked autoimmune rheumatic disease and had negative autoantibodies. In conclusion, the association between vitiligo and autoimmune rheumatic diseases was relatively low. However, the relative risk increased when there were other autoimmune comorbidities, such as thyroiditis or celiac disease. Therefore, the presence of multiple autoimmune syndromes should be suspected.

  4. Interleukin 1 β (IL-1B) and IL-1 antagonist receptor (IL-1RN) gene polymorphisms are associated with the genetic susceptibility and steroid dependence in patients with ulcerative colitis.

    PubMed

    Yamamoto-Furusho, Jesús K; Santiago-Hernández, Jean J; Pérez-Hernández, Nonanzit; Ramírez-Fuentes, Silvestre; Fragoso, José Manuel; Vargas-Alarcón, Gilberto

    2011-07-01

    Ulcerative colitis (UC) is an inflammatory bowel disease of unknown etiology. Among cytokines induced in UC, interleukin 1 antagonist (IL-1ra) and interleukin 1 β (IL-1β) seems to have a central role because of its immunoregulatory and proinflammatory activities. To determine the association between IL-1RA and IL-1B gene polymorphisms and the clinical features of UC in the Mexican Mestizo population. Five polymorphisms in the IL-1 gene cluster members IL-1B (rs16944), IL1F10 (rs3811058), and IL-1RN (rs419598, rs315952, and rs315951) were genotyped by 5' exonuclease TaqMan genotyping assays in a group of 200 Mexican patients with UC and 248 ethnically matched unrelated healthy controls. We found a significant increased frequencies of IL-1RN6/1 TC (rs315952) and RN6/2 CC (rs315951) and decreased frequency of IL-1B-511 TC (rs16944) genotypes in UC patients as compared with healthy controls. In the subgroup analysis, we found a significant association between the RN6/2 GG (rs315951) and IL-1B-511 CC (rs16944) genotypes and the presence of steroid-dependence in UC patients (pC=00001, OR=15.6 and pC=0.008, OR=4.09, respectively). Patients with UC showed increased frequencies of IL-1RN "CTC" and "TCG" haplotypes when compared with healthy controls (P=0.019, OR=1.43 and P<10(-7), OR=2.63, respectively). Two haplotypes (TTG and CTG) showed decreased frequency in patients when compared with healthy controls (P=9×10(-7), OR=0.11 and P=8×10(-6), OR=0.11, respectively). IL-1 RN and IL-1B polymorphisms were associated with the genetic susceptibility to develop UC and might be associated with the presence of steroid-dependence in UC patients.

  5. MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

    PubMed

    Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Muñoz-Valle, J F

    2018-07-15

    Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Differences in body mass index according to fat mass- and obesity-associated (FTO) genotype in Mexican patients with bipolar disorder.

    PubMed

    Díaz-Anzaldúa, Adriana; Ocampo-Mendoza, Yolanda; Hernández-Lagunas, José Octavio; Díaz-Madrid, Federico Alejandro; Romo-Nava, Francisco; Juárez-García, Francisco; Ortega-Ortiz, Hiram; Díaz-Anzaldúa, Alejandro; Gutiérrez-Mora, Doris; Becerra-Palars, Claudia; Berlanga-Cisneros, Carlos

    2015-09-01

    The prevalence of obesity has dramatically increased in many countries and it is particularly high in patients with bipolar disorder (BD). A region in the first intron of the fat mass- and obesity-associated (FTO) gene, encompassing markers rs9939973, rs8050136, and rs9939609, has been consistently associated with obesity and body mass index (BMI) in different populations. We sought to determine whether FTO is associated with BMI and/or obesity in patients with BD. The sample included 129 Mexican Mestizo patients with bipolar I or bipolar II disorder. After obtaining informed consent, participants were evaluated with the Structured Clinical Interview for DSM-IV Axis I Disorders and weight, height, and body measurements were recorded. DNA was extracted from a 5-mL blood sample and real-time polymerase chain reaction was performed. The results were analyzed with Haploview v4.2 and SPSS v21. Differences in mean BMI were explained by rs8050136 and rs9939609 genotypes, especially by comparing non-carriers and carriers of two copies of the risk allele (Tukey's p ≤ 0.019), with a mean difference in BMI as high as 7.81 kg/m(2) . Differences in BMI were also explained by the interaction of the genotype (rs8050136 and/or rs9939609), the use of second-generation antipsychotics, and the use of mood stabilizers (p ≤ 0.41). Obesity was also associated with these two markers when patients with and without obesity were compared. In patients with BD, differences in BMI may be affected by the presence of FTO risk alleles, especially in homozygous individuals for these variants. Besides evaluating the possible metabolic effects of certain antipsychotics or mood stabilizers, it is important to evaluate the role of other factors such as FTO risk alleles. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. -592 and -1082 interleukin-10 polymorphisms in pulmonary tuberculosis with type 2 diabetes.

    PubMed

    García-Elorriaga, Guadalupe; Vera-Ramírez, Leila; del Rey-Pineda, Guillermo; González-Bonilla, César

    2013-07-01

    To determine the polymorphisms of Interleukin-10 (IL-10) (-592, -1082) in pulmonary tuberculosis (PTB) with and without type 2 diabetes (T2D). We studied a Mexican mestizo population of 37 patients with TB in remission (TBr) and 40 with active pulmonary TB (PTB), 21 patients with TB + T2D, 47 blood donors accepted, and 13 healthy health-care workers with tuberculin skin test positive. Determination of IL-10 polymorphisms was performed by real-time Polymerase chain reaction. IL-10-592C/A presented in a greater proportion in healthy individuals than in patients with type 2 diabetes and TB in a not quite significant statistically manner. IL-10-1082A/A presented more frequently in the group of patients with both diseases, not being statistically significant in comparison with the group of healthy subjects. This study describes two important new findings. First, it reveals that the IL-10 (-592 A/A and -592 C/C) polymorphisms were found in a greater proportion in a group of patients with T2D and TB than in healthy subjects. Second, the study provides evidence that the (-1082 G/G) polymorphism presented with greater frequency in healthy individuals than in patients with both of these diseases. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  8. Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary.

    PubMed

    Ugarte-Gil, Manuel F; Pons-Estel, Guillermo J; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K; Pons-Estel, Bernardo A; Alarcón-Riquelme, Marta; Alarcón, Graciela S

    2016-03-01

    To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student's t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity.

    PubMed

    Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H; Falfán-Valencia, Ramcés

    2017-01-01

    Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1-10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction.

  10. Impact of genetic variants of IL-6, IL6R, LRP5, ESR1 and SP7 genes on bone mineral density in postmenopausal Mexican-Mestizo women with obesity.

    PubMed

    Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia

    2013-10-10

    Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.

  11. Prevalence of metabolic syndrome, obesity and diabetes type 2 in cryptogenic cirrhosis.

    PubMed

    Tellez-Avila, Felix I; Sanchez-Avila, Francisco; García-Saenz-de-Sicilia, Mauricio; Chavez-Tapia, Norberto C; Franco-Guzman, Ada M; Lopez-Arce, Gustavo; Cerda-Contreras, Eduardo; Uribe, Misael

    2008-08-14

    To evaluate the prevalence of metabolic syndrome (MS), obesity and type 2 diabetes mellitus (T2DM) in a group of Mexican Mestizo patients with cryptogenic cirrhosis (CC) and to compare this group with patients with cirrhosis secondary to other causes (disease controls). Patients with CC, diagnosed between January, 1990 and April, 2005, were included in a retrospective study. Patients with cirrhosis caused by chronic hepatitis C, alcohol abuse or autoimmune hepatitis (AIH) served as disease controls. A total of 134 patients with CC were analyzed. Disease controls consisted of 81 patients with chronic hepatitis C, 33 with alcohol abuse and 20 with AIH. The median age of patients with CC was 57 years (range, 16-87); 83 (61.9%) patients were female; 53 (39.6%) were Child A, 65 (48.5%) Child B, and 16 (11.9%) were Child C cirrhosis. The prevalence of MS (29.1% vs 6%; P<0.001), obesity (16.4% vs 8.2%; P=0.04) and T2DM (40% vs 22.4%; P=0.013) was higher in CC patients than in disease controls. There were no differences in sex, age or liver function tests between the two groups. The prevalence of MS, obesity and T2DM were higher in patients with CC than in patients with cirrhosis secondary to others causes. Our findings support the hypothesis that non-alcoholic steatohepatitis (NASH) plays an under-recognized role in CC.

  12. Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico

    PubMed Central

    2014-01-01

    Background Worldwide, mestizo communities’s ethnobotanical knowledge has been poorly studied. Based on a mestizo group in Mexico, this study assesses a) the use value (UV) of the local flora, b) gendered differences in plant species, and c) the association between socio-economic variables and ethnobotanical knowledge. Methods To assess the degree of knowledge of plant resources, we conducted 41 interviews collecting information on knowledge of local plant resources and the socio-economic situation of the informant. We also collected free listings of useful plants by category of use to identify the UV of each species. With the support of key informants, we photographed and collected the plant material recorded during the interviews and free listings on five different habitats. Paired t-tests and a Wilcoxon signed rank test were used to determine differences in the number of species known by men and women. Differences in distribution were analyzed by means of the Shapiro–Wilk’s W normality tests. To determine the association of socio-economic factors and ethnobotanical knowledge, we used a non-metric multidimensional scaling analysis (NMDS). Results Informants listed 185 species. Medicinal plants constituted the most diverse group (90 species). Tropical deciduous forest is the habitat that concentrates the highest proportion of plant resources (80 species). The use-values were classified into three groups: A (4–6 UV; three species), B (0.35-1.37 UV; 39 species) and C (0–0.29 UV; 143 species). High-quality wood species and those associated to religious ceremonies had the highest UV. Women’s and men’s knowledge of plant species showed statistically significant differences at the interspecific and the intracategorical levels (Student’s test, T15 = 4.8, p < 0.001). Occupation, gender and age were statistically significant associated to ethnobotanical knowledge (p < 0.05), whereas income, education level, and place of origin were not. Conclusion This research improves our understanding of the socio-economic activities associated with the intracultural distribution of ethnobotanical knowledge among mestizo Mexican communities. It also provides information on plant resources and habitats and how local peasants value them. This information could help in the development of proposals to improve biocultural conservation and strengthen traditional knowledge systems for effective forest management. PMID:24467777

  13. Population data and mutation rate of nine Y-STRs in a mestizo Mexican population from Guadalajara, Jalisco, México.

    PubMed

    Padilla-Gutiérrez, Jorge Ramón; Valle, Yeminia; Quintero-Ramos, Antonio; Hernández, Guillermo; Rodarte, Katya; Ortiz, Rocío; Olivares, Norma; Rivas, Fernando

    2008-11-01

    Nine Y-STR (DYS19, DYS390, DYS391, DYS392, DYS446, DYS447, DYS448, DYS456 and DYS458) were analyzed in a male sample of 285 unrelated individuals from Guadalajara, Jalisco, México. The haplotype diversity (0.996) and discrimination capacity (0.986) were calculated. A family study of around 200 father/son pairs and among 1828 meiosis showed five mutational events. All mutations were single step. The overall mutation rate estimated across the nine Y-STRs was 2.7 x 10(-3) (95% CI 1.2-6.4 x 10(-3))/locus/meiosis. The results indicate that these nine loci are useful Y-linked markers for forensic applications.

  14. Genetic structure of the populations migrating from San Luis Potosi and Zacatecas to Nuevo León in Mexico.

    PubMed

    Cerda-Flores, R M; Kshatriya, G K; Barton, S A; Leal-Garza, C H; Garza-Chapa, R; Schull, W J; Chakraborty, R

    1991-06-01

    The Mexicans residing in the Monterrey metropolitan area in Nuevo León, Mexico, were grouped by generation and birthplace [Monterrey Metropolitan Area (MMA), San Luis Potosi (SLP), and Zacatecas (ZAC)] of the four grandparents to determine the extent of genetic variation within this population and the genetic differences, if any, between the natives living in the MMA and the immigrant populations from SLP and ZAC. Nine genetic marker systems were analyzed. The genetic distance analysis indicates that SLP and ZAC are similar to the MMA, irrespective of birthplace and generation. Gene diversity analysis (GST) suggests that more than 96% of the total gene diversity (HT) can be attributed to individual variation within the population. The genetic admixture analysis suggests that the Mexicans of the MMA, SLP, and ZAC, stratified by birthplace and generation, have received a predominantly Spanish contribution (78.5%), followed by a Mexican Indian contribution (21.5%). Similarly, admixture analysis, conducted on the population of Nuevo León and stratified by generation, indicates a substantial contribution from the MMA (64.6%), followed by ZAC (22.1%) and SLP (13.3%). Finally, we demonstrate that there is no nonrandom association of alleles among the genetic marker systems (i.e., no evidence of gametic disequilibrium) despite the Mestizo origin of this population.

  15. Genetic admixture of eight Mexican indigenous populations: based on five polymarker, HLA-DQA1, ABO, and RH loci.

    PubMed

    Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Salamanca-Gómez, Fabio; Cerda-Flores, Ricardo M

    2008-01-01

    This study explores the genetic admixture of eight Mexican indigenous populations (Otomi-Ixmiquilpan, Otomi-Actopan, Tzeltales, Nahua-Milpa-Alta, Nahua-Xochimilco, Nahua-Zitlala, Nahua-Ixhuatlancillo, and Nahua-Coyolillo) on the basis of five PCR-based polymorphic DNA loci (LDLR, GYPA, HBGG, D7S8, GC), HLA_DQA1, and the blood groups ABO and Rh (CcDEe). Among the indigenous populations, the highest gene frequencies for O and D were 0.9703 and 1.000 for Zitlala (State of Guerrero) and 0.9955 and 0.9414 for Tzeltales (State of Chiapas), respectively. Maximum likelihood estimates of admixture components yield a trihybrid model with Amerindian (assuming that Nahua-Zitlala is the most representative indigenous population), Spanish, and African ancestry with the admixture proportions: 93.03, 6.03, and 0.94 for Tzeltales, and 28.99, 44.03, and 26.98 for Coyolillo. A contribution of the ancestral populations of Ixhuatlancillo, Actopan, Ixmiquilpan, Milpa-Alta, and Xochimilco were found with the following average of admixture proportions: 75.84, 22.50, and 1.66. The findings herein demonstrate that the genetic admixture of the Mexican indigenous populations who at present speak the same Amer-Indian language can be differentiated and that the majority of them have less ancestral indigenous contribution than those considered as Mestizo populations.

  16. CYP2D6 genotype and phenotype in Amerindians of Tepehuano origin and Mestizos of Durango, Mexico.

    PubMed

    Sosa-Macías, Martha; Elizondo, Guillermo; Flores-Pérez, Carmen; Flores-Pérez, Janet; Bradley-Alvarez, Francisco; Alanis-Bañuelos, Ruth E; Lares-Asseff, Ismael

    2006-05-01

    Although the drug-metabolizing enzyme CYP2D6 has been studied extensively in subjects of differing ethnicities, limited CYP2D6 pharmacogenetic data are available for the Amerindian population and Mestizos of Mexico. Dextromethorphan hydroxylation phenotype was studied in Tepehuano Amerindian (n = 58) and Mestizo (n = 88) subjects, and 195 individuals (85 Tepehuano Amerindians and 110 Mestizos) were genotyped by polymerase chain reaction-restriction fragment length polymorphism methods to identify the frequencies of the CYP2D6*3, *4, *6, and *10 alleles. Tepehuano Amerindian subjects lacked the poor metabolizer (PM) phenotype, whereas in Mestizos the PM phenotype frequency was 6.8%. The CYP2D6*3, *6, and *10 alleles were not found in Tepehuano Amerindians. The CYP2D6*4 allele had a low frequency (0.006) in this Amerindian group. In the Mestizo group, the CYP2D6*3, *4, and *10 alleles had frequencies of 0.009, 0.131, and 0.023, respectively. The CYP2D6*6 allele was not found in Mestizos. The genotype-phenotype association was strongly statistically significant (r(2) = .45; P = .005) in Mestizos. The Tepehuano population was found to have a low phenotypic and genotypic CYP2D6 diversity and differed from other Amerindian groups. On the other hand, the frequencies of the CYP2D6 variant alleles in Mestizos were similar to those reported for whites.

  17. Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity

    PubMed Central

    Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A.; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H.

    2017-01-01

    Background Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. Aims To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. Methods The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1–10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. Results The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Conclusions Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction. PMID:28103253

  18. A slow life history is related to a negative attitude towards cousin marriages: a study in three ethnic groups in Mexico.

    PubMed

    Buunk, Abraham P; Hoben, Ashley D

    2013-06-24

    Little is known about current attitudes towards cousin marriages. Using data from a rural population in the Mexican state of Oaxaca, the present research examined how life history was related to attitudes towards cousin marriages in various ethnic groups. Participants were 205 parents from three ethnic groups. i.e., Mestizos (people of mixed descent, n = 103), indigenous Mixtecs (n = 65), and Blacks (n = 35). Nearly all men in this study were farm workers or fishermen. Participants reported more negative than positive attitudes towards cousin marriage, and women reported more negative attitudes than did men. The main objection against marrying a cousin was that it is wrong for religious reasons, whereas the risk of genetic defects was considered relatively unimportant. Cousin marriage was not considered to contribute to the quality and unity of marriage and the family. The three ethnic groups did not differ in their attitude towards cousin marriages. However, a slower life history was related to a more negative attitude towards cousin marriages, especially among Blacks, less so among Mixtecs, and not at all among Mestizos. In addition, and independent of the effect of life history, with increasing levels of parental control over mate choice, the attitude towards cousin marriage was more positive, but among men the attitude was more negative the more religious they were. The results are discussed in the context of theorizing on life history theory and the benefits and costs of cousin marriages.

  19. Evaluation of forensic and anthropological potential of D9S1120 in Mestizos and Amerindian populations from Mexico

    PubMed Central

    Rangel-Villalobos, Héctor; Sánchez-Gutiérrez, Viviana M; Botello-Ruiz, Miriam; Salazar-Flores, Joel; Martínez-Cortés, Gabriela; Muñoz-Valle, José F; Phillips, Christopher

    2012-01-01

    Aim To carry out a deeper forensic and anthropological evaluation of the short tandem repeat (STR) D9S1120 in five Mestizo populations and eight Amerindian groups from Mexico. Methods We amplified the STR D9S1120 based on primers and conditions described by Phillips et al, followed by capillary electrophoresis in the genetic analyzer ABI Prism 310. Genotypes were analyzed with the GeneMapper ID software. In each population we estimated statistical parameters of forensic importance and Hardy-Weinberg equilibrium. Heterozygosity and FST-values were compared with those previously obtained with nine STRs of the Combined DNA Index System (CODIS-STRs). Results Amerindian and Mestizo populations showed high frequencies of the allele 9 and 16, respectively. Population structure analysis (AMOVA) showed a significant differentiation between Amerindian groups (FST = 2.81%; P < 0.0001), larger than between Mestizos (FST = 0.44%; P = 0.187). D9S1120 showed less genetic diversity but better population differentiation estimates than CODIS-STRs between Amerindian groups and between Amerindians and Mestizos, but not between Mestizo groups. Conclusion This study evaluated the ability of D9S1120 to be used for human identification purposes and demonstrated its anthropological potential to differentiate Mestizos and Amerindian populations. PMID:23100204

  20. Beta 2 adrenergic receptor polymorphisms, at codons 16 and 27, and bronchodilator responses in adult Venezuelan asthmatic patients.

    PubMed

    Larocca, Nancy; Moreno, Dolores; Garmendia, Jenny Valentina; Velasquez, Olga; Martin-Rojo, Joana; Talamo, Carlos; Garcia, Alexis; De Sanctis, Juan Bautista

    2013-12-01

    One of the gene polymorphisms often studied in asthmatic patients is the β2 adrenergic receptor (ADRβ2). Even though in the Venezuelan Mestizo population there is a high incidence of asthma, there are no direct reports of ADRβ2 gene polymorphism, and treatment response. The aim of this study was to assess, in this population, the gene frequency of ADRβ2 polymorphisms at codons 16 Arg/Gly and 27 Gln/Glu, allergen sensitization, and its relationship to bronchodilator response. Purified genomic DNA was obtained form 105 Mestizo asthmatic and 100 Mestizo healthy individuals from Venezuela. The two polymorphisms were assessed by PCR-RFLP. Patient sensitization to aeroallergens and their response to bronchodilatation were correlated. Significant differences between patients and controls were recorded in: 1) the prevalence of Arg/Arg at codon 16 (28.6% in patients vs. 47% in controls, P<0.01), 2) the frequency of heterozygotes Arg/Gly (55% in patients vs. 35% in controls, P<0.01). Conversely, no differences in polymorphism frequencies were found at codon 27. The haplotypes Arg/Gly-Gln/Gln were more common in patients than controls (P <0.01), whereas the Arg/Arg-Gln/Glu combination prevailed in the control group (P<0.01). The Arg/Gly and Gln/Glu genotypes were associated with better responses after salbutamol. The asthmatic homozygotes Arg/Arg have higher sensitivity to aeroallergens. The difference in Arg/Arg frequency between groups suggests that this could be a protective genotype although the asthmatic group had a higher sensitivity to aeroallergens. The asthmatic heterozygotes had better bronchodilator responses than the homozygotes.

  1. Arsenic exposure and risk of preeclampsia in a Mexican mestizo population.

    PubMed

    Sandoval-Carrillo, Ada; Méndez-Hernández, Edna M; Antuna-Salcido, Elizabeth I; Salas-Pacheco, Sergio M; Vázquez-Alaniz, Fernando; Téllez-Valencia, Alfredo; Aguilar-Durán, Marisela; Barraza-Salas, Marcelo; Castellanos-Juárez, Francisco X; La Llave-León, Osmel; Salas-Pacheco, José M

    2016-07-11

    Exposure to arsenic in drinking water has been associated with various complications of pregnancy including fetal loss, low birth weight, anemia, gestational diabetes and spontaneous abortion. However, to date, there are no studies evaluating its possible association with preeclampsia. This case-control study involved 104 preeclamptic and 202 healthy pregnant women. The concentrations of arsenic in drinking water and urine were measured using a Microwave Plasma-Atomic Emission Spectrometer. We found relatively low levels of arsenic in household tap water (range of 2.48-76.02 μg/L) and in the urine of the participants (7.1 μg/L vs 6.78 μg/L in cases and controls, respectively). The analysis between groups showed for the first time that at these lower levels of exposure there is no association with preeclampsia.

  2. Insulin resistance and β-cell function in Colombian mestizo and Embera-Chamí populations and their relation with adiposity degree.

    PubMed

    Caro-Gomez, María Antonieta; Naranjo-González, Andrés; Parra-Marín, María Victoria; Gallego-Lopera, Natalia; Valencia, Diana María; Rúa-Molina, Diana Carolina; Rosique-Gracia, Javier; García-Pineda, Andres Felipe; Gómez-Isaza, Luis Felipe; Pizano-Ramírez, Norman Diego; Arcos, Edgar Gerardo; Villegas-Perrasse, Alberto; Duque-Botero, Julieta; Bedoya-Berrío, Gabriel

    2017-04-01

    Insulin resistance (IR) is a condition favored by metabolic and endocrine changes experienced by adipose tissue in the context of obesity. The prevalence and the presentation of both IR and obesity vary among the populations, and may be affected by ancestral genetic composition among other factors. The aim of this study was to compare the presence of IR and obesity in Amerindians of the Embera-Chamí ethnicity and Colombian mestizo population. A sample of 630 individuals, 471 mestizos and 159 Amerindians of the Embera-Chamí ethnicity, from the general population of Colombia were studied. For each participant, anthropometric and biochemical measurements, as well as blood pressure and the Homeostatic Model Assessment (HOMA) of IR and β-cell function (%B) were recorded. These values were compared between the two populations. While prevalence of central obesity was similar in both populations (48.7% and 42.6% in the mestizo and Embera groups respectively; p=0.148), body mass index (BMI) values suggested a higher prevalence of overweight in the Embera than in mestizo population (43.4% Embera, 31.8% mestizo; p=0.027). Despite the similarities in the prevalence of HOMA-IR and HOMA-%B status between both populations, the Embera population had a significantly greater pancreatic β-cell function, higher insulin levels, and better glucose control, across BMI and central obesity categories, than the mestizo population. There are differences in aspects related to energy metabolism between the samples of the mestizo and Amerindian populations analyzed. Copyright © 2017 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

  3. [Prevalence of asthma in Tepehuano and Mestizo school children from Durango, Mexico].

    PubMed

    Esquivel, Cosme Alvarado; Pérez, Vicente Cisneros; Arredondo, Domingo Moreno; Iturbide, María Sandoval; Hernández, Albertino de la Rosa; Arellano, Andrés González

    2008-01-01

    There is a lack of information concerning the prevalence of asthma among ethnic groups of Mexico. Therefore, we sought to determine the prevalence of asthma in school children of two ethnic groups (Tepehuanos and Mestizos) of Durango state, Mexico. To determine the prevalence of asthma in school children from two ethnic groups of Durango, Mexico. Four hundred and eight school children of Mestizo ethnicity and all 327 school children of Tepehuano ethnicity of the whole Tepehuano region of Durango state participated in the study. All children or their parents submitted the ISAAC questionnaire. For Tepehuano population a translator helped in submitting the questionnaires. Confirmation of asthma was performed by clinical examination, skin prick tests, and spirometry. Thirty two (7.8%; 95% CI: 5.5-10.8) Mestizo children and twelve (3.7%; 95% CI 2.0-6.2) Tepehuano children were found as suggestive of suffering from asthma (wheeze ever) by using the ISAAC questionnaire and were further evaluated by clinical examination, skin prick test, and in some cases by spirometry. Asthma was confirmed in 30 (7.4%; 95% CI 5.1-10.2) of the Mestizo children but in none of the Tepehuano children (p < 0.001). Asthma in Mestizo children was associated with a mother or tutor who smokes at home (OR = 3.35; 95% CI: 1.48-7.59; p = 0.002). There was an absence of asthma cases among the Tepehuano school children population of Durango state, Mexico. The prevalence of asthma in our Mestizo children population is low compared to those reported in other Latin American countries. A mother or tutor who smokes at home might be a contributing factor of asthma in our Mestizo children.

  4. PTPN22 -1123G>C polymorphism and anti-cyclic citrullinated protein antibodies in rheumatoid arthritis.

    PubMed

    Muñoz-Valle, José Francisco; Padilla-Gutiérrez, Jorge Ramón; Hernández-Bello, Jorge; Ruiz-Noa, Yeniley; Valle, Yeminia; Palafox-Sánchez, Claudia Azucena; Parra-Rojas, Isela; Gutiérrez-Ureña, Sergio Ramón; Rangel-Villalobos, Hector

    2017-08-10

    The protein tyrosine phosphatase non-receptor type 22 (PTPN22) gene encodes an important negative regulator of T-cell activation, lymphoid-specific phosphatase -Lyp- and has been associated with different autoimmune disorders. The PTPN22 -1123G>C polymorphism appears to affect the transcriptional control of this gene, but to date, the biological significance of this polymorphisms on rheumatoid arthritis (RA) risk remains unknown. We evaluate the association of PTPN22 -1123G>C polymorphism with anti-cyclic citrullinated protein antibodies (anti-CCP) and risk for RA in population from Western Mexico. A transversal analytic study, which enrolled 300 RA patients classified according to ACR-EULAR criteria and 300 control subjects (CS) was conducted. The -1123 G>C polymorphism was genotyped by PCR-RFLP. The anti-CCP antibodies levels were quantified by ELISA kit. We found a higher prevalence of homozygous PTPN22 -1123CC genotype in CS than in RA patients (OR 0.41; 95% confidence interval 0.24-0.71; P=.001), suggesting a potential protective effect against RA. Concerning anti-CCP levels, the CC genotype carriers showed the lowest median levels in RA (P<.05). The PTPN22 -1123CC genotype is a protector factor to RA in a Mexican-mestizo population and is associated with low anti-CCP antibodies. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  5. Pharmacogenetic Variation in Over 100 Genes in Patients Receiving Acenocumarol

    PubMed Central

    Gonzalez-Covarrubias, Vanessa; Urena-Carrion, Javier; Villegas-Torres, Beatriz; Cossío-Aranda, J. Eduardo; Trevethan-Cravioto, Sergio; Izaguirre-Avila, Raul; Fiscal-López, O. Javier; Soberon, Xavier

    2017-01-01

    Coumarins are widely prescribed worldwide, and in Mexico acenocumarol is the preferred form. It is well known that despite its efficacy, coumarins show a high variability for dose requirements. We investigated the pharmacogenetic variation of 110 genes in patients receiving acenocumarol using a targeted NGS approach. We report relevant population differentiation for variants on CYP2C8, CYP2C19, CYP4F11, CYP4F2, PROS, and GGCX, VKORC1, CYP2C18, NQO1. A higher proportion of novel-to-known variants for 10 genes was identified on 41 core pharmacogenomics genes related to the PK (29), PD (3), of coumarins, and coagulation proteins (9) including, CYP1A1, CYP3A4, CYP3A5, and F8, and a low proportion of novel-to-known variants on CYP2E1, VKORC1, and SULT1A1/2. Using a Bayesian approach, we identified variants influencing acenocumarol dosing on, VKORC1 (2), SULT1A1 (1), and CYP2D8P (1) explaining 40–55% of dose variability. A collection of pharmacogenetic variation on 110 genes related to the PK/PD of coumarins is also presented. Our results offer an initial insight into the use of a targeted NGS approach in the pharmacogenomics of coumarins in Mexican Mestizos. PMID:29218011

  6. The 3'UTR 1188A/C polymorphism of IL-12p40 is not associated with susceptibility for developing plaque psoriasis in Mestizo population from western Mexico.

    PubMed

    Sandoval-Talamantes, Ana Karen; Brito-Luna, Myrian Johanna; Fafutis-Morris, Mary; Villanueva-Quintero, Delfina Guadalupe; Graciano-Machuca, Omar; Ramírez-Dueñas, María Guadalupe; Alvarado-Navarro, Anabell

    2015-02-01

    Psoriasis is a chronic autoimmune inflammatory disease that affects the skin and the joints. Psoriasis is characterized by the keratinocyte proliferation, which is induced by cytokines Th1 and Th17. Patients with plaque psoriasis present a chronic inflammatory response with high levels of interleukin (IL)-12 and IL-23. Various single-nucleotide polymorphisms (SNP) have been identified in the IL12B gene, such as SNP 3' UTR 1188 A/C (SNP rs3212227), which has been associated with susceptibility to developing plaque psoriasis and with the production of IL-12 and IL-23 in individuals of different ethnic groups. In this study, we determined whether there is an association of SNP rs3212227 with the susceptibility of developing plaque psoriasis and with serum levels of IL-12 and IL-23 in Mestizo population in western Mexico. We included 112 patients with psoriasis and 112 clinical healthy individuals in the study. The frequencies of genotypes A/A, A/C, and C/C in patients with plaque psoriasis were 41, 53, and 6%, respectively, while in the control group, these were 37, 53, and 10%, respectively, without finding statistically significant differences between both groups (p>0.05). Although IL-12 and IL-23 serum levels were higher in patients than in controls, we found no significant differences. The group of patients with genotype CC presented the highest levels of IL-23 (p<0.05). These data suggest that the SNP rs3212227 phenotype is not associated with the risk of developing plaque psoriasis or with IL-12 and IL-23 levels in Mestizo population in western Mexico. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  7. Leptin Levels and Nutritional Status of Indigenous Tepehuán and Mestizo Subjects in Durango, Mexico

    PubMed Central

    Delgadillo Guzmán, Dealmy; Marchat Marchau, Laurence Annie; Reyes, José L.; Loera Castañeda, Verónica; Sosa Macías, Martha; García Vivas, Jessica; Asseff, Ismael Lares

    2014-01-01

    The aim of this study was to assess differences in nutritional status and their association with circulating leptin levels in the indigenous Tepehuán people of Mezquital Durango and Mestizo populations of Durango City, Mexico. A group of 128 volunteers aged 18 through 59 years were recruited for the study: 60 indigenous Tepehuán from Mezquital and 68 Mestizo individuals from Durango City. The classification of nutritional status was through body mass index (BMI). Clinical evaluations, including anthropometry and lipid profiles, were performed to ascertain the health of the participants. Circulating leptin levels were determined in blood samples after at 08 hours of fasting. The healthy subjects were classified according to BMI: 32 Tepehuán and 30 Mestizo subjects were of normal weight (NW), and 28 Tepehuán and 38 Mestizo subjects were overweight or obese (OW/O). Both NW and OW/O Tepehuán subjects showed lower leptin concentrations than the comparable Mestizo subjects. Statistical analysis showed a negative Pearson's correlation (r = −0.5; P < 0.05) between BMI and leptin levels in NW Tepehuán subjects, but no significant correlation was found in other groups. The differences found in Tepehuán compared with Mestizo subjects might be explained by poor nutritional status, which leads to scarce adipose tissue and low levels of leptin synthesis. Leptin concentration and its relationship to BMI are associated with ethnicity. PMID:24825928

  8. Leptin levels and nutritional status of indigenous Tepehuán and Mestizo subjects in Durango, Mexico.

    PubMed

    Guzmán, Dealmy Delgadillo; Marchau, Laurence Annie Marchat; Reyes, José L; Castañeda, Verónica Loera; Macías, Martha Sosa; Vivas, Jessica García; Asseff, Ismael Lares

    2014-01-01

    The aim of this study was to assess differences in nutritional status and their association with circulating leptin levels in the indigenous Tepehuán people of Mezquital Durango and Mestizo populations of Durango City, Mexico. A group of 128 volunteers aged 18 through 59 years were recruited for the study: 60 indigenous Tepehuán from Mezquital and 68 Mestizo individuals from Durango City. The classification of nutritional status was through body mass index (BMI). Clinical evaluations, including anthropometry and lipid profiles, were performed to ascertain the health of the participants. Circulating leptin levels were determined in blood samples after at 08 hours of fasting. The healthy subjects were classified according to BMI: 32 Tepehuán and 30 Mestizo subjects were of normal weight (NW), and 28 Tepehuán and 38 Mestizo subjects were overweight or obese (OW/O). Both NW and OW/O Tepehuán subjects showed lower leptin concentrations than the comparable Mestizo subjects. Statistical analysis showed a negative Pearson's correlation (r = -0.5; P < 0.05) between BMI and leptin levels in NW Tepehuán subjects, but no significant correlation was found in other groups. The differences found in Tepehuán compared with Mestizo subjects might be explained by poor nutritional status, which leads to scarce adipose tissue and low levels of leptin synthesis. Leptin concentration and its relationship to BMI are associated with ethnicity.

  9. E-cadherin expression in sporadic gastric cancer from Mexico: exon 8 and 9 deletions are infrequent events associated with poor survival.

    PubMed

    Gamboa-Dominguez, Armando; Dominguez-Fonseca, Claudia; Chavarri-Guerra, Yanin; Vargas, Roberto; Reyes-Gutierrez, Edgardo; Green, Dan; Quintanilla-Martinez, Leticia; Luber, Birgit; Busch, Raymonde; Becker, Karl-Friedrich; Becker, Ingrid; Höfler, Heinz; Fend, Falko

    2005-01-01

    Aberrant expression and mutation of E-cadherin is frequent in gastric carcinoma (GC) especially of the diffuse type. The frequency of CDH1 (gene encoding E-cadherin) mutation in populations with high incidence of diffuse GC and its prognostic significance is unknown. One hundred seventy-seven gastrectomies from Mexican mestizo patients with intestinal (53), mixed (55), or diffuse (69) GC were included. In addition, 101 endoscopic biopsies from patients with GC not subjected to surgery were analyzed. Immunohistochemistry against wild-type E-cadherin (clone 36) and against 2 mutation-specific antibodies (MSA) recognizing mutant CDH1 lacking exon-8 (del 8) or exon-9 (del 9) were performed. Staining was correlated with histotype, tumor node metastasis stage, and follow-up. Abnormal or absent E-cadherin expression (clone 36) was identified in 84% GC, predominantly in diffuse or mixed tumors (P = 0.004) in advanced stages (P = 0.003). No survival differences at 1 and 2 years were observed among patients showing normal, abnormal, or absent wild type E-cadherin expression. Overall reactivity with the MSA was observed in 10 (5.6%) patients who were treated with surgery. In 140 patients, dead from the disease or alive with the disease, the survival at 1 and 2 years was 37% versus 17% and 14% versus 0 for patients without and with del 8/9 positivity, respectively (log rank P = 0.01). Biopsies from patients with inoperable-GC (101) rendered 5 (4.95%) with del 8 or 9 immunoreactivity. Abnormal E-cadherin expression is frequent in GC. However, exon 8 or 9 deletions were observed in only 5.3% tumors in this series from Mexico, at a lower rate than previously published, but associated with a worse prognosis.

  10. [Obesity, body morphology, and blood pressure in urban and rural population groups of Yucatan].

    PubMed

    Arroyo, Pedro; Fernández, Victoria; Loría, Alvar; Pardío, Jeannette; Laviada, Hugo; Vargas-Ancona, Lizardo; Ward, Ryk

    2007-01-01

    To characterize body morphology and blood pressure of adults of the Mexican state of Yucatan. Rural-urban differences in weight, height, waist, and hip circumferences, and blood pressure were analyzed in 313 urban and 271 rural subjects. No rural-urban differences in prevalence of obesity and overweight were found. Hypertension was marginally higher in urban subjects. Rural abnormal waist circumference was higher in young men and young women. Comparison with two national surveys and a survey in the aboriginal population (rural mixtecos) showed similar prevalence of obesity as ENSA-2000 and higher than mixtecos and ENEC-1993. Abnormal waist circumference was intermediate between ENSANUT-2006 and mixtecos and hypertension was intermediate between ENEC and mixtecos. The Maya and mestizo population of Yucatan showed a high prevalence of obesity and abnormal waist circumference not accompanied by a comparable higher hypertension frequency. This finding requires further confirmation.

  11. Features associated with hematologic abnormalities and their impact in patients with systemic lupus erythematosus: Data from a multiethnic Latin American cohort.

    PubMed

    González-Naranjo, Luis A; Betancur, Octavio Martínez; Alarcón, Graciela S; Ugarte-Gil, Manuel F; Jaramillo-Arroyave, Daniel; Wojdyla, Daniel; Pons-Estel, Guillermo J; Rondón-Herrera, Federico; Vásquez-Duque, Gloria M; Quintana-López, Gerardo; Da Silva, Nilzio A; Tavares Brenol, João C; Reyes-Llerena, Gil; Pascual-Ramos, Virginia; Amigo, Mary C; Massardo, Loreto; Alfaro-Lozano, José; Segami, María I; Esteva-Spinetti, María H; Iglesias-Gamarra, Antonio; Pons-Estel, Bernardo A

    2016-06-01

    To examine hematological manifestations' correlates and their impact on damage accrual and mortality in SLE patients from the multiethnic, Latin American, GLADEL cohort. In patients with recent SLE diagnosis (≤2 years), the association between follow-up hematological manifestations (per ACR criteria) and socio-demographic and clinical variables was examined by univariable and multivariable logistic regressions; their impact on damage accrual and mortality was examined by Poisson and Cox proportional-hazards regression analyses, respectively. Of 1437 patients, 948 (66.0%) developed ≥1 hematological manifestation [5.5% hemolytic anemia (AHA), 16.3% thrombocytopenia, and 56.4% lymphopenia] over 4.3 (3.3) follow-up years. Younger age, Mestizo ethnicity, hematologic disorder (at/or before SLE diagnosis), and first damage recorded were associated with hematological manifestations while antimalarials were negatively associated. AHA (at/or before SLE diagnosis), anti-Sm, and anti-RNP antibodies were associated with subsequent AHA occurrence while musculoskeletal involvement was negatively associated. Thrombocytopenia (at/or before SLE diagnosis), AHA, anti-phospholipid antibodies (aPLs), anti-SSA/Ro, anti-SSB/La antibodies, and first damage recorded were associated with later thrombocytopenia occurrence. Lymphopenia (at/or before SLE diagnosis), younger age at diagnosis, Mestizo ethnicity, having medical insurance, and first damage recorded were associated with subsequent lymphopenia occurrence while antimalarials and azathioprine treatment were negatively associated. AHA was associated with damage accrual and mortality after adjusting for variables known to affect these outcomes. Mestizo ethnicity and early hematological manifestations are risk factors for their subsequent occurrence while antimalarials have a protective effect. The associations between AHA and aPLs and thrombocytopenia were corroborated. AHA contributes independently to damage accrual and diminished survival. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study

    PubMed Central

    2013-01-01

    Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of vaginal lactobacilli colonisation and richness in this particular population. PMID:23617246

  13. Biochemical differences in ethnic groups in Durango, Mexico.

    PubMed

    Lares-Asseff, Ismael; Lujín-García, Azalia; Sosa-Macías, Martha; Lazalde-Ramos, Blanca; Loera-Castañeda, Veronica; Galaviz-Hernández, Carlos; Villanueva-Fierro, Ignacio

    2012-01-01

    The aim of this study was to assess biochemical differences between Tepehuano indigenous people, and Mennonite and Mestizo populations of Durango, Mexico. Our study involved 334 volunteers aged 15 to 80 years; 132 Mennonite and 130 Mestizo individuals from Nuevo Ideal Municipality and 72 Tepehuano indigenous people from Mezquital Durango were evaluated. A clinical history and fast determination of aspartate aminotransferase (AST), alanine aminotransferase (ALT), uric acid, urea and creatinine were performed on each studied case. Statistically significant differences between the three studied groups were found for age, weight and height (P < .05), with higher values observed in men. The highest plasma urea levels were found in Mennonite compared to Mestizo people, followed by the Tepehuano indigenous. Higher biochemical parameters were found in men (vs women) in the studied groups. The percentage of individuals with abnormal levels for AST, ALT and uric acid were higher in Tepehuano indigenous people than in Mestizo, whereas the urea and creatinine percentages were higher in Mestizo people. The differences found on biochemical tests, could be explained by differences in lifestyle such as diet and sanitary habits.

  14. Evaluation of the contribution of D9S1120 to anthropological studies in Native American populations.

    PubMed

    Aguilar-Velázquez, J A; Martínez-Sevilla, V Manuel; Sosa-Macías, M; González-Martin, A; Muñoz-Valle, J F; Rangel-Villalobos, H

    2017-12-01

    The D9S1120 locus exhibits a population-specific allele of 9 repeats (9RA) in all Native American and two Siberian populations currently studied, but it is absent in other worldwide populations. Although this feature has been used in anthropological genetic studies, its impact on the evaluation of the structure and genetic relations among Native American populations has been scarcely assessed. Consequently, the aim of this study was to evaluate the anthropological impact of D9S1120 when it was added to STR population datasets in Mexican Native American groups. We analyzed D9S1120 by PCR and capillary electrophoresis (CE) in 1117 unrelated individuals from 13 native groups from the north and west of Mexico. Additional worldwide populations previously studied with D9S1120 and/or 15 autosomal STRs (Identifier kit) were included for interpopulation analyses. We report statistical results of forensic importance for D9S1120. On average, the modal alleles were the Native American-specific allele 9RA (0.3254) and 16 (0.3362). Genetic distances between Native American and worldwide populations were estimated. When D9S1120 was included in the 15 STR population dataset, we observed improvements for admixture estimation in Mestizo populations and for representing congruent genetic relationships in dendrograms. Analysis of molecular variance (AMOVA) based on D9S1120 confirms that most of the genetic variability in the Mexican population is attributable to their Native American backgrounds, and allows the detection of significant intercontinental differentiation attributed to the exclusive presence of 9RA in America. Our findings demonstrate the contribution of D9S1120 to a better understanding of the genetic relationships and structure among Mexican Native groups. Copyright © 2017 Elsevier GmbH. All rights reserved.

  15. Analysis of PTPN22, ZFAT and MYO9B polymorphisms in Turner Syndrome and risk of autoimmune disease.

    PubMed

    Villanueva-Ortega, E; Ahedo, B; Fonseca-Sánchez, M A; Pérez-Durán, J; Garibay-Nieto, N; Macías-Galavíz, M T; Trujillo-Cabrera, Y; García-Latorre, E; Queipo, G

    2017-08-01

    Turner syndrome (TS) is one of the most common sexual chromosome abnormalities and is clearly associated with an increased risk of autoimmune diseases, particularly thyroid disease and coeliac disease (CD). Single-nucleotide polymorphism analyses have been shown to provide correlative evidence that specific genes are associated with autoimmune disease. Our aim was to study the functional polymorphic variants of PTPN22 and ZFAT in relation to thyroid disease and those of MYO9B in relation to CD. A cross-sectional comparative analysis was performed on Mexican mestizo patients with TS and age-matched healthy females. Our data showed that PTPN22 C1858T (considered a risk variant) is not associated with TS (X 2  = 3.50, p = .61, and OR = 0.33 [95% CI = 0.10-1.10]). Also, ZFAT was not associated with TS (X 2  = 1.2, p = .28, and OR = 1.22 [95% CI = 0.84-1.79]). However, for the first time, rs2305767 MYO9B was revealed to have a strong association with TS (X 2  = 58.6, p = .0001, and OR = 10.44 [95% C = 5.51-19.80]), supporting a high level of predisposition to CD among TS patients. This report addresses additional data regarding the polymorphic variants associated with autoimmune disease, one of the most common complications in TS. © 2017 John Wiley & Sons Ltd.

  16. Effects of Ethnic Attributes on the Quality of Family Planning Services in Lima, Peru: A Randomized Crossover Trial

    PubMed Central

    Planas, Maria-Elena; García, Patricia J.; Bustelo, Monserrat; Carcamo, Cesar P.; Martinez, Sebastian; Nopo, Hugo; Rodriguez, Julio; Merino, Maria-Fernanda; Morrison, Andrew

    2015-01-01

    Most studies reporting ethnic disparities in the quality of healthcare come from developed countries and rely on observational methods. We conducted the first experimental study to evaluate whether health providers in Peru provide differential quality of care for family planning services, based on the indigenous or mestizo (mixed ethnoracial ancestry) profile of the patient. In a crossover randomized controlled trial conducted in 2012, a sample of 351 out of the 408 public health establishments in Metropolitan Lima, Peru were randomly assigned to receive unannounced simulated patients enacting indigenous and mestizo profiles (sequence-1) or mestizo and then indigenous profiles (sequence-2), with a five week wash-out period. Both ethnic profiles used the same scripted scenario for seeking contraceptive advice but had distinctive cultural attributes such as clothing, styling of hair, make-up, accessories, posture and patterns of movement and speech. Our primary outcome measure of quality of care is the proportion of technical tasks performed by providers, as established by Peruvian family planning clinical guidelines. Providers and data analysts were kept blinded to the allocation. We found a non-significant mean difference of -0·7% (p = 0·23) between ethnic profiles in the percentage of technical tasks performed by providers. However we report large deficiencies in the compliance with quality standards of care for both profiles. Differential provider behaviour based on the patient's ethnic profiles compared in the study did not contribute to deficiencies in family planning outcomes observed. The study highlights the need to explore other determinants for poor compliance with quality standards, including demand and supply side factors, and calls for interventions to improve the quality of care for family planning services in Metropolitan Lima. PMID:25671664

  17. Cardiovascular health status and metabolic syndrome in Ecuadorian natives/Mestizos aged 40 years or more with and without stroke and ischemic heart disease--an atahualpa project case-control nested study.

    PubMed

    Del Brutto, Oscar H; Mera, Robertino M; Montalván, Martha; Del Brutto, Victor J; Zambrano, Mauricio; Santamaría, Milton; Tettamanti, Daniel

    2014-04-01

    Knowledge of regional-specific cardiovascular risk factors is mandatory to reduce the growing burden of stroke and ischemic heart disease in Latin American populations. We conducted a population-based case-control study to assess which risk factors are associated with the occurrence of vascular events in natives/mestizos living in rural coastal Ecuador. We assessed the cardiovascular health (CVH) status and the presence of the metabolic syndrome in all Atahualpa residents aged 40 years or more with stroke and ischemic heart disease and in randomly selected healthy persons to evaluate differences in the prevalence of such risk factors between patients and controls. A total of 120 persons (24 with stroke or ischemic heart disease and 96 matched controls) were included. A poor CVH status (according to the American Heart Association) was found in 87.5% case-patients and 81.3% controls (P = .464). The metabolic syndrome was present in the same proportion (58.3%) of case-patients and controls. Likewise, both sets of risk factors (poor CVH status and the metabolic syndrome) were equally prevalent among both groups (58.3% versus 49%, P = .501). This case-control study suggests that none of the measured risk factors is associated with the occurrence of vascular events. It is possible that some yet unmeasured risk factors or an unknown genetic predisposition may account for a sizable proportion of stroke and ischemic heart disease occurring in the native/mestizo population of rural coastal Ecuador. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  18. Effects of ethnic attributes on the quality of family planning services in Lima, Peru: a randomized crossover trial.

    PubMed

    Planas, Maria-Elena; García, Patricia J; Bustelo, Monserrat; Carcamo, Cesar P; Martinez, Sebastian; Nopo, Hugo; Rodriguez, Julio; Merino, Maria-Fernanda; Morrison, Andrew

    2015-01-01

    Most studies reporting ethnic disparities in the quality of healthcare come from developed countries and rely on observational methods. We conducted the first experimental study to evaluate whether health providers in Peru provide differential quality of care for family planning services, based on the indigenous or mestizo (mixed ethnoracial ancestry) profile of the patient. In a crossover randomized controlled trial conducted in 2012, a sample of 351 out of the 408 public health establishments in Metropolitan Lima, Peru were randomly assigned to receive unannounced simulated patients enacting indigenous and mestizo profiles (sequence-1) or mestizo and then indigenous profiles (sequence-2), with a five week wash-out period. Both ethnic profiles used the same scripted scenario for seeking contraceptive advice but had distinctive cultural attributes such as clothing, styling of hair, make-up, accessories, posture and patterns of movement and speech. Our primary outcome measure of quality of care is the proportion of technical tasks performed by providers, as established by Peruvian family planning clinical guidelines. Providers and data analysts were kept blinded to the allocation. We found a non-significant mean difference of -0.7% (p = 0.23) between ethnic profiles in the percentage of technical tasks performed by providers. However we report large deficiencies in the compliance with quality standards of care for both profiles. Differential provider behaviour based on the patient's ethnic profiles compared in the study did not contribute to deficiencies in family planning outcomes observed. The study highlights the need to explore other determinants for poor compliance with quality standards, including demand and supply side factors, and calls for interventions to improve the quality of care for family planning services in Metropolitan Lima.

  19. Common gene variants interactions related to uric acid transport are associated with knee osteoarthritis susceptibility.

    PubMed

    Fernández-Torres, Javier; Martínez-Nava, Gabriela Angélica; Oliviero, Francesca; López-Reyes, Alberto Gabriel; Martínez-Flores, Karina; Garrido-Rodríguez, Daniela; Francisco-Balderas, Adriana; Zamudio-Cuevas, Yessica

    2018-06-01

    Background The presence of genetic variants in the uric acid (UA) transporters can be associated with hyperuricemia, and therefore with an increased risk of monosodium urate (MSU) crystal precipitation. The inflammatory process triggered by these crystals lead to cartilage damage which, in turn, could promote knee osteoarthritis (KOA). Objective To determine whether genetic polymorphisms of the UA transporters and its interactions are associated with KOA. Materials and Methods Two hundred forty-three unrelated Mexican-mestizo individuals were recruited for this case control-study. Ninety-three of them were KOA patients but without gout, and one hundred and fifty healthy individuals with no symptoms or signs of KOA were recruited as controls. Forty-one single nucleotide polymorphisms (SNPs) involved in the UA transporters were genotyped with OpenArray technology in a QuantStudio 12K flex-System both cases and controls. Results After adjusting by age, gender, BMI and ancestry, significant associations were found for 8 SNPs: rs1260326 (GCKR), rs780093 (GCKR), rs17050272 (INHBB), rs1471633 (PDZK1), rs12129861 (PDZK1), rs7193778 (IGF1R), rs17786744 (STC1) and rs1106766 (R3HDM2). With respect to gene-gene interactions, the pairwise interactions of rs112129861 (PDZK1) and rs7193778 (IGF1R); rs17050272 (INHBB) and rs1106766 (R3HDM2); rs1106766 (R3HDM2) and rs780093 (GCKR); rs1260326 (GCKR) and rs17786744 (STC1); and rs17786744 (STC1) and rs1106766 (R3HDM2), make it possible to visualize the synergistic or antagonistic effect of their genotypes or alleles on KOA development. Conclusions Our preliminary results show that the common gene variants related with the UA transport are associated with KOA in the Mexican population. Further studies must be done to corroborate it.

  20. Lactase non-persistence and general patterns of dairy intake in indigenous and mestizo chilean populations.

    PubMed

    Fernández, Catalina I; Montalva, Nicolás; Arias, Macarena; Hevia, Macarena; Moraga, Mauricio L; Flores, Sergio V

    2016-01-01

    Lactase persistence (LP) is a genetic trait that has been studied among different countries and ethnic groups. In Latin America, the frequencies of this trait have been shown to vary according to the degree of admixture of the populations. The objective of this study is to better understand the relationship between this genetic trait and dairy intake in a multiethnic context through a synthesis of studies conducted in four regions of Chile. Genotypes frequencies for the SNP LCT-13910C>T (rs4988235) and frequency of dairy consumption were obtained from four populations: Polynesians from Easter Island (Rapanui); Amerindians (Mapuche) and Mestizos from the Araucanía region; urban Mestizos from Santiago; and rural Mestizos from the Coquimbo region. Genetic differentiation and association between milk consumption and genotype frequencies were estimated. Genetic differentiation between Native and Mestizo populations was significant; the LP frequency in Mapuche and Rapanui was 10% and 25%, respectively, whereas among the Mestizos, LP frequency was near 40%. Dairy intake was below the nutritional recommendations for the four groups, and extremely below recommendations among the indigenous populations. Association between milk intake and LP was found in Santiago and Rapanui populations. Although the frequency of LP varies among the populations according to their degree of admixture, dairy consumption was very low across the populations. Given that the association between milk consumption and expected phenotype was found only in two of the populations analyzed, it seems that lactase non-persistence (LNP) is not the only cause for dairy avoidance. Thus, it is suggested that SES and cultural preferences are likely affecting dairy consumption. © 2015 Wiley Periodicals, Inc.

  1. The Light Infantry Division Regionally Focused for Low Intensity Conflict

    DTIC Science & Technology

    1990-06-01

    The= offical languages are Spanish, Quechua and Aymara. (3) Education: Illiteracy: 20%. (4) Ethnic Composition: Indian 45%; mestizo 37%; Caucasian 15... Quechua , and Aymara are the offical languages. (3) Education: Illiteracy: 37%. (4) Ethnic Composition: Quechua 30%; Aymara 25%; Mestizo 31%; European

  2. Amazonian plants from Peru used by Quechua and Mestizo to treat malaria with evaluation of their activity.

    PubMed

    Roumy, V; Garcia-Pizango, G; Gutierrez-Choquevilca, A-L; Ruiz, L; Jullian, V; Winterton, P; Fabre, N; Moulis, C; Valentin, A

    2007-07-25

    Indigenous Quechua and Mestizo populations from distinct areas in Loreto, Peru, were interviewed about traditional medication for the treatment of malaria. An ethnographic survey concerning the native theory of illness aetiology in the specific case of malaria permitted the elaboration of an efficient ethnopharmacological enquiry. The survey took place on three main zones corresponding to villages on the Napo and the Pastaza rivers (for the Quechua), and in the surroundings of Iquitos (for the Mestizos) and led to the collection of 14 plants. Serial extractions in hexane, dichloromethane, and methanol were performed on the different parts of the plants collected. The extracts were then tested for antiplasmodial activity in vitro. Seven plants displayed antiplasmodial activity (IC(50) from 2 to 25 microg/mL) and usually low cytotoxicity, indicating their antiplasmodial specificity. The results give scientific validation to the traditional medical knowledge of Quechua and Mestizo populations from Loreto and confirm a source of potentially active plants.

  3. Polymorphisms of alcohol metabolizing enzymes in indigenous Mexican population: unusual high frequency of CYP2E1*c2 allele.

    PubMed

    Gordillo-Bastidas, Elizabeth; Panduro, Arturo; Gordillo-Bastidas, Daniela; Zepeda-Carrillo, Eloy A; García-Bañuelos, Jesús J; Muñoz-Valle, José F; Bastidas-Ramírez, Blanca E

    2010-01-01

    Alcohol abuse represents the major identified etiological factor of cirrhosis in México. ADH1B, ALDH2, and CYP2E1 have been considered candidate genes in alcohol-related diseases. Controversial results probably due to ethnic differences, among other factors, have been reported. Mexican Mestizos (MES) derive from the combination of indigenous, Spaniard, and African genes. Huichols (HUI) constitute an indigenous group from western Mexico with no racial admixture. We determined ADH1B*2, ALDH2*2, and CYP2E1*c2 allele frequencies in healthy HUI and MES from western Mexico. Lipid and hepatic profile were also carried out. One hundred and one HUI and 331 MES subjects were studied. Genotype and allele frequency were assessed through polymerase chain reaction-restriction fragment length polymorphism after DNA isolation from peripheral leukocytes. Commercial kits for lipid and hepatic determinations were used. Polymorphic allele distribution in HUI was: 0%ADH1B*2, 0.5%ALDH2*2, 51.5%CYP2E1*c2; in MES: 3.4%ADH1B*2, 0%ALDH2*2, 16.1%CYP2E1*c2. Frequency of ADH1B*2 was statistically (p < 0.001) lower in HUI than MES. CYP2E1*c2 polymorphic allele was significantly higher (p < 0.0001) in HUI than MES. Hepatic profile was normal in both groups. HUI showed a better lipid profile than MES independently of genotype. Huichols exhibited the highest CYP2E1*c2 allele frequency of the world documented up to this date; meanwhile, ADH1B*2 and ALDH2*2 were practically absent. This feature could be useful in the understanding of Mexican population gene composition, alcohol metabolism, and alcoholic liver disease development. However, further association studies are necessary. The heterogeneity of Mexican population was evidenced by the significantly different distribution of CYP2E1*c2 allele observed among different regions of the country. Lipid and hepatic values were not associated to genotype. This report constitutes the first study dealing with gene polymorphisms of alcohol metabolizing enzymes conducted in HUI.

  4. [High frequency of ancestral allele of the TJP1 polymorphism rs2291166 in Mexican population, conformational effect and applications in surgery and medicine].

    PubMed

    Ramirez-Garcia, Sergio Alberto; Flores-Alvarado, Luis Javier; Topete-González, Luz Rosalba; Charles-Niño, Claudia; Mazariegos-Rubi, Manuel; Dávalos-Rodríguez, Nory Omayra

    2016-01-01

    TJP1 gene encodes a ZO-1 protein that is required for the recruitment of occludins and claudins in tight junction, and is involved in cell polarisation. It has different variations, the frequency of which has been studied in different populations. In Mexico there are no studies of this gene. These are required because their polymorphisms can be used in studies associated with medicine and surgery. Therefore, the aim of this study was to estimate the frequency of alleles and genotypes of rs2291166 gene polymorphism TJP1 in Mexico Mestizos population, and to estimate the conformational effect of an amino acid change. A total of 473 individuals were included. The rs2291166 polymorphism was identified PASA PCR-7% PAGE, and stained with silver nitrate. The conformational effect of amino acid change was performed in silico, and was carried out with servers ProtPraram Tool and Search Database with Fasta. The most frequent allele in the two populations is the ancestral allele (T). A genotype distribution similar to other populations was found. The polymorphism is in Hardy-Weinberg, p>0.05. Changing aspartate to alanine produced a conformational change. The study reveals a high frequency of the ancestral allele at rs2291166 polymorphism in the Mexican population. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

  5. [Reference values for the blood coagulation tests in Mexico: usefulness of the pooled plasma from blood donors].

    PubMed

    Calzada-Contreras, Adriana; Moreno-Hernández, Manuel; Castillo-Torres, Noemi Patricia; Souto-Rosillo, Guadalupe; Hernández-Juárez, Jesús; Ricardo-Moreno, María Tania; Sánchez-Fernández, Maria Guadalupe de Jesús; García-González, América; Majluf-Cruz, Abraham

    2012-01-01

    The blood coagulation system maintains the blood in a liquid state and bleeding and thrombosis are the manifestations of its malfunction. Blood coagulation laboratory evaluates the physiology of this system. To establish both, the reference values for several tests performed at the blood coagulation laboratory as well as the utility of the pooled plasma to perform these assays. MATERIAL AND: In this descriptive, cross-sectional, randomized study, we collected plasma from Mexican Mestizos. Each pooled plasma was prepared with the plasma from at least 20 blood donors. We performed screening and special tests and the Levey-Jennings graphs were built and interpreted after each pass. Results of the tests were analyzed and their distribution was established using the Kolmogorov-Smirnov test. To establish the reference values we used 95% confidence intervals. We collected 72 pooled plasmas. The distribution for PT, APTT, and TT tests was abnormal. Although the PT test showed a bimodal distribution it was normal for factor VII. The reference values for the hemostatic, anticoagulant, and fibrinolytic factors were different from those suggested by the manufacturers. We established the reference values for the blood coagulation tests in the adult Mexican population. We have shown that the pooled plasma must be used for the screening tests. We suggest that each clinical laboratory should establish its own reference values (at least for the screening tests). To reach this objective, we encourage the use of the pooled plasma.

  6. Genetic, metabolic and environmental factors involved in the development of liver cirrhosis in Mexico

    PubMed Central

    Ramos-Lopez, Omar; Martinez-Lopez, Erika; Roman, Sonia; Fierro, Nora A; Panduro, Arturo

    2015-01-01

    Liver cirrhosis (LC) is a chronic illness caused by inflammatory responses and progressive fibrosis. Globally, the most common causes of chronic liver disease include persistent alcohol abuse, followed by viral hepatitis infections and nonalcoholic fatty liver disease. However, regardless of the etiological factors, the susceptibility and degree of liver damage may be influenced by genetic polymorphisms that are associated with distinct ethnic and cultural backgrounds. Consequently, metabolic genes are influenced by variable environmental lifestyle factors, such as diet, physical inactivity, and emotional stress, which are associated with regional differences among populations. This Topic Highlight will focus on the genetic and environmental factors that may influence the metabolism of alcohol and nutrients in the setting of distinct etiologies of liver disease. The interaction between genes and environment in the current-day admixed population, Mestizo and Native Mexican, will be described. Additionally, genes involved in immune regulation, insulin sensitivity, oxidative stress and extracellular matrix deposition may modulate the degree of severity. In conclusion, LC is a complex disease. The onset, progression, and clinical outcome of LC among the Mexican population are influenced by specific genetic and environmental factors. Among these are an admixed genome with a heterogenic distribution of European, Amerindian and African ancestry; a high score of alcohol consumption; viral infections; a hepatopathogenic diet; and a high prevalence of obesity. The variance in risk factors among populations suggests that intervention strategies directed towards the prevention and management of LC should be tailored according to such population-based features. PMID:26556986

  7. Helicobacter pylori Infection in Rural and Urban Dyspeptic Patients from Venezuela

    PubMed Central

    Contreras, Monica; Fernández-Delgado, Milagro; Reyes, Nelson; García-Amado, María Alexandra; Rojas, Héctor; Michelangeli, Fabian

    2015-01-01

    The goal of this work was to assess the Helicobacter pylori prevalence in a rural mestizo population and compare it to an urban population from Venezuela. The study was performed in gastric juice samples of 71 dyspeptic patients from Caracas (urban) and 39 from Tucupita (rural), in the Orinoco Delta region. Helicobacter pylori was detected by amplification of 16S rRNA, glmM, and ureA genes in 55.0% patients from urban and 87.2% from rural populations. cagA was found positive in 51% and 62% urban and rural patients, respectively. Non-H. pylori Helicobacter species were not detected in the urban population, but was found in 7.7% of patients in the rural study site. Frequency values of the 16S rRNA, glmM, and ureA genes were higher in the rural population. The odds ratio for each gene was 15.18 for 16S rRNA, 2.34 for glmM, 2.89 for ureA, and 1.53 cagA, showing significant differences except for cagA when gene frequency was compared in both populations. These results demonstrate a higher frequency of H. pylori and gastric non-H. pylori Helicobacter infection in a rural mestizo population with low hygienic standards as compared with city dwellers, representing a potential risk for the development of gastroduodenal diseases. PMID:26195456

  8. Disease Severity in Patients Infected with Leishmania mexicana Relates to IL-1β

    PubMed Central

    Fernández-Figueroa, Edith A.; Rangel-Escareño, Claudia; Espinosa-Mateos, Valeria; Carrillo-Sánchez, Karol; Salaiza-Suazo, Norma; Carrada-Figueroa, Georgina; March-Mifsut, Santiago; Becker, Ingeborg

    2012-01-01

    Leishmania mexicana can cause both localized (LCL) and diffuse (DCL) cutaneous leishmaniasis, yet little is known about factors regulating disease severity in these patients. We analyzed if the disease was associated with single nucleotide polymorphisms (SNPs) in IL-1β (−511), CXCL8 (−251) and/or the inhibitor IL-1RA (+2018) in 58 Mexican mestizo patients with LCL, 6 with DCL and 123 control cases. Additionally, we analyzed the in vitro production of IL-1β by monocytes, the expression of this cytokine in sera of these patients, as well as the tissue distribution of IL-1β and the number of parasites in lesions of LCL and DCL patients. Our results show a significant difference in the distribution of IL-1β (−511 C/T) genotypes between patients and controls (heterozygous OR), with respect to the reference group CC, which was estimated with a value of 3.23, 95% CI = (1.2, 8.7) and p-value = 0.0167), indicating that IL-1β (−511 C/T) represents a variable influencing the risk to develop the disease in patients infected with Leishmania mexicana. Additionally, an increased in vitro production of IL-1β by monocytes and an increased serum expression of the cytokine correlated with the severity of the disease, since it was significantly higher in DCL patients heavily infected with Leishmania mexicana. The distribution of IL-1β in lesions also varied according to the number of parasites harbored in the tissues: in heavily infected LCL patients and in all DCL patients, the cytokine was scattered diffusely throughout the lesion. In contrast, in LCL patients with lower numbers of parasites in the lesions, IL-1β was confined to the cells. These data suggest that IL-1β possibly is a key player determining the severity of the disease in DCL patients. The analysis of polymorphisms in CXCL8 and IL-1RA showed no differences between patients with different disease severities or between patients and controls. PMID:22629474

  9. Impact of immigration on the clinical expression of systemic lupus erythematosus: a comparative study of Hispanic patients residing in the USA and Mexico.

    PubMed

    Uribe, América G; Romero-Díaz, Juanita; Apte, Mandar; Fernández, Mónica; Burgos, Paula I; Reveille, John D; Sánchez-Guerrero, Jorge; Alarcón, Graciela S

    2009-11-01

    To compare the socio-economic characteristics, clinical features and health-related quality of life in Hispanic SLE patients residing in Mexico and in the Southwest USA (Mexican and Texan, herein). Mexican and Texan SLE patients (fulfilling ACR criteria) participating in separate longitudinal outcome studies were evaluated. Texan patients were randomly chosen to match total disease duration with the Mexican patients. Cross-sectional data for the Mexican patients were obtained by a US-trained investigator who had previously participated in data collection for the cohort to which the Texan patients belonged. Socio-economic and -demographic characteristics, clinical characteristics, disease activity (with SLAM-Revised), damage accrual (with SLICC/ACR Damage Index) and self-reported function (with Short Form-36) were compared between the two groups. Seventy Mexican patients were matched with either one or two Texan patients (n = 94) for a total of 164 patients. Mexican patients were younger. In age-adjusted analyses, the Mexican patients were more educated, had better health-related quality of life and overall less systemic SLE manifestations. Mexican patients were exposed more frequently to AZA. Texan patients had more severe disease than the Mexican patients. In multivariable analyses, Texan Hispanic ethnicity was significantly associated with high disease activity, but significance was not reached for damage. The discrepant findings observed between these two Hispanic groups of SLE patients may reflect socio-economic or biological factors. Given the global phenomenon of immigration, rheumatologists should be aware of the overall course and outcome of immigrant SLE patients if undesirable outcomes are to be prevented.

  10. Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

    PubMed Central

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

  11. Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

    PubMed

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

  12. [Relation of leptin in plasma with oxidative damage in indigenous tepehuán and mestizo populations from Durango].

    PubMed

    Delgadillo-Guzmán, Dealmy; Quintanar-Escorza, Martha Angélica; Carrera-Gracia, Manuela de la A; Lares-Aseff, Ismael

    2015-01-01

    Obesity is a multifactorial metabolic disorder that involves lipid peroxidation (LPX), activating the antioxidant systems to counteract cellular damage. Objective: To evaluate the correlation between the antioxidant capacity and LPX levels of /eptin, in indigenous Tepehuan and Mestizo populations of the State of Durango. We conducted a nutritional clinical study and lipid profile to confirm the state of health of a group of 60 indigenous Tepehuan of Mezquital and 68 mestizos subjects of Durango city, aged between 18 to 59 years. We determined the concentrations of leptin, antioxidant capacity and LPX in fasting conditions on plasma of participants, comparing averages, minimum, maximum, and standard deviation through ANOVA and Kruskai-Wal/is. For the correlation of variables, Pearson test was applied, getting the r value. Leptin levels were lower in indigenous Tepehuan than mestizos independent of body mass index. Mestizo subjects and Tepehuan with overweight and obesity (OW/0) or both ethnic groups show a greater degree of LPX (3.39 ± 0.31, 2.72 ± 0.54 MDA J.lmol/1, respectively; p < 0.05); however, OW/0 mestizos show more activation of its (0.37±0. 03 meqltrolox) than Tepehuan normal weight (NW) and OW/0 (0.32 ±0. 01 meq/trolox). The correlation between antioxidant capacity and LPX in mixed OW/0 was positive (r = 0.9; p < 0. 001). There is a correlation between levels of leptin and the antioxidant capacity of Tepehuan subjects both NW and OW/0 (r = 0.40; p < 0.05 and r = -0.66; p < 0.0001, respectively). Tepehuan groups with OW/0 have less oxidative damage, while antioxidant mechanisms have a smaller activation than the top crosses of the same nutritional condition. The results suggest that antioxidant capacity has an implication on the regulation of leptin levels in Tepehuan subjects.

  13. 16 de Septiembre, 1810 Module. Secondary Level. [16 of September, 1810 Module. Secondary Level.

    ERIC Educational Resources Information Center

    Crystal City Independent School District, TX.

    Independence for Mexico took 11 years to achieve. Before its independence Mexico was ruled by Spain and had a basic caste system of indios, mestizos, criollos, and gachupines. The gachupines and criollos ruled the government and exploited the indios and mestizos. When the criollos became dissatisfied with being secondary to the gachupines, they…

  14. Impact of immigration on the clinical expression of systemic lupus erythematosus: a comparative study of Hispanic patients residing in the USA and Mexico

    PubMed Central

    Uribe, América G.; Romero-Díaz, Juanita; Apte, Mandar; Fernández, Mónica; Burgos, Paula I.; Reveille, John D.; Sánchez-Guerrero, Jorge

    2009-01-01

    Objective. To compare the socio-economic characteristics, clinical features and health-related quality of life in Hispanic SLE patients residing in Mexico and in the Southwest USA (Mexican and Texan, herein). Methods. Mexican and Texan SLE patients (fulfilling ACR criteria) participating in separate longitudinal outcome studies were evaluated. Texan patients were randomly chosen to match total disease duration with the Mexican patients. Cross-sectional data for the Mexican patients were obtained by a US-trained investigator who had previously participated in data collection for the cohort to which the Texan patients belonged. Socio-economic and -demographic characteristics, clinical characteristics, disease activity (with SLAM-Revised), damage accrual (with SLICC/ACR Damage Index) and self-reported function (with Short Form-36) were compared between the two groups. Results. Seventy Mexican patients were matched with either one or two Texan patients (n = 94) for a total of 164 patients. Mexican patients were younger. In age-adjusted analyses, the Mexican patients were more educated, had better health-related quality of life and overall less systemic SLE manifestations. Mexican patients were exposed more frequently to AZA. Conclusions. Texan patients had more severe disease than the Mexican patients. In multivariable analyses, Texan Hispanic ethnicity was significantly associated with high disease activity, but significance was not reached for damage. The discrepant findings observed between these two Hispanic groups of SLE patients may reflect socio-economic or biological factors. Given the global phenomenon of immigration, rheumatologists should be aware of the overall course and outcome of immigrant SLE patients if undesirable outcomes are to be prevented. PMID:19717548

  15. Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

    PubMed

    González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

    2018-02-03

    The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

  16. Disseminated Tuberculosis and Chronic Mucocutaneous Candidiasis in a Patient with a Gain-of-Function Mutation in Signal Transduction and Activator of Transcription 1.

    PubMed

    Pedraza-Sánchez, Sigifredo; Lezana-Fernández, Jose Luis; Gonzalez, Yolanda; Martínez-Robles, Luis; Ventura-Ayala, María Laura; Sadowinski-Pine, Stanislaw; Nava-Frías, Margarita; Moreno-Espinosa, Sarbelio; Casanova, Jean-Laurent; Puel, Anne; Boisson-Dupuis, Stephanie; Torres, Martha

    2017-01-01

    In humans, recessive loss-of-function mutations in STAT1 are associated with mycobacterial and viral infections, whereas gain-of-function (GOF) mutations in STAT1 are associated with a type of primary immunodeficiency related mainly, but not exclusively, to chronic mucocutaneous candidiasis (CMC). We studied and established a molecular diagnosis in a pediatric patient with mycobacterial infections, associated with CMC. The patient, daughter of a non-consanguineous mestizo Mexican family, had axillary adenitis secondary to BCG vaccination and was cured with resection of the abscess at 1-year old. At the age of 4 years, she had a supraclavicular abscess with acid-fast-staining bacilli identified in the soft tissue and bone, with clinical signs of disseminated infection and a positive Gene-X-pert test, which responded to anti-mycobacterial drugs. Laboratory tests of the IL-12/interferon gamma (IFN-γ) circuit showed a higher production of IL-12p70 in the whole blood from the patient compared to healthy controls, when stimulated with BCG and BCG + IFN-γ. The whole blood of the patient produced 35% less IFN-γ compared to controls assessed by ELISA and flow cytometry, but IL-17 producing T cells from patient were almost absent in PBMC stimulated with PMA plus ionomycin. Signal transduction and activator of transcription 1 (STAT1) was hyperphosphorylated at tyrosine 701 in response to IFN-γ and -α, as demonstrated by flow cytometry and Western blotting in fresh blood mononuclear cells and in Epstein-Barr virus lymphoblastoid cell lines (EBV-LCLs); phosphorylation of STAT1 in EBV-LCLs from the patient was resistant to inhibition by staurosporine but sensitive to ruxolitinib, a Jak phosphorylation inhibitor. Genomic DNA sequencing showed a de novo mutation in STAT1 in cells from the patient, absent in her parents and brother; a known T385M missense mutation in the DNA-binding domain of the transcription factor was identified, and it is a GOF mutation. Therefore, GOF mutations in STAT1 can induce susceptibility not only to fungal but also to mycobacterial infections by mechanisms to be determined.

  17. Disseminated Tuberculosis and Chronic Mucocutaneous Candidiasis in a Patient with a Gain-of-Function Mutation in Signal Transduction and Activator of Transcription 1

    PubMed Central

    Pedraza-Sánchez, Sigifredo; Lezana-Fernández, Jose Luis; Gonzalez, Yolanda; Martínez-Robles, Luis; Ventura-Ayala, María Laura; Sadowinski-Pine, Stanislaw; Nava-Frías, Margarita; Moreno-Espinosa, Sarbelio; Casanova, Jean-Laurent; Puel, Anne; Boisson-Dupuis, Stephanie; Torres, Martha

    2017-01-01

    In humans, recessive loss-of-function mutations in STAT1 are associated with mycobacterial and viral infections, whereas gain-of-function (GOF) mutations in STAT1 are associated with a type of primary immunodeficiency related mainly, but not exclusively, to chronic mucocutaneous candidiasis (CMC). We studied and established a molecular diagnosis in a pediatric patient with mycobacterial infections, associated with CMC. The patient, daughter of a non-consanguineous mestizo Mexican family, had axillary adenitis secondary to BCG vaccination and was cured with resection of the abscess at 1-year old. At the age of 4 years, she had a supraclavicular abscess with acid-fast-staining bacilli identified in the soft tissue and bone, with clinical signs of disseminated infection and a positive Gene-X-pert test, which responded to anti-mycobacterial drugs. Laboratory tests of the IL-12/interferon gamma (IFN-γ) circuit showed a higher production of IL-12p70 in the whole blood from the patient compared to healthy controls, when stimulated with BCG and BCG + IFN-γ. The whole blood of the patient produced 35% less IFN-γ compared to controls assessed by ELISA and flow cytometry, but IL-17 producing T cells from patient were almost absent in PBMC stimulated with PMA plus ionomycin. Signal transduction and activator of transcription 1 (STAT1) was hyperphosphorylated at tyrosine 701 in response to IFN-γ and -α, as demonstrated by flow cytometry and Western blotting in fresh blood mononuclear cells and in Epstein-Barr virus lymphoblastoid cell lines (EBV-LCLs); phosphorylation of STAT1 in EBV-LCLs from the patient was resistant to inhibition by staurosporine but sensitive to ruxolitinib, a Jak phosphorylation inhibitor. Genomic DNA sequencing showed a de novo mutation in STAT1 in cells from the patient, absent in her parents and brother; a known T385M missense mutation in the DNA-binding domain of the transcription factor was identified, and it is a GOF mutation. Therefore, GOF mutations in STAT1 can induce susceptibility not only to fungal but also to mycobacterial infections by mechanisms to be determined. PMID:29270166

  18. Lactase persistence and dairy intake in Mapuche and Mestizo populations from southern Chile.

    PubMed

    Fernández, Catalina I; Flores, Sergio V

    2014-11-01

    Lactase persistence (LP) occurs at a very low frequency in indigenous populations from Latin America, offering an opportunity to understand the relationship between this genetic trait and patterns of dairy consumption. Here, the frequency of LP is analyzed from Mapuche and -an adjacent- mestizo population inhabiting the Araucanía region. In addition to genotyping for LP, participants were surveyed in relation to general perception and consumption habits of dairy products. Low LP frequency (10%) and very low dairy intake was found among the Mapuche population as compared with Mestizo populations inhabiting Chile. The survey reported that the main reasons for avoidance of dairy were the gastrointestinal symptoms after dairy intake and cultural dietary habits. The interaction between low LP genotype frequency, low dairy intake, and sociocultural determinants is here discussed in the light of their potential health outcomes. © 2014 Wiley Periodicals, Inc.

  19. SNPs in NRXN1 and CHRNA5 are associated to smoking and regulation of GABAergic and glutamatergic pathways.

    PubMed

    Pérez-Rubio, Gloria; Pérez-Rodríguez, Martha E; Fernández-López, Juan Carlos; Ramírez-Venegas, Alejandra; García-Colunga, Jesús; Ávila-Moreno, Federico; Camarena, Angel; Sansores, Raúl H; Falfán-Valencia, Ramcés

    2016-07-01

    To identify genetic variants associated with greater tobacco consumption in a Mexican population. Daily smokers were classified as light smokers (LS; n = 742), heavy smokers (HS; n = 601) and nonsmokers (NS; n = 606). In the first stage, a genotyping microarray that included 347 SNPs in CHRNA2-CHRNA7/CHRNA10, CHRNB2-CHRNB4 and NRXN1 genes and 37 ancestry-informative markers was used to analyze 707 samples (187 HS, 328 LS and 192 NS). In the second stage, 14 SNPs from stage 1 were validated in the remaining samples (HS, LS and NS; n = 414 in each group) using real-time PCR. To predict the role of the associated SNPs, an in silico analysis was performed. Two SNPs in NRXN1 and two in CHRNA5 were associated with cigarette consumption, while rs10865246/C (NRXN1) was associated with high nicotine addiction. The in silico analysis revealed that rs1882296/T had a high level of homology with Hsa-miR-6740-5p, which encodes a putative miRNA that targets glutamate receptor subunits (GRIA2, GRID2) and GABA receptor subunits (GABRG1, GABRA4, GABRB2), while rs1882296/C had a high level of homology with Hsa-miR-6866-5p, which encodes a different miRNA that targets GRID2 and GABRB2. In a Mexican Mestizo population, greater consumption of cigarettes was influenced by polymorphisms in the NRXN1 and CHRNA5 genes. We proposed new hypotheses regarding the putative roles of miRNAs that influence the GABAergic and glutamatergic pathways in smoking addiction.

  20. Exploring the Distribution of Genetic Markers of Pharmacogenomics Relevance in Brazilian and Mexican Populations

    PubMed Central

    Bonifaz-Peña, Vania; Contreras, Alejandra V.; Struchiner, Claudio Jose; Roela, Rosimeire A.; Furuya-Mazzotti, Tatiane K.; Chammas, Roger; Rangel-Escareño, Claudia; Uribe-Figueroa, Laura; Gómez-Vázquez, María José; McLeod, Howard L.; Hidalgo-Miranda, Alfredo

    2014-01-01

    Studies of pharmacogenomics-related traits are increasingly being performed to identify loci that affect either drug response or susceptibility to adverse drug reactions. However, the effect of the polymorphisms can differ in magnitude or be absent depending on the population being assessed. We used the Affymetrix Drug Metabolizing Enzymes and Transporters (DMET) Plus array to characterize the distribution of polymorphisms of pharmacogenetics and pharmacogenomics (PGx) relevance in two samples from the most populous Latin American countries, Brazil and Mexico. The sample from Brazil included 268 individuals from the southeastern state of Rio de Janeiro, and was stratified into census categories. The sample from Mexico comprised 45 Native American Zapotecas and 224 self-identified Mestizo individuals from 5 states located in geographically distant regions in Mexico. We evaluated the admixture proportions in the Brazilian and Mexican samples using a panel of Ancestry Informative Markers extracted from the DMET array, which was validated with genome-wide data. A substantial variation in ancestral proportions across census categories in Brazil, and geographic regions in Mexico was identified. We evaluated the extent of genetic differentiation (measured as FST values) of the genetic markers of the DMET Plus array between the relevant parental populations. Although the average levels of genetic differentiation are low, there is a long tail of markers showing large frequency differences, including markers located in genes belonging to the Cytochrome P450, Solute Carrier (SLC) and UDP-glucuronyltransferase (UGT) families as well as other genes of PGx relevance such as ABCC8, ADH1A, CHST3, PON1, PPARD, PPARG, and VKORC1. We show how differences in admixture history may have an important impact in the distribution of allele and genotype frequencies at the population level. PMID:25419701

  1. Evaluation of expressed emotion in schizophrenia: a comparison of Caucasians and Mexican-Americans.

    PubMed

    Kopelowicz, Alex; Zarate, Roberto; Gonzalez, Veronica; Lopez, Steven R; Ortega, Paula; Obregon, Nora; Mintz, Jim

    2002-05-01

    Social desirability, while a recognized source of respondent bias among Mexican-Americans, has not been evaluated as an explanation for the lower rate of high expressed emotion (EE) found in the family members of Mexican-Americans versus Caucasians with schizophrenia. In this study, we tested the hypothesis that the lower rate of high EE (hostility and criticism) among Mexican-Americans was the result of cultural factors impacting on how information was reported by the Mexican-American relative of a patient with schizophrenia. We compared the ratings of EE between Caucasian (N = 17) and Mexican-American (N = 44) patients with schizophrenia or schizoaffective disorder and their key relatives using the level of expressed emotion (LEE) scale (paper and pencil instrument rated by the patient and relative separately) and the Five Minute Speech Sample (observational experimenter rated). The ability of the various measures to predict relapse over two years was also examined. Contrary to our hypothesis, there were no differences between patient and family measures within ethnic group. Mexican-American patients and relatives reported lower rates of high EE than Caucasians across all measures. High EE predicted relapse across measures for Caucasian participants, but did not predict relapse for Mexican-Americans on any of the measurement instruments. We discuss the implications of these findings on cross-cultural research and family interventions for individuals with psychotic disorders.

  2. In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases

    PubMed Central

    Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

    2015-01-01

    Context: Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). Material and Method: The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Results: Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. Conclusion: This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. SUMMARY This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto. PMID:27013805

  3. In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases.

    PubMed

    Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

    2015-10-01

    Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto.

  4. Because difficulty is not the same for everyone: the impact of complexity in working memory is associated with cannabinoid 1 receptor genetic variation in young adults.

    PubMed

    Ruiz-Contreras, Alejandra E; Román-López, Talía V; Caballero-Sánchez, Ulises; Rosas-Escobar, Cintia B; Ortega-Mora, E Ivett; Barrera-Tlapa, Miguel A; Romero-Hidalgo, Sandra; Carrillo-Sánchez, Karol; Hernández-Morales, Salvador; Vadillo-Ortega, Felipe; González-Barrios, Juan Antonio; Méndez-Díaz, Mónica; Prospéro-García, Oscar

    2017-03-01

    Individual differences in working memory ability are mainly revealed when a demanding challenge is imposed. Here, we have associated cannabinoid 1 (CB1) receptor genetic variation rs2180619 (AA, AG, GG), which is located in a potential CNR1 regulatory sequence, with performance in working memory. Two-hundred and nine Mexican-mestizo healthy young participants (89 women, 120 men, mean age: 23.26 years, SD = 2.85) were challenged to solve a medium (2-back) vs. a high (3-back) difficulty N-back tasks. All subjects responded as expected, performance was better with the medium than the high demand task version, but no differences were found among genotypes while performing each working memory (WM) task. However, the cost of the level of complexity in N-back paradigm was double for GG subjects than for AA subjects. It is noteworthy that an additive-dosage allele relation was found for G allele in terms of cost of level of complexity. These genetic variation results support that the endocannabinoid system, evaluated by rs2180619 polymorphism, is involved in WM ability in humans.

  5. Analysis of ancestry informative markers in three main ethnic groups from Ecuador supports a trihybrid origin of Ecuadorians.

    PubMed

    Santangelo, Roberta; González-Andrade, Fabricio; Børsting, Claus; Torroni, Antonio; Pereira, Vania; Morling, Niels

    2017-11-01

    Ancestry inference is traditionally done using autosomal SNPs that present great allele frequency differences among populations from different geographic regions. These ancestry informative markers (AIMs) are useful for determining the most likely biogeographic ancestry or population of origin of an individual. Due to the growing interest in AIMs and their applicability in different fields, commercial companies have started to develop AIM multiplexes targeted for Massive Parallel Sequencing platforms. This project focused on the study of three main ethnic groups from Ecuador (Kichwa, Mestizo, and Afro-Ecuadorian) using the Precision ID Ancestry panel (Thermo Fisher Scientific). In total, 162 Ecuadorian individuals were investigated. The Afro-Ecuadorian and Mestizo showed higher average genetic diversities compared to the Kichwa. These results are consistent with the highly admixed nature of the first two groups. The Kichwa showed the highest proportion of Native Amerindian (NAM) ancestry relative to the other two groups. The Mestizo had an admixed ancestry of NAM and European with a larger European component, whereas the Afro-Ecuadorian were highly admixed presenting proportions of African, Native Amerindian, and European ancestries. The comparison of our results with previous studies based on uniparental markers (i.e. Y chromosome and mtDNA) highlighted the sex-biased admixture process in the Ecuadorian Mestizo. Overall, the data generated in this work represent one important step to assess the application of ancestry inference in admixed populations in a forensic context. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Clinical and pathological characteristics of Hispanic BRCA-associated breast cancers in the American-Mexican border city of El Paso, TX.

    PubMed

    Nahleh, Zeina; Otoukesh, Salman; Dwivedi, Alok Kumar; Mallawaarachchi, Indika; Sanchez, Luis; Saldivar, J Salvador; Cataneda, Kayla; Heydarian, Rosalinda

    2015-01-01

    Hispanics in El Paso, TX, a large American-Mexican border city constitute 85% of the population. Limited cancer research has been conducted in this population. We sought to study the prevalence of BRCA mutations among Hispanic patients of Mexican origin, identify reported Mexican founder or recurrent mutations, and study the breast cancer characteristics in mutation carriers. Hispanic women of Mexican descent with a personal history of breast cancer, who presented consecutively for genetic cancer risk assessment, were enrolled in an Institutional Review Board-approved registry and underwent BRCA testing based on national guidelines. The characteristics of tumors and patients with positive BRCA mutation were analyzed. 88 patients were screened; 18 patients (20%) were BRCA carriers. Among BRCA carriers, 72% were diagnosed with breast cancer at younger than 50 years, 61% had "Triple negative disease". BRCA carriers had a significantly higher Body Mass Index (BMI) than non-carriers. Thirteen patients had BRCA1 mutations and five had BRCA2 mutations. A total of 17 deleterious BRCA Mutations were observed. Seven have been previously reported as specific genes from Mexico as country of origin. Five new mutations in BRCA carriers of Mexican descent were identified. Hispanic breast cancer patients of Mexican origin present at a younger age, and have predominantly triple negative tumors and high BMI. We identified 5 new mutations not reported previously in Hispanic BRCA carriers of Mexican descent. Interestingly, 41% of BRCA mutations identified have been reported as recurrent mutations in Hispanic individuals from Mexico as the country of origin. A more cost-effective approach to initial screening of Hispanic individuals based on country of origin is desirable and would potentially decrease the number of cases requiring complete sequencing.

  7. Prevalence of the BCR/ABL1 transcripts in Mexican patients with chronic myelogenous leukemia.

    PubMed

    Meza-Espinoza, Juan Pablo; Gutiérrez-Angulo, Melva; Vázquez-Cárdenas, Alejandra; Delgado-Lamas, José Luis; Esparza-Flores, María Amparo; González-García, Juan Ramón

    2007-01-01

    RT-PCR studies in 93 patients with chronic myelogenous leukemia from the Mexican West were done in order to know the proportion of b2a2 and b3a2 BCR/ABL1 transcripts. Forty-five patients showed the b3a2 transcript (48%), 37 (40%) displayed the b2a2 and in 11 cases (12%) both transcripts were detected. Statistical analyses showed that these figures are in accordance with two of three similar studies realized in Mexican population. Moreover, significant differences were found among Mexican people and patients from other countries, namely Ecuador, England, Italy, Poland, Japan, and Thailand. Ecuadorian patients showed differences with all the populations analyzed. These variations could be due to a different genetic background.

  8. High Rate of Infection by Only Oncogenic Human Papillomavirus in Amerindians.

    PubMed

    Vargas-Robles, Daniela; Magris, Magda; Morales, Natalia; de Koning, Maurits N C; Rodríguez, Iveth; Nieves, Tahidid; Godoy-Vitorino, Filipa; Sánchez, Gloria I; Alcaraz, Luis David; Forney, Larry J; Pérez, María-Eglée; García-Briceño, Luis; van Doorn, Leen-Jan; Domínguez-Bello, María Gloria

    2018-06-27

    Human papillomavirus (HPV), an etiological agent of cervical cancer (CC), has infected humans since ancient times. Amerindians are the furthest migrants out of Africa, and they reached the Americas more than 14,000 years ago. Some groups still remain isolated, and some migrate to towns, forming a gradient spanning urbanization. We hypothesized that, by virtue of their history, lifestyle, and isolation from the global society, remote Amerindian women have lower HPV diversity than do urban women (Amerindian or mestizo). Here we determined the diversity of the 25 most relevant cervical HPV types in 82 Amerindians spanning urbanization (low, medium, and high, consistent with the exposure to urban lifestyles of the town of Puerto Ayacucho in the Venezuelan Amazonas State), and in 29 urban mestizos from the town. Cervical, anal, oral, and introitus samples were taken, and HPVs were typed using reverse DNA hybridization. A total of 23 HPV types were detected, including 11 oncogenic or high-risk types, most associated with CC. Cervical HPV prevalence was 75%, with no differences by group, but Amerindians from low and medium urbanization level had significantly lower HPV diversity than mestizos did. In Amerindians, but not in mestizos, infections by only high-risk HPVs were higher than coinfections or by exclusively low-risk HPVs. Cervical abnormalities only were observed in Amerindians (9/82), consistent with their high HPV infection. The lower cervical HPV diversity in more isolated Amerindians is consistent with their lower exposure to the global pool, and transculturation to urban lifestyles could have implications on HPV ecology, infection, and virulence. IMPORTANCE The role of HPV type distribution on the disparity of cervical cancer (CC) incidence between human populations remains unknown. The incidence of CC in the Amazonas State of Venezuela is higher than the national average. In this study, we determined the diversity of known HPV types (the viral agent of CC) in Amerindian and mestizo women living in the Venezuelan Amazonas State. Understanding the ecological diversity of HPV in populations undergoing lifestyle transformations has important implication on public health measures for CC prevention. Copyright © 2018 Vargas-Robles et al.

  9. Cultural significance of wild mammals in Mayan and mestizo communities of the Lacandon Rainforest, Chiapas, Mexico.

    PubMed

    García Del Valle, Yasminda; Naranjo, Eduardo J; Caballero, Javier; Martorell, Carlos; Ruan-Soto, Felipe; Enríquez, Paula L

    2015-05-07

    Several ethnobiology studies evaluate the cultural significance (CS) of plants and mushrooms. However, this is not the case for mammals. It is important to make studies of CS allowing the comparison of cultural groups because the value given to groups of organisms may be based on different criteria. Such information would be valuable for wildlife preservation plans. In this study, the most culturally significant species of mammals from the Lacandon Rainforest (Chiapas, Mexico) for people from two Mayan-Lacandon and mestizo communities were identified. The reasons behind the CS of the studied species were explored and the existence of differences among the cultural groups was evaluated. One hundred ninety-eight semi-structured and structured interviews were applied to compile socio-demographic information, qualitative data on CS categories, and free listings. Frequency of mention was a relative indicator to evaluate the CS of each species of mammal. Comparison of responses between communities was carried out through multivariate analyses. The non-parametric Mann-Whitney U test was used to compare the number of mentioned species by Lacandons and mestizos as well as different responses in the qualitative categories. A χ2 test was used to compare frequency of categories. 38 wild mammal species were identified. The classification and Principal Components Analyses show an apparent separation between Lacandon and mestizo sites based on the relative importance of species. All four communities mentioned the lowland paca the most, followed by peccary, white-tailed deer, armadillo, and jaguar. No significant difference was found in the number of mentioned species between the two groups. Eight CS categories were identified. The most important category was "harmful mammals", which included 28 species. Other relevant categories were edible, medicinal, and appearing in narratives. The data obtained in this study demonstrates the existence of differential cultural patterns in the relationships that Lacandon and mestizo groups establish with mammals. Species are deemed important either because they are eaten of because of the harm they cause. We suggest the incorporation of local conceptions about wild animals in conservation frameworks for the fauna in the Lacandon Rainforest.

  10. Higher prepregnancy body mass index is a risk factor for developing preeclampsia in Maya-Mestizo women: a cohort study.

    PubMed

    Canto-Cetina, Thelma; Coral-Vázquez, Ramón Mauricio; Rojano-Mejía, David; Pérez Godoy, Sergio; Coronel, Agustín; Canto, Patricia

    2018-08-01

    Preeclampsia and obesity are two closely related syndromes. The high maternal prepregnancy body mass index (BMI) is a risk factor for present preeclampsia, independently of the ethnic background of the studied population. The aim of this study was to analyse in a prospective cohort study the relation between prepregnancy BMI and development of preeclampsia in Maya-Mestizo women. This is a prospective cohort study of 642 pregnant women that were included in the first trimester of the pregnancy (gestational age ≤12 weeks at the first antenatal visit) and all of them were of Maya-Mestizo ethnic origin from the state of Yucatán, México. We assessed the potential risk factors for preeclampsia and documented the prepregnancy BMI (kg/m 2 ) that was based on measured height and maternal self-report of prepregnancy weight at the initial visit. Besides, in the antenatal visit we documented if the pregnant women developed preeclampsia. Of the 642 pregnant Maya-Mestizo women, 49 developed preeclampsia, with an incidence of 7.6% (44.9% had severe and 55% mild). The prepregnancy BMI was higher in women with developed preeclampsia than in those with normal pregnancies. Women with overweight or obesity in comparison with normal weight presented a RR = 2.82 (95% CI: 1.32-6.03; P = 0.008) and RR= 4.22 (95% CI: 2.07-8.61; P = 0.001), respectively. Our findings expand the previous studies to show that the higher prepregnancy BMI is a strong, independent risk factor for preeclampsia.

  11. Work disability in Argentinian patients with systemic lupus erythematosus is prevalent and it is due to ethnic, socioeconomic and disease-related factors.

    PubMed

    Pisoni, Cecilia N; Muñoz, Sebastián A; Tamborenea, María N; García, Mercedes; Curti, Ana; Cappuccio, Ana; Rillo, Oscar; Imamura, Patricia M; Schneeberger, Emilce; Ballent, Marcela; Cousseau, Mario L; Velasco Zamora, Jorge; Saurit, Verónica; Toloza, Sergio; Danielsen, María C; Bellomio, Verónica I; Graf, Cesar; Paira, Sergio; Cavallasca, Javier; Pons Estel, Bernardo; Moreno, José L C; Díaz, Mónica; Alba, Paula; Verando, Marcela; Tate, Guillermo; Mysler, Eduardo; Sarano, Judith; Civit, Emma E; Risueño, Fabián; Álvarez Sepúlveda, Pablo; Larroude, María S; Méndez, Marcos F; Conforti, Andrea; Sohn, Débora

    2018-04-02

    To study the prevalence and the associated factors of work disability (WD) in systemic lupus erythematosus (SLE) patients. A sample of 419 SLE patients from an observational cross-sectional multicenter study was included. Sociodemographic features, disease characteristics, comorbidities, quality of life, unhealthy behaviors, and work-related factors were measured in a standardized interview. Work disability was defined by patient self-report of not being able to work because of SLE. To identify variables associated with work disability, two different multivariate regression models using a stepwise backward method were performed. Prevalence of WD due to SLE was 24.3%. Eighty-nine percent were female and 51% were Caucasians. Mean disease duration was 8.9 ± 7.2 years, and median System Lupus International Collaborating Clinics/American College of Rheumatology damage index SLICC-SDI was 1.5 (range 0-17). In stepwise multivariate logistic regression, living below the poverty line (odds ratio [OR] = 4.65), less than 12 years of education (OR = 2.84), Mestizo ethnicity (OR = 1.94) and SLICC-SDI (OR = 1.25) were predictors of WD. A second model was performed including patient-derived measures; in this model sedentary lifestyle (OR = 2.69) and lower emotional health domain score of the Lupus Quality of Life (LupusQoL) questionnaire (OR = 1.03) were found to be associated to WD and a higher score in LupusQoL physical health domain (OR = 0.93) was protective. The prevalence of WD in Argentinian SLE patients was 24.3%. WD was associated with ethnic (Mestizo), socioeconomic (poverty) and disease-related factors. Patient-related outcomes such us sedentary lifestyle and poor emotional quality of life were also associated with WD. © 2018 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  12. History of religious delusions and psychosocial functioning among Mexican patients with paranoid schizophrenia.

    PubMed

    Robles-García, Rebeca; López-Luna, Sonia; Páez, Francisco; Escamilla, Raúl; Camarena, Beatriz; Fresán, Ana

    2014-12-01

    The association between global functionality and religiosity among patients from developing and predominantly Catholic countries warrants attention. To compare religiosity and psychosocial functioning in Mexican schizophrenia patients with and without a history of religious delusions, seventy-four patients with paranoid schizophrenia were recruited. Patients with a history of religious delusions had more psychiatric hospitalizations and poorer psychosocial functioning compared with those without a history of religious delusions. No differences emerged between groups in the total scores of religiosity scales. A history of religious delusions rather than religiosity itself may have an influence on psychosocial functioning among Mexican patients with schizophrenia.

  13. Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children

    PubMed Central

    2012-01-01

    Background Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. Methods This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. Results For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. Conclusions The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total cholesterol levels in Mexican children. PMID:22459021

  14. Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children.

    PubMed

    De la Cruz-Mosso, Ulises; Muñoz-Valle, José F; Salgado-Goytia, Lorenzo; García-Carreón, Adrián; Illades-Aguiar, Berenice; Castañeda-Saucedo, Eduardo; Parra-Rojas, Isela

    2012-03-29

    Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total cholesterol levels in Mexican children.

  15. [Homocysteinemia and its relationship with the methylentetrahydrofolate reductase polymorphism in various ethnic groups from western Venezuela].

    PubMed

    Vizcaíno, Gilberto; Diez-Ewald, María; Herrmann, Falko H; Schuster, Gudrun; Torres-Guerra, Enrique; Arteaga-Vizcaíno, Melvis

    2005-12-01

    The prevalence of hyperhomocysteinemia and C677T MTHFR polymorphism was studied in various ethnic groups from Western Venezuela (60 Wayuu Indians, 42 italian immigrants and 77 Venezuelan mestizos) in relation with the prevalence of hyperhomocysteinemia and the C677T MTHFR polymorphism. Homocysteinemia was determined by polarized fluorescence immunoassay in an IMX system, serum folate was measured by radioimmunoanalysis and the MTHFR genotype was determined by PCR and restriction analysis. Hyperhomocysteinemia was defined as a value over 2 SD above the mean value for normal MTHFR (CC677) in each group. The prevalence of MTHFR variants (C677T and 677TT) was elevated in all ethnic groups (78% among the wayuu, 76% among Italians and 63% among mestizos) with a significant association between the concentrations of homocysteine and the levels of serum folate among the wayuu (p < 0.0001) and the mestizos (p < 0.001) only. Hyperhomocysteinemia was associated with MTHFR variants in 23% of the wayuu (OR: 6.17, CI 95: 0.74-51.36), 9.5% of the Italians (OR: 0.93, CI 95: 0.085-10.10) and 20.7 of the Venezuelans mestizos (OR: 5.2, CI 95: 1.08-24.90, p > 0.03). There was no relationship between hyperhomocysteinemia and folate deficiency in any of the groups studied. In conclusion, despite a high prevalence of C677T MTHFR variants in these ethnic groups of western Venezuela, the lack of no evidence of hyperhomocysteinemia combined with folate deficiency may imply that the nutritional status of these groups plays an important role in the control of hyperhomocysteinemia as a risk factor for cardiovascular disease.

  16. Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

    PubMed

    Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

    2013-11-01

    Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  17. Undocumented immigration status and diabetes care among Mexican immigrants in two immigration "sanctuary" areas.

    PubMed

    Iten, A Elizabeth; Jacobs, Elizabeth A; Lahiff, Maureen; Fernández, Alicia

    2014-04-01

    The objective of this study is to investigate the relationship between immigration status and the patient experience of health care, diabetes self-management, and clinical outcomes among Mexican immigrants with diabetes receiving health care in two immigration sanctuary cities. We used data from the Immigration, Culture and Health Care study, a cross-sectional survey and medical record study of low-income patients with diabetes recruited from public hospitals and community clinics in the San Francisco Bay Area and Chicago. Undocumented Mexican, documented Mexican immigrants, and US-born Mexican-Americans' health care experiences, diabetes self-management, and clinical outcomes were compared using multivariate linear and logistic regressions. We found no significant differences in reports of physician communication, or in measures of diabetes management between undocumented and documented immigrants. All three groups had similar clinical outcomes in glycemic, systolic blood pressure, and lipid control. These results indicate that, at least in some settings, undocumented Mexican immigrants with diabetes can achieve similar clinical outcomes and report similar health care experiences as documented immigrants and US-born Mexican-Americans.

  18. Pattern of deletions of the dystrophin gene in Mexican Duchenne/Becker muscular dystrophy patients: the use of new designed primers for the analysis of the major deletion "hot spot" region.

    PubMed

    Coral-Vazquez, R; Arenas, D; Cisneros, B; Peñaloza, L; Salamanca, F; Kofman, S; Mercado, R; Montañez, C

    1997-06-13

    We have analyzed 59 unrelated Mexican Duchenne/Becker muscular dystrophy patients (DMD/BMD) using PCR analysis of the 2 prone deletion regions in the DMD gene. Thirty one (52%) of the patients had a deletion of one or several of the exons. Most of the alterations (87%) were clustered in exons 44-52, this being the highest percentage reported until now. In order to improve the molecular diagnosis in the Mexican population, we designed a new multiplex assay to PCR amplify exons 44-52. This assay allowed for the identification of a greater number of deletions in this region compared with the 9 and 5-plex assays previously described and to determine most of the deletion end boundaries. This is a reliable alternative for the initial screening of the DMD patients in the Mexican population.

  19. Aspects of Death, Grief and Mourning in the Treatment of Spanish-Speaking Mental Patients.

    ERIC Educational Resources Information Center

    Aguilar, Ignacio; Wood, Virginia N.

    An intense preoccupation with death is evident in the Mexican culture's pre-Columbian art, myths, and religion. This preoccupation is still present in the urban Mexican American. A death in a Mexican family causes a set of emotions and events quite different from those seen in an Anglo family. The Mexican reaction to death is such that if the full…

  20. Heart rate and use of β-blockers in Mexican stable outpatients with coronary artery disease.

    PubMed

    Alcocer-Gamba, Marco Antonio; Martínez-Sánchez, Carlos; Verdejo-Paris, Juan; Ferrari, Roberto; Fox, Kim; Greenlaw, Nicola; Steg Philippe, Gabriel

    2015-01-01

    To evaluate the use of β-blockers and to monitor heart rate in Mexican patients with coronary artery disease. CLARIFY is an outpatients registry with stable CAD. A total of 33,283 patients from 45 countries were enrolled between November 2009 and July 2010 from which 1342 were Mexican patients. The mean HR pulse was 70 bpm (beats per minute). Patients in Mexico were compared with the remaining global CLARIFY population. Patients in Mexico had a higher incidence of acute myocardial infarction and percutaneous coronary intervention, and lower incidence of revascularization surgery compared with the remaining CLARIFY population. More often, Mexican patients presented with diabetes, but less often hypertension and stroke. These patients were split into three mutually exclusive groups of HR ≤ 60 (N=263), HR 61-69 (N=356) and HR ≥ 70 (N=722). Patients with elevated HR had a higher incidence of diabetes and higher diastolic blood pressure on average than those with controlled HR. Regarding the use of β-blockers, they were used in 63.3% of patients, 2.7% showed intolerance or contraindication to treatment to monitor heart rate, and ivabradine was used in 2.3%. Out of approximately 849 patients receiving treatment of β-blockers, 52.1% had ≥ 70 bpm HR. In a large proportion of Mexican patients with stable coronary disease the HR remain elevated, > 70 bpm, even with the use of β-blockers; this requires further attention. Copyright © 2014 Instituto Nacional de Cardiología Ignacio Chávez. Published by Masson Doyma México S.A. All rights reserved.

  1. Diabetic nephropathy among Mexican Americans.

    PubMed

    Debnath, Subrata; Thameem, Farook; Alves, Tahira; Nolen, Jacqueline; Al-Shahrouri, Hania; Bansal, Shweta; Abboud, Hanna E; Fanti, Paolo

    2012-04-01

    The incidence of diabetic nephropathy (DN) is growing rapidly worldwide as a consequence of the rising prevalence of Type 2 diabetes mellitus (T2DM). Among U.S. ethnic groups, Mexican Americans have a disproportionately high incidence and prevalence of DN and associated end-stage renal disease (ESRD). In communities bordering Mexico, as many as 90% of Mexican American patients with ESRD also suffer from T2DM compared to only 50% of non-Hispanic Whites (NHW). Both socio-economic factors and genetic predisposition appear to have a strong influence on this association. In addition, certain pathogenetic and clinical features of T2DM and DN are different in Mexican Americans compared to NHW, raising questions as to whether the diagnostic and treatment strategies that are standard practice in the NHW patient population may not be applicable in Mexican Americans. This article reviews the epidemiology of DN in Mexican Americans, describes the pathophysiology and associated risk factors, and identifies gaps in our knowledge and understanding that needs to be addressed by future investigations.

  2. Diabetic nephropathy among Mexican Americans

    PubMed Central

    Debnath, Subrata; Thameem, Farook; Alves, Tahira; Nolen, Jacqueline; Al-Shahrouri, Hania; Bansal, Shweta; Abboud, Hanna E.; Fanti, Paolo

    2012-01-01

    The incidence of diabetic nephropathy (DN) is growing rapidly worldwide as a consequence of the rising prevalence of Type 2 diabetes mellitus (T2DM). Among U.S. ethnic groups, Mexican Americans have a disproportionately high incidence and prevalence of DN and associated end-stage renal disease (ESRD). In communities bordering Mexico, as many as 90% of Mexican American patients with ESRD also suffer from T2DM compared to only 50% of non-Hispanic Whites (NHW). Both socio-economic factors and genetic predisposition appear to have a strong influence on this association. In addition, certain pathogenetic and clinical features of T2DM and DN are different in Mexican Americans compared to NHW, raising questions as to whether the diagnostic and treatment strategies that are standard practice in the NHW patient population may not be applicable in Mexican Americans. This article reviews the epidemiology of DN in Mexican Americans, describes the pathophysiology and associated risk factors, and identifies gaps in our knowledge and understanding that needs to be addressed by future investigations. PMID:22445478

  3. Association of the Shared Epitope, Smoking and the Interaction Between the Two With the Presence of Autoantibodies (Anti-CCP and FR) in Patients With Rheumatoid Arthritis in a Hospital in Seville, Spain.

    PubMed

    García de Veas Silva, José Luis; González Rodríguez, Concepción; Hernández Cruz, Blanca

    2017-11-01

    To evaluate the association of shared epitope, smoking and their interaction on the presence of autoantibodies (anti-cyclic citrullinated peptide [CCP] antibodies and rheumatoid factor) in patients with rheumatoid arthritis in our geographical area. A descriptive and cross-sectional study was carried out in a cohort of 106 patients diagnosed with RA. Odds ratios (OR) for antibody development were calculated for shared epitope, tobacco exposure and smoking dose. Statistical analysis was performed with univariate and multivariate statistics using ordinal logistic regression. Odds ratios were calculated with 95% confidence interval (95% CI) and a value of P<.05 was considered significant. In univariate analysis, shared epitope (OR=2.68; 95% CI: 1.11-6.46), tobacco exposure (OR=2.79; 95% CI: 1.12-6.97) and heavy smoker (>20 packs/year) (OR=8.93; 95% CI: 1.95-40.82) were associated with the presence of anti-CCP antibodies. For rheumatoid factor, the association was only significant for tobacco exposure (OR=3.89; 95% CI: 1.06-14.28) and smoking dose (OR=8.33; 95% CI: 1.05-66.22). By ordinal logistic regression analysis, an association with high titers of anti-CCP (>200U/mL) was identified with South American mestizos, patients with homozygous shared epitope, positive FR and heavy smokers. Being a South American mestizo, having a shared epitope, rheumatoid factor positivity and a smoking dose>20 packs/year are independent risk factors for the development of rheumatoid arthritis with a high titer of anti-CCP (>200U/mL). In shared epitope-positive rheumatoid arthritis patients, the intensity of smoking is more strongly associated than tobacco exposure with an increased risk of positive anti-CCP. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  4. Concepts of diabetes self-management in Mexican American and African American low-income patients with diabetes.

    PubMed

    Lynch, E B; Fernandez, A; Lighthouse, N; Mendenhall, E; Jacobs, E

    2012-10-01

    The goal of the study was to explore low-income minority patients' concepts of diabetes self-management and assess the extent to which patient beliefs correspond to evidence-based recommendations. African American and Mexican American patients with type 2 diabetes were recruited from safety net clinics that serve the uninsured and under-insured in Chicago and San Francisco to participate in focus group discussions. Grounded theory was used to identify themes related to diabetes self-management. Strategies participants mentioned for diabetes self-care were medication use, diet, weight loss and exercise. Eating more fruit and vegetables and consuming smaller portions were the most commonly mentioned dietary behaviors to control diabetes. African Americans expressed skepticism about taking medications. Mexican Americans discussed barriers to acquiring medications and use of herbal remedies. Mexican Americans frequently mentioned intentional exercise of long duration as a management strategy, whereas African Americans more frequently described exercise as regular activities of daily living. Blood glucose self-monitoring and reducing risks of diabetes complications were rarely mentioned as diabetes self-management behaviors. African American and Mexican American patients have different concepts of diabetes self-management, especially with regard to medication use and physical activity. Consideration of these differences may facilitate design of effective self-management interventions for these high-risk populations.

  5. VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.

    PubMed

    Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

    2015-01-01

    Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.

  6. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    PubMed

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  7. Factors that enable or limit the sustained use of improved firewood cookstoves: Qualitative findings eight years after an intervention in rural Mexico.

    PubMed

    Catalán-Vázquez, Minerva; Fernández-Plata, Rosario; Martínez-Briseño, David; Pelcastre-Villafuerte, Blanca; Riojas-Rodríguez, Horacio; Suárez-González, Laura; Pérez-Padilla, Rogelio; Schilmann, Astrid

    2018-01-01

    The aim of this study was to analyze the factors enabling/limiting the use of improved cookstoves among rural fuel wood users from one mestizo and two indigenous communities eight years after an intervention in the state of Michoacan, in Mexico. A qualitative study with an ethnographic perspective was conducted in 2013/2014 based on 62 interviews with women who had participated in an improved firewood cookstove program in 2005. Thematic qualitative content analysis was performed. Very few women from the indigenous communities were using the improved cookstove at the time of the study; the majority had dismantled or had ceased using it; whereas most of those from the mestizo community were using it for all of their cooking activities. In the indigenous communities, characterized by extended families, uptake of new technology was limited by traditional routine practices, rearrangement of rooms in the house, attachment to the traditional stove, a low- or non-risk perception of woodsmoke; gender relations, insufficient training, non-compliance with program recommendations and design-related aspects. Conversely, in the mestizo community, the uptake of the improved cookstove was favored by routine cooking practices in a nuclear family, a previous use of a raised cookstove and social representations on the health-disease-death effects of woodsmoke vs. the health benefits of cooking with improved stoves. The sociocultural dimension of communities and the cookstove design are aspects that either favor or limit the use of improved cookstoves in indigenous and mestizo populations. Effective cookstove programs must take these elements into account from their early planning stages, and blend them into implementation and follow-up. Project communication, training and differentiated follow-up activities ensuring the operation and maintenance of the cookstove, should be designed according to the specific needs and traditions of each community; they should be based on the preferences and needs of the users.

  8. Factors that enable or limit the sustained use of improved firewood cookstoves: Qualitative findings eight years after an intervention in rural Mexico

    PubMed Central

    Catalán-Vázquez, Minerva; Fernández-Plata, Rosario; Martínez-Briseño, David; Pelcastre-Villafuerte, Blanca; Riojas-Rodríguez, Horacio; Suárez-González, Laura; Pérez-Padilla, Rogelio

    2018-01-01

    Objective The aim of this study was to analyze the factors enabling/limiting the use of improved cookstoves among rural fuel wood users from one mestizo and two indigenous communities eight years after an intervention in the state of Michoacan, in Mexico. Methods A qualitative study with an ethnographic perspective was conducted in 2013/2014 based on 62 interviews with women who had participated in an improved firewood cookstove program in 2005. Thematic qualitative content analysis was performed. Results Very few women from the indigenous communities were using the improved cookstove at the time of the study; the majority had dismantled or had ceased using it; whereas most of those from the mestizo community were using it for all of their cooking activities. In the indigenous communities, characterized by extended families, uptake of new technology was limited by traditional routine practices, rearrangement of rooms in the house, attachment to the traditional stove, a low- or non-risk perception of woodsmoke; gender relations, insufficient training, non-compliance with program recommendations and design-related aspects. Conversely, in the mestizo community, the uptake of the improved cookstove was favored by routine cooking practices in a nuclear family, a previous use of a raised cookstove and social representations on the health-disease-death effects of woodsmoke vs. the health benefits of cooking with improved stoves. The sociocultural dimension of communities and the cookstove design are aspects that either favor or limit the use of improved cookstoves in indigenous and mestizo populations. Conclusions Effective cookstove programs must take these elements into account from their early planning stages, and blend them into implementation and follow-up. Project communication, training and differentiated follow-up activities ensuring the operation and maintenance of the cookstove, should be designed according to the specific needs and traditions of each community; they should be based on the preferences and needs of the users. PMID:29466464

  9. A Delta-Sarcoglycan Gene Polymorphism as a Risk Factor for Hypertrophic Cardiomyopathy

    PubMed Central

    Garrido-Garduño, Martín H.; Pérez-Martínez, Ramón A.; Ruiz, Victor M.; Herrera-Tepatlán, Esteban; Rodríguez-Cruz, Maricela; Jiménez-Vaca, Ana L.; Minauro-Sanmiguel, Fernando; Salamanca-Gómez, Fabio A.

    2012-01-01

    Background: The C allele of c.−94C>G polymorphism of the delta-sarcoglycan gene was associated as a risk factor for coronary spasm in Japanese patients with hypertrophic cardiomyopathy (HCM). Aim: We evaluated whether the c.−94C>G polymorphism can be a risk factor for HCM in Mexican patients. Methods: The polymorphism was genotyped and the risk was estimated in 35 HCM patients and 145 healthy unrelated individuals. Data of this polymorphism reported in Mexican Amerindian populations were included. Results: The C allele frequency in HCM patients was higher with an odds ratio (OR) of 2.37, and the risk for the CC genotype increased to 5.0. The analysis with Mexican Amerindian populations showed that the C allele frequency was significantly higher in HCM patients with an OR of 2.96 and for CC genotype the risk increased to 7.60. Conclusions: The C allele of the c.−94C>G polymorphism is a risk factor for HCM, which is increased by the Amerindian component and can play an important role in the etiology and progression of disease in Mexican patients. PMID:22524166

  10. Nonlinear Analysis of Time Series in Genome-Wide Linkage Disequilibrium Data

    NASA Astrophysics Data System (ADS)

    Hernández-Lemus, Enrique; Estrada-Gil, Jesús K.; Silva-Zolezzi, Irma; Fernández-López, J. Carlos; Hidalgo-Miranda, Alfredo; Jiménez-Sánchez, Gerardo

    2008-02-01

    The statistical study of large scale genomic data has turned out to be a very important tool in population genetics. Quantitative methods are essential to understand and implement association studies in the biomedical and health sciences. Nevertheless, the characterization of recently admixed populations has been an elusive problem due to the presence of a number of complex phenomena. For example, linkage disequilibrium structures are thought to be more complex than their non-recently admixed population counterparts, presenting the so-called ancestry blocks, admixed regions that are not yet smoothed by the effect of genetic recombination. In order to distinguish characteristic features for various populations we have implemented several methods, some of them borrowed or adapted from the analysis of nonlinear time series in statistical physics and quantitative physiology. We calculate the main fractal dimensions (Kolmogorov's capacity, information dimension and correlation dimension, usually named, D0, D1 and D2). We also have made detrended fluctuation analysis and information based similarity index calculations for the probability distribution of correlations of linkage disequilibrium coefficient of six recently admixed (mestizo) populations within the Mexican Genome Diversity Project [1] and for the non-recently admixed populations in the International HapMap Project [2]. Nonlinear correlations showed up as a consequence of internal structure within the haplotype distributions. The analysis of these correlations as well as the scope and limitations of these procedures within the biomedical sciences are discussed.

  11. Plasma triglyceride/HDL-cholesterol ratio, insulin resistance, and cardiometabolic risk in young adults

    PubMed Central

    Murguía-Romero, Miguel; Jiménez-Flores, J. Rafael; Sigrist-Flores, Santiago C.; Espinoza-Camacho, Miguel A.; Jiménez-Morales, Mayra; Piña, Enrique; Méndez-Cruz, A. René; Villalobos-Molina, Rafael; Reaven, Gerald M.

    2013-01-01

    Studies in mature adults suggest that the plasma concentration ratio of triglyceride (TG)/HDL-cholesterol (HDL-C) provides a simple way to identify apparently healthy individuals who are insulin resistant (IR) and at increased cardiometabolic risk. This study extends these observations by examining the clinical utility of the TG/HDL-C ratio and the metabolic syndrome (MetS) in 2,244 healthy college students (17–24 years old) of Mexican Mestizo ancestry. The TG/HDL-C ratio separating the 25% with the highest value was used to identify IR and increased cardiometabolic risk. Cardiometabolic risk factors were more adverse in men and women whose TG/HDL-C ratios exceeded 3.5 and 2.5, respectively, and approximately one third were identified as being IR. The MetS identified fewer individuals as being IR, but their risk profile was accentuated. In conclusion, both a higher TG/HDL-C ratio and a diagnosis of the MetS identify young IR individuals with an increased cardiometabolic risk profile. The TG/HDL-C ratio identified a somewhat greater number of “high risk” subjects, whereas the MetS found a group whose risk profile was somewhat magnified. These findings suggest that the TG/HDL-C ratio may serve as a simple and clinically useful approach to identify apparently healthy, young individuals who are IR and at increased cardiometabolic risk. PMID:23863983

  12. Triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) index as a reference criterion of risk for metabolic syndrome (MetS) and low insulin sensitivity in apparently healthy subjects.

    PubMed

    Baez-Duarte, Blanca Guadalupe; Zamora-Gínez, Irma; González-Duarte, Ramiro; Torres-Rasgado, Enrique; Ruiz-Vivanco, Guadalupe; Pérez-Fuentes, Ricardo; Celis, The Multidisciplinary Research Group Of Diabetes

    To evaluate if the TG/HDL-C index can be considered as a reference criterion of MetS and low insulin sensitivity in apparently healthy subjects. The subjects were Mexican mestizos who resided in Puebla City, Mexico, who were anthropometrically, biochemically, and clinically characterized. The TG/HDL-C index was calculated by dividing triglyceride (TG) levels by HDL-C levels. MetS was diagnosed by the Third Report from the Adult Treatment Panel-National Cholesterol Education Program (ATP-III NCEP) criteria, while insulin sensitivity was evaluated by the Quantitative Insulin sensitivity Check Index (QUICKI). The study included 813 subjects, with an average age of 38.6 ± 12.1 years, of which 564 were women and 249 men. An association was found between high TG/HDL-C index and low insulin sensitivity (Odds ratio [OR]: 4.09; p < 0.01) and with MetS (OR: 15.29; p < 0.01). A correlation was found between the TG/HDL-C index and QUICKI (rho: -0.4989; p < 0.01) and with MetS (rho: 0.6581; p < 0.01). The results indicate that the TG/HDL-C index is associated with low insulin sensitivity and MetS in apparently healthy subjects, suggesting this index as a reference criterion of risk for low insulin sensitivity and MetS.

  13. [Familial pulmonary fibrosis in 2 Mexican sisters with Hermansky-Pudlak syndrome].

    PubMed

    Zamora, Ana C; Alonso-Martínez, Delfino; Barrera, Lourdes; Mendoza, Felipe; Gaxiola, Miguel; Carrillo, Guillermo

    2009-08-01

    Hermansky-Pudlak syndrome is an autosomal recessive disorder commonly found in individuals of Puerto Rican ancestry. We present 2 cases of familial pulmonary fibrosis in 2 Mexican sisters with Hermansky-Pudlak syndrome. Pulmonary fibrosis was biopsy-proven in 1 of the patients. This report shows that Hermansky-Pudlak syndrome may occur in individuals of Mexican ancestry.

  14. Determination of SCN1A genetic variants in Mexican patients with refractory epilepsy and Dravet syndrome.

    PubMed

    Jiménez-Arredondo, R E; Brambila-Tapia, A J L; Mercado-Silva, F M; Magaña-Torres, M T; Figuera, L E

    2017-05-18

    Mutations in the SCN1A gene can result in syndromes associated with epilepsy, including the Dravet syndrome (DS). However, the prevalence of such mutations in these diseases varies widely between different studies, and has not been examined in Mexican patients with epilepsy. Therefore, the objective of this study was to determine the frequency of SCN1A mutations (in the exon 26) in a cohort of Mexican patients with DS and refractory epilepsy (RE). We recruited 24 Mexican patients (14 males and 10 females), of which 15 were diagnosed with RE and 9 were diagnosed with DS. The SCN1A gene was sequenced to uncover mutations in exon 26. We detected 2 novel genotypes in 2 DS patients. One was a synonymous variant, c.5418 G > A (E1806E), and the other was a missense variant, c. 5324 T > C (L1775P). The missense mutation was predicted to be damaging with a score of 100% by the PolyPhen-2 program. The frequency of pathogenic variants was 4.17% in all the patients and 11.1% in DS patients, which, together with other publications, emphasize that specific and more severe phenotypes are associated with SCN1A mutations.

  15. [Quality of health care for diabetic and hypertensive patients in primary care settings servicing Mexican Seguro Popular].

    PubMed

    Ortiz-Domínguez, Maki E; Garrido-Latorre, Francisco; Orozco, Ricardo; Pineda-Pérez, Dayana; Rodríguez-Salgado, Marlenne

    2011-01-01

    To assess health care quality provided to type-2 diabetic and hypertensive patients in primary care settings from the Mexican Ministry of Health and to evaluate whether accredited clinics providing services to the Mexican Seguro Popular performed better in terms of metabolic control of those patients compared to the non-accredited. Cross-sectional study performed on 2008. Previous year clinical measures were obtained from 5 444 diabetic and 5 827 hypertensive patient's clinical records. Adequate metabolic control (glucose <110 mg/dl for diabetes and blood pressure <140/90 mmHg for hypertension) associated factors were assessed by multiple-multilevel logistic regression methods. Patients attending accredited clinics were more likely to be controlled, however, metabolic control was not constant over time of accreditation. Additional efforts are required to monitor accredited clinics' performance in order to maintain both metabolic control and clinical assessment of patients.

  16. The geoepidemiology of systemic lupus erythematosus.

    PubMed

    Borchers, Andrea T; Naguwa, Stanley M; Shoenfeld, Yehuda; Gershwin, M Eric

    2010-03-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease with manifold clinical manifestations and immunological abnormalities, affecting primarily women. Although accurate current data on its incidence and prevalence are largely lacking, there are numerous indications that SLE is far less common in Europeans and their descendants compared to all other ethnicities. The clinical manifestations of the disease show geographic or ethnic variation, generally being less severe in patients of European ancestry than in African, Asian, certain "Hispanic" or mestizo, and various indigenous populations. In particular, renal involvement is far more common in non-European patients. Genetic as well as environmental, sociodemographic and sociocultural factors are likely to contribute to the differences in the incidence and clinical expression of SLE. 2009 Elsevier B.V. All rights reserved.

  17. Socioeconomic status and organ damage in Mexican systemic lupus erythematosus women.

    PubMed

    Mendoza-Pinto, C; Méndez-Martínez, S; Soto-Santillán, P; Galindo Herrera, J; Pérez-Contreras, I; Macías-Díaz, S; Taboada-Cole, A; García-Carrasco, M

    2015-10-01

    The objective of this cross-sectional study was to determine relationships between socioeconomic status and organ damage in Mexican systemic lupus erythematosus (SLE) patients. Demographic and clinical variables were assessed. Socioeconomic status was evaluated using the Graffar method and monthly household income. Lupus activity and organ damage were measured using the SLE disease activity scale, validated for the Mexican population (Mex-SLEDAI), and the Systemic Lupus International Collaborating Clinics/American College of Rheumatology (SLICC/ACR) scale. The 143 Mexican female SLE patients included (mean age 40.1 ± 8.9 years, mean disease duration 8.9 ± 6.3 years) had a mean monthly household income of $ 407.2 ± 326.5. According to the Graffar index, 18.9%, 52.5%, and 28.7% had high/medium-high, medium, and medium-low/low socioeconomic status, respectively. Organ damage was observed in 61 patients (42.7%). Patients with organ damage had lower monthly household incomes ($241.4 ± 152.4 vs. $354.8 ± 288.3) and were more frequently unemployed (57.3% vs. 35.3%; p = 0.01) than those without. Low monthly income was not associated with lupus activity or self-reported health status. In the adjusted multivariate analysis, low monthly income ( < $300) was associated with organ damage. In conclusion, low income may be associated with organ damage in Mexican SLE patients. © The Author(s) 2015.

  18. Efficacy and safety of adapalene gel 0.1% and 0.3% and tretinoin gel 0.05% for acne vulgaris: results of a single-center, randomized, double-blinded, placebo-controlled clinical trial on Mexican patients (skin type III-IV).

    PubMed

    Tirado-Sánchez, Andrés; Espíndola, Yareni Salas; Ponce-Olivera, Rosa María; Bonifaz, Alexandro

    2013-06-01

    The efficacy of topical retinoids is well known according to several clinical studies conducted predominantly among Caucasian patients. This study aimed to evaluate the efficacy and safety profile of adapalene and tretinoin among Mexican patients. To compare adapalene 0.1 and 0.3% and tretinoin 0.05% in Mexican subjects with acne vulgaris. We enrolled 171 patients in this single-center, randomized, double-blinded, placebo-controlled clinical trial. The patients applied on the face either adapalene 0.1%, adapalene 0.3%, tretinoin 0.05%, or placebo for 90 days and were evaluated for the reduction in total lesion counts and for the level of irritation. Tretinoin 0.05% and adapalene 0.3% were more effective than adapalene 0.1% and placebo in the reduction of both inflammatory and noninflammatory lesions. Most of adverse events to adapalene and many on tretinoin group were related to skin irritation, dry skin, scaling, pruritus, burning, and postinflammatory hyperpigmentation. Adapalene 0.3% and tretinoin 0.05% are comparable in efficacy, and adapalene 0.1% offers a better safety profile in Mexican patients. © 2013 Wiley Periodicals, Inc.

  19. Association between the APOE ε4 Allele and Late-Onset Alzheimer's Disease in an Ecuadorian Mestizo Population

    PubMed Central

    Calero, Cristian; Vinueza, Rodrigo; Correa, Patricio; Carrera-Gonzalez, Andrea; Villegas, Franklin; Moreta, Germania; Paredes, Rosario

    2017-01-01

    Alzheimer's disease (AD) is the most common neurodegenerative disease. It has two main pathological hallmarks: amyloid plaques and neurofibrillary tangles. The APOE ε4 allele has been recognized as the strongest genetic risk factor for late-onset Alzheimer's disease (LOAD) in several populations worldwide, yet the risk varies by region and ethnicity. The aims of this study were to describe APOE allele and genotype frequencies and examine the relationship between the APOE ε4 allele and LOAD risk in an Ecuadorian Mestizo population. We carried out a case-control study comprising 56 individuals clinically diagnosed with probable AD (≥65 years of age) and 58 unrelated healthy control subjects (≥65 years of age). Genotyping was performed using the real-time PCR method. Our data showed that allelic and genotypic frequencies follow the trends observed in most worldwide populations. We also found a high-risk association between APOE ε4 allele carriers and LOAD (OR = 7.286; 95% CI = 2.824–18.799; p < 0.001). Therefore, we concluded that APOE ε4 must be considered an important genetic risk factor for LOAD in the Ecuadorian Mestizo population. Additionally, we suggest that in mixed populations the effects of admixture and ethnic identity should be differentiated when evaluating genetic contributions to Alzheimer's disease risk. PMID:29348964

  20. Development of the Flu-PRO: a patient-reported outcome (PRO) instrument to evaluate symptoms of influenza.

    PubMed

    Powers, John H; Guerrero, M Lourdes; Leidy, Nancy Kline; Fairchok, Mary P; Rosenberg, Alice; Hernández, Andrés; Stringer, Sonja; Schofield, Christina; Rodríguez-Zulueta, Patricia; Kim, Katherine; Danaher, Patrick J; Ortega-Gallegos, Hilda; Bacci, Elizabeth Dansie; Stepp, Nathaniel; Galindo-Fraga, Arturo; St Clair, Kristina; Rajnik, Michael; McDonough, Erin A; Ridoré, Michelande; Arnold, John C; Millar, Eugene V; Ruiz-Palacios, Guillermo M

    2016-01-05

    To develop content validity of a comprehensive patient-reported outcome (PRO) measure following current best scientific methodology to standardize assessment of influenza (flu) symptoms in clinical research. Stage I (Concept Elicitation): 1:1 telephone interviews with influenza-positive adults (≥18 years) in the US and Mexico within 7 days of diagnosis. Participants described symptom type, character, severity, and duration. Content analysis identified themes and developed the draft Flu-PRO instrument. Stage II (Cognitive Interviewing): The Flu-PRO was administered to a unique set of influenza-positive adults within 14 days of diagnosis; telephone interviews addressed completeness, respondent interpretation of items and ease of use. Samples: Stage I: N = 46 adults (16 US, 30 Mexico); mean (SD) age: 38 (19), 39 (14) years; % female: 56%, 73%; race: 69% White, 97% Mestizo. Stage II: N = 34 adults (12 US, 22 Mexico); age: 37 (14), 39 (11) years; % female: 50%, 50%; race: 58% White, 100% Mestizo. Symptoms identified by >50%: coughing, weak or tired, throat symptoms, congestion, headache, weakness, sweating, chills, general discomfort, runny nose, chest (trouble breathing), difficulty sleeping, and body aches or pains. No new content was uncovered during Stage II; participants easily understood the instrument. Results show the 37-item Flu-PRO is a content valid measure of influenza symptoms in adults with a confirmed diagnosis of influenza. Research is underway to evaluate the suitability of the instrument for children and adolescents. This work can form the basis for future quantitative tests of reliability, validity, and responsiveness to evaluate the measurement properties of Flu-PRO for use in clinical trials and epidemiology studies.

  1. Validation of the UNC TRxANSITION Scale™Version 3 Among Mexican Adolescents With Chronic Kidney Disease.

    PubMed

    Cantú-Quintanilla, Guillermo; Ferris, María; Otero, Araceli; Gutiérrez-Almaraz, Anabel; Valverde-Rosas, Saúl; Velázquez-Jones, Luis; Luque-Coqui, Mercedes; Cohen, Sarah; Medeiros, Mara

    2015-01-01

    There is a lack of valid health care transition readiness (HCT) scales in Spanish. To provide initial validation of the UNC TRxANSITION Scale™ among Mexican adolescents and young adults (youth) with chronic kidney disease (CKD). We used the professionally translated/back translated, provider-administered UNC TRxANSITION Scale™ (Ferris et al., 2012). This 33-question scale measures HCT in ten sub-scales including knowledge about diagnosis or treatment, diet, reproductive health, school/work, insurance, ability to self-manage and looking for new health providers. Its maximum score is 10. We enrolled 163 Mexican adolescents (48.5% females) with CKD stage≥3, mean age of 15.1years (±2.1) and whose primary language is Spanish. There were 15 patients on hemodialysis (9.2%) and 30 transplant recipients (18.4%). Results were compared to those reported in adolescents with chronic conditions from the USA. Our cohort's overall median total score was 5.9. Patients≥16years old had a median total score of 6.4, whereas younger patients had median score of 5.6 (p<0.05). Transplant patients had greater scores in the total and the sub-scales of medication knowledge, issues of reproduction, insurance, trade/work and adherence (p<0.05). When comparing the total score (by age), results from our Mexican youth were similar to those reported in youth from the USA. In our Mexican cohort of youth with CKD, health care transition readiness is greater in older patients and in transplant recipients. Our cohort's overall score is low, indicating the need for a health care transition preparation program. The UNC TRxANSITION Scale™ results in Mexican youth with CKD are comparable to findings in youth from the USA. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Will patients find diversity in the medical home?

    PubMed

    Turner, Eddie J; Bazemore, Andrew W; Phillips, Robert L; Green, Larry A

    2008-07-15

    Mexican Americans and blacks experience disparities in health outcomes relative to white populations. During the past five to 10 years, fewer blacks and Mexican Americans are going to medical school and entering primary care professions. To assure the availability of a patient-centered medical home for all Americans, policy makers must work to support a culturally competent and diverse primary care workforce.

  3. Rare intronic variants of TCF7L2 arising by selective sweeps in an indigenous population from Mexico.

    PubMed

    Acosta, Jose Luis; Hernández-Mondragón, Alma Cristal; Correa-Acosta, Laura Carolina; Cazañas-Padilla, Sandra Nathaly; Chávez-Florencio, Berenice; Ramírez-Vega, Elvia Yamilet; Monge-Cázares, Tulia; Aguilar-Salinas, Carlos A; Tusié-Luna, Teresa; Del Bosque-Plata, Laura

    2016-05-26

    Genetic variations of the TCF7L2 gene are associated with the development of Type 2 diabetes (T2D). The associated mutations have demonstrated an adaptive role in some human populations, but no studies have determined the impact of evolutionary forces on genetic diversity in indigenous populations from Mexico. Here, we sequenced and analyzed the variation of the TCF7L2 gene in three Amerindian populations and compared the results with whole-exon-sequencing of Mestizo populations from Sigma and the 1000 Genomes Project to assess the roles of selection and recombination in diversity. The diversity in the indigenous populations was biased to intronic regions. Most of the variation was low frequency. Only mutations rs77961654 and rs61724286 were located on exon 15. We did not observe variation in intronic region 4-6 in any of the three indigenous populations. In addition, we identified peaks of selective sweeps in the mestizo samples from the Sigma Project within this region. By replicating the analysis of association with T2D between case-controls from the Sigma Project, we determined that T2D was most highly associated with the rs7903146 risk allele and to a lesser extent with the other six variants. All associated markers were located in intronic region 4-6, and their r(2) values of linkage disequilibrium were significantly higher in the Mexican population than in Africans from the 1000 Genomes Project. We observed reticulations in both the haplotypes network analysis from seven marker associates and the neighborNet tree based on 6061 markers in the TCF7L2 gene identified from all samples of the 1000 Genomes Project. Finally, we identified two recombination hotspots in the upstream region and 3' end of the TCF7L2 gene. The lack of diversity in intronic region 4-6 in Indigenous populations could be an effect of selective sweeps generated by the selection of neighboring rare variants at T2D-associated mutations. The survivors' variants make the intronic region 4-6 the area of the greatest population differentiation within the TCF7L2 gene. The abundance of selective peak sweeps in the downstream region of the TCF7L2 gene suggests that the TCF7L2 gene is part of a region that is in constant recombination between populations.

  4. Gender-Dependent Association of FTO Polymorphisms with Body Mass Index in Mexicans

    PubMed Central

    Saldaña-Alvarez, Yolanda; Salas-Martínez, María Guadalupe; García-Ortiz, Humberto; Luckie-Duque, Angélica; García-Cárdenas, Gustavo; Vicenteño-Ayala, Hermenegildo; Cordova, Emilio J.; Esparza-Aguilar, Marcelino; Contreras-Cubas, Cecilia; Carnevale, Alessandra; Chávez-Saldaña, Margarita; Orozco, Lorena

    2016-01-01

    To evaluate the associations between six single-nucleotide polymorphisms (SNPs) in intron 1 of FTO and body mass index (BMI), a case-control association study of 2314 unrelated Mexican-Mestizo adult subjects was performed. The association between each SNP and BMI was tested using logistic and linear regression adjusted for age, gender, and ancestry and assuming additive, recessive, and dominant effects of the minor allele. Association analysis after BMI stratification showed that all five FTO SNPs (rs1121980, rs17817449, rs3751812, rs9930506, and rs17817449), were significantly associated with obesity class II/III under an additive model (P<0.05). Interestingly, we also documented a genetic model-dependent influence of gender on the effect of FTO variants on increased BMI. Two SNPs were specifically associated in males under a dominant model, while the remainder were associated with females under additive and recessive models (P<0.05). The SNP rs9930506 showed the highest increased in obesity risk in females (odds ratio = 4.4). Linear regression using BMI as a continuous trait also revealed differential FTO SNP contributions. Homozygous individuals for the risk alleles of rs17817449, rs3751812, and rs9930506 were on average 2.18 kg/m2 heavier than homozygous for the wild-type alleles; rs1121980 and rs8044769 showed significant but less-strong effects on BMI (1.54 kg/m2 and 0.9 kg/m2, respectively). Remarkably, rs9930506 also exhibited positive interactions with age and BMI in a gender-dependent manner. Women carrying the minor allele of this variant have a significant increase in BMI by year (0.42 kg/m2, P = 1.17 x 10−10). Linear regression haplotype analysis under an additive model, confirmed that the TGTGC haplotype harboring all five minor alleles, increased the BMI of carriers by 2.36 kg/m2 (P = 1.15 x 10−5). Our data suggest that FTO SNPs make differential contributions to obesity risk and support the hypothesis that gender differences in the mechanisms involving these variants may contribute to disease development. PMID:26726774

  5. Validation of the Impulsive/Premeditated Aggression Scale in Mexican psychiatric patients.

    PubMed

    Romans, Laura; Fresán, Ana; Sentíes, Héctor; Sarmiento, Emmanuel; Berlanga, Carlos; Robles-García, Rebeca; Tovilla-Zarate, Carlos-Alfonso

    2015-07-01

    Aggression has been linked to several psychiatric disorders. None of the available instruments validated in Mexico is able to classify aggression as impulsive or premeditated. The Impulsive/Premeditated Aggression Scale (IPAS) is a self-report instrument designed to characterize aggressiveness as predominately impulsive or premeditated. The aim of the study was to determine the validity and reliability of the IPAS in a sample of Mexican psychiatric patients. A total of 163 patients diagnosed with affective, anxiety or psychotic disorder were included. A principal-component factor analysis was performed to obtain construct validity of the IPAS impulsive and premeditated aggression subscales; convergent validity as well as internal consistency of subscales were also determined. The rotated matrix accounted for 33.4% of the variance. Significant values were obtained for convergent validity and reliability of the IPAS subscales. The IPAS is an adequate instrument, which might be used to differentiate the type of aggressive behavior in Mexican psychiatric patients.

  6. Quality of life in multiple myeloma: clinical validation of the Mexican-Spanish version of the QLQ-MY20 instrument.

    PubMed

    Espinoza-Zamora, José Ramiro; Portilla-Espinosa, César Miguel; Labardini-Méndez, Juan Rafael; Cervera, Eduardo; Niesvisky, Ruben; Oñate-Ocaña, Luis F

    2015-06-01

    Health-related quality of life (HRQL) has become an important outcome measurement in hematology. Our aim was to validate the quality of life questionnaire (QLQ)-MY20 instrument in patients with multiple myeloma (MM) in Mexico. The Mexican-Spanish versions of the QLQ-C30 and QLQ-MY20 instruments were applied to patients with MM at a cancer referral centre. Reliability and validity tests were performed. Test-retest was carried out in selected patients. Ninety-eight patients with MM were included in this study. Questionnaire compliance rates were high, and the instrument was well accepted; internal consistency tests demonstrated good convergent and divergent validity. Cronbach's α coefficients of seven of nine multi-item scales of the QLQ-C30 and of all three multi-item scales of the QLQ-MY20 instruments were >0.7 (range, 0.36-0.89). The scales of the QLQ-C30 and QLQ-MY20 instruments distinguished among clinically distinct groups of patients; 9 of 15 scales of the QLQ-C30 and all 4 scales of the QLQ-MY20 presented responsiveness after change over time. The Mexican-Spanish version of the QLQ-MY20 questionnaire is reliable and valid for the assessment of HRQL in patients with MM and can be used in clinical trials in the Mexican community.

  7. Newborn screening for six lysosomal storage disorders in a cohort of Mexican patients: Three-year findings from a screening program in a closed Mexican health system.

    PubMed

    Navarrete-Martínez, Juana Inés; Limón-Rojas, Ana Elena; Gaytán-García, Maria de Jesús; Reyna-Figueroa, Jesús; Wakida-Kusunoki, Guillermo; Delgado-Calvillo, Ma Del Rocío; Cantú-Reyna, Consuelo; Cruz-Camino, Héctor; Cervantes-Barragán, David Eduardo

    2017-05-01

    To evaluate the results of a lysosomal newborn screening (NBS) program in a cohort of 20,018 Mexican patients over the course of 3years in a closed Mexican Health System (Petróleos Mexicanos [PEMEX] Health Services). Using dried blood spots (DBS), we performed a multiplex tandem mass spectrometry enzymatic assay for six lysosomal storage disorders (LSDs) including Pompe disease, Fabry disease, Gaucher disease, mucopolysaccharidosis type I (MPS-I), Niemann-Pick type A/B, and Krabbe disease. Screen-positive cases were confirmed using leukocyte enzymatic activity and DNA molecular analysis. From July 2012 to April 2016, 20,018 patients were screened; 20 patients were confirmed to have an LSD phenotype (99.9 in 100,000 newborns). Final distributions include 11 Pompe disease, five Fabry disease, two MPS-I, and two Niemann-Pick type A/B patients. We did not find any Gaucher or Krabbe patients. A final frequency of 1 in 1001 LSD newborn phenotypes was established. NBS is a major public health achievement that has decreased the morbidity and mortality of inborn errors of metabolism. The introduction of NBS for LSD presents new challenges. This is the first multiplex Latin-American study of six LSDs detected through NBS. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Tuberculosis along the United States-Mexico border, 1993-2001.

    PubMed

    Schneider, Eileen; Laserson, Kayla F; Wells, Charles D; Moore, Marisa

    2004-07-01

    Tuberculosis (TB) is a leading public health problem and a recognized priority for the federal Governments of both Mexico and the United States of America. The objectives of this research, primarily for the four states in the United States that are along the border with Mexico, were to: (1) describe the epidemiological situation of TB, (2) identify TB risk factors, and (3) discuss tuberculosis program strategies. We analyzed tuberculosis case reports collected from 1993 through 2001 by the tuberculosis surveillance system of the United States. We used those data to compare TB cases mainly among three groups: (1) Mexican-born persons in the four United States border states (Arizona, California, New Mexico, and Texas), (2) persons in those four border states who had been born in the United States, and (3) Mexican-born persons in the 46 other states of the United States, which do not border Mexico. For the period from 1993 through 2001, of the 16 223 TB cases reported for Mexican-born persons in the United States, 12 450 of them (76.7%) were reported by Arizona, California, New Mexico, and Texas. In those four border states overall in 2001, tuberculosis case rates for Mexican-born persons were 5.0 times as high as the rates for persons born in the United States; those four states have 23 counties that directly border on Mexico, and the ratio in those counties was 5.8. HIV seropositivity, drug and alcohol use, unemployment, and incarceration were significantly less likely to be reported in Mexican-born TB patients from the four border states and the nonborder states than in patients born in the United States from the four border states (P < 0.001). Multivariate analysis revealed that among pulmonary tuberculosis patients who were 18-64 years of age and residing in the four border states, the Mexican-born patients were 3.6 times as likely as the United States-born patients were to have resistance to at least isoniazid and rifampin (i. e., to have multidrug-resistant TB) and twice as likely to have isoniazid resistance. Mexican-born TB patients from the four border states and the nonborder states were significantly more likely to have moved or to be lost to follow-up than were the TB patients born in the United States from the four border states (P < 0.001). Increased collaborative tuberculosis control efforts by the federal Governments of both Mexico and the United States along the border that they share are needed if tuberculosis is to be eliminated in the United States.

  9. Relationship between physical and psychosocial dysfunction in Mexican patients with vertigo: a cross-cultural validation of the vertigo symptom scale.

    PubMed

    Yardley, L; Medina, S M; Jurado, C S; Morales, T P; Martinez, R A; Villegas, H E

    1999-01-01

    The Vertigo Symptom Scale (VSS) was designed to assess and differentiate symptoms of: (a) balance disorder; and (b) somatic anxiety and autonomic arousal in patients complaining of dizziness and vertigo. Although it has been translated for use in countries other than the UK, where it was originally developed, its validity in different languages and cultures has not previously been evaluated. This study examined the structure, reliability, and discriminative power of a Spanish translation of the VSS administered to a Mexican sample of 172 dizzy patients and 40 healthy controls. Scores on the two subscales of the VSS not only discriminated between patients and controls, but were also sensitive to differences between patient groups classified on the basis of diagnosis, test results, and occupational disability. The pattern of intercorrelations between symptoms, anxiety, depression, and handicap in the Mexican sample was almost identical to that observed in the original UK sample.

  10. Can data science inform environmental justice and community risk screening for type 2 diabetes?

    PubMed

    Davis, J Allen; Burgoon, Lyle D

    2015-01-01

    Having the ability to scan the entire country for potential "hotspots" with increased risk of developing chronic diseases due to various environmental, demographic, and genetic susceptibility factors may inform risk management decisions and enable better environmental public health policies. Develop an approach for community-level risk screening focused on identifying potential genetic susceptibility hotpots. Our approach combines analyses of phenotype-genotype data, genetic prevalence of single nucleotide polymorphisms, and census/geographic information to estimate census tract-level population attributable risks among various ethnicities and total population for the state of California. We estimate that the rs13266634 single nucleotide polymorphism, a type 2 diabetes susceptibility genotype, has a genetic prevalence of 56.3%, 47.4% and 37.0% in Mexican Mestizo, Caucasian, and Asian populations. Looking at the top quintile for total population attributable risk, 16 California counties have greater than 25% of their population living in hotspots of genetic susceptibility for developing type 2 diabetes due to this single genotypic susceptibility factor. This study identified counties in California where large portions of the population may bear additional type 2 diabetes risk due to increased genetic prevalence of a susceptibility genotype. This type of screening can easily be extended to include information on environmental contaminants of interest and other related diseases, and potentially enables the rapid identification of potential environmental justice communities. Other potential uses of this approach include problem formulation in support of risk assessments, land use planning, and prioritization of site cleanup and remediation actions.

  11. Validation of the Mexican Spanish version of the EORTC QLQ-H&N35 instrument to measure health-related quality of life in patients with head and neck cancers.

    PubMed

    Carrillo, José F; Ortiz-Toledo, Miguel Angel; Salido-Noriega, Zarahi; Romero-Ventura, Norma Berenice; Ochoa-Carrillo, Francisco J; Oñate-Ocaña, Luis F

    2013-05-01

    Health-related quality of life (HRQL) is an important outcome measurement in oncology. Our aim was to validate the Mexican Spanish version of the European Organisation for Research and Treatment of Cancer (EORTC) QLQ-H&N35 questionnaire to measure HRQL in patients with head and neck cancers. The QLQ-C30 and QLQ-H&N35 instruments were applied to Mexican patients with head and neck cancer at a cancer referral center. Reliability and validity tests were performed. Test-retest was carried out in selected patients. One hundred ninety-three patients were included in this cohort; tumor locations included the following: oral cavity 45 (23.3 %); larynx 35 (18.1 %); thyroid carcinoma invasive to aerodigestive tract 32 (16.6 %); oropharynx 17 (8.8 %); hypopharynx 12 (6.2 %); nasal cavity and paranasal sinuses 11 (5.7 %); salivary glands 11 (5.7 %); nasopharynx 8 (4.1 %); eye and adnexa 7 (3.6 %); cervical metastases of unknown origin 5 (2.6 %); primary sarcoma of the head and neck region 5 (2.6 %); maxillary antrum carcinoma 4 (2.1 %); and retinoblastoma 1 (0.5 %). Questionnaire compliance rates were high, and the instrument was well accepted; the internal consistency tests demonstrated good convergent and divergent validity. Cronbach's α coefficients of 8 of 9 multi-item scales of the QLQ-C30 and 6 of 8 scales of the QLQ-H&N35 instruments were >0.7 (range 0.22-0.89). Scales of the QLQ-C30 and QLQ-H&N35 instruments distinguished among clinically distinct groups of patients; some were highly sensitive to change over time. The Mexican Spanish version of the QLQ-H&N35 questionnaire is reliable and valid for the assessment of HRQL in patients with head and neck cancers and can be used in clinical trials in Mexican communities.

  12. Achievement of therapeutic targets in Mexican patients with diabetes mellitus.

    PubMed

    Lavalle-González, Fernando J; Chiquete, Erwin; de la Luz, Julieta; Ochoa-Guzmán, Ana; Sánchez-Orozco, Laura V; Godínez-Gutiérrez, Sergio A

    2012-12-01

    Complications of diabetes comprise the leading cause of death in Mexico. We aimed to describe the characteristics of management and achievement of therapeutic targets in Mexican patients with diabetes mellitus. We analyzed data from 2642 Mexican patients with type 1 (T1D, n=203, 7.7%) and type 2 diabetes (T2D, n=2439, 92.3%) included in the third wave of the International Diabetes Management Practices Study. Of T2D patients, 63% were on oral glucose-lowering drugs (OGLD) exclusively (mostly metformin), 11% on insulin, 22% on OGLD plus insulin, and 4% on diet and exercise exclusively. T2D patients on insulin were more likely to be trained on diabetes, but they were older, had worse control, longer disease duration and more chronic complications than patients on OGLD only. Glycated hemoglobin (HbA1c) <7% was achieved by 21% and 37% of T1D and T2D patients, respectively. Only 5% of T1D and 3% of T2D attained the composite target of HbA1c <7%, blood pressure <130/80 mmHg and low-density lipoprotein cholesterol <100 mg/dl. T1D patients had less macrovascular but more microvascular complications, compared with T2D patients. Late complications increased with disease duration, so that about 80% of patients after 20 years of diagnosis have at least one late complication. Reaching the target HbA1c <7% was associated with a reduced number of microvascular but not with less macrovascular complications. A great proportion of these Mexican patients with diabetes did not reach therapeutic targets. Insulin was used mostly in complicated cases with advanced disease. Copyright © 2011 SEEN. Published by Elsevier Espana. All rights reserved.

  13. Analysis of 16 cystic fibrosis mutations in Mexican patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Villalobos-Torres, C.; Rojas-Martinez, A.; Barrera-Saldana, H.A.

    1997-04-14

    We carried out molecular analysis of 80 chromosomes from 40 unrelated Mexican patients with a diagnosis of cystic fibrosis. The study was performed in two PCR steps: a preliminary one to identify mutation AF508, the most frequent cause of cystic fibrosis worldwide, and the second a reverse dot-blot with allele-specific oligonucleotide probes to detect 15 additional common mutations in the Caucasian population. A frequency of 45% for AF508 was found, making it the most common in our sample of Mexican patients. Another five mutations (G542X, 3849 + 10 kb C{r_arrow}T, N1303K, S549N, and 621 + 1 G{r_arrow}T) were detected, andmore » these accounted for 11.25%. The remaining mutations (43.75%) were undetectable with the methodology used. 20 refs., 2 tabs.« less

  14. Metastasis Risk Reduction Related with Beta-Blocker Treatment in Mexican Women with Breast Cancer.

    PubMed

    Parada-Huerta, E; Alvarez-Dominguez, Tp; Uribe-Escamilla, R; Rodriguez-Joya, Jf; Ponce-Medrano, Ja Diaz; Padron-Lucio, S; Alfaro-Rodriguez, A; Bandala, C

    2016-01-01

    Breast Cancer (BCa) is the most common malignant tumour in Mexican women. In BCa, several studies have linked β2-adrenergic receptor activation with increased tumour growth and progression as related with Epinephrine-NorEpinephrine (E-NE) stimulation. The aim of this study was to describe Beta-Blocker (BB) treatment related with reduction of the risk of metastasis in Mexican patients with BCa. We collected data of 120 patients seen at the High-Specialty Naval General Hospital in Mexico City (HOSGENAES), all of these with a histopathological diagnosis of BCa. Four groups of patients were divided as follows: without Systemic Arterial Hypertension (SAH); with SAH treatment with non-selective BB; with SAH treatment with selective BB, and with SAH treatment with other antihypertensive drugs. Chi-square, Mantel- Haenszel, Student t, and ANOVA tests were performed for data analysis. On average, patients were 54.8±11.8 years of age. Risk factors such as smoking and consuming alcohol exhibited a frequency of 33 and 36.5% respectively. Clinical stages III- IV were found in 50% of patients, while, 30% of patients had arterial hypertension (n=29 and N=96, respectively) and 17.5% used BB. One hundred percent of patients with arterial hypertension treated with BB for β1 - and β2 -adrenergic-receptors did not present metastasis globally, but patients treated with β1 BB presented 30% of metastasis while patients treated with no BB or without SAH had around 70% of metastasis. In Mexican patients with BCa and SAH treated with non-selective (β1- and β2-adrenergic receptors) BB, a decrease in the risk for metastasis was observed at the time of diagnosis.

  15. Description of Mexican Cleft Surgeons' Experience With Foreign Surgical Volunteer Missions in Mexico.

    PubMed

    Schoenbrunner, Anna R; Kelley, Kristen D; Buckstaff, Taylor; McIntyre, Joyce K; Sigler, Alicia; Gosman, Amanda A

    2018-05-01

    Mexican cleft surgeons provide multidisciplinary comprehensive cleft lip and palate care to children in Mexico. Many Mexican cleft surgeons have extensive experience with foreign, visiting surgeons. The purpose of this study was to characterize Mexican cleft surgeons' domestic and volunteer practice and to learn more about Mexican cleft surgeons' experience with visiting surgeons. A cross-sectional validated e-mail survey tool was sent to Mexican cleft surgeons through 2 Mexican plastic surgery societies and the Asociación Mexicana de Labio y Paladar Hendido y Anomalías Craneofaciales, the national cleft palate society that includes plastic and maxillofacial surgeons who specialize in cleft surgery. We utilized validated survey methodology, including neutral fact-based questions and repeated e-mails to survey nonresponders to maximize validity of statistical data; response rate was 30.6% (n = 81). Mexican cleft surgeons performed, on average, 37.7 primary palate repairs per year with an overall complication rate of 2.5%; 34.6% (n = 28) of respondents had direct experience with patients operated on by visiting surgeons; 53.6% of these respondents performed corrective surgery because of complications from visiting surgeons. Respondents rated 48% of the functional outcomes of visiting surgeons as "acceptable," whereas 43% rated aesthetic outcomes of visiting surgeons as "poor"; 73.3% of respondents were never paid for the corrective surgeries they performed. Thirty-three percent of Mexican cleft surgeons believe that there is a role for educational collaboration with visiting surgeons. Mexican cleft surgeons have a high volume of primary cleft palate repairs in their domestic practice with good outcomes. Visiting surgeons may play an important role in Mexican cleft care through educational collaborations that complement the strengths of Mexican cleft surgeons.

  16. [Mexican Cardiology Society Guidelines on the management of patients with unstable angina and non-ST-segment elevation myocardial infarction. Cancún, Quintana Roo 15-16 November 2002. Cooperative Group of Consensus].

    PubMed

    Lupi-Herrera, Eulo

    2002-01-01

    Mexican Cardiology Society guidelines for the Management of patients with unstable angina and non-ST--segment elevation myocardial infarction are presented. The Mexican Society of Cardiology has engaged in the elaboration of these guidelines in the area of acute coronary syndromes based on the recent report of RENASICA [National Registry of Acute Coronary Syndromes]: 70% of the ACS correspond to patients with unstable angina and non-ST--segment elevation myocardial infarction seen in the emergency departments during the years 1999-2001 in hospitals of 2nd and 3rd level of medical attention. Experts in the subject under consideration were selected to examine subject-specific data and to write guidelines. Special groups were specifically chosen to perform a formal literature review, to weight the strength of evidences for or against a particular treatment or procedure, and to include estimates of expected health outcomes where data exist. Current classifications were used in the recommendations that summarize both the evidence and expert opinion and provide final recommendation for both patient evaluation and therapy. These guidelines represent an attempt to define practices that meet the needs of most patients in most circumstances in Mexico. The ultimate judgment regarding the care of a particular patient must be made by the physician and patient in light of all of the available information and the circumstances presented by that patient. The present guidelines for the management of patients with unstable angina and non-ST--segment elevation myocardial infarction should be reviewed in the next coming future by Mexican cardiologists according to the forthcoming advances in ACS without ST-segment elevation.

  17. Tofacitinib, an oral Janus kinase inhibitor, in patients from Mexico with rheumatoid arthritis: Pooled efficacy and safety analyses from Phase 3 and LTE studies.

    PubMed

    Burgos-Vargas, Ruben; Cardiel, Mario; Xibillé, Daniel; Pacheco-Tena, César; Pascual-Ramos, Virginia; Abud-Mendoza, Carlos; Mahgoub, Ehab; Rahman, Mahboob; Fan, Haiyun; Rojo, Ricardo; García, Erika; Santana, Karina

    2017-05-25

    Tofacitinib is an oral Janus kinase inhibitor for the treatment of rheumatoid arthritis (RA). We characterized efficacy and safety of tofacitinib in Mexican patients from RA Phase 3 and long-term extension (LTE) studies. Data from Mexican patients with RA and an inadequate response to disease-modifying antirheumatic drugs (DMARDs) were taken from four Phase 3 studies (pooled across studies) and one open-label LTE study of tofacitinib. Patients received tofacitinib 5 or 10mg twice daily, adalimumab (one Phase 3 study) or placebo (four Phase 3 studies) as monotherapy or in combination with conventional synthetic DMARDs. Efficacy up to Month 12 (Phase 3) and Month 36 (LTE) was assessed by American College of Rheumatology 20/50/70 response rates, Disease Activity Score (erythrocyte sedimentation rate), and Health Assessment Questionnaire-Disability Index. Safety, including incidence rates (IRs; patients with events/100 patient-years) for adverse events (AEs) of special interest, was assessed throughout the studies. 119 and 212 Mexican patients were included in the Phase 3 and LTE analyses, respectively. Tofacitinib-treated patients in Phase 3 had numerically greater improvements in efficacy responses versus placebo at Month 3. Efficacy was sustained in Phase 3 and LTE studies. IRs for AEs of special interest were similar to those with tofacitinib in the global and Latin American RA populations. In Mexican patients from the tofacitinib global RA program, tofacitinib efficacy was demonstrated up to Month 12 in Phase 3 studies and Month 36 in the LTE study, with a safety profile consistent with tofacitinib global population. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  18. Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia

    PubMed Central

    Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel

    2007-01-01

    Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261

  19. Cytokine Signatures Discriminate Highly Frequent Acute Hepatitis a Virus and Hepatitis E Virus Coinfections from Monoinfections in Mexican Pediatric Patients.

    PubMed

    Realpe-Quintero, Mauricio; Copado-Villagrana, Edgar Daniel; Trujillo-Ochoa, Jorge Luis; Alvarez, Angel Hilario; Panduro, Arturo; Fierro, Nora Alma

    2017-07-01

    The frequency of hepatitis A virus and hepatitis E virus infections and their cytokine profiles were analyzed in Mexican pediatric patients with acute hepatitis. A high frequency of coinfections was found. Significant overexpression of interleukin (IL)-4, IL-12, IL-13 and interferon-gamma during hepatitis A virus monoinfections and limited secretion of cytokines in hepatitis E virus infections were observed.

  20. Periodontal microbiology in Latin America.

    PubMed

    Contreras, Adolfo; Moreno, Sandra M; Jaramillo, Adriana; Pelaez, Melissa; Duque, Andres; Botero, Javier E; Slots, Jørgen

    2015-02-01

    This review article describes the microbiota associated with periodontal disease in Latin America. This vast territory includes 22 nations, which show great ethnic diversity, with large groups of White people, Black people, Mestizo people and Native people. Widespread poverty and limited access to education and health-care services, including periodontal care, are prominent predisposing factors for destructive periodontal disease in Latin America. Black people and Mestizo people seem to have particularly severe periodontal disease and are frequently colonized by the major periodontal pathogens Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. The 'red complex' bacterial pathogens and A. actinomycetemcomitans predominate in chronic and aggressive periodontitis, but gram-negative enteric rods and herpesviruses can also play important periodontopathic roles in Latin America. The key to minimizing the risk of periodontal disease is control of the pathogens, and new low-cost periodontal treatments deserve serious consideration in Latin America. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. High Prolactin Excretion in Patients with Diabetes Mellitus and Impaired Renal Function.

    PubMed

    Triebel, Jakob; Moreno-Vega, Aura Ileana; Vázquez-Membrillo, Miguel; Nava, Gabriel; García-Franco, Renata; López-Star, Ellery; Baldivieso-Hurtado, Olivia; Ochoa, Daniel; Macotela, Yazmín; Bertsch, Thomas; Martinez de la Escalera, Gonzalo; Clapp, Carmen

    2015-01-01

    The metabolic clearance of prolactin (PRL) is partially executed by the kidney. Here, we investigate the urine excretion of PRL in patients with Diabetes Mellitus and renal impairment. Serum and urine samples were collected from male, mestizo patients in central Mexico employing a cross-sectional study design. Ninety-eight individuals had either no diabetes and normal renal function (control), diabetes and normal renal function, or diabetes with impaired renal function. PRL was determined by a chemiluminescent immunometric assay; protein, albumin, and creatinine were evaluated using quantitative colorimetric assays. The results were analyzed using ANOVA-testing. Patients with Diabetes Mellitus and renal impairment had significantly higher urine PRL levels than patients with Diabetes Mellitus and normal renal function and control patients. Higher urine PRL levels were associated with lower glomerular filtration rates, higher serum creatinine, and higher urinary albumin-to-creatinine ratios (UACR). Urine PRL levels correlated positively with UACR. Serum PRL levels were similar among groups. Patients with Diabetes Mellitus and impaired renal function demonstrate a high urinary PRL excretion. Urinary PRL excretion in the context of proteinuria could contribute to PRL dysregulation in renal impairment.

  2. [Characterisation of thromboembolic risk in a mexican population with non-valvular atrial fibrillation and its effect on anticoagulation (MAYA Study)].

    PubMed

    Vázquez-Acosta, Jorge A; Ramírez-Gutiérrez, Álvaro E; Cerecedo-Rosendo, Mario A; Olivera-Barrera, Francisco M; Tenorio-Sánchez, Salvador S; Nieto-Villarreal, Javier; González-Borjas, José M; Villanueva-Rodríguez, Estefanie

    2016-01-01

    To evaluate the risk of stroke and bleeding using the CHA2DS2-VASc and HAS-BLED scores in Mexican patients with atrial fibrillation and to analyze whether the risk score obtained determined treatment decisions regarding antithrombotic therapy. This is an observational, retrospective study in Mexican patients recently diagnosed with atrial fibrillation. The risk of stroke was assessed using the CHA2DS2-VASc scores. The bleeding risk was evaluated using the HAS-BLED score. The frequency of use of antithrombotic therapy was calculated according to the results of the score risk assessment. A total of 350 patients with non-valvular atrial fibrillation were analyzed. A 92.9% of patients had a high risk (score ≥ 2) of stroke according to the CHA2DS2-VASc score and only 17.2% were treated with anticoagulants. A high proportion of patients with atrial fibrillation (72.5%) showed both a high risk of stroke and a high risk of bleeding based on HAS-BLED score. In this group of patients with atrial fibrillation, from Northeast Mexico, there is a remarkably underutilization of anticoagulation despite the high risk of stroke of these patients.

  3. Differences Between Patients that Made an Impulsive or Premeditated Suicide Attempt in a Mexican Population.

    PubMed

    Reyes-Tovilla, Jorge E; Hernández Yánez, Homero Daniel; Peralta-Jiménez, Yesenia; Ramón-Frías, Teresa; Juárez-Rojop, Isela; Pool-García, Sherezada; Velázquez-Sánchez, Martha Patricia; López-Narvóez, Lilia; Fresán, Ana; Tovilla-Zárate, Carlos Alfonso

    2015-01-01

    We performed a study to identify differences between patients with impulsive suicide attempt and those with premeditated suicide attempt in a Mexican population. We studied 144 patients who recently attempted suicide. Impulsive and premeditated suicide attempts were evaluated with the Suicide Intent Scale. These data were divided according to the type of attempt. Subsequently, the characteristics between the two groups were compared. The rate of patients that made an impulsive attempt was 61.8% and only 9.7% of the patients carried out a premeditated suicide attempt. More years of schooling/education and less severity of the attempt were observed in patients that carried out an impulsive suicide attempt (p < 0.001). Alcohol consumption (0.003) and use of cannabis (0.002) were present in patients who premeditated a suicide attempt. Our findings demonstrate that there are clinical differences among the individuals who carried out an impulsive suicide attempt from those who premeditated an attempt in a Mexican population. As a result, when planning interventions and prevention efforts it may be helpful to consider these clinical differences and demographic characteristics. © 2015 The Author(s).

  4. Home-Based Diabetes Symptom Self-Management Education for Mexican Americans with Type 2 Diabetes

    ERIC Educational Resources Information Center

    García, Alexandra A.; Brown, Sharon A.; Horner, Sharon D.; Zuñiga, Julie; Arheart, Kristopher L.

    2015-01-01

    This pilot study evaluated an innovative diabetes symptom awareness and self-management educational program for Mexican Americans, a fast growing minority population experiencing a diabetes epidemic. Patients with diabetes need assistance interpreting and managing symptoms, which are often annoying and potentially life-threatening. A repeated…

  5. The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

    PubMed Central

    Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

    2017-01-01

    Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

  6. CFTR allelic heterogeneity in Mexican patients with cystic fibrosis: implications for molecular screening.

    PubMed

    Chávez-Saldaña, Margarita; Yokoyama, Emiy; Lezana, José Luis; Carnevale, Alessandra; Macías, Miguel; Vigueras, Rosa M; López, Marisol; Orozco, Lorena

    2010-01-01

    Cystic fibrosis, the most common autosomal recessive disorder, is caused by defects in the CF transmembrane conductance regulator gene (CFTR) that encodes a chloride channel. To date, over 1,800 mutations have been described related to the causative gene of CF, showing a variable frequency among populations. In a previous extensive analysis of the CFTR locus in 97 Mexican patients, 34 different mutations (75% of CF alleles) were found using several strategies for mutation screening; however, 63% had at least an uncharacterized allele. Despite the combined technologies used, there are still a great number of unknown mutations in the Mexican population. Screening of the CFTR gene to provide additional evidence of the mutational wide spectrum responsible for CF in Mexican patients. In this study, the number of unrelated CF patients was increased to 230, 133 new cases and the 97 previously reported to include 63% with at least an uncharacterized allele. Additional tools were used to improve the detection rate of CF mutations, such as a commercial kit for 36 mutations plus a single chain conformational polymorphism method and DNA sequencing. By using a combination of these strategies we characterized 77.7% of all the CF alleles, resulting in a total of 46 different mutations detected, including the identification of 12 additional mutations (p.R334W, p.A455E, c.3120+1G > A, c.3272-26A > G, c.711+1G > T, p.Q552X, p.W1282X, c.IVS8-5T, p.R1162X and p.R347P, p.D1152H and p.T1036N). Although these 12 mutations have been reported in other populations, they have not yet been reported in Mexican patients. This report shows that Mexico has one of the widest spectra of CFTR mutations worldwide. The knowledge of the ethnic and geographic distribution of CFTR mutations in this population will allow the development of more effective methods for diagnosis and treatment.

  7. A New Strategy for Latin America

    DTIC Science & Technology

    1992-04-01

    resulted in six significant racial groups; Indians, Europeans, Mestizo (Indians & Europeans); Black, Mulattoes (Black & Europeans), and Zambos (Indians...slice of the budget pie , a priority ranking of these countries would establish where the best benefits lie for US national security. As discussed, Latin

  8. Mexican "Curanderismo" as Ethnopsychotherapy: A Qualitative Study on Treatment Practices, Effectiveness, and Mechanisms of Change

    ERIC Educational Resources Information Center

    Zacharias, Steffi

    2006-01-01

    This article reports the results of a qualitative field study of the ethnotherapeutic treatment practices of "curanderos," the practitioners of traditional Mexican medicine, and their effectiveness in the treatment of mental illness. Three healers and their patients from the southwestern state of Oaxaca participated in the study. The…

  9. Self-care and Subjectivity among Mexican Diabetes Patients in the United States.

    PubMed

    Seligman, Rebecca; Mendenhall, Emily; Valdovinos, Maria D; Fernandez, Alicia; Jacobs, Elizabeth A

    2015-03-01

    Type 2 diabetes is considered a public health crisis, particularly among people of Mexican descent in the United States. Clinical approaches to diabetes management increasingly emphasize self-care, which places responsibility for illness on individuals and mandates self-regulation. Using narrative and free-list data from a two-phase study of low-income first- and second-generation Mexican immigrants living with diabetes, we present evidence that self-care among our participants involves emotion regulation as well as maintenance of and care for family. These findings suggest, in turn, that the ideology of selfhood on which these practices are based does not correspond with the ideology of selfhood cultivated in the U.S. clinical sphere. Divergence between these ideologies may lead to self-conflict for patients and the experience of moral blame. We argue that our participants use their explanations of diabetes causality and control as a form of self-making, which both resists such blame and asserts an alternative form of selfhood that may align more closely with the values held by our Mexican-American participants. © 2014 by the American Anthropological Association.

  10. Healthcare provider perspectives on barriers to HIV-care access and utilisation among Latinos living with HIV in the US-Mexico border.

    PubMed

    Servin, Argentina E; Muñoz, Fátima A; Zúñiga, María Luisa

    2014-01-01

    Latinos living with HIV residing in the US-Mexico border region frequently seek care on both sides of the border. Given this fact, a border health perspective to understanding barriers to care is imperative to improve patient health outcomes. This qualitative study describes and compares experiences and perceptions of Mexican and US HIV care providers regarding barriers to HIV care access for Latino patients living in the US-Mexico border region. In 2010, we conducted in-depth qualitative interviews with HIV care providers in Tijuana (n = 10) and San Diego (n = 9). We identified important similarities and differences between Mexican and US healthcare provider perspectives on HIV care access and barriers to service utilisation. Similarities included the fact that HIV-positive Latino patients struggle with access to ART medication, mental health illness, substance abuse and HIV-related stigma. Differences included Mexican provider perceptions of medication shortages and US providers feeling that insurance gaps influenced medication access. Differences and similarities have important implications for cross-border efforts to coordinate health services for patients who seek care in both countries.

  11. [Cost-effectiveness of two hospital care schemes for psychiatric disorders].

    PubMed

    Nevárez-Sida, Armando; Valencia-Huarte, Enrique; Escobedo-Islas, Octavio; Constantino-Casas, Patricia; Verduzco-Fragoso, Wázcar; León-González, Guillermo

    2013-01-01

    In Mexico, six of every twenty Mexicans suffer psychiatric disorders at some time in their lives. This disease ranks fifth in the country. The objective was to determine and compare the cost-effectiveness of two models for hospital care (partial and traditional) at a psychiatric hospital of Instituto Mexicano del Seguro Social (IMSS). a multicenter study with a prospective cohort of 374 patients was performed. We made a cost-effectiveness analysis from an institutional viewpoint with a six-month follow-up. Direct medical costs were analyzed, with quality of life gains as outcome measurement. A decision tree and a probabilistic sensitivity analysis were used. patient care in the partial model had a cost 50 % lower than the traditional one, with similar results in quality of life. The cost per successful unit in partial hospitalization was 3359 Mexican pesos while in the traditional it increased to 5470 Mexican pesos. treating patients in the partial hospitalization model is a cost-effective alternative compared with the traditional model. Therefore, the IMSS should promote the infrastructure that delivers the psychiatric services to the patient attending to who requires it.

  12. Herbal product use in non-HIV and HIV-positive Hispanic patients.

    PubMed Central

    Rivera, José O.; González-Stuart, Armando; Ortiz, Melchor; Rodríguez, José C.; Anaya, Jaime P.; Meza, Armando

    2005-01-01

    PURPOSE: The primary endpoint of this study was to determine the prevalence of herbal product use by a sample of Mexican-American patients in the El Paso, TX region. Even though medicinal plants are popularly assumed to be a safe and natural alternative to conventional medications, some herbal products may pose a potential health risk to the consumer. Currently, there are few studies related to herbal use by Mexican Americans and none in HIV patients living on the U.S./México border. METHODS: A prospective observational study was conducted in hospitals and clinics throughout the El Paso region area. A semistructured interview was conducted by trained bilingual interviewers. A 45-item bilingual questionnaire was used to collect the information. RESULTS: A total of 439 non-HIV patients as well as 35 patients afflicted with HIV participated in the study. Seventy-nine percent (347/439) of non-HIV and 71% (25/35) of HIV patients reported using herbal products. The percentages of herbal use among the two groups did not show any statistically significant differences (p=0.29), and both groups reflected that herbal products are commonly used. CONCLUSIONS: The use of herbal products was very common among non-HIV (79%) and HIV-positive (71%) Mexican-Americans patients in the El Paso region. PMID:16396061

  13. Course and predictors of supportive care needs among Mexican breast cancer patients: A longitudinal study.

    PubMed

    Pérez-Fortis, Adriana; Fleer, Joke; Schroevers, Maya J; López, Patricia Alanís; Sosa, Juan José Sánchez; Eulenburg, Christine; Ranchor, Adelita V

    2018-05-26

    This study examined the course and predictors of supportive care needs among Mexican breast cancer patients for different cancer treatment trajectories. Data from 172 (66.4% response rate) patients were considered in this observational longitudinal study. Participants were measured after diagnosis, neoadjuvant treatment, surgery, adjuvant treatment and the first post-treatment follow-up visit. Psychological, Health System and Information, Physical and Daily Living, Patient Care and Support, Sexual, and Additional care needs were measured with the Supportive Care Needs Survey (SCNS-SF34). Linear mixed models with maximum-likelihood estimation were computed. The course of supportive care needs was similar across the different cancer treatment trajectories. Supportive care needs declined significantly from diagnosis to the first post-treatment follow-up visit. Health System and Information care needs were the highest needs over time. Depressive symptoms and time since diagnosis were the most consistent predictors of changes in course of supportive care needs of these patients. Health system and information care needs of Mexican breast cancer patients need to be addressed with priority because these needs are the least met. Furthermore, patients with high depressive symptoms at the start of the disease trajectory have greater needs for supportive care throughout the disease trajectory. This article is protected by copyright. All rights reserved.

  14. Self-Care Behaviors and Glycemic Control in Low-Income Adults in México With Type 2 Diabetes Mellitus May Have Implications for Patients of Mexican Heritage Living in the United States.

    PubMed

    Compeán Ortiz, Lidia G; Del Ángel Pérez, Beatriz; Reséndiz González, Eunice; Piñones Martínez, Socorro; González Quirarte, Nora H; Berry, Diane C

    2016-04-01

    This study examined self-care behaviors and their relationship to glycemic control in low-income Mexican adults with type 2 diabetes in Southeastern Tamaulipas, México. A total of 135 patients were enrolled from 17 community health centers. The most frequent self-care behavior was medication management (80%), and the least frequent self-care behavior was self blood glucose monitoring (7%). All the patients demonstrated poor glycemic control, with glycated hemoglobin > 7%. Self-care behaviors were associated with fasting blood glucose (rs = .223, p = .005). Medication management was influenced by cognitive performance, F(1, 130) = 4.49, p = .036, and depression, F(1, 130) = 8.22, p = .005. Dietary behaviors were influenced by previous diabetes education, F(1, 130) = 6.73, p = .011. These findings indicate that education and cognitive behavioral interventions in Spanish for Mexican adults with type 2 diabetes are urgently needed. © The Author(s) 2015.

  15. Distribution of genetic variants of oxidative stress metabolism genes: Paraoxonase 1 (PON1) and Glutathione S-transferase (GSTM1/GSTT1) in a population from Southeastern Mexico.

    PubMed

    García-González, I; Mendoza-Alcocer, R; Pérez-Mendoza, G J; Rubí-Castellanos, R; González-Herrera, L

    2016-11-01

    Paraoxonase 1 (PON1) and glutathione S-transferases (GSTs) are involved in the biotransformation of xenobiotics. Variation in the enzyme concentration and activity suggests individual differences for the degree of protection against oxidative stress. This study analysed the distribution of SNPs Q192R, L55M (PON1) and variants in GSTM1 and GSTT1 genes in a population from Southeastern Mexico. One hundred and fifty-one Mexican Mestizo healthy volunteers were included. PON1 polymorphisms were determined by Taqman allele discrimination real time-PCR, whereas GSTM1 and GSTT1 genes were determined with a multiplex PCR-based method. All genotypes were in Hardy-Weinberg equilibrium, except for GSTM1. The genotypic distributions of Q192R and L55M were 22% QQ, 48% QR, 30% RR, 62% LL, 34% LM and 4% MM, respectively, whereas the allele frequencies were 0.46 (Q), 0.54 (R), 0.79 (L) and 0.21 (M). The most frequent haplotype was R/L (46.7%). It was found that 31% and 9% of the individuals had the GSTM1 and GSTT1 null genotype, respectively. The frequency of the combined null genotype GSTM1*0/GSTT1*0 was 4.64%. The results showed that the frequencies of polymorphisms of PON1, GSTM1 and GSTT1 in the Yucatán population differ to those observed in other ethnic groups and provide useful data for epidemiological studies.

  16. The Frequency and Type of K-RAS Mutations in Mexican Patients With Colorectal Cancer: A National Study.

    PubMed

    Cárdenas-Ramos, Susana G; Alcázar-González, Gregorio; Reyes-Cortés, Luisa M; Torres-Grimaldo, Abdiel A; Calderón-Garcidueñas, Ana L; Morales-Casas, José; Flores-Sánchez, Patricia; De León-Escobedo, Raúl; Gómez-Díaz, Antonio; Moreno-Bringas, Carmen; Sánchez-Guillén, Jorge; Ramos-Salazar, Pedro; González-de León, César; Barrera-Saldaña, Hugo A

    2017-06-01

    Current metastatic colorectal cancer (mCRC) therapy uses monoclonal antibodies against the epidermal growth factor receptor. This treatment is only useful in the absence of K-RAS gene mutations; therefore the study of such mutations is part of a personalized treatment. The aim of this work is to determine the frequency and type of the most common K-RAS mutations in Mexican patients with metastatic disease by nucleotide sequencing. We studied 888 patients with mCRC from different regions of Mexico. The presence of mutations in exon 2, codons 12 and 13, of the K-RAS gene was determined by nucleotide sequencing. Patients exhibited K-RAS gene mutations in 35% (310/888) of cases. Mutation frequency of codons 12 and 13 was 71% (221/310) and 29% (89/310), respectively. The most common mutation (45.7%) in codon 12 was c.35G>A (p.G12D), whereas the one in codon 13 was c.38G>A (p.G13D) (78.7%). Given the frequency of K-RAS mutations in Mexicans, making a genetic study before deciding to treat mCRC patients with monoclonal antibodies is indispensable.

  17. Cost of care according to disease-modifying therapy in Mexicans with relapsing-remitting multiple sclerosis.

    PubMed

    Macías-Islas, Miguel A; Soria-Cedillo, Isaac F; Velazquez-Quintana, Merced; Rivera, Victor M; Baca-Muro, Verónica I; Lemus-Carmona, Edith A; Chiquete, Erwin

    2013-12-01

    Limited data exist on the costs of care of patients with multiple sclerosis (MS) in low- to middle-income nations. The purpose of this study was to describe the economic burden associated with care of Mexican patients with relapsing-remitting MS in a representative sample of the largest institution of the Mexican public healthcare system. We analysed individual data of 492 patients (67% women) with relapsing-remitting MS registered from January 2009 to February 2011 at the Mexican Social Security Institute. Direct costs were measured about the use of diagnostic tests, disease-modifying therapies (DMTs), symptoms control, medical consultations, relapses, intensive care and rehabilitation. Four groups were defined according to DMT alternatives: (1) interferon beta (IFNβ)-1a, 6 million units (MU); (2) IFNβ-1a, 12MU; (3) IFNβ-1b, 8MU; and (4) glatiramer acetate. All patients received DMTs for at least 1 year. The most frequently used DMT was glatiramer acetate (45.5%), followed by IFNβ-1a 12MU (22.6%), IFNβ-1b 8MU (20.7%), and IFNβ-1a 6MU (11.2%). The mean cost of a specialised medical consultation was €74.90 (US $107.00). A single relapse had a mean total cost of €2,505.97 (US $3,579.96). No differences were found in annualised relapse rates and costs of relapses according to DMT. However, a significant difference was observed in total annual costs according to treatment groups (glatiramer acetate being the most expensive), mainly due to differences in unitary costs of alternatives. From the public institutional perspective, when equipotent DMTs are used in patients with comparable characteristics, the costs of DMTs largely determine the total expenses associated with care of patients with relapsing-remitting MS in a middle-income country.

  18. High‐altitude ancestry protects against hypoxia‐associated reductions in fetal growth

    PubMed Central

    Julian, Colleen Glyde; Vargas, Enrique; Armaza, J Fernando; Wilson, Megan J; Niermeyer, Susan; Moore, Lorna G

    2007-01-01

    Objective The chronic hypoxia of high‐altitude (⩾2500 m) residence has been shown to decrease birth weight in all populations studied to date. However, multigenerational high‐altitude populations appear protected relative to newcomer groups. This study aimed to determine whether such protection exists independently of other factors known to influence fetal growth and whether admixed populations (ie, people having both high‐ and low‐altitude ancestry) show an intermediate level of protection. Design 3551 medical records from consecutive deliveries to Andean, European or Mestizo (ie, admixed) women at low, intermediate or high altitudes in Bolivia were evaluated for maternal characteristics influencing fetal growth as measured by birth weight and the frequency of small for gestational age births (SGA or ⩽10th percentile birth weight for gestational age and sex). Two‐way analysis of variance and χ2 tests were used to compare maternal and infant characteristics. The effects of ancestry or altitude on SGA and birth weight were assessed using logistic or linear regression models, respectively. Results Altitude decreased birth weight and increased SGA in all ancestry groups. Andean infants weighed more and were less often SGA than Mestizo or European infants at high altitude (13%, 16% and 33% respectively, p<0.01). After accounting for the influences of maternal hypertensive complications of pregnancy, parity, body weight, and number of prenatal visits, European relative to Andean ancestry increased the frequency of SGA at high altitude nearly fivefold. Conclusions Andean relative to European ancestry protects against altitude‐associated reductions in fetal growth. The intermediate protection seen in the admixed (Mestizo) group is consistent with the influence of genetic or other Andean‐specific protective characteristics. PMID:17329275

  19. Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

    PubMed

    Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

    2013-01-01

    Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

  20. Mexican American Women's Adherence to Hemodialysis Treatment: A Social Constructivist Perspective

    ERIC Educational Resources Information Center

    Tijerina, Mary S.

    2009-01-01

    Mexican Americans have as much as a six-times greater risk of end-stage renal disease (ESRD) than non-Hispanic white Americans, and women show a faster rate of decline in diabetic renal functioning. The leading treatment for ESRD is hemodialysis, an intensive, complex treatment regimen associated with high levels of patient nonadherence. Previous…

  1. Epidemic hecatomb in the New World.

    PubMed

    Naranjo, P

    1992-01-01

    The American population developed, during thousands of years, free of epidemics that had been attacking Europe, Asia and Africa. The European and African migrations, after Columbus's first trip, produced an epidemic invasion of influenza, smallpox, measles, yellow fever, malaria, diphtheria, typhus, and other diseases that attacked the immunologically virgin populations and produced a very high mortality, with a diminution of the indigenous population of more than 90% in many places. According to historical evidence, the first epidemic was influenza, produced by swine strain of virus, immediately followed by smallpox. The Spaniards mated freely with the Indians producing a mixed race called the Mestizo, who were immunologically more capable of defending themselves against various viruses, bacteria, and parasites brought over from the Old World. Marriage between the races also was sanctioned by Queen Isabella (1503) and Fernando I (1515). With these new genetic immunologic defenses against infections, the Mestizo eventually made up the majority of the population of Indians in the New World.

  2. Surgical Outcome of Ahmed Valve Implantation in Mexican Patients with Neovascular Glaucoma.

    PubMed

    Hernandez-Oteyza, Alejandra; Lazcano-Gomez, Gabriel; Jimenez-Roman, Jesus; Hernandez-Garciadiego, Carlos

    2014-01-01

    To describe clinical results of Ahmed glaucoma valve implantation in Mexican patients with neovascular glaucoma (NVG). We reviewed records of 60 eyes of 60 patients with NVG who underwent Ahmed valve implantation, with a follow-up period of 1 year. We identified successful and failed cases and compared baseline and follow-up characteristics to identify possible differences between both groups. We classified 36 eyes (60%) as successful and 24 (40%) as failed cases. We found a significant difference in success rate in patients who had a hypertensive phase at any time during the follow-up period (OR = 5.15, CI = 1.49-20.15, p = 0.004). Patients in the success group showed a statistically significant decrease in the number of glaucoma medications 1 year after surgery (p <0.0001). We found a statistically significant difference in success rate in patients who had preoperative best corrected visual acuity (BCVA) better than logmar 0.70 (odds ratio 4.31, CI = 1.1-19.3, p = 0.03086). A hypertensive postoperative phase and a preoperative BCVA worse or equal to 20/100 seem to be risk factors for Ahmed valve surgical failure in patients with NVG. How to cite this article: Hernandez-Oteyza A, Lazcano-Gomez G, Jimenez-Roman J, Hernandez-Garciadiego C. Surgical Outcome of Ahmed Valve Implantation in Mexican Patients with Neovascular Glaucoma. J Curr Glaucoma Pract 2014;8(3):86-90.

  3. [Comparison of dissolution profile and plasma concentration-time profile of the thalidomide formulations made by Japanese, Mexican and British companies].

    PubMed

    Fujita, Yukiyoshi; Yamamoto, Koujirou; Aomori, Tohru; Murakami, Hirokazu; Horiuchi, Ryuya

    2008-10-01

    Thalidomide is an important advance in the treatment of multiple myeloma. In Japan thalidomide is now on the approval step for the treatment of multiple myeloma. The drug has some bothersome side effects such as defect of organogenesis, neuropathy, constipation and fatigue, but is likely more effective than standard chemotherapy and is changing multiple myeloma treatment. At this moment, Japanese patients must import the thalidomide preparations from Mexico, Britain and elsewhere, but after approval, they patients will be able to get the new Japanese thalidomide capsules. In order to determine appropriate amounts of Japanese thalidomide capsules in the treatment of multiple myeloma, we compared the dissolution profile and plasma thalidomide concentrations of Japanese and British capsules and Mexican tablets. The dissolution test was performed according to the Japanese and the United States Pharmacopoeia. The pharmacokinetic data for Japanese capsules were obtained from the clinical trial in Japanese subjects and compared with those data published for other formulations. The dissolution rate of the Japanese capsule was the fastest, followed by British and Mexican formulations. The pharmacokinetic profiles of Japanese and British capsules were similar, while the 100 mg Japanese thalidomide capsule demonstrated a 1.6-fold higher maximum plasma concentration than the 200 mg Mexican thalidomide tablet (1.7 vs. 1.1 microg/ml), greatly shortened t(max) (4.5 vs. 6.2 h), and the apparent half life was only one-third of the Mexican tablet (4.8 vs. 13.5 h). A comparison of the dissolution and the pharmacokinetic absorption profiles demonstrated a rank-order correlation. Physicians and pharmacists should be aware of the probable alteration in plasma thalidomide concentration when switching to the Japanese capsule, especially from the Mexican tablet, and should monitor clinical response carefully.

  4. The Hispanicization of the United States.

    ERIC Educational Resources Information Center

    Nostrand, Richard L.

    Two strikingly contrasting culture groups, Latin Americans and Anglo Americans, overlap in a Borderlands that straddles the international boundary between the United States and Mexico. This overlap began with the Aztec conquest by Cortes which triggered the intermixing and miscegenation between Spaniards and Indians that produced a mestizo people…

  5. Validity of the Mexican version of the combined Foot Care Confidence / Foot-Care Behavior scale for diabetes.

    PubMed

    García-Inzunza, Jaime A; Valles-Medina, Ana M; Muñoz, Fátima A; Delgadillo-Ramos, Guadalupe; Compean-Ortiz, Lidia G

    2015-07-01

    To 1) translate / transculturally adapt the original (English-language) combined Foot Care Confidence Scale / Foot-Care Behavior instrument (FCCS-FCB) to produce a Mexican-Spanish version and 2) determine its validity and reliability in a population with diabetes in Tijuana, Mexico. The original FCCS-FCB was translated (and back-translated), the content validated (by a group of health professional experts), and the instrument applied to 304 patients 23-78 years old in diabetes support groups in Tijuana, Mexico. Internal consistency for the study constructs ("self-efficacy," and risk / preventive foot self-care behaviors) was measured using Cronbach's alpha. The constructs were validated using principal component factor analysis. The Cronbach's alpha values for internal consistency were 0.782 for self-efficacy and 0.505 for behaviors. Based on the analysis, two factors explained 49.1% of the total variance for self-efficacy, and six factors explained 57.7% of the total variance for behaviors. The results were consistent with those for the original (English) version of the FCCS-FCB. The Mexican version of the FCCS-FCB is a reliable and valid instrument recommended for use with Mexican-Spanish-speaking patients with diabetes.

  6. Supportive care needs of Mexican adult cancer patients: validation of the Mexican version of the Short-Form Supportive Care Needs Questionnaire (SCNS-SFM).

    PubMed

    Doubova, Svetlana V; Aguirre-Hernandez, Rebeca; Gutiérrez-de la Barrera, Marcos; Infante-Castañeda, Claudia; Pérez-Cuevas, Ricardo

    2015-09-01

    The purpose of this study is to validate the Mexican version of the Short-Form Supportive Care Needs survey (SCNS-SFM). A cross-sectional survey was conducted from June to December 2013 at the Oncology Hospital of the Mexican Institute of Social Security in Mexico City. The study included 825 subsequent cancer patients >20 years of age with all forms of solid cancer. Patients had prior surgical removal of histologically confirmed cancer and attended outpatient consultations. Validation of SCNS-SFM included the following: (1) content validity through a group of experts; (2) construct validity through an exploratory factor analysis based on the polychoric correlation matrix; (3) internal consistency using Cronbach's alpha; (4) convergent validity between SCNS-SFM and quality of life, anxiety, and depression scales by calculating Pearson's correlation coefficient; (5) discriminative validity through analysis of MANOVAs; and (6) test-retest reliability using intraclass correlation coefficient calculations. SCNS-SFM has 33 items with five factors accounting for 59 % of total variance. Cronbach's alpha values ranged from 0.78 to 0.90 among factors. SCNS-SFM has good convergent validity compared with quality of life and depression and anxiety scales and good discriminative validity, revealing great information, psychological support, and physical daily living needs for women, patients <60 years, and high physical daily living needs for those with <1 year since cancer diagnosis, with advanced disease stages and current chemo- or radiotherapy. Intraclass correlation coefficient between SCNS-SFM measurements was 0.9. SCNS-SFM has acceptable psychometric properties and is suitable to evaluate supportive care needs of cancer patients.

  7. Healthcare provider perspectives on barriers to HIV-care access and utilisation among Latinos living with HIV in the US-Mexico border

    PubMed Central

    Servin, Argentina E.; Muñoz, Fátima A.; Zúñiga, María Luisa

    2015-01-01

    Latinos living with HIV residing in the US-Mexico border region frequently seek care on both sides of the border. Given this fact, a border health perspective to understanding barriers to care is imperative to improve patient health outcomes. This qualitative study describes and compares experiences and perceptions of Mexican and US HIV care providers regarding barriers to HIV care access for Latino patients living in the US-Mexico border region. In 2010, we conducted in-depth qualitative interviews with HIV care providers in Tijuana (n = 10) and San Diego (n = 9). We identified important similarities and differences between Mexican and US healthcare provider perspectives on HIV care access and barriers to service utilisation. Similarities included the fact that HIV-positive Latino patients struggle with access to ART medication, mental health illness, substance abuse and HIV-related stigma. Differences included Mexican provider perceptions of medication shortages and US providers feeling that insurance gaps influenced medication access. Differences and similarities have important implications for cross-border efforts to coordinate health services for patients who seek care in both countries. PMID:24592920

  8. Culture in la clínica: Evaluating the utility of the Cultural Formulation Interview (CFI) in a Mexican outpatient setting.

    PubMed

    Ramírez Stege, Alyssa M; Yarris, Kristin Elizabeth

    2017-08-01

    While the classification of psychiatric disorders has been critiqued for failing to adequately account for culture, the inclusion of the Cultural Formulation Interview (CFI) in the DSM-5 has been viewed as a promising development for the inclusion of cultural factors in diagnosis and treatment of mental illness. In this study, we assess the appropriateness, acceptability, and clinical utility of the CFI among outpatients in a Mexican psychiatric hospital. Our assessment included observations of psychiatric residents' application of the CFI with 19 patients during routine outpatient visits, along with pre- and post-CFI interviews to determine providers' and patients' views of the CFI. The CFI was generally well received by providers and patients, viewed as a way of building trust and increasing providers' understanding of contextual factors influencing mental illness, such as social support. However, the CFI questions specifically related to "culture" were of limited effect and both patients and providers did not view them as useful. We discuss implications for the clinical assessment of cultural factors influencing mental health and illness and for the incorporation of the CFI in Mexican clinical settings.

  9. Mexican registry of pulmonary hypertension: REMEHIP.

    PubMed

    Sandoval Zarate, Julio; Jerjes-Sanchez, Carlos; Ramirez-Rivera, Alicia; Zamudio, Tomas Pulido; Gutierrez-Fajardo, Pedro; Elizalde Gonzalez, Jose; Leon, Mario Seoane Garcia De; Gamez, Miguel Beltran; Abril, Francisco Moreno Hoyos; Michel, Rodolfo Parra; Aguilar, Humberto Garcia

    REMEHIP is a prospective, multicentre registry on pulmonary hypertension. The main objective will be to identify the clinical profile, medical care, therapeutic trends and outcomes in adult and pediatric Mexican patients with well-characterized pulmonary hypertension. REMEHIP a multicenter registry began in 2015 with a planned recruitment time of 12 months and a 4-year follow-up. The study population will comprise a longitudinal cohort study, collecting data on patients with prevalent and incident pulmonary hypertension. Will be included patients of age >2 years and diagnosis of pulmonary hypertension by right heart catheterization within Group 1 and Group 4 of the World Health Organization classification. The structure, data collection and data analysis will be based on quality current recommendations for registries. The protocol has been approved by institutional ethics committees in all participant centers. All patients will sign an informed consent form. Currently in Mexico, there is a need of observational registries that include patients with treatment in the everyday clinical practice so the data could be validated and additional information could be obtained versus the one from the clinical trials. In this way, REMEHIP emerges as a link among randomized clinical trials developed by experts and previous Mexican experience. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  10. [HLA class II in Mexican patients with pemphigus vulgaris: shared epitope for autoimmunity].

    PubMed

    Rangel-Gamboa, Lucía; Vega-Memije, María Elisa; Acuña-Alonzo, Víctor; Granados-Arriola, Julio

    Pemphigus is an autoimmune blistering disease of skin and mucous membranes characterized by presence of IgG antibodies against desmoglein 3, and 1. Desmoglein 3 and 1 are presented in pemphigus vulgaris and pemphigus foliaceous, respectively. Desmoglein are transmembrane proteins that form part of cellular junctions called desmosomes. Major histocompatibility complex class II molecules have been related to autoimmune disease; in pemphigus vulgaris, different human lymphocyte antigens (HLA) were associated among different ethnic groups, such as HLA-DR4, HLA-DR14, and HLA-DR1. to determine the allele HLA-DR genetic frequencies in Mexican patients with pemphigus. Patients with clinical, histological, and immunofluorescence diagnosis monitored at the Dermatology Department of the Mexican General Hospital were included. DNA was extracted from blood samples and genetic recognition of HLA-DRβ1 was performed by polymerase chain reaction and hybridization. Forty-three patients with pemphigus were included: 35 (81.4%) women and eight men (18.6%) between 16 and 85 years old. The HLA-DR14 and HLA-DR1 genetic frequencies were elevated among pemphigus patients and these alleles confer risk to pemphigus 2.2 and 3.3, respectively. These findings suggest that pemphigus vulgaris susceptibility is part of a general predisposition to present autoimmune diseases.

  11. Nicaragua: Educational Policy for Ethnic Minorities.

    ERIC Educational Resources Information Center

    Rippberger, Susan

    Since taking power, the Sandinista government has made a commitment to educating all Nicaraguans. Under its direction, literacy increased from approximately 50 to 88 percent. Thousands of new teachers were hired, and the number of elementary schools doubled. The official language is Spanish, and the dominant culture, Mestizo (mixed Spanish and…

  12. Amerindian and Translingual Literacies across Time and Space

    ERIC Educational Resources Information Center

    Coronel-Molina, Serafín M.; Cowan, Peter M.

    2017-01-01

    Recent studies have examined Indigenous and mestizo communities that engage in social practices of transculturated, Amerindian and translingual literacies, often to resist efforts by powerful groups to oppress them. By drawing on data from studies conducted in Peru and the United States, we trace the trajectories of Amerindian and translingual…

  13. Methylenetetrahydrofolate reductase C677T polymorphism and Factor V Leiden variant in Mexican women with preeclampsia/eclampsia.

    PubMed

    Dávalos, I P; Moran, M C; Martínez-Abundis, E; González-Ortiz, M; Flores-Martínez, S E; Machorro, V; Sandoval, L; Figuera, L E; Mena, J P; Oliva, J M; Tlacuilo-Parra, J A; Sánchez-Corona, J; Salazar-Páramo, M

    2005-01-01

    The etiology of preeclampsia is still a matter of controversy. An association between hyperhomocysteinemia and preeclamptic patients has been described. A common missense mutation in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with increased plasma homocysteine concentrations. In addition, the polymorphism of gene encoding for Factor V Leiden G1691A is associated with a prothrombotic state in heterozygous subjects. Both mutations in these thrombophilic proteins appear to have different prevalence in the general population and in patients with preeclampsia/eclampsia (PE/E). We studied single nucleotide polymorphisms for MTHFR C677T and coagulation Factor V Leiden in 33 Mexican patients with PE/E as a genetic risk factor for these diseases, comparing with a normotensive pregnant control group. The genotype and allele frequencies of MTHFR C677T and Factor V Leiden mutations between Mexican women with PE/E and healthy controls were not different. We conclude that these polymorphisms do not contribute in the etiology of PE/E as it has been reported in other populations.

  14. [Lower incidence of severe damage to target organs in mexican patients with systemic sclerosis and diffuse skin affection].

    PubMed

    Rojas-Serrano, Jorge; Codina-Velásquez, Helga; Medrano-Ramírez, Gabriel; Abraham Simón, J; Vera-Lastra, Olga; Vázquez-Mellado, Janitzia

    2008-01-01

    To determine the cumulative incidence of severe organ involvement in Mexican patients with systemic sclerosis (SS) and diffuse scleroderma at 3 years from the onset of SS symptoms, and to compare itwith the cumulative incidence observed in a cohort of white patients with SS. Patients with SS and diffuse scleroderma were evaluated within the first 2 years from the onset of SS symptoms and were included. An estimation of the cumulative incidence of severe involvement to the skin, kidney, heart, lungs, and gastrointestinal track at 3 years from the onset of SS symptoms was carried out. This cumulative incidence was compared with that of white SS patients with diffuse scleroderma, using the one sample test for a binomial proportion. Sixty-three patients were included. The cumulative incidence of severe involvement to the skin was 3.17% (2/63) (95% CI, 0.04%-11); kidney involvement in 4.17% (3/63) (95% CI, 0.99%-13.29%); heart involvement in 1.6% (1/63) (95% CI, 0.04%-8.5%); lung involvement in 11.11% (7/63) (95% IC, 4.5%-21.5%); and gastrointestinal involvement in 4.7% (3/63) (95% IC, 0.99%-13.3%). Mexican patients had a lower Reumatol Clin. 2008;4(1):3-7 3 02 ORIG 2582 (3-7).qxp 23/1/08 11:09 Página 4 Rojas-Serrano J et al. Incidencia de daño grave en pacientes mexicanos con esclerosis sistémica incidence of severe skin involvement (P=.0001), kidney involvement (P=.03) and heart involvement (P=.03) compared to white SS patients with diffuse scleroderma. The cumulative incidence of severe organ involvement in SS Mexican patients with diffuse scleroderma was determined. The incidence of severe skin, kidney and heart involvement is lower than in white SS patients with diffuse scleroderma. Copyright © 2008 Elsevier España. Reumatología Clínica ® Sociedad Española de Reumatología and ® Colegio Mexicano de Reumatología. Published by Elsevier Espana. All rights reserved.

  15. Biosimilar drugs in Mexico: position of the Mexican College of Rheumatology, 2012.

    PubMed

    Espinosa Morales, Rolando; Díaz Borjón, Alejandro; Barile Fabris, Leonor Adriana; Esquivel Valerio, Jorge Antonio; Medrano Ramírez, Gabriel; Arce Salinas, César Alejandro; Barreira Mercado, Eduardo Rubén; Cardiel Ríos, Mario Humberto; Díaz Jouanen, Efraín; Flores Murrieta, Francisco Javier; Fraga Mouret, Antonio; Garza Elizondo, Mario Alberto; Luján Estrada, Miguel; Muñoz Barradas, Francisco José; Talavera Piña, Juan Osvaldo; Vera Lastra, Olga Lidia

    2013-01-01

    Biotechnological drugs (BTDs) are complex molecules whose manufacturing process precludes the ability to identically reproduce the structure of the original product, and therefore there cannot be an absolute equivalence between the original (innovative) medication and its biosimilar counterpart. BTDs have been proven useful in the treatment of several rheumatic diseases, however their high cost has prevented their use in many patients. Several BTD patents have expired or are close to expire, triggering the development of structurally similar drugs with efficacy and safety profiles comparable to the innovative compound; however, these must be evaluated through evidence based medicine. The Mexican General Health Law contemplates the registry of these biosimilar drugs for their use in our country. This document is a forethought from members of the Mexican College of Rheumatology, pharmacologists, and epidemiologists, in accordance with Mexican health authorities regarding the necessary scientific evidence required to evaluate the efficacy and safety of biosimilar drugs before and after their arrival to the Mexican market. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  16. The effects of financial pressures on adherence and glucose control among racial/ethnically diverse patients with diabetes.

    PubMed

    Ngo-Metzger, Quyen; Sorkin, Dara H; Billimek, John; Greenfield, Sheldon; Kaplan, Sherrie H

    2012-04-01

    The Affordable Care Act is designed to decrease the numbers of uninsured patients in U.S. However, even with insurance, patients who have financial hardships may have difficulty obtaining their medications because of cost issues. Among patients with type 2 diabetes, to examine the association between patients' self-reported financial pressures on cost-related medication non-adherence and glucose control. Additionally, to examine whether having insurance decrease the financial pressures of diabetes care. Racially/ethnically diverse patients (N = 1,361; 249 non-Hispanic whites, 194 Vietnamese, and 533 Mexican American) with type 2 diabetes were recruited from seven outpatient clinics for a cross-sectional, observational study. Although both Vietnamese and Mexican-American patients reported having low annual incomes, more Mexican Americans reported the presence of financial barriers to getting medical care and perceived financial burden due to their diabetes, compared to whites and Vietnamese (p < 0.001). Over half (53.2%) of Mexican Americans reported cost-related non-adherence compared to 27.2% of white and 27.6% of Vietnamese patients (p < 0.001). Perceived financial burden was found to be associated with poor glucose control (HbA1c ≥8%), after adjusting for sociodemographic and health characteristics (aOR = 1.70, 95%CI 1.09-2.63), but not when adjusting for non-adherence. Similarly, a significant association between presence of financial barriers and HbA1c (aOR = 1.69, 95%CI 1.23-2.32) was attenuated with the inclusion of insurance status in the model. Being uninsured (aOR = 1.90, 95%CI 1.13-3.21) and non-adherent (aOR = 1.49, 95%CI 1.06-2.08) were each independently associated with HbA1c. While having health insurance coverage eliminated some of the financial barriers associated with having diabetes, low-income patients still faced significant financial burdens. Thus, providing health insurance to more individuals is only the first step towards eliminating health disparities. It is important to address medication cost in order to improve medication adherence and glucose control.

  17. Knowledge about cervical cancer screening among family physicians: cross-sectional survey.

    PubMed

    Del Refugio Gonzalez-Losa, Maria; Gongora-Marfil, Glendy K; Puerto-Solis, Marylin

    2009-04-01

    Cervical cancer (CC) is an important public health problem worldwide. In Mexico, there has been a National Cervical Cancer Screening Program (NCCSP) since 1974. Mexican Social Security Institute attended Mexican workers and family physicians are responsible of the primary care of patients. To evaluate knowledge about the aetiology and prevention of CC among family physicians working in Yucatan, Mexico, at Mexican Social Security Institute. A questionnaire was applied to 187 family doctors. Self-administer questionnaire with 10 item previously used by ours and other researchers, was used for the evaluation. Each correctly answered item was given a point. The maximum grade was 10 and the minimum 0. The knowledge mean was 6.93 points. Fewer than 50% knew what to do with women who are human papillomavirus (HPV) positive without a precancerous cervical lesion and the appropriate age range for Pap smears. A total of 61.1% identified CC as an important health problem in Mexico; however, 95.1% identified CC as a preventive cause of deaths among Mexican women and recognized that HPV is the main CC aetiological agent, and 90.3% mentioned the Pap smear as the main method of diagnosis of CC. The family doctors need to have an adequate knowledge of the practical elements of the NCCSP to give an efficient attention to their patients.

  18. Prevalence of gene rearrangements in Mexican children with acute lymphoblastic leukemia: a population study-report from the Mexican Interinstitutional Group for the identification of the causes of childhood leukemia.

    PubMed

    Bekker-Méndez, Vilma Carolina; Miranda-Peralta, Enrique; Núñez-Enríquez, Juan Carlos; Olarte-Carrillo, Irma; Guerra-Castillo, Francisco Xavier; Pompa-Mera, Ericka Nelly; Ocaña-Mondragón, Alicia; Rangel-López, Angélica; Bernáldez-Ríos, Roberto; Medina-Sanson, Aurora; Jiménez-Hernández, Elva; Amador-Sánchez, Raquel; Peñaloza-González, José Gabriel; de Diego Flores-Chapa, José; Fajardo-Gutiérrez, Arturo; Flores-Lujano, Janet; Rodríguez-Zepeda, María Del Carmen; Dorantes-Acosta, Elisa María; Bolea-Murga, Victoria; Núñez-Villegas, Nancy; Velázquez-Aviña, Martha Margarita; Torres-Nava, José Refugio; Reyes-Zepeda, Nancy Carolina; González-Bonilla, Cesar; Mejía-Aranguré, Juan Manuel

    2014-01-01

    Mexico has one of the highest incidences of childhood leukemia worldwide and significantly higher mortality rates for this disease compared with other countries. One possible cause is the high prevalence of gene rearrangements associated with the etiology or with a poor prognosis of childhood acute lymphoblastic leukemia (ALL). The aims of this multicenter study were to determine the prevalence of the four most common gene rearrangements [ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL rearrangements] and to explore their relationship with mortality rates during the first year of treatment in ALL children from Mexico City. Patients were recruited from eight public hospitals during 2010-2012. A total of 282 bone marrow samples were obtained at each child's diagnosis for screening by conventional and multiplex reverse transcription polymerase chain reaction to determine the gene rearrangements. Gene rearrangements were detected in 50 (17.7%) patients. ETV6-RUNX1 was detected in 21 (7.4%) patients, TCF3-PBX1 in 20 (7.1%) patients, BCR-ABL1 in 5 (1.8%) patients, and MLL rearrangements in 4 (1.4%) patients. The earliest deaths occurred at months 1, 2, and 3 after diagnosis in patients with MLL, ETV6-RUNX1, and BCR-ABL1 gene rearrangements, respectively. Gene rearrangements could be related to the aggressiveness of leukemia observed in Mexican children.

  19. Prevalence of Gene Rearrangements in Mexican Children with Acute Lymphoblastic Leukemia: A Population Study—Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia

    PubMed Central

    Bekker-Méndez, Vilma Carolina; Miranda-Peralta, Enrique; Núñez-Enríquez, Juan Carlos; Olarte-Carrillo, Irma; Guerra-Castillo, Francisco Xavier; Pompa-Mera, Ericka Nelly; Ocaña-Mondragón, Alicia; Bernáldez-Ríos, Roberto; Medina-Sanson, Aurora; Jiménez-Hernández, Elva; Amador-Sánchez, Raquel; Peñaloza-González, José Gabriel; de Diego Flores-Chapa, José; Fajardo-Gutiérrez, Arturo; Flores-Lujano, Janet; Rodríguez-Zepeda, María del Carmen; Dorantes-Acosta, Elisa María; Bolea-Murga, Victoria; Núñez-Villegas, Nancy; Velázquez-Aviña, Martha Margarita; Torres-Nava, José Refugio; Reyes-Zepeda, Nancy Carolina; González-Bonilla, Cesar; Mejía-Aranguré, Juan Manuel

    2014-01-01

    Mexico has one of the highest incidences of childhood leukemia worldwide and significantly higher mortality rates for this disease compared with other countries. One possible cause is the high prevalence of gene rearrangements associated with the etiology or with a poor prognosis of childhood acute lymphoblastic leukemia (ALL). The aims of this multicenter study were to determine the prevalence of the four most common gene rearrangements [ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL rearrangements] and to explore their relationship with mortality rates during the first year of treatment in ALL children from Mexico City. Patients were recruited from eight public hospitals during 2010–2012. A total of 282 bone marrow samples were obtained at each child's diagnosis for screening by conventional and multiplex reverse transcription polymerase chain reaction to determine the gene rearrangements. Gene rearrangements were detected in 50 (17.7%) patients. ETV6-RUNX1 was detected in 21 (7.4%) patients, TCF3-PBX1 in 20 (7.1%) patients, BCR-ABL1 in 5 (1.8%) patients, and MLL rearrangements in 4 (1.4%) patients. The earliest deaths occurred at months 1, 2, and 3 after diagnosis in patients with MLL, ETV6-RUNX1, and BCR-ABL1 gene rearrangements, respectively. Gene rearrangements could be related to the aggressiveness of leukemia observed in Mexican children. PMID:25692130

  20. Resist This! Embodying the Contradictory Positions and Collective Possibilities of Transformative Resistance

    ERIC Educational Resources Information Center

    Quijada Cerecer, David Alberto; Cahill, Caitlin; Bradley, Matt

    2011-01-01

    Youth participatory action research (YPAR) and arts-informed approaches reflect a source of critical resistance at the intersection of theory and practice (praxis). Our discussion draws upon "Mestizo Arts & Activism" ("MAA"), a participatory action research collective made up of young people who focused their research on the educational rights of…

  1. Let Jorge Do It: An Approach to Rural Nonformal Education.

    ERIC Educational Resources Information Center

    Hoxeng, James

    Operating under the philosophy that people can learn from each other, the Nonformal Education Project trained 24 Ecuadorian campesinos in seven rural mestizo villages to instruct their peers in basic litaracy skills, negotiating techniques, and the development of self-esteem. Within a year of operation some of the original "facilitators"…

  2. Influence of School and Environment on Selective Memory.

    ERIC Educational Resources Information Center

    Wilkinson, Alex; And Others

    1979-01-01

    Subjects were 943 mestizo and Quechua Indian children aged five and six years who lived in jungle villages near Lanas and in slum settlements in Lima, Peru. Some six year olds attended school and others did not. The children were tested with a task that assessed memory for central and incidental features of drawings. (JMB)

  3. Schooling, Environment and Cognitive Development: A Cross-Cultural Study.

    ERIC Educational Resources Information Center

    Stevenson, Harold W.; And Others

    1978-01-01

    Investigated the influence of schooling and environment on young children's memory and cognitive skills. Subjects were five- and six-year-old Mestizo and Quechua Indian children living in jungle villages or city slums in Peru. Samples of upper-middle-class children in Lima and poor children in Detroit were also tested. (JMB)

  4. The Impact of LEP G-2548A and LEPR Gln223Arg Polymorphisms on Adiposity, Leptin, and Leptin-Receptor Serum Levels in a Mexican Mestizo Population.

    PubMed

    Chavarria-Avila, Efraín; Vázquez-Del Mercado, Mónica; Gomez-Bañuelos, Eduardo; Ruiz-Quezada, Sandra-Luz; Castro-Albarran, Jorge; Sánchez-López, Lizeth; Martín-Marquez, Beatriz Teresita; Navarro-Hernández, Rosa-Elena

    2015-01-01

    The polymorphisms in leptin (LEP G-2548A) and leptin-receptor (LEPR Gln223Arg) seem to influence obesity and lipid metabolism among others. The aim of this study was to investigate the effect of these polymorphisms on adiposity, leptin (sLeptin), and leptin-receptor (sLeptin-receptor) serum concentrations as well as inflammation markers. We included 382 adults originally from Western Mexico. They were genotyped by PCR-RFLP. Obese individuals showed higher sLeptin (58.2 ± 31.35 ng/mL) but lower sLeptin-receptor (12.6 ± 3.74 ng/mL) levels than normal weight ones (17.6 ± 14.62 ng/mL, 17.4 ± 4.62 ng/mL, resp.), P < 0.001. Obese subjects carriers of Arg/Arg genotype had more (P = 0.016) sLeptin-receptor (14.7 ± 4.96 ng/mL) and less (P = 0.004) sLeptin (44.0 ± 28.12 ng/mL) levels than Gln/Gln genotype (11.0 ± 2.92 ng/mL, 80.3 ± 33.24 ng/mL, resp.). Body fat mass was lower (P from 0.003 to 0.045) for A/A (36.5% ± 6.80) or Arg/Arg (36.8% ± 6.82) genotypes with respect to G/G (41.3% ± 5.52) and G/A (41.6% ± 5.61) or Gln/Gln (43.7% ± 4.74) and Gln/Arg (41.0% ± 5.52) genotypes carriers. Our results suggest that LEP -2548A and LEPR 223Arg could be genetic markers of less body fat mass accumulation in obese subjects from Western Mexico.

  5. A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans

    PubMed Central

    Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K.; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D.; de Ángeles Granados-Silvestre, Ma; Montufar-Robles, Isela; Tito-Alvarez, Ana M.; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P.; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L.; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A.; Lisker, Ruben; Moises, Regina S.; Menjivar, Marta; Salzano, Francisco M.; Knowler, William C.; Bortolini, M. Cátira; Hayden, Michael R.; Baier, Leslie J.; Canizales-Quinteros, Samuel

    2010-01-01

    It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 × 10−11) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations. PMID:20418488

  6. Performance in working memory and attentional control is associated with the rs2180619 SNP in the CNR1 gene.

    PubMed

    Ruiz-Contreras, A E; Carrillo-Sánchez, K; Ortega-Mora, I; Barrera-Tlapa, M A; Román-López, T V; Rosas-Escobar, C B; Flores-Barrera, L; Caballero-Sánchez, U; Muñoz-Torres, Z; Romero-Hidalgo, S; Hernández-Morales, S; González-Barrios, J A; Vadillo-Ortega, F; Méndez-Díaz, M; Aguilar-Roblero, R; Prospéro-García, O

    2014-02-01

    Individual differences in cognitive performance are partly dependent, on genetic polymporhisms. One of the single-nucleotide polymorphisms (SNP) of the CNR1 gene, which codes for cannabinoid receptor 1 (CB1R), is the rs2180619, located in a regulatory region of this gene (6q14-q15). The alleles of the rs2180619 are A > G; the G allele has been associated with addiction and high levels of anxiety (when the G allele interacts with the SS genotype of the 5-HTTLPR gene). However, GG genotype is observed also in healthy subjects. Considering G allele as risk for 'psychopathological conditions', it is possible that GG healthy subjects do not be addicted or anxious, but would have reduced performance, compared to AA subjects, in attentional control and working memory processing. One hundred and sixty-four healthy young Mexican-Mestizo subjects (100 women and 64, men; mean age: 22.86 years, SD=2.72) participated in this study, solving a task where attentional control and working memory were required. GG subjects, compared to AA subjects showed: (1) a general lower performance in the task (P = 0.02); (2) lower performance only when a high load of information was held in working memory (P = 0.02); and (3) a higher vulnerability to distractors (P = 0.03). Our results suggest that, although the performance of GG subjects was at normal levels, a lower efficiency of the endocannabinoid system, probably due to a lowered expression of CB1R, produced a reduction in the performance of these subjects when attentional control and working memory processing is challenged. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  7. Cultural factors affecting urban Mexican male homosexual behavior.

    PubMed

    Carrier, J M

    1976-03-01

    Some aspects of the mestizoized urban culture in Mexico are linked to male homosexuality in support of the theory that cultural factors play an important role in the kind of life styles and sex practices of males involved in homosexual behavior. The following factors are considered relevant: the sharp dichotomization of gender roles, dual categorization of females as good or bad, separate social networks maintained by males before and after marriage, proportion of unmarried males, and distribution of income. One result of the sharp dichotomization of male and female gender roles is the widely held belief that effeminate males generally prefer to play the female role rather than the male. Effeminacy and homosexuality are also linked by the belief that as a result of this role preference effeminate males are sexually interested only in masculine males with whom they play the passive sex role. The participation of masculine males in homosexual encounters is related in part to a relatively high level of sexual awareness in combination with the lack of stigmatization of the insertor sex role and in part to the restraints placed on alternative sexual outlets by available income and/or marital status. Males involved in homosexual behavior in Mexico operate in a sociocultural environment which gives rise to expectations that they should play either the insertee or insertor sex role but not both and that they should obtain ultimate sexual satisfaction with anal intercourse rather than fellatio. In spite of cultural imperatives, however, individual preferences stemming from other variables such as personality needs, sexual gratification, desires of wanted partners, and amount of involvement may override the imperatives with resulting variations in sexual behavior patterns.

  8. Plants used by native Amazonian groups from the Nanay River (Peru) for the treatment of malaria.

    PubMed

    Ruiz, Lastenia; Ruiz, Liliana; Maco, Martha; Cobos, Marianela; Gutierrez-Choquevilca, Andréa-Luz; Roumy, Vincent

    2011-01-27

    In order to evaluate the antimalarial potential of traditional remedies used in Peru, Indigenous and Mestizo populations from the river Nanay in Loreto were interviewed about traditional medication for the treatment of malaria. The survey took place on six villages and led to the collection of 59 plants. 35 hydro-alcoholic extractions were performed on the 21 most cited plants. The extracts were then tested for antiplasmodial activity in vitro on Plasmodium falciparum chloroquine resistant strain (FCR-3), and ferriprotoporphyrin inhibition test was also performed in order to assume pharmacological properties. Extracts from 9 plants on twenty-one tested (Abuta rufescens, Ayapana lanceolata, Capsiandra angustifolia, Citrus limon, Citrus paradise, Minquartia guianensis, Potalia resinífera, Scoparia dulcis, and Physalis angulata) displayed an interesting antiplasmodial activity (IC(50)<10 μg/ml) and 16 remedies were active on the ferriprotoporphyrin inhibition test. The results give scientific validation to the traditional medical knowledge of the Amerindian and Mestizo populations from Loreto and exhibit a source of potentially active plants. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  9. The prevalence of BRCA1 and BRCA2 mutations among young Mexican women with triple-negative breast cancer

    PubMed Central

    Villarreal-Garza, C.; Weitzel, J. N.; Llacuachaqui, M.; Sifuentes, E.; Magallanes-Hoyos, M. C.; Gallardo, L.; Alvarez-Gómez, R. M.; Herzog, J.; Castillo, D.; Royer, R.; Akbari, Mohammad; Lara-Medina, F.; Herrera, L. A.; Mohar, A.

    2015-01-01

    Various guidelines recommend that women with triple-negative breast cancer should be tested for BRCA1 mutations, but the prevalence of mutations may vary with ethnic group and with geographic region, and the optimal cutoff age for testing has not been established. We estimated the frequencies of BRCA1 and BRCA2 (BRCA) mutations among 190 women with triple-negative breast cancer, unselected for family history, diagnosed at age 50 or less at a single hospital in Mexico City. Patients were screened for 115 recurrent BRCA mutations, which have been reported previously in women of Hispanic origin, including a common large rearrangement Mexican founder mutation (BRCA1 ex9-12del). A BRCA mutation was detected in 44 of 190 patients with triple-negative breast cancer (23 %). Forty-three mutations were found in BRCA1 and one mutation was found in BRCA2. Seven different mutations accounted for 39 patients (89 % of the total mutations). The Mexican founder mutation (BRCA1 ex9-12del) was found 18 times and accounted for 41 % of all mutations detected. There is a high prevalence of BRCA1 mutations among young triple-negative breast cancer patients in Mexico. Women with triple-negative breast cancer in Mexico should be screened for mutations in BRCA1. PMID:25716084

  10. Breast Cancer Risk Associated with Genotype Polymorphisms of the Aurora Kinase a Gene (AURKA): a Case-Control Study in a High Altitude Ecuadorian Mestizo Population.

    PubMed

    López-Cortés, Andrés; Cabrera-Andrade, Alejandro; Oña-Cisneros, Fabián; Rosales, Felipe; Ortiz, Malena; Tejera, Eduardo; Paz-Y-Miño, César

    2018-07-01

    Breast cancer (BC) is the leading cause of cancer related death among women in 2014. The AURKA gene that encodes the protein called Aurora kinase A plays an important role in the progression of the cell cycle, by controlling and promoting the entry into the phase of mitosis. The single nucleotide polymorphism AURKA T91A (rs2273535) (Phe21Ile) has been identified as functional alternator of this kinase, the Ile allele is associated with the occurrence of chromosome segregation errors and tumor progression. Therefore, it is essential to know how BC risk is associated with histopathological characteristics, immunohistochemical characteristics, and genotype polymorphism in a high altitude Ecuadorian mestizo population. In this retrospective case-control study 200 individuals were analyzed. DNA was extracted from 100 healthy and 100 affected women. Genotypes were determined by genomic sequencing. We found significant association between the AURKA T91A (rs2273535) (Phe21Ile) genotype and an increased risk of BC development: Phe/Ile (odds ratio [OR] = 2.6; 95% confidence interval [CI] = 1.4-4.9; P = 0.004), Ile/Ile (OR = 3.8; 95% CI = 1.6-9.0; P = 0.002), and Phe/Ile + Ile/Ile (OR = 2.9; 95% CI = 1.6-5.2; P = 0.001). Additionally, the rs2273535 variant was associated with the tumor grade SBR III (OR = 9.6; 95% CI = 1.0-91.9; P = 0.048) and the Ki-67 ≥ 20 (OR = 16.5; 95% CI = 2.7-101.3; P = 0.002). In brief, this study provides the first evidence where the Ile allele of the AURKA gene could act as potentially predictive biomarker of BC in the high altitude Ecuadorian mestizo population that lives at 2800 m above sea level (masl).

  11. [Human resources requirements for diabetic patients healthcare in primary care clinics of the Mexican Institute of Social Security].

    PubMed

    Doubova, Svetlana V; Ramírez-Sánchez, Claudine; Figueroa-Lara, Alejandro; Pérez-Cuevas, Ricardo

    2013-12-01

    To estimate the requirements of human resources (HR) of two models of care for diabetes patients: conventional and specific, also called DiabetIMSS, which are provided in primary care clinics of the Mexican Institute of Social Security (IMSS). An evaluative research was conducted. An expert group identified the HR activities and time required to provide healthcare consistent with the best clinical practices for diabetic patients. HR were estimated by using the evidence-based adjusted service target approach for health workforce planning; then, comparisons between existing and estimated HRs were made. To provide healthcare in accordance with the patients' metabolic control, the conventional model required increasing the number of family doctors (1.2 times) nutritionists (4.2 times) and social workers (4.1 times). The DiabetIMSS model requires greater increase than the conventional model. Increasing HR is required to provide evidence-based healthcare to diabetes patients.

  12. Enzyme-linked immunosorbent assay and polymerase chain reaction performance using Mexican and Guatemalan discrete typing unit I strains of Trypanosoma cruzi.

    PubMed

    Ballinas-Verdugo, Martha; Reyes, Pedro Antonio; Mejia-Dominguez, Ana; López, Ruth; Matta, Vivian; Monteón, Victor M

    2011-12-01

    Thirteen Trypanosoma cruzi isolates from different geographic regions of Mexico and Guatemala belonging to discrete typing unit (DTU) I and a reference CL-Brener (DTU VI) strain were used to perform enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). A panel of 57 Mexican serum samples of patients with chronic chagasic cardiopathy and asymptomatic infected subjects (blood bank donors) were used in this study. DNA from the above 14 T. cruzi strains were extracted and analyzed by PCR using different sets of primers designed from minicircle and satellite T. cruzi DNA. The chronic chagasic cardiopathy serum samples were easily recognized with ELISA regardless of the source of antigenic extract used, even with the CL-Brener TcVI, but positive serum samples from blood bank donors in some cases were not recognized by some Mexican antigenic extracts. On the other hand, PCR showed an excellent performance despite the set of primers used, since all Mexican and Guatemalan T. cruzi strains were correctly amplified. In general terms, Mexican, Guatemalan, and CL-Brener T. cruzi strains are equally good sources of antigen when using the ELISA test to detect Mexican serum samples. However, there are some strains with poor performance. The DTU I strains are easily detected using either kinetoplast or satellite DNA target designed from DTU VI strains.

  13. Cost-effectiveness analysis of pharmacologic treatment of fibromyalgia in Mexico.

    PubMed

    Arreola Ornelas, Héctor; Rosado Buzzo, Alfonso; García, Lourdes; Dorantes Aguilar, Javier; Contreras Hernández, Iris; Mould Quevedo, Joaquín F

    2012-01-01

    To identify, from the Mexican Public Health System perspective, which would be the most cost-effective treatment for patients with Fibromyalgia (FM). A Markov model including three health states, divided by pain intensity (absence or presence of mild, moderate or severe pain) and considering three-month cycles; costs and effectiveness were estimated for amitriptyline (50mg/day), fluoxetine (80 mg/day), duloxetine (120 mg/day), gabapentin (900 mg/day), pregabalin (450 mg/day), tramadol/acetaminophen (150 mg/1300 mg/día) and amitriptyline/fluoxetine (50mg/80 mg/día) for the treatment of FM. The clinical outcome considered was the annual rate of pain control. Probabilities assigned to the model were collected from published literature. Direct medical costs for FM treatment were retrieved from the 2006 data of the Mexican Institute of Social Security (IMSS) databases and were expressed in 2010 Mexican Pesos. Probabilistic Sensitivity Analyses were conducted. The best pain control rate was obtained with pregabalin (44.8%), followed by gabapentin (38.1%) and duloxetine (34.2%). The lowest treatment costs was for amitriptyline ($ 9047.01), followed by fluoxetine ($ 10,183.89) and amitriptyline/fluoxetine ($ 10,866.01). By comparing pregabalin vs amitriptyline, additional annual cost per patient for pain control would be around $ 50.000 and $ 75.000 and would result cost-effective in 70% and 80% of all cases. Among all treatment options for FM, pregabalin achieved the highest pain control and was cost-effective in 80% of patients of the Mexican Public Health System. Copyright © 2011 Elsevier España, S.L. All rights reserved.

  14. Historical Development of the Concept of the Multicultural Personality: A Mixed Ethnic Heritage Perspective.

    ERIC Educational Resources Information Center

    Ramirez, Manuel, III

    The Mestizo (mixed ethnic heritage) Civil Rights Movement in the United States can be divided into five phases: Pre-Civil Rights, Civil Rights, Bilingual-Multicultural Education, Political Conservatism, and the current period, an Assault on Civil Rights. The paper describes how a personal research career has been influenced by the different stages…

  15. Perceived Institutional Support among Young Indigenous and Mestizo Students from Chiapas (México): A Group Vitality Approach

    ERIC Educational Resources Information Center

    Esteban-Guitart, Moisès; Viladot, Maria Àngels; Giles, Howard

    2015-01-01

    Ethnolinguistic Vitality Theory (EVT) asserts that status, demographic and institutional support (IS) factors make up the vitality of ethnolinguistic groups within intergroup relations. Specifically, IS factor refers to the extent to which a language group enjoys representation in the various institutions of a society, in particular, mass media,…

  16. Linguistic Purism in Cuzco, Peru: A Historical Perspective.

    ERIC Educational Resources Information Center

    Nino-Murcia, Mercedes

    1997-01-01

    Notes that a group of mestizo intellectuals in Peru claims that "Qhpaj'simi" is the Quechua used by the ancient Inca nobility and is the purest form of Quechua. Explains that a social hierarchy has arisen with the use of this "imperial language" demarcating its users from the common people and that these purist attitudes play a…

  17. Effects of Family-to-Family Psychoeducation Among Relatives of Patients With Severe Mental Disorders in Mexico City.

    PubMed

    Domínguez-Martinez, Tecelli; Rascon-Gasca, Maria Luisa; Alcántara-Chabelas, Humberto; Garcia-Silberman, Sara; Casanova-Rodas, Leticia; Lopez-Jimenez, Jorge Luis

    2017-04-01

    This study examined the effects of a three-month Family-to-Family (FTF) Education Program on expressed emotion and subjective knowledge about mental illness among relatives of Mexican patients with severe mental disorders. A total of 230 relatives of patients with severe mental disorders completed self-reported questionnaires before (pretest) and after (posttest) the FTF program. FTF led to reductions in negative emotional attitudes and improved the understanding of the disorder, regardless of sex or age of the relative. This study supported the evidence-based practice of FTF in a Mexican population and confirmed the importance of providing routine family psychoeducation as an additional component of health care service provision for relatives of people with severe mental illness in the community.

  18. Glycemic Control and Bone Turnover in Older Mexican Americans with Type 2 Diabetes

    PubMed Central

    Smith, Scott M.; Lee, MinJae; Pervin, Hannah; Musgrave, Paul; Watt, Gordon P.; Nader, Shahla; Khosla, Sundeep; Ambrose, Catherine G.; McCormick, Joseph B.; Fisher-Hoch, Susan P.

    2018-01-01

    Altered bone quality, caused by underlying metabolic changes of type 2 diabetes (T2D), has been hypothesized to cause altered bone strength and turnover leading to increased fracture risk in T2D patients. Current understanding about changes in bone turnover markers in T2D patients is mainly based on studies focused on Caucasian men and women. However, Hispanic populations have the highest prevalence of both T2D and osteoporosis in the US. We investigated associations of glycemic control (in terms of glycated hemoglobin [HbA1c]) and bone turnover rate in 69 older (≥50 years) Mexican American Cameron County Hispanic Cohort (CCHC) participants with T2D. Multivariable analyses were conducted to assess the associations between HbA1c (%), serum osteocalcin (OC), and serum sclerostin. In agreement with published reports from other racial/ethnic populations, our study found that lower bone turnover (indicated by lower serum OC) occurred in Mexican American men with T2D who had poorer glycemic control. For the women in our study, we found no significant association between glycemic control and OC. In contrast, HbA1c was positively associated with sclerostin for women, with near significance (p = 0.07), while no association was found in men. We recommend screening Mexican American individuals with T2D, specifically those with poor glycemic control, for bone loss and fracture risk. PMID:29862008

  19. Trust Development With the Spanish-Speaking Mexican American Patient: A Grounded Theory Study.

    PubMed

    Jones, Sharon M

    2018-06-01

    Interpersonal trust between patient and nurse is important in patient-centered care. Trust development may be more difficult if the patient and nurse do not speak the same language. In this grounded theory study, Spanish-speaking Mexican American adults ( n = 20) hospitalized on a medical-surgical or obstetric unit in the Midwestern United States were interviewed. Through data analysis, a model of how trust develops between nurse and patient revealed eight categories and the core category Caring for Me Well Even When Not Understanding Me. The beginning phase had four categories: Asking for Help, Bothering, Communicating, and Understanding. The middle phase had two categories: Platicando (chatting) and Being Available. The end point category was Having Trust, and outcomes were Feeling Comfortable and Feeling Supported. The language barrier was a hindrance to trust development but the nurse's way of being (personality) was more important. Therefore, the patient did develop trust with nurses who did not speak Spanish.

  20. Mexico.

    PubMed

    1988-02-01

    Focus in this discussion of Mexico is on the following: geography; the people; history; political conditions; the economy; foreign relations; and relations between the US and Mexico. As of July 1987, the population of Mexico numbered 81.9 million with an estimated annual growth rate of 2.09%. 60% of the population is Indian-Spanish (mestizo), 30% American Indian, 9% white, and 1% other. Mexico is the most populous Spanish-speaking country in the world and the 2nd most populous country in Latin America. Education is decentralized and expanded. Mexico's topography ranges from low desert plains and jungle-like coastal strips to high plateaus and rugged mountains. Hernan Cortes conquered Mexico in 1919-21 and founded a Spanish colony that lasted for almost 300 years. Independence from Spain was proclaimed by Father Miguel Hidalgo on September 16, 1810; the republic was established on December 6, 1822. Mexico's constitution of 1917 provides for a federal republic with a separation of powers into independent executive, legislative, and judicial branches of government. Significant political themes of the administration of President Miguel de la Madrid Hurtado, who began his 6-year term in 1982, have been restructuring the economy, liberalizing trade practices, decentralizing government services, and eliminating corruption among public servants. In 1987, estimates put the real growth of the Mexican economy at 1.5%; the gross domestic product (GDP) had shrunk by 3.5% in 1986. Yet, on the positive side, Mexico's international reserves increased to record levels in 1987 (to about $15 billion), and its current account surplus reached more than $3 billion. Mexico has made considerable progress in moving to restructure its economy. It has substantially reduced impediments to international trade and has moved to reduce the number of parastatal firms. 1987 was the 2nd consecutive year in which Mexico recorded triple-digit inflation; inflation reached 158.8%. Other problems include the public sector deficit and high domestic interest rates. Further, the last quarter of 1987 saw the collapse of the Mexican stock market and the reappearance of capital flight. To cope with these and other problems, the President de la Madrid announced The Economic Solidarity Pact in mid-December 1987, which, among other things, raised the minimum wage rate, increased prices of some public goods and services, and reduced the maximum tariff on imports to 20%. Mexico and the US have maintained close and friendly relations since 1938, and these friendly relations were reinforced by US measured in the last several years to help Mexico deal with its economic problems.

  1. Making Me Feel Comfortable: Developing Trust in the Nurse for Mexican Americans.

    PubMed

    Jones, Sharon M

    2015-11-01

    Trust (confianza) is an important component of patient-centered care and culturally competent care and a major element in the Hispanic culture. The aim of this study was to conceptualize the process of the development of interpersonal trust by hospitalized patients in their nurses. Using the grounded theory method, English-speaking Mexican American patients (N = 22) were interviewed. The core category was Making Me Feel Comfortable. The cyclical process included a beginning stage (Having Needs, Relying on the Nurse), middle stage (Coming Across to Me, Taking Care of Me, Connecting), and end point (Feeling Confianza) with two outcomes (Confiding in the Nurse, Taking Away the Negative). Anytime there was a negative element during the middle stage, this element halted any further development of trust with the nurse. Unique findings were related to Hispanic cultural values of familism and personalismo. The findings have implications which impact patient safety and quality care. © The Author(s) 2014.

  2. Clinical features of Mexican patients with Mucopolysaccharidosis type I.

    PubMed

    Alonzo-Rojo, A; García-Ortiz, J E; Ortiz-Aranda, M; Gallegos-Arreola, M P; Figuera-Villanueva, L E

    2017-09-21

    Mucopolysaccharidosis type I (MPS-I) is an autosomal recessive lysosomal storage disorder caused by a deficiency or absence of α--iduronidase, which is involved in the catabolism of glycosaminoglycans (GAGs). This deficiency leads to the accumulation of GAGs in several organs. Given the wide spectrum of the disease, MPS-I has historically been classified into 3 clinical subtypes - severe (Hurler syndrome), intermediate (Hurler-Scheie syndrome), and mild (Scheie syndrome) - none of which is determined by residual enzyme activity. Eleven Mexican patients with MPS-I from northwestern México were evaluated. Diagnoses were confirmed through quantification of GAGs in urine and enzyme assay for α--iduronidase. Regardless of phenotype, all patients had various degrees of infiltrated facies, short stature, dysostosis multiplex, joint contractures, and corneal opacity typical of the disease. A better understanding of the spectrum of this disease can assist in diagnosis, treatment, and improvement in the quality of life for these patients.

  3. Adherence to a Gluten-Free Diet in Mexican Subjects with Gluten-Related Disorders: A High Prevalence of Inadvertent Gluten Intake.

    PubMed

    Ramírez-Cervantes, Karen Lizzette; Romero-López, Angélica Viridiana; Núñez-Álvarez, Carlos Alberto; Uscanga-Domínguez, Luis F

    2016-01-01

    The rate of compliance with a gluten-free diet in patients with gluten-related disorders is unknown in most Latin American countries. To study the adherence to a gluten-free diet of Mexican individuals with celiac disease and nonceliac gluten sensitivity at the time of their first medical and nutritional consultation at a tertiary referral center. A cross-sectional study was performed. A specific questionnaire was used to gather information on demographics, clinical condition, and self-reported adherence to a gluten-free diet, and to determine strict compliance and intentional or inadvertent gluten consumption. All questionnaires were applied by a nutritionist with expertise in gluten-related disorders. Fifty-six patients with celiac disease and 24 with non-celiac gluten sensitivity were included. Overall, 46 (57.5%) subjects perceived themselves as strictly adherent; however, inadvertent gluten intake was frequent in both celiac disease and non-celiac gluten sensitivity patients (39.2 vs. 33.3%; p = 0.2). Intentional consumption was more prevalent in subjects with celiac disease (48.8 vs. 29.1%; p = 0.048) and individuals with non-celiac gluten sensitivity showed better adherence (37.5 vs. 12.5%; p = 0.035). The importance of a gluten-free diet is underestimated by Mexican patients with celiac disease. The role of a team with expertise in gluten-related disorders is essential to identify inadvertent gluten intake.

  4. Barriers to implementing the "2008 Mexican Clinical Practice Guideline recommendations for the management of hip and knee osteoarthritis" in primary healthcare practice.

    PubMed

    Loyola-Sanchez, Adalberto; Richardson, Julie; Pelaez-Ballestas, Ingris; Sánchez, José Guadalupe; González, Martha Alicia; Sánchez-Cruz, Juan; Jiménez-Baez, María Valeria; Nolasco-Alonso, Nancy; Alvarado, Idolina; Rodríguez-Amado, Jacqueline; Alvarez-Nemegyei, José; Wilson, Mike G

    2014-01-01

    To evaluate the implementability of the "2008 Mexican Clinical Practice Guideline for the management of hip and knee osteoarthritis at the primary level of care" within primary healthcare of three Mexican regions using the Guideline Implementability Appraisal methodology version 2 (GLIA.v2). Six family physicians, representing the South, North, and Central Mexico, and one Mexican physiatrist evaluated the 45 recommendations stated by the Mexican guideline. The GLIA.v2 methodology includes the execution of qualitative and semi-quantitative techniques. Reviewers' agreement was between moderate to near complete in most cases. Sixty-nine percent of the recommendations were considered difficult to implement within clinical practice. Eight recommendations did not have an appropriate format. Only 6 recommendations were judged as able to be consistently applied to clinical practice. Barriers related to the context of one or more institutions/regions were identified in 25 recommendations. These barriers are related to health providers/patients' beliefs, processes of care within each institution, and availability of some treatments recommended by the guideline. The guideline presented problems of conciseness and clarity that negatively affect its application within the Mexican primary healthcare context. We identified individual, organizational and system characteristics, which are common to the 3 institutions/regions studied and constitute barriers for implementing the guideline to clinical practice. It is recommended that the 2008-Mexican-CPG-OA be thoroughly revised and restructured to improve the clarity of the actions implied by each recommendation. We propose some strategies to accomplish this and to overcome some of the identified regional/institutional barriers. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  5. Differences in Insulin Resistance in Mexican and U.S. Pima Indians with Normal Glucose Tolerance

    PubMed Central

    Esparza-Romero, Julian; Valencia, Mauro E.; Martinez, Maria Elena; Ravussin, Eric; Schulz, Leslie O.; Bennett, Peter H.

    2010-01-01

    Context: Insulin resistance is a major risk factor for the development of type 2 diabetes in Pima Indians, a population with the highest prevalence of type 2 diabetes mellitus in the world. Their Mexican counterpart, living a traditional lifestyle in the mountains of Sonora, have at least 5 times less diabetes than the U.S. Pima Indians. Objective: We evaluated whether Mexican Pima Indians had lower insulin resistance than U.S. Pima Indians. Design and Patients: We compared fasting insulin and homeostasis model assessment for insulin resistance (HOMA-IR) in 194 Mexican Pima Indians (100 females, 94 males) and 449 U.S. Pima Indians (246 females, 203 males) with normal glucose tolerance from a cross-sectional study. Adjusted differences of log-transformed outcomes (fasting insulin and HOMA-IR) between groups were evaluated using multiple linear regression models and paired t test in a matched subset. Results: Unadjusted fasting insulin and HOMA-IR were much lower in the Mexican Pima Indians than in their U.S. counterparts. After adjusting by obesity, age, and sex, mean (95% confidence interval) for fasting insulin was 6.22 (5.34–7.24) vs. 13.56 μU/ml (12.27–14.97) and for HOMA-IR 1.40 (1.20–1.64) vs. 3.07 (2.77–3.40), respectively, for Mexican Pima and U.S. Pima Indians. Results were confirmed in subset matched for age, sex, and body fat. Conclusion: Our results indicate that Mexican Pima Indians have lower insulin resistance in comparison with their genetically related U.S. counterparts, even after controlling for differences in obesity, age, and sex. This finding underscores the importance of lifestyle factors as protecting factors against insulin resistance in individuals with a high propensity to develop diabetes. PMID:20668044

  6. Adaptation and validation of the Distress Scale for Mexican patients with type 2 diabetes and hypertension: a cross-sectional survey.

    PubMed

    Martinez-Vega, Ingrid Patricia; Doubova, Svetlana V; Aguirre-Hernandez, Rebeca; Infante-Castañeda, Claudia

    2016-03-02

    The aim of this study was to adapt and validate the Distress Scale for Mexican patients with type 2 diabetes and hypertension (DSDH17M). Two family medicine clinics affiliated with the Mexican Institute of Social Security. 722 patients with type 2 diabetes and/or hypertension (235 patients with diabetes, 233 patients with hypertension and 254 patients with both diseases). A cross-sectional survey. The validation procedures included: (1) content validity using a group of experts, (2) construct validity from exploratory factor analysis, (3) internal consistency using Cronbach's α, (4) convergent validity between DSDH17M and anxiety and depression using the Spearman correlation coefficient, (5) discriminative validity through the Wilcoxon rank-sum test and (6) test-retest reliability using intraclass correlation coefficient. The DSDH17M has 17 items and three factors explaining 67% of the total variance. Cronbach α ranged from 0.83 to 0.91 among factors. The first factor of 'Regime-related Distress and Emotional Burden' moderately correlated with anxiety and depression scores. Discriminative validity revealed that patients with obesity, those with stressful events and those who did not adhere to pharmacological treatment had significantly higher distress scores in all DSDH17M domains. Test-retest intraclass correlation coefficient for DSDH17M ranged from 0.92 to 0.97 among factors. DSDH17M is a valid and reliable tool to identify distress of patients with type 2 diabetes and hypertension. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  7. Histopathologic characteristics of gastric adenocarcinoma in Mexican patients: a 10-year experience at the Hospital Juárez of Mexico.

    PubMed

    Martínez-Galindo, M G; Zamarripa-Dorsey, F; Carmona-Castañeda, A; Angeles-Labra, A; Peñavera-Hernández, R; Ugarte-Briones, C; Blanco-Vela, C I

    2015-01-01

    Gastric cancer is the second cause of death by cancer worldwide. Histologic classification may predict tumor biology, clinical behavior, and outcome. According to the Lauren classification, the disease is divided into 2 types, diffuse and intestinal, and the latter has a better prognosis. To determine the frequency of gastric adenocarcinoma and compare the histopathologic characteristics of intestinal and diffuse-type gastric adenocarcinoma in Mexican patients treated at a tertiary referral hospital. A retrospective study evaluated the pathology reports of patients with gastric adenocarcinoma corresponding to the time frame of January 2003 to December 2012. Adenocarcinomas of the gastric cardia were excluded. Frequencies were expressed as percentages and the categorical variables were compared with the chi-square test. Statistical significance was set at a P<.05. A total of 417 cases of gastric adenocarcinoma were found, 230 (55.2%) of which were diffuse-type and 118 (28.2%) were intestinal-type. The mean age of the patients with diffuse type gastric cancer was 54.02±14.93 and 119 (51.3%) of those patients were men. The mean age of the patients with intestinal-type gastric cancer was 63.43±13.78, and 69 (62.2%) were men. Ninety-two of the diffuse-type patients were under the age of 50 years, compared with 22 of the patients with intestinal-type carcinoma. This is the first study on the Mexican population to analyze the differences in the histologic types of adenocarcinoma. Diffuse-type gastric carcinoma was the most frequent subtype in our study population and it is associated with worse outcome. Copyright © 2014 Asociación Mexicana de Gastroenterología. Published by Masson Doyma México S.A. All rights reserved.

  8. Phenotypic Variation in Patients with Homozygous c.1678G>T Mutation in EVC Gene: Report of Two Mexican Families with Ellis-van Creveld Syndrome

    PubMed Central

    Ibarra-Ramirez, Marisol; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Jose; Martínez-Garza, Laura E.; Martinez-Glez, Víctor; Valencia-Benitez, María; Lapunzina, Pablo; Ruiz-Peréz, Víctor

    2017-01-01

    Case series Patient: — Final Diagnosis: Ellis van Creveld syndrome Symptoms: Conical teeth • polydactyly • short stature Medication: — Clinical Procedure: — Specialty: Pediatrics and Neonatology Objective: Rare disease Background: Ellis-van Creveld syndrome is an autosomal recessive chondro-ectodermal dysplasia characterized by disproportionate short stature, limb shortening, narrow chest, postaxial polydactyly and dysplastic nails and teeth. In addition, 60% of cases present congenital heart defects. Ellis-van Creveld syndrome is predominantly caused by mutations in the EVC or EVC2 (4p16) genes, with only a few cases caused by mutations in WDR35. Case Report: Here, we report on two Mexican families with patients diagnosed with Ellis-van Creveld syndrome. Family 1 includes four patients: three females of 15, 18, and 23 years of age and a 7-year old male. Family 2 has only one affected newborn male. All patients exhibited multiple features including hypodontia, dysplastic teeth, extra frenula, mild short stature, distal limb shortening, postaxial polydactyly of hands and feet, nail dystrophy, and knee joint abnormalities. Only two patients had an atrial septal defect. In all cases, molecular analysis by Sanger sequencing identified the same homozygous mutation in exon 12 of EVC, c.1678G>T, which leads to a premature stop codon. Conclusions: The mutation c.1678G>T has been previously reported in another Mexican patient and it appears to be a recurrent mutation in Mexico which could represent a founder mutation. The large number of patients in this case allows the clinical variability and spectrum of manifestations present in individuals with Ellis-van Creveld syndrome even if they carry the same homozygous mutation in a same family. PMID:29229899

  9. Health-Related Information-Seeking Behaviors and Preferences Among Mexican Patients with Cancer.

    PubMed

    Soto-Perez-de-Celis, Enrique; Perez-Montessoro, Viridiana; Rojo-Castillo, Patricia; Chavarri-Guerra, Yanin

    2018-06-01

    Understanding the preferred sources of health-related information among patients with cancer is essential for designing successful cancer education and prevention strategies. However, little is known about health-related information-seeking practices among patients living in low- and middle-income countries. We studied the preferred sources of health-related information among Mexican patients with cancer and explored which factors influence these choices. The health-related information-seeking practices among patients with cancer treated at a public hospital in Mexico City were evaluated using questions from the Spanish Version of the Health Information National Trends Survey. The characteristics of patients who sought health-related information, and of those who chose the internet as their preferred source of information, were analyzed. Fisher's exact test and logistic regression were used for statistical analyses. One hundred forty-eight patients answered the survey (median age 60 years, 70% female), of which 88 (59%) had sought for health-related information. On multivariate analysis, the only characteristic associated with lower odds of seeking health-related information was increasing age (OR 0.93, 95% CI 0.90-0.97). Sixty-one respondents (69%) listed the internet as their preferred source of health-related information. On multivariate analysis, only being of the female gender (OR 4.9, 95% CI 1.3-18.3) was related with higher odds of preferring other sources of information over the internet. Among Mexican patients with cancer, the Internet is the most widely used information source. Older age was the characteristic most strongly associated with not seeking health-related information, while being female was strongly associated with preferring other sources of information over the Internet.

  10. Factors Contributing to 50-ft Walking Speed and Observed Ethnic Differences in Older Community-Dwelling Mexican Americans and European Americans

    PubMed Central

    Hazuda, Helen P.

    2015-01-01

    Background Mexican Americans comprise the most rapidly growing segment of the older US population and are reported to have poorer functional health than European Americans, but few studies have examined factors contributing to ethnic differences in walking speed between Mexican Americans and European Americans. Objective The purpose of this study was to examine factors that contribute to walking speed and observed ethnic differences in walking speed in older Mexican Americans and European Americans using the disablement process model (DPM) as a guide. Design This was an observational, cross-sectional study. Methods Participants were 703 Mexican American and European American older adults (aged 65 years and older) who completed the baseline examination of the San Antonio Longitudinal Study of Aging (SALSA). Hierarchical regression models were performed to identify the contribution of contextual, lifestyle/anthropometric, disease, and impairment variables to walking speed and to ethnic differences in walking speed. Results The ethic difference in unadjusted mean walking speed (Mexican Americans=1.17 m/s, European Americans=1.29 m/s) was fully explained by adjustment for contextual (ie, age, sex, education, income) and lifestyle/anthropometric (ie, body mass index, height, physical activity) variables; adjusted mean walking speed in both ethnic groups was 1.23 m/s. Contextual variables explained 20.3% of the variance in walking speed, and lifestyle/anthropometric variables explained an additional 8.4%. Diseases (ie, diabetes, stroke, chronic obstructive pulmonary disease) explained an additional 1.9% of the variance in walking speed; impairments (ie, FEV1, upper leg pain, and lower extremity strength and range of motion) contributed an additional 5.5%. Thus, both nonmodifiable (ie, contextual, height) and modifiable (ie, impairments, body mass index, physical activity) factors contributed to walking speed in older Mexican Americans and European Americans. Limitations The study was conducted in a single geographic area and included only Mexican American Hispanic individuals. Conclusions Walking speed in older Mexican Americans and European Americans is influenced by modifiable and nonmodifiable factors, underscoring the importance of the DPM framework, which incorporates both factors into the physical therapist patient/client management process. PMID:25592187

  11. Biological wound dressings sterilized with gamma radiation: Mexican clinical experience

    NASA Astrophysics Data System (ADS)

    Martínez-Pardo, M. E.; Ley-Chávez, E.; Reyes-Frías, M. L.; Rodríguez-Ferreyra, P.; Vázquez-Maya, L.; Salazar, M. A.

    2007-11-01

    Biological wound dressings sterilized with gamma radiation, such as amnion and pig skin, are a reality in Mexico. These tissues are currently processed in the tissue bank and sterilized in the Gamma Industrial Irradiation Plant; both facilities belong to the Instituto Nacional de Investigaciones Nucleares (ININ) (National Institute of Nuclear Research). With the strong support of the International Atomic Energy Agency, the bank was established at the ININ and the Mexican Ministry of Health issued its sanitary license on July 7, 1999. The Quality Management System of the bank was certified by ISO 9001:2000 on August 1, 2003; the scope of the system is "Research, Development and Processing of Biological Tissues Sterilized with Gamma Radiation". At present, more than 150 patients from 16 hospitals have been successfully treated with these tissues. This paper presents a brief description of the tissue processing, as well as the present Mexican clinical experience with children and adult patients who underwent medical treatment with radiosterilized amnion and pig skin, used as biological wound dressings on burns and ocular surface disorders.

  12. Assessing the reliability, predictive and construct validity of historical, clinical and risk management-20 (HCR-20) in Mexican psychiatric inpatients.

    PubMed

    Sada, Andrea; Robles-García, Rebeca; Martínez-López, Nicolás; Hernández-Ramírez, Rafael; Tovilla-Zarate, Carlos-Alfonso; López-Munguía, Fernando; Suárez-Alvarez, Enrique; Ayala, Xochitl; Fresán, Ana

    2016-08-01

    Assessing dangerousness to gauge the likelihood of future violent behaviour has become an integral part of clinical mental health practice in forensic and non-forensic psychiatric settings, one of the most effective instruments for this being the Historical, Clinical and Risk Management-20 (HCR-20). To examine the HCR-20 factor structure in Mexican psychiatric inpatients and to obtain its predictive validity and reliability for use in this population. In total, 225 patients diagnosed with psychotic, affective or personality disorders were included. The HCR-20 was applied at hospital admission and violent behaviours were assessed during psychiatric hospitalization using the Overt Aggression Scale (OAS). Construct validity, predictive validity and internal consistency were determined. Violent behaviour remains more severe in patients classified in the high-risk group during hospitalization. Fifteen items displayed adequate communalities in the original designated domains of the HCR-20 and internal consistency of the instruments was high. The HCR-20 is a suitable instrument for predicting violence risk in Mexican psychiatric inpatients.

  13. Screening for depression among indigenous Mexican migrant farmworkers using the Patient Health Questionnaire-9.

    PubMed

    Donlan, William; Lee, Junghee

    2010-04-01

    U.S. farmworkers include growing numbers of individuals from indigenous, pre-Columbian communities in southern Mexico with distinctive languages and cultures. Given the high stress these farmworkers experience in their challenging work environments, they are very susceptible to depression and other mental and emotional health disorders. The present study explores the Spanish version of the Patient Health Questionnaire-9 (PHQ-9) as a screen for the presence and severity of depression among 123 indigenous Mexican-origin, migrant farmworkers in Oregon. Factor structure and inter-item correlations of the PHQ-9 are examined, along with associations between depression and culture-bound syndromes, self-esteem, self-efficacy, acculturation stress, and other sample psychosocial characteristics. The PHQ-9 exhibited strong factor loadings and internal consistency, and its severity score significantly correlated with other indicators of health status that were observed in previous studies to be significantly associated with depression. The PHQ-9 appears to be culturally relevant for use with Mexicans coming from a variety of indigenous cultures and having very low education and literacy.

  14. Clinical follow up of mexican women with early onset of breast cancer and mutations in the BRCA1 and BRCA2 genes.

    PubMed

    Calderón-Garcidueñas, Ana Laura; Ruiz-Flores, Pablo; Cerda-Flores, Ricardo M; Barrera-Saldaña, Hugo A

    2005-01-01

    This study describes the presence of mutations in BRCA1 and BRCA2 genes in a group of Mexican women and the clinical evolution of early onset breast cancer (EOBC). A prospective hospital-based study was performed in a sample of 22 women with EOBC (7 in clinical stage IIA, 8 in IIB, and 7 in IIIA). The patients attended a tertiary care hospital in northeastern Mexico in 1997 and were followed up over a 5-year period. Molecular analysis included: 1) a mutation screening by heteroduplex analysis (HA) of BRCA1 and BRCA2 genes and 2) a sequence analysis. Of 22 patients, 14 (63.6%) showed a variant band detected by heteroduplex analysis of the BRCA1 and BRCA2 genes: 8 polymorphisms, 4 mutations of uncertain significance, and 2 novel truncated protein mutations, one in BRCAI (exon 11, 3587delT) and the other in the BRCA2 gene (exon 11, 2664InsA). These findings support future studies to determine the significance and impact of the genetic factor in this Mexican women population.

  15. Porque me tocó a mi? Mexican American diabetes patients' causal stories and their relationship to treatment behaviors.

    PubMed

    Hunt, L M; Valenzuela, M A; Pugh, J A

    1998-04-01

    This paper reports findings from an ethnographic study of self-care behaviors and illness concepts among Mexican-American non-insulin dependent diabetes mellitus (NIDDM) patients. Open-ended interviews were conducted with 49 NIDDM patients from two public hospital outpatient clinics in South Texas. They are self-identified Mexican-Americans who have had NIDDM for at least 1 yr, and have no major impairment due to NIDDM. Interviews focused on their concepts and experiences in managing their illness and their self-care behaviors. Clinical assessment of their glucose control was also extracted from their medical records. The texts of patient interviews were content analyzed through building and refining thematic matrixes focusing on their causal explanations and treatment behaviors. We found patients' causal explanations of their illness often are driven by an effort to connect the illness in a direct and specific way to their personal history and their past experience with treatments. While most cite biomedically accepted causes such as heredity and diet, they elaborate these concepts into personally relevant constructs by citing Provoking Factors, such as behaviors or events. Their causal models are thus both specific to their personal history and consistent with their experiences with treatment success or failure. Based on these findings, we raise a critique of the Locus of Control Model of treatment behavior prevalent in the diabetes education literature. Our analysis suggests that a sense that one's own behavior is important to the disease onset may reflect patients' evaluation of their experience with treatment outcomes, rather than determining their level of activity in treatment.

  16. Building the genomic nation: ‘Homo Brasilis’ and the ‘Genoma Mexicano’ in comparative cultural perspective

    PubMed Central

    Kent, Michael; García-Deister, Vivette; López-Beltrán, Carlos; Santos, Ricardo Ventura; Schwartz-Marín, Ernesto; Wade, Peter

    2015-01-01

    This article explores the relationship between genetic research, nationalism and the construction of collective social identities in Latin America. It makes a comparative analysis of two research projects – the ‘Genoma Mexicano’ and the ‘Homo Brasilis’ – both of which sought to establish national and genetic profiles. Both have reproduced and strengthened the idea of their respective nations of focus, incorporating biological elements into debates on social identities. Also, both have placed the unifying figure of the mestizo/mestiço at the heart of national identity constructions, and in so doing have displaced alternative identity categories, such as those based on race. However, having been developed in different national contexts, these projects have had distinct scientific and social trajectories: in Mexico, the genomic mestizo is mobilized mainly in relation to health, while in Brazil the key arena is that of race. We show the importance of the nation as a frame for mobilizing genetic data in public policy debates, and demonstrate how race comes in and out of focus in different Latin American national contexts of genomic research, while never completely disappearing. PMID:27479999

  17. Using the theory of planned behavior to improve treatment adherence in Mexican Americans with schizophrenia.

    PubMed

    Kopelowicz, Alex; Zarate, Roberto; Wallace, Charles J; Liberman, Robert Paul; Lopez, Steven R; Mintz, Jim

    2015-10-01

    Failure to adhere to treatment with antipsychotic medication is the most common cause of relapse among patients with schizophrenia. A novel multifamily group (MFG) intervention, informed by the Theory of Planned Behavior (TPB), demonstrated efficacy in increasing medication adherence and decreasing rehospitalizations in schizophrenia patients. This report explores the hypothesis that the improved outcomes obtained through the MFG approach were mediated by changes in the patients' attitudes toward medications, subjective norms-social influences, and perceived behavioral control of resources. Data from a recently completed, randomized controlled trial of MFG was used to test the hypothesis that the improvement in adherence was mediated by the 3 TPB factors. Subjects were 174 Mexican American adults with schizophrenia-spectrum disorder who had participated in a study of MFG focused on improving medication adherence. Assessments occurred at baseline and at 4, 8, 12, 18, and 24 months. Path analysis revealed that the increased adherence associated with MFG was mediated by improvements in subjective norms but not attitudes toward medications nor perceived behavioral control. An MFG treatment specifically tailored to increase medication adherence among Mexican Americans with schizophrenia achieved its benefits by leveraging social influences through teaching family members how to support medication adherence in their ill relatives. (c) 2015 APA, all rights reserved).

  18. Antioxidant effects of herbal therapies used by patients with inflammatory bowel disease: an in vitro study.

    PubMed

    Langmead, L; Dawson, C; Hawkins, C; Banna, N; Loo, S; Rampton, D S

    2002-02-01

    Herbal remedies used by patients for treatment of inflammatory bowel disease include slippery elm, fenugreek, devil's claw, Mexican yam, tormentil and wei tong ning, a traditional Chinese medicine. Reactive oxygen metabolites produced by inflamed colonic mucosa may be pathogenic. Aminosalicylates (5-ASA) are antioxidant and other such agents could be therapeutic. To assess the antioxidant effects of herbal remedies in cell-free oxidant-generating systems and inflamed human colorectal biopsies. Luminol-enhanced chemiluminescence in a xanthine/xanthine oxidase cell-free system was used to detect superoxide scavenging by herbs and 5-ASA, and fluorimetry to define peroxyl radical scavenging using a phycoerythrin degradation assay. Chemiluminescence was used to detect herbal effects on generation of oxygen radicals by mucosal biopsies from patients with active ulcerative colitis. Like 5-ASA, all herbs, except fenugreek, scavenged superoxide dose-dependently. All materials tested scavenged peroxyl dose-dependently. Oxygen radical release from biopsies was reduced after incubation in all herbs except Mexican yam, and by 5-ASA. All six herbal remedies have antioxidant effects. Fenugreek is not a superoxide scavenger, while Mexican yam did not inhibit radical generation by inflamed biopsies. Slippery elm, fenugreek, devil's claw, tormentil and wei tong ning merit formal evaluation as novel therapies in inflammatory bowel disease.

  19. Phyllodes Tumor of the Breast: 307 Treated Cases, the Largest Mexican Experience at a Single Breast Disease Institution

    PubMed Central

    Ruvalcaba-Limón, Eva; Jiménez-López, Josefina; Bautista-Piña, Verónica; Ramírez-Bollas, Julio; Morales-Vásquez, Flavia; Domínguez-Reyes, Carlos; Maffuz-Aziz, Antonio; Rodríguez-Cuevas, Sergio

    2016-01-01

    Background: Phyllodes tumor (PT) of the breast in Hispanic patients is more frequently reported with large tumors and with more borderline/malignant subtypes compared with other populations. The objective of this study was to describe characteristics of patients with PT and to identify differences among subtypes in a Mexican population. Methods: A retrospective study was conducted on patients with PT. Sociodemographic, histopathologic, and treatment characteristics were compared among subtypes, including only surgically treated cases due the complete surgical-specimen study requirement for appropriate WHO classification. Results: During 10 years, 346 PT were diagnosed; only 307 were included (305 patients), with a mean age of 41.7 yr. Self-detected lump took place in 91.8%, usually discovered 6 months previously, with median tumor size of 4.5 cm. Local wide excisions were done in 213 (69.8%) and mastectomies in 92 (30.1%). Immediate breast reconstruction took place in 38% and oncoplastic procedures in 23%. PT were classified as benign in 222 (72.3%) cases, borderline in 50 (16.2%), and malignant in 35 (11.4%), with pathological tumor size of 4.2, 5.4, and 8.7 cm, respectively (P<0.001). Patients with malignant PT were older (48 yr), with more diabetics (14.3%), less breastfeeding (37.1%), more smokers (17.1%), with more postmenopausal cases (42.9%), and older age at menopause (51.5 years) compared with the remaining subtypes (P<0.05). Relapse occurred in 8.2% of patients with follow-up. Conclusion: In comparison with other Hispanic publications, these Mexican patients had similar age, with smaller tumors, modestly higher benign PT, fewer malignant PT, and lower documented relapse cases. PMID:28855932

  20. HLA Class I and II study in a mestizo family with high incidence of autoimmune disease.

    PubMed

    de Sorrentino, Alicia Habegger; Young, Marcela; Marinic, Karina; Motta, Patricia Fabiana; Baruzzo, Carlos

    2013-01-01

    There are many factors that influence the pathogenesis of autoimmune disease of which host genetic factors play an important role. The aim of this study was to investigate the HLA Class I and II genes in a family with a high incidence of AID to establish whether they contribute to the development of these disease. Four of them had been diagnosed with SLE and one with AHA. The patients with SLE showed the presence of HLA-A*02 B*40 DRB1*04:07 DQB1*03:02 haplotype with a high statistical significance. This haplotype was not present in the healthy individuals and in the patient with AHA, although the DRB1*04:07 DQB1*03:02 haplotype (carried by both parents) was found in the AHA patients and one of the healthy individuals. We must consider how HLA Class I in linkage disequilibrium with HLA Class II may be involved in susceptibility or in the development of SLE. An extensive study in this population should be conducted to establish the true participation of the HLA Class I region. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  1. Wide allelic heterogeneity with predominance of large IDS gene complex rearrangements in a sample of Mexican patients with Hunter syndrome.

    PubMed

    Alcántara-Ortigoza, M A; García-de Teresa, B; González-Del Angel, A; Berumen, J; Guardado-Estrada, M; Fernández-Hernández, L; Navarrete-Martínez, J I; Maza-Morales, M; Rius-Domínguez, R

    2016-05-01

    Hunter syndrome or mucopolysaccharidosis type II (MPSII) is caused by pathogenic variants in the IDS gene. This is the first study that examines the mutational spectrum in 25 unrelated Mexican MPSII families. The responsible genotype was identified in 96% of the families (24/25) with 10 novel pathogenic variants: c.133G>C, c.1003C>T, c.1025A>C, c.463_464delinsCCGTATAGCTGG, c.754_767del, c.1132_1133del, c.1463del, c.508-1G>C, c.1006+1G>T and c.(-217_103del). Extensive IDS gene deletions were identified in four patients; using DNA microarray analysis two patients showed the loss of the entire AFF2 gene, and epilepsy developed in only one of them. Wide allelic heterogeneity was noted, with large gene alterations (e.g. IDS/IDSP1 gene inversions, partial to extensive IDS deletions, and one chimeric IDS-IDSP1 allele) that occurred at higher frequencies than previously reported (36% vs 18.9-29%). The frequency of carrier mothers (80%) is consistent with previous descriptions (>70%). Carrier assignment allowed molecular prenatal diagnoses. Notably, somatic and germline mosaicism was identified in one family, and two patients presented thrombocytopenic purpura and pancytopenia after idursulfase enzyme replacement treatment. Our findings suggest a wide allelic heterogeneity in Mexican MPSII patients; DNA microarray analysis contributes to further delineation of the resulting phenotype for IDS and neighboring loci deletions. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Physician-assisted death. Opinions of a sample of Mexican physicians.

    PubMed

    Lisker, Rubén; Alvarez Del Rio, Asunción; Villa, Antonio R; Carnevale, Alessandra

    2008-05-01

    There is insufficient information on what Mexicans think of physician-assisted death, a problem that is currently being discussed in our legislative bodies. This paper discusses the findings among a sample of physicians. The sample was formed by 2097 physicians from several specialties employed by a Mexican government health system, distributed throughout the country. Each physician received a structured questionnaire exploring what they thought of two different scenarios related to physician-assisted death: 1) intolerable suffering of patients; and 2) persistent vegetative state (PVS). Questions included data on several personal characteristics of the respondents and two open-ended questions asking the reasons why they answered the main questions as they did. There was an overall response rate of 47.3%. Approximately 40% agreed with physicians helping terminally ill patients request to die because of intolerable suffering caused by incurable diseases, whereas 44% said no and the rest were undecided. This was statistically different from the answers to the scenario where the relatives of a patient in a PVS ask their physician to help him or her die, where 48% of respondents said yes, and 35% said no. The main reasons to say yes in both scenarios were respect for patients or family autonomy and to avoid suffering, whereas those opposed cited other ethical and mainly religious considerations. The variable with the highest probability to approve both scenarios was of a legal nature, whereas strong religious beliefs were against accepting physician-assisted death. The group was evenly divided with approximately 40% each between those for and against the idea of helping die a patient and approximately 20% were undecided.

  3. MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures.

    PubMed

    Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra

    2014-01-01

    Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR.

  4. MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures

    PubMed Central

    Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra

    2014-01-01

    Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR. PMID:25346718

  5. Reducing racial/ethnic disparities in diabetes: the Coached Care (R2D2C2) project.

    PubMed

    Kaplan, Sherrie H; Billimek, John; Sorkin, Dara H; Ngo-Metzger, Quyen; Greenfield, Sheldon

    2013-10-01

    Despite numerous efforts to change healthcare delivery, the profile of disparities in diabetes care and outcomes has not changed substantially over the past decade. To understand potential contributors to disparities in diabetes care and glycemic control. Cross sectional analysis. Seven outpatient clinics affiliated with an academic medical center. Adult patients with type 2 diabetes who were Mexican American, Vietnamese American or non-Hispanic white (n = 1,484). Glycemic control was measured as hemoglobin A1c (HbA1c) level. Patient, provider and system characteristics included demographic characteristics; access to care; quality of process of care including clinical inertia; quality of interpersonal care; illness burden; mastery (diabetes management confidence, passivity); and adherence to treatment. Unadjusted HbA1c values were significantly higher for Mexican American patients (n = 782) (mean = 8.3 % [SD:2.1]) compared with non-Hispanic whites (n = 389) (mean = 7.1 % [SD:1.4]). There were no significant differences in HbA1c values between Vietnamese American and non-Hispanic white patients. There were no statistically significant group differences in glycemic control after adjustment for multiple measures of access, and quality of process and interpersonal care. Disease management mastery and adherence to treatment were related to glycemic control for all patients, independent of race/ethnicity. Generalizability to other minorities or to patients with poorer access to care may be limited. The complex interplay among patient, physician and system characteristics contributed to disparities in HbA1c between Mexican American and non-Hispanic white patients. In contrast, Vietnamese American patients achieved HbA1c levels comparable to non-Hispanic whites and adjustment for numerous characteristics failed to identify confounders that could have masked disparities in this subgroup. Disease management mastery appeared to be an important contributor to glycemic control for all patient subgroups.

  6. Psychological, interpersonal, and clinical factors predicting time spent on physical activity among Mexican patients with hypertension.

    PubMed

    Ybarra Sagarduy, José Luis; Camacho Mata, Dacia Yurima; Moral de la Rubia, José; Piña López, Julio Alfonso; Yunes Zárraga, José Luis Masud

    2018-01-01

    It is widely known that physical activity is the key to the optimal management and clinical control of hypertension. This research was conducted to identify factors that can predict the time spent on physical activity among Mexican adults with hypertension. This cross-sectional study was conducted among 182 Mexican patients with hypertension, who completed a set of self-administered questionnaires related to personality, social support, and medical adherence and health care behaviors, body mass index, and time since the disease diagnosis. Several path analyses were performed in order to test the predictors of the study behavior. Lower tolerance to frustration, more tolerance to ambiguity, more effective social support, and less time since the disease diagnosis predicted more time spent on physical activity, accounting for 13.3% of the total variance. The final model shows a good fit to the sample data ( p BS =0.235, χ 2 / gl =1.519, Jöreskog and Sörbom's Goodness of Fit Index =0.987, adjusted modality =0.962, Bollen's Incremental Fit Index =0.981, Bentler-Bonett Normed Fit Index =0.946, standardized root mean square residual =0.053). The performance of physical activity in patients with hypertension depends on a complex set of interactions between personal, interpersonal, and clinical variables. Understanding how these factors interact might enhance the design of interdisciplinary intervention programs so that quality of life of patients with hypertension improves and they might be able to manage and control their disease well.

  7. Needs of caregivers of cancer patients: validation of the Mexican version of the Support Person Unmet Needs Survey (SPUNS-SFM).

    PubMed

    Doubova, Svetlana V; Aguirre-Hernandez, Rebeca; Infante-Castañeda, Claudia; Martinez-Vega, Ingrid; Pérez-Cuevas, Ricardo

    2015-10-01

    The purpose of this study was to validate the Mexican version of the Support Person Unmet Needs Survey (SPUNS-SFM). A cross-sectional survey that included 826 primary caregivers of cancer patients was conducted from June to December 2013 at the Oncology Hospital of the Mexican Institute of Social Security in Mexico City. The validation procedure comprised (1) content validity through a group of experts; (2) construct validity through an exploratory factor analysis based on the polychoric correlation matrix; (3) internal consistency using Cronbach's alpha; (4) convergent validity between SPUNS-SFM and quality of life, anxiety-and-depression scales by calculating Spearman's rank correlation coefficient;( 5) discriminative validity through the Wilcoxon rank-sum test; and (6) test-retest reliability using intraclass correlation coefficient. SPUNS-SFM has 23 items with six factors accounting for 65 % of the total variance. The domains were concerns about the future, access and continuity of healthcare, information, work and finance, and personal and emotional needs. Cronbach's alpha values ranged from 0.70 to 0.88 among factors. SPUNS-SFM had moderate convergent validity compared with quality of life and depression-and-anxiety scales and good discriminative validity, revealing high needs for younger caregivers and more emotional needs for caregivers of patients with advanced cancer stages. Intraclass correlation coefficient between SPUNS-SFM measurements was 0.78. SPUNS-SFM is a valid and reliable tool to identify needs of caregivers of cancer patients.

  8. Medicinal use of wild fauna by mestizo communities living near San Guillermo Biosphere Reserve (San Juan, Argentina).

    PubMed

    Hernandez, Jorge; Campos, Claudia M; Borghi, Carlos E

    2015-01-21

    Wild and domestic animals and their by-products are important ingredients in the preparation of curative, protective and preventive medicines. Despite the medicinal use of animals worldwide, this topic has received less attention than the use of medicinal plants. This study assessed the medicinal use of animals by mestizo communities living near San Guillermo MaB Reserve by addressing the following questions: What animal species and body parts are used? What ailments or diseases are treated with remedies from these species? To what extent do mestizo people use animals as a source of medicine? Is the use related to people's age? We conducted semi-structured interviews with 171 inhabitants (15-93 years old) of four villages close to the Reserve: Tudcúm, Angualasto, Malimán and Colangüil. We calculated the informant consensus factor and fidelity level to test homogeneity of knowledge and to know the importance of different medicinal uses for a given species. The medicinal use of animals was reported by 57% of the surveyed people. Seven species were mentioned: Rhea pennata, Lama guanicoe, Puma concolor, Pseudalopex sp., Lama vicugna, Lepus europaeus and Conepatus chinga. Several body parts were used: fat, leg, bezoar-stone, stomach, feather, meat, blood, feces, wool, and liver. The fat of R. pennata was the most frequently used animal part, followed by the bezoar stone and the leg of L. guanicoe. Animals were used to treat 22 ailments, with respiratory and nervous system disorders being the most frequently treated diseases with a high degree of consensus. Old people used animals as remedies more frequently than young residents, showing some differences among villages. A low number of animal species was mentioned as used for medicinal purposes, which could be explained by the perception of strong control related the legislation that bans hunting and the erosion of traditional knowledge produced by mestizaje. However, the presence of a traditional medicine is deeply rooted in the community culture. Management strategy for protected areas should focus not only on the conservation and sustainability of biological resources, but also on the ancestral knowledge of local communities, such as the medicinal use of animals.

  9. Medical care costs incurred by patients with smoking-related non-small cell lung cancer treated at the National Cancer Institute of Mexico.

    PubMed

    Arrieta, Oscar; Quintana-Carrillo, Roger Humberto; Ahumada-Curiel, Gabriel; Corona-Cruz, Jose Francisco; Correa-Acevedo, Elma; Zinser-Sierra, Juan; de la Mata-Moya, Dolores; Mohar-Betancourt, Alejandro; Morales-Oyarvide, Vicente; Reynales-Shigematsu, Luz Myriam

    2014-01-01

    Smoking is a public health problem in Mexico and worldwide; its economic impact on developing countries has not been well documented. The aim of this study was to assess the direct medical costs attributable to smoking incurred by lung cancer patients treated at the National Cancer Institute of Mexico (INCan). The study was conducted at INCan in 2009. We carried out a cost of illness (COI) methodology, using data derived from an expert panel consensus and from medical chart review. A panel of experts developed a diagnostic-therapeutic guide that combined the hospital patient pathways and the infrastructure, human resources, technology, and services provided by the medical units at INCan. Cost estimates in Mexican pesos were adjusted by inflation and converted into US Dollars using the 2013 FIX exchange rate for foreign transactions (1 USD = 13.06 Mexican pesos). A 297 incident cases diagnosed with any type of lung cancer were analyzed. According to clinical stage, the costs per patient were 13,456; 35,648; 106,186; and 144,555 USD, for lung cancer stages I, II, III, and IV respectively. The weighted average annual cost/patient was and 139,801 USD and the average annual cost/patient that was attributable to smoking was 92,269 USD. This cost was independent of the clinical stage, with stage IV representing 96% of the annual cost. The total annual cost of smoking-related lung cancer at INCan was 19,969,781 USD. The medical care costs of lung cancer attributable to smoking represent a high cost both for INCan and the Mexican health sector. These costs could be reduced if all provisions established in the Framework Convention of Tobacco Control of the World Health Organization were implemented in Mexico.

  10. (153)Sm-EDTMP for pain relief of bone metastases from prostate and breast cancer and other malignancies.

    PubMed

    Correa-González, Luis; Arteaga de Murphy, Consuelo; Pichardo-Romero, Pablo; Pedraza-López, Martha; Moreno-García, Claudia; Correa-Hernández, Luis

    2014-05-01

    Approximately 85% of patients with cancer suffer severe metastatic bone pain for which radionuclide therapy has been employed for pain palliation. We undertook this study to evaluate the pain relief effect of (153)Sm-EDTMP in Mexican patients with severe and painful bone metastases from mainly prostate, breast, and renal cancer and other malignancies. Patients (277) with intense sustained pain caused by bone metastases were referred to the Nuclear Medicine Department of the Oncology Hospital of the Mexican Social Security Institute. The patients had to have acceptable physical conditions, a previous positive (99m)Tc-MDP scan and blood values within normal range. (153)Sm-EDTMP was prepared at the Instituto Nacional de Investigaciones Nucleares (ININ) and 37 MBq/kg of body weight was injected intravenously. Pain palliation was evaluated with a visual analogue scale (VAS) and a verbal rating scale (VRS) before treatment and 3 and 12 weeks after treatment was started. The age interval of the patients was 24-92 years with a mean age of 64 ± 12 years. Mean values for hemoglobin, leukocyte and platelet counts did not statistically differ at zero time, 3 and 12 weeks after treatment. Pain intensity and relief assessment were statistically different: 9.1 ± 0.61 units initially; 4.2 ± 1.3 units 3 weeks later (54%) and after 12 weeks the pain diminished to 2.4 ± 1.4 units (74%) in the pain relief score scales. (153)Sm-EDTMP was readily available, safe and well tolerated. We conclude that (153)Sm-EDTMP was an adequate palliative agent and was the best option for our Mexican patients to relieve their severe metastatic bone pain. Copyright © 2014 IMSS. Published by Elsevier Inc. All rights reserved.

  11. Association between G1733A (rs6152) polymorphism in androgen receptor gene and recurrent spontaneous abortions in Mexican population.

    PubMed

    Porras-Dorantes, Ángela; Brambila-Tapia, Aniel Jessica Leticia; Lazcano-Castellanos, Alma Benita; Da Silva-José, Thiago Donizete; Juárez-Osuna, Jesús Alejandro; García-Ortiz, José Elías

    2017-10-01

    Recurrent spontaneous abortion (RSA) is a multifactorial condition that occurs with a frequency of 0.2-5% in women of reproductive age. Among genetic factors, the single nucleotide polymorphism (SNP) G1733A in the androgen receptor (AR) gene has been associated with its presence in Greek and Iranian populations. Therefore, the aim of this study is to determine its possible association with RSA in this population. A total of 156 Mexican RSA (with at least 2 consecutive abortions) unrelated patients and 152 unrelated healthy women were included, the presence of karyotype anomalies in the parents as well as uterine anomalies as well as antiphospholipid antibodies was excluded in patients; while all the controls presented at least two healthy pregnancies and no abortion. In all the included women, the presence of the SNP G1733A was determined by restriction fragment length polymorphism (RFLP) technique. No significant differences were observed in age between groups. The genotype GG, GA, and AA had a frequency of 0.70, 0.27, and 0.03 in controls and of 0.89, 0.10, and 0.01 in patients (p < 0.001); while the A allele frequency was of 0.06 and 0.16 in controls and patients, respectively (p < 0.0001). The difference in allele frequency increased 10-15% when patients with primary RSA (with no live births) and with at least three abortions were included. The SNP G1733A of the AR gene is significantly associated with RSA in Mexican patients. These results coincide with previous reports in other populations.

  12. What's Values Got to Do with It? Thriving among Mexican/Mexican American College Students

    ERIC Educational Resources Information Center

    Morgan Consoli, Melissa L.; Llamas, Jasmín; Consoli, Andrés J.

    2016-01-01

    The authors examined traditional Mexican/Mexican American and perceived U.S. mainstream cultural values as predictors of thriving. One hundred twenty-four (37 men, 87 women) self-identified Mexican/Mexican American college students participated in the study. The traditional Mexican/Mexican American cultural values of family support and religion…

  13. Identification of novel mutations in Mexican patients with Aarskog-Scott syndrome.

    PubMed

    Pérez-Coria, Mariana; Lugo-Trampe, José J; Zamudio-Osuna, Michell; Rodríguez-Sánchez, Iram P; Lugo-Trampe, Angel; de la Fuente-Cortez, Beatriz; Campos-Acevedo, Luis D; Martínez-de-Villarreal, Laura E

    2015-05-01

    Aarskog-Scott syndrome (AAS), also known as faciogenital dysplasia (FGD, OMIM # 305400), is an X-linked disorder of recessive inheritance, characterized by short stature and facial, skeletal, and urogenital abnormalities. AAS is caused by mutations in the FGD1 gene (Xp11.22), with over 56 different mutations identified to date. We present the clinical and molecular analysis of four unrelated families of Mexican origin with an AAS phenotype, in whom FGD1 sequencing was performed. This analysis identified two stop mutations not previously reported in the literature: p.Gln664* and p.Glu380*. Phenotypically, every male patient met the clinical criteria of the syndrome, whereas discrepancies were found between phenotypes in female patients. Our results identify two novel mutations in FGD1, broadening the spectrum of reported mutations; and provide further delineation of the phenotypic variability previously described in AAS.

  14. Identification of novel mutations in Mexican patients with Aarskog–Scott syndrome

    PubMed Central

    Pérez-Coria, Mariana; Lugo-Trampe, José J; Zamudio-Osuna, Michell; Rodríguez-Sánchez, Iram P; Lugo-Trampe, Angel; de la Fuente-Cortez, Beatriz; Campos-Acevedo, Luis D; Martínez-de-Villarreal, Laura E

    2015-01-01

    Aarskog–Scott syndrome (AAS), also known as faciogenital dysplasia (FGD, OMIM # 305400), is an X-linked disorder of recessive inheritance, characterized by short stature and facial, skeletal, and urogenital abnormalities. AAS is caused by mutations in the FGD1 gene (Xp11.22), with over 56 different mutations identified to date. We present the clinical and molecular analysis of four unrelated families of Mexican origin with an AAS phenotype, in whom FGD1 sequencing was performed. This analysis identified two stop mutations not previously reported in the literature: p.Gln664* and p.Glu380*. Phenotypically, every male patient met the clinical criteria of the syndrome, whereas discrepancies were found between phenotypes in female patients. Our results identify two novel mutations in FGD1, broadening the spectrum of reported mutations; and provide further delineation of the phenotypic variability previously described in AAS. PMID:26029706

  15. [Psychosocial factors associated with late HAART initiation in Mexican patients with HIV].

    PubMed

    Nogueda-Orozco, María José; Caro-Vega, Yanink; Crabtree-Ramírez, Brenda; Vázquez-Pineda, Fernando; Sierra-Madero, Juan G

    2015-01-01

    To explore the association between psychosocial factors and late highly active antiretroviral therapy (HAART) initiation in a sample of Mexican patients with HIV. We conducted a cross-sectional study at the HIV Clinic of the Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), and applied structured questionnaires to 150 patients who initiated HAART between January 2010 and August 2011. Late HAART initiation (LHI) was considered when patients started HAART with CD4 counts of <200+ cells/mm³. By multivariate analysis, the strongest psychosocial risk factor for LHI observed was self-stigma towards HIV/AIDS. In addition, being tested by medical prescription, not by own initiative, as well as having one or more previous medical contacts, were associated with greater risk for LH. Our findings suggest the need to develop psychosocial interventions to decrease negative self-image and stigmatizing attitudes and behaviors in risk groups for HIV in Mexico.

  16. [Hip fracture in older adults: prevalence and costs in two hospitals. Tabasco, Mexico, 2009].

    PubMed

    Quevedo-Tejero, Elsy del Carmen; Zavala-González, Marco Antonio; Hernández-Gamas, Arianna del Carmen; Hernández-Ortega, Hilda María

    2011-01-01

    To determine hip fracture prevalence and direct healthcare costs in elderly users of the reference hospitals of the Mexican Institute of Social Insurance (IMSS by spanish initials) and Mexican Oils (PEMEX by spanish initials), from Villahermosa, Tabasco, Mexico, during 2009. This is a cross-sectional study. The information was based on the registers of surgical interventions and institutional reports of the elderly inpatients who had a registered attention in their institution. Descriptive statistical analysis was performed considering the following variables: age, gender, hip fracture type, occurrence month, direct healthcare cost. Out of 10,765 records of hospitalized elderly, 57 hip fracture cases were found (33 in the IMSS and 24 in PEMEX). Hip fracture prevalence was 0.5%, (IMSS 1.1% and PEMEX 0.3%), being more frequent in women and older than 69. The most frequent fracture type was the femur neck one (78.9%). The estimated cost of healthcare in the hospital per patient was USD 5,803 in the IMSS and USD 11,800 in PEMEX. The hip fracture prevalence was higher in the IMSS users. Estimated healthcare costs per patient were higher than the reported in other institutions of the of the mexican health national system.

  17. [Costs of appendicitis treatment by diagnosis-related groups in a third-level pediatric hospital].

    PubMed

    Tlacuilo-Parra, Alberto; Hernández-Hernández, Araceli; Venegas-Dávalos, Martha; Gutiérrez-Hermosillo, Violeta; Guevara-Gutiérrez, Elizabeth; Ambriz-González, Gabriela

    2014-01-01

    Diagnosis-related groups (DRGs) are widely used in Europe. They allow performing comparisons in hospitals and incurrent hospital payment systems, defining the payment categories. We undertook this study to classify children who underwent appendectomy according to DRGs. Cross-sectional study. Comorbidities, length of hospitalization, histopathologic classification, and DRG classifications were analyzed. We included 313 patients, 62% males, with an average age of 8 ± 3 years; 91% were referred by another hospital and 67% were treated at night. Average length of hospitalization was 4 ± 3 days. There were comorbidities in 8% and surgical complications in 11%. According to histopathology, appendicitis was edematous (11%), suppurative (36%), gangrenous (22%), perforated (29%), and abscessed (2%). At discharge, 97% of the patients were healthy. Total cost for DRG 343 was $10,470,173.00 (Mexican pesos), DRG 342 was $1,227,592.00 and DRG 340 was $511,521.00. The global amount was $12,209,286.00 (Mexican pesos). The unitary cost for treatment of appendectomy for DRG 343 was $37,935.00, for DRG 342 was $49,103.00 and for DRG 340 was $42,626.00 (Mexican pesos). Because 88% of the cases of appendicitis were uncomplicated, this amount of money could be spent to treat these patients in a second-level hospital, using reimbursement 343 without generating additional expenses.

  18. The prevalence and correlates of severe depression in a cohort of Mexican teachers.

    PubMed

    Soria-Saucedo, Rene; Lopez-Ridaura, Ruy; Lajous, Martin; Wirtz, Veronika J

    2018-07-01

    Depression is among the 10 major causes of disability in Mexico. Yet, local contextual factors associated to the disorder remain poorly understood. We measured the impact of several factors on severe depression such as demographics, pharmacotherapy, multimorbidity, and unhealthy behaviors in Mexican teachers. A total of 43,845 Mexican female teachers from 12 Mexican states answered the Patient Health Questionnaire (PHQ9). Data were part the Mexican Teacher's Cohort prospective study, the largest ongoing cohort study in Latin America. Unadjusted and adjusted estimates assessed the impact of several contextual factors between severe versus mild-no depression cases. In total 7026 teachers (16%) had a PHQ9 score compatible with severe depression. From them, only 17% received psychotropics, compared to 60% for those with a formal diagnosis. Less than 5% of teachers with PHQ9 scores compatible with severe depression had a formal diagnosis. Adjusted analysis reported higher odds of pharmacotherapy, having ≥ 3 comorbidities, higher levels of couple, family and work stress, fewer hours of vigorous physical activity, higher alcohol consumption, and smoking as risk factors for severe depression. Also, rural residents of northern and center states appeared more severely depressed compared to their urban counterparts. On average, the PHQ9 scores differed by ~ 10 points between severe and mild-no depressed teachers. A cross-sectional design. Also, the study focused on female teachers between ages 25 and 74 years old, reducing the generalizability of the estimates. Under-diagnosis of clinical depression in Mexican teachers is concerning. Unhealthy behavior is associated with severe depression. The information collected in this study represents an opportunity to build prevention mechanisms of depression in high-risk subgroups of female educators and warrants improving access to mental care in Mexico. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Acculturation, Behavioral Factors, and Family History of Breast Cancer among Mexican and Mexican-American Women.

    PubMed

    Nodora, Jesse N; Cooper, Renee; Talavera, Gregory A; Gallo, Linda; Meza Montenegro, María Mercedes; Komenaka, Ian; Natarajan, Loki; Gutiérrez Millán, Luis Enrique; Daneri-Navarro, Adrian; Bondy, Melissa; Brewster, Abenaa; Thompson, Patricia; Martinez, María Elena

    2015-01-01

    Incidence rates for breast cancer are higher among Mexican-American (MA) women in the United States than women living in Mexico. Studies have shown higher prevalence of breast cancer risk factors in more acculturated than less acculturated Hispanic/Latinas in the United States. We compared the prevalence of behavioral risk factors and family history of breast cancer by level of acculturation and country of residence in women of Mexican descent. Data were collected from 1,201 newly diagnosed breast cancer patients living in Mexico (n = 581) and MAs in the United States (n = 620). MA participants were categorized into three acculturation groups (Spanish dominant, bilingual, and English dominant); women living in Mexico were used as the referent group. The prevalence of behavioral risk factors and family history of breast cancer were assessed according to acculturation level, adjusting for age at diagnosis and education. In the adjusted models, bilingual and English-dominant MAs were significantly more likely to have a body mass index of 30 kg/m(2) or greater, consume more than one alcoholic beverage a week, and report having a family history of breast cancer than women living in Mexico. All three U.S. acculturation groups were significantly more likely to have lower total energy expenditure (≤533 kcal/d) than women in Mexico. English-dominant women were significantly less likely to ever smoke cigarettes than the Mexican group. Our findings add to the limited scientific literature on the relationships among acculturation, health behavior, and family history of breast cancer in Mexican and MA women. Copyright © 2015 Jacobs Institute of Women's Health. Published by Elsevier Inc. All rights reserved.

  20. Gastric cancer research in Mexico: A public health priority

    PubMed Central

    Sampieri, Clara Luz; Mora, Mauricio

    2014-01-01

    This study aimed review studies conducted on Mexican patients diagnosed with gastric cancer and/or diseases associated with its development, in which at least one Mexican institute has participated, and to assess their contributions to the primary and secondary prevention of this disease. A search of the Medline database was conducted using the following keywords: gastric/stomach cancer, Mexico. Studies of the Mexican population were selected in which at least one Mexican Institute had participated and where the findings could support public policy proposals directed towards the primary or secondary prevention of gastric cancer. Of the 148 studies found in the Medline database, 100 were discarded and 48 were reviewed. According to the analysis presented, these studies were classified as: epidemiology of gastric cancer (5/48); risk factors and protectors relating to gastric cancer (9/48); relationship between Helicobacter pylori and pathologies associated with gastric cancer and the development of the disease (16/48); relationship between the Epstein-Barr virus and pathologies associated with gastric cancer and the development of the disease (3/48); molecular markers for the development of diseases associated with gastric cancer and gastric cancer (15/48). Mexico requires a program for the prevention and control of gastric cancer based on national health indicators. This should be produced by a multidisciplinary committee of experts who can propose actions that are relevant in the current national context. The few studies of gastric cancer conducted on the Mexican population in national institutes highlight the poor connection that currently exists between the scientific community and the health sector in terms of resolving this health issue. Public policies for health research should support projects with findings that can be translated into benefits for the population. This review serves to identify national research groups studying gastric cancer in the Mexican population. PMID:24782602

  1. Gastric cancer research in Mexico: a public health priority.

    PubMed

    Sampieri, Clara Luz; Mora, Mauricio

    2014-04-28

    This study aimed review studies conducted on Mexican patients diagnosed with gastric cancer and/or diseases associated with its development, in which at least one Mexican institute has participated, and to assess their contributions to the primary and secondary prevention of this disease. A search of the Medline database was conducted using the following keywords: gastric/stomach cancer, Mexico. Studies of the Mexican population were selected in which at least one Mexican Institute had participated and where the findings could support public policy proposals directed towards the primary or secondary prevention of gastric cancer. Of the 148 studies found in the Medline database, 100 were discarded and 48 were reviewed. According to the analysis presented, these studies were classified as: epidemiology of gastric cancer (5/48); risk factors and protectors relating to gastric cancer (9/48); relationship between Helicobacter pylori and pathologies associated with gastric cancer and the development of the disease (16/48); relationship between the Epstein-Barr virus and pathologies associated with gastric cancer and the development of the disease (3/48); molecular markers for the development of diseases associated with gastric cancer and gastric cancer (15/48). Mexico requires a program for the prevention and control of gastric cancer based on national health indicators. This should be produced by a multidisciplinary committee of experts who can propose actions that are relevant in the current national context. The few studies of gastric cancer conducted on the Mexican population in national institutes highlight the poor connection that currently exists between the scientific community and the health sector in terms of resolving this health issue. Public policies for health research should support projects with findings that can be translated into benefits for the population. This review serves to identify national research groups studying gastric cancer in the Mexican population.

  2. Waardenburg syndrome in four Mexican patients.

    PubMed

    Aguilar Caso, Sandra I; Ortiz Nieva, Gabriela

    2009-01-01

    Waardenburg syndrome is a hereditary auditory-pigmentary syndrome. The major features include pigmentary disturbances and congenital deafness. Clinical findings are extremely variable, not only at the authors' institution but also in the literature. The authors describe four patients who presented with various clinical features and different genetic pedigree penetration.

  3. Access to care issues adversely affect breast cancer patients in Mexico: oncologists' perspective.

    PubMed

    Chavarri-Guerra, Yanin; St Louis, Jessica; Liedke, Pedro E R; Symecko, Heather; Villarreal-Garza, Cynthia; Mohar, Alejandro; Finkelstein, Dianne M; Goss, Paul E

    2014-09-09

    Despite recently implemented access to care programs, Mexican breast cancer (BC) mortality rates remain substantially above those in the US. We conducted a survey among Mexican Oncologists to determine whether practice patterns may be responsible for these differences. A web-based survey was sent to 851 oncologists across Mexico using the Vanderbilt University REDCap database. Analyses of outcomes are reported using exact and binomial confidence bounds and tests. 138 participants (18.6% of those surveyed) from the National capital and 26 Mexican states, responded. Respondents reported that 58% of newly diagnosed BC patients present with stage III-IV disease; 63% undergo mastectomy, 52% axillary lymph node dissection (ALND) and 48% sentinel lymph node biopsy (SLNB). Chemotherapy is recommended for tumors > 1 cm (89%), positive nodes (86.5%), triple-negative (TN) (80%) and HER2 positive tumors (58%). Trastuzumab is prescribed in 54.3% and 77.5% for HER2 < 1 cm and > 1 cm tumors, respectively. Tamoxifen is indicated for premenopausal hormone receptor (HR) positive tumors in 86.5% of cases and aromatase inhibitors (AI's) for postmenopausal in 86%. 24% of physicians reported treatment limitations, due to delayed or incomplete pathology reports and delayed or limited access to medications. Even though access to care programs have been recently applied nationwide, women commonly present with advanced BC, leading to increased rates of mastectomy and ALND. Mexican physicians are dissatisfied with access to appropriate medical care. Our survey detects specific barriers that may impact BC outcomes in Mexico and warrant further investigation.

  4. Venezuela, A Country Study.

    DTIC Science & Technology

    1982-04-16

    NUMBERS US Army War College Carlisle Barracks, PA 17013 11. CONTROLLING OFFICE NAME AND ADDRESS 12. REPORT DATE Same16 Aril 1982Same13. NUMBER OF...to grips with expectations for more and better social welfare programs, education, health facilities and jobs. The pressures are the 2 greatest in the...the mestizos or mulattos - and freed blacks. This group was spreading through the country. They became a significant ethnic culture in Venezuela

  5. Clinical practice guidelines for the treatment of systemic lupus erythematosus by the Mexican College of Rheumatology.

    PubMed

    Xibillé-Friedmann, Daniel; Pérez-Rodríguez, Marcela; Carrillo-Vázquez, Sandra; Álvarez-Hernández, Everardo; Aceves, Francisco Javier; Ocampo-Torres, Mario C; García-García, Conrado; García-Figueroa, José Luis; Merayo-Chalico, Javier; Barrera-Vargas, Ana; Portela-Hernández, Margarita; Sicsik, Sandra; Andrade-Ortega, Lilia; Rosales-Don Pablo, Víctor Manuel; Martínez, Aline; Prieto-Seyffert, Pilar; Pérez-Cristóbal, Mario; Saavedra, Miguel Ángel; Castro-Colín, Zully; Ramos, Azucena; Huerta-Sil, Gabriela; Hernández-Cabrera, María Fernanda; Jara, Luis Javier; Limón-Camacho, Leonardo; Tinajero-Nieto, Lizbet; Barile-Fabris, Leonor A

    2018-05-04

    There are national and international clinical practice guidelines for systemic lupus erythematosus treatment. Nonetheless, most of them are not designed for the Mexican population or are devoted only to the treatment of certain disease manifestations, like lupus nephritis, or are designed for some physiological state like pregnancy. The Mexican College of Rheumatology aimed to create clinical practice guidelines that included the majority of the manifestations of systemic lupus erythematosus, and also incorporated guidelines in controversial situations like vaccination and the perioperative period. The present document introduces the «Clinical Practice Guidelines for the Treatment of Systemic Lupus Erythematosus» proposed by the Mexican College of Rheumatology, which could be useful mostly for non-rheumatologist physicians who need to treat patients with systemic lupus erythematosus without having the appropriate training in the field of rheumatology. In these guidelines, the reader will find recommendations on the management of general, articular, kidney, cardiovascular, pulmonary, neurological, hematologic and gastrointestinal manifestations, and recommendations on vaccination and treatment management during the perioperative period. Copyright © 2018 Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. Publicado por Elsevier España, S.L.U. All rights reserved.

  6. Prevalence of metabolic syndrome and obesity in renal transplanted Mexican children.

    PubMed

    Ramirez-Cortes, Guadalupe; Fuentes-Velasco, Yolanda; García-Roca, Pilar; Guadarrama, Omar; López, Mónica; Valverde-Rosas, Saúl; Velásquez-Jones, Luis; Romero, Benjamin; Toussaint, Georgina; Medeiros, Mara

    2009-08-01

    The purpose of the study was to evaluate the prevalence of MS and obesity in Mexican children with more than one yr post-renal transplantation. Thirty-two children transplanted between January 2004 and February 2006 were included in the study. The weight and height at the time of renal transplant were obtained. A fasting blood sample was drawn for serum creatinine, adiponectin, and complete lipid profile, and a three-h glucose tolerance test was also taken. A complete nutritional evaluation was performed including anthropometry. There was a statistically significant increase in BMI at one yr post-transplant that was maintained at two yr post-transplant. Three patients exhibited obesity and were overweight. Seventeen patients had hypertension, 14 patients had low HDL, 12 patients had hypertriglyceridemia, all had normal fasting glucose, six of them had glucose intolerance, and two had waist circumference higher than 90%. Eight patients (25%) had MS. Patients with MS had higher proportion of deceased donor grafts, acute rejection episodes, and received more methylprednisolone pulses; also they had a statistically significant higher pretransplant BMI than patients without MS. There was a significant relationship between BMI at one yr post-renal transplant and creatinine clearance estimated by Schwartz formula.

  7. Symptoms and Etiological Attribution: A Cross-Sectional Study in Mexican Outpatients with Psychosis and Their Relatives.

    PubMed

    Gómez-de-Regil, Lizzette; Ros-Morente, Agnès; Rodríguez-Hansen, Gisela

    2016-01-01

    This cross-sectional study aimed at identifying the most common attributions of their mental disorder in a Mexican patients who have experienced psychosis and their relatives and exploring how having experienced or not characteristic psychotic symptoms and their present clinical status might affect their etiological attributions. Past and current symptom profiles of 66 patients were as assessed with the SCID-I (Structured Clinical Interview for DSM-IV Axis I Disorders) and the PANSS (Positive and Negative Syndrome Scale), respectively. The etiological attribution of psychosis of patients (n = 62) and the relatives (n = 65) was assessed with the Angermeyer and Klusmann scale comprising 30 items into five categories: biology, personality, family, society, and esoteric. Patients and relatives attribute psychosis mainly to social factors. Relatives' attributions were not influenced by clinical profile of patients, whereas in the case of patients it was only current clinical status that showed a difference, with those in nonremission scoring higher personality and family factors. Acknowledging patients' and relatives' beliefs about mental disorders at onset and later on is particularly important in psychosis, a mental condition with severe and/or persistent symptoms, in order to promote better involvement in treatment and in consequence efficacy and recovery.

  8. The use of the finasteride-adjusted Prostate Cancer Prevention Trial Prostate Cancer Risk Calculator in a Mexican referral population: a validation study.

    PubMed

    Liang, Yuanyuan; Ketchum, Norma S; Louden, Christopher; Jimenez-Rios, Miguel A; Thompson, Ian M; Camarena-Reynoso, Hector R

    2012-01-01

    To perform the first validation study of the finasteride-adjusted Prostate Cancer Prevention Trial Prostate Cancer Risk Calculator (finPCPTRC) in a contemporary referral population in Mexico. 837 patients referred to the Instituto Nacional de Cancerología, Mexico City, Mexico, between 2005 and 2009 were used to validate the finPCPTRC by examining various measures of discrimination and calibration. Net benefit curve analysis was used to gain insight into the use of the finPCPTRC for clinical decisions. Prostate cancer (PCa) incidence (72.8%) was high in this Mexican referral cohort and 45.7% of men who were diagnosed with PCa had high-grade lesions (HGPCa, Gleason score >6). 1.3% of the patients were taking finasteride. The finPCPTRC was a superior diagnostic tool compared to prostate-specific antigen alone when discriminating patients with PCa from those without PCa (AUC = 0.784 vs. AUC = 0.687, p < 0.001) and when discriminating patients with HGPCa from those without HGPCa (AUC = 0.768 vs. AUC = 0.739, p < 0.001). The finPCPTRC underestimated the risk of PCa but overestimated the risk of HGPCa (both p < 0.001). Compared with other strategies to opt for biopsy, the net benefit would be larger with utilization of the finPCPTRC for patients accepting higher risks of HGPCa. Rates of biopsy-detectable PCa and HGPCa were high and 1.3% of this referral cohort in Mexico was taking finasteride. The risks of PCa or HGPCa calculated by the finPCPTRC were not well calibrated for this referral Mexican population and new clinical diagnostic tools are needed. Copyright © 2012 S. Karger AG, Basel.

  9. Cost-effectiveness analysis of EGFR mutation testing in patients with non-small cell lung cancer (NSCLC) with gefitinib or carboplatin-paclitaxel.

    PubMed

    Arrieta, Oscar; Anaya, Pablo; Morales-Oyarvide, Vicente; Ramírez-Tirado, Laura Alejandra; Polanco, Ana C

    2016-09-01

    Assess the cost-effectiveness of an EGFR-mutation testing strategy for advanced NSCLC in first-line therapy with either gefitinib or carboplatin-paclitaxel in Mexican institutions. Cost-effectiveness analysis using a discrete event simulation (DES) model to simulate two therapeutic strategies in patients with advanced NSCLC. Strategy one included patients tested for EGFR-mutation and therapy given accordingly. Strategy two included chemotherapy for all patients without testing. All results are presented in 2014 US dollars. The analysis was made with data from the Mexican frequency of EGFR-mutation. A univariate sensitivity analysis was conducted on EGFR prevalence. Progression-free survival (PFS) transition probabilities were estimated on data from the IPASS and simulated with a Weibull distribution, run with parallel trials to calculate a probabilistic sensitivity analysis. PFS of patients in the testing strategy was 6.76 months (95 % CI 6.10-7.44) vs 5.85 months (95 % CI 5.43-6.29) in the non-testing group. The one-way sensitivity analysis showed that PFS has a direct relationship with EGFR-mutation prevalence, while the ICER and testing cost have an inverse relationship with EGFR-mutation prevalence. The probabilistic sensitivity analysis showed that all iterations had incremental costs and incremental PFS for strategy 1 in comparison with strategy 2. There is a direct relationship between the ICER and the cost of EGFR testing, with an inverse relationship with the prevalence of EGFR-mutation. When prevalence is >10 % ICER remains constant. This study could impact Mexican and Latin American health policies regarding mutation detection testing and treatment for advanced NSCLC.

  10. When health systems are barriers to health care: challenges faced by uninsured Mexican kidney patients.

    PubMed

    Kierans, Ciara; Padilla-Altamira, Cesar; Garcia-Garcia, Guillermo; Ibarra-Hernandez, Margarita; Mercado, Francisco J

    2013-01-01

    Chronic Kidney Disease disproportionately affects the poor in Low and Middle Income Countries (LMICs). Mexico exemplifies the difficulties faced in supporting Renal Replacement Therapy (RRT) and providing equitable patient care, despite recent attempts at health reform. The objective of this study is to document the challenges faced by uninsured, poor Mexican families when attempting to access RRT. The article takes an ethnographic approach, using interviewing and observation to generate detailed accounts of the problems that accompany attempts to secure care. The study, based in the state of Jalisco, comprised interviews with patients, their caregivers, health and social care professionals, among others. Observations were carried out in both clinical and social settings. In the absence of organised health information and stable pathways to renal care, patients and their families work extraordinarily hard and at great expense to secure care in a mixed public-private healthcare system. As part of this work, they must navigate challenging health and social care environments, negotiate treatments and costs, resource and finance healthcare and manage a wide range of formal and informal health information. Examining commonalities across pathways to adequate healthcare reveals major failings in the Mexican system. These systemic problems serve to reproduce and deepen health inequalities. A system, in which the costs of renal care are disproportionately borne by those who can least afford them, faces major difficulties around the sustainability and resourcing of RRTs. Attempts to increase access to renal therapies, therefore, need to take into account the complex social and economic demands this places on those who need access most. This paper further shows that ethnographic studies of the concrete ways in which healthcare is accessed in practice provide important insights into the plight of CKD patients and so constitute an important source of evidence in that effort.

  11. Psychological, interpersonal, and clinical factors predicting time spent on physical activity among Mexican patients with hypertension

    PubMed Central

    Ybarra Sagarduy, José Luis; Camacho Mata, Dacia Yurima; Moral de la Rubia, José; Piña López, Julio Alfonso; Yunes Zárraga, José Luis Masud

    2018-01-01

    Background It is widely known that physical activity is the key to the optimal management and clinical control of hypertension. Purpose This research was conducted to identify factors that can predict the time spent on physical activity among Mexican adults with hypertension. Methods This cross-sectional study was conducted among 182 Mexican patients with hypertension, who completed a set of self-administered questionnaires related to personality, social support, and medical adherence and health care behaviors, body mass index, and time since the disease diagnosis. Several path analyses were performed in order to test the predictors of the study behavior. Results Lower tolerance to frustration, more tolerance to ambiguity, more effective social support, and less time since the disease diagnosis predicted more time spent on physical activity, accounting for 13.3% of the total variance. The final model shows a good fit to the sample data (pBS =0.235, χ2/gl =1.519, Jöreskog and Sörbom’s Goodness of Fit Index =0.987, adjusted modality =0.962, Bollen’s Incremental Fit Index =0.981, Bentler-Bonett Normed Fit Index =0.946, standardized root mean square residual =0.053). Conclusion The performance of physical activity in patients with hypertension depends on a complex set of interactions between personal, interpersonal, and clinical variables. Understanding how these factors interact might enhance the design of interdisciplinary intervention programs so that quality of life of patients with hypertension improves and they might be able to manage and control their disease well. PMID:29379276

  12. Clinical and biochemical findings in Mexican patients with distal renal tubular acidosis.

    PubMed

    Guerra-Hernández, Norma; Matos-Martínez, Mario; Ordaz-López, Karen Verónica; Camargo-Muñiz, María Dolores; Medeiros, Mara; Escobar-Pérez, Laura

    2014-01-01

    Renal tubular acidosis (RTA) is a rare disease characterized by a normal serum anion gap, sustained metabolic acidosis, low concentration of plasma bicarbonate, variable hyperchloremia and hypokalemia and conserved glomerular filtration rate. RTA is developed during the first year of life and produces failure to thrive and anorexia. Primary distal RTA (type 1) is a renal syndrome with a reduced ability to excrete the acid load through the collecting ducts and impairment to concentrate the urine causing polyuria and dehydration. Evaluate the current health status and describe the clinical findings and progress of Mexican patients with distal RTA. Demonstrate the distal urinary acidification defect by measuring the urinary pCO2 tension in alkaline urines. We looked for infants in tertiary care hospitals with a clinical history of normal serum anion gap, metabolic acidosis, hypokalemia, hyperchloremia, nephrocalcinosis, sensorineural hearing loss and inability for urine acidification under systemic metabolic acidosis. Biochemical analysis were performed periodically. Alkali medication was not suspended in one patient to assess urinary acidification with oral administration of sodium bicarbonate (2 mEq/Kg) and acetazolamide (500 mg/1.73 m2 body surface). Urinary pCO2 levels were determined at 60 and 90 min. Three children, one adolescent and one adult with distal RTA were found. They had an infant history of dehydration, failure to thrive, anorexia, vomiting, muscle paralysis, hypercalciuria, urinary infections, polyuria, polydipsia and polyhidramnios during pregnancy. Severe nephrocalcinosis was detected in all patients whereas sensorineural hearing loss was developed in four cases. Under the alkali medication all cases but one were normocalciuric. A patient developed kidney failure. The urinary acidification test confirmed the innability to eliminate the acid load. Early diagnosis in infancy and continuos alkali medication were of great benefit for most of the patients. Urinary pCO2 levels in alkaline urine provided an index for collecting duct hydrogen-ion secretion. To our knowledge this is the first report of mexican patients with distal RTA.

  13. Mexican case report of a never-treated Laron syndrome patient evolving to metabolic syndrome, type 2 diabetes, and stroke.

    PubMed

    Castilla-Cortazar, Inma; Femat-Roldán, Giovana; Rodríguez-Rivera, Joel; Aguirre, Gabriel A; García-Magariño, Mariano; Martín-Estal, Irene; Espinosa, Luis; Díaz-Olachea, Carlos

    2017-11-01

    Glucose and lipid profile together with blood pressure should always be considered for low sera-IGF-1 patients. Even when adulthood is reached, IGF-1 therapy in these patients should be pursued as metabolic and protective cellular effects could be triggered. Real incidence of growth hormone insensitivity is still to be uncovered.

  14. [Kidney transplant program: Mexican Institute of Transplants. Model of synergy between private hospital and private assistance foundations].

    PubMed

    Mondragón-Ramírez, Guillermo A; Bochicchio-Riccardelli, Tommaso; Bernal-Flores, Lourdes; León-Rojas, Gerardo; Martínez-Hernández, José A; Orozco-Tapia, Luis M; Rustrián-Hernández, Alicia E; López-Amozurrutia, Ricardo; Ortega-Montillo, Carlos A; Flores-Gama, Francisco

    2011-09-01

    The Mexican Institute of Transplantation (IMT) was created in 1999 in response to the need to meet the demand for transplants in the south of the country for patients with limited resources. Thanks to the synergy with private assistance foundations this task has been accomplished. To describe the IMT experience in kidney transplants. From November 1999 to May 23,2011, 754 kidney transplants were performed in the IMT, of which 733 were from living donors and only 21 from deceased donors. In our experience, the 10-year patient and graft survival were 84.4 and 72.4%, respectively. The average follow-up of patients was 44 months, it was during the first year after transplantation when most of patients were lost. More than 50% of patients have been supported by private assistance foundations. The IMT has participated in research protocols for phase II and phase III, for the development of new immunosuppressants. The synergy between our private medical institution and private assistance foundations has permitted to transplant low income patients, a similar association can be carried out in governmental health institutions that have overcharge in their transplant services.

  15. [Depressive disorder in Mexican pediatric patients with systemic lupus erythematosus (SLE)].

    PubMed

    Carbajal-Alonso, Hilda Lilian; García-Moreno, Norberta Prisilia; Rodríguez-Arreola, Brenda; Barrera de León, Juan Carlos

    2016-01-01

    To identify the prevalence of depression in Mexican pediatric patients with systemic lupus erythematosus. Analytical transversal study including patients aged 7-16 years with a diagnosis of systemic lupus erythematosus seen at the Pediatric Rheumatology Consultation Service. The disease was classified by means of the MEX-SLEDAI questionnaire. Descriptive statistics with central tendency and dispersion and comparative measurements with chi-squared and Mann-Whitney U tests. Logistic regression and association with odds ratios. SPSS v.21.0 statistical software package. We evaluated 45 patients who presented depression, n=9 (20%), including eight females (89%) and one male (11%), median age 13 years (range, 7-16) in children with depression vs. 13 years (range, 9-14) p=0.941, depression more frequent in schoolchildren. Habitual residence, disease evolution time, and duration of the immunosuppressor did not show a significant difference between both groups. Divorced parents p=0.037. Neuropsychiatric manifestations of lupus presented in 2.2% of all patients and in 100% of patients with depression. Disease activity index (MEX-SLEDAI) did not demonstrate a relationship with the presence of depression. Prevalences in pediatric populations are less that that reported in adults, association with disease activity, evolution time, and immunosuppressor use and duration not found.

  16. Velocardiofacial syndrome in Mexican patients: Unusually high prevalence of congenital heart disease.

    PubMed

    Márquez-Ávila, Candy Sue; Vizcaíno-Alarcón, Alfredo; García-Delgado, Constanza; Núñez-Martínez, Paulina María; Flores-Ramírez, Francisco; Reyes-de la Rosa, Alejandra del Pilar; Mendelsberg-Fishbein, Paola; Ibarra-Grajeda, Diana; Medina-Bravo, Patricia; Balderrábano-Saucedo, Norma; Esteva-Solsona, Salvador; Márquez-Quiróz, Luz del Carmen; Flores-Cuevas, Arturo; Sánchez-Urbina, Rocío; Morales-Jiménez, Ariadna Berenice; Garibay-Nieto, Nayely; Del Bosque-Garza, Jesús; Pietropaolo-Cienfuegos, Dino; Gutiérrez-Camacho, Claudia; García-Morales, Leticia; Morán-Barroso, Verónica Fabiola

    2015-11-01

    Velocardiofacial syndrome (VCFS) is the most common microdeletion syndrome with an incidence of 1:4000 live births. Its phenotype is highly variable with facial, velopharyngeal, cardiac, endocrine, immunologic and psychiatric abnormalities. It is caused by a microdeletion in chromosome 22q11.2. We present 7 years of experience evaluating patients with VCFS regarding their main clinical characteristics. The patients included were multidisciplinary evaluated and had a positive FISH analysis for del22q11.2. A total of 62 patients were assessed, a 34 female/28 male ratio was observed with ages ranging from 9 days to 16 years, all but one patient had typical facial features. A diagnosis of congenital heart disease was established in 97% of the patients; other clinical characteristics were identified with different percentages such as cleft palate, and hypocalcaemia. Three cases had a familial presentation. While the clinical findings of this study were in general terms in keeping with the literature, it is interesting the unexpectedly high percentage of congenital heart disease identified in Mexican children with VCFS that also was the main cause for clinical referral. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Seeking a "Mexicana"/"Mestiza" Ethic of Care: Rosa's "Revolución" of Carrying Alongside

    ERIC Educational Resources Information Center

    Sosa-Provencio, Mia Angélica

    2017-01-01

    This Chicana Critical Feminist "Testimonio" reveals a Mexican/Mexican-American Ethic of Care particular to the needs and strengths of "Mexicana/o" students and "Testimonios" of struggle, survival informing one Mexican/Mexican-American female educator of predominantly Mexican/Mexican-American students. This work,…

  18. Mexican Perspectives on Mexican-U.S. Relations

    DTIC Science & Technology

    1993-04-01

    while serving in the United States military, working in the Bracero program and in American factories. By working with Americans, Mexicans learned that...Mexican government blames the problem on the United States. During the history of the Bracero Program (1942 -1964) 4.6 million Mexicans traveled to...and became familiar to Mexican migrants.ŕ The termination of the Bracero Program did not discourage Mexican agricultural workers from entering the

  19. Normal/Modern: Reconstructive Surgery in a Mexican Public Hospital.

    PubMed

    Taylor-Alexander, Samuel

    2017-10-01

    A growing corpus of anthropological scholarship demonstrates how science and medicine in Mexico are imbued by national concerns with modernization. Drawing on ethnographic research in a public hospital located in the south of Mexico City, I unpack one manifestation of this dynamic, which is the conjugation of the normal and the modern in Mexican reconstructive surgery. The aspiration toward normality underlies everyday clinic practices and relationships in this field, including why parents want surgery for their children and how doctors see their patients and their responsibilities toward them. It is also central to the professional ethic of reconstructive surgeons. I argue that the realities of health care provision in Mexico coalesced with this ethic to produce reconstructive surgeons as political subjects. They aimed to modernize craniofacial surgery in Mexico and so make the bodies of craniofacial patients normal.

  20. Association between the -794 (CATT)5-8  MIF gene polymorphism and susceptibility to acute coronary syndrome in a western Mexican population.

    PubMed

    Valdés-Alvarado, Emmanuel; Muñoz-Valle, José Francisco; Valle, Yeminia; Sandoval-Pinto, Elena; García-González, Ilian Janet; Valdez-Haro, Angélica; De la Cruz-Mosso, Ulises; Flores-Salinas, Héctor Enrique; Padilla-Gutiérrez, Jorgé Ramón

    2014-01-01

    The macrophage migration inhibitory factor (MIF) is related to the progression of atherosclerosis, which, in turn, is a key factor in the development of acute coronary syndrome (ACS). MIF has a CATT short tandem repeat (STR) at position -794 that might be involved in its expression rate. The aim of this study was to investigate the association between the -794 (CATT)5-8  MIF gene polymorphism and susceptibility to ACS in a western Mexican population. This research included 200 ACS patients classified according to the criteria of the American College of Cardiology (ACC) and 200 healthy subjects (HS). The -794 (CATT)5-8  MIF gene polymorphism was analyzed using a conventional polymerase chain reaction (PCR) technique. The 6 allele was the most frequent in both groups (ACS: 54% and HS: 57%). The most common genotypes in ACS patients and HS were 6/7 and 6/6, respectively, and a significant association was found between the 6/7 genotype and susceptibility to ACS (68% versus 47% in ACS and HS, resp., P = 0.03). We conclude that the 6/7 genotype of the MIF -794 (CATT)5-8 polymorphism is associated with susceptibility to ACS in a western Mexican population.

  1. Using the Theory of Planned Behavior to Improve Treatment Adherence in Mexican Americans with Schizophrenia

    PubMed Central

    Kopelowicz, Alex; Zarate, Roberto; Wallace, Charles J.; Liberman, Robert Paul; Lopez, Steven R.; Mintz, Jim

    2015-01-01

    Objective Failure to adhere to treatment with antipsychotic medication is the most common cause of relapse among patients with schizophrenia. A novel multi-family group (MFG) intervention, informed by the Theory of Planned Behavior (TPB), demonstrated efficacy in increasing medication adherence and decreasing re-hospitalizations in schizophrenia patients. This report explores the hypothesis that the improved outcomes obtained through the MFG approach were mediated by changes in the patients’ attitudes towards medications, subjective norms-social influences, and perceived behavioral control of resources. Method Data from a recently completed, randomized controlled trial of MFG was used to test the hypothesis that the improvement in adherence was mediated by the three TPB factors. Subjects were 174 Mexican American adults with schizophrenia-spectrum disorder who had participated in a study of MFG focused on improving medication adherence. Assessments occurred at baseline and at 4, 8, 12, 18 and 24 months. Results Path analysis revealed that the increased adherence associated with MFG was mediated by improvements in subjective norms but not attitudes towards medications nor perceived behavioral control. Conclusion An MFG treatment specifically tailored to increase medication adherence among Mexican Americans with schizophrenia achieved its benefits by leveraging social influences through teaching family members how to support medication adherence in their ill relatives. PMID:26030760

  2. Mouse mammary tumor virus-like gene sequences are present in lung patient specimens

    PubMed Central

    2011-01-01

    Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV)-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18%) of the lung carcinomas and 1 out of 7 (14%) of acute inflamatory lung infiltrate specimens studied of a Mexican Population. PMID:21943279

  3. Explanatory Emotion Talk in Mexican Immigrant and Mexican American Families.

    ERIC Educational Resources Information Center

    Cervantes, Christi A.

    2002-01-01

    Mother-child conversations during story-telling play were analyzed for patterns of emotion talk. Subjects were 48 Mexican immigrant and Mexican American mothers and their children aged 3-4. Contrary to previous findings, Mexican immigrant mothers used more explanations of emotions than labels. Mexican American mothers used both, equally. Results…

  4. [Emergency and disaster response in critical care unit in the Mexican Social Security Institute: triage and evacuation].

    PubMed

    Echevarría-Zuno, Santiago; Cruz-Vega, Felipe; Elizondo-Argueta, Sandra; Martínez Valdés, Everardo; Franco-Bey, Rubén; Méndez-Sánchez, Luis Miguel

    2013-01-01

    Providing medical assistance in emergencies and disaster in advance makes the need to maintain Medical Units functional despite the disturbing phenomenon that confronts the community, but conflict occurs when the Medical Unit needs support and needs to be evacuated, especially when the evacuation of patients in a Critical Care Unit is required. In world literature there is little on this topic, and what is there usually focuses on the conversion of areas and increased ability to care for mass casualties, but not about how to evacuate if necessary, and when a wrong decision can have fatal consequences. That is why the Mexican Social Security Institute gave the task of examining these problems to a working group composed of specialists of the Institute. The purpose was to evaluate and establish a method for performing a protocol in the removal of patients and considering always to safeguard both staff and patients and maintain the quality of care.

  5. [Identification of components of metabolic syndrome in Mexican patients hospitalized for acute ischemic coronary syndrome: a tool for prevention].

    PubMed

    Cárdenas-Villarreal, V M; Vargas-Estrada, M; Hernández González, M A; Flores-Peña, Y; Cerda-Flores, R M

    2012-01-01

    To determine the prevalence of metabolic syndrome (MS) and its risk factors in patients with Acute Ischemic Coronary Syndrome (AICS) in a tertiary hospital. A total of 65 patients admitted to Cardiac Intensive Care Unit with myocardial infarction or unstable angina participated. MS was diagnosed in accordance to the Adult Treatment Panel III (ATPIII) criteria. The total prevalence of MS was 84.6% (95% CI: 75.6 to 93.6). MS was more frequent in women, persons with obesity according to the body mass index (BMI), family background diabetes, and dyslipidemia. Phenotype predictors of MS were: BMI (OR=2.12, 95% CI: 1.24, 3.17) and familiar history of dyslipidemia (OR=0.026, 95% CI: 0.003, 0.587). The prevalence of MS with AICS is higher than that reported in other populations. This fact is alarming if this risk is maintained in the Mexican population. Copyright © 2011 Elsevier España, S.L. y SEEIUC. All rights reserved.

  6. Perceived social stress, pregnancy-related anxiety, depression and subjective social status among pregnant Mexican and Mexican American women in south Texas.

    PubMed

    Fleuriet, K Jill; Sunil, T S

    2014-05-01

    The purpose of this study was to determine differences in subjective social status, perceived social stress, depressive symptoms, and pregnancy-related anxiety between pregnant Mexican American and Mexican immigrant women. Three hundred pregnant Mexican immigrant and Mexican American women in South Texas were surveyed for pregnancy-related anxiety, perceived social stress, depressive symptoms, and subjective social status. Pregnant Mexican immigrant women had higher levels of pregnancy-related anxiety and lower levels of depression and perceived social stress than pregnant Mexican American women. Change in these variables among Mexican immigrant women was relatively linear as time of residence in the United States increased. Mexican immigrant and Mexican American women had significantly different correlations between subjective social status, self-esteem and perceived social stress. Results indicate that subjective social status is an important psychosocial variable among pregnant Hispanic women. Results contribute to ongoing efforts to provide culturally responsive prenatal psychosocial support services.

  7. Mexico, Mexicans and Mexican Americans in Secondary-School United States History Textbooks.

    ERIC Educational Resources Information Center

    Salvucci, Linda K.

    1991-01-01

    Discusses coverage of Mexican history and Mexican Americans in 10 U.S. history textbooks approved for use in Texas. Criticizes the lack of complete information, ethnocentricity, and failure to present the Mexican point of view. Argues that U.S. history courses should cover topics of Mexican history, including Spanish colonialism, the Texas…

  8. Factors Affecting Career Decision Making of Mexican and Mexican-American Students.

    ERIC Educational Resources Information Center

    Newlon, Betty J.; Borboa, Roman

    The purpose of this research was to identify the self-reported factors affecting the career decision making of Mexican and Mexican-American students. It was hypothesized that the factor clusters would differ between the two sample populations, Mexican and Mexican-American. It was also hypothesized that these clusters would differ from six clusters…

  9. Legal Status and Wage Disparities for Mexican Immigrants.

    PubMed

    Hall, Matthew; Greenman, Emily; Farkas, George

    2010-12-01

    This paper employs a unique method of imputing the legal status of Mexican immigrants in the 1996-1999 and 2001-2003 panels of the Survey of Income and Program Participation to provide new evidence of the role of legal authorization in the U.S. on workers' wages. Using growth curve techniques, we estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants, U.S-born Mexican Americans, and native non-Latino whites. Our estimates reveal a 17 percent wage disparity between documented and undocumented Mexican immigrant men, and a 9 percent documented-undocumented wage disparity for Mexican immigrant women. We also find that in comparison to authorized Mexicans, undocumented Mexican immigrants have lower returns to human capital and slower wage growth.

  10. Legal Status and Wage Disparities for Mexican Immigrants

    PubMed Central

    Hall, Matthew; Greenman, Emily; Farkas, George

    2014-01-01

    This paper employs a unique method of imputing the legal status of Mexican immigrants in the 1996-1999 and 2001-2003 panels of the Survey of Income and Program Participation to provide new evidence of the role of legal authorization in the U.S. on workers’ wages. Using growth curve techniques, we estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants, U.S-born Mexican Americans, and native non-Latino whites. Our estimates reveal a 17 percent wage disparity between documented and undocumented Mexican immigrant men, and a 9 percent documented-undocumented wage disparity for Mexican immigrant women. We also find that in comparison to authorized Mexicans, undocumented Mexican immigrants have lower returns to human capital and slower wage growth. PMID:25414526

  11. A regional approach to health care reform: the Texas border.

    PubMed

    Rivera, Jose Luis Manzanares; Zuniga, Genny Carrillo

    2015-01-01

    The purpose of this article is to analyze health insurance disparities related to labor environment factors in the Texas-Mexico border region. A logistic regression model was performed using microdata from the 2010 American Community Survey to estimate the probability of having employer-based insurance, controlling labor environment factors such as hours worked, occupation industry, and the choice of private, nonprofit or public sector jobs. Industries primarily employing the Mexican American population are less likely to offer employer-based health insurance. These industries have the North American Industry Classification System (NAICS) code 770 construction, including cleaning, and NAICS code 8680, restaurants and other food services. Although it was found that working in public sector industries such as code 9470, administration of justice, public order, and safety, or NAICS code 7860, elementary and secondary schools, improved by 60% the probability of the Mexican American population having employer-based health insurance, these occupations ranked at the bottom of the main occupation list for Mexican Americans. These findings provide evidence that the labor environment plays an important role in understanding current health insurance access limitations within the Mexican American community under 2010 Patient Protection and Affordable Care Act provisions, which are directed to small business and lower-income individuals.

  12. Traditional beliefs and practices among Mexican American immigrants with type II diabetes: A case study.

    PubMed

    Lemley, Megan; Spies, Lori A

    2015-04-01

    To describe selected common health beliefs and practices among Mexican American immigrants with type II diabetes. Selected clinical trials, qualitative studies, and systematic reviews. The Hispanic folk illness belief susto refers to an episode of severe fright, and Mexican American immigrants hold varying views on its relation to diabetes. Culturally and in the research, susto has also been linked with depression. Sabila (aloe vera) and nopal (prickly pear cactus) are herbal remedies that have had widespread, longstanding use in Mexican culture and while this is not the gold standard of research, it does provide ample evidence and a strong cultural belief that these therapies work. There is some evidence in the literature to support their efficacy as glucose-lowering agents, but lack of Food and Drug Administration (FDA) regulation, potential side effects, and a dearth of rigorous clinical trials preclude aloe vera and nopal from being recommended therapy. Awareness about susto beliefs, commonly used herbal remedies, and development of culturally sensitive communication skills are essential for nurse practitioners to effectively assist patients in this population achieve their glycemic goals. Research on the effects of nopal and aloe vera on diabetes is needed to guide clinical decisions. ©2014 American Association of Nurse Practitioners.

  13. AIP mutations in young patients with acromegaly and the Tampico Giant: the Mexican experience.

    PubMed

    Ramírez-Rentería, Claudia; Hernández-Ramírez, Laura C; Portocarrero-Ortiz, Lesly; Vargas, Guadalupe; Melgar, Virgilio; Espinosa, Etual; Espinosa-de-Los-Monteros, Ana Laura; Sosa, Ernesto; González, Baldomero; Zúñiga, Sergio; Unterländer, Martina; Burger, Joachim; Stals, Karen; Bussell, Anne-Marie; Ellard, Sian; Dang, Mary; Iacovazzo, Donato; Kapur, Sonal; Gabrovska, Plamena; Radian, Serban; Roncaroli, Federico; Korbonits, Márta; Mercado, Moisés

    2016-08-01

    Although aryl hydrocarbon receptor-interacting protein (AIP) mutations are rare in sporadic acromegaly, their prevalence among young patients is nonnegligible. The objectives of this study were to evaluate the frequency of AIP mutations in a cohort of Mexican patients with acromegaly with disease onset before the age of 30 and to search for molecular abnormalities in the AIP gene in teeth obtained from the "Tampico Giant". Peripheral blood DNA from 71 patients with acromegaly (51 females) with disease onset <30 years was analysed (median age of disease onset of 23 years) and correlated with clinical, biochemical and imaging characteristics. Sequencing was also carried out in DNA extracted from teeth of the Tampico Giant. Five patients (7 %) harboured heterozygous, germline mutations of the AIP gene. In two of them (a 9-year-old girl with gigantism and a young man with symptoms of GH excess since age 14) the c.910C>T (p.Arg304Ter), well-known truncating mutation was identified; in one of these two cases and her identical twin sister, the mutation proved to be a de novo event, since neither of their parents were found to be carriers. In the remaining three patients, new mutations were identified: a frameshift mutation (c.976_977insC, p.Gly326AfsTer), an in-frame deletion (c.872_877del, p.Val291_Leu292del) and a nonsense mutation (c.868A > T, p.Lys290Ter), which are predicted to be pathogenic based on in silico analysis. Patients with AIP mutations tended to have an earlier onset of acromegaly and harboured larger and more invasive tumours. A previously described genetic variant of unknown significance (c.869C > T, p.Ala299Val) was identified in DNA from the Tampico Giant. The prevalence of AIP mutations in young Mexican patients with acromegaly is similar to that of European cohorts. Our results support the need for genetic evaluation of patients with early onset acromegaly.

  14. Symptoms and Etiological Attribution: A Cross-Sectional Study in Mexican Outpatients with Psychosis and Their Relatives

    PubMed Central

    Rodríguez-Hansen, Gisela

    2016-01-01

    This cross-sectional study aimed at identifying the most common attributions of their mental disorder in a Mexican patients who have experienced psychosis and their relatives and exploring how having experienced or not characteristic psychotic symptoms and their present clinical status might affect their etiological attributions. Past and current symptom profiles of 66 patients were as assessed with the SCID-I (Structured Clinical Interview for DSM-IV Axis I Disorders) and the PANSS (Positive and Negative Syndrome Scale), respectively. The etiological attribution of psychosis of patients (n = 62) and the relatives (n = 65) was assessed with the Angermeyer and Klusmann scale comprising 30 items into five categories: biology, personality, family, society, and esoteric. Patients and relatives attribute psychosis mainly to social factors. Relatives' attributions were not influenced by clinical profile of patients, whereas in the case of patients it was only current clinical status that showed a difference, with those in nonremission scoring higher personality and family factors. Acknowledging patients' and relatives' beliefs about mental disorders at onset and later on is particularly important in psychosis, a mental condition with severe and/or persistent symptoms, in order to promote better involvement in treatment and in consequence efficacy and recovery. PMID:27413550

  15. [Specialty care in the transformation process].

    PubMed

    Rodríguez Suárez, Romeo S; Mansilla Olivares, Armando; Díaz Jiménez, María Juana

    2012-01-01

    The scientific research goals developed and applied beyond their own frontiers, by the National Institutes of Health and High Specialty Hospitals, are presented regarding the specialized medical care of excellence on the field of global health, in benefice of the Mexican population. Maternal mortality as well as malnutrition, and the lack of micronutrients in the pregnant mother and child, put them in disadvantage to face future physical and mental diseases. Low weight at birth, prematurity, and overweight during childhood are factors that can trigger the the development of the metabolic syndrome, with all its consequences on physical and mental health. These challenges are faced with a preventive vision by means of pilot programs like "Towards a new generation of Mexicans" and "Chronic kidney disease stratification in high risk patients", besides the development of new strategies for the prevention and treatment of other chronic diseases such as cancer, hypertension, and diabetes among others by decreasing the number of overweight and obesity people in the Mexican population.

  16. Prevalence of Metabolic Syndrome Components in an Urban Mexican Sample: Comparison between Two Classifications

    PubMed Central

    Isordia-Salas, Irma; Santiago-Germán, David; Rodrìguez-Navarro, Helem; Almaráz-Delgado, Martín; Leaños-Miranda, Alfredo; Anaya-Gómez, Francisco; Borrayo-Sánchez, Gabriela; Majluf-Cruz, Abraham

    2012-01-01

    Background. The aim of this study was to examine the prevalence of metabolic syndrome (MS) components in an urban Mexican sample. Methods. A total of 854 subjects were included. Anthropometric, blood pressure measurements, clinical data, and overnight fasting blood samples were obtained from all subjects. Results. In accordance with definitions by the American Heart Association/ National Heart, Lung, and Blood Institute (AHA/NHLBI) and the International Diabetes Federation (IDF), the prevalence of MS among participants was 59.7 and 68.7%, respectively. The prevalence of MS was higher in women and in individuals older than 45 years of age. More than 40% of the subjects fulfilled four criterions of MS according to both definitions. Conclusions. There was a high prevalence of MS components in an urban Mexican sample. Therefore, strong strategies had to be developed for early detection of MS and its components to prevent DMT2 and atherothrombotic complications in these patients. PMID:22203834

  17. Current state of biosimilars in Mexico: The position of the Mexican College of Rheumatology, 2016.

    PubMed

    Xibille, Daniel; Carrillo, Sandra; Huerta-Sil, Gabriela; Hernández, Ramiro; Limón, Leonardo; Olvera-Soto, Guadalupe; Jara-Quezada, Luis Javier; Esquivel, Abdieel; Pérez-Rodríguez, Marcela

    The present document is a position statement of the Mexican College of Rheumatology on the use of biosimilars in rheumatic diseases. This position considers that biosimilars should be considered as interchangeable, that automatic substitution without previous notice in stable patients during follow-up is not ethical, that the approval of a biosimilar should only be given after exhaustive review of preclinical and clinical data marked by Mexican regulations, that it should be clearly stated in the nomenclature of biologic drugs which is the innovator and which is the biosimilar, that it is not correct to choose a biosimilar as treatment based only on economic reasons or extrapolate indications based only on the approval of the innovator and in the absence of safety and efficacy data for the biosimilar. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  18. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    PubMed

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  19. Mast cells in the human lung at high altitude

    NASA Astrophysics Data System (ADS)

    Heath, Donald

    1992-12-01

    Mast cell densities in the lung were measured in five native highlanders of La Paz (3600 m) and in one lowlander dying from high-altitude pulmonary oedema (HAPO) at 3440 m. Two of the highlanders were mestizos with normal pulmonary arteries and the others were Aymara Indians with muscular remodelling of their pulmonary vasculature. The aim of the investigation was to determine if accumulation of mast cells in the lung at high altitude (HA) is related to alveolar hypoxia alone, to a combination of hypoxia and muscularization of the pulmonary arterial tree, or to oedema of the lung. The lungs of four lowlanders were used as normoxic controls. The results showed that the mast cell density of the two Mestizos was in the normal range of lowlanders (0.6-8.8 cells/mm2). In the Aymara Indians the mast cell counts were raised (25.6-26.0 cells/mm2). In the lowlander dying from HAPO the mast cell count was greatly raised to 70.1 cells/mm2 lung tissue. The results show that in native highlanders an accumulation of mast cells in the lung is not related to hypoxia alone but to a combination of hypoxia and muscular remodelling of the pulmonary arteries. However, the most potent cause of increased mast cell density in the lung at high altitude appears to be high-altitude pulmonary oedema.

  20. Factor structure of the Spanish version of the Patient Health Questionnaire-9 in Mexican women.

    PubMed

    Familiar, Itziar; Ortiz-Panozo, Eduardo; Hall, Brian; Vieitez, Isabel; Romieu, Isabelle; Lopez-Ridaura, Ruy; Lajous, Martin

    2015-03-01

    Structure of the Spanish version of the nine-item Patient Health Questionnaire (PHQ-9) has been inconclusive. We report the factor structure of the PHQ-9 in 55,555 women from the Mexican Teachers' Cohort (MTC). Factor structure of the PHQ-9 was assessed by exploratory and confirmatory factor analyses in two sub-samples (n = 27,778 and 27,777 respectively). A one-factor model of the PHQ-9 was the solution with the best fit to the data, exhibiting strong factor loadings (0.71 to 0.90) and high internal consistency (Cronbach's alpha = 0.89). A prevalence rate of moderate to high severity of depressive symptoms of 12.6% was identified. Results suggest that a global score is an appropriate measure of depressive symptoms and commend the use of the Spanish PHQ-9 as a measure of depression for research and clinical purposes. Copyright © 2014 John Wiley & Sons, Ltd.

  1. The Evolution of the Mexican Military: From the Mexican Revolution In 1910 to 2014

    DTIC Science & Technology

    2015-03-01

    government, the Mexican army’s track record and SEDENA’s laissez - faire approach demonstrate that the sheltering of the military, which was...Changes to the Modern Military’s Leadership and Structure ......41 D. THE MEXICAN MILITARY AND THE HUMAN RIGHTS VIOLATIONS... leadership and structure of the contemporary Mexican military was directly shaped by the events and actions of the Mexican Revolution. Through the research

  2. Higher risk for obesity among Mexican-American and Mexican immigrant children and adolescents than among peers in Mexico.

    PubMed

    Hernández-Valero, María A; Bustamante-Montes, L Patricia; Hernández, Mike; Halley-Castillo, Elizabeth; Wilkinson, Anna V; Bondy, Melissa L; Olvera, Norma

    2012-08-01

    We conducted a cross-sectional study among 1,717 children and adolescents of Mexican origin ages 5-19 years living in Mexico and Texas to explore the influence of country of birth and country of longest residence on their overweight and obesity status. Descriptive statistics were used to compare demographic and anthropometric characteristics of participants born and raised in Mexico (Mexicans), born in Mexico and raised in the United States (Mexican immigrants), and born and raised in the United States (Mexican-Americans). Univariate and multivariate nominal logistic regression was used to determine the demographic predictors of obesity adjusted by country of birth, country of residence, age, and gender. Almost half (48.8%) of the Mexican-Americans and 43.2% of the Mexican immigrants had body mass index at the 85th percentile or above, compared to only 29.3% of the Mexicans (P < .001). Thus, Mexican-Americans and Mexican immigrants were more likely to be obese than their Mexican peers [Mexican-Americans: odds ratio (OR) = 2.5 (95% confidence interval [CI] 1.8-3.4); Mexican immigrants: OR = 2.2 (95% CI 1.6-3.0)]. In addition, males were more likely than females to be obese [OR = 1.6 (95% CI 1.2-2.1)], and adolescents 15-19 years of age were less likely than their younger counterparts [OR = 0.5 (95% CI 0.4-0.7)] to be obese. The high prevalence of obesity among children of Mexican origin in the United States is of great concern and underscores the urgent need to develop and implement obesity preventive interventions targeting younger children of Mexican origin, especially newly arrived immigrant children. In addition, future obesity research should take into consideration the country of origin of the study population to develop more culturally specific obesity interventions.

  3. Subjective Social Status, Mental and Psychosocial Health, and Birth Weight Differences in Mexican-American and Mexican Immigrant Women.

    PubMed

    Fleuriet, K Jill; Sunil, T S

    2015-12-01

    Recent Mexican immigrant women on average have an unexpectedly low incidence of low birth weight (LBW). Birth weights decline and LBW incidence increases in post-immigrant generations. This pilot project tested the hypothesis that subjective social status (SSS) of pregnant women predicts variation in birth weight between Mexican immigrant and Mexican-American women. 300 low-income pregnant Mexican immigrant and Mexican-American women in South Texas were surveyed for SSS, depression, pregnancy-related anxiety, perceived social stress and self-esteem and subsequent birth weight. No significant difference in SSS levels between pregnant Mexican immigrant and Mexican-American women were found. However, SSS better predicted variation in birth weight across both groups than mental and psychosocial health variables. Results suggest distinct relationships among SSS, mental and psychosocial health that could impact birth weight. They underscore the relevance of a multilevel, biopsychosocial analytical framework to studying LBW.

  4. Nativity and nutritional behaviors in the Mexican origin population living in the US-Mexico border region.

    PubMed

    Montoya, Jared A; Salinas, Jennifer J; Barroso, Cristina S; Mitchell-Bennett, Lisa; Reininger, Belinda

    2011-02-01

    The purpose of this study is to determine the relationship between nativity and nutritional behaviors and beliefs in the Mexican American population living in the South Texas border region. Mexican Americans living the border region of South Texas were sampled to assess their nutrition behaviors and beliefs. Nativity was measured as whether subjects were born in the United States or Mexico. Nutritional behaviors were measured using the SPAN and indexes were used to measure barriers to good nutrition, dietary self-efficacy, and dietary importance. OLS regression analysis was used and adjustments were made for sociodemographic factors. Differences between US-born Mexican Americans and Mexico-born Mexican Americans existed in nutritional beliefs, but not in behaviors. Mexico-born Mexican Americans reported their dietary choices as more important and reported greater food self-efficacy than their US-born Mexican American counterparts. Socioeconomic status influenced US-born Mexican Americans nutritional beliefs only and the same effect was not observed for Mexico-born Mexican Americans. Despite low levels of overall acculturation in the border region dietary beliefs still exist between immigrants and US-born Mexican Americans in dietary beliefs, but, not behaviors in US-born Mexican Americans.

  5. Substance use disorder comorbidity with schizophrenia in families of Mexican and Central American Ancestry

    PubMed Central

    Jiménez-Castro, Lorena; Hare, Elizabeth; Medina, Rolando; Raventos, Henriette; Nicolini, Humberto; Mendoza, Ricardo; Ontiveros, Alfonso; Jerez, Alvaro; Muñoz, Rodrigo; Dassori, Albana; Escamilla, Michael

    2010-01-01

    Objectives The aims of this study were to estimate the frequency and course of substances use disorders in Latino patients with schizophrenia and to ascertain risk factors associated with substance use disorders in this population. Method We studied 518 subjects with schizophrenia recruited for a genetic study from the Southwest United States, Mexico, and Central America (Costa Rica and Guatemala). Subjects were assessed using structured interviews and a best estimate consensus process. Logistic regression, χ2, t- test, Fisher’s exact test, and Yates’ correction, as appropriate, were performed to assess the sociodemographic variables associated with dual diagnosis. We defined substance use disorder as either alcohol or substance abuse or dependence. Results Out of 518 patients with schizophrenia, 121 (23.4%) had substance use disorders. Comorbid substance use disorders were associated with male gender, residence in the United States, immigration of Mexican men to the United State, history of depressive syndrome or episode, and being unemployed. The most frequent substance use disorder was alcohol abuse/dependence, followed by marijuana abuse/dependence, and solvent abuse/dependence. Conclusion This study provides data suggesting that depressive episode or syndrome, unemployment, male gender, and immigration of Mexican men to the United States were factors associated with substance use disorder comorbidity in schizophrenia. Binary logistic regression showed that country of residence was associated with substance use disorder in schizophrenic patients. The percentage of subjects with comorbid substance use disorders was higher in the Latinos living in the United States compared with subjects living in Central America and Mexico. PMID:20303714

  6. Association of polymorphisms of genes involved in lipid metabolism with blood pressure and lipid values in mexican hypertensive individuals.

    PubMed

    Ríos-González, Blanca Estela; Ibarra-Cortés, Bertha; Ramírez-López, Guadalupe; Sánchez-Corona, José; Magaña-Torres, María Teresa

    2014-01-01

    Hypertension and dyslipidemia exhibit an important clinical relationship because an increase in blood lipids yields an increase in blood pressure (BP). We analyzed the associations of seven polymorphisms of genes involved in lipid metabolism (APOA5 rs3135506, APOB rs1042031, FABP2 rs1799883, LDLR rs5925, LIPC rs1800588, LPL rs328, and MTTP rs1800591) with blood pressure and lipid values in Mexican hypertensive (HT) patients. A total of 160 HT patients and 160 normotensive individuals were included. Genotyping was performed through PCR-RFLP, PCR-AIRS, and sequencing. The results showed significant associations in the HT group and HT subgroups classified as normolipemic and hyperlipemic. The alleles FABP2 p.55T, LIPC -514T, and MTTP -493T were associated with elevated systolic BP. Five alleles were associated with lipids. LPL p.474X and FABP2 p.55T were associated with decreased total cholesterol and LDL-C, respectively; APOA5 p.19W with increased HDL-C; APOA5 p.19W and FABP2 p.55T with increased triglycerides; and APOB p.4181K and LDLR c.1959T with decreased triglycerides. The APOB p.E4181K polymorphism increases the risk for HT (OR = 1.85, 95% CI: 1.17-2.93; P = 0.001) under the dominant model. These findings indicate that polymorphisms of lipid metabolism genes modify systolic BP and lipid levels and may be important in the development of essential hypertension and dyslipidemia in Mexican HT patients.

  7. Association of Polymorphisms of Genes Involved in Lipid Metabolism with Blood Pressure and Lipid Values in Mexican Hypertensive Individuals

    PubMed Central

    Ríos-González, Blanca Estela; Ibarra-Cortés, Bertha; Ramírez-López, Guadalupe; Sánchez-Corona, José; Magaña-Torres, María Teresa

    2014-01-01

    Hypertension and dyslipidemia exhibit an important clinical relationship because an increase in blood lipids yields an increase in blood pressure (BP). We analyzed the associations of seven polymorphisms of genes involved in lipid metabolism (APOA5 rs3135506, APOB rs1042031, FABP2 rs1799883, LDLR rs5925, LIPC rs1800588, LPL rs328, and MTTP rs1800591) with blood pressure and lipid values in Mexican hypertensive (HT) patients. A total of 160 HT patients and 160 normotensive individuals were included. Genotyping was performed through PCR-RFLP, PCR-AIRS, and sequencing. The results showed significant associations in the HT group and HT subgroups classified as normolipemic and hyperlipemic. The alleles FABP2 p.55T, LIPC −514T, and MTTP −493T were associated with elevated systolic BP. Five alleles were associated with lipids. LPL p.474X and FABP2 p.55T were associated with decreased total cholesterol and LDL-C, respectively; APOA5 p.19W with increased HDL-C; APOA5 p.19W and FABP2 p.55T with increased triglycerides; and APOB p.4181K and LDLR c.1959T with decreased triglycerides. The APOB p.E4181K polymorphism increases the risk for HT (OR = 1.85, 95% CI: 1.17–2.93; P = 0.001) under the dominant model. These findings indicate that polymorphisms of lipid metabolism genes modify systolic BP and lipid levels and may be important in the development of essential hypertension and dyslipidemia in Mexican HT patients. PMID:25587205

  8. The relationship between functional capacity and community responsibilities in middle-aged and older Latinos of Mexican origin with chronic psychosis.

    PubMed

    Cardenas, Veronica; Mausbach, Brent T; Barrio, Concepcion; Bucardo, Jesus; Jeste, Dilip; Patterson, Thomas

    2008-01-01

    The purpose of this study was to examine the relationship between scores on the UCSD Performance-based Skills Assessment (UPSA), a performance-based measure of functional capacity, and level of patient community responsibilities (i.e., work for pay; volunteer work; attend school; household duties) in a Latino sample. Participants were 58 middle-aged and older Latinos of Mexican origin (mean age=48.8 years) with a diagnosis of schizophrenia or schizoaffective disorder. We conducted an analysis of covariance (ANCOVA), controlling for age, symptoms of psychosis, and participant language, to determine if greater participation in community responsibilities was associated with higher functional capacity, as measured by the UPSA. Results indicated significant group differences in UPSA scores (F=5.11, df=2, 51; p=.009), with patients reporting only a single community responsibility having significantly higher UPSA scores than those reporting zero community responsibilities (p=.016) and those reporting two responsibilities scoring significantly higher than those reporting zero community responsibility (p=.008). There were no differences found between those reporting one and those reporting two community responsibilities (p=.256). In contrast, no group differences were observed on the Dementia Rating Scale, a global measure of cognitive functioning (F=2.14, df=2, 51; p=.128). These results provide initial support for the validity of the UPSA in Latino patients of Mexican origin, and suggest that improvement in functional capacity (i.e., UPSA scores) may be associated with increased capacity for greater community involvement in this population.

  9. The Relationship between Functional Capacity and Community Responsibilities in Middle-aged and Older Latinos of Mexican Origin with Chronic Psychosis

    PubMed Central

    Cardenas, Veronica; Mausbach, Brent T.; Barrio, Concepcion; Bucardo, Jesus; Jeste, Dilip; Patterson, Thomas

    2008-01-01

    The purpose of this study was to examine the relationship between scores on the UCSD Performance-based Skills Assessment (UPSA), a performance-based measure of functional capacity, and level of patient community responsibilities (i.e., work for pay; volunteer work; attend school; household duties) in a Latino sample. Participants were 58 middle-aged and older Latinos of Mexican origin (mean age = 48.8 years) with a diagnosis of schizophrenia or schizoaffective disorder. We conducted an analysis of covariance (ANCOVA), controlling for age, symptoms of psychosis, and participant language, to determine if greater participation in community responsibilities was associated with higher functional capacity, as measured by the UPSA. Results indicated significant group differences in UPSA scores (F = 5.11, df = 2,51; p = .009), with patients reporting only a single community responsibility having significantly higher UPSA scores than those reporting zero community responsibilities (p = .016) and those reporting two responsibilities scoring significantly higher than those reporting zero community responsibility (p = .008). There were no differences found between those reporting one and those reporting two community responsibilities (p= .256). In contrast, no group differences were observed on the Dementia Rating Scale, a global measure of cognitive functioning (F = 2.14, df = 2,51; p = .128). These results provide initial support for the validity of the UPSA in Latino patients of Mexican origin, and suggest that improvement in functional capacity (i.e., UPSA scores) may be associated with increased capacity for greater community involvement in this population. PMID:17936585

  10. Bell's palsy. A prospective, longitudinal, descriptive, and observational analysis of prognosis factors for recovery in Mexican patients.

    PubMed

    Sánchez-Chapul, Laura; Reyes-Cadena, Susana; Andrade-Cabrera, José Luis; Carrillo-Soto, Irma A; León-Hernández, Saúl R; Paniagua-Pérez, Rogelio; Olivera-Díaz, Hiram; Baños-Mendoza, Teresa; Flores-Mondragón, Gabriela; Hernández-Campos, Norma A

    2011-01-01

    To determine the prognosis factors in Mexican patients with Bell's palsy. We designed a prospective, longitudinal, descriptive, and observational analysis. Two hundred and fifty one patients diagnosed with Bell's palsy at the National Institute of Rehabilitation were included. We studied the sociodemographic characteristics, seasonal occurrence, sidedness, symptoms, and therapeutic options to determine the prognostic factors for their recovery. Thirty-nine percent of patients had a complete recovery and 41.5% had an incomplete recovery. Marital status, gender, etiology, symptoms, sidedness, House-Brackmann grade, and treatments did not represent significant prognostic factors for recovery. Age > 40 years (OR = 2.4, IC 95% 1.3-4.3, p = 0.002) and lack of physical therapy (OR = 6.4, IC 95% 1.4-29.6, p = 0.006) were significant prognostic factors for incomplete recovery. Familial palsy resulted to be a protective prognostic factor against an incomplete recovery (OR = 0.54, IC 95% 0.28-1.01, p = 0.039). This protection factor was only significant in female patients (OR = 0.41, p = 0.22) but not in male patients (OR = 1.0, p = 0.61). The proportion of cases with incomplete recovery was high. The age > 40 years and lack of physical therapy were the only significant prognostic factors for an incomplete recovery.

  11. The molecular adsorbent recirculating system as a liver support system: summary of Mexican experience.

    PubMed

    Cisneros-Garza, Laura Esthela; Muñoz-Ramírez, Ma del Rosario; Muñoz-Espinoza, Linda Elsa; Ruiz Velasco, José Antonio Velarde; Moreno-Alcántar, Rosalba; Marín-López, Eduardo; Méndez-Sánchez, Nahum

    2014-01-01

    The aim of this study was to assess the effects of the molecular absorbent recirculating system (MARS) on patients with acute liver failure (ALF) and liver failure with cirrhosis (AoCLF) as well as in cholestatic patients with intractable pruritus in a Mexican population. From August 2003 to December 2011, MARS was used in 38 patients with ALF, 15 patients with AoCLF, and 17 cholestatic patients with intractable pruritus. The patients were examined using a standard liver function test and for vital signs, presence of ascites and encephalopathy before and after each treatment. The therapeutic response, patient status, follow-up status, and need for liver transplantation were determined. Seventy-nine MARS procedures were performed. MARS was used for ALF in 54.3% of patients, AoCLF in 24.2%, and cholestatic disease in 21.5%. There were significant improvements in serum bilirubin (p = 0.000), aspartate aminotransferase (p = 0.000), alanine aminotransferase (p = 0.030), gamma-glytamyl transpeptidase (p = 0.044), alkaline phosphatase (p = 0.006), and encephalopathy grade (p = 0.000). Thirty-eight ALF patients were listed for emergency liver transplantation and treated with MARS; 20 of these patients died on a waiting list, 18 survived. only four underwent liver transplantation and 14 (37%) recovered without transplantation after the MARS procedure. MARS is a safe and effective procedure, especially for ALF patients. Our results suggest that MARS therapy can contribute to native liver recovery in ALF patients.

  12. Correction to: Health-Related Information-Seeking Behaviors and Preferences Among Mexican Patients with Cancer.

    PubMed

    Soto-Perez-de-Celis, Enrique; Perez-Montessoro, Viridiana; Rojo-Castillo, Patricia; Chavarri-Guerra, Yanin

    2018-06-01

    The original version of this article unfortunately contained a mistake. The name of "Viridiana Perez-Montessoro" is now corrected in the author group of this article. The original article has been corrected.

  13. Draft Genome Sequence of Aeromonas caviae Strain 429865 INP, Isolated from a Mexican Patient

    PubMed Central

    Padilla, Juan Carlos A.; Bustos, Patricia; Sánchez-Varela, Alejandro; Palma-Martinez, Ingrid; Arzate-Barbosa, Patricia; García-Pérez, Carlos A.; López-López, María de Jesús; González, Víctor

    2015-01-01

    Aeromonas caviae is an emerging human pathogen. Here, we report the draft genome sequence of Aeromonas caviae strain 429865 INP which shows the presence of various putative virulence-related genes. PMID:26494682

  14. Molecular analysis of the PAX6 gene in Mexican patients with congenital aniridia: report of four novel mutations

    PubMed Central

    Villarroel, Camilo E.; Villanueva-Mendoza, Cristina; Orozco, Lorena; Alcántara-Ortigoza, Miguel Angel; Jiménez, Diana F.; Ordaz, Juan C.

    2008-01-01

    Purpose Paired box gene 6 (PAX6) heterozygous mutations are well known to cause congenital non-syndromic aniridia. These mutations produce primarily protein truncations and have been identified in approximately 40%–80% of all aniridia cases worldwide. In Mexico, there is only one previous report describing three intragenic deletions in five cases. In this study, we further analyze PAX6 variants in a group of Mexican aniridia patients and describe associated ocular findings. Methods We evaluated 30 nonrelated probands from two referral hospitals. Mutations were detected by single-strand conformation polymorphism (SSCP) and direct sequencing, and novel missense mutations and intronic changes were analyzed by in silico analysis. One intronic variation (IVS2+9G>A), which in silico analysis suggested had no pathological effects, was searched in 103 unaffected controls. Results Almost all cases exhibited phenotypes that were at the severe end of the aniridia spectrum with associated ocular alterations such as nystagmus, macular hypoplasia, and congenital cataracts. The mutation detection rate was 30%. Eight different mutations were identified: four (c.184_188dupGAGAC, c.361T>C, c.879dupC, and c.277G>A) were novel, and four (c.969C>T, IVS6+1G>C, c.853delC, and IVS7–2A>G) have been previously reported. The substitution at position 969 was observed in two patients. None of the intragenic deletions previously reported in Mexican patients were found. Most of the mutations detected predict either truncation of the PAX6 protein or conservative amino acid changes in the paired domain. We also detected two intronic non-pathogenic variations, IVS9–12C>T and IVS2+9G>A, that had been previously reported. Because the latter variation was considered potentially pathogenic, it was analyzed in 103 healthy Mexican newborns where we found an allelic frequency of 0.1116 for the A allele. Conclusions This study adds four novel mutations to the worldwide PAX6 mutational spectrum, and reaffirms the finding that c.969C>T is one of the three more frequent causal mutations in aniridia cases. It also provides evidence that IVS2+9G>A is an intronic change without pathogenic effect. PMID:18776953

  15. Cost-Effectiveness of Canagliflozin versus Sitagliptin as Add-on to Metformin in Patients with Type 2 Diabetes Mellitus in Mexico.

    PubMed

    Neslusan, Cheryl; Teschemaker, Anna; Johansen, Pierre; Willis, Michael; Valencia-Mendoza, Atanacio; Puig, Andrea

    2015-12-01

    To assess the cost-effectiveness of canagliflozin versus sitagliptin for the treatment of type 2 diabetes mellitus (T2DM) as an add-on to metformin in Mexico. A validated model (Economic and Health Outcomes [ECHO]-T2DM) was used to estimate the cost-effectiveness of canagliflozin 300 or 100 mg versus sitagliptin 100 mg in patients with T2DM inadequately controlled on metformin monotherapy. Data from a head-to-head, phase III clinical trial, including patients' baseline demographic characteristics, biomarker values, and treatment effects, were used to simulate outcomes and resource use over 20 years from the perspective of the Mexican health care system. Costs of complications and adverse events were tailored to the Mexican setting and discounted at 5%. Cost-effectiveness was assessed using willingness-to-pay thresholds equivalent to 1 times the gross domestic product per capita (locally perceived to be "very cost-effective") and 3 times the gross domestic product per capita (locally perceived to be "cost-effective") on the basis of recommendations of the Mexican government and the World Health Organization. Owing primarily to better glycated hemoglobin (HbA 1c ), body weight, and systolic blood pressure values, canagliflozin 300 and 100 mg were associated with an incremental benefit of 0.16 and 0.06 quality-adjusted life-years (QALYs) versus sitagliptin 100 mg, respectively, over 20 years. The mean differences in cost for canagliflozin 300 and 100 mg versus sitagliptin 100 mg were Mexican pesos (MXP) 1797 (US $134) and MXP 7262 (US $540), respectively, resulting in a cost per QALY gained of MXP 11,210 (US $834) and MXP 128,883 (US $9590), respectively. Both of these cost-effectiveness ratios are below the very cost-effective willingness-to-pay threshold in Mexico. The general finding that canagliflozin is cost-effective versus sitagliptin in Mexico was supported by sensitivity analyses. In Mexico, both doses of canagliflozin are likely to be cost-effective versus sitagliptin in patients with T2DM who have inadequate glucose control on metformin, primarily because of better biomarker control and higher QALYs. Copyright © 2015 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  16. Stepwise strategies to successfully recruit diabetes patients in a large research study in Mexican population.

    PubMed

    Wacher, Niels H; Reyes-Sánchez, Mario; Vargas-Sánchez, Héctor Raúl; Gamiochipi-Cano, Mireya; Rascón-Pacheco, Ramón Alberto; Gómez-Díaz, Rita A; Doubova, Svetlana V; Valladares-Salgado, Adán; Sánchez-Becerra, Martha Catalina; Méndez-Padrón, Araceli; Valdez-González, Leticia A; Mondragón-González, Rafael; Cruz, Miguel; Salinas-Martinez, Ana María; Garza-Sagástegui, María Guadalupe; Hernández-Rubí, Jaime; González-Hermosillo, Arturo; Borja-Aburto, Víctor H

    2017-06-01

    Describe stepwise strategies (electronic chart review, patient preselection, call-center, personnel dedicated to recruitment) for the successful recruitment of >5000 type 2 diabetes patients in four months. Twenty-five family medicine clinics from Mexico City and the State of Mexico participated: 13 usual care, 6 specialized diabetes care and 6 chronic disease care. Appointments were scheduled from 11/3/2015 to 3/31/2016. Phone calls were generated automatically from an electronic database. A telephone questionnaire verified inclusion criteria, and scheduled an appointment, with a daily report of appointments, patient attendance, acceptance rate, and questionnaire completeness. Another recruitment log reviewed samples collected. Absolute number (percentage) of patients are reported. Means and standard deviations were estimated for continuous variables, χ 2 test and independent "t" tests were used. OR and 95% CI were estimated. 14,358 appointments were scheduled, 9146 (63.7%) attended their appointment: 5710 (62.4%) fulfilled inclusion criteria and 5244 agreed to participate (91.8% acceptance). Those accepting participation were more likely women, younger and with longer disease duration (p<0.05). The cost of the call-center service was $3,010,000.00 Mexican pesos (∼$31.70 USD per recruited patient). Stepwise strategies recruit a high number of patients in a short time. Call centers offer a low cost per patient. Copyright © 2017 Primary Care Diabetes Europe. Published by Elsevier Ltd. All rights reserved.

  17. Prevalence and factors associated with the presence of abnormal function liver tests in patients with ulcerative colitis.

    PubMed

    Yamamoto-Furusho, Jesús K; Sánchez-Osorio, Magdalena; Uribe, Misael

    2010-01-01

    To investigate the prevalence of abnormal function liver tests and risk factors associated with their development in Mexican patients with UC. A total of 200 patients with confirmed diagnosis of UC were evaluated prospectively during a one year period from January 1, 2007 to December 31, 2008. A total of 94 females and 106 males patients with UC were analyzed. The age at diagnosis was 31.4 ± 13.2 years and the mean of disease duration was 6.7 ± 5.2 years. We found a high prevalence of abnormal function livers tests in 40% of UC patients. The pattern of abnormal function liver test was hepatitis in 70%, cholestatic (20%) and mixed (10%). The most common cause of abnormal function liver test was transient elevation in 50 patients (63%) followed by fatty liver disease (11.2%), primary sclerosing cholangitis (6.3%), drug-toxicity (6%) and others (13.5%) including chronic hepatitis C, total parenteral nutrition, granulomatous and ischemic hepatitis. In the multivariate logistic regression model, active disease, colectomy and abdominal sepsis were factors that persisted associated with the development of abnormal liver tests in UC patients. A high prevalence of abnormal function liver tests (40%) was found in Mexican UC patients is likely to be related to active disease, colectomy and the presence of sepsis.

  18. Undocumented Migration and the Residential Segregation of Mexicans in New Destinations1

    PubMed Central

    Hall, Matthew; Stringfield, Jonathan

    2014-01-01

    This study uses data from the 2000 Census and 2005–2009 American Community Survey to examine the impact of undocumented Mexican migration to new destinations on residential segregation between Mexican immigrants and native-born whites and native-born blacks. We find that Mexican-white and Mexican-black segregation is higher in new Mexican gateways than in established areas and that, for Mexican-immigrant segregation from whites, this heightened level of residential segregation in new destinations can be explained by the high presence of unauthorized Mexican immigrants living there which tends to bolster segregation between the two groups. By contrast, Mexican-immigrant segregation from native-born blacks tends to be lower in areas with larger undocumented populations, a pattern that is especially true in new destinations. Neither of these opposing effects of legal status on Mexican-immigrant segregation can be explained by compositional differences in assimilation (English ability and earnings) between documented and undocumented immigrants nor by structural variation in metropolitan areas, suggesting a unique association between legal status and segregation. PMID:24913945

  19. The ability of multifamily groups to improve treatment adherence in Mexican Americans with schizophrenia.

    PubMed

    Kopelowicz, Alex; Zarate, Roberto; Wallace, Charles J; Liberman, Robert Paul; Lopez, Steven R; Mintz, Jim

    2012-03-01

    Evidence-based interventions to improve medication adherence among patients with schizophrenia are lacking. Although family psychoeducation has demonstrated efficacy in improving outcomes in schizophrenia, empirical support for its ability to enhance medication adherence is scarce. To determine whether a culturally adapted, multifamily group (MFG) therapy would increase medication adherence and decrease psychiatric hospitalizations for Spanish-speaking Mexican Americans with schizophrenia. A total of 174 Mexican American adults with schizophrenia-spectrum disorder and their key relatives were studied in a 3-armed, randomized controlled trial of MFG therapy focused on improving medication adherence. Assessments occurred at baseline and at 4, 8, 12, 18, and 24 months. Two community mental health centers in Los Angeles, California. Patients had a diagnosis of schizophrenia or schizoaffective disorder with a recent exacerbation of psychotic symptoms and nonadherence to medication before enrollment. Intervention  Patients participated in 1 of 2 MFGs (MFG-adherence or MFG-standard) or treatment as usual. Groups convened twice monthly in 90-minute sessions for 1 year. The Treatment Compliance Interview uses multiple sources of information to quantify medication adherence. Computerized records were used to collect information on the use of inpatient resources. At the end of the 1-year treatment, MFG-adherence was associated with higher medication adherence than MFG-standard or treatment as usual only (F = 6.41; P = .003). The MFG-adherence participants had a longer time to first hospitalization (χ(2) = 13.3; P = .001) and were less likely to be hospitalized than those in MFG-standard (χ(2) = 8.2; P = .04) and treatment as usual alone (χ(2) = 11.3; P < .001). Increased adherence accounted for one-third of the overall effect of treatment on the reduced risk for psychiatric hospitalization. Multifamily group therapy specifically tailored to improve medication adherence through a focus on the beliefs and attitudes of the target population is associated with improved outcome for Mexican American adults with schizophrenia-spectrum disorders. Trial Registration  clinicaltrials.gov Identifier: NCT01125267.

  20. Polymorphisms rs12998 and rs5780218 in KiSS1 suppressor metastasis gene in Mexican patients with breast cancer.

    PubMed

    Quevedo, Edhit Guadalupe Cruz; Aguilar, Gabriela Monserrat Mimendi; Aguilar, Luis Anselmo Juárez; Rubio, Susan Andrea Gutierrez; Martínez, Silvia Esperanza Flores; Rodríguez, Ingrid Patricia Dávalos; Corona, José Sánchez; Morán, Martha Isabel Torres; Gómez, Roberto Carlos Rosales; Moguel, María Cristina Morán

    2015-01-01

    KiSS1 is a metastasis suppressor gene associated with inhibition of cellular chemotaxis and invasion attenuating the metastasis in melanoma and breast cancer cell lines. Along the KiSS-1 gene at least 294 SNPs have been described; however the association of these polymorphisms as genetic markers for metastasis in breast cancer studies has not been investigated. Here we describe two simple PCR-RFLPs protocols to identify the rs5780218 (9DelT) and the rs12998 (E20K) KiSS1 polymorphisms and the allelic, genotypic, and haplotypic frequencies in Mexican general population (GP) and patients with benign breast disease (BBD) or breast cancer (BC). The rs5780218 polymorphism was individually associated with breast cancer (P = 0.0332) and the rs12998 polymorphism shows statistically significant differences when GP versus case (BC and BBD) groups were compared (P < 0.0001). The H1 Haplotype (G/-) occurred more frequently in BC group (0.4256) whereas H2 haplotype (G/T) was the most prevalent in BBD group (0.4674). Our data indicated that the rs5780218 polymorphism individually confers susceptibility for development of breast cancer in Mexican population and a possible role as a genetic marker in breast cancer metastasis for H1 haplotype (Wt/variant) in KiSS1 gene must be analyzed in other populations.

  1. When Health Systems Are Barriers to Health Care: Challenges Faced by Uninsured Mexican Kidney Patients

    PubMed Central

    Kierans, Ciara; Padilla-Altamira, Cesar; Garcia-Garcia, Guillermo; Ibarra-Hernandez, Margarita; Mercado, Francisco J.

    2013-01-01

    Background Chronic Kidney Disease disproportionately affects the poor in Low and Middle Income Countries (LMICs). Mexico exemplifies the difficulties faced in supporting Renal Replacement Therapy (RRT) and providing equitable patient care, despite recent attempts at health reform. The objective of this study is to document the challenges faced by uninsured, poor Mexican families when attempting to access RRT. Methods The article takes an ethnographic approach, using interviewing and observation to generate detailed accounts of the problems that accompany attempts to secure care. The study, based in the state of Jalisco, comprised interviews with patients, their caregivers, health and social care professionals, among others. Observations were carried out in both clinical and social settings. Results In the absence of organised health information and stable pathways to renal care, patients and their families work extraordinarily hard and at great expense to secure care in a mixed public-private healthcare system. As part of this work, they must navigate challenging health and social care environments, negotiate treatments and costs, resource and finance healthcare and manage a wide range of formal and informal health information. Conclusions Examining commonalities across pathways to adequate healthcare reveals major failings in the Mexican system. These systemic problems serve to reproduce and deepen health inequalities. A system, in which the costs of renal care are disproportionately borne by those who can least afford them, faces major difficulties around the sustainability and resourcing of RRTs. Attempts to increase access to renal therapies, therefore, need to take into account the complex social and economic demands this places on those who need access most. This paper further shows that ethnographic studies of the concrete ways in which healthcare is accessed in practice provide important insights into the plight of CKD patients and so constitute an important source of evidence in that effort. PMID:23349868

  2. Effect of knee osteoarthritis on the perception of quality of life in Venezuelan patients.

    PubMed

    Chacón, José G; González, Nancy E; Véliz, Aleida; Losada, Benito R; Paul, Hernando; Santiago, Luís G; Antúnez, Ana; Finol, Yelitza; González, María E; Granados, Isabel; Maldonado, Irama; Maldonado, Teolinda; Marín, Francisco; Zambrano, Gisela; Rodríguez, Martín A

    2004-06-15

    To measure the perception of quality of life in Venezuelan patients with knee osteoarthritis and to identify those variables that may influence it. A multicenter, cross-sectional study of 126 mestizo patients with knee osteoarthritis recruited from 8 rheumatology centers in Venezuela. We used a Spanish-translated version of the Arthritis Impact Measurement Scales (AIMS), as adapted in Venezuela. One-way analysis of variance was used to compare the AIMS mean total score among subgroups of knee pain, anatomic stage, and socioeconomic status (SES); a post-hoc test was performed to identify significant intragroup differences. Pearson's correlation coefficient was used to examine correlations between age, body mass index (BMI), disease duration, knee pain, and AIMS score. Associations between radiologic stage, SES, and AIMS scores were examined using Spearman's rank correlation. Multiple regression analysis was used to estimate predictor factors of AIMS scores. A significant correlation was found between total AIMS scores and knee pain, age, and socioeconomic status, but not with BMI, disease duration, or anatomic stage. Patients with severe knee pain differed from those with mild and moderate pain, and the highest AIMS mean total score was seen in patients within the severe knee pain subset. Patients in the highest socioeconomic levels differed from those within lowest categories. Patients classified as being at the levels of relative and critical poverty showed the highest AIMS scores. Multiple regression analysis showed that knee pain was the only variable that exerted an independent effect on the quality of life in our patients. The perception of quality of life is negatively affected by increasing levels of joint pain, old age, and low socioeconomic status in Venezuelan patients with knee osteoarthritis. Our study supports the need for an early and vigorous approach to treat pain in this group of patients.

  3. Cross-cultural validation of the paediatric Gait, Arms, Legs, Spine (pGALS) tool for the screening of musculoskeletal disorders in Mexican children.

    PubMed

    Moreno-Torres, Luis Antonio; Hernández-Garduño, Adolfo Gabriel; Arellano-Valdés, Carmen Araceli; Salinas-Rodríguez, Aarón; Rubio-Perez, Nadina; Peláez-Ballestas, Ingris

    2016-04-01

    The aim of this study was to validate the paediatric Gait, Arms, Legs, Spine (pGALS) tool for Mexican Spanish to screen Mexican paediatric population for musculoskeletal (MSK) disorders. A cross-sectional study was performed in the Paediatric Hospital of the Mexican Social Security Institute in Guadalajara, Jalisco. The validation included children and adolescents aged 6-16 years, 87 patients with musculoskeletal disorders and 88 controls without musculoskeletal disorders. The cross-cultural validation followed the current published guidelines. The average pGALS administration time was 2.9 min (SD 0.54). The internal consistency score (Cronbach's α) was 0.90 (0.89 for inflammatory and 0.77 for non-inflammatory disorders) for MSK disorders, with a sensitivity of 97 % (95 % CI 92-99 %), a specificity of 93 % (95 % CI 86-97 %), a LR+ of 14.3, and a ROC curve of 0.95 (95 % CI 0.92-0.98 %). The inflammatory disorders group had a sensitivity of 97 % (95 % CI 86-99 %), a specificity of 93 % (95 % CI 86-97 %), a LR+ of 14.2, and a ROC curve of 0.95 % (95 % CI 0.91-0.99 %). The non-inflammatory disorders group had a sensitivity of 98 % (95 % CI 89-99 %), a specificity of 93 % (95 % CI 86-97 %), and a LR+ of 14.37, with a ROC curve of 0.95 % (95 % CI 0.92-0.98 %). pGALS is a valid screening tool, fast, easy to administer, and useful for detecting musculoskeletal disorders in Mexican children and adolescents.

  4. Genetic epidemiology of gallbladder disease in Mexican Americans and cholesterol 7a-hydroxylase gene variation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, J.P.; Hanis, C.L.; Boerwinkle, E.

    1994-09-01

    Among Mexican Americans the prevalence of gallbladder disease is markedly elevated. Previous data from both genetic admixture and family studies indicate that there is genetic component to the occurrence of gallbladder disease in Mexican Americans. However, prior to this study no formal genetic analysis of gallbladder disease had been carried out nor had any contributing gene been identified. The results of complex segregation analysis in a sample of 232 Mexican Americans with age- and gender-specific effects influencing the occurrence of gallbladder disease. The estimated frequency of the allele increasing susceptibility was 0.39. The lifetime probabilities that an individual will bemore » affected by gallbladder disease were 1.0, 0.54, and 0.00 for females of genotypes {open_quotes}AA{close_quotes}, {open_quotes}Aa{close_quotes}, and {open_quotes}aa{close_quotes}, respectively, and 0.68, 0.30, and 0.00 for males, respectively. Human cholesterol 7a-hydroxylase is the rate-limiting enzyme in bile acid synthesis. The results of an association study in both a random sample and a matched case/control sample showed that there is a significant association between cholesterol 7a-hydroxylase gene variation and the occurrence of gallbladder disease in Mexican Americans males but not in females. For loci in the 5{prime}-end of the cholesterol 7a-hydroxylase gene, the frequency of the susceptibility alleles was twice as high in gallbladder disease patients compared to controls. The results of a linkage analysis provide evidence that the cholesterol 7a-hydroxylase gene and the inferred gallbladder disease gene are genetically linked.« less

  5. Erasing Differences for the Sake of Inclusion: How Mexican/Mexican American Students Construct Historical Narratives

    ERIC Educational Resources Information Center

    Santiago, Maribel

    2017-01-01

    "Mendez v. Westminster," a case about 1940s Mexican American school segregation, is a new vehicle for including Mexican Americans into U.S. history classrooms. This study explores how a class of primarily Mexican American students, who because of their heritage might develop a personal connection to the case, made sense of…

  6. Espanol mexicano y espanol chicano: Problemas y propuestas fundamentales (Mexican Spanish and Chicano Spanish: Fundamental Problems and Proposals).

    ERIC Educational Resources Information Center

    Hidalgo, Margarita

    1987-01-01

    Discusses the rise of Mexican Spanish as a distinct variety of Spanish and describes the regional and social dialects of contemporary Mexican Spanish. Although countless similarities exist between Mexican Spanish and the Chicano Spanish spoken in the southwestern United States, Mexican Spanish shows greater variability. (GR)

  7. Sugar Beets, Segregation, and Schools: Mexican Americans in a Northern Colorado Community, 1920-1960.

    ERIC Educational Resources Information Center

    Donato, Ruben

    2003-01-01

    What was unique about the Mexican American experience in Fort Collins (Colorado) was the extent to which the Great Western Sugar Company colonized Mexican workers. They lived in Mexican colonies, separate neighborhoods, or remote locations on sugar beet farms. In public schools, Mexican Americans were perceived as intellectually inferior and were…

  8. [Metabolic syndrome in adults from 20 to 40 years old in a rural Mexican community].

    PubMed

    Echavarría-Pinto, Mauro; Hernández-Lomelí, Adrián; Alcocer-Gamba, Marco Antonio; Morales-Flores, Héctor; Vázquez-Mellado, Alberto

    2006-01-01

    Metabolic syndrome is the main health problem in Mexico. Its two principal complications (ischemic cardiopathy and type-2 diabetes) are the two main causes of death in Mexico since 2000. To describe the prevalence of the metabolic syndrome in adults from 20 to 40 years old in a Mexican rural community (Senegal de Palomas, San Juan del Río, Querétaro) using the National Cholesterol Education Program (NCEP III) definition. A descriptive study with a random sample was carried out. We present a univariate analysis with a 95% confidence interval. 73 cases were studied. The prevalence of the metabolic syndrome was 45.2% slightly higher in men (48.4%) than in women (42.8%). The prevalence of hypertension was 27.3%. The prevalence of obesity was 26.1% using the definition of the WHO and this prevalence rises up to 49.4% using the definition of the Mexican Official Norm. 90.5% of women and 93.5% of men had low HDLc. The prevalence of metabolic syndrome in adults from 20 to 40 years old in this Mexican rural community is much higher than the national mean for the same age cohort. The results show the necessity to increase the research of our rural communities in order to identify the possible causes to this problem and to create therapeutic programs for patients with metabolic syndrome.

  9. Status of renal replacement therapy and peritoneal dialysis in Mexico.

    PubMed

    Cueto-Manzano, Alfonso M; Rojas-Campos, Enrique

    2007-01-01

    Mexico is struggling to gain a place among developed countries; however, there are many socioeconomic and health problems still waiting for resolution. While Mexico has the twelfth largest economy in the world, a large portion of its population is impoverished. Treatment for end-stage renal disease (377 patients per million population) is determined by the individual's access to resources such as private medical care (approximately 3%) and public sources (Social Security System: approximately 40%; Health Secretariat: approximately 57%). With only 6% of the gross national product spent on healthcare and most treatment providers being public health institutions that are often under economic restrictions, it is not surprising that many Mexican patients do not receive renal replacement therapy. Mexico is still the country with the largest utilization of peritoneal dialysis (PD) in the world, with 18% on automated PD, 56% on continuous ambulatory PD (CAPD), and 26% on hemodialysis. Results of PD (patient morbi-mortality, peritonitis rate, and technique survival) in Mexico are comparable to other countries. However, malnutrition and diabetes mellitus are highly prevalent in Mexican patients on CAPD programs, and these conditions are among the most important risk factors for a poor outcome in our setting.

  10. Two in one: report of a patient with spinocerebellar ataxia types 2 and 10.

    PubMed

    Kapur, Sachin S; Goldman, Jennifer G

    2012-09-01

    To report a rare case of the coexistence of 2 spinocerebellar ataxia (SCA) mutations in a single patient. Case report. University hospital, Movement Disorders Center. A 54-year-old man of Mexican, American Indian, and French descent with an 11-year history of gait and limb ataxia. Findings of clinical examination, magnetic resonance imaging, and video electroencephalographic monitoring. Neurologic history revealed a gradually progressive gait and limb ataxia along with muscle cramps and sensory symptoms in his distal extremities; examination revealed executive dysfunction, dysarthria, ataxia, and sensory neuronopathy. Episodes of loss of awareness were reported, but electroencephalograms were negative. Brain imaging demonstrated severe cerebellar and brainstem atrophy. Genetic evaluation of the case revealed mutations in both the SCA2 and SCA10 genes. Our patient has a unique combination of genetic mutations for 2 different SCAs, types 2 and 10, which to our knowledge, has not been previously reported. His clinical phenotype is largely consistent with SCA2, but his possible seizures and Mexican heritage suggest influences of SCA10.

  11. The costs of breast cancer in a Mexican public health institution

    PubMed Central

    Gómez-Rico, Jacobo Alejandro; Altagracia-Martínez, Marina; Kravzov-Jinich, Jaime; Cárdenas-Elizalde, Rosario; Rubio-Poo, Consuelo

    2008-01-01

    Breast cancer (BC) is the second leading cause of death as a result of neoplasia in Mexico. This study aimed to identify the direct and indirect costs of treating female outpatients diagnosed with BC at a Mexican public hospital. A cross-sectional, observational, analytical study was conducted. A total of 506 medical records were analyzed and 102 were included in the cost analysis. The micro-costing process was used to estimate treatment costs. A 17-item questionnaire was used to obtain information on direct and indirect costs. Of the 102 women with BC included in the study, 92.2% (94) were at Stage II, and only 7.8% at Stage I. Total direct costs over six months for the 82 women who had modified radical mastectomy (MRM) surgury were US$733,821.15. Total direct costs for the 15 patients with conservative surgery (CS) were US$138,190.39. We found that the total economic burden in the study population was much higher for patients with MRM than for patients with CS. PMID:22312199

  12. Serum uric acid levels contribute to new renal damage in systemic lupus erythematosus patients.

    PubMed

    Reátegui-Sokolova, C; Ugarte-Gil, Manuel F; Gamboa-Cárdenas, Rocío V; Zevallos, Francisco; Cucho-Venegas, Jorge M; Alfaro-Lozano, José L; Medina, Mariela; Rodriguez-Bellido, Zoila; Pastor-Asurza, Cesar A; Alarcón, Graciela S; Perich-Campos, Risto A

    2017-04-01

    This study aims to determine whether uric acid levels contribute to new renal damage in systemic lupus erythematosus (SLE) patients. This prospective study was conducted in consecutive patients seen since 2012. Patients had a baseline visit and follow-up visits every 6 months. Patients with ≥2 visits were included; those with end-stage renal disease (regardless of dialysis or transplantation) were excluded. Renal damage was ascertained using the SLICC/ACR damage index (SDI). Univariable and multivariable Cox-regression models were performed to determine the risk of new renal damage. Uric acid was included as a continuous and dichotomous (per receiving operating characteristic curve) variable. Multivariable models were adjusted for age at diagnosis, disease duration, socioeconomic status, SLEDAI, SDI, serum creatinine, baseline use of prednisone, antimalarials, and immunosuppressive drugs. One hundred and eighty-six patients were evaluated; their mean (SD) age at diagnosis was 36.8 (13.7) years; nearly all patients were mestizo. Disease duration was 7.7 (6.8) years. Follow-up time was 2.3 (1.1) years. The SLEDAI was 5.2 (4.3) and the SDI 0.8 (1.1). Uric acid levels were 4.5 (1.3) mg/dl. During follow-up, 16 (8.6%) patients developed at least one new point in the renal domain of the SDI. In multivariable analyses, uric acid levels (continuous and dichotomous) at baseline predicted the development of new renal damage (HR 3.21 (1.39-7.42), p 0.006; HR 18.28 (2.80-119.48), p 0.002; respectively). Higher uric acid levels contribute to the development of new renal damage in SLE patients independent of other well-known risk factors for such occurrence.

  13. MEXICAN-AMERICAN STUDY PROJECT. ADVANCE REPORT 2, MEXICAN IMMIGRATION TO THE UNITED STATES--THE RECORD AND ITS IMPLICATIONS.

    ERIC Educational Resources Information Center

    GREBLER, LEO; AND OTHERS

    THIS PRELIMINARY REPORT DESCRIBES THAT PHASE OF THE UCLA MEXICAN-AMERICAN STUDY PROJECT WHICH CONCERNS THE IMMIGRATION PROCESS OF MEXICANS TO THE UNITED STATES. STATISTICS ARE PRESENTED ABOUT--(1) THE VOLUME OF IMMIGRATION OVER THE YEARS, (2) THE SOCIO-ECONOMIC CHARACTERISTICS OF IMMIGRATING MEXICANS, (3) THE GEOGRAPHIC DISTRIBUTION OF MIGRANTS…

  14. A Tribute to Thomas P. Carter (1927-2001): Activist Scholar and Pioneer in Mexican American Education

    ERIC Educational Resources Information Center

    Valencia, Richard R.

    2006-01-01

    This article presents a testimony to the late Dr. Thomas P. Carter. Well known for his classic (1970) book, Mexican Americans in School: A History of Educational Neglect, Carter was an activist scholar and pioneer in Mexican American education. His considerable interactions with South Americans, Mexicans, and Mexican Americans served as a…

  15. The Many Faces of the Mexican-American; An Essay Concerning Chicano Character. Working Paper Series No. 1.

    ERIC Educational Resources Information Center

    Gil, Carlos B.

    Contemporary Mexican Americans have a multi-faceted character. Twentieth century Mexican Americans are no longer Mexicans but neither are they Anglo American. The strength of their Mexican traditions and cultural values and the forces of dilution to which these are exposed depend on various combined factors. Contributing to their multi-faceted…

  16. Another Mexican birthweight paradox? The role of residential enclaves and neighborhood poverty in the birthweight of Mexican-origin infants.

    PubMed

    Osypuk, Theresa L; Bates, Lisa M; Acevedo-Garcia, Dolores

    2010-02-01

    Examining whether contextual factors influence the birth outcomes of Mexican-origin infants in the US may contribute to assessing rival explanations for the so-called Mexican health paradox. We examined whether birthweight among infants born to Mexican-origin women in the US was associated with Mexican residential enclaves and exposure to neighborhood poverty, and whether these associations were modified by nativity (i.e. mother's place of birth). We calculated metropolitan indices of neighborhood exposure to Mexican-origin population and poverty for the Mexican-origin population, and merged with individual-level, year 2000 natality data (n=490,332). We distinguished between neighborhood exposure to US-born Mexican-origin population (i.e. ethnic enclaves) and neighborhood exposure to foreign-born (i.e. Mexico-born) Mexican-origin population (i.e. immigrant enclaves). We used 2-level hierarchical linear regression models adjusting for individual, metropolitan, and regional covariates and stratified by nativity. We found that living in metropolitan areas with high residential segregation of US-born Mexican-origin residents (i.e. high prevalence of ethnic enclaves) was associated with lower birthweight for infants of US-born Mexican-origin mothers before and after covariate adjustment. When simultaneously adjusting for exposure to ethnic and immigrant enclaves, the latter became positively associated with birthweight and the negative effect of the former increased, among US-born mothers. We found no contextual birthweight associations for mothers born in Mexico in adjusted models. Our findings highlight a differential effect of context by nativity, and the potential health effects of ethnic enclaves, which are possibly a marker of downward assimilation, among US-born Mexican-origin women. Copyright 2009 Elsevier Ltd. All rights reserved.

  17. Vitamin D (25(OH)D) in patients with chronic kidney disease stages 2-5.

    PubMed

    Restrepo Valencia, César Augusto; Aguirre Arango, José Vicente

    2016-09-30

    To establish the impact the chronic kidney disease stage has in the native vitamin D levels in patients not undergoing dialysis treatment. A study performed in Manizales, Colombia, a city located 2,200 meters above sea level, without important stational variations. Patients with 18 years of age or more, with chronic kidney disease stages 2 to 5 and not undergoing dialysis treatment were recruited for this study. Demographic and anthropometric variations were evaluated as well as solar exposure, CKD etiology and laboratory variables related to bone and mineral diseases. For each CKD clinical stage, correlations were evaluated for vitamin D levels, laboratory results for bone and mineral diseases, solar exposure and ethnicity. Three hundred thirty-three patients were evaluated with a median age of 71 years, most of them mestizo (71%), 173 were women. The main CKD etiology was hypertensive nephropathy (32.2%). 21.1% of patients had normal vitamin D levels, 70.1% were within insufficient range and 8.8% were in deficit. A negative correlation was found between the levels of vitamin 25 (OH) D and the values for: creatinine, phosphorous, calcium x phosphorous product, PTH, 24 hours urine protein and BMI. A positive relationship was found for calcium and albumin. Positive significant statistical correlation was found for vitamin 25(OH) D levels and solar exposure for stages 3b and 4 of CKD. It is common to find low levels of vitamin 25(OH) D in patients with CKD; these can contribute to the appearance of secondary hyperparathyroidism.

  18. Vitamin D (25(OH)D) in patients with chronic kidney disease stages 2-5

    PubMed Central

    Aguirre Arango, José Vicente

    2016-01-01

    Objective: To establish the impact the chronic kidney disease stage has in the native vitamin D levels in patients not undergoing dialysis treatment. Methods: A study performed in Manizales, Colombia, a city located 2,200 meters above sea level, without important stational variations. Patients with 18 years of age or more, with chronic kidney disease stages 2 to 5 and not undergoing dialysis treatment were recruited for this study. Demographic and anthropometric variations were evaluated as well as solar exposure, CKD etiology and laboratory variables related to bone and mineral diseases. For each CKD clinical stage, correlations were evaluated for vitamin D levels, laboratory results for bone and mineral diseases, solar exposure and ethnicity. Results: Three hundred thirty-three patients were evaluated with a median age of 71 years, most of them mestizo (71%), 173 were women. The main CKD etiology was hypertensive nephropathy (32.2%). 21.1% of patients had normal vitamin D levels, 70.1% were within insufficient range and 8.8% were in deficit. A negative correlation was found between the levels of vitamin 25 (OH) D and the values for: creatinine, phosphorous, calcium x phosphorous product, PTH, 24 hours urine protein and BMI. A positive relationship was found for calcium and albumin. Positive significant statistical correlation was found for vitamin 25(OH) D levels and solar exposure for stages 3b and 4 of CKD. Conclusions: It is common to find low levels of vitamin 25(OH) D in patients with CKD; these can contribute to the appearance of secondary hyperparathyroidism. PMID:27821896

  19. Hematopoietic stem cell transplantation (HSCT): an approach to autoimmunity.

    PubMed

    Alaez, Carmen; Loyola, Mariana; Murguía, Andrea; Flores, Hilario; Rodríguez, Araceli; Ovilla, Roberto; Ignacio, Gregorio; Amador, Raquel; Salinas, Victor; Perez, Fernanda; Rodríguez, Danaee; Morales, Zoila; Llinguin, Gonzalo; Vazquez, Alejandra; Altamirano, Analia; Gorodezky, Clara

    2006-03-01

    HSCT provides the opportunity to replace a damaged tissue. It is the most important treatment for high risk hematologic malignant and non malignant disorders. An important challenge in the identification of matched donors/patients is the HLA diversity. The Mexican Bone Marrow Registry (DONORMO) has nowadays > 5000 donors. The prevalent alleles are Amerindian, Mediterranean (Semitic and Spanish genes) and African. In theory, it is possible to find 11% of 6/6 A-B-DR low resolution matches for 70% of patients with Mexican ancestry. We contributed with 39 unrelated, cord blood and autologous HSCT for patients with malignant, genetic and autoimmune disorders. Overall disease survival was 50% (2-7 years) depending on the initial diagnosis, conditioning, disease evolution or other factors. Clinical studies using autologous and unrelated HSC are performed on patients with refractory autoimmune diseases producing mixed results: mainly, T1D, RA, MS, SLE. Improvement has been observed in skin damage and quality of life in SLE and systemic sclerosis. Disease stabilization in 2/3 of MS patients. However, in RA and T1D, initial benefits have been followed by eventual relapse. With growing clinical experience and protocol improvement, treatment-related mortality is decreasing. Proof efficacy will be achieved by comparing HSCT with standard therapy in autoimmunity.

  20. The relationship between Mexican American cultural values and resilience among Mexican American college students: a mixed methods study.

    PubMed

    Morgan Consoli, Melissa L; Llamas, Jasmin D

    2013-10-01

    The current study investigated the role of cultural values in the resilience of Mexican American college students. Utilizing mixed methodology, 124 self-identified Mexican American college students were asked to complete an online survey, including a demographic questionnaire, the Resilience Scale, Mexican American Cultural Values Scale, and 2 open-ended questions concerning overcoming adversity and cultural values. As hypothesized, Mexican American traditional cultural values (Familismo, Respeto, Religiosidad, and Traditional Gender Roles) predicted resilience, with Familismo accounting for the majority of the variance. Consensual qualitative research (Hill, Thompson, & Nutt Williams, 1997) was used to identify emergent domains and themes within the open-ended question responses. Traditional Mexican American Value themes included Familismo, Ethnic Identity, Religiosidad, Perseverance, and Respeto. Results highlight the important role that certain Mexican American cultural values play in providing strength for overcoming adversities.

  1. The Mexican American Cultural Values scales for Adolescents and Adults

    PubMed Central

    Knight, George P.; Gonzales, Nancy A.; Saenz, Delia S.; Bonds, Darya D.; Germán, Miguelina; Deardorff, Julianna; Roosa, Mark W.; Updegraff, Kimberly A.

    2009-01-01

    This research evaluates the properties of a measure of culturally linked values of Mexican Americans in early adolescence and adulthood. The items measure were derived from qualitative data provided by focus groups in which Mexican Americans’ (adolescents, mothers and fathers) perceptions of key values were discussed. The focus groups and a preliminary item refinement resulted in the fifty-item Mexican American Cultural Values Scales (identical for adolescents and adults) that includes nine value subscales. Analyses of data from two large previously published studies sampling Mexican American adolescents, mothers, and fathers provided evidence of the expected two correlated higher order factor structures, reliability, and construct validity of the subscales of the Mexican American Cultural Values Scales as indicators of values that are frequently associated with Mexican/Mexican American culture. The utility of this measure for use in longitudinal research, and in resolving some important theoretical questions regarding dual cultural adaptation, are discussed. PMID:20644653

  2. A Six-Wave Study of the Consistency of Mexican/Mexican American Preadolescents' Lifetime Substance Use Reports

    ERIC Educational Resources Information Center

    Wagstaff, David A.; Kulis, Stephen; Elek, Elvira

    2009-01-01

    In the Fall of 2004, 1,948 5th grade students from Phoenix, AZ enrolled in an evaluation of a school-based, substance use prevention intervention. To assess the consistency of Mexican and Mexican-American students' self-reports of lifetime substance use, the present study analyzed data reported by 1,418 students who reported Mexican ancestry and…

  3. [Lifestyle and probabilty of dementia in the elderly].

    PubMed

    León-Ortiz, Pablo; Ruiz-Flores, Manuel Leonardo; Ramírez-Bermúdez, Jesús; Sosa-Ortiz, Ana Luisa

    2013-01-01

    there is evidence of a relationship between physical and cognitive activity and the development of dementia, although this hypothesis has not been tested in Mexican population. analyze the association between an increased participation in physical and cognitive activities and the probability of having dementia, using a Mexican open population sample. we made a cross sectional survey in open Mexican population of residents in urban and rural areas of 65 of age and older; we performed cognitive assessments to identify subjects with dementia, as well as questionnaires to assess the level of participation in physical and cognitive activities. We performed a binary logistic regression analysis to establish the association between participation and the probability of having dementia. we included 2003 subjects, 180 with diagnosis of dementia. Subjects with dementia were older, had less education and higher prevalence of some chronic diseases. The low participation in cognitive activities was associated with a higher probability of developing dementia. Patients with dementia had significantly lower scores on physical activity scales. this study supports the hypothesis of a relationship between low cognitive and physical activity and the presentation of dementia.

  4. Conceptions of schizophrenia as a problem of nerves: a cross-cultural comparison of Mexican-Americans and Anglo-Americans.

    PubMed

    Jenkins, J H

    1988-01-01

    This paper explores indigenous conceptions of psychosis within family settings. The cultural categories nervios and 'nerves', as applied by Mexican-American and Anglo-American relatives to family members diagnosed with schizophrenia, are examined. While Mexican-Americans tended to consider nervios an appropriate interpretation of the problem, Anglo-Americans explicitly dismissed the parallel English term 'nerves'. Anglo-American relatives were likely to consider the problem as 'mental' in nature, often with specific reference to psychiatric diagnostic labels such as 'schizophrenia'. Although variations in conceptions appear related to both ethnicity and socioeconomic status, significant cultural differences were observed independent of socioeconomic status. These results raise questions concerning contemporary anthropological views that psychosis is conceptualized in substantially similar ways cross-culturally, and underscore the need for more contextualized understanding of the meaning and application of indigenous concepts of mental disorder. The paper concludes with a discussion of psychocultural meanings associated with ethnopsychiatric labels for schizophrenia and their importance for the social and moral status of patients and their kin.

  5. Differential Item Functioning of the Psychological Domain of the Menopause Rating Scale.

    PubMed

    Monterrosa-Castro, Alvaro; Portela-Buelvas, Katherin; Oviedo, Heidi C; Herazo, Edwin; Campo-Arias, Adalberto

    2016-01-01

    Introduction. Quality of life could be quantified with the Menopause Rating Scale (MRS), which evaluates the severity of somatic, psychological, and urogenital symptoms in menopause. However, differential item functioning (DIF) analysis has not been applied previously. Objective . To establish the DIF of the psychological domain of the MRS in Colombian women. Methods . 4,009 women aged between 40 and 59 years, who participated in the CAVIMEC (Calidad de Vida en la Menopausia y Etnias Colombianas) project, were included. Average age was 49.0 ± 5.9 years. Women were classified in mestizo, Afro-Colombian, and indigenous. The results were presented as averages and standard deviation ( X ± SD). A p value <0.001 was considered statistically significant. Results . In mestizo women, the highest X ± SD were obtained in physical and mental exhaustion (PME) (0.86 ± 0.93) and the lowest ones in anxiety (0.44 ± 0.79). In Afro-Colombian women, an average score of 0.99 ± 1.07 for PME and 0.63 ± 0.88 for anxiety was gotten. Indigenous women obtained an increased average score for PME (1.33 ± 0.93). The lowest score was evidenced in depressive mood (0.50 ± 0.81), which is different from other Colombian women ( p < 0.001). Conclusions . The psychological items of the MRS show differential functioning according to the ethnic group, which may induce systematic error in the measurement of the construct.

  6. Differential Item Functioning of the Psychological Domain of the Menopause Rating Scale

    PubMed Central

    Portela-Buelvas, Katherin; Oviedo, Heidi C.; Herazo, Edwin; Campo-Arias, Adalberto

    2016-01-01

    Introduction. Quality of life could be quantified with the Menopause Rating Scale (MRS), which evaluates the severity of somatic, psychological, and urogenital symptoms in menopause. However, differential item functioning (DIF) analysis has not been applied previously. Objective. To establish the DIF of the psychological domain of the MRS in Colombian women. Methods. 4,009 women aged between 40 and 59 years, who participated in the CAVIMEC (Calidad de Vida en la Menopausia y Etnias Colombianas) project, were included. Average age was 49.0 ± 5.9 years. Women were classified in mestizo, Afro-Colombian, and indigenous. The results were presented as averages and standard deviation (X ± SD). A p value <0.001 was considered statistically significant. Results. In mestizo women, the highest X ± SD were obtained in physical and mental exhaustion (PME) (0.86 ± 0.93) and the lowest ones in anxiety (0.44 ± 0.79). In Afro-Colombian women, an average score of 0.99 ± 1.07 for PME and 0.63 ± 0.88 for anxiety was gotten. Indigenous women obtained an increased average score for PME (1.33 ± 0.93). The lowest score was evidenced in depressive mood (0.50 ± 0.81), which is different from other Colombian women (p < 0.001). Conclusions. The psychological items of the MRS show differential functioning according to the ethnic group, which may induce systematic error in the measurement of the construct. PMID:27847825

  7. Brief Intervention in the Emergency Department Among Mexican-Origin Young Adults at the US-Mexico Border: Outcomes of a Randomized Controlled Clinical Trial Using Promotores.

    PubMed

    Cherpitel, Cheryl J; Ye, Yu; Bond, Jason; Woolard, Robert; Villalobos, Susana; Bernstein, Judith; Bernstein, Edward; Ramos, Rebeca

    2016-03-01

    A randomized controlled trial of brief intervention (BI), for drinking and related problems, using peer health promotion advocates (promotores), was conducted among at-risk and alcohol-dependent Mexican-origin young adult emergency department (ED) patients, aged 18-30. Six hundred and ninety-eight patients were randomized to: screened only (n = 78), assessed (n = 310) and intervention (n = 310). Primary outcomes were at-risk drinking and Rapid Alcohol Problems Screen (RAPS4) scores. Secondary outcomes were drinking days per week, drinks per drinking day, maximum drinks in a day and negative consequences of drinking. At 3- and 12-month follow-up the intervention condition showed significantly lower values or trends on all outcome variables compared to the assessed condition, with the exception of the RAPS4 score; e.g. at-risk drinking days dropped from 2.9 to 1.7 at 3 months for the assessed condition and from 3.2 to 1.2 for the intervention condition. Using random effects modeling controlling for demographics and baseline values, the intervention condition showed significantly greater improvement in all consumption measures at 12 months, but not in the RAPS4 or negative consequences of drinking. Improvements in outcomes were significantly more evident for non-injured patients, those reporting drinking prior to the event, and those lower on risk taking disposition. At 12-month follow-up this study demonstrated significantly improved drinking outcomes for Mexican-origin young adults in the ED who received a BI delivered by promotores compared to those who did not. ClinicalTrials.gov. NCT02056535. © The Author 2015. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  8. Racial Identity and Racial Treatment of Mexican Americans

    PubMed Central

    Ortiz, Vilma; Telles, Edward

    2013-01-01

    How racial barriers play in the experiences of Mexican Americans has been hotly debated. Some consider Mexican Americans similar to European Americans of a century ago that arrived in the United States with modest backgrounds but were eventually able to participate fully in society. In contrast, others argue that Mexican Americans have been racialized throughout U.S. history and this limits their participation in society. The evidence of persistent educational disadvantages across generations and frequent reports of discrimination and stereotyping support the racialization argument. In this paper, we explore the ways in which race plays a role in the lives of Mexican Americans by examining how education, racial characteristics, social interactions, relate to racial outcomes. We use the Mexican American Study Project, a unique data set based on a 1965 survey of Mexican Americans in Los Angeles and San Antonio combined with surveys of the same respondents and their adult children in 2000, thereby creating a longitudinal and intergenerational data set. First, we found that darker Mexican Americans, therefore appearing more stereotypically Mexican, report more experiences of discrimination. Second, darker men report much more discrimination than lighter men and than women overall. Third, more educated Mexican Americans experience more stereotyping and discrimination than their less-educated counterparts, which is partly due to their greater contact with Whites. Lastly, having greater contact with Whites leads to experiencing more stereotyping and discrimination. Our results are indicative of the ways in which Mexican Americans are racialized in the United States. PMID:24307918

  9. Racial Identity and Racial Treatment of Mexican Americans.

    PubMed

    Ortiz, Vilma; Telles, Edward

    2012-04-01

    How racial barriers play in the experiences of Mexican Americans has been hotly debated. Some consider Mexican Americans similar to European Americans of a century ago that arrived in the United States with modest backgrounds but were eventually able to participate fully in society. In contrast, others argue that Mexican Americans have been racialized throughout U.S. history and this limits their participation in society. The evidence of persistent educational disadvantages across generations and frequent reports of discrimination and stereotyping support the racialization argument. In this paper, we explore the ways in which race plays a role in the lives of Mexican Americans by examining how education, racial characteristics, social interactions, relate to racial outcomes. We use the Mexican American Study Project, a unique data set based on a 1965 survey of Mexican Americans in Los Angeles and San Antonio combined with surveys of the same respondents and their adult children in 2000, thereby creating a longitudinal and intergenerational data set. First, we found that darker Mexican Americans, therefore appearing more stereotypically Mexican, report more experiences of discrimination. Second, darker men report much more discrimination than lighter men and than women overall. Third, more educated Mexican Americans experience more stereotyping and discrimination than their less-educated counterparts, which is partly due to their greater contact with Whites. Lastly, having greater contact with Whites leads to experiencing more stereotyping and discrimination. Our results are indicative of the ways in which Mexican Americans are racialized in the United States.

  10. SES Gradients Among Mexicans in the United States and in Mexico: A New Twist to the Hispanic Paradox?

    PubMed

    Beltrán-Sánchez, Hiram; Palloni, Alberto; Riosmena, Fernando; Wong, Rebeca

    2016-10-01

    Recent empirical findings have suggested the existence of a twist in the Hispanic paradox, in which Mexican and other Hispanic foreign-born migrants living in the United States experience shallower socioeconomic status (SES) health disparities than those in the U.S. In this article, we seek to replicate this finding and test conjectures that could explain this new observed phenomenon using objective indicators of adult health by educational attainment in several groups: (1) Mexican-born individuals living in Mexico and in the United States, (2) U.S.-born Mexican Americans, and (3) non-Hispanic American whites. Our analytical strategy improves upon previous research on three fronts. First, we derive four hypotheses from a general framework that has also been used to explain the standard Hispanic paradox. Second, we study biomarkers rather than self-reported health and related conditions. Third, we use a binational data platform that includes both Mexicans living in Mexico (Mexican National Health and Nutrition Survey 2006) and Mexican migrants to the United States (NHANES 1999-2010). We find steep education gradients among Mexicans living in Mexico's urban areas in five of six biomarkers of metabolic syndrome (MetS) and in the overall MetS score. Mexican migrants living in the United States experience similar patterns to Mexicans living in Mexico in glucose and obesity biomarkers. These results are inconsistent with previous findings, suggesting that Mexican migrants in the United States experience significantly attenuated health gradients relative to the non-Hispanic white U.S. Our empirical evidence also contradicts the idea that SES-health gradients in Mexico are shallower than those in the United States and could be invoked to explain shallower gradients among Mexicans living in the United States.

  11. Gastrointestinal tract and liver graft-versus-host disease in pediatric patients with hematopoietic progenitor cell transplantation at a tertiary care center in Mexico.

    PubMed

    Jaramillo-Esparza, C M; Consuelo-Sánchez, A; Acosta-Rodríguez-Bueno, C P; Ramón-García, G; Sadowinski-Pine, S W; Escobar-Sánchez, M A; Castorena-Villa, I; Gaytán-Morales, F; Vázquez-Frias, R

    2018-02-24

    Graft-versus-host disease (GVHD) is a common multisystemic complication of allogeneic hematopoietic cell transplantation. The most frequent presentations of graft-versus-host disease involve the skin, the gastrointestinal tract, and the liver. The aim of the present study was to know the frequency of gastrointestinal tract and liver GVHD and the characteristics of disease presentation in pediatric patients that underwent hematopoietic stem cell transplantation (HSCT) at a tertiary care hospital center in Mexico City. A retrospective study was carried out, utilizing the case records of patients that underwent HSCT in 2015, to determine the frequency of GVHD in pediatric patients at a Mexican tertiary care hospital center. In 2015, 16 HSCT were performed, 11 of which were carried out in males (68%). Only 3 patients developed graft-versus-host disease (18.7%). One patient presented with skin and liver GVHD and 2 patients presented with gastrointestinal tract and liver GVHD, which was the most frequent type. HSCT is still an uncommon procedure in Mexico and there is a lower frequency of gastrointestinal tract and liver GVHD than that reported in other studies. Most certainly, there will be an increase in this type of patient and risk factors in the Mexican population must still be determined to help predict the onset of GVHD. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

  12. Strong selection at MHC in Mexicans since admixture

    USDA-ARS?s Scientific Manuscript database

    Mexicans are a recent admixture of Amerindians, Europeans, and Africans. We performed local ancestry analysis of Mexican samples from two genome-wide association studies obtained from dbGaP, and discovered that at the major histocompatibility complex (MHC) region Mexicans have excessive African ance...

  13. Mexican and Mexican American women in a battered women's shelter: barriers to condom negotiation for HIV/AIDS prevention.

    PubMed

    Davila, Y R; Brackley, M H

    1999-01-01

    Anecdotal information suggests that, for Hispanic women who are involved with abusive partners, condom use request as an HIV/AIDS sexual risk-reduction behavior may expose the women to risk of both abuse and HIV/AIDS. A qualitative study explored barriers to condom negotiation for HIV/AIDS prevention among Mexican and Mexican American women in abusive relationships. A convenience sample of 14 Mexican and Mexican American women was recruited from a battered women's shelter. A demographic form, a domestic violence assessment form, and audiotaped responses to a semistructured interview guide were used to collect data. Descriptive statistics were used to describe the sample. Audiotaped interviews were transcribed verbatim and submitted to content analysis, which revealed past and present themes of physical, psychological, and sexual abuse of Mexican and Mexican American women who requested condom use by their male sexual partners. Also identified by content analysis was the influence of men's power on women's public, private, and sexual interactions.

  14. Expressed emotion and sociocultural moderation in the course of schizophrenia.

    PubMed

    Aguilera, Adrian; López, Steven R; Breitborde, Nicholas J K; Kopelowicz, Alex; Zarate, Roberto

    2010-11-01

    This study examined whether the sociocultural context moderates the relationship between families' expressed emotion (EE) and clinical outcomes in schizophrenia. In a sample of 60 Mexican American caregivers and their ill relatives, we first assessed whether EE and its indices (criticism, emotional overinvolvement [EOI], and warmth) related to relapse. Second, we extended the analysis of EE and its indices to a longitudinal assessment of symptomatology. Last, we tested whether bidimensional acculturation moderated the relationship between EE (and its indices) and both relapse and symptom trajectory over time. Results indicated that EOI was associated with increased relapse and that criticism was associated with increased symptomatology. Additionally, as patients' Mexican enculturation (Spanish language and media involvement) decreased, EE was increasingly related to relapse. For symptomatology, as patients' U.S. acculturation (English language and media involvement) increased, EE was associated with increased symptoms longitudinally. Our results replicate and extend past research on how culture might shape the way family factors relate to the course of schizophrenia. PsycINFO Database Record (c) 2010 APA, all rights reserved

  15. Early mortality in children with acute lymphoblastic leukemia in a developing country: the role of malnutrition at diagnosis. A multicenter cohort MIGICCL study.

    PubMed

    Martín-Trejo, Jorge Alfonso; Núñez-Enríquez, Juan Carlos; Fajardo-Gutiérrez, Arturo; Medina-Sansón, Aurora; Flores-Lujano, Janet; Jiménez-Hernández, Elva; Amador-Sanchez, Raquel; Peñaloza-Gonzalez, José Gabriel; Alvarez-Rodriguez, Francisco Javier; Bolea-Murga, Victoria; Espinosa-Elizondo, Rosa Martha; de Diego Flores-Chapa, José; Pérez-Saldivar, Maria Luisa; Rodriguez-Zepeda, María Del Carmen; Dorantes-Acosta, Elisa María; Núñez-Villegas, Nora Nancy; Velazquez-Aviña, Martha Margarita; Torres-Nava, José Refugio; Reyes-Zepeda, Nancy Carolina; González-Bonilla, César Raúl; Flores-Villegas, Luz Victoria; Rangel-López, Angélica; Rivera-Luna, Roberto; Paredes-Aguilera, Rogelio; Cárdenas-Cardós, Rocío; Martínez-Avalos, Armando; Gil-Hernández, Ana Elena; Duarte-Rodríguez, David Aldebarán; Mejía-Aranguré, Juan Manuel

    2017-04-01

    The role of malnutrition at diagnosis as a predictor of early mortality in Mexican leukemia children remains controversial. The objective of present study was to investigate whether malnutrition was a predictor of early mortality during the first year of treatment in Mexican acute lymphoblastic leukemia (ALL) children through the first population-based study. A total of 794 newly diagnosed ALL pediatric patients from public hospitals of Mexico City were enrolled. A multivariate Cox proportional hazards regression model was constructed and adjusted by patient's age at diagnosis, gender, hospital of treatment, and socioeconomic status. Early mortality was high (12.1%) and malnutrition by different indicators was not associated with mortality at induction phase and at 6th month; a high risk of dying (RR = 2.08; 95% CI: 1.08-4.01) was observed in the group of malnourished children with a high-risk ALL.

  16. Direct costs of osteoporosis and hip fracture: an analysis for the Mexican healthcare system.

    PubMed

    Clark, P; Carlos, F; Barrera, C; Guzman, J; Maetzel, A; Lavielle, P; Ramirez, E; Robinson, V; Rodriguez-Cabrera, R; Tamayo, J; Tugwell, P

    2008-03-01

    This study reports the direct costs related to osteoporosis and hip fractures paid for governmental and private institutions in the Mexican health system and estimates the impact of these entities on Mexico. We conclude that the economic burden due to the direct costs of hip fracture justifies wide-scale prevention programs for osteoporosis (OP). To estimate the total direct costs of OP and hip fractures in the Mexican Health care system, a sample of governmental and private institutions were studied. Information was gathered through direct questionnaires in 275 OP patients and 218 hip fracture cases. Additionally, a chart review was conducted and experts' opinions obtained to get accurate protocol scenarios for diagnoses and treatment of OP with no fracture. Microcosting and activity-based costing techniques were used to yield unit costs. The total direct costs for OP and hip fracture were estimated for 2006 based on the projected annual incidence of hip fractures in Mexico. A total of 22,233 hip fracture cases were estimated for 2006 with a total cost to the healthcare system of US$ 97,058,159 for the acute treatment alone ($4,365.50 per case). We found considerable differences in costs and the way the patients were treated across the different health sectors within the country. Costs of the acute treatment of hip fractures in Mexico are high and are expected to increase with the predicted increment of life expectancy and the number of elderly in our population.

  17. Illness representations and cultural practices play a role in patient-centered care in childhood asthma: experiences of Mexican mothers.

    PubMed

    Arcoleo, Kimberly; Zayas, Luis E; Hawthorne, April; Begay, Rachelle

    2015-09-01

    Patients' cultural health beliefs and behaviors may conflict with biomedical healthcare values and practices potentially leading to non-adherence with asthma treatment regimens. To optimize shared decision-making, healthcare providers should understand and be sensitive to these cultural beliefs and behaviors and negotiate an asthma management plan acceptable to parents. The purpose of this study was to obtain the perspective of Mexican mothers regarding (1) their experiences of living with a child with asthma, (2) their understanding of the nature of asthma, and (3) how their cultural beliefs influence asthma management. A qualitative, phenomenological study design was employed to assess mothers' lived experiences with and perceptions of their child's asthma. Individual in-depth interviews were conducted with a purposeful sample of 20 Mexican mothers of children ages 5-17 years with asthma. An inductive, theory-driven, phenomenological analysis approach was used to elicit thematic findings. Mothers expressed a symptomatic perception of asthma and limited understanding of the disease. Most believe the disease is present only when their child is symptomatic. Many are surprised and puzzled by the unpredictability of their child's asthma attacks, which they report as sometimes "silent". The inconsistency of triggers also leads to frustration and worry, which may reflect their concerns around daily controller medication use and preference for alternative illness management strategies. Our clinical encounters should be refocused to better understand the context of these families' lives and the cultural lens through which they view their child's asthma.

  18. The Wealth of Mexican Americans

    ERIC Educational Resources Information Center

    Cobb-Clark, Deborah A.; Hildebrand, Vincent A.

    2006-01-01

    This paper analyzes the sources of disparities in the relative wealth position of Mexican Americans. Results reveal that--unlike the racial wealth gap--Mexican Americans' wealth disadvantage is in large part not the result of differences in wealth distributions conditional on the underlying determinants of wealth. Rather, Mexican Americans' wealth…

  19. Case series: Two cases of eyeball tattoos with short-term complications.

    PubMed

    Duarte, Gonzalo; Cheja, Rashel; Pachón, Diana; Ramírez, Carolina; Arellanes, Lourdes

    2017-04-01

    To report two cases of eyeball tattoos with short-term post procedural complications. Case 1 is a 26-year-old Mexican man that developed orbital cellulitis and posterior scleritis 2 h after an eyeball tattoo. Patient responded satisfactorily to systemic antibiotic and corticosteroid treatment. Case 2 is a 17-year-old Mexican man that developed two sub-episcleral nodules in the ink injection sites immediately after the procedure. Eyeball tattoos are performed by non-ophthalmic trained personnel. There are a substantial number of short-term risks associated with this procedure. Long-term effects on the eyes and vision are still unknown, but in a worst case scenario could include loss of vision or permanent damage to the eyes.

  20. [Leigh syndrome caused by the mitochondrial DNA G14459A mutation in a Mexican family].

    PubMed

    Gutiérrez, A; Saldaña-Martínez, A; García-Ramírez, R; Rayo-Mares, D; Carreras, M; López-Pérez, M J; Ruiz-Pesini, E; Montoya, J; Montiel-Sosa, J F

    Leigh syndrome is a neurodegenerative and progressive disease that appears usually in childhood due to defects in nuclear or mitochondrial genome. The mutation G14459A in mitochondrial DNA has been associated previously to Leber hereditary optic neuropathy and recently to Leigh syndrome. A 10 months-old Mexican girl diagnosed of Leigh syndrome. Molecular-genetic studies detected the mutation G14459A in a percentage close to homoplasmy and in low heteroplasmy in her mother. The rest of the maternally related family members analyzed were negative. The G14459A mutation, although not very frequently associated to Leigh syndrome, should be analyzed in patients that do not present the most common point mutations.

  1. The Prevention and Treatment of Child Abuse and Neglect: A Focus on the Mexican American Family. Proceedings of the Annual Conference (2nd, San Antonio, Texas, September 8-10, 1982).

    ERIC Educational Resources Information Center

    Torres, Angelina Moreno

    The 26 papers focus on child abuse issues affecting the Mexican American family. The keynote address notes various issues in child abuse and neglect among Mexican Americans. Three papers discuss Mexican American families in transition, adjustment of the family into the Mexican American barrio and vice versa, and the effects of sexual assault on…

  2. Immigration and suicidal behavior among Mexicans and Mexican Americans.

    PubMed

    Borges, Guilherme; Breslau, Joshua; Su, Maxwell; Miller, Matthew; Medina-Mora, Maria Elena; Aguilar-Gaxiola, Sergio

    2009-04-01

    We examined migration to the United States as a risk factor for suicidal behavior among people of Mexican origin. We pooled data from 2 nationally representative surveys in the United States (2001-2003; n = 1284) and Mexico (2001-2002; n = 5782). We used discrete time survival models to account for time-varying and time-invariant characteristics, including psychiatric disorders. Risk for suicidal ideation was higher among Mexicans with a family member in the United States (odds ratio [OR] = 1.50; 95% confidence interval [CI] = 1.06, 2.11), Mexican-born immigrants who arrived in the United States at 12 years or younger (OR = 1.84; 95% CI = 1.09, 3.09), and US-born Mexican Americans (OR = 1.56; 95% CI = 1.03, 2.38) than among Mexicans with neither a history of migration to the United States nor a family member currently living there. Risk for suicide attempts was also higher among Mexicans with a family member in the United States (OR = 1.68; 95% CI = 1.13, 2.52) and US-born Mexican Americans (OR = 1.97; 95% CI = 1.06, 3.65). Selection bias caused by differential migration or differential return migration of persons at higher risk of suicidal ideation or attempt did not account for these findings. Public health efforts should focus on the impact of Mexico-US migration on family members of migrants and on US-born Mexican Americans.

  3. Validation of the FRAIL scale in Mexican elderly: results from the Mexican Health and Aging Study.

    PubMed

    Díaz de León González, Enrique; Gutiérrez Hermosillo, Hugo; Martinez Beltran, Jesus Avilio; Chavez, Juan Humberto Medina; Palacios Corona, Rebeca; Salinas Garza, Deborah Patricia; Rodriguez Quintanilla, Karina Alejandra

    2016-10-01

    The aging population in Latin America is characterized by not optimal conditions for good health, experiencing high burden of comorbidity, which contribute to increase the frequency of frailty; thus, identification should be a priority, to classify patients at high risk to develop its negative consequences. The objective of this analysis was to validate the FRAIL instrument to measure frailty in Mexican elderly population, from the database of the Mexican Health and Aging Study (MHAS). Prospective, population study in Mexico, that included subjects of 60 years and older who were evaluated for the variables of frailty during the year 2001 (first wave of the study). Frailty was measured with the five-item FRAIL scale (fatigue, resistance, ambulation, illnesses, and weight loss). The robust, pre-frail or intermediate, and the frail group were considered when they had zero, one, and at least two components, respectively. Mortality, hospitalizations, falls, and functional dependency were evaluated during 2003 (second wave of the study). Relative risk was calculated for each complications, as well as hazard ratio (for mortality) through Cox regression model and odds ratio with logistic regression (for the rest of the outcomes), adjusted for covariates. The state of frailty was independently associated with mortality, hospitalizations, functional dependency, and falls. The pre-frailty state was only independently associated with hospitalizations, functional dependency, and falls. Frailty measured through the FRAIL scale, is associated with an increase in the rate of mortality, hospitalizations, dependency in activities of daily life, and falls.

  4. Mexican immigrant mothers' expectations for children's health services.

    PubMed

    Clark, Lauren; Redman, Richard W

    2007-10-01

    Women of Mexican descent living in the United States raise children who use health care services. What do immigrant Mexican mothers expect from children's health care services? And how do their expectations for children's health services compare to acculturated Mexican American mothers' expectations? This focused ethnographic study, based on repeated interviews with 28 mothers of varying acculturation levels, describes their expectations and experiences with children's health care services in the United States. Findings support a shared core of expectations for both Mexican immigrant and Mexican American mothers, and differences in health care access and financing, time spent in health care encounters, and cultural and linguistic expectations for care. Health care providers can use this information to approach Mexican-descent mothers and children with their expectations in mind, and craft a negotiated plan of care congruent with their expectations.

  5. Church-Based Social Relationships, Belonging, and Health Among Older Mexican Americans

    PubMed Central

    Krause, Neal; Bastida, Elena

    2011-01-01

    The purpose of this study is to explain how church-based emotional support influences the health of older Mexican Americans. This issue is evaluated with a theoretical model that contains the following core linkages: (1) older Mexican Americans who go to church more often will be more likely to receive emotional support from fellow church members; (2) older Mexican Americans who receive more support from their fellow church members will be more likely to feel they belong in their congregation; (3) older Mexican Americans who feel they belong in their congregation are likely to have a stronger sense of personal control; and (4) older Mexican Americans who have a stronger sense of personal control are likely to enjoy better health. Data from a recent nationwide survey of older Mexican Americans provide support for each of these relationships. PMID:21687808

  6. Mexican American Self-Referents and Linguistic Attitudes.

    ERIC Educational Resources Information Center

    Flores, Nancy de la Zerda; Whitehead, Jack

    In order to determine whether differences in choice of ethnic self-referent by Mexican-Americans reflect differences in ethnic identity and attitudes toward their culture, questionnaires were distributed among Mexican-Americans living in San Antonio. The measurable cultural attitude was that toward language, since to the Mexican-American Spanish…

  7. How Mexican Is a Spanish-Speaking Mexican American?

    ERIC Educational Resources Information Center

    Patella, Victoria M.

    To investigate the validity of language usage as an indicator of identification with the Mexican American subculture, this study hypothesized that greater use of Spanish than English would be correlated with characteristics consistent with the ideal, typical, Mexican American family in terms of family of orientation and aspirations for future…

  8. Green Medicine: Traditional Mexican-American Herbal Remedies.

    ERIC Educational Resources Information Center

    Torres, Eliseo

    Traditional Mexican American herbal potions and remedies and their history are explained in an introductory book for the general reader. The importance of curanderismo, or green medicine, in Mexican and Mexican American cultures is explored. A brief history traces the herbal aspects of curanderismo through Mayan and Aztec cultures, the Spanish…

  9. Two Scales for the Measurement of Mexican-American Identity.

    ERIC Educational Resources Information Center

    Teske, Raymond, Jr.; Nelson, Bardin H.

    The development of scales to measure Mexican American identification with their population is discussed in this paper. The scales measure (1) identification with the Mexican American population using attitudinal items (Identity Scale) and (2) interaction behavior with the Mexican American population (Interaction Scale). The sample consisted of all…

  10. Sociocultural Beliefs Related to Sex among Mexican American Adolescents.

    ERIC Educational Resources Information Center

    Flores, Elena; Millstein, Susan G.; Eyre, Stephen L.

    1998-01-01

    In a two-phase study, Mexican American male and female adolescents listed positive and negative elements related to preferred partner qualities and engaging in sexual activity; then other Mexican American adolescents classified the items. Results suggest that adolescents' partner preferences and reasons to have sex reflected Mexican American…

  11. Los Dos Mundos: Rural Mexican Americans, Another America.

    ERIC Educational Resources Information Center

    Baker, Richard

    This book explores race relations between Mexican Americans and Anglo Americans in "Middlewest," a fictitious name for an actual rural Idaho community with the highest proportion of Mexican Americans in the state. Many Mexican Americans in this predominantly agricultural area are current or former migrant workers. The first chapter…

  12. Fair Start Program: Outreach to Mexican and Mexican American Farmworker Families.

    ERIC Educational Resources Information Center

    Winters-Smith, Carol; Larner, Mary

    This presentation describes a home visiting health education program serving Mexican and Mexican-American migrant farmworkers in Florida. The purposes of the program were to educate farmworker families about pregnancy, childbirth, nutrition, and child development, and to encourage the use of preventive health care services. Home visitors were…

  13. Conceptualizing Parent Involvement: Low-Income Mexican Immigrant Perspectives

    ERIC Educational Resources Information Center

    Crane, Thomas B.

    2012-01-01

    The purposes of this study were to (a) investigate the conceptualization of low-income Mexican immigrant parents about their parental involvement and the family-school connection, (b) identify the influences on low-income Mexican immigrant parents' approach to parent involvement, and (c) identify the ways that Mexican immigrant parents…

  14. Mexican-American Cultural Assumptions and Implications.

    ERIC Educational Resources Information Center

    Carranza, E. Lou

    The search for presuppositions of a people's thought is not new. Octavio Paz and Samuel Ramos have both attempted to describe the assumptions underlying the Mexican character. Paz described Mexicans as private, defensive, and stoic, characteristics taken to the extreme in the "pachuco." Ramos, on the other hand, described Mexicans as…

  15. "American" Abjection: "Chicanos," Gangs, and Mexican/Migrant Transnationality in Chicago

    ERIC Educational Resources Information Center

    De Genova, Nicholas

    2008-01-01

    Crime and street violence often evoke racialized discourses about urban space. In this ethnographic research in Chicago, however, the disdain that many Mexican migrants articulated about street gangs principally concerned issues "internal" to the Mexican/Chicano community, notably a profound ambivalence about U.S.-born Mexicans and a…

  16. Evaluating the Impact of Drug Trafficking Organizations on the Stability of the Mexican State

    DTIC Science & Technology

    2010-06-11

    Mexican state is unlikely to fail as state failure is defined, but the Mexican government is likely to return to a one party system under which drug...College or any other governmental agency. (References to this study should include the foregoing statement.) iv ABSTRACT EVALUATING THE IMPACT OF...security of the U.S. The primary conclusion drawn is that the Mexican state is unlikely to fail as state failure is defined, but the Mexican government

  17. Antimicrobial properties of Honduran medicinal plants.

    PubMed

    Lentz, D L; Clark, A M; Hufford, C D; Meurer-Grimes, B; Passreiter, C M; Cordero, J; Ibrahimi, O; Okunade, A L

    1998-12-01

    Ninety-two plants used in the traditional pharmacopoeia of the Pech and neighboring Mestizo peoples of central Honduras are reported. The results of in vitro antimicrobial screens showed that 19 of the extracts from medicinal plants revealed signs of antifungal activity while 22 demonstrated a measurable inhibitory effect on one or more bacterial cultures. Bioassay-guided fractionation of extracts from Mikania micrantha, Neurolaena lobata and Piper aduncum produced weak to moderately active isolates. The broad spectrum of activity of the extracts helps to explain the widespread use of these plants for wound healing and other applications.

  18. Mujeres Latinas--Santas y Marquesas.

    PubMed

    Arredondo, Patricia

    2002-11-01

    This presidential address is a conceptualization and application of psychohistorical and mestizo psychology frameworks to address gender and ethnic identity conflicts for contemporary Latinas. Connections are made between historical and cultural icons and Latina literature of the 21st century with protagonists who give voice to the struggles of acculturated and self-empowered women. Spanish terms are used to communicate and give emphasis to the Latino landscape. The article comes to conclusion with personal reflections about María Morales de Zaldívar, or Mamá, the author's grandmother, who embodies the santa y marquesa life script.

  19. [Staging gastritis with the OLGA system: prevalence of advanced stages of gastric atrophy in Mexican patients].

    PubMed

    Ramírez-Mendoza, P; Ruiz-Castillo, S A; Maroun-Marun, C; Trujillo-Benavides, O; Baltazar-Montúfar, P; Méndez del Monte, R; Angeles-Garay, U

    2011-01-01

    Gastric adenocarcinoma of intestinal type is preceded by inflammation, which produces mucosal atrophy and intestinal metaplasia, progressing eventually to dysplasia and invasive cancer. Recently an international group, the Operative Link on Gastritis Assessment (OLGA) proponed a staging system for gastric biopsies. To recognize the distribution of advanced stages of gastric mucosal atrophy in Mexican patients with dyspepsia according to the OLGA system. We apply the OLGA system for cancer risk (Stages 0 to IV) to 322 gastric biopsies from consecutive patients with dyspepsia. Using the Sydney protocol, we recorded the presence of atrophy, dysplasia and the relationship with ulcer disease. We report the stage of atrophy for each region and the Helicobacter pylori infection status. We documented 72 (22.4%) cases with atrophy, 50 of them (69.4%) were metaplastic-type. Overall, nine biopsies (2.78%) were stage III (all of them with metaplastic-type atrophy) and there was not stage IV cases. We did not find high-grade dysplasia or intramucosal carcinoma. In 8 of subjects with stage III, we observed low-grade dysplasia. We documented gastric ulcer in 5 patients with stage II, 60% of them with associated low-grade dysplasia. Five patients with duodenal ulcer were found in stages 0 and I. We found low prevalence of advanced stages of mucosal gastric atrophy among patients with dyspepsia. However we recognized 9 patients with stage III according to OLGA system worthy of follow-up because the high risk for developing gastric cancer.

  20. Forensic parameters of the X-STR Decaplex system in Mexican populations.

    PubMed

    Mariscal Ramos, C; Martínez-Cortes, G; Ramos-González, B; Rangel-Villalobos, H

    2018-03-01

    We studied the X-STR decaplex system in 529 DNA female samples of Mexican populations from five geographic regions. Allele frequencies and forensic parameters were estimated in each region and in the pooled Mexican population. Genotype distribution by locus was in agreement with Hardy-Weinberg expectations in each Mexican population sample. Similarly, linkage equilibrium was demonstrated between pair of loci. Pairwise comparisons and genetic distances between Mexican, Iberoamerican and one African populations were estimated and graphically represented. Interestingly, a non-significant interpopulation differentiation was detected (Fst = 0.0021; p = .74389), which allows using a global Mexican database for forensic interpretation of X-STR genotypes. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Effectiveness of Photodynamic Therapy in Elimination of HPV-16 and HPV-18 Associated with CIN I in Mexican Women.

    PubMed

    Maldonado Alvarado, Elizabeth; Osorio Peralta, Martha Olivia; Moreno Vázquez, Alejandra; Martínez Guzmán, Lydia Alejandra; Melo Petrone, Maria Eugenia; Enriquez Mar, Zulma Iveth; Jovel Galdamez, Dora Estela; Carrión Solana, Bárbara; Balderas Martínez, Guadalupe; Parra, Eduarda; Castellanos Oliveros, Rossana Inés; Bello Leiva, Rosa Linda; Espinosa Montesinos, Araceli; Barrera Mendoza, Citlalli; Medina García, Selma Eugenia; Ramón Gallegos, Eva

    2017-10-01

    This study aimed to determine the effectiveness of photodynamic therapy (PDT), using δ-aminolevulinic acid (5-ALA), in the elimination of premalignant cervical lesions in Mexican patients with human papillomavirus (HPV) infection and/or cervical intraepithelial neoplasia (CIN). Thirty women diagnosed with CIN I and/or positive for HPV participated in the study. Topical 6% 5-ALA in gel form was applied to the uterine cervix; after 4 h, the lesion area was irradiated with a light dose of 200 J cm -2 at 635 nm. This procedure was performed three times at 48-h intervals. Clinical follow-up was performed at 3, 6, and 12 months after the initial PDT administration, by colposcopy, cervical cytology, histopathological analysis, polymerase chain reaction, and hybrid capture. Of HPV-infected patients without evidence of CIN I, 80% cleared the infection, while HPV associated with CIN I was eliminated in 83% of patients (P < 0.05). At 12 months, CIN I had regressed in 57% of patients, although this response was not statistically significant. PDT using 6% 5-ALA is concluded to be effective in eliminating HPV infection associated or not with CIN I. © 2017 The American Society of Photobiology.

  2. Anxiety disorders among Mexican Americans and non-Hispanic whites in Los Angeles.

    PubMed

    Karno, M; Golding, J M; Burnam, M A; Hough, R L; Escobar, J I; Wells, K M; Boyer, R

    1989-04-01

    This report from the Los Angeles site of the NIMH Epidemiologic Catchment Area study reveals significant ethnic and national origin differences in lifetime prevalence rates for three out of six specific, DSM-III-defined anxiety disorders. In the case of simple phobia, United States-born Mexican Americans report higher rates than native non-Hispanic whites or immigrant Mexican Americans, the latter two groups having similar rates. Mexican Americans born in the United States had higher rates of agoraphobia than immigrant Mexican Americans, and non-Hispanic whites reported higher lifetime rates of generalized anxiety disorder compared with both immigrant and native Mexican Americans. Neither ethnic nor national origin differences in lifetime prevalence rates were found for panic disorder, social phobia, and obsessive-compulsive disorder. Selective migration is postulated as a potential factor influencing prevalence differences between native and immigrant Mexican Americans.

  3. Unpacking acculturation: cultural orientations and educational attainment among Mexican-origin youth.

    PubMed

    Roche, Kathleen M; Ghazarian, Sharon R; Fernandez-Esquer, Maria Eugenia

    2012-07-01

    Given educational risks facing Mexican-origin children of immigrant parents, it is important to understand how aspects of the acculturation process influence Mexican-origin youth's educational success. Drawing from selective assimilation theory, this study examined how cultural orientations across myriad facets of acculturation were associated with the educational attainment of second-generation Mexican immigrant youth. The sample included 755 Mexican-origin youth (50% female) in the "Children of Immigrants Longitudinal Study." Results from structural equation models indicated that youth reporting greater facility in the English language and a stronger value on familism attained higher levels of education in young adulthood than did other youth. Parents' U.S. social ties and youth's value on early paid work were associated with less educational attainment. Innovative findings from this study indicate the importance of considering both Mexican and American cultural orientations across myriad facets of acculturation for understanding second-generation immigrant Mexican youth's educational attainment.

  4. Mexican-American Women: Diversity in Depth.

    ERIC Educational Resources Information Center

    Weaver, Marleen E.

    Various literary views of the Mexican American woman have been presented over the past 150 years. Anglo treatment of Mexican American women in literature has varied from blatant prejudice or vague mystical eroticism in early portrayals to more realistic views of the Chicano in modern writing. The current identity crisis of Mexican Americans is…

  5. MEXICAN-AMERICAN STUDY PROJECT. ADVANCE REPORT 10, MEXICAN AMERICANS IN SOUTHWEST LABOR MARKETS.

    ERIC Educational Resources Information Center

    FOGEL, WALTER

    MEXICAN AMERICANS ARE CLEARLY A DISADVANTAGED GROUP IN THE LABOR MARKETS OF THE SOUTHWEST. ALTHOUGH SUBSTANTIAL GAINS IN INCOME AND OCCUPATIONAL STATUS TAKE PLACE BETWEEN THE FIRST AND SECOND GENERATIONS OF MEXICAN AMERICANS, LITTLE IMPROVEMENT IS EVIDENCED AFTER THE SECOND GENERATION. AS FURTHER EVIDENCE OF DISADVANTAGEMENT, IT HAS BEEN FOUND…

  6. Incorporating Mexican American History and Culture into the Social Studies Classroom.

    ERIC Educational Resources Information Center

    Escamilla, Kathy

    Although Mexican Americans are the fastest growing ethnic group in the United States, their history and literature are seldom taught in American classrooms. A study of over 3,000 high school sophomores in the Southwest revealed that neither Anglos nor Hispanics were aware of the contributions of Mexican Americans. Incorporating Mexican American…

  7. Contradictory Literacy Practices of Mexican-Background Students: An Ethnography From the Rural Midwest

    ERIC Educational Resources Information Center

    Godina, Heriberto

    2004-01-01

    This ethnographic study explores the contradictory literacy practices of 10 high school students of Mexican background from the rural Midwest. The author uses the term "Mexican background" to encompass both settled Mexican Americans and recent-immigrant Mexicanos. Literacy is investigated through English and Spanish in a sociocultural…

  8. Contemporary Fertility Patterns and First-Birth Timing among Mexican-Origin Women

    ERIC Educational Resources Information Center

    Batson, Christie D.

    2013-01-01

    This article examines first-birth timing among Mexican women in the United States over two birth cohorts. Currently, Mexican women are one of a small group that maintains above-replacement fertility in the United States, contributing to both Mexican population growth and overall national population growth. Yet, the fertility timing of Mexican…

  9. Military Support to Law Enforcement Agencies Along the United States Southwestern Border

    DTIC Science & Technology

    2011-06-10

    Eagle Pass on 1 October 1855.8 After a battle with Mexican soldiers, Captain Callahan 11 occupied the Mexican town of Piedras Negras, as Matthews...Captain Callahan a Texas Ranger and his men riding into Mexico and subsequently burning the Mexican town of Piedras Negras. Juan Cortina a Mexican

  10. Mexican-American and Mexican National Farm Workers: A Literature Review.

    ERIC Educational Resources Information Center

    Miller, Michael V.

    This paper is concerned with the scholarly treatment accorded to Mexican American and Mexican National farm workers by historical, legal, social work, and social science journals. Only those articles published after the arbitrary date of 1960 are reviewed due to space and time limitations. Works published since then are briefly summarized and…

  11. The Mexican Health Paradox: Expanding the Explanatory Power of the Acculturation Construct

    ERIC Educational Resources Information Center

    Horevitz, Elizabeth; Organista, Kurt C.

    2013-01-01

    The Mexican health paradox refers to initially favorable health and mental health outcomes among recent Mexican immigrants to the United States. The subsequent rapid decline in Mexican health outcomes has been attributed to the process of acculturation to U.S. culture. However, the construct of acculturation has come under significant criticism…

  12. Language Factors in the Employment of Bilingual Mexican-Americans: A Case Study Analysis.

    ERIC Educational Resources Information Center

    Garcia, Nelda Carola

    To determine the extent to which the perceived English language performance of employed bilingual Mexican-Americans influenced or handicapped them in performing job duties as proficiently as their monolingual counterparts, personal interviews were conducted with equal numbers of Mexican-Americans, their non-Mexican-American occupational peers, and…

  13. Legal Status and Wage Disparities for Mexican Immigrants

    ERIC Educational Resources Information Center

    Hall, Matthew; Greenman, Emily; Farkas, George

    2010-01-01

    This article employs a unique method of inferring the legal status of Mexican immigrants in the Survey of Income and Program Participation to offer new evidence of the role of legal authorization in the United States on workers' wages. We estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants,…

  14. Challenges and Strategies to Maintaining Emotional Health: Qualitative Perspectives of Mexican Immigrant Mothers

    ERIC Educational Resources Information Center

    Ornelas, India J.; Perreira, Krista M.; Beeber, Linda; Maxwell, Lauren

    2009-01-01

    Mexican immigrant mothers face many challenges that put them at increased risk for poor mental health. To understand the factors that lead to the development of depressive symptoms among Mexican immigrant mothers, we analyzed data from 20 qualitative, semistructured interviews. Participants included low-income, Mexican-born mothers of young…

  15. Mexican Parenting Questionnaire (MPQ)

    ERIC Educational Resources Information Center

    Halgunseth, Linda C.; Ispa, Jean M.

    2012-01-01

    The present study was conducted in four phases and constructed a self-report parenting instrument for use with Mexican immigrant mothers of children aged 6 to 10. The 14-item measure was based on semistructured qualitative interviews with Mexican immigrant mothers (N = 10), was refined by a focus group of Mexican immigrant mothers (N = 5), and was…

  16. A Qualitative Study of Mexican American Adolescents and Depression

    ERIC Educational Resources Information Center

    Fornos, Laura B.; Mika, Virginia Seguin; Bayles, Bryan; Serrano, Alberto C.; Jimenez, Roberto L.; Villarreal, Roberto

    2005-01-01

    Depressive disorders are present in a high percentage of Mexican American adolescents. Among the US Mexican American population, suicide is the fourth leading cause of death among 10- to 19-year-olds. Little research, however, has focused on Mexican American adolescents' knowledge and views about depression and seeking help for depression. Results…

  17. Still "Unfinished Education": Latino Students Forty Years after the Mexican American Education Study

    ERIC Educational Resources Information Center

    Madrigal-Gonzalez, Lizely

    2012-01-01

    The onus of this dissertation was to evaluate the educational conditions of Mexican American students forty years after the "Mexican American Education Study" published a six-volume study detailing the findings of the "Mexican American Education Study" (1970-1974). The "MAES" study focused on five southwest states…

  18. Forgotten History: Mexican American School Segregation in Arizona from 1900-1951

    ERIC Educational Resources Information Center

    Powers, Jeanne M.

    2008-01-01

    This article documents the efforts by Mexican Americans to challenge school segregation in Arizona in the first half of the twentieth century. As in Texas and California, although state law never formally mandated the segregation of Mexican American students, school districts in Arizona often established separate "Mexican Schools" for…

  19. The Representation of "Curanderismo" in Selected Mexican American Works

    ERIC Educational Resources Information Center

    Pabon, Melissa

    2007-01-01

    "Curanderismo," a Mexican folk practice, is a prevalent subject in Mexican American literature. Because much of the presence of "curanderismo" in Mexican American literature is only explored in ethnographic studies, the purpose of this study is to examine the artistic representation of "curanderismo" in the novels "Bless Me, Ultima" by Rudolfo…

  20. A Qualitative Examination of Mexican Immigrants' Career Development: Perceived Barriers and Motivators

    ERIC Educational Resources Information Center

    Shinnar, Rachel Sheli

    2007-01-01

    This study examines the variables shaping career development among Mexican immigrants. Based on qualitative interviews with 17 adult, Mexican immigrants, a model describing the barriers and motivators to career development for this sample is offered. Findings indicate that Mexican immigrants' careers are shaped by three sets of interrelated…

  1. Parents' Promotion of Psychological Autonomy, Psychological Control, and Mexican-American Adolescents' Adjustment

    ERIC Educational Resources Information Center

    Sher-Censor, Efrat; Parke, Ross D.; Coltrane, Scott

    2011-01-01

    Mexican-American adolescents are at an elevated risk for adjustment difficulties. In an effort to identify parenting practices that can affect the adjustment of Mexican-American youth, the current study examined parents' promotion of psychological autonomy and parents' psychological control as perceived by Mexican-American early adolescents, and…

  2. Five Mexican-American Women in Transition: A Case Study of Migrants in the Midwest.

    ERIC Educational Resources Information Center

    Lindborg, Kristina; Ovando, Carlos J.

    Focusing on four Mexican American women from migrant farmworker backgrounds and one woman recently immigrated from Mexico, the study explored the attitudes and experiences of the Mexican American culture considered important by Mexican American migrant women themselves. Extensive open-ended interviews, conducted mostly in the women's homes, were…

  3. Perceived Discrimination and Mexican-Origin Young Adults' Sleep Duration and Variability: The Moderating Role of Cultural Orientations.

    PubMed

    Zeiders, Katharine H; Updegraff, Kimberly A; Kuo, Sally I-Chun; Umaña-Taylor, Adriana J; McHale, Susan M

    2017-08-01

    Perceived ethnic discrimination is central to the experiences of Latino young adults, yet we know little about the ways in which and the conditions under which ethnic discrimination relates to Latino young adults' sleep patterns. Using a sample of 246 Mexican-origin young adults (M age  = 21.11, SD = 1.54; 50 % female), the current study investigated the longitudinal links between perceived ethnic discrimination and both sleep duration and night-to-night variability in duration, while also examining the moderating roles of Anglo and Mexican orientations in the associations. The results revealed that perceived discrimination predicted greater sleep variability, and this link was not moderated by cultural orientations. The relation between perceived discrimination and hours of sleep, however, was moderated by Anglo and Mexican orientations. Individuals with high Anglo and Mexican orientations (bicultural) and those with only high Mexican orientations (enculturated), showed no association between discrimination and hours of sleep. Individuals with low Anglo and Mexican orientations (marginalized) displayed a positive association, whereas those with high Anglo and low Mexican orientations (acculturated) displayed a negative association. The results suggest that discrimination has long term effects on sleep variability of Mexican-origin young adults, regardless of cultural orientations; however, for sleep duration, bicultural and enculturated orientations are protective.

  4. Immigration and Suicidal Behavior Among Mexicans and Mexican Americans

    PubMed Central

    Breslau, Joshua; Su, Maxwell; Miller, Matthew; Medina-Mora, Maria Elena; Aguilar-Gaxiola, Sergio

    2009-01-01

    Objectives. We examined migration to the United States as a risk factor for suicidal behavior among people of Mexican origin. Methods. We pooled data from 2 nationally representative surveys in the United States (2001–2003; n = 1284) and Mexico (2001–2002; n = 5782). We used discrete time survival models to account for time-varying and time-invariant characteristics, including psychiatric disorders. Results. Risk for suicidal ideation was higher among Mexicans with a family member in the United States (odds ratio [OR] = 1.50; 95% confidence interval [CI] = 1.06, 2.11), Mexican-born immigrants who arrived in the United States at 12 years or younger (OR = 1.84; 95% CI = 1.09, 3.09), and US-born Mexican Americans (OR = 1.56; 95% CI = 1.03, 2.38) than among Mexicans with neither a history of migration to the United States nor a family member currently living there. Risk for suicide attempts was also higher among Mexicans with a family member in the United States (OR = 1.68; 95% CI = 1.13, 2.52) and US-born Mexican Americans (OR = 1.97; 95% CI = 1.06, 3.65). Selection bias caused by differential migration or differential return migration of persons at higher risk of suicidal ideation or attempt did not account for these findings. Conclusions. Public health efforts should focus on the impact of Mexico–US migration on family members of migrants and on US-born Mexican Americans. PMID:19150909

  5. SES Gradients Among Mexicans in the United States and in Mexico: A New Twist to the Hispanic Paradox?

    PubMed Central

    Palloni, Alberto; Riosmena, Fernando; Wong, Rebeca

    2016-01-01

    Recent empirical findings have suggested the existence of a twist in the Hispanic paradox, in which Mexican and other Hispanic foreign-born migrants living in the United States experience shallower socioeconomic status (SES) health disparities than those in the U.S. population. In this article, we seek to replicate this finding and test conjectures that could explain this new observed phenomenon using objective indicators of adult health by educational attainment in several groups: (1) Mexicanborn individuals living in Mexico and in the United States, (2) U.S.-born Mexican Americans, and (3) non-Hispanic American whites. Our analytical strategy improves upon previous research on three fronts. First, we derive four hypotheses from a general framework that has also been used to explain the standard Hispanic paradox. Second, we study biomarkers rather than self-reported health and related conditions. Third, we use a binational data platform that includes both Mexicans living in Mexico (Mexican National Health and Nutrition Survey 2006) and Mexican migrants to the United States (NHANES 1999–2010). We find steep education gradients among Mexicans living in Mexico’s urban areas in five of six biomarkers of metabolic syndrome (MetS) and in the overall MetS score. Mexican migrants living in the United States experience similar patterns to Mexicans living in Mexico in glucose and obesity biomarkers. These results are inconsistent with previous findings, suggesting that Mexican migrants in the United States experience significantly attenuated health gradients relative to the non-Hispanic white U.S. population. Our empirical evidence also contradicts the idea that SES-health gradients in Mexico are shallower than those in the United States and could be invoked to explain shallower gradients among Mexicans living in the United States. PMID:27655408

  6. Assessment of Epstein-Barr virus nucleic acids in gastric but not in breast cancer by next-generation sequencing of pooled Mexican samples

    PubMed Central

    Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier

    2016-01-01

    Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline. PMID:26910355

  7. Comparative study of polymorphism frequencies of the CYP2D6, CYP3A5, CYP2C8 and IL-10 genes in Mexican and Spanish women with breast cancer.

    PubMed

    Alcazar-González, Gregorio Antonio; Calderón-Garcidueñas, Ana Laura; Garza-Rodríguez, María Lourdes; Rubio-Hernández, Gabriela; Escorza-Treviño, Sergio; Olano-Martin, Estibaliz; Cerda-Flores, Ricardo Martín; Castruita-Avila, Ana Lilia; González-Guerrero, Juan Francisco; le Brun, Stéphane; Simon-Buela, Laureano; Barrera-Saldaña, Hugo Alberto

    2013-10-01

    Pharmacogenetic studies in breast cancer (BC) may predict the efficacy of tamoxifen and the toxicity of paclitaxel and capecitabine. We determined the frequency of polymorphisms in the CYP2D6 gene associated with activation of tamoxifen, and those of the genes CYP2C8, CYP3A5 and DPYD associated with toxicity of paclitaxel and capecitabine. We also included a IL-10 gene polymorphism associated with advanced tumor stage at diagnosis. Genomic DNAs from 241 BC patients from northeast Mexico were genotyped using DNA microarray technology. For tamoxifen processing, CYP2D6 genotyping predicted that 90.8% of patients were normal metabolizers, 4.2% ultrarapid, 2.1% intermediate and 2.9% poor metabolizers. For paclitaxel and the CYP2C8 gene, 75.3% were normal, 23.4% intermediate and 1.3% poor metabolizers. Regarding the DPYD gene, only one patient was a poor metabolizer. For the IL-10 gene, 47.1% were poor metabolizers. These results contribute valuable information towards personalizing BC chemotherapy in Mexican women.

  8. Assessment of Epstein-Barr virus nucleic acids in gastric but not in breast cancer by next-generation sequencing of pooled Mexican samples.

    PubMed

    Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier

    2016-03-01

    Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline.

  9. eNOS gene Glu298Asp and 4b/a polymorphisms are associated with renal function parameters in Mexican patients with Fabry disease.

    PubMed

    Marin-Medina, A; Brambila-Tapia, A J L; Picos-Cárdenas, V J; Gallegos-Arreola, M P; Figuera, L E

    2016-10-24

    Fabry disease (FD) is an inherited X-linked lysosomal disease that causes renal failure in a high percentage of affected individuals. The eNOS gene encodes for endothelial nitric oxide synthase, which plays an important role in glomerular hemodynamics. This gene has two main polymorphisms (Glu298Asp and 4b/a) that have been studied in the context of many different diseases, including those involving cardiovascular and renal alterations. Considering the lack of information regarding eNOS variants and FD, we investigated whether there were associations between eNOS genetic variants and renal function parameters in Mexican patients with FD and renal impairment. In total, 15 FD patients with renal alterations were included in the present study, and associations between eNOS polymorphisms and renal function parameters (urea, creatinine, and GFR) were evaluated. The Asp298 and 4a alleles of the eNOS gene were found to be significantly associated with increased levels of urea and creatinine, and a decreased glomerular filtration rate in FD patients, and this association behaved in a co-dominant fashion. Our results coincide with previous reports showing an association between these polymorphisms and kidney disease, and along with other studies regarding their role in the nitric oxide pathway, suggest that these variants affect the severity of nephropathy in patients with FD.

  10. Using participatory methods to enhance patient-centred mental health care in a federally qualified community health center serving a Mexican American farmworker community.

    PubMed

    Ingram, Maia; Schachter, Ken A; Guernsey de Zapien, Jill; Herman, Patricia M; Carvajal, Scott C

    2015-12-01

    Mexican American farmworkers experience high rates of mental health conditions; however, it is difficult for them to access care. Patient-centred care is a systems-wide approach to improving the delivery of services for diverse populations in the primary care setting. We describe the application of community-based participatory research methods to assess and address gaps in perceptions of mental health care between providers and migrant workers living in a US-Mexico Border community. A federally qualified health centre (FQHC) serving a community of approximately 60 000 agricultural workers who live in Yuma County and harvest vegetables during the winter season. We conducted patient focus groups (n = 64) and FQHC staff interviews (n = 16) to explore attributes and dimensions of patient-centred mental health care. Patients and staff both prioritized increased access to mental health care and patient-centred care, while patients were more concerned with interpersonal care and providers with coordination of care. All participants stressed the relationship between life events and mental health and the centrality of family in care. Patients also emphasized the importance of a good attitude, the ability to solve problems, positive family relationships and reliance on faith. Patients suggested that the FQHC inform patients about mental health resources, provide community informational talks to address stigma, and offer support groups. The participatory approach of this qualitative study resulted in a wealth of data regarding patient preferences that will enable the FQHC to develop protocols and training to provide patient-centred mental health-care services for their community. © 2014 John Wiley & Sons Ltd.

  11. Patient dose estimation from CT scans at the Mexican National Neurology and Neurosurgery Institute

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alva-Sánchez, Héctor, E-mail: halva@ciencias.unam.mx; Reynoso-Mejía, Alberto; Casares-Cruz, Katiuzka

    In the radiology department of the Mexican National Institute of Neurology and Neurosurgery, a dedicated institute in Mexico City, on average 19.3 computed tomography (CT) examinations are performed daily on hospitalized patients for neurological disease diagnosis, control scans and follow-up imaging. The purpose of this work was to estimate the effective dose received by hospitalized patients who underwent a diagnostic CT scan using typical effective dose values for all CT types and to obtain the estimated effective dose distributions received by surgical and non-surgical patients. Effective patient doses were estimated from values per study type reported in the applications guidemore » provided by the scanner manufacturer. This retrospective study included all hospitalized patients who underwent a diagnostic CT scan between 1 January 2011 and 31 December 2012. A total of 8777 CT scans were performed in this two-year period. Simple brain scan was the CT type performed the most (74.3%) followed by contrasted brain scan (6.1%) and head angiotomography (5.7%). The average number of CT scans per patient was 2.83; the average effective dose per patient was 7.9 mSv; the mean estimated radiation dose was significantly higher for surgical (9.1 mSv) than non-surgical patients (6.0 mSv). Three percent of the patients had 10 or more brain CT scans and exceeded the organ radiation dose threshold set by the International Commission on Radiological Protection for deterministic effects of the eye-lens. Although radiation patient doses from CT scans were in general relatively low, 187 patients received a high effective dose (>20 mSv) and 3% might develop cataract from cumulative doses to the eye lens.« less

  12. Patient dose estimation from CT scans at the Mexican National Neurology and Neurosurgery Institute

    NASA Astrophysics Data System (ADS)

    Alva-Sánchez, Héctor; Reynoso-Mejía, Alberto; Casares-Cruz, Katiuzka; Taboada-Barajas, Jesús

    2014-11-01

    In the radiology department of the Mexican National Institute of Neurology and Neurosurgery, a dedicated institute in Mexico City, on average 19.3 computed tomography (CT) examinations are performed daily on hospitalized patients for neurological disease diagnosis, control scans and follow-up imaging. The purpose of this work was to estimate the effective dose received by hospitalized patients who underwent a diagnostic CT scan using typical effective dose values for all CT types and to obtain the estimated effective dose distributions received by surgical and non-surgical patients. Effective patient doses were estimated from values per study type reported in the applications guide provided by the scanner manufacturer. This retrospective study included all hospitalized patients who underwent a diagnostic CT scan between 1 January 2011 and 31 December 2012. A total of 8777 CT scans were performed in this two-year period. Simple brain scan was the CT type performed the most (74.3%) followed by contrasted brain scan (6.1%) and head angiotomography (5.7%). The average number of CT scans per patient was 2.83; the average effective dose per patient was 7.9 mSv; the mean estimated radiation dose was significantly higher for surgical (9.1 mSv) than non-surgical patients (6.0 mSv). Three percent of the patients had 10 or more brain CT scans and exceeded the organ radiation dose threshold set by the International Commission on Radiological Protection for deterministic effects of the eye-lens. Although radiation patient doses from CT scans were in general relatively low, 187 patients received a high effective dose (>20 mSv) and 3% might develop cataract from cumulative doses to the eye lens.

  13. Significant clinical impact of recurrent BRCA1 and BRCA2 mutations in Mexico.

    PubMed

    Villarreal-Garza, Cynthia; Alvarez-Gómez, Rosa María; Pérez-Plasencia, Carlos; Herrera, Luis A; Herzog, Josef; Castillo, Danielle; Mohar, Alejandro; Castro, Clementina; Gallardo, Lenny N; Gallardo, Dolores; Santibáñez, Miguel; Blazer, Kathleen R; Weitzel, Jeffrey N

    2015-02-01

    Frequent recurrent mutations in the breast and ovarian cancer susceptibility (BRCA) genes BRCA1 and BRCA2 among Hispanics, including a large rearrangement Mexican founder mutation (BRCA1 exon 9-12 deletion [ex9-12del]), suggest that an ancestry-informed BRCA-testing strategy could reduce disparities and promote cancer prevention by enabling economic screening for hereditary breast and ovarian cancer in Mexico. In a multistage approach, 188 patients with cancer who were unselected for family cancer history (92 with ovarian cancer and 96 with breast cancer) were screened for BRCA mutations using a Hispanic mutation panel (HISPANEL) of 115 recurrent mutations in a multiplex assay (114 were screened on a mass spectroscopy platform, and a polymerase chain reaction assay was used to screen for the BRCA1 ex9-12del mutation). This was followed by sequencing of all BRCA exons and adjacent intronic regions and a BRCA1 multiplex ligation-dependent probe amplification assay (MLPA) for HISPANEL-negative patients. BRCA mutation prevalence was calculated and correlated with histology and tumor receptor status, and HISPANEL sensitivity was estimated. BRCA mutations were detected in 26 of 92 patients (28%) with ovarian cancer, in 14 of 96 patients (15%) with breast cancer overall, and in 9 of 33 patients (27%) who had tumors that were negative for estrogen receptor, progesterone receptor, and human epithelial growth factor 2 (triple-negative breast cancer). Most patients with breast cancer were diagnosed with locally advanced disease. The Mexican founder mutation (BRCA1 ex9-12del) accounted for 35% of BRCA-associated ovarian cancers and 29% of BRCA-associated breast cancers. At 2% of the sequencing and MLPA cost, HISPANEL detected 68% of all BRCA mutations. In this study, a remarkably high prevalence of BRCA mutations was observed among patients with ovarian cancer and breast cancer who were not selected for family history, and the BRCA1 ex9-12del mutation explained 33% of the total. The remarkable frequency of BRCA1 ex9-12del in Mexico City supports a nearby origin of this Mexican founder mutation and may constitute a regional public health problem. The HISPANEL mutation panel presents a translational opportunity for cost-effective genetic testing to enable breast and ovarian cancer prevention. © 2014 American Cancer Society.

  14. Bilingual "Educación" in the Home: Everyday Mexican Immigrant Family Educational Practices

    ERIC Educational Resources Information Center

    Valdez, Verónica

    2015-01-01

    As we embrace the increasing numbers of young Mexican immigrant children and their families present in our schools, it is important for educators to better understand the many family educational practices present in these households. This article examines the strategies and resources utilized by two Mexican-born and two U.S.-born Mexican immigrant…

  15. The Mexican American Extended Family as an Emotional Support System.

    ERIC Educational Resources Information Center

    Keefe, Susan E.; And Others

    Using data gathered over a three-year period in three Southern California towns, the family structure and the reliance on kin for emotional support of Anglo Americans and Mexican Americans were compared. The first year 666 Mexican Americans and 340 Anglos were interviewed. In the second year, 372 Mexican Americans and 163 Anglos were…

  16. Cultural and Ethnic Awareness Manual for Professionals Working with Mexican-American Migrant Families.

    ERIC Educational Resources Information Center

    Montoya, Jose R.

    Intended as a tool for personnel in the helping professions who work with Chicano migrant families and have little or nor prior knowledge of their culture or history, the manual presents a historical and cultural perspective of the Mexican American migrant families. The six units cover Mexican American history, cultural awareness, Mexican American…

  17. Depression and Acculturation in Mexican-American Women.

    ERIC Educational Resources Information Center

    Masten, William G.

    It has been postulated that the result of the Mexican woman's inability to live up to the stiff requirements of her culture should show itself in depressive trends. These theories are often applied to the Mexican-American female as well. The aim of this study was to determine if acculturation is related to depression in Mexican-American females. A…

  18. Folk Arts in the Home: New Mexican Tinwork.

    ERIC Educational Resources Information Center

    Gomez, Aurelia; Sullivan, Laura Temple

    New Mexican tinwork is a folk art tradition that developed out of Mexican and European silver work. Due to a lack of silver in New Mexico, tin became the material of choice. Rooted in European Hispanic traditions, this contemporary craft is yet another example of the resourceful ingenuity and adaptation that characterizes many New Mexican folk…

  19. Mexico: Failing State or Emerging Democracy?

    DTIC Science & Technology

    2011-03-01

    were dominated by The Institutional Revolutionary Party, or PRI. Mexican politics largely resembled the subliminally oppressive conditions... communications equipment, while Mexican security forces have only austere capabilities.27 The Mexican Federal Police and the Mexican Army killed...economic and government institutions. Mexico joins a community U.S. Defense Secretary Robert M. Gates, Chairman of the Joint Chiefs of Staff Admiral

  20. Mexican and Mexican American Student Reflections on Transfer: Institutional Agents and the Continued Role of the Community College

    ERIC Educational Resources Information Center

    Cortez, Edén; Castro, Erin L.

    2017-01-01

    This qualitative analysis draws upon the experiences of six Mexican and Mexican American community college transfer students during the 2012-2013 academic year. Relying on literature regarding institutional agents, we examine students' reflections regarding pre- and post-transfer support from both institutional agents and structured student…

  1. Family Attitudes Among Mexican-American and Anglo-American Parents in San Jose, California.

    ERIC Educational Resources Information Center

    Rusmore, Jay T.; Kirmeyer, Sandra L.

    Home interviews were used to investigate the degree to which Mexican American parents have retained traditional Mexican family attitudes and childrearing practices. Respondents were 118 Mexican American and 148 Anglo American parents, residing in the same working-class neighborhoods in San Jose, California, who were married to persons of the same…

  2. El Arte Culinario Mexicano (Mexican Culinary Art).

    ERIC Educational Resources Information Center

    Card, Michelle

    This unit in Mexican cooking can be used in Junior High School home economics classes to introduce students to Mexican culture or as a mini-course in Spanish at almost any level. It is divided into two parts. Part One provides historical background and information on basic foods, the Mexican market, shopping tips, regional cooking and customs.…

  3. 7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 5 2013-01-01 2013-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

  4. 7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 5 2011-01-01 2011-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

  5. 7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

  6. 7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 5 2014-01-01 2014-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

  7. 7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 5 2012-01-01 2012-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

  8. Legally White, Socially "Mexican": The Politics of De Jure and De Facto School Segregation in the American Southwest

    ERIC Educational Resources Information Center

    Donato, Ruben; Hanson, Jarrod S.

    2012-01-01

    The history of Mexican American school segregation is complex, often misunderstood, and currently unresolved. The literature suggests that Mexican Americans experienced de facto segregation because it was local custom and never sanctioned at the state level in the American Southwest. However, the same literature suggests that Mexican Americans…

  9. Drug and Alcohol Use among Rural Mexican-Americans.

    ERIC Educational Resources Information Center

    Castro, Felipe G.; Gutierres, Sara

    Very little research has examined drug and alcohol use among rural Mexican-Americans, and the few existing studies have yielded mixed results. Some authors have suggested that substance use by Mexican-American youth is similar to that of Anglo youth, but at least one study has shown that Mexican-American females use drugs at a higher rate than do…

  10. The Retention of Mexican American Students in Higher Education with Special Reference to Bicultural and Bilingual Problems.

    ERIC Educational Resources Information Center

    Guerra, Manuel H.; And Others

    The problem of retaining Mexican American students in institutions of higher education is reviewed in these 5 papers: "The Retention of Mexican American Students in Higher Education with Special Reference to Bicultural and Bilingual Problems" by Manuel H. Guerra; "Mexicanismo vs. Retention: Implications of Retaining Mexican American…

  11. An Instructional Model on Mexican Culture.

    ERIC Educational Resources Information Center

    Finer, Neal

    The document presents a content outline of Mexican and Mexican American culture in seven units. It is adaptable for use at elementary, secondary, and college levels in bilingual and multicultural-oriented classes. Two charts introduce the units: (1) a reverse time line of Mexican culture from 1979 back to 1000 B.C.; and (2) a cause-effect chart…

  12. Mexican/Mexican American Adolescents and "Keepin' It REAL": An Evidence-Based Substance Use Prevention Program

    ERIC Educational Resources Information Center

    Kulis, Stephen; Marsiglia, Flavio F.; Elek, Elvira; Dustman, Patricia; Wagstaff, David A.; Hecht, Michael L.

    2005-01-01

    A randomized trial tested the efficacy of three curriculum versions teaching drug resistance strategies, one modeled on Mexican American culture; another modeled on European American and African American culture; and a multicultural version. Self-report data at baseline and 14 months post-intervention were obtained from 3,402 Mexican heritage…

  13. Self-Knowledge and Identity in a Mexican American Counseling Course: A Qualitative Exploration

    ERIC Educational Resources Information Center

    Zamarripa, Manuel X.; Lane, Ileana; Lerma, Eunice; Holin, Lyle, II

    2011-01-01

    This study explores the lived experiences of Mexican American graduate students who completed a course on Mexican American counseling and mental health. The experiences of Mexican American students taking a mental health course that focuses on their own ethnic group has not been previously discussed in the literature. Given the history of…

  14. [Dichotic perception of Mandarin third tone by Mexican Chinese learners].

    PubMed

    Wang, Hongbin

    2014-05-01

    To investigate the relationship between the advantage ear (cerebral hemisphere) of Spanish-speaking Mexican learners and the third Chinese tone. Third tone Chinese vowel syllables were used as experimental materials with dichotic listening technology to test the Spanish-speaking Mexican Chinese learners (20-32 years old) who studied Chinese about 20 h. In terms of error rates to identify the third Chinese tone, the Spanish-speaking Mexican Chinese learners's reaction to the third tone suggested that their left ears were the advantageous ear (the right cerebral hemisphere) (Z=-2.091, P=0.036). The verbal information of tones influenced the perception of Mexican Chinese learners' mandarin tones. In the process of learning mandarin tones, Mexican Chinese learners gradually formed the category of tones.

  15. “Only the Best Class of Immigration”

    PubMed Central

    Abel, Emily K.

    2004-01-01

    Public health officials contributed to the early 20thcentury campaign against Mexicans and Filipinos in Los Angeles. In 1914, the newly established city and county health departments confronted the overwhelming task of building a public health infrastructure for a rapidly growing population spread over a large area. However, for several years public health reports focused almost exclusively on the various infectious diseases associated with Mexican immigrants. Although the segregation of Mexicans was illegal in California until 1935, county officials established separate clinics for Whites and Mexicans during the 1920s. With assistance from state officials, local health authorities participated actively in efforts to restrict Mexican immigration throughout the 1920s and to expel both Mexicans and Filipinos during the 1930s. PMID:15249292

  16. [Constitutional analysis of Mexican Official Norm NOM-174-SSA1-1998 for the handling of obesity].

    PubMed

    Cossío Díaz, José Ramón

    2013-01-01

    The First Chamber of the Mexican Supreme Court of Justice decided, by a majority of four votes, on a case where it had to be evaluated if some articles of a Mexican Official Norm (NOM) on obesity violated human rights. The majority in the chamber concluded that the restrictions went against Medics' prescribing or therapeutic rights, and therefore their freedom to work. Justice Cossío Díaz voted against the judgment and wrote a separate opinion where he holds, first of all, that the prescribing right works as a guideline for the medical profession and is not an essential element of the freedom to work. Secondly, he points out that the freedom to work is not an absolute right, for it has certain limits permitted by the Constitution. Consequently, experts' opinions should have been consulted for them to be able to determine if the NOM´s requirements were in accordance with the Constitution. Finally, he considers that the judgment should have introduced a balancing test between freedom to work and the patient's health rights, since this last-mentioned right was what the NOM intended to protect.

  17. Canaries in a Coalmine: Immigration and Overweight among Mexican-origin Children in the US and Mexico

    PubMed Central

    Van Hook, Jennifer; Baker, Elizabeth; Altman, Claire E.; Frisco, Michelle

    2011-01-01

    The prevalence of overweight is higher for Hispanic children of immigrants than children of natives. This does not fit the pattern of the epidemiological paradox; the widely supported finding that immigrants tend to be healthier than their U.S.-born peers, and it suggests that exposure to the U.S. increases immigrant children’s risk of overweight. This study’s primary contribution is to better assess how exposure to the U.S. environment affects childhood overweight among a homogamous ethnic group, Mexican-Americans. We do so by using an innovative binational study design to compare the weight of Mexican-American children of immigrants, Mexican-American children of natives, and Mexican children in Mexico with different propensities of having immigrant parents. Cross-sectional data are derived from a pooled sample of 9,982 6–19 year old children living in either Mexico or the United States in the early 2000s. Mexican-resident children with a very high propensity to have immigrant parents have significantly lower percentile BMIs and lower odds of overweight than Mexican children with lower propensities of emigration and U.S.-resident Mexican-American children. This suggests that selection into immigration streams does not account for the high prevalence of overweight among children of Mexican immigrants. Rather, U.S. exposure significantly raises children of Mexican immigrants’ risk of being overweight. Moreover, second generation children have the highest percentile BMIs and greatest odds of overweight of all comparison groups, including children of natives. This suggests that they experience risks above and beyond the effects of exposure to American society. PMID:22153862

  18. Genome-Wide Analysis of SNPs Is Consistent with No Domestic Dog Ancestry in the Endangered Mexican Wolf (Canis lupus baileyi).

    PubMed

    Fitak, Robert R; Rinkevich, Sarah E; Culver, Melanie

    2018-05-11

    The Mexican gray wolf (Canis lupus baileyi) was historically distributed throughout the southwestern United States and northern Mexico. Extensive predator removal campaigns during the early 20th century, however, resulted in its eventual extirpation by the mid 1980s. At this time, the Mexican wolf existed only in 3 separate captive lineages (McBride, Ghost Ranch, and Aragón) descended from 3, 2, and 2 founders, respectively. These lineages were merged in 1995 to increase the available genetic variation, and Mexican wolves were reintroduced into Arizona and New Mexico in 1998. Despite the ongoing management of the Mexican wolf population, it has been suggested that a proportion of the Mexican wolf ancestry may be recently derived from hybridization with domestic dogs. In this study, we genotyped 87 Mexican wolves, including individuals from all 3 captive lineages and cross-lineage wolves, for more than 172000 single nucleotide polymorphisms. We identified levels of genetic variation consistent with the pedigree record and effects of genetic rescue. To identify the potential to detect hybridization with domestic dogs, we compared our Mexican wolf genotypes with those from studies of domestic dogs and other gray wolves. The proportion of Mexican wolf ancestry assigned to domestic dogs was only between 0.06% (SD 0.23%) and 7.8% (SD 1.0%) for global and local ancestry estimates, respectively; and was consistent with simulated levels of incomplete lineage sorting. Overall, our results suggested that Mexican wolves lack biologically significant ancestry with dogs and have useful implications for the conservation and management of this endangered wolf subspecies.

  19. Genome-wide analysis of SNPs is consistent with no domestic dog ancestry in the endangered Mexican Wolf (Canis lupus baileyi)

    USGS Publications Warehouse

    Fitak, Robert R.; Rinkevich, Sarah E.; Culver, Melanie

    2018-01-01

    The Mexican gray wolf (Canis lupus baileyi) was historically distributed throughout the southwestern United States and northern Mexico. Extensive predator removal campaigns during the early 20th century, however, resulted in its eventual extirpation by the mid 1980s. At this time, the Mexican wolf existed only in 3 separate captive lineages (McBride, Ghost Ranch, and Aragón) descended from 3, 2, and 2 founders, respectively. These lineages were merged in 1995 to increase the available genetic variation, and Mexican wolves were reintroduced into Arizona and New Mexico in 1998. Despite the ongoing management of the Mexican wolf population, it has been suggested that a proportion of the Mexican wolf ancestry may be recently derived from hybridization with domestic dogs. In this study, we genotyped 87 Mexican wolves, including individuals from all 3 captive lineages and cross-lineage wolves, for more than 172000 single nucleotide polymorphisms. We identified levels of genetic variation consistent with the pedigree record and effects of genetic rescue. To identify the potential to detect hybridization with domestic dogs, we compared our Mexican wolf genotypes with those from studies of domestic dogs and other gray wolves. The proportion of Mexican wolf ancestry assigned to domestic dogs was only between 0.06% (SD 0.23%) and 7.8% (SD 1.0%) for global and local ancestry estimates, respectively; and was consistent with simulated levels of incomplete lineage sorting. Overall, our results suggested that Mexican wolves lack biologically significant ancestry with dogs and have useful implications for the conservation and management of this endangered wolf subspecies.

  20. Longitudinal Lung Function Growth of Mexican Children Compared with International Studies

    PubMed Central

    Martínez-Briseño, David; Fernández-Plata, Rosario; Gochicoa-Rangel, Laura; Torre-Bouscoulet, Luis; Rojas-Martínez, Rosalba; Mendoza, Laura; García-Sancho, Cecilia; Pérez-Padilla, Rogelio

    2013-01-01

    Introduction Our aim was to compare the longitudinal lung function growth of Mexican children and adolescents with the collated spirometric reference proposed for international use and with that of Mexican-Americans from the National Health State Examination Survey III (NHANES) III study. Materials and Methods A cohort of Mexican children in third year of primary school was followed with spirometry twice a year through secondary school. Multilevel mixed-effects lineal models separated by gender were fit for the spirometric variables of 2,641 respiratory-healthy Mexican children expressed as Z-scores of tested reference equations. Impact of adjustment by sitting height on differences with Mexican-American children was observed in a subsample of 1,987 children. Results At same gender, age, and height, Mexican children had increasingly higher forced expiratory volume in 1 s (FEV1) and Forced vital capacity (FVC) than the children from the collated reference study (mean Z-score, 0.68 for FEV1 and 0.51 for FVC) and than Mexican-American children (Z-score, 0.23 for FEV1 and 0.21 for FVC) respectively. Differences with Mexican-Americans were not reduced by adjusting by sitting height. Conclusions For reasons that remain unclear, the gender-, age-, and height-adjusted lung function of children from Mexico City is higher than that reported by several international studies. PMID:24143231

Top