Sample records for mice imaging analysis

  1. Molecular imaging assessment of periodontitis lesions in an experimental mouse model.

    PubMed

    Ideguchi, Hidetaka; Yamashiro, Keisuke; Yamamoto, Tadashi; Shimoe, Masayuki; Hongo, Shoichi; Kochi, Shinsuke; Yoshihara-Hirata, Chiaki; Aoyagi, Hiroaki; Kawamura, Mari; Takashiba, Shogo

    2018-06-06

    We aimed to evaluate molecular imaging as a novel diagnostic tool for mice periodontitis model induced by ligature and Porphyromonas gingivalis (Pg) inoculation. Twelve female mice were assigned to the following groups: no treatment as control group (n = 4); periodontitis group induced by ligature and Pg as Pg group (n = 4); and Pg group treated with glycyrrhizinic acid (GA) as Pg + GA group (n = 4). All mice were administered a myeloperoxidase (MPO) activity-specific luminescent probe and observed using a charge-coupled device camera on day 14. Image analysis on all mice was conducted using software to determine the signal intensity of inflammation. Additionally, histological and radiographic evaluation for periodontal inflammation and bone resorption at the site of periodontitis, and quantitative enzyme-linked immunosorbent assay (ELISA) were conducted on three mice for each group. Each experiment was performed three times. Levels of serum IgG antibody against P. gingivalis were significantly higher in the Pg than in the Pg + GA group. Histological analyses indicated that the number of osteoclasts and neutrophils were significantly lower in the Pg + GA than in the Pg group. Micro-CT image analysis indicated no difference in bone resorption between the Pg and Pg + GA groups. The signal intensity of MPO activity was detected on the complete craniofacial image; moreover, strong signal intensity was localized specifically at the periodontitis site in the ex vivo palate, with group-wise differences. Molecular imaging analysis based on MPO activity showed high sensitivity of detection of periodontal inflammation in mice. Molecular imaging analysis based on MPO activity has potential as a diagnostic tool for periodontitis.

  2. Magnetic resonance imaging for monitoring therapeutic response in a transgenic mouse model of Alzheimer's disease using voxel-based analysis of amyloid plaques.

    PubMed

    Kim, Jae-Hun; Ha, Tae Lin; Im, Geun Ho; Yang, Jehoon; Seo, Sang Won; Chung, Julius Juhyun; Chae, Sun Young; Lee, In Su; Lee, Jung Hee

    2014-03-05

    In this study, we have shown the potential of a voxel-based analysis for imaging amyloid plaques and its utility in monitoring therapeutic response in Alzheimer's disease (AD) mice using manganese oxide nanoparticles conjugated with an antibody of Aβ1-40 peptide (HMON-abAβ40). T1-weighted MR brain images of a drug-treated AD group (n=7), a nontreated AD group (n=7), and a wild-type group (n=7) were acquired using a 7.0 T MRI system before (D-1), 24-h (D+1) after, and 72-h (D+3) after injection with an HMON-abAβ40 contrast agent. For the treatment of AD mice, DAPT was injected intramuscularly into AD transgenic mice (50 mg/kg of body weight). For voxel-based analysis, the skull-stripped mouse brain images were spatially normalized, and these voxels' intensities were corrected to reduce voxel intensity differences across scans in different mice. Statistical analysis showed higher normalized MR signal intensity in the frontal cortex and hippocampus of AD mice over wild-type mice on D+1 and D+3 (P<0.01, uncorrected for multiple comparisons). After the treatment of AD mice, the normalized MR signal intensity in the frontal cortex and hippocampus decreased significantly in comparison with nontreated AD mice on D+1 and D+3 (P<0.01, uncorrected for multiple comparisons). These results were confirmed by histological analysis using a thioflavin staining. This unique strategy allows us to detect brain regions that are subjected to amyloid plaque deposition and has the potential for human applications in monitoring therapeutic response for drug development in AD.

  3. Brain and Brown Adipose Tissue Metabolism in Transgenic Tg2576 Mice Models of Alzheimer Disease Assessed Using 18F-FDG PET Imaging

    PubMed Central

    Coleman, Robert A.; Liang, Christopher; Patel, Rima; Ali, Sarah

    2017-01-01

    Objective: Imaging animal models of Alzheimer disease (AD) is useful for the development of therapeutic drugs and understanding AD. Transgenic Swedish hAPPswe Tg2576 mice are a good model of β-amyloid plaques. We report 18F-fluoro-2-deoxyglucose (18F-FDG) positron emission tomography (PET) imaging of brain and intrascapular brown adipose tissue (IBAT) in transgenic mice 2576 (Tg2576) and wild-type (WT) mice. Methods: Transgenic Tg2576 mice and WT mice, >18 months were injected intraperitonally with ≈ 25 to 30 MBq 18F-FDG while awake. After 60 minutes, they were anesthetized with isoflurane (2.5%) and imaged with Inveon MicroPET. Select mice were killed, imaged ex vivo, and 20 µm sections cut for autoradiography. 18F-FDG uptake in brain and IBAT PET and brain autoradiographs were analyzed. Results: Fasting blood glucose levels averaged 120 mg/dL for WT and 100 mg/dL for Tg2576. Compared to WT, Tg2576 mice exhibited a decrease in SUVglc in the various brain regions. Average reductions in the cerebrum regions were as high as −20%, while changes in cerebellum were −3%. Uptake of 18F-FDG in IBAT decreased by −60% in Tg2576 mice and was found to be significant. Intrascapular brown adipose tissue findings in Tg2576 mice are new and not previously reported. Use of blood glucose for PET data analysis and corpus callosum as reference region for autoradiographic analysis were important to detect change in Tg2576 mice. Conclusion: Our results suggest that 18F-FDG uptake in the Tg2576 mice brain show 18F-FDG deficits only when blood glucose is taken into consideration. PMID:28654383

  4. Continuous monitoring of arthritis in animal models using optical imaging modalities

    NASA Astrophysics Data System (ADS)

    Son, Taeyoon; Yoon, Hyung-Ju; Lee, Saseong; Jang, Won Seuk; Jung, Byungjo; Kim, Wan-Uk

    2014-10-01

    Given the several difficulties associated with histology, including difficulty in continuous monitoring, this study aimed to investigate the feasibility of optical imaging modalities-cross-polarization color (CPC) imaging, erythema index (EI) imaging, and laser speckle contrast (LSC) imaging-for continuous evaluation and monitoring of arthritis in animal models. C57BL/6 mice, used for the evaluation of arthritis, were divided into three groups: arthritic mice group (AMG), positive control mice group (PCMG), and negative control mice group (NCMG). Complete Freund's adjuvant, mineral oil, and saline were injected into the footpad for AMG, PCMG, and NCMG, respectively. LSC and CPC images were acquired from 0 through 144 h after injection for all groups. EI images were calculated from CPC images. Variations in feet area, EI, and speckle index for each mice group over time were calculated for quantitative evaluation of arthritis. Histological examinations were performed, and the results were found to be consistent with those from optical imaging analysis. Thus, optical imaging modalities may be successfully applied for continuous evaluation and monitoring of arthritis in animal models.

  5. Fluorine-19 magnetic resonance imaging probe for the detection of tau pathology in female rTg4510 mice.

    PubMed

    Yanagisawa, Daijiro; Ibrahim, Nor Faeizah; Taguchi, Hiroyasu; Morikawa, Shigehiro; Kato, Tomoko; Hirao, Koichi; Shirai, Nobuaki; Sogabe, Takayuki; Tooyama, Ikuo

    2018-05-01

    Aggregation of tau into neurofibrillary tangles (NFTs) is characteristic of tauopathies, including Alzheimer's disease. Recent advances in tau imaging have attracted much attention because of its potential contributions to early diagnosis and monitoring of disease progress. Fluorine-19 magnetic resonance imaging ( 19 F-MRI) may be extremely useful for tau imaging once a high-quality probe has been formulated. In this investigation, a novel fluorine-19-labeling compound has been developed as a probe for tau imaging using 19 F-MRI. This compound is a buta-1,3-diene derivative with a polyethylene glycol side chain bearing a CF 3 group and is known as Shiga-X35. Female rTg4510 mice (a mouse model of tauopathy) and wild-type mice were intravenously injected with Shiga-X35, and magnetic resonance imaging of each mouse's head was conducted in a 7.0-T horizontal-bore magnetic resonance scanner. The 19 F-MRI in rTg4510 mice showed an intense signal in the forebrain region. Analysis of the signal intensity in the forebrain region revealed a significant accumulation of fluorine-19 magnetic resonance signal in the rTg4510 mice compared with the wild-type mice. Histological analysis showed fluorescent signals of Shiga-X35 binding to the NFTs in the brain sections of rTg4510 mice. Data collected as part of this investigation indicate that 19 F-MRI using Shiga-X35 could be a promising tool to evaluate tau pathology in the brain. © 2017 Wiley Periodicals, Inc.

  6. Visualisation and quantitative analysis of the rodent malaria liver stage by real time imaging.

    PubMed

    Ploemen, Ivo H J; Prudêncio, Miguel; Douradinha, Bruno G; Ramesar, Jai; Fonager, Jannik; van Gemert, Geert-Jan; Luty, Adrian J F; Hermsen, Cornelus C; Sauerwein, Robert W; Baptista, Fernanda G; Mota, Maria M; Waters, Andrew P; Que, Ivo; Lowik, Clemens W G M; Khan, Shahid M; Janse, Chris J; Franke-Fayard, Blandine M D

    2009-11-18

    The quantitative analysis of Plasmodium development in the liver in laboratory animals in cultured cells is hampered by low parasite infection rates and the complicated methods required to monitor intracellular development. As a consequence, this important phase of the parasite's life cycle has been poorly studied compared to blood stages, for example in screening anti-malarial drugs. Here we report the use of a transgenic P. berghei parasite, PbGFP-Luc(con), expressing the bioluminescent reporter protein luciferase to visualize and quantify parasite development in liver cells both in culture and in live mice using real-time luminescence imaging. The reporter-parasite based quantification in cultured hepatocytes by real-time imaging or using a microplate reader correlates very well with established quantitative RT-PCR methods. For the first time the liver stage of Plasmodium is visualized in whole bodies of live mice and we were able to discriminate as few as 1-5 infected hepatocytes per liver in mice using 2D-imaging and to identify individual infected hepatocytes by 3D-imaging. The analysis of liver infections by whole body imaging shows a good correlation with quantitative RT-PCR analysis of extracted livers. The luminescence-based analysis of the effects of various drugs on in vitro hepatocyte infection shows that this method can effectively be used for in vitro screening of compounds targeting Plasmodium liver stages. Furthermore, by analysing the effect of primaquine and tafenoquine in vivo we demonstrate the applicability of real time imaging to assess parasite drug sensitivity in the liver. The simplicity and speed of quantitative analysis of liver-stage development by real-time imaging compared to the PCR methodologies, as well as the possibility to analyse liver development in live mice without surgery, opens up new possibilities for research on Plasmodium liver infections and for validating the effect of drugs and vaccines on the liver stage of Plasmodium.

  7. Visualisation and Quantitative Analysis of the Rodent Malaria Liver Stage by Real Time Imaging

    PubMed Central

    Douradinha, Bruno G.; Ramesar, Jai; Fonager, Jannik; van Gemert, Geert-Jan; Luty, Adrian J. F.; Hermsen, Cornelus C.; Sauerwein, Robert W.; Baptista, Fernanda G.; Mota, Maria M.; Waters, Andrew P.; Que, Ivo; Lowik, Clemens W. G. M.; Khan, Shahid M.; Janse, Chris J.; Franke-Fayard, Blandine M. D.

    2009-01-01

    The quantitative analysis of Plasmodium development in the liver in laboratory animals in cultured cells is hampered by low parasite infection rates and the complicated methods required to monitor intracellular development. As a consequence, this important phase of the parasite's life cycle has been poorly studied compared to blood stages, for example in screening anti-malarial drugs. Here we report the use of a transgenic P. berghei parasite, PbGFP-Luccon, expressing the bioluminescent reporter protein luciferase to visualize and quantify parasite development in liver cells both in culture and in live mice using real-time luminescence imaging. The reporter-parasite based quantification in cultured hepatocytes by real-time imaging or using a microplate reader correlates very well with established quantitative RT-PCR methods. For the first time the liver stage of Plasmodium is visualized in whole bodies of live mice and we were able to discriminate as few as 1–5 infected hepatocytes per liver in mice using 2D-imaging and to identify individual infected hepatocytes by 3D-imaging. The analysis of liver infections by whole body imaging shows a good correlation with quantitative RT-PCR analysis of extracted livers. The luminescence-based analysis of the effects of various drugs on in vitro hepatocyte infection shows that this method can effectively be used for in vitro screening of compounds targeting Plasmodium liver stages. Furthermore, by analysing the effect of primaquine and tafenoquine in vivo we demonstrate the applicability of real time imaging to assess parasite drug sensitivity in the liver. The simplicity and speed of quantitative analysis of liver-stage development by real-time imaging compared to the PCR methodologies, as well as the possibility to analyse liver development in live mice without surgery, opens up new possibilities for research on Plasmodium liver infections and for validating the effect of drugs and vaccines on the liver stage of Plasmodium. PMID:19924309

  8. Phenotype detection in morphological mutant mice using deformation features.

    PubMed

    Roy, Sharmili; Liang, Xi; Kitamoto, Asanobu; Tamura, Masaru; Shiroishi, Toshihiko; Brown, Michael S

    2013-01-01

    Large-scale global efforts are underway to knockout each of the approximately 25,000 mouse genes and interpret their roles in shaping the mammalian embryo. Given the tremendous amount of data generated by imaging mutated prenatal mice, high-throughput image analysis systems are inevitable to characterize mammalian development and diseases. Current state-of-the-art computational systems offer only differential volumetric analysis of pre-defined anatomical structures between various gene-knockout mice strains. For subtle anatomical phenotypes, embryo phenotyping still relies on the laborious histological techniques that are clearly unsuitable in such big data environment. This paper presents a system that automatically detects known phenotypes and assists in discovering novel phenotypes in muCT images of mutant mice. Deformation features obtained from non-linear registration of mutant embryo to a normal consensus average image are extracted and analyzed to compute phenotypic and candidate phenotypic areas. The presented system is evaluated using C57BL/10 embryo images. All cases of ventricular septum defect and polydactyly, well-known to be present in this strain, are successfully detected. The system predicts potential phenotypic areas in the liver that are under active histological evaluation for possible phenotype of this mouse line.

  9. Alzheimer disease in a mouse model: MR imaging-guided focused ultrasound targeted to the hippocampus opens the blood-brain barrier and improves pathologic abnormalities and behavior.

    PubMed

    Burgess, Alison; Dubey, Sonam; Yeung, Sharon; Hough, Olivia; Eterman, Naomi; Aubert, Isabelle; Hynynen, Kullervo

    2014-12-01

    To validate whether repeated magnetic resonance (MR) imaging-guided focused ultrasound treatments targeted to the hippocampus, a brain structure relevant for Alzheimer disease ( AD Alzheimer disease ), could modulate pathologic abnormalities, plasticity, and behavior in a mouse model. All animal procedures were approved by the Animal Care Committee and are in accordance with the Canadian Council on Animal Care. Seven-month-old transgenic (TgCRND8) (Tg) mice and their nontransgenic (non-Tg) littermates were entered in the study. Mice were treated weekly with MR imaging-guided focused ultrasound in the bilateral hippocampus (1.68 MHz, 10-msec bursts, 1-Hz burst repetition frequency, 120-second total duration). After 1 month, spatial memory was tested in the Y maze with the novel arm prior to sacrifice and immunohistochemical analysis. The data were compared by using unpaired t tests and analysis of variance with Tukey post hoc analysis. Untreated Tg mice spent 61% less time than untreated non-Tg mice exploring the novel arm of the Y maze because of spatial memory impairments (P < .05). Following MR imaging-guided focused ultrasound, Tg mice spent 99% more time exploring the novel arm, performing as well as their non-Tg littermates. Changes in behavior were correlated with a reduction of the number and size of amyloid plaques in the MR imaging-guided focused ultrasound-treated animals (P < .01). Further, after MR imaging-guided focused ultrasound treatment, there was a 250% increase in the number of newborn neurons in the hippocampus (P < .01). The newborn neurons had longer dendrites and more arborization after MR imaging-guided focused ultrasound, as well (P < .01). Repeated MR imaging-guided focused ultrasound treatments led to spatial memory improvement in a Tg mouse model of AD Alzheimer disease . The behavior changes may be mediated by decreased amyloid pathologic abnormalities and increased neuronal plasticity. © RSNA, 2014.

  10. High-resolution dynamic imaging and quantitative analysis of lung cancer xenografts in nude mice using clinical PET/CT

    PubMed Central

    Wang, Ying Yi; Wang, Kai; Xu, Zuo Yu; Song, Yan; Wang, Chu Nan; Zhang, Chong Qing; Sun, Xi Lin; Shen, Bao Zhong

    2017-01-01

    Considering the general application of dedicated small-animal positron emission tomography/computed tomography is limited, an acceptable alternative in many situations might be clinical PET/CT. To estimate the feasibility of using clinical PET/CT with [F-18]-fluoro-2-deoxy-D-glucose for high-resolution dynamic imaging and quantitative analysis of cancer xenografts in nude mice. Dynamic clinical PET/CT scans were performed on xenografts for 60 min after injection with [F-18]-fluoro-2-deoxy-D-glucose. Scans were reconstructed with or without SharpIR method in two phases. And mice were sacrificed to extracting major organs and tumors, using ex vivo γ-counting as a reference. Strikingly, we observed that the image quality and the correlation between the all quantitive data from clinical PET/CT and the ex vivo counting was better with the SharpIR reconstructions than without. Our data demonstrate that clinical PET/CT scanner with SharpIR reconstruction is a valuable tool for imaging small animals in preclinical cancer research, offering dynamic imaging parameters, good image quality and accurate data quatification. PMID:28881772

  11. High-resolution dynamic imaging and quantitative analysis of lung cancer xenografts in nude mice using clinical PET/CT.

    PubMed

    Wang, Ying Yi; Wang, Kai; Xu, Zuo Yu; Song, Yan; Wang, Chu Nan; Zhang, Chong Qing; Sun, Xi Lin; Shen, Bao Zhong

    2017-08-08

    Considering the general application of dedicated small-animal positron emission tomography/computed tomography is limited, an acceptable alternative in many situations might be clinical PET/CT. To estimate the feasibility of using clinical PET/CT with [F-18]-fluoro-2-deoxy-D-glucose for high-resolution dynamic imaging and quantitative analysis of cancer xenografts in nude mice. Dynamic clinical PET/CT scans were performed on xenografts for 60 min after injection with [F-18]-fluoro-2-deoxy-D-glucose. Scans were reconstructed with or without SharpIR method in two phases. And mice were sacrificed to extracting major organs and tumors, using ex vivo γ-counting as a reference. Strikingly, we observed that the image quality and the correlation between the all quantitive data from clinical PET/CT and the ex vivo counting was better with the SharpIR reconstructions than without. Our data demonstrate that clinical PET/CT scanner with SharpIR reconstruction is a valuable tool for imaging small animals in preclinical cancer research, offering dynamic imaging parameters, good image quality and accurate data quatification.

  12. Imaging Lung Function in Mice Using SPECT/CT and Per-Voxel Analysis

    PubMed Central

    Jobse, Brian N.; Rhem, Rod G.; McCurry, Cory A. J. R.; Wang, Iris Q.; Labiris, N. Renée

    2012-01-01

    Chronic lung disease is a major worldwide health concern but better tools are required to understand the underlying pathologies. Ventilation/perfusion (V/Q) single photon emission computed tomography (SPECT) with per-voxel analysis allows for non-invasive measurement of regional lung function. A clinically adapted V/Q methodology was used in healthy mice to investigate V/Q relationships. Twelve week-old mice were imaged to describe normal lung function while 36 week-old mice were imaged to determine how age affects V/Q. Mice were ventilated with Technegas™ and injected with 99mTc-macroaggregated albumin to trace ventilation and perfusion, respectively. For both processes, SPECT and CT images were acquired, co-registered, and quantitatively analyzed. On a per-voxel basis, ventilation and perfusion were moderately correlated (R = 0.58±0.03) in 12 week old animals and a mean log(V/Q) ratio of −0.07±0.01 and standard deviation of 0.36±0.02 were found, defining the extent of V/Q matching. In contrast, 36 week old animals had significantly increased levels of V/Q mismatching throughout the periphery of the lung. Measures of V/Q were consistent across healthy animals and differences were observed with age demonstrating the capability of this technique in quantifying lung function. Per-voxel analysis and the ability to non-invasively assess lung function will aid in the investigation of chronic lung disease models and drug efficacy studies. PMID:22870297

  13. Facilitating in vivo tumor localization by principal component analysis based on dynamic fluorescence molecular imaging

    NASA Astrophysics Data System (ADS)

    Gao, Yang; Chen, Maomao; Wu, Junyu; Zhou, Yuan; Cai, Chuangjian; Wang, Daliang; Luo, Jianwen

    2017-09-01

    Fluorescence molecular imaging has been used to target tumors in mice with xenograft tumors. However, tumor imaging is largely distorted by the aggregation of fluorescent probes in the liver. A principal component analysis (PCA)-based strategy was applied on the in vivo dynamic fluorescence imaging results of three mice with xenograft tumors to facilitate tumor imaging, with the help of a tumor-specific fluorescent probe. Tumor-relevant features were extracted from the original images by PCA and represented by the principal component (PC) maps. The second principal component (PC2) map represented the tumor-related features, and the first principal component (PC1) map retained the original pharmacokinetic profiles, especially of the liver. The distribution patterns of the PC2 map of the tumor-bearing mice were in good agreement with the actual tumor location. The tumor-to-liver ratio and contrast-to-noise ratio were significantly higher on the PC2 map than on the original images, thus distinguishing the tumor from its nearby fluorescence noise of liver. The results suggest that the PC2 map could serve as a bioimaging marker to facilitate in vivo tumor localization, and dynamic fluorescence molecular imaging with PCA could be a valuable tool for future studies of in vivo tumor metabolism and progression.

  14. Automated quantification of pancreatic β-cell mass

    PubMed Central

    Golson, Maria L.; Bush, William S.

    2014-01-01

    β-Cell mass is a parameter commonly measured in studies of islet biology and diabetes. However, the rigorous quantification of pancreatic β-cell mass using conventional histological methods is a time-consuming process. Rapidly evolving virtual slide technology with high-resolution slide scanners and newly developed image analysis tools has the potential to transform β-cell mass measurement. To test the effectiveness and accuracy of this new approach, we assessed pancreata from normal C57Bl/6J mice and from mouse models of β-cell ablation (streptozotocin-treated mice) and β-cell hyperplasia (leptin-deficient mice), using a standardized systematic sampling of pancreatic specimens. Our data indicate that automated analysis of virtual pancreatic slides is highly reliable and yields results consistent with those obtained by conventional morphometric analysis. This new methodology will allow investigators to dramatically reduce the time required for β-cell mass measurement by automating high-resolution image capture and analysis of entire pancreatic sections. PMID:24760991

  15. Full-field optical coherence microscopy is a novel technique for imaging enteric ganglia in the gastrointestinal tract

    PubMed Central

    CORON, E.; AUKSORIUS, E.; PIERETTI, A.; MAHÉ, M. M.; LIU, L.; STEIGER, C.; BROMBERG, Y.; BOUMA, B.; TEARNEY, G.; NEUNLIST, M.; GOLDSTEIN, A. M.

    2013-01-01

    Background Noninvasive methods are needed to improve the diagnosis of enteric neuropathies. Full-field optical coherence microscopy (FFOCM) is a novel optical microscopy modality that can acquire 1 μm resolution images of tissue. The objective of this research was to demonstrate FFOCM imaging for the characterization of the enteric nervous system (ENS). Methods Normal mice and EdnrB−/− mice, a model of Hirschsprung’s disease (HD), were imaged in three-dimensions ex vivo using FFOCM through the entire thickness and length of the gut. Quantitative analysis of myenteric ganglia was performed on FFOCM images obtained from whole-mount tissues and compared with immunohistochemistry imaged by confocal microscopy. Key Results Full-field optical coherence microscopy enabled visualization of the full thickness gut wall from serosa to mucosa. Images of the myenteric plexus were successfully acquired from the stomach, duodenum, colon, and rectum. Quantification of ganglionic neuronal counts on FFOCM images revealed strong interobserver agreement and identical values to those obtained by immunofluorescence microscopy. In EdnrB−/− mice, FFOCM analysis revealed a significant decrease in ganglia density along the colorectum and a significantly lower density of ganglia in all colorectal segments compared with normal mice. Conclusions & Inferences Full-field optical coherence microscopy enables optical microscopic imaging of the ENS within the bowel wall along the entire intestine. FFOCM is able to differentiate ganglionic from aganglionic colon in a mouse model of HD, and can provide quantitative assessment of ganglionic density. With further refinements that enable bowel wall imaging in vivo, this technology has the potential to revolutionize the characterization of the ENS and the diagnosis of enteric neuropathies. PMID:23106847

  16. Simple and rapid determination of homozygous transgenic mice via in vivo fluorescence imaging.

    PubMed

    Lin, Xiaolin; Jia, Junshuang; Qin, Yujuan; Lin, Xia; Li, Wei; Xiao, Gaofang; Li, Yanqing; Xie, Raoying; Huang, Hailu; Zhong, Lin; Wu, Qinghong; Wang, Wanshan; Huang, Wenhua; Yao, Kaitai; Xiao, Dong; Sun, Yan

    2015-11-17

    Setting up breeding programs for transgenic mouse strains require to distinguish homozygous from the heterozygous transgenic animals. The combinational use of the fluorescence reporter transgene and small animal in-vivo imaging system might allow us to rapidly and visually determine the transgenic mice homozygous for transgene(s) by the in vivo fluorescence imaging. RLG, RCLG or Rm17LG transgenic mice ubiquitously express red fluorescent protein (RFP). To identify homozygous RLG transgenic mice, whole-body fluorescence imaging for all of newborn F2-generation littermates produced by mating of RFP-positive heterozygous transgenic mice (F1-generation) derived from the same transgenic founder was performed. Subsequently, the immediate data analysis of the in vivo fluorescence imaging was carried out, which greatly facilitated us to rapidly and readily distinguish RLG transgenic individual(s) with strong fluorescence from the rest of F2-generation littermates, followed by further determining this/these RLG individual(s) showing strong fluorescence to be homozygous, as strongly confirmed by mouse mating. Additionally, homozygous RCLG or Rm17LG transgenic mice were also rapidly and precisely distinguished by the above-mentioned optical approach. This approach allowed us within the shortest time period to obtain 10, 8 and 2 transgenic mice homozygous for RLG, RCLG and Rm17LG transgene, respectively, as verified by mouse mating, indicating the practicality and reliability of this optical method. Taken together, our findings fully demonstrate that the in vivo fluorescence imaging offers a visual, rapid and reliable alternative method to the traditional approaches (i.e., mouse mating and real-time quantitative PCR) in identifying homozygous transgenic mice harboring fluorescence reporter transgene under the control of a ubiquitous promoter in the situation mentioned in this study.

  17. Simple and rapid determination of homozygous transgenic mice via in vivo fluorescence imaging

    PubMed Central

    Li, Wei; Xiao, Gaofang; Li, Yanqing; Xie, Raoying; Huang, Hailu; Zhong, Lin; Wu, Qinghong; Wang, Wanshan; Huang, Wenhua; Yao, Kaitai; Xiao, Dong; Sun, Yan

    2015-01-01

    Setting up breeding programs for transgenic mouse strains require to distinguish homozygous from the heterozygous transgenic animals. The combinational use of the fluorescence reporter transgene and small animal in-vivo imaging system might allow us to rapidly and visually determine the transgenic mice homozygous for transgene(s) by the in vivo fluorescence imaging. RLG, RCLG or Rm17LG transgenic mice ubiquitously express red fluorescent protein (RFP). To identify homozygous RLG transgenic mice, whole-body fluorescence imaging for all of newborn F2-generation littermates produced by mating of RFP-positive heterozygous transgenic mice (F1-generation) derived from the same transgenic founder was performed. Subsequently, the immediate data analysis of the in vivo fluorescence imaging was carried out, which greatly facilitated us to rapidly and readily distinguish RLG transgenic individual(s) with strong fluorescence from the rest of F2-generation littermates, followed by further determining this/these RLG individual(s) showing strong fluorescence to be homozygous, as strongly confirmed by mouse mating. Additionally, homozygous RCLG or Rm17LG transgenic mice were also rapidly and precisely distinguished by the above-mentioned optical approach. This approach allowed us within the shortest time period to obtain 10, 8 and 2 transgenic mice homozygous for RLG, RCLG and Rm17LG transgene, respectively, as verified by mouse mating, indicating the practicality and reliability of this optical method. Taken together, our findings fully demonstrate that the in vivo fluorescence imaging offers a visual, rapid and reliable alternative method to the traditional approaches (i.e., mouse mating and real-time quantitative PCR) in identifying homozygous transgenic mice harboring fluorescence reporter transgene under the control of a ubiquitous promoter in the situation mentioned in this study. PMID:26472024

  18. Investigation of gastric cancers in nude mice using X-ray in-line phase contrast imaging.

    PubMed

    Tao, Qiang; Luo, Shuqian

    2014-07-24

    This paper is to report the new imaging of gastric cancers without the use of imaging agents. Both gastric normal regions and gastric cancer regions can be distinguished by using the principal component analysis (PCA) based on the gray level co-occurrence matrix (GLCM). Human gastric cancer BGC823 cells were implanted into the stomachs of nude mice. Then, 3, 5, 7, 9 or 11 days after cancer cells implantation, the nude mice were sacrificed and their stomachs were removed. X-ray in-line phase contrast imaging (XILPCI), an X-ray phase contrast imaging method, has greater soft tissue contrast than traditional absorption radiography and generates higher-resolution images. The gastric specimens were imaged by an XILPCIs' charge coupled device (CCD) of 9 μm image resolution. The PCA of the projective images' region of interests (ROIs) based on GLCM were extracted to discriminate gastric normal regions and gastric cancer regions. Different stages of gastric cancers were classified by using support vector machines (SVMs). The X-ray in-line phase contrast images of nude mice gastric specimens clearly show the gastric architectures and the details of the early gastric cancers. The phase contrast computed tomography (CT) images of nude mice gastric cancer specimens are better than the traditional absorption CT images without the use of imaging agents. The results of the PCA of the texture parameters based on GLCM of normal regions is (F1+F2) >8.5, but those of cancer regions is (F1+F2) <8.5. The classification accuracy is 83.3% that classifying gastric specimens into different stages using SVMs. This is a very preliminary feasibility study. With further researches, XILPCI could become a noninvasive method for future the early detection of gastric cancers or medical researches.

  19. Correlating microscopy techniques and ToF-SIMS analysis of fully grown mammalian oocytes.

    PubMed

    Gulin, Alexander; Nadtochenko, Victor; Astafiev, Artyom; Pogorelova, Valentina; Rtimi, Sami; Pogorelov, Alexander

    2016-06-20

    The 2D-molecular thin film analysis protocol for fully grown mice oocytes is described using an innovative approach. Time-of-flight secondary ion mass spectrometry (ToF-SIMS), scanning electron microscopy (SEM), atomic force microscopy (AFM) and optical microscopy imaging were applied to the same mice oocyte section on the same sample holder. A freeze-dried mice oocyte was infiltrated into embedding media, e.g. Epon, and then was cut with a microtome and 2 μm thick sections were transferred onto an ITO coated conductive glass. Mammalian oocytes can contain "nucleolus-like body" (NLB) units and ToF-SIMS analysis was used to investigate the NLB composition. The ion-spatial distribution in the cell components was identified and compared with the images acquired by SEM, AFM and optical microscopy. This study presents a significant advancement in cell embryology, cell physiology and cancer-cell biochemistry.

  20. Fully-automated, high-throughput micro-computed tomography analysis of body composition enables therapeutic efficacy monitoring in preclinical models.

    PubMed

    Wyatt, S K; Barck, K H; Kates, L; Zavala-Solorio, J; Ross, J; Kolumam, G; Sonoda, J; Carano, R A D

    2015-11-01

    The ability to non-invasively measure body composition in mouse models of obesity and obesity-related disorders is essential for elucidating mechanisms of metabolic regulation and monitoring the effects of novel treatments. These studies aimed to develop a fully automated, high-throughput micro-computed tomography (micro-CT)-based image analysis technique for longitudinal quantitation of adipose, non-adipose and lean tissue as well as bone and demonstrate utility for assessing the effects of two distinct treatments. An initial validation study was performed in diet-induced obesity (DIO) and control mice on a vivaCT 75 micro-CT system. Subsequently, four groups of DIO mice were imaged pre- and post-treatment with an experimental agonistic antibody specific for anti-fibroblast growth factor receptor 1 (anti-FGFR1, R1MAb1), control immunoglobulin G antibody, a known anorectic antiobesity drug (rimonabant, SR141716), or solvent control. The body composition analysis technique was then ported to a faster micro-CT system (CT120) to markedly increase throughput as well as to evaluate the use of micro-CT image intensity for hepatic lipid content in DIO and control mice. Ex vivo chemical analysis and colorimetric analysis of the liver triglycerides were performed as the standard metrics for correlation with body composition and hepatic lipid status, respectively. Micro-CT-based body composition measures correlate with ex vivo chemical analysis metrics and enable distinction between DIO and control mice. R1MAb1 and rimonabant have differing effects on body composition as assessed by micro-CT. High-throughput body composition imaging is possible using a modified CT120 system. Micro-CT also provides a non-invasive assessment of hepatic lipid content. This work describes, validates and demonstrates utility of a fully automated image analysis technique to quantify in vivo micro-CT-derived measures of adipose, non-adipose and lean tissue, as well as bone. These body composition metrics highly correlate with standard ex vivo chemical analysis and enable longitudinal evaluation of body composition and therapeutic efficacy monitoring.

  1. Histopathological image analysis of chemical-induced hepatocellular hypertrophy in mice.

    PubMed

    Asaoka, Yoshiji; Togashi, Yuko; Mutsuga, Mayu; Imura, Naoko; Miyoshi, Tomoya; Miyamoto, Yohei

    2016-04-01

    Chemical-induced hepatocellular hypertrophy is frequently observed in rodents, and is mostly caused by the induction of phase I and phase II drug metabolic enzymes and peroxisomal lipid metabolic enzymes. Liver weight is a sensitive and commonly used marker for detecting hepatocellular hypertrophy, but is also increased by a number of other factors. Histopathological observations subjectively detect changes such as hepatocellular hypertrophy based on the size of a hepatocyte. Therefore, quantitative microscopic observations are required to evaluate histopathological alterations objectively. In the present study, we developed a novel quantitative method for an image analysis of hepatocellular hypertrophy using liver sections stained with hematoxylin and eosin, and demonstrated its usefulness for evaluating hepatocellular hypertrophy induced by phenobarbital (a phase I and phase II enzyme inducer) and clofibrate (a peroxisomal enzyme inducer) in mice. The algorithm of this imaging analysis was designed to recognize an individual hepatocyte through a combination of pixel-based and object-based analyses. Hepatocellular nuclei and the surrounding non-hepatocellular cells were recognized by the pixel-based analysis, while the areas of the recognized hepatocellular nuclei were then expanded until they ran against their expanding neighboring hepatocytes and surrounding non-hepatocellular cells by the object-based analysis. The expanded area of each hepatocellular nucleus was regarded as the size of an individual hepatocyte. The results of this imaging analysis showed that changes in the sizes of hepatocytes corresponded with histopathological observations in phenobarbital and clofibrate-treated mice, and revealed a correlation between hepatocyte size and liver weight. In conclusion, our novel image analysis method is very useful for quantitative evaluations of chemical-induced hepatocellular hypertrophy. Copyright © 2015 Elsevier GmbH. All rights reserved.

  2. Morphological analysis of the growth stages of in-vivo mouse hair follicles by using optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Jha, Rakesh Kumar; Kim, Kanghae; Jeon, Mansik; Kim, Jeehyun; Kang, Minyoung; Han, Insook; Kim, Moonkyu

    2016-09-01

    Swept-source optical coherence tomography (SS-OCT), a bio-photonic imaging modality, was used to demonstrate an initial feasibility experiment for detecting morphological variations of in-vivo mouse hair follicles for the anagen and the telogen growth stages. Two C57BL/6 adult male mice, one undergoing the anagen stage and the other undergoing the telogen stage of the hair follicle growth cycle, were selected for the experiment. The OCT cross-sectional images of mice skin were acquired in-vivo within an interval of 15 days, and the observed morphological changes were analyzed. The micro-structural features of mice skin on the 15th experimental day were further compared with corresponding histological observations. The preliminary result of this study provides clear insights into the structural details of mouse skin, confirming the resemblance of the OCT images with the corresponding histological measurements, and ensures the suitability of SS-OCT for non-invasive analysis of hair follicle conditions.

  3. Magnetic particle imaging for in vivo blood flow velocity measurements in mice

    NASA Astrophysics Data System (ADS)

    Kaul, Michael G.; Salamon, Johannes; Knopp, Tobias; Ittrich, Harald; Adam, Gerhard; Weller, Horst; Jung, Caroline

    2018-03-01

    Magnetic particle imaging (MPI) is a new imaging technology. It is a potential candidate to be used for angiographic purposes, to study perfusion and cell migration. The aim of this work was to measure velocities of the flowing blood in the inferior vena cava of mice, using MPI, and to evaluate it in comparison with magnetic resonance imaging (MRI). A phantom mimicking the flow within the inferior vena cava with velocities of up to 21 cm s‑1 was used for the evaluation of the applied analysis techniques. Time–density and distance–density analyses for bolus tracking were performed to calculate flow velocities. These findings were compared with the calibrated velocities set by a flow pump, and it can be concluded that velocities of up to 21 cm s‑1 can be measured by MPI. A time–density analysis using an arrival time estimation algorithm showed the best agreement with the preset velocities. In vivo measurements were performed in healthy FVB mice (n  =  10). MRI experiments were performed using phase contrast (PC) for velocity mapping. For MPI measurements, a standardized injection of a superparamagnetic iron oxide tracer was applied. In vivo MPI data were evaluated by a time–density analysis and compared to PC MRI. A Bland–Altman analysis revealed good agreement between the in vivo velocities acquired by MRI of 4.0  ±  1.5 cm s‑1 and those measured by MPI of 4.8  ±  1.1 cm s‑1. Magnetic particle imaging is a new tool with which to measure and quantify flow velocities. It is fast, radiation-free, and produces 3D images. It therefore offers the potential for vascular imaging.

  4. Effects of Low Carbohydrate High Protein (LCHP) diet on atherosclerotic plaque phenotype in ApoE/LDLR-/- mice: FT-IR and Raman imaging.

    PubMed

    Wrobel, T P; Marzec, K M; Chlopicki, S; Maślak, E; Jasztal, A; Franczyk-Żarów, M; Czyżyńska-Cichoń, I; Moszkowski, T; Kostogrys, R B; Baranska, M

    2015-09-22

    Low Carbohydrate High Protein (LCHP) diet displays pro-atherogenic effects, however, the exact mechanisms involved are still unclear. Here, with the use of vibrational imaging, such as Fourier transform infrared (FT-IR) and Raman (RS) spectroscopies, we characterize biochemical content of plaques in Brachiocephalic Arteries (BCA) from ApoE/LDLR(-/-) mice fed LCHP diet as compared to control, recomended by American Institute of Nutrition, AIN diet. FT-IR images were taken from 6-10 sections of BCA from each mice and were complemented with RS measurements with higher spatial resolution of chosen areas of plaque sections. In aortic plaques from LCHP fed ApoE/LDLR(-/-) mice, the content of cholesterol and cholesterol esters was increased, while that of proteins was decreased as evidenced by global FT-IR analysis. High resolution imaging by RS identified necrotic core/foam cells, lipids (including cholesterol crystals), calcium mineralization and fibrous cap. The decreased relative thickness of the outer fibrous cap and the presence of buried caps were prominent features of the plaques in ApoE/LDLR(-/-) mice fed LCHP diet. In conclusion, FT-IR and Raman-based imaging provided a complementary insight into the biochemical composition of the plaque suggesting that LCHP diet increased plaque cholesterol and cholesterol esters contents of atherosclerotic plaque, supporting the cholesterol-driven pathogenesis of LCHP-induced atherogenesis.

  5. Noninvasive bioluminescence imaging of normal and spontaneously transformed prostate tissue in mice.

    PubMed

    Lyons, Scott K; Lim, Ed; Clermont, Anne O; Dusich, Joan; Zhu, Lingyun; Campbell, Kenneth D; Coffee, Richard J; Grass, David S; Hunter, John; Purchio, Tony; Jenkins, Darlene

    2006-05-01

    Several transgenic mouse models of prostate cancer have been developed recently that are able to recapitulate many key biological features of the human condition. It would, therefore, be desirable to employ these models to test the efficacy of new therapeutics before clinical trial; however, the variable onset and non-visible nature of prostate tumor development limit their use for such applications. We now report the generation of a transgenic reporter mouse that should obviate these limitations by enabling noninvasive in vivo bioluminescence imaging of normal and spontaneously transformed prostate tissue in the mouse. We used an 11-kb fragment of the human prostate-specific antigen (PSA) promoter to achieve specific and robust expression of firefly luciferase in the prostate glands of transgenic mice. Ex vivo bioluminescence imaging and in situ hybridization analysis confirmed that luciferase expression was restricted to the epithelium in all four lobes of the prostate. We also show that PSA-Luc mice exhibit decreased but readily detectable levels of in vivo bioluminescence over extended time periods following androgen ablation. These results suggest that this reporter should enable in vivo imaging of both androgen-dependent and androgen-independent prostate tumor models. As proof-of-principle, we show that we could noninvasively image SV40 T antigen-induced prostate tumorigenesis in mice with PSA-Luc. Furthermore, we show that our noninvasive imaging strategy can be successfully used to image tumor response to androgen ablation in transgenic mice and, as a result, that we can rapidly identify individual animals capable of sustaining tumor growth in the absence of androgen.

  6. Non-Invasive In Vivo Imaging of Calcium Signaling in Mice

    PubMed Central

    Rogers, Kelly L.; Picaud, Sandrine; Roncali, Emilie; Boisgard, Raphaël; Colasante, Cesare; Stinnakre, Jacques; Tavitian, Bertrand; Brûlet, Philippe

    2007-01-01

    Rapid and transient elevations of Ca2+ within cellular microdomains play a critical role in the regulation of many signal transduction pathways. Described here is a genetic approach for non-invasive detection of localized Ca2+ concentration ([Ca2+]) rises in live animals using bioluminescence imaging (BLI). Transgenic mice conditionally expressing the Ca2+-sensitive bioluminescent reporter GFP-aequorin targeted to the mitochondrial matrix were studied in several experimental paradigms. Rapid [Ca2+] rises inside the mitochondrial matrix could be readily detected during single-twitch muscle contractions. Whole body patterns of [Ca2+] were monitored in freely moving mice and during epileptic seizures. Furthermore, variations in mitochondrial [Ca2+] correlated to behavioral components of the sleep/wake cycle were observed during prolonged whole body recordings of newborn mice. This non-invasive imaging technique opens new avenues for the analysis of Ca2+ signaling whenever whole body information in freely moving animals is desired, in particular during behavioral and developmental studies. PMID:17912353

  7. Investigation of gastric cancers in nude mice using X-ray in-line phase contrast imaging

    PubMed Central

    2014-01-01

    Background This paper is to report the new imaging of gastric cancers without the use of imaging agents. Both gastric normal regions and gastric cancer regions can be distinguished by using the principal component analysis (PCA) based on the gray level co-occurrence matrix (GLCM). Methods Human gastric cancer BGC823 cells were implanted into the stomachs of nude mice. Then, 3, 5, 7, 9 or 11 days after cancer cells implantation, the nude mice were sacrificed and their stomachs were removed. X-ray in-line phase contrast imaging (XILPCI), an X-ray phase contrast imaging method, has greater soft tissue contrast than traditional absorption radiography and generates higher-resolution images. The gastric specimens were imaged by an XILPCIs’ charge coupled device (CCD) of 9 μm image resolution. The PCA of the projective images’ region of interests (ROIs) based on GLCM were extracted to discriminate gastric normal regions and gastric cancer regions. Different stages of gastric cancers were classified by using support vector machines (SVMs). Results The X-ray in-line phase contrast images of nude mice gastric specimens clearly show the gastric architectures and the details of the early gastric cancers. The phase contrast computed tomography (CT) images of nude mice gastric cancer specimens are better than the traditional absorption CT images without the use of imaging agents. The results of the PCA of the texture parameters based on GLCM of normal regions is (F1 + F2) > 8.5, but those of cancer regions is (F1 + F2) < 8.5. The classification accuracy is 83.3% that classifying gastric specimens into different stages using SVMs. Conclusions This is a very preliminary feasibility study. With further researches, XILPCI could become a noninvasive method for future the early detection of gastric cancers or medical researches. PMID:25060352

  8. Type I Diabetic Akita Mouse Model is Characterized by Abnormal Cardiac Deformation During Early Stages of Diabetic Cardiomyopathy with Speckle-Tracking Based Strain Imaging.

    PubMed

    Zhou, Yingchao; Xiao, Hong; Wu, Jianfei; Zha, Lingfeng; Zhou, Mengchen; Li, Qianqian; Wang, Mengru; Shi, Shumei; Li, Yanze; Lyu, Liangkun; Wang, Qing; Tu, Xin; Lu, Qiulun

    2018-01-01

    Diabetes mellitus (DM) has been demonstrated to have a strong association with heart failure. Conventional echocardiographic analysis cannot sensitively monitor cardiac dysfunction in type I diabetic Akita hearts, but the phenotype of heart failure is observed in molecular levels during the early stages. Male Akita (Ins2WT/C96Y) mice were monitored with echocardiographic imaging at various ages, and then with conventional echocardiographic analysis and speckle-tracking based strain analyses. With speckle-tracking based strain analyses, diabetic Akita mice showed changes in average global radial strain at the age of 12 weeks, as well as decreased longitudinal strain. These changes occurred in the early stage and remained throughout the progression of diabetic cardiomyopathy in Akita mice. Speckle-tracking showed that the detailed and precise changes of cardiac deformation in the progression of diabetic cardiomyopathy in the genetic type I diabetic Akita mice were uncoupled. We monitored early-stage changes in the heart of diabetic Akita mice. We utilize this technique to elucidate the underlying mechanism for heart failure in Akita genetic type I diabetic mice. It will further advance the assessment of cardiac abnormalities, as well as the discovery of new drug treatments using Akita genetic type I diabetic mice. © 2018 The Author(s). Published by S. Karger AG, Basel.

  9. 3D visualization and quantification of bone and teeth mineralization for the study of osteo/dentinogenesis in mice models

    NASA Astrophysics Data System (ADS)

    Marchadier, A.; Vidal, C.; Ordureau, S.; Lédée, R.; Léger, C.; Young, M.; Goldberg, M.

    2011-03-01

    Research on bone and teeth mineralization in animal models is critical for understanding human pathologies. Genetically modified mice represent highly valuable models for the study of osteo/dentinogenesis defects and osteoporosis. Current investigations on mice dental and skeletal phenotype use destructive and time consuming methods such as histology and scanning microscopy. Micro-CT imaging is quicker and provides high resolution qualitative phenotypic description. However reliable quantification of mineralization processes in mouse bone and teeth are still lacking. We have established novel CT imaging-based software for accurate qualitative and quantitative analysis of mouse mandibular bone and molars. Data were obtained from mandibles of mice lacking the Fibromodulin gene which is involved in mineralization processes. Mandibles were imaged with a micro-CT originally devoted to industrial applications (Viscom, X8060 NDT). 3D advanced visualization was performed using the VoxBox software (UsefulProgress) with ray casting algorithms. Comparison between control and defective mice mandibles was made by applying the same transfer function for each 3D data, thus allowing to detect shape, colour and density discrepencies. The 2D images of transverse slices of mandible and teeth were similar and even more accurate than those obtained with scanning electron microscopy. Image processing of the molars allowed the 3D reconstruction of the pulp chamber, providing a unique tool for the quantitative evaluation of dentinogenesis. This new method is highly powerful for the study of oro-facial mineralizations defects in mice models, complementary and even competitive to current histological and scanning microscopy appoaches.

  10. Fluorine MR Imaging Monitoring of Tumor Inflammation after High-Intensity Focused Ultrasound Ablation.

    PubMed

    Shin, Soo Hyun; Park, Sang Hyun; Kim, Seung Won; Kim, Minsun; Kim, Daehong

    2018-05-01

    Purpose To investigate whether high-intensity focused ultrasound (HIFU)-induced macrophage infiltration could be longitudinally monitored with fluorine 19 ( 19 F) magnetic resonance (MR) imaging in a quantitative manner. Materials and Methods BALB/c mice were subcutaneously inoculated with 4T1 cells and were separated into three groups: untreated mice (control, n = 9), HIFU-treated mice (HIFU, n = 9), and HIFU- and clodronate-treated mice (HIFU+Clod, n = 9). Immediately after HIFU treatment, all mice were intravenously given perfluorocarbon (PFC) emulsion. MR imaging examinations were performed 2, 4, 7, 10, and 14 days after HIFU treatment. Two-way repeated measures analysis of variance was used to analyze the changes in 19 F signal over time and differences between groups. Histologic examinations were performed to confirm in vivo data. Results Fluorine 19 signals were detected at the rims of tumors and the peripheries of ablated lesions. Mean 19 F signal in tumors was significantly higher in HIFU-treated mice than in control mice up to day 4 (0.82 ± 0.26 vs 0.42 ± 0.17, P < .001). Fluorine 19 signals were higher in the HIFU+Clod group than in the control group from day 4 (0.82 ± 0.23, P < .001) to day 14 (0.55 ± 0.16 vs 0.28 ± 0.06, P < .05). Histologic examination revealed macrophage infiltration around ablated lesions. Immunofluorescence staining confirmed PFC labeling of macrophages. Conclusion Fluorine 19 MR imaging can longitudinally capture and quantify HIFU-induced macrophage infiltration in preclinical tumor models. © RSNA, 2018 Online supplemental material is available for this article.

  11. Role of near-infrared fluorescence imaging in the resection of metastatic lymph nodes in an optimized orthotopic animal model of HNSCC.

    PubMed

    Atallah, I; Milet, C; Quatre, R; Henry, M; Reyt, E; Coll, J-L; Hurbin, A; Righini, C A

    2015-12-01

    To study the role of near-infrared fluorescence imaging in the detection and resection of metastatic cervical lymph nodes in head and neck cancer. CAL33 head and neck cancer cells of human origin were implanted in the oral cavity of nude mice. The mice were followed up after tumor resection to detect the development of lymph node metastases. A specific fluorescent tracer for αvβ3 integrin expressed by CAL33 cells was injected intravenously in the surviving mice between the second and the fourth month following tumor resection. A near-infrared fluorescence-imaging camera was used to detect tracer uptake in metastatic cervical lymph nodes, to guide of lymph-node resection for histological analysis. Lymph node metastases were observed in 42.8% of surviving mice between the second and the fourth month following orthotopic tumor resection. Near-infrared fluorescence imaging provided real-time intraoperative detection of clinical and subclinical lymph node metastases. These results were confirmed histologically. Near infrared fluorescence imaging provides real-time contrast between normal and malignant tissue, allowing intraoperative detection of metastatic lymph nodes. This preclinical stage is essential before testing the technique in humans. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. Development of novel approach to diagnostic imaging of lung cancer with 18F-Nifene PET/CT using A/J mice treated with NNK

    PubMed Central

    Galitovskiy, V; Kuruvilla, SA; Sevriokov, E; Corches, A; Pan, ML; Kalantari-Dehaghi, M; Chernyavsky, AI; Mukherjee, J; Grando, SA

    2017-01-01

    Development of novel methods of early diagnosis of lung cancer is one of the major tasks of contemporary clinical and experimental oncology. In this study, we utilized the tobacco nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)-induced lung cancer in A/J mice as an animal model for development of a new imaging technique for early diagnosis of lung cancer. Lung cancer cells in A/J mice overexpress nicotinic acetylcholine receptors. Longitudinal CT scans were carried out over a period of 8 months after NNK treatment, followed by PET/CT scans with 18F-Nifene that binds to α4-made nicotinic receptors with high affinity. PET/CT scans of lungs were also obtained ex vivo. CT revealed the presence of lung nodules in 8-month NNK-treated mice, while control mice had no tumors. Imaging of live animals prior to necropsy allowed correlation of results of tumor load via PET/CT and histopathological findings. Significant amount of 18F-Nifene was seen in the lungs of NNK-treated mice, whereas lungs of control mice showed only minor uptake of 18F-Nifene. Quantitative analysis of the extent and amount of 18F-Nifene binding in lung in vivo and ex vivo demonstrated a higher tumor/nontumor ratio due to selective labeling of tumor nodules expressing abundant α4 nicotinic receptor subunits. For comparison, we performed PET/CT studies with 18F-FDG, which is used for the imaging diagnosis of lung cancer. The tumor/nontumor ratios for 18F-FDG were lower than for 18F-Nifene. Thus, we have developed a novel diagnostic imaging approach to early diagnosis of lung cancer using 18F-Nifene PET/CT. This technique allows quantitative assessment of lung tumors in live mice, which is critical for establishing tumor size and location, and also has salient clinical implications. PMID:28553544

  13. Quantitative Analysis of Mouse Retinal Layers Using Automated Segmentation of Spectral Domain Optical Coherence Tomography Images

    PubMed Central

    Dysli, Chantal; Enzmann, Volker; Sznitman, Raphael; Zinkernagel, Martin S.

    2015-01-01

    Purpose Quantification of retinal layers using automated segmentation of optical coherence tomography (OCT) images allows for longitudinal studies of retinal and neurological disorders in mice. The purpose of this study was to compare the performance of automated retinal layer segmentation algorithms with data from manual segmentation in mice using the Spectralis OCT. Methods Spectral domain OCT images from 55 mice from three different mouse strains were analyzed in total. The OCT scans from 22 C57Bl/6, 22 BALBc, and 11 C3A.Cg-Pde6b+Prph2Rd2/J mice were automatically segmented using three commercially available automated retinal segmentation algorithms and compared to manual segmentation. Results Fully automated segmentation performed well in mice and showed coefficients of variation (CV) of below 5% for the total retinal volume. However, all three automated segmentation algorithms yielded much thicker total retinal thickness values compared to manual segmentation data (P < 0.0001) due to segmentation errors in the basement membrane. Conclusions Whereas the automated retinal segmentation algorithms performed well for the inner layers, the retinal pigmentation epithelium (RPE) was delineated within the sclera, leading to consistently thicker measurements of the photoreceptor layer and the total retina. Translational Relevance The introduction of spectral domain OCT allows for accurate imaging of the mouse retina. Exact quantification of retinal layer thicknesses in mice is important to study layers of interest under various pathological conditions. PMID:26336634

  14. Facilitated Diagnosis of Pneumothoraces in Newborn Mice Using X-ray Dark-Field Radiography.

    PubMed

    Hellbach, Katharina; Yaroshenko, Andre; Willer, Konstantin; Pritzke, Tina; Baumann, Alena; Hesse, Nina; Auweter, Sigrid; Reiser, Maximilian F; Eickelberg, Oliver; Pfeiffer, Franz; Hilgendorff, Anne; Meinel, Felix G

    2016-10-01

    The aim of this study was to evaluate the diagnostic value of x-ray dark-field imaging in projection radiography-based depiction of pneumothoraces in the neonatal murine lung, a potentially life-threatening medical condition that requires a timely and correct diagnosis. By the use of a unique preclinical model, 7-day-old C57Bl/6N mice received mechanical ventilation for 2 or 8 hours with oxygen-rich gas (FIO2 = 0.4; n = 24). Unventilated mice either spontaneously breathed oxygen-rich gas (FIO2 = 0.4) for 2 or 8 hours or room air (n = 22). At the end of the experiment, lungs were inflated with a standardized volume of air after a lethal dose of pentobarbital was administered to the pups. All lungs were imaged with a prototype grating-based small-animal scanner to acquire x-ray transmission and dark-field radiographs. Image contrast between the air-filled pleural space and lung tissue was quantified for both transmission and dark-field radiograms. After the independent expert's assessment, 2 blinded readers evaluated all dark-field and transmission images for the presence or absence of pneumothoraces. Contrast ratios, diagnostic accuracy, as well as reader's confidence and interreader agreement were recorded for both imaging modalities. Evaluation of both x-ray transmission and dark-field radiographs by independent experts revealed the development of a total of 10 pneumothoraces in 8 mice. Here, the contrast ratio between the air-filled pleural space of the pneumothoraces and the lung tissue was significantly higher in the dark field (8.4 ± 3.5) when compared with the transmission images (5.1 ± 2.8; P < 0.05). Accordingly, the readers' diagnostic confidence for the diagnosis of pneumothoraces was significantly higher for dark-field compared with transmission images (P = 0.001). Interreader agreement improved from moderate for the analysis of transmission images alone (κ = 0.41) to very good when analyzing dark-field images alone (κ = 0.90) or in combination with transmission images (κ = 0.88). Diagnostic accuracy significantly improved for the analysis of dark-field images alone (P = 0.04) or in combination with transmission images (P = 0.02), compared with the analysis of transmission radiographs only. The significant improvement in contrast ratios between lung parenchyma and free air in the dark-field images allows the facilitated detection of pneumothoraces in the newborn mouse. These preclinical experiments indicate the potential of the technique for future clinical applications.

  15. Chromosomal localization of Emv-16 and Emv-17, two closely linked ecotropic proviruses of RF/J mice.

    PubMed Central

    Buchberg, A M; Taylor, B A; Jenkins, N A; Copeland, N G

    1986-01-01

    Emv-16 and Emv-17, the two closely linked ecotropic proviral loci of RF/J mice, have been mapped to chromosome 1 between leaden, ln, and the mouse engrailed homeo-box locus, En-1, by using recombinant inbred strains and conventional backcross analysis. Images PMID:2878091

  16. Theranostic multimodular potential of zinc-doped ferrite-saturated metal-binding protein-loaded novel nanocapsules in cancers

    PubMed Central

    Kamalapuram, Sishir K; Kanwar, Rupinder K; Roy, Kislay; Chaudhary, Rajneesh; Sehgal, Rakesh; Kanwar, Jagat R

    2016-01-01

    The present study successfully developed orally deliverable multimodular zinc (Zn) iron oxide (Fe3O4)-saturated bovine lactoferrin (bLf)-loaded polymeric nanocapsules (NCs), and evaluated their theranostic potential (antitumor efficacy, magnetophotothermal efficacy and imaging capability) in an in vivo human xenograft CpG-island methylator phenotype (CIMP)-1+/CIMP2−/chromosome instability-positive colonic adenocarcinoma (Caco2) and claudin-low, triple-negative (ER−/PR−/HER2−; MDA-MB-231) breast cancer model. Mice fed orally on the Zn-Fe-bLf NC diet showed downregulation in tumor volume and complete regression in tumor volume after 45 days of feeding. In human xenograft colon cancer, vehicle-control NC diet-group (n=5) mice showed a tumor volume of 52.28±11.55 mm3, and Zn-Fe-bLf NC diet (n=5)-treated mice had a tumor-volume of 0.10±0.073 mm3. In the human xenograft breast cancer model, Zn-Fe-bLf NC diet (n=5)-treated mice showed a tumor volume of 0.051±0.062 mm3 within 40 days of feeding. Live mouse imaging conducted by near-infrared fluorescence imaging of Zn-Fe-bLf NCs showed tumor site-specific localization and regression of colon and breast tumor volume. Ex vivo fluorescence-imaging analysis of the vital organs of mice exhibited sparse localization patterns of Zn-Fe-bLf NCs and also confirmed tumor-specific selective localization patterns of Zn-Fe-bLf NCs. Dual imaging using magnetic resonance imaging and computerized tomography scans revealed an unprecedented theranostic ability of the Zn-Fe-bLf NCs. These observations warrant consideration of multimodular Zn-Fe-bLf NCs for real-time cancer imaging and simultaneous cancer-targeted therapy. PMID:27099495

  17. In Vivo Performance of a Novel Fluorinated Magnetic Resonance Imaging Agent for Functional Analysis of Bile Acid Transport

    PubMed Central

    2015-01-01

    A novel trifluorinated cholic acid derivative, CA-lys-TFA, was designed and synthesized for use as a tool to measure bile acid transport noninvasively using magnetic resonance imaging (MRI). In the present study, the in vivo performance of CA-lys-TFA for measuring bile acid transport by MRI was investigated in mice. Gallbladder CA-lys-TFA content was quantified using MRI and liquid chromatography/tandem mass spectrometry. Results in wild-type (WT) C57BL/6J mice were compared to those in mice lacking expression of Asbt, the ileal bile acid transporter. 19F signals emanating from the gallbladders of WT mice 7 h after oral gavage with 150 mg/kg CA-lys-TFA were reproducibly detected by MRI. Asbt-deficient mice administered the same dose had undetectable 19F signals by MRI, and gallbladder bile CA-lys-TFA levels were 30-fold lower compared to WT animals. To our knowledge, this represents the first report of in vivo imaging of an orally absorbed drug using 19F MRI. Fluorinated bile acid analogues have potential as tools to measure and detect abnormal bile acid transport by MRI. PMID:24708306

  18. Quantification of plaque area and characterization of plaque biochemical composition with atherosclerosis progression in ApoE/LDLR(-/-) mice by FT-IR imaging.

    PubMed

    Wrobel, Tomasz P; Mateuszuk, Lukasz; Kostogrys, Renata B; Chlopicki, Stefan; Baranska, Malgorzata

    2013-11-07

    In this work the quantitative determination of atherosclerotic lesion area (ApoE/LDLR(-/-) mice) by FT-IR imaging is presented and validated by comparison with atherosclerotic lesion area determination by classic Oil Red O staining. Cluster analysis of FT-IR-based measurements in the 2800-3025 cm(-1) range allowed for quantitative analysis of the atherosclerosis plaque area, the results of which were highly correlated with those of Oil Red O histological staining (R(2) = 0.935). Moreover, a specific class obtained from a second cluster analysis of the aortic cross-section samples at different stages of disease progression (3, 4 and 6 months old) seemed to represent the macrophages (CD68) area within the atherosclerotic plaque.

  19. Luciferase Protein Complementation Assays for Bioluminescence Imaging of Cells and Mice

    PubMed Central

    Luker, Gary D.; Luker, Kathryn E.

    2015-01-01

    Summary Protein fragment complementation assays (PCAs) with luciferase reporters currently are the preferred method for detecting and quantifying protein-protein interactions in living animals. At the most basic level, PCAs involve fusion of two proteins of interest to enzymatically inactive fragments of luciferase. Upon association of the proteins of interest, the luciferase fragments are capable of reconstituting enzymatic activity to generate luminescence in vivo. In addition to bi-molecular luciferase PCAs, unimolecular biosensors for hormones, kinases, and proteases also have been developed using target peptides inserted between inactive luciferase fragments. Luciferase PCAs offer unprecedented opportunities to quantify dynamics of protein-protein interactions in intact cells and living animals, but successful use of luciferase PCAs in cells and mice involves careful consideration of many technical factors. This chapter discusses the design of luciferase PCAs appropriate for animal imaging, including construction of reporters, incorporation of reporters into cells and mice, imaging techniques, and data analysis. PMID:21153371

  20. Imaging of lipids in atherosclerotic lesion in aorta from ApoE/LDLR-/- mice by FT-IR spectroscopy and Hierarchical Cluster Analysis.

    PubMed

    P Wrobel, Tomasz; Mateuszuk, Lukasz; Chlopicki, Stefan; Malek, Kamilla; Baranska, Malgorzata

    2011-12-21

    Spectroscopy-based approaches can provide an insight into the biochemical composition of a tissue sample. In the present work Fourier transform infrared (FT-IR) spectroscopy was used to develop a reliable methodology to study the content of free fatty acids, triglycerides, cholesteryl esters as well as cholesterol in aorta from mice with atherosclerosis (ApoE/LDLR(-/-) mice). In particular, distribution and concentration of palmitic, oleic and linoleic acid derivatives were analyzed. Spectral analysis of pure compounds allowed for clear discrimination between free fatty acids and other similar moieties based on the carbonyl band position (1699-1710 cm(-1) range). In order to distinguish cholesteryl esters from triglycerides a ratio of carbonyl band to signal at 1010 cm(-1) was used. Imaging of lipids in atherosclerotic aortic lesions in ApoE/LDLR(-/-) mice was followed by Hierarchical Cluster Analysis (HCA). The aorta from C57Bl/6J control mice (fed with chow diet) was used for comparison. The measurements were completed with an FT-IR spectrometer equipped with a 128 × 128 FPA detector. In cross-section of aorta from ApoE/LDLR(-/-) mice a region of atherosclerotic plaque was clearly identified by HCA, which was later divided into 2 sub-regions, one characterized by the higher content of cholesterol, while the other by higher contents of cholesteryl esters. HCA of tissues deposited on normal microscopic glass, hence limited to the 2200-3800 cm(-1) spectral range, also identified a region of atherosclerotic plaque. Importantly, this region correlates with the area stained by standard histological staining for atherosclerotic plaque (Oil Red O). In conclusion, the use of FT-IR and HCA may provide a novel tool for qualitative and quantitative analysis of contents and distribution of lipids in atherosclerotic plaque.

  1. Phage-display library biopanning and bioinformatic analysis yielded a high-affinity peptide to inflamed vascular endothelium both in vitro and in vivo.

    PubMed

    Yang, Min; Liu, Chenwu; Niu, Maochang; Hu, Yonghe; Guo, Mingyang; Zhang, Jun; Luo, Yong; Yuan, Weili; Yang, Mei; Yun, Mingdong; Guo, Linling; Yan, Jiao; Liu, Defang; Liu, Jinghua; Jiang, Yong

    2014-01-28

    Vascular inflammation is considered the primary pathological condition occurring in many chronic diseases. To detect the inflamed endothelium via imaging analysis or guide the drug to target lesions is therefore important for early diagnosis and treatment of vascular inflammatory diseases. In this study, we obtained a novel peptide NTTTH through high throughout biopanning and bioinformatic analysis. In vitro studies indicated that NTTTH homologs could especially target inflamed vascular endothelial cells, as imaging quantitative analysis indicated that the mean of integrated optical density (MIOD) and mean of stained area (MSA) were significantly higher versus control (P<0.05). In vivo studies showed that, after intravenous injection of enhanced green fluorescent protein (EGFP)-labeled NTTTH homologs into the lipopolysaccharide (LPS)-inflamed mice for 30min, NTTTH homologs were distributed in highly vascularized and inflamed organs like liver and kidney. As a control, little fluorescence could be detected in mice injected with EGFP alone. Cryosection showed that NTTTH homologs especially targeted inflamed vasculatures but not normal ones. We did not detect fluorescence signal in either normal or inflamed mice which were injected with EGFP alone. The results suggested the role of NTTTH homologs in guiding the targeted binding of EGFP to inflamed vasculature and the potential usage for imaging detection and drug delivery. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. In vivo imaging of advanced glycation end products (AGEs) of albumin: first observations of significantly reduced clearance and liver deposition properties in mice.

    PubMed

    Tsutsui, Ayumi; Ogura, Akihiro; Tahara, Tsuyoshi; Nozaki, Satoshi; Urano, Sayaka; Hara, Mitsuko; Kojima, Soichi; Kurbangalieva, Almira; Onoe, Hirotaka; Watanabe, Yasuyoshi; Taniguchi, Naoyuki; Tanaka, Katsunori

    2016-06-15

    Advanced glycation end products (AGEs) are associated with various diseases, especially during aging and the development of diabetes and uremia. To better understand these biological processes, investigation of the in vivo kinetics of AGEs, i.e., analysis of trafficking and clearance properties, was carried out by molecular imaging. Following the preparation of Cy7.5-labeled AGE-albumin and intravenous injection in BALB/cA-nu/nu mice, noninvasive fluorescence kinetics analysis was performed. In vivo imaging and fluorescence microscopy analysis revealed that non-enzymatic AGEs were smoothly captured by scavenger cells in the liver, i.e., Kupffer and other sinusoidal cells, but were unable to be properly cleared from the body. Overall, these results highlight an important link between AGEs and various disorders associated with them, which may serve as a platform for future research to better understand the processes and mechanisms of these disorders.

  3. Automated MicroSPECT/MicroCT Image Analysis of the Mouse Thyroid Gland.

    PubMed

    Cheng, Peng; Hollingsworth, Brynn; Scarberry, Daniel; Shen, Daniel H; Powell, Kimerly; Smart, Sean C; Beech, John; Sheng, Xiaochao; Kirschner, Lawrence S; Menq, Chia-Hsiang; Jhiang, Sissy M

    2017-11-01

    The ability of thyroid follicular cells to take up iodine enables the use of radioactive iodine (RAI) for imaging and targeted killing of RAI-avid thyroid cancer following thyroidectomy. To facilitate identifying novel strategies to improve 131 I therapeutic efficacy for patients with RAI refractory disease, it is desired to optimize image acquisition and analysis for preclinical mouse models of thyroid cancer. A customized mouse cradle was designed and used for microSPECT/CT image acquisition at 1 hour (t1) and 24 hours (t24) post injection of 123 I, which mainly reflect RAI influx/efflux equilibrium and RAI retention in the thyroid, respectively. FVB/N mice with normal thyroid glands and TgBRAF V600E mice with thyroid tumors were imaged. In-house CTViewer software was developed to streamline image analysis with new capabilities, along with display of 3D voxel-based 123 I gamma photon intensity in MATLAB. The customized mouse cradle facilitates consistent tissue configuration among image acquisitions such that rigid body registration can be applied to align serial images of the same mouse via the in-house CTViewer software. CTViewer is designed specifically to streamline SPECT/CT image analysis with functions tailored to quantify thyroid radioiodine uptake. Automatic segmentation of thyroid volumes of interest (VOI) from adjacent salivary glands in t1 images is enabled by superimposing the thyroid VOI from the t24 image onto the corresponding aligned t1 image. The extent of heterogeneity in 123 I accumulation within thyroid VOIs can be visualized by 3D display of voxel-based 123 I gamma photon intensity. MicroSPECT/CT image acquisition and analysis for thyroidal RAI uptake is greatly improved by the cradle and the CTViewer software, respectively. Furthermore, the approach of superimposing thyroid VOIs from t24 images to select thyroid VOIs on corresponding aligned t1 images can be applied to studies in which the target tissue has differential radiotracer retention from surrounding tissues.

  4. Long-working-distance fluorescence microscope with high-numerical-aperture objectives for variable-magnification imaging in live mice from macro- to subcellular

    NASA Astrophysics Data System (ADS)

    Kimura, Hiroaki; Momiyama, Masashi; Tomita, Katsuro; Tsuchiya, Hiroyuki; Hoffman, Robert M.

    2010-11-01

    We demonstrate the development of a long-working-distance fluorescence microscope with high-numerical-aperture objectives for variable-magnification imaging in live mice from macro- to subcellular. To observe cytoplasmic and nuclear dynamics of cancer cells in the living mouse, 143B human osteosarcoma cells are labeled with green fluorescent protein in the nucleus and red fluorescent protein in the cytoplasm. These dual-color cells are injected by a vascular route in an abdominal skin flap in nude mice. The mice are then imaged with the Olympus MVX10 macroview fluorescence microscope. With the MVX10, the nuclear and cytoplasmic behavior of cancer cells trafficking in blood vessels of live mice is observed. We also image lung metastases in live mice from the macro- to the subcellular level by opening the chest wall and imaging the exposed lung in live mice. Injected splenocytes, expressing cyan fluorescent protein, could also be imaged on the lung of live mice. We demonstrate that the MVX10 microscope offers the possibility of full-range in vivo fluorescence imaging from macro- to subcellular and should enable widespread use of powerful imaging technologies enabled by genetic reporters and other fluorophores.

  5. Triple Negative Breast Cancer and Metabolic Regulation

    DTIC Science & Technology

    2015-08-01

    about 100 cells in mice whose head hair was removed by Nair or equivalent chemical products. We are in the process of performing the imaging with...tumor-bearing mice, whose head hair has been shaved. We also learned that repeated Nair use is detrimental to the mice and are using a small shaver to...gently remove the hair . Tasks 1B. (months 1-18). • Conduct signaling and gene analysis outlined in Aim1 and Figure 1. All reagents and procedures

  6. Image-guided microbeam irradiation to brain tumour bearing mice using a carbon nanotube x-ray source array

    NASA Astrophysics Data System (ADS)

    Zhang, Lei; Yuan, Hong; Burk, Laurel M.; Inscoe, Christy R.; Hadsell, Michael J.; Chtcheprov, Pavel; Lee, Yueh Z.; Lu, Jianping; Chang, Sha; Zhou, Otto

    2014-03-01

    Microbeam radiation therapy (MRT) is a promising experimental and preclinical radiotherapy method for cancer treatment. Synchrotron based MRT experiments have shown that spatially fractionated microbeam radiation has the unique capability of preferentially eradicating tumour cells while sparing normal tissue in brain tumour bearing animal models. We recently demonstrated the feasibility of generating orthovoltage microbeam radiation with an adjustable microbeam width using a carbon nanotube based x-ray source array. Here we report the preliminary results from our efforts in developing an image guidance procedure for the targeted delivery of the narrow microbeams to the small tumour region in the mouse brain. Magnetic resonance imaging was used for tumour identification, and on-board x-ray radiography was used for imaging of landmarks without contrast agents. The two images were aligned using 2D rigid body image registration to determine the relative position of the tumour with respect to a landmark. The targeting accuracy and consistency were evaluated by first irradiating a group of mice inoculated with U87 human glioma brain tumours using the present protocol and then determining the locations of the microbeam radiation tracks using γ-H2AX immunofluorescence staining. The histology results showed that among 14 mice irradiated, 11 received the prescribed number of microbeams on the targeted tumour, with an average localization accuracy of 454 µm measured directly from the histology (537 µm if measured from the registered histological images). Two mice received one of the three prescribed microbeams on the tumour site. One mouse was excluded from the analysis due to tissue staining errors.

  7. Endothelial cell-derived microparticles loaded with iron oxide nanoparticles: feasibility of MR imaging monitoring in mice.

    PubMed

    Al Faraj, Achraf; Gazeau, Florence; Wilhelm, Claire; Devue, Cécile; Guérin, Coralie L; Péchoux, Christine; Paradis, Valérie; Clément, Olivier; Boulanger, Chantal M; Rautou, Pierre-Emmanuel

    2012-04-01

    To assess the feasibility of loading iron oxide nanoparticles in endothelial microparticles (EMPs), thereby enabling their noninvasive monitoring with magnetic resonance (MR) imaging in mice. Experiments were approved by the French Ministry of Agriculture. Endothelial cells, first labeled with anionic superparamagnetic nanoparticles, were stimulated to generate EMPs, carrying the nanoparticles in their inner compartment. C57BL/6 mice received an intravenous injection of nanoparticle-loaded EMPs, free nanoparticles, or the supernatant of nanoparticle-loaded EMPs. A 1-week follow-up was performed with a 4.7-T MR imaging device by using a gradient-echo sequence for imaging spleen, liver, and kidney and a radial very-short-echo time sequence for lung imaging. Comparisons were performed by using the Student t test. The signal intensity loss induced by nanoparticle-loaded EMPs or free nanoparticles was readily detected within 5 minutes after injection in the liver and spleen, with a more pronounced effect in the spleen for the magnetic EMPs. The kinetics of signal intensity attenuation differed for nanoparticle-loaded EMPs and free nanoparticles. No signal intensity changes were observed in mice injected with the supernatant of nanoparticle-loaded EMPs, confirming that cells had not released free nanoparticles, but only in association with EMPs. The results were confirmed by using Perls staining and immunofluorescence analysis. The strategy to generate EMPs with magnetic properties allowed noninvasive MR imaging assessment and follow-up of EMPs and opens perspectives for imaging the implications of these cellular vectors in diseases. © RSNA, 2012.

  8. Development and preclinical studies of 64Cu-NOTA-pertuzumab F(ab′)2 for imaging changes in tumor HER2 expression associated with response to trastuzumab by PET/CT

    PubMed Central

    Lam, Karen; Chan, Conrad; Reilly, Raymond M.

    2017-01-01

    ABSTRACT We previously reported that microSPECT/CT imaging with 111In-labeled pertuzumab detected decreased HER2 expression in human breast cancer (BC) xenografts in athymic mice associated with response to treatment with trastuzumab (Herceptin). Our aim was to extend these results to PET/CT by constructing F(ab′)2 of pertuzumab modified with NOTA chelators for complexing 64Cu. The effect of the administered mass (5–200 µg) of 64Cu-NOTA-pertuzumab F(ab′)2 was studied in NOD/SCID mice engrafted with HER2-positive SK-OV-3 human ovarian cancer xenografts. Biodistribution studies were performed in non-tumor bearing Balb/c mice to predict radiation doses to normal organs in humans. Serial PET/CT imaging was conducted on mice engrafted with HER2-positive and trastuzumab-sensitive BT-474 or trastuzumab-insensitive SK-OV-3 xenografted mice treated with weekly doses of trastuzumab. There were no significant effects of the administered mass of 64Cu-NOTA-pertuzumab F(ab′)2 on tumor or normal tissue uptake. The predicted total body dose in humans was 0.015 mSv/MBq, a 3.3-fold reduction compared to 111In-labeled pertuzumab. MicroPET/CT images revealed specific tumor uptake of 64Cu-NOTA-pertuzumab F(ab′)2 at 24 or 48 h post-injection in mice with SK-OV-3 tumors. Image analysis of mice treated with trastuzumab showed 2-fold reduced uptake of 64Cu-NOTA-pertuzumab F(ab′)2 in BT-474 tumors after 1 week of trastuzumab normalized to baseline, and 1.9-fold increased uptake in SK-OV-3 tumors after 3 weeks of trastuzumab, consistent with tumor response and resistance, respectively. We conclude that PET/CT imaging with 64Cu-NOTA-pertuzumab F(ab′)2 detected changes in HER2 expression in response to trastuzumab while delivering a lower total body radiation dose compared to 111In-labeled pertuzumab. PMID:27813707

  9. Photoacoustic spectroscopic imaging of intra-tumor heterogeneity and molecular identification

    NASA Astrophysics Data System (ADS)

    Stantz, Keith M.; Liu, Bo; Cao, Minsong; Reinecke, Dan; Miller, Kathy; Kruger, Robert

    2006-02-01

    Purpose. To evaluate photoacoustic spectroscopy as a potential imaging modality capable of measuring intra-tumor heterogeneity and spectral features associated with hemoglobin and the molecular probe indocyanine green (ICG). Material and Methods. Immune deficient mice were injected with wildtype and VEGF enhanced MCF-7 breast cancer cells or SKOV3x ovarian cancer cells, which were allowed to grow to a size of 6-12 mm in diameter. Two mice were imaged alive and after euthanasia for (oxy/deoxy)-hemoglobin content. A 0.4 mL volume of 1 μg/mL concentration of ICG was injected into the tail veins of two mice prior to imaging using the photoacoustic computed tomography (PCT) spectrometer (Optosonics, Inc., Indianapolis, IN 46202) scanner. Mouse images were acquired for wavelengths spanning 700-920 nm, after which the major organs were excised, and similarly imaged. A histological study was performed by sectioning the organ and optically imaging the fluorescence distribution. Results. Calibration of PCT-spectroscopy with different samples of oxygenated blood reproduced a hemoglobin dissociation curve consistent with empirical formula with an average error of 5.6%. In vivo PCT determination of SaO II levels within the tumor vascular was measurably tracked, and spatially correlated to the periphery of the tumor. Statistical and systematic errors associated with hypoxia were estimated to be 10 and 13%, respectively. Measured ICG concentrations determined by contrast-differential PCT images in excised organs (tumor, liver) were approximately 0.8 μg/mL, consistent with fluorescent histological results. Also, the difference in the ratio of ICG concentration in the gall bladder-to-vasculature between the mice was consistent with excretion times between the two mice. Conclusion. PCT spectroscopic imaging has shown to be a noninvasive modality capable of imaging intra-tumor heterogeneity of (oxy/deoxy)-hemoglobin and ICG in vivo, with an estimated error in SaO II at 17% and in ICG at 0.8 μg/mL in excised tissue. Ongoing development of spectroscopic analysis techniques, probe development, and calibration techniques are being developed to improve sensitivity to both exogenous molecular probes and (oxy/deoxy)-hemoglobin fraction.

  10. Image-derived arterial input function for quantitative fluorescence imaging of receptor-drug binding in vivo

    PubMed Central

    Elliott, Jonathan T.; Samkoe, Kimberley S.; Davis, Scott C.; Gunn, Jason R.; Paulsen, Keith D.; Roberts, David W.; Pogue, Brian W.

    2017-01-01

    Receptor concentration imaging (RCI) with targeted-untargeted optical dye pairs has enabled in vivo immunohistochemistry analysis in preclinical subcutaneous tumors. Successful application of RCI to fluorescence guided resection (FGR), so that quantitative molecular imaging of tumor-specific receptors could be performed in situ, would have a high impact. However, assumptions of pharmacokinetics, permeability and retention, as well as the lack of a suitable reference region limit the potential for RCI in human neurosurgery. In this study, an arterial input graphic analysis (AIGA) method is presented which is enabled by independent component analysis (ICA). The percent difference in arterial concentration between the image-derived arterial input function (AIFICA) and that obtained by an invasive method (ICACAR) was 2.0 ± 2.7% during the first hour of circulation of a targeted-untargeted dye pair in mice. Estimates of distribution volume and receptor concentration in tumor bearing mice (n = 5) recovered using the AIGA technique did not differ significantly from values obtained using invasive AIF measurements (p=0.12). The AIGA method, enabled by the subject-specific AIFICA, was also applied in a rat orthotopic model of U-251 glioblastoma to obtain the first reported receptor concentration and distribution volume maps during open craniotomy. PMID:26349671

  11. Detection of early stage atherosclerotic plaques using PET and CT fusion imaging targeting P-selectin in low density lipoprotein receptor-deficient mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Ikuko, E-mail: nakamuri@riken.jp; Department of Cardiovascular Medicine, Saga University, Saga; Hasegawa, Koki

    2013-03-29

    Highlights: ► P-selectin regulates leukocyte recruitment as an early stage event of atherogenesis. ► We developed an antibody-based molecular imaging probe targeting P-selectin for PET. ► This is the first report on successful PET imaging for delineation of P-selectin. ► P-selectin is a candidate target for atherosclerotic plaque imaging by clinical PET. -- Abstract: Background: Sensitive detection and qualitative analysis of atherosclerotic plaques are in high demand in cardiovascular clinical settings. The leukocyte–endothelial interaction mediated by an adhesion molecule P-selectin participates in arterial wall inflammation and atherosclerosis. Methods and results: A {sup 64}Cu-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid conjugated anti-P-selectin monoclonal antibody ({sup 64}Cu-DOTA-anti-P-selectinmore » mAb) probe was prepared by conjugating an anti-P-selectin monoclonal antibody with DOTA followed by {sup 64}Cu labeling. Thirty-six hours prior to PET and CT fusion imaging, 3 MBq of {sup 64}Cu-DOTA-anti-P-selectin mAb was intravenously injected into low density lipoprotein receptor-deficient Ldlr-/- mice. After a 180 min PET scan, autoradiography and biodistribution of {sup 64}Cu-DOTA-anti-P-selectin monoclonal antibody was examined using excised aortas. In Ldlr-/- mice fed with a high cholesterol diet for promotion of atherosclerotic plaque development, PET and CT fusion imaging revealed selective and prominent accumulation of the probe in the aortic root. Autoradiography of aortas that demonstrated probe uptake into atherosclerotic plaques was confirmed by Oil red O staining for lipid droplets. In Ldlr-/- mice fed with a chow diet to develop mild atherosclerotic plaques, probe accumulation was barely detectable in the aortic root on PET and CT fusion imaging. Probe biodistribution in aortas was 6.6-fold higher in Ldlr-/- mice fed with a high cholesterol diet than in those fed with a normal chow diet. {sup 64}Cu-DOTA-anti-P-selectin mAb accumulated selectively in aortic atherosclerotic plaques and was detectable by PET and CT fusion imaging in Ldlr-/- mice. Conclusions: P-selectin is a candidate target molecule for early-phase detection by PET and CT fusion imaging of atherosclerotic plaques.« less

  12. Analysis of speckle patterns in phase-contrast images of lung tissue

    NASA Astrophysics Data System (ADS)

    Kitchen, M. J.; Paganin, D.; Lewis, R. A.; Yagi, N.; Uesugi, K.

    2005-08-01

    Propagation-based phase-contrast images of mice lungs have been obtained at the SPring-8 synchrotron research facility. Such images exhibit a speckled intensity pattern that bears a superficial resemblance to alveolar structures. This speckle results from focussing effects as projected air-filled alveoli form aberrated compound refractive lenses. An appropriate phase-retrieval algorithm has been utilized to reconstruct the approximate projected lung tissue thickness from single-phase-contrast mice chest radiographs. The results show projected density variations across the lung, highlighting regions of low density corresponding to air-filled regions. Potentially, this offers a better method than conventional radiography for detecting lung diseases such as fibrosis, emphysema and cancer, though this has yet to be demonstrated. As such, the approach can assist in continuing studies of lung function utilizing propagation-based phase-contrast imaging.

  13. A tracer kinetic model for 18F-FHBG for quantitating herpes simplex virus type 1 thymidine kinase reporter gene expression in living animals using PET.

    PubMed

    Green, Leeta Alison; Nguyen, Khoi; Berenji, Bijan; Iyer, Meera; Bauer, Eileen; Barrio, Jorge R; Namavari, Mohammad; Satyamurthy, Nagichettiar; Gambhir, Sanjiv S

    2004-09-01

    Reporter probe 9-(4-18F-fluoro-3-[hydroxymethyl]butyl)guanine (18F-FHBG) and reporter gene mutant herpes simplex virus type 1 thymidine kinase (HSV1-sr39tk) have been used for imaging reporter gene expression with PET. Current methods for quantitating the images using the percentage injected dose per gram of tissue do not distinguish between the effects of probe transport and subsequent phosphorylation. We therefore investigated tracer kinetic models for 18F-FHBG dynamic microPET data and noninvasive methods for determining blood time-activity curves in an adenoviral gene delivery model in mice. 18F-FHBG (approximately 7.4 MBq [approximately 200 microCi]) was injected into 4 mice; 18F-FHBG concentrations in plasma and whole blood were measured from mouse heart left ventricle (LV) direct sampling. Replication-incompetent adenovirus (0-2 x 10(9) plaque-forming units) with the E1 region deleted (n = 8) or replaced by HSV1-sr39tk (n = 18) was tail-vein injected into mice. Mice were dynamically scanned using microPET (approximately 7.4 MBq [approximately 200 microCi] 18F-FHBG) over 1 h; regions of interest were drawn on images of the heart and liver. Serial whole blood 18F-FHBG concentrations were measured in 6 of the mice by LV sampling, and 1 least-squares ratio of the heart image to the LV time-activity curve was calculated for all 6 mice. For 2 control mice and 9 mice expressing HSV1-sr39tk, heart image (input function) and liver image time-activity curves (tissue curves) were fit to 2- and 3-compartment models using Levenberg-Marquardt nonlinear regression. The models were compared using an F statistic. HSV1-sr39TK enzyme activity was determined from liver samples and compared with model parameter estimates. For another 3 control mice and 6 HSV1-sr39TK-positive mice, the model-predicted relative percentage of metabolites was compared with high-performance liquid chromatography analysis. The ratio of 18F-FHBG in plasma to whole blood was 0.84 +/- 0.05 (mean +/- SE) by 30 s after injection. The least-squares ratio of the heart image time-activity curve to the LV time-activity curve was 0.83 +/- 0.02, consistent with the recovery coefficient for the partial-volume effect (0.81) based on independent measures of heart geometry. A 3-compartment model best described 18F-FHBG kinetics in mice expressing HSV1-sr39tk in the liver; a 2-compartment model best described the kinetics in control mice. The 3-compartment model parameter, k3, correlated well with the HSV1-sr39TK enzyme activity (r2 = 0.88). 18F-FHBG equilibrates rapidly between plasma and whole blood in mice. Heart image time-activity curves corrected for partial-volume effects well approximate LV time-activity curves and can be used as input functions for 2- and 3-compartment models. The model parameter k3 from the 3-compartment model can be used as a noninvasive estimate for HSV1-sr39TK reporter protein activity and can predict the relative percentage of metabolites.

  14. Brain and behaviour phenotyping of a mouse model of neurofibromatosis type-1: an MRI/DTI study on social cognition.

    PubMed

    Petrella, L I; Cai, Y; Sereno, J V; Gonçalves, S I; Silva, A J; Castelo-Branco, M

    2016-09-01

    Neurofibromatosis type-1 (NF1) is a common neurogenetic disorder and an important cause of intellectual disability. Brain-behaviour associations can be examined in vivo using morphometric magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI) to study brain structure. Here, we studied structural and behavioural phenotypes in heterozygous Nf1 mice (Nf1(+/-) ) using T2-weighted imaging MRI and DTI, with a focus on social recognition deficits. We found that Nf1(+/-) mice have larger volumes than wild-type (WT) mice in regions of interest involved in social cognition, the prefrontal cortex (PFC) and the caudate-putamen (CPu). Higher diffusivity was found across a distributed network of cortical and subcortical brain regions, within and beyond these regions. Significant differences were observed for the social recognition test. Most importantly, significant structure-function correlations were identified concerning social recognition performance and PFC volumes in Nf1(+/-) mice. Analyses of spatial learning corroborated the previously known deficits in the mutant mice, as corroborated by platform crossings, training quadrant time and average proximity measures. Moreover, linear discriminant analysis of spatial performance identified 2 separate sub-groups in Nf1(+/-) mice. A significant correlation between quadrant time and CPu volumes was found specifically for the sub-group of Nf1(+/-) mice with lower spatial learning performance, suggesting additional evidence for reorganization of this region. We found strong evidence that social and spatial cognition deficits can be associated with PFC/CPu structural changes and reorganization in NF1. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  15. A microarray analysis of retinal transcripts that are controlled by image contrast in mice.

    PubMed

    Brand, Christine; Schaeffel, Frank; Feldkaemper, Marita Pauline

    2007-06-18

    The development of myopia is controlled by still largely unknown retinal signals. The aim of this study was to investigate the changes in retinal mRNA expression after different periods of visual deprivation in mice, while controlling for retinal illuminance. Each group consisted of three male C57BL/6 mice. Treatment periods were 30 min, 4 h, and 6+6 h. High spatial frequencies were filtered from the retinal image by frosted diffusers over one eye while the fellow eyes were covered by clear neutral density (ND) filters that exhibited similar light attenuating properties (0.1 log units) as the diffusers. For the final 30 min of the respective treatment period mice were individually placed in a clear Perspex cylinder that was positioned in the center of a rotating (60 degrees) large drum. The inside of the drum was covered with a 0.1 cyc/degree vertical square wave grating. This visual environment was chosen to standardize illuminances and contrasts seen by the mice. Labeled cRNA was prepared and hybridized to Affymetrix GeneChip Mouse Genome 430 2.0 arrays. Alterations in mRNA expression levels of candidate genes with potential biological relevance were confirmed by semi-quantitative real-time reverse transcription polymerase chain reaction (RT-PCR). In all groups, Egr-1 mRNA expression was reduced in diffuser-treated eyes. Furthermore, the degradation of the spatial frequency spectrum also changed the cFos mRNA level, with reduced expression after 4 h of diffuser treatment. Other interesting candidates were Akt2, which was up-regulated after 30 min of deprivation and Mapk8ip3, a neuron specific JNK binding and scaffolding protein that was temporally regulated in the diffuser-treated eyes only. The microarray analysis demonstrated a pattern of differential transcriptional changes, even though differences in the retinal images were restricted to spatial features. The candidate genes may provide further insight into the biochemical short-term changes following retinal image degradation in mice. Because deprivation of spatial vision leads to increased eye growth and myopia in both animals and humans, it is believed some of the identified genes play a role in myopia development.

  16. Evaluating mononuclear cells as nanoparticle delivery vehicles for the treatment of breast tumors

    NASA Astrophysics Data System (ADS)

    Murton, Jaclyn K.; Hu, Chelin; Ahmed, Mona M.; Hathaway, Helen J.; Nysus, Monique; Anderson Daniels, Tamara; Norenberg, Jeffrey P.; Adolphi, Natalie L.

    2015-08-01

    In breast cancer, certain types of circulating immune cells respond to long-range chemical signals from tumors by leaving the blood stream to actively infiltrate tumor tissue. The aim of this study was to evaluate whether immune cells could be used to deliver therapeutic nanoparticles into breast tumors in mice. Mononuclear splenocytes (MS) were harvested from donor mice, labeled with Indium-111, injected intravenously into immune-competent recipient mice (3 tumor-bearing and 3 control), and imaged longitudinally by SPECT/CT. For comparison, the biodistribution of bonemarrow derived macrophages (BMDM) in one pair of mice was also imaged. Quantitative analysis of the SPECT images demonstrates that, after 24 hours, the concentration of MS detected in mammary tumors is more than 3-fold higher than the concentration detected in normal mammary glands. The ratio of MS concentration in mammary tissue to MS concentration in non-target tissues (muscle, lung, heart, liver, spleen, and kidney) was enhanced in tumor-bearing mice (compared to controls), with statistical significance achieved for mammary/muscle (p<0.01), mammary/lung (p<0.05), and mammary/kidney (p<0.05). By contrast, BMDM did not show a different affinity for tumors relative to normal mammary tissue. MS were incubated with 100 nm red fluorescent nanoparticles, and flow cytometry demonstrated that ~35% of the MS population exhibited strong phagocytic uptake of the nanoparticles. After intravenous injection into tumor-bearing mice, fluorescence microscopy images of tumor sections show qualitatively that nanoparticle-loaded MS retain the ability to infiltrate mammary tumors. Taken together, these results suggest that MS carriers are capable of actively targeting therapeutic nanoparticles to breast tumors.

  17. Hyperplasia of type 2 pneumocytes following 0. 34 ppm nitrogen dioxide exposure: quantitation by image analysis. [Mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sherwin, R.P.; Richters, V.

    1982-09-01

    Swiss Webster male mice were exposed to intermittent 0.34 ppm nitrogen dioxide for 6 wk. Quantitative image analysis showed increased Type 2 cell numbers in each of the three lobes measured, with and without adjustment to alveolar wall measurements for lung volume normalization (e.g., P < .037 for Type 2 cell number adjusted to alveolar wall perimeters, combined lobe analysis of variance). The exposed animals dominated the upper quartile ranking of the cell number/alveolar area ratio computations (P < .025), which implied the presence of an especially susceptible subpopulation of animals. The Type 2 cell increase is believed to resultmore » from damage and loss of Type 1 cells, the reversibility and progression of which are presently unknown. The data also suggest an increased size of the Type 2 cell, and possibly slight atelectasis and/or edema of the alveolar walls.« less

  18. Comprehensive Cardiovascular magnetic resonance of myocardial mechanics in mice using three-dimensional cine DENSE

    PubMed Central

    2011-01-01

    Background Quantitative noninvasive imaging of myocardial mechanics in mice enables studies of the roles of individual genes in cardiac function. We sought to develop comprehensive three-dimensional methods for imaging myocardial mechanics in mice. Methods A 3D cine DENSE pulse sequence was implemented on a 7T small-bore scanner. The sequence used three-point phase cycling for artifact suppression and a stack-of-spirals k-space trajectory for efficient data acquisition. A semi-automatic 2D method was adapted for 3D image segmentation, and automated 3D methods to calculate strain, twist, and torsion were employed. A scan protocol that covered the majority of the left ventricle in a scan time of less than 25 minutes was developed, and seven healthy C57Bl/6 mice were studied. Results Using these methods, multiphase normal and shear strains were measured, as were myocardial twist and torsion. Peak end-systolic values for the normal strains at the mid-ventricular level were 0.29 ± 0.17, -0.13 ± 0.03, and -0.18 ± 0.14 for Err, Ecc, and Ell, respectively. Peak end-systolic values for the shear strains were 0.00 ± 0.08, 0.04 ± 0.12, and 0.03 ± 0.07 for Erc, Erl, and Ecl, respectively. The peak end-systolic normalized torsion was 5.6 ± 0.9°. Conclusions Using a 3D cine DENSE sequence tailored for cardiac imaging in mice at 7 T, a comprehensive assessment of 3D myocardial mechanics can be achieved with a scan time of less than 25 minutes and an image analysis time of approximately 1 hour. PMID:22208954

  19. [Establishment of a human bladder cancer cell line stably co-expressing hSPRY2 and luciferase genes and its subcutaneous tumor xenograft model in nude mice].

    PubMed

    Yin, Xiaotao; Li, Fanglong; Jin, Yipeng; Yin, Zhaoyang; Qi, Siyong; Wu, Shuai; Wang, Zicheng; Wang, Lin; Yu, Jiyun; Gao, Jiangping

    2017-03-01

    Objective To establish a human bladder cancer cell line stably co-expressing human sprouty2 (hSPRY2) and luciferase (Luc) genes simultaneously, and develop its subcutaneous tumor xenograft model in nude mice. Methods The hSPRY2 and Luc gene segments were amplified by PCR, and were cloned into lentiviral vector pCDH and pLVX respectively to produce corresponding lentivirus particles. The J82 human bladder cancer cells were infected with these two kinds of lentivirus particles, and then further screened by puromycin and G418. The expressions of hSPRY2 and Luc genes were detected by bioluminescence, immunofluorescence and Western blot analysis. The screened J82-hSPRY2/Luc cells were injected subcutaneously into BALB/c nude mice, and the growth of tumor was monitored dynamically using in vivo fluorescence imaging system. Results J82-hSPRY2/Luc cell line stably expressing hSPRY2 and Luc genes was established successfully. Bioluminescence, immunofluorescence and Western blot analysis validated the expressions of hSPRY2 and Luc genes. The in vivo fluorescence imaging system showed obvious fluorescence in subcutaneous tumor xenograft in nude mice. Conclusion The J82-hSPRY2/Luc bladder cancer cell line and its subcutaneous tumor xenograft model in nude mice have been established successfully.

  20. Unsupervised analysis of small animal dynamic Cerenkov luminescence imaging

    NASA Astrophysics Data System (ADS)

    Spinelli, Antonello E.; Boschi, Federico

    2011-12-01

    Clustering analysis (CA) and principal component analysis (PCA) were applied to dynamic Cerenkov luminescence images (dCLI). In order to investigate the performances of the proposed approaches, two distinct dynamic data sets obtained by injecting mice with 32P-ATP and 18F-FDG were acquired using the IVIS 200 optical imager. The k-means clustering algorithm has been applied to dCLI and was implemented using interactive data language 8.1. We show that cluster analysis allows us to obtain good agreement between the clustered and the corresponding emission regions like the bladder, the liver, and the tumor. We also show a good correspondence between the time activity curves of the different regions obtained by using CA and manual region of interest analysis on dCLIT and PCA images. We conclude that CA provides an automatic unsupervised method for the analysis of preclinical dynamic Cerenkov luminescence image data.

  1. Image-guided microbeam irradiation to brain tumour bearing mice using a carbon nanotube X-ray source array

    PubMed Central

    Zhang, Lei; Yuan, Hong; Burk, Laurel M; Inscoe, Christy R; Hadsell, Michael J; Chtcheprov, Pavel; Lee, Yueh Z; Lu, Jianping; Chang, Sha; Zhou, Otto

    2014-01-01

    Microbeam radiation therapy (MRT) is a promising experimental and preclinical radiotherapy method for cancer treatment. Synchrotron based MRT experiments have shown that spatially fractionated microbeam radiation has the unique capability of preferentially eradicating tumour cells while sparing normal tissue in brain tumour bearing animal models. We recently demonstrated the feasibility of generating orthovoltage microbeam radiation with an adjustable microbeam width using a carbon nanotube based X-ray source array. Here we report the preliminary results from our efforts in developing an image guidance procedure for the targeted delivery of the narrow microbeams to the small tumour region in the mouse brain. Magnetic resonance imaging was used for tumour identification, and on-board X-ray radiography was used for imaging of landmarks without contrast agents. The two images were aligned using 2D rigid body image registration to determine the relative position of the tumour with respect to a landmark. The targeting accuracy and consistency were evaluated by first irradiating a group of mice inoculated with U87 human glioma brain tumours using the present protocol and then determining the locations of the microbeam radiation tracks using γ-H2AX immunofluorescence staining. The histology results showed that among 14 mice irradiated, 11 received the prescribed number of microbeams on the targeted tumour, with an average localization accuracy of 454 μm measured directly from the histology (537 μm if measured from the registered histological images). Two mice received one of the three prescribed microbeams on the tumour site. One mouse was excluded from the analysis due to tissue staining errors. PMID:24556798

  2. Cardiac Chemical Exchange Saturation Transfer MR Imaging Tracking of Cell Survival or Rejection in Mouse Models of Cell Therapy.

    PubMed

    Pumphrey, Ashley L; Ye, Shaojing; Yang, Zhengshi; Simkin, Jennifer; Gensel, John C; Abdel-Latif, Ahmed; Vandsburger, Moriel H

    2017-01-01

    Purpose To examine whether cardiac chemical exchange saturation transfer (CEST) imaging can be serially and noninvasively used to probe cell survival or rejection after intramyocardial implantation in mice. Materials and Methods Experiments were compliant with the National Institutes of Health Guidelines on the Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee. One million C2C12 cells labeled with either europium (Eu) 10-(2-hydroxypropyl)-1,4,7-tetraazacyclododecane-1,4,7-triacetic acid (HP-DO3A) or saline via the hypotonic swelling technique were implanted into the anterior-lateral left ventricular wall in C57BL/6J (allogeneic model, n = 17) and C3H (syngeneic model, n = 13) mice. Imaging (frequency offsets of ±15 parts per million) was performed 1, 10, and 20 days after implantation, with the asymmetrical magnetization transfer ratio (MTR asym ) calculated from image pairs. Histologic examination was performed at the conclusion of imaging. Changes in MTR asym over time and between mice were assessed by using two-way repeated-measures analysis of variance. Results MTR asym was significantly higher in C3H and C57BL/6J mice in grafts of Eu-HP-DO3A-labeled cells (40.2% ± 5.0 vs 37.8% ± 7.0, respectively) compared with surrounding tissue (-0.67% ± 1.7 vs -1.8% ± 5.3, respectively; P < .001) and saline-labeled grafts (-0.4% ± 6.0 vs -1.2% ± 3.6, respectively; P < .001) at day 1. In C3H mice, MTR asym remained increased (31.3% ± 9.2 on day 10, 28.7% ± 5.2 on day 20; P < .001 vs septum) in areas of in Eu-HP-DO3A-labeled cell grafts. In C57BL/6J mice, corresponding MTR asym values (11.3% ± 8.1 on day 10, 5.1% ± 9.4 on day 20; P < .001 vs day 1) were similar to surrounding myocardium by day 20 (P = .409). Histologic findings confirmed cell rejection in C57BL/6J mice. Estimation of graft area was similar with cardiac CEST imaging and histologic examination (R 2 = 0.89). Conclusion Cardiac CEST imaging can be used to image cell survival and rejection in preclinical models of cell therapy. © RSNA, 2016 Online supplemental material is available for this article.

  3. Characterization of skin abnormalities in a mouse model of osteogenesis imperfecta using high resolution magnetic resonance imaging and Fourier transform infrared imaging spectroscopy.

    PubMed

    Canuto, H C; Fishbein, K W; Huang, A; Doty, S B; Herbert, R A; Peckham, J; Pleshko, N; Spencer, R G

    2012-01-01

    Evaluation of the skin phenotype in osteogenesis imperfecta (OI) typically involves biochemical measurements, such as histologic or biochemical assessment of the collagen produced from biopsy-derived dermal fibroblasts. As an alternative, the current study utilized non-invasive magnetic resonance imaging (MRI) microscopy and optical spectroscopy to define biophysical characteristics of skin in an animal model of OI. MRI of skin harvested from control, homozygous oim/oim and heterozygous oim/+ mice demonstrated several differences in anatomic and biophysical properties. Fourier transform infrared imaging spectroscopy (FT-IRIS) was used to interpret observed MRI signal characteristics in terms of chemical composition. Differences between wild-type and OI mouse skin included the appearance of a collagen-depleted lower dermal layer containing prominent hair follicles in the oim/oim mice, accounting for 55% of skin thickness in these. The MRI magnetization transfer rate was lower by 50% in this layer as compared to the upper dermis, consistent with lower collagen content. The MRI transverse relaxation time, T2, was greater by 30% in the dermis of the oim/oim mice compared to controls, consistent with a more highly hydrated collagen network. Similarly, an FT-IRIS-defined measure of collagen integrity was 30% lower in the oim/oim mice. We conclude that characterization of phenotypic differences between the skin of OI and wild-type mice by MRI and FT-IRIS is feasible, and that these techniques provide powerful complementary approaches for the analysis of the skin phenotype in animal models of disease. Copyright © 2011 John Wiley & Sons, Ltd.

  4. Monitoring therapeutic response of human ovarian cancer to trastuzumab by SPECT imaging with (99m)Tc-peptide-Z(HER2:342).

    PubMed

    Zhang, Jingmian; Zhao, Xinming; Wang, Shijie; Wang, Na; Han, Jingya; Jia, Lizhuo; Ren, Xiuchun

    2015-06-01

    Patients with human epidermal growth factor receptor 2 (HER2)-positive cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. How to systemically assess tumor HER2 expression and identifying appropriate use of anti-HER2 therapies by noninvasive imaging in vivo is an urgent issue. The purpose of this study was to evaluate SPECT imaging of (99m)Tc-Gly-(D)Ala-Gly-Gly-Z(HER2:342) ((99m)Tc-peptide-Z(HER2:342)) for monitoring therapeutic response to trastuzumab in nude mice bearing HER2-positive SKOV-3 xenografts. Nude mice bearing HER2-positive SKOV-3 xenografts were treated with trastuzumab (treatment group) or saline (control) with ten mice in each group. Mice in trastuzumab-treated group were given trastuzumab intraperiotoneally 4 mg/kg on day 1 and 2 mg/kg on day 8; Mice in control group were given physiological saline on day 1 and 8. Mice body weights and tumour volume were monitored every three days during treatment. In vivo SPECT imaging was performed in mice of the two groups using (99m)Tc-peptide-Z(HER2:342) before treatment, on day 8 and 15 after treatment. Radiolabeled probe uptake in tumours was measured as the ratio of radioactive counts in the tumour to that in the contralateral equivalent region (T/NT). After SPECT imaging on day 15, all the mice were euthanized, biodistribution studies of the SKOV-3 xenografts were carried out to validate the imaging results and HER2 expression of the transplanted tumours was analyzed by immunohistochemistry (IHC). Correlation analysis was performed between T/NT ratios acquired by in vivo SPECT imaging on day 15 and the HER2 level of tumours. In vitro cell binding capacity of (99m)Tc-Z(HER2:342) with SKOV-3 cells in the absence and presence of varying amount of trastuzumab were also conducted in the study. Twenty mice body weight in the two groups gradually increased during treatment, but there was no statistical difference (p > 0.05). Though volumes of SKOV-3 xenografts gradually increased in each group during the treatment, the transplanted tumours in trastuzumab-treated group had a slower growth than those in control group (p < 0.05). Compared with the baseline, the results of in vivo imaging showed that radionuclide accumulation in transplanted tumours reduced significantly in trastuzumab-treated group after treatment (p < 0.05), whereas the tumour accumulation in control group increased after treatment. Biodistribution studies demonstrated that the results corresponded well with in vivo imaging data. Immunohistochemical staining confirmed the significant reduction in tumor HER2 level upon trastuzumab treatment, and there was an obviously positive correlation between T/NT ratios and HER2 level of tumours with correlation coefficient rs = 0.919, p < 0.05. There was no significant significance in cell binding ratios between varying amount of trastuzumab and the absence of trastuzumab (p > 0.05). The early response to trastuzumab in mice bearing SKOV-3 xenografts was successfully monitored by SPECT imaging using (99m)Tc-peptide-Z(HER2:342). This approach may be valuable in monitoring the therapeutic response in HER 2-positive tumours under HER2-targeted therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Carbon Tube Electrodes for Electrocardiography-Gated Cardiac Multimodality Imaging in Mice

    PubMed Central

    Choquet, Philippe; Goetz, Christian; Aubertin, Gaelle; Hubele, Fabrice; Sannié, Sébastien; Constantinesco, André

    2011-01-01

    This report describes a simple design of noninvasive carbon tube electrodes that facilitates electrocardiography (ECG) in mice during cardiac multimodality preclinical imaging. Both forepaws and the left hindpaw, covered by conductive gel, of mice were placed into the openings of small carbon tubes. Cardiac ECG-gated single-photon emission CT, X-ray CT, and MRI were tested (n = 60) in 20 mice. For all applications, electrodes were used in a warmed multimodality imaging cell. A heart rate of 563 ± 48 bpm was recorded from anesthetized mice regardless of the imaging technique used, with acquisition times ranging from 1 to 2 h. PMID:21333165

  6. Reduced Collagen Deposition in Infarcted Myocardium Facilitates Induced Pluripotent Stem Cell Engraftment and Angiomyogenesis for Improvement of Left Ventricular Function

    PubMed Central

    Dai, Bo; Huang, Wei; Xu, Meifeng; Millard, Ronald W.; Gao, Mei Hua; Hammond, H. Kirk; Menick, Donald R.; Ashraf, Muhammad; Wang, Yigang

    2012-01-01

    Objectives The purpose of this study was to assess the effect of scar tissue composition on engraftment of progenitor cells into infarcted myocardium. Background Scar tissue formation after myocardial infarction creates a barrier that severely compromises tissue regeneration, limiting potential functional recovery. Methods In vitro: A tricell patch (Tri-P) was created from peritoneum seeded and cultured with induced pluripotent stem cell–derived cardiomyocytes, endothelial cells, and mouse embryonic fibroblasts. The expression of fibrosis-related molecules from mouse embryonic fibroblasts and infarcted heart was measured by Western blot and quantitative reverse transcriptase polymerase chain reaction. In vivo: A Tri-P was affixed over the entire infarcted area 7 days after myocardial infarction in mice overexpressing adenylyl cyclase 6 (AC6). Engraftment efficiency of progenitor cells in hearts of AC6 mice was compared with that of control wild-type (WT) mice using a combination of in vivo bioluminescence imaging, post-mortem ex vivo tissue analysis, and the number of green fluorescent protein–positive cells. Echocardiography of left ventricular (LV) function was performed weekly. Hearts were harvested for analysis 4 weeks after Tri-P application. Mouse embryonic fibroblasts were stimulated with forskolin before an anoxia/reoxygenation protocol. Fibrosis-related molecules were analyzed. Results In AC6 mice, infarcted hearts treated with Tri-P showed significantly higher bioluminescence imaging intensity and numbers of green fluorescent protein–positive cells than in WT mice. LV function improved progressively in AC6 mice from weeks 2 to 4 and was associated with reduced LV fibrosis. Conclusions Application of a Tri-P in AC6 mice resulted in significantly higher induced pluripotent stem cell engraftment accompanied by angiomyogenesis in the infarcted area and improvement in LV function. PMID:22051336

  7. First experiences with in-vivo x-ray dark-field imaging of lung cancer in mice

    NASA Astrophysics Data System (ADS)

    Gromann, Lukas B.; Scherer, Kai; Yaroshenko, Andre; Bölükbas, Deniz A.; Hellbach, Katharina; Meinel, Felix G.; Braunagel, Margarita; Eickelberg, Oliver; Reiser, Maximilian F.; Pfeiffer, Franz; Meiners, Silke; Herzen, Julia

    2017-03-01

    Purpose: The purpose of the present study was to evaluate if x-ray dark-field imaging can help to visualize lung cancer in mice. Materials and Methods: The experiments were performed using mutant mice with high-grade adenocarcinomas. Eight animals with pulmonary carcinoma and eight control animals were imaged in radiography mode using a prototype small-animal x-ray dark-field scanner and three of the cancerous ones additionally in CT mode. After imaging, the lungs were harvested for histological analysis. To determine their diagnostic value, x-ray dark-field and conventional attenuation images were analyzed by three experienced readers in a blind assessment. Results radiographic imaging: The lung nodules were much clearer visualized on the dark-field radiographs compared to conventional radiographs. The loss of air-tissue interfaces in the tumor leads to a significant loss of x-ray scattering, reflected in a strong dark-field signal change. The difference between tumor and healthy tissue in terms of x-ray attenuation is significantly less pronounced. Furthermore, the signal from the overlaying structures on conventional radiographs complicates the detection of pulmonary carcinoma. Results CT imaging: The very first in-vivo CT-imaging results are quite promising as smaller tumors are often better visible in the dark-field images. However the imaging quality is still quite low, especially in the attenuation images due to un-optimized scanning parameters. Conclusion: We found a superior diagnostic performance of dark-field imaging compared to conventional attenuation based imaging, especially when it comes to the detection of small lung nodules. These results support the motivation to further develop this technique and translate it towards a clinical environment.

  8. Low-cost three-dimensional gait analysis system for mice with an infrared depth sensor.

    PubMed

    Nakamura, Akihiro; Funaya, Hiroyuki; Uezono, Naohiro; Nakashima, Kinichi; Ishida, Yasumasa; Suzuki, Tomohiro; Wakana, Shigeharu; Shibata, Tomohiro

    2015-11-01

    Three-dimensional (3D) open-field gait analysis of mice is an essential procedure in genetic and nerve regeneration research. Existing gait analysis systems are generally expensive and may interfere with the natural behaviors of mice because of optical markers and transparent floors. In contrast, the proposed system captures the subjects shape from beneath using a low-cost infrared depth sensor (Microsoft Kinect) and an opaque infrared pass filter. This means that we can track footprints and 3D paw-tip positions without optical markers or a transparent floor, thereby preventing any behavioral changes. Our experimental results suggest with healthy mice that they are more active on opaque floors and spend more time in the center of the open-field, when compared with transparent floors. The proposed system detected footprints with a comparable performance to existing systems, and precisely tracked the 3D paw-tip positions in the depth image coordinates. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  9. Multi-modality optical imaging of ovarian cancer in a post-menopausal mouse model

    NASA Astrophysics Data System (ADS)

    Watson, Jennifer M.; Rice, Photini Faith; Marion, Samuel L.; Bentley, David L.; Brewer, Molly A.; Utzinger, Urs; Hoyer, Patricia B.; Barton, Jennifer K.

    2011-03-01

    Our goal is to use optical imaging to detect cancer development on the sub cellular scale. By determining the microscopic changes that precede ovarian cancer we hope to develop a minimally invasive screening test for high risk patients. A mouse ovarian cancer model has been developed by treating mice with 4-Vinylcyclohexene Diepoxide to induce ovarian failure and 7, 12-Dimethylbenz[a]anthracene (DMBA) to induce ovarian cancer. Using optical coherence tomography (OCT) and multiphoton microscopy (MPM) we have obtained co-registered en face images of sixty-seven mouse ovaries ex vivo and forty-two ovaries in vivo. Preliminary analysis indicates that OCT and MPM can visualize ovarian microstructure. During the next year we will be completing a long term survival study using post-menopausal mice that have been treated with DMBA to induce cancer and imaged in vivo at time points before and after treatment.

  10. Quantifying lung morphology with respiratory-gated micro-CT in a murine model of emphysema

    NASA Astrophysics Data System (ADS)

    Ford, N. L.; Martin, E. L.; Lewis, J. F.; Veldhuizen, R. A. W.; Holdsworth, D. W.; Drangova, M.

    2009-04-01

    Non-invasive micro-CT imaging techniques have been developed to investigate lung structure in free-breathing rodents. In this study, we investigate the utility of retrospectively respiratory-gated micro-CT imaging in an emphysema model to determine if anatomical changes could be observed in the image-derived quantitative analysis at two respiratory phases. The emphysema model chosen was a well-characterized, genetically altered model (TIMP-3 knockout mice) that exhibits a homogeneous phenotype. Micro-CT scans of the free-breathing, anaesthetized mice were obtained in 50 s and retrospectively respiratory sorted and reconstructed, providing 3D images representing peak inspiration and end expiration with 0.15 mm isotropic voxel spacing. Anatomical measurements included the volume and CT density of the lungs and the volume of the major airways, along with the diameters of the trachea, left bronchus and right bronchus. From these measurements, functional parameters such as functional residual capacity and tidal volume were calculated. Significant differences between the wild-type and TIMP-3 knockout groups were observed for measurements of CT density over the entire lung, indicating increased air content in the lungs of TIMP-3 knockout mice. These results demonstrate retrospective respiratory-gated micro-CT, providing images at multiple respiratory phases that can be analyzed quantitatively to investigate anatomical changes in murine models of emphysema.

  11. Mutations in GPR143/OA1 and ABCA4 Inform Interpretations of Short-Wavelength and Near-Infrared Fundus Autofluorescence

    PubMed Central

    Paavo, Maarjaliis; Zhao, Jin; Kim, Hye Jin; Lee, Winston; Zernant, Jana; Cai, Carolyn; Allikmets, Rando; Tsang, Stephen H.; Sparrow, Janet R.

    2018-01-01

    Purpose We sought to advance interpretations and quantification of short-wavelength fundus autofluorescence (SW-AF) emitted from bisretinoid lipofuscin and near-infrared autofluoresence (NIR-AF) originating from melanin. Methods Carriers of mutations in X-linked GPR143/OA1, a common form of ocular albinism; patients with confirmed mutations in ABCA4 conferring increased SW-AF; and subjects with healthy eyes were studied. SW-AF (488 nm excitation, 500–680 nm emission) and NIR-AF (excitation 787 nm, emission >830 nm) images were acquired with a confocal scanning laser ophthalmoscope. SW-AF images were analyzed for quantitative autofluoresence (qAF). Analogous methods of image acquisition and analysis were performed in albino and pigmented Abca4−/− mice and wild-type mice. Results Quantitation of SW-AF (qAF), construction of qAF color-coded maps, and examination of NIR-AF images from GPR143/OA1 carriers revealed mosaics in which patches of fundus exhibiting NIR-AF signal had qAF levels within normal limits whereas the hypopigmented areas in the NIR-AF image corresponded to foci of elevated qAF. qAF also was increased in albino versus pigmented mice. Although melanin contributes to fundus infrared reflectance, the latter appeared to be uniform in en face reflectance images of GPR143/OA1-carriers. In patients diagnosed with ABCA4-associated disease, NIR-AF increased in tandem with increased qAF originating in bisretinoid lipofuscin. Similarly in Abca4−/− mice having increased SW-AF, NIR-AF was more pronounced than in wild-type mice. Conclusions These studies corroborate RPE melanin as the major source of NIR-AF but also indicate that bisretinoid lipofuscin, when present at sufficient concentrations, contributes to the NIR-AF signal. Ocular melanin attenuates the SW-AF signal.

  12. Multiple-animal MR imaging using a 3T clinical scanner and multi-channel coil for volumetric analysis in a mouse tumor model.

    PubMed

    Mitsuda, Minoru; Yamaguchi, Masayuki; Furuta, Toshihiro; Nabetani, Akira; Hirayama, Akira; Nozaki, Atsushi; Niitsu, Mamoru; Fujii, Hirofumi

    2011-01-01

    Multiple small-animal magnetic resonance (MR) imaging to measure tumor volume may increase the throughput of preclinical cancer research assessing tumor response to novel therapies. We used a clinical scanner and multi-channel coil to evaluate the usefulness of this imaging to assess experimental tumor volume in mice. We performed a phantom study to assess 2-dimensional (2D) geometric distortion using 9-cm spherical and 32-cell (8×4 one-cm(2) grids) phantoms using a 3-tesla clinical MR scanner and dedicated multi-channel coil composed of 16 5-cm circular coils. Employing the multi-channel coil, we simultaneously scanned 6 or 8 mice bearing sarcoma 180 tumors. We estimated tumor volume from the sum of the product of tumor area and slice thickness on 2D spin-echo images (repetition time/echo time, 3500/16 ms; in-plane resolution, 0.195×0.195×1 mm(3)). After MR acquisition, we excised and weighed tumors, calculated reference tumor volumes from actual tumor weight assuming a density of 1.05 g/cm(3), and assessed the correlation between the estimated and reference volumes using Pearson's test. Two-dimensional geometric distortion was acceptable below 5% in the 9-cm spherical phantom and in every cell in the 32-cell phantom. We scanned up to 8 mice simultaneously using the multi-channel coil and found 11 tumors larger than 0.1 g in 12 mice. Tumor volumes were 1.04±0.73 estimated by MR imaging and 1.04±0.80 cm(3) by reference volume (average±standard deviation) and highly correlated (correlation coefficient, 0.995; P<0.01, Pearson's test). Use of multiple small-animal MR imaging employing a clinical scanner and multi-channel coil enabled accurate assessment of experimental tumor volume in a large number of mice and may facilitate high throughput monitoring of tumor response to therapy in preclinical research.

  13. Novel whole blood assay for phenotyping platelet reactivity in mice identifies ICAM-1 as a mediator of platelet-monocyte interaction

    PubMed Central

    Kirkby, Nicholas S.; Chan, Melissa V.; Finsterbusch, Michaela; Hogg, Nancy; Nourshargh, Sussan; Warner, Timothy D.

    2015-01-01

    Testing of platelet function is central to the cardiovascular phenotyping of genetically modified mice. Traditional platelet function tests have been developed primarily for testing human samples and the volumes required make them highly unsuitable for the testing of mouse platelets. This limits research in this area. To address this problem, we have developed a miniaturized whole blood aggregometry assay, based on a readily accessible 96-well plate format coupled with quantification of single platelet depletion by flow cytometric analysis. Using this approach, we observed a concentration-dependent loss of single platelets in blood exposed to arachidonic acid, collagen, U46619 or protease activated receptor 4 activating peptide. This loss was sensitive to well-established antiplatelet agents and genetic manipulation of platelet activation pathways. Observations were more deeply analyzed by flow cytometric imaging, confocal imaging, and measurement of platelet releasates. Phenotypic analysis of the reactivity of platelets taken from mice lacking intercellular adhesion molecule (ICAM)-1 identified a marked decrease in fibrinogen-dependent platelet-monocyte interactions, especially under inflammatory conditions. Such findings exemplify the value of screening platelet phenotypes of genetically modified mice and shed further light upon the roles and interactions of platelets in inflammation. PMID:26215112

  14. Identification of novel loci for the generation of reporter mice

    PubMed Central

    Rebecchi, Monica; Levandis, Giovanna

    2017-01-01

    Abstract Deciphering the etiology of complex pathologies at molecular level requires longitudinal studies encompassing multiple biochemical pathways (apoptosis, proliferation, inflammation, oxidative stress). In vivo imaging of current reporter animals enabled the spatio-temporal analysis of specific molecular events, however, the lack of a multiplicity of loci for the generalized and regulated expression of the integrated transgenes hampers the creation of systems for the simultaneous analysis of more than a biochemical pathways at the time. We here developed and tested an in vivo-based methodology for the identification of multiple insertional loci suitable for the generation of reliable reporter mice. The validity of the methodology was tested with the generation of novel mice useful to report on inflammation and oxidative stress. PMID:27899606

  15. Diffusion Kurtosis Imaging Detects Microstructural Alterations in Brain of α-Synuclein Overexpressing Transgenic Mouse Model of Parkinson's Disease: A Pilot Study.

    PubMed

    Khairnar, Amit; Latta, Peter; Drazanova, Eva; Ruda-Kucerova, Jana; Szabó, Nikoletta; Arab, Anas; Hutter-Paier, Birgit; Havas, Daniel; Windisch, Manfred; Sulcova, Alexandra; Starcuk, Zenon; Rektorova, Irena

    2015-11-01

    Evidence suggests that accumulation and aggregation of α-synuclein contribute to the pathogenesis of Parkinson's disease (PD). The aim of this study was to evaluate whether diffusion kurtosis imaging (DKI) will provide a sensitive tool for differentiating between α-synuclein-overexpressing transgenic mouse model of PD (TNWT-61) and wild-type (WT) littermates. This experiment was designed as a proof-of-concept study and forms a part of a complex protocol and ongoing translational research. Nine-month-old TNWT-61 mice and age-matched WT littermates underwent behavioral tests to monitor motor impairment and MRI scanning using 9.4 Tesla system in vivo. Tract-based spatial statistics (TBSS) and the DKI protocol were used to compare the whole brain white matter of TNWT-61 and WT mice. In addition, region of interest (ROI) analysis was performed in gray matter regions such as substantia nigra, striatum, hippocampus, sensorimotor cortex, and thalamus known to show higher accumulation of α-synuclein. For the ROI analysis, both DKI (6 b-values) protocol and conventional (2 b-values) diffusion tensor imaging (cDTI) protocol were used. TNWT-61 mice showed significant impairment of motor coordination. With the DKI protocol, mean, axial, and radial kurtosis were found to be significantly elevated, whereas mean and radial diffusivity were decreased in the TNWT-61 group compared to that in the WT controls with both TBSS and ROI analysis. With the cDTI protocol, the ROI analysis showed decrease in all diffusivity parameters in TNWT-61 mice. The current study provides evidence that DKI by providing both kurtosis and diffusivity parameters gives unique information that is complementary to cDTI for in vivo detection of pathological changes that underlie PD-like symptomatology in TNWT-61 mouse model of PD. This result is a crucial step in search for a candidate diagnostic biomarker with translational potential and relevance for human studies.

  16. Effect of sea buckthorn protein on the intestinal microbial community in streptozotocin-induced diabetic mice.

    PubMed

    Yuan, Huaibo; Shi, Fangfang; Meng, Lina; Wang, Wenjuan

    2018-02-01

    This study investigated the intestinal microbial community distribution of Type 2 diabetic mice and discussed the effects of the sea buckthorn protein on the regulation of gut microbes. Date was collected for 12 cases of normal mice (NC group), 12 cases of Type 2 diabetic mice (DC group), and 12 cases of highly concentrated sea buckthorn seed protein dosed mice (SSPH group). This study analysed fecal samples, measured faecal pH value, and cultivated and determined intestinal bacteria count. This investigation also included the extraction of faecal samples for genomic DNA, PCR amplification of bacterial V3 16S rDNA products by denaturing gradient gel electrophoresis, DGGE map analysis of intestinal flora, determination of intestinal bacteria richness, Shannon-Wiener index and evenness index, and image similarity cluster analysis with UPGMA clustering. This study analysed and elucidated differences between the normal mice group, diabetic mice group, and sea buckthorn protein supplemented group, and the structures of respective intestinal flora. The mice supplemented with sea buckthorn protein exhibited an obvious drop in body weight and blood glucose levels. The Bifidobacterium, Lactobacillus, Bacteroides, and Clostridium coccoides populations recovered. The amplification of the 16S rDNA gene V3 region revealed that the species of intestinal microbes in the treatment group were adjusted to a certain extent. Analysis by ARDRA confirmed that sea buckthorn protein could increase type 2 diabetes in mice intestinal microorganism diversity (H) and simpson (E). Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Salivary Gland Hypofunction in tyrosylprotein sulfotransferase-2 Knockout Mice Is Due to Primary Hypothyroidism

    PubMed Central

    Westmuckett, Andrew D.; Siefert, Joseph C.; Tesiram, Yasvir A.; Pinson, David M.; Moore, Kevin L.

    2013-01-01

    Background Protein-tyrosine sulfation is a post-translational modification of an unknown number of secreted and membrane proteins mediated by two known Golgi tyrosylprotein sulfotransferases (TPST-1 and TPST-2). We reported that Tpst2-/- mice have mild-moderate primary hypothyroidism, whereas Tpst1-/- mice are euthyroid. While using magnetic resonance imaging (MRI) to look at the thyroid gland we noticed that the salivary glands in Tpst2-/- mice appeared smaller than in wild type mice. This prompted a detailed analysis to compare salivary gland structure and function in wild type, Tpst1-/-, and Tpst2 -/- mice. Methodology/Principal Findings Quantitative MRI imaging documented that salivary glands in Tpst2-/- females were ≈ 30% smaller than wild type or Tpst1-/- mice and that the granular convoluted tubules in Tpst2-/- submandibular glands were less prominent and were almost completely devoid of exocrine secretory granules compared to glands from wild type or Tpst1-/- mice. In addition, pilocarpine–induced salivary flow and salivary α-amylase activity in Tpst2-/- mice of both sexes was substantially lower than in wild type and Tpst1-/- mice. Anti-sulfotyrosine Western blots of salivary gland extracts and saliva showed no differences between wild type, Tpst1-/-, and Tpst2-/- mice, suggesting that the salivary gland hypofunction is due to factor(s) extrinsic to the salivary glands. Finally, we found that all indicators of hypothyroidism (serum T4, body weight) and salivary gland hypofunction (salivary flow, salivary α-amylase activity, histological changes) were restored to normal or near normal by thyroid hormone supplementation. Conclusions/Significance Our findings conclusively demonstrate that low body weight and salivary gland hypofunction in Tpst2-/- mice is due solely to primary hypothyroidism. PMID:23951251

  18. Quantification of Pulmonary Fibrosis in a Bleomycin Mouse Model Using Automated Histological Image Analysis.

    PubMed

    Gilhodes, Jean-Claude; Julé, Yvon; Kreuz, Sebastian; Stierstorfer, Birgit; Stiller, Detlef; Wollin, Lutz

    2017-01-01

    Current literature on pulmonary fibrosis induced in animal models highlights the need of an accurate, reliable and reproducible histological quantitative analysis. One of the major limits of histological scoring concerns the fact that it is observer-dependent and consequently subject to variability, which may preclude comparative studies between different laboratories. To achieve a reliable and observer-independent quantification of lung fibrosis we developed an automated software histological image analysis performed from digital image of entire lung sections. This automated analysis was compared to standard evaluation methods with regard to its validation as an end-point measure of fibrosis. Lung fibrosis was induced in mice by intratracheal administration of bleomycin (BLM) at 0.25, 0.5, 0.75 and 1 mg/kg. A detailed characterization of BLM-induced fibrosis was performed 14 days after BLM administration using lung function testing, micro-computed tomography and Ashcroft scoring analysis. Quantification of fibrosis by automated analysis was assessed based on pulmonary tissue density measured from thousands of micro-tiles processed from digital images of entire lung sections. Prior to analysis, large bronchi and vessels were manually excluded from the original images. Measurement of fibrosis has been expressed by two indexes: the mean pulmonary tissue density and the high pulmonary tissue density frequency. We showed that tissue density indexes gave access to a very accurate and reliable quantification of morphological changes induced by BLM even for the lowest concentration used (0.25 mg/kg). A reconstructed 2D-image of the entire lung section at high resolution (3.6 μm/pixel) has been performed from tissue density values allowing the visualization of their distribution throughout fibrotic and non-fibrotic regions. A significant correlation (p<0.0001) was found between automated analysis and the above standard evaluation methods. This correlation establishes automated analysis as a novel end-point measure of BLM-induced lung fibrosis in mice, which will be very valuable for future preclinical drug explorations.

  19. Quantification of Pulmonary Fibrosis in a Bleomycin Mouse Model Using Automated Histological Image Analysis

    PubMed Central

    Gilhodes, Jean-Claude; Kreuz, Sebastian; Stierstorfer, Birgit; Stiller, Detlef; Wollin, Lutz

    2017-01-01

    Current literature on pulmonary fibrosis induced in animal models highlights the need of an accurate, reliable and reproducible histological quantitative analysis. One of the major limits of histological scoring concerns the fact that it is observer-dependent and consequently subject to variability, which may preclude comparative studies between different laboratories. To achieve a reliable and observer-independent quantification of lung fibrosis we developed an automated software histological image analysis performed from digital image of entire lung sections. This automated analysis was compared to standard evaluation methods with regard to its validation as an end-point measure of fibrosis. Lung fibrosis was induced in mice by intratracheal administration of bleomycin (BLM) at 0.25, 0.5, 0.75 and 1 mg/kg. A detailed characterization of BLM-induced fibrosis was performed 14 days after BLM administration using lung function testing, micro-computed tomography and Ashcroft scoring analysis. Quantification of fibrosis by automated analysis was assessed based on pulmonary tissue density measured from thousands of micro-tiles processed from digital images of entire lung sections. Prior to analysis, large bronchi and vessels were manually excluded from the original images. Measurement of fibrosis has been expressed by two indexes: the mean pulmonary tissue density and the high pulmonary tissue density frequency. We showed that tissue density indexes gave access to a very accurate and reliable quantification of morphological changes induced by BLM even for the lowest concentration used (0.25 mg/kg). A reconstructed 2D-image of the entire lung section at high resolution (3.6 μm/pixel) has been performed from tissue density values allowing the visualization of their distribution throughout fibrotic and non-fibrotic regions. A significant correlation (p<0.0001) was found between automated analysis and the above standard evaluation methods. This correlation establishes automated analysis as a novel end-point measure of BLM-induced lung fibrosis in mice, which will be very valuable for future preclinical drug explorations. PMID:28107543

  20. Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

    DTIC Science & Technology

    2012-10-01

    ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

  1. Wave intensity analysis in mice: an ultrasound-based study in the abdominal aorta and common carotid artery

    NASA Astrophysics Data System (ADS)

    Di Lascio, N.; Kusmic, C.; Stea, F.; Faita, F.

    2017-03-01

    Wave Intensity Analysis (WIA) can provide parameters representative of the interaction between the vascular network and the heart. It has been already demonstrated that WIA-derived biomarkes have a quantitative physiological meaning. Aim of this study was to develop an image process algorithm for performing non-invasive WIA in mice and correlate commonly used cardiac function parameters with WIA-derived indexes. Sixteen wild-type male mice (8 weeks-old) were imaged with high-resolution ultrasound (Vevo 2100). Abdominal aorta and common carotid pulse wave velocities (PWVabd, PWVcar) were obtained processing B-Mode and PW-Doppler images and employed to assess WIA. Amplitudes of the first (W1abd, W1car) and the second (W2abd, W2car) local maxima and minimum (Wbabd,Wbcar) were evaluated; areas under the negative part of the curve were also calculated (NAabd, NAcar). Cardiac output (CO), ejection fraction (EF) fractional shortening (FS) and stroke volume (SV) were estimated; strain analysis provided strain and strain rate values for longitudinal, radial and circumferential directions (LS, LSR, RS, RSR, CS, CSR). Isovolumetric relaxation time (IVRT) was calculated from mitral inflow PW-Doppler images; IVRT values were normalized for cardiac cycle length. W1abd was correlated with LS (R=0.65) and LSR (R=0.59), while W1car was correlated with CO (R=0.58), EF (R=0.72), LS (R=0.65), LSR (R=0.89), CS (R=0.71), CSR (R=0.70). Both W2abd and W2car were not correlated with IVRT. Carotid artery WIA-derived parameters are more representative of cardiac function than those obtained from the abdominal aorta. The described US-based method can provide information about cardiac function and cardio-vascular interaction simply studying a single vascular site.

  2. 4D MEMRI atlas of neonatal FVB/N mouse brain development.

    PubMed

    Szulc, Kamila U; Lerch, Jason P; Nieman, Brian J; Bartelle, Benjamin B; Friedel, Miriam; Suero-Abreu, Giselle A; Watson, Charles; Joyner, Alexandra L; Turnbull, Daniel H

    2015-09-01

    The widespread use of the mouse as a model system to study brain development has created the need for noninvasive neuroimaging methods that can be applied to early postnatal mice. The goal of this study was to optimize in vivo three- (3D) and four-dimensional (4D) manganese (Mn)-enhanced MRI (MEMRI) approaches for acquiring and analyzing data from the developing mouse brain. The combination of custom, stage-dependent holders and self-gated (motion-correcting) 3D MRI sequences enabled the acquisition of high-resolution (100-μm isotropic), motion artifact-free brain images with a high level of contrast due to Mn-enhancement of numerous brain regions and nuclei. We acquired high-quality longitudinal brain images from two groups of FVB/N strain mice, six mice per group, each mouse imaged on alternate odd or even days (6 3D MEMRI images at each day) covering the developmental stages between postnatal days 1 to 11. The effects of Mn-exposure, anesthesia and MRI were assessed, showing small but significant transient effects on body weight and brain volume, which recovered with time and did not result in significant morphological differences when compared to controls. Metrics derived from deformation-based morphometry (DBM) were used for quantitative analysis of changes in volume and position of a number of brain regions. The cerebellum, a brain region undergoing significant changes in size and patterning at early postnatal stages, was analyzed in detail to demonstrate the spatiotemporal characterization made possible by this new atlas of mouse brain development. These results show that MEMRI is a powerful tool for quantitative analysis of mouse brain development, with great potential for in vivo phenotype analysis in mouse models of neurodevelopmental diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. A new technique for quantitative analysis of hair loss in mice using grayscale analysis.

    PubMed

    Ponnapakkam, Tulasi; Katikaneni, Ranjitha; Gulati, Rohan; Gensure, Robert

    2015-03-09

    Alopecia is a common form of hair loss which can occur in many different conditions, including male-pattern hair loss, polycystic ovarian syndrome, and alopecia areata. Alopecia can also occur as a side effect of chemotherapy in cancer patients. In this study, our goal was to develop a consistent and reliable method to quantify hair loss in mice, which will allow investigators to accurately assess and compare new therapeutic approaches for these various forms of alopecia. The method utilizes a standard gel imager to obtain and process images of mice, measuring the light absorption, which occurs in rough proportion to the amount of black (or gray) hair on the mouse. Data that has been quantified in this fashion can then be analyzed using standard statistical techniques (i.e., ANOVA, T-test). This methodology was tested in mouse models of chemotherapy-induced alopecia, alopecia areata and alopecia from waxing. In this report, the detailed protocol is presented for performing these measurements, including validation data from C57BL/6 and C3H/HeJ strains of mice. This new technique offers a number of advantages, including relative simplicity of application, reliance on equipment which is readily available in most research laboratories, and applying an objective, quantitative assessment which is more robust than subjective evaluations. Improvements in quantification of hair growth in mice will improve study of alopecia models and facilitate evaluation of promising new therapies in preclinical studies.

  4. Absence of bone sialoprotein (BSP) impairs cortical defect repair in mouse long bone.

    PubMed

    Malaval, Luc; Monfoulet, Laurent; Fabre, Thierry; Pothuaud, Laurent; Bareille, Reine; Miraux, Sylvain; Thiaudiere, Eric; Raffard, Gerard; Franconi, Jean-Michel; Lafage-Proust, Marie-Hélène; Aubin, Jane E; Vico, Laurence; Amédée, Joëlle

    2009-11-01

    Matrix proteins of the SIBLING family interact with bone cells and with bone mineral and are thus in a key position to regulate bone development, remodeling and repair. Within this family, bone sialoprotein (BSP) is highly expressed by osteoblasts, hypertrophic chondrocytes and osteoclasts. We recently reported that mice lacking BSP (BSP-/-) have very low trabecular bone turnover. In the present study, we set up an experimental model of bone repair by drilling a 1 mm diameter hole in the cortical bone of femurs in both BSP-/- and +/+ mice. A non-invasive MRI imaging and bone quantification procedure was designed to follow bone regeneration, and these data were extended by microCT imaging and histomorphometry on undecalcified sections for analysis at cellular level. These combined approaches revealed that the repair process as reflected in defect-refilling in the cortical area was significantly delayed in BSP-/- mice compared to +/+ mice. Concomitantly, histomorphometry showed that formation, mineralization and remodeling of repair (primary) bone in the medulla were delayed in BSP-/- mice, with lower osteoid and osteoclast surfaces at day 15. In conclusion, the absence of BSP delays bone repair at least in part by impairing both new bone formation and osteoclast activity.

  5. Using X-Ray In-Line Phase-Contrast Imaging for the Investigation of Nude Mouse Hepatic Tumors

    PubMed Central

    Zhang, Lu; Luo, Shuqian

    2012-01-01

    The purpose of this paper is to report the noninvasive imaging of hepatic tumors without contrast agents. Both normal tissues and tumor tissues can be detected, and tumor tissues in different stages can be classified quantitatively. We implanted BEL-7402 human hepatocellular carcinoma cells into the livers of nude mice and then imaged the livers using X-ray in-line phase-contrast imaging (ILPCI). The projection images' texture feature based on gray level co-occurrence matrix (GLCM) and dual-tree complex wavelet transforms (DTCWT) were extracted to discriminate normal tissues and tumor tissues. Different stages of hepatic tumors were classified using support vector machines (SVM). Images of livers from nude mice sacrificed 6 days after inoculation with cancer cells show diffuse distribution of the tumor tissue, but images of livers from nude mice sacrificed 9, 12, or 15 days after inoculation with cancer cells show necrotic lumps in the tumor tissue. The results of the principal component analysis (PCA) of the texture features based on GLCM of normal regions were positive, but those of tumor regions were negative. The results of PCA of the texture features based on DTCWT of normal regions were greater than those of tumor regions. The values of the texture features in low-frequency coefficient images increased monotonically with the growth of the tumors. Different stages of liver tumors can be classified using SVM, and the accuracy is 83.33%. Noninvasive and micron-scale imaging can be achieved by X-ray ILPCI. We can observe hepatic tumors and small vessels from the phase-contrast images. This new imaging approach for hepatic cancer is effective and has potential use in the early detection and classification of hepatic tumors. PMID:22761929

  6. High-resolution clustered pinhole (131)Iodine SPECT imaging in mice.

    PubMed

    van der Have, Frans; Ivashchenko, Oleksandra; Goorden, Marlies C; Ramakers, Ruud M; Beekman, Freek J

    2016-08-01

    High-resolution pre-clinical (131)I SPECT can facilitate development of new radioiodine therapies for cancer. To this end, it is important to limit resolution-degrading effects of pinhole edge penetration by the high-energy γ-photons of iodine. Here we introduce, optimize and validate (131)I SPECT performed with a dedicated high-energy clustered multi-pinhole collimator. A SPECT-CT system (VECTor/CT) with stationary gamma-detectors was equipped with a tungsten collimator with clustered pinholes. Images were reconstructed with pixel-based OSEM, using a dedicated (131)I system matrix that models the distance- and energy-dependent resolution and sensitivity of each pinhole, as well as the intrinsic detector blurring and variable depth of interaction in the detector. The system performance was characterized with phantoms and in vivo static and dynamic (131)I-NaI scans of mice. Reconstructed image resolution reached 0.6mm, while quantitative accuracy measured with a (131)I filled syringe reaches an accuracy of +3.6±3.5% of the gold standard value. In vivo mice scans illustrated a clear shape of the thyroid and biodistribution of (131)I within the animal. Pharmacokinetics of (131)I was assessed with 15-s time frames from the sequence of dynamic images and time-activity curves of (131)I-NaI. High-resolution quantitative and fast dynamic (131)I SPECT in mice is possible by means of a high-energy collimator and optimized system modeling. This enables analysis of (131)I uptake even within small organs in mice, which can be highly valuable for development and optimization of targeted cancer therapies. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Dynamic Contrast-Enhanced Magnetic Resonance Imaging of the Metastatic Potential of Melanoma Xenografts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ovrebo, Kirsti Marie; Ellingsen, Christine; Galappathi, Kanthi

    2012-05-01

    Purpose: Gadolinium diethylene-triamine penta-acetic acid (Gd-DTPA)-based dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) has been suggested as a useful noninvasive method for characterizing the physiologic microenvironment of tumors. In the present study, we investigated whether Gd-DTPA-based DCE-MRI has the potential to provide biomarkers for hypoxia-associated metastatic dissemination. Methods and Materials: C-10 and D-12 melanoma xenografts were used as experimental tumor models. Pimonidazole was used as a hypoxia marker. A total of 60 tumors were imaged, and parametric images of K{sup trans} (volume transfer constant of Gd-DTPA) and v{sub e} (fractional distribution volume of Gd-DTPA) were produced by pharmacokinetic analysis of themore » DCE-MRI series. The host mice were killed immediately after DCE-MRI, and the primary tumor and the lungs were resected and prepared for histologic assessment of the fraction of pimonidazole-positive hypoxic tissue and the presence of lung metastases, respectively. Results: Metastases were found in 11 of 26 mice with C-10 tumors and 14 of 34 mice with D-12 tumors. The primary tumors of the metastatic-positive mice had a greater fraction of hypoxic tissue (p = 0.00031, C-10; p < 0.00001, D-12), a lower median K{sup trans} (p = 0.0011, C-10; p < 0.00001, D-12), and a lower median v{sub e} (p = 0.014, C-10; p = 0.016, D-12) than the primary tumors of the metastatic-negative mice. Conclusions: These findings support the clinical attempts to establish DCE-MRI as a method for providing biomarkers for tumor aggressiveness and suggests that primary tumors characterized by low K{sup trans} and low v{sub e} values could have a high probability of hypoxia-associated metastatic spread.« less

  8. Neuroglial metabolic compartmentation underlying leptin deficiency in the obese ob/ob mice as detected by magnetic resonance imaging and spectroscopy methods

    PubMed Central

    Delgado, Teresa C; Violante, Inês R; Nieto-Charques, Laura; Cerdán, Sebastián

    2011-01-01

    Manganese-Enhanced Magnetic Resonance Imaging (MEMRI), 1H and 13C High-Resolution-Magic Angle Spinning (HR-MAS) Spectroscopy, and genomic approaches were used to compare cerebral activation and neuronal and glial oxidative metabolism in ad libitum fed C57BL6/J leptin-deficient, genetically obese ob/ob mice. T1-weighted Magnetic Resonance Images across the hypothalamic Arcuate and the Ventromedial nuclei were acquired kinetically after manganese infusion. Neuroglial compartmentation was investigated in hypothalamic biopsies after intraperitoneal injections of [1-13C]glucose or [2-13C]acetate. Total RNA was extracted to determine the effects of leptin deficiency in the expression of representative genes coding for regulatory enzymes of hypothalamic energy pathways and glutamatergic neurotransmission. Manganese-Enhanced Magnetic Resonance Imaging revealed enhanced cerebral activation in the hypothalamic Arcuate and Ventromedial nuclei of the ob/ob mice. 13C HR-MAS analysis showed increased 13C accumulation in the hypothalamic glutamate and glutamine carbons of ob/ob mice after the administration of [1-13C]glucose, a primarily neuronal substrate. Hypothalamic expression of the genes coding for glucokinase, phosphofructokinase, pyruvate dehydrogenase, and glutamine synthase was not significantly altered while pyruvate kinase expression was slightly upregulated. In conclusion, leptin deficiency associated with obesity led to increased cerebral activation in the hypothalamic Arcuate and Ventromedial nuclei, concomitant with significant increases in neuronal oxidative metabolism and glutamatergic neurotransmission. PMID:21971349

  9. Calibration of a semi-automated segmenting method for quantification of adipose tissue compartments from magnetic resonance images of mice.

    PubMed

    Garteiser, Philippe; Doblas, Sabrina; Towner, Rheal A; Griffin, Timothy M

    2013-11-01

    To use an automated water-suppressed magnetic resonance imaging (MRI) method to objectively assess adipose tissue (AT) volumes in whole body and specific regional body components (subcutaneous, thoracic and peritoneal) of obese and lean mice. Water-suppressed MR images were obtained on a 7T, horizontal-bore MRI system in whole bodies (excluding head) of 26 week old male C57BL6J mice fed a control (10% kcal fat) or high-fat diet (60% kcal fat) for 20 weeks. Manual (outlined regions) versus automated (Gaussian fitting applied to threshold-weighted images) segmentation procedures were compared for whole body AT and regional AT volumes (i.e., subcutaneous, thoracic, and peritoneal). The AT automated segmentation method was compared to dual-energy X-ray (DXA) analysis. The average AT volumes for whole body and individual compartments correlated well between the manual outlining and the automated methods (R2>0.77, p<0.05). Subcutaneous, peritoneal, and total body AT volumes were increased 2-3 fold and thoracic AT volume increased more than 5-fold in diet-induced obese mice versus controls (p<0.05). MRI and DXA-based method comparisons were highly correlative (R2=0.94, p<0.0001). Automated AT segmentation of water-suppressed MRI data using a global Gaussian filtering algorithm resulted in a fairly accurate assessment of total and regional AT volumes in a pre-clinical mouse model of obesity. © 2013 Elsevier Inc. All rights reserved.

  10. Quantitative assessment of tumor angiogenesis using real-time motion-compensated contrast-enhanced ultrasound imaging

    PubMed Central

    Pysz, Marybeth A.; Guracar, Ismayil; Foygel, Kira; Tian, Lu; Willmann, Jürgen K.

    2015-01-01

    Purpose To develop and test a real-time motion compensation algorithm for contrast-enhanced ultrasound imaging of tumor angiogenesis on a clinical ultrasound system. Materials and methods The Administrative Institutional Panel on Laboratory Animal Care approved all experiments. A new motion correction algorithm measuring the sum of absolute differences in pixel displacements within a designated tracking box was implemented in a clinical ultrasound machine. In vivo angiogenesis measurements (expressed as percent contrast area) with and without motion compensated maximum intensity persistence (MIP) ultrasound imaging were analyzed in human colon cancer xenografts (n = 64) in mice. Differences in MIP ultrasound imaging signal with and without motion compensation were compared and correlated with displacements in x- and y-directions. The algorithm was tested in an additional twelve colon cancer xenograft-bearing mice with (n = 6) and without (n = 6) anti-vascular therapy (ASA-404). In vivo MIP percent contrast area measurements were quantitatively correlated with ex vivo microvessel density (MVD) analysis. Results MIP percent contrast area was significantly different (P < 0.001) with and without motion compensation. Differences in percent contrast area correlated significantly (P < 0.001) with x- and y-displacements. MIP percent contrast area measurements were more reproducible with motion compensation (ICC = 0.69) than without (ICC = 0.51) on two consecutive ultrasound scans. Following anti-vascular therapy, motion-compensated MIP percent contrast area significantly (P = 0.03) decreased by 39.4 ± 14.6 % compared to non-treated mice and correlated well with ex vivo MVD analysis (Rho = 0.70; P = 0.05). Conclusion Real-time motion-compensated MIP ultrasound imaging allows reliable and accurate quantification and monitoring of angiogenesis in tumors exposed to breathing-induced motion artifacts. PMID:22535383

  11. Quantitative assessment of tumor angiogenesis using real-time motion-compensated contrast-enhanced ultrasound imaging.

    PubMed

    Pysz, Marybeth A; Guracar, Ismayil; Foygel, Kira; Tian, Lu; Willmann, Jürgen K

    2012-09-01

    To develop and test a real-time motion compensation algorithm for contrast-enhanced ultrasound imaging of tumor angiogenesis on a clinical ultrasound system. The Administrative Institutional Panel on Laboratory Animal Care approved all experiments. A new motion correction algorithm measuring the sum of absolute differences in pixel displacements within a designated tracking box was implemented in a clinical ultrasound machine. In vivo angiogenesis measurements (expressed as percent contrast area) with and without motion compensated maximum intensity persistence (MIP) ultrasound imaging were analyzed in human colon cancer xenografts (n = 64) in mice. Differences in MIP ultrasound imaging signal with and without motion compensation were compared and correlated with displacements in x- and y-directions. The algorithm was tested in an additional twelve colon cancer xenograft-bearing mice with (n = 6) and without (n = 6) anti-vascular therapy (ASA-404). In vivo MIP percent contrast area measurements were quantitatively correlated with ex vivo microvessel density (MVD) analysis. MIP percent contrast area was significantly different (P < 0.001) with and without motion compensation. Differences in percent contrast area correlated significantly (P < 0.001) with x- and y-displacements. MIP percent contrast area measurements were more reproducible with motion compensation (ICC = 0.69) than without (ICC = 0.51) on two consecutive ultrasound scans. Following anti-vascular therapy, motion-compensated MIP percent contrast area significantly (P = 0.03) decreased by 39.4 ± 14.6 % compared to non-treated mice and correlated well with ex vivo MVD analysis (Rho = 0.70; P = 0.05). Real-time motion-compensated MIP ultrasound imaging allows reliable and accurate quantification and monitoring of angiogenesis in tumors exposed to breathing-induced motion artifacts.

  12. Imaging biomarkers to predict response to anti-HER2 (ErbB2) therapy in preclinical models of breast cancer

    PubMed Central

    Shah, Chirayu; Miller, Todd W.; Wyatt, Shelby K.; McKinley, Eliot T.; Olivares, Maria Graciela; Sanchez, Violeta; Nolting, Donald D.; Buck, Jason R.; Zhao, Ping; Ansari, M. Sib; Baldwin, Ronald M.; Gore, John C.; Schiff, Rachel; Arteaga, Carlos L.; Manning, H. Charles

    2010-01-01

    Purpose To evaluate non-invasive imaging methods as predictive biomarkers of response to trastuzumab in mouse models of HER2-overexpressing breast cancer. The correlation between tumor regression and molecular imaging of apoptosis, glucose metabolism, and cellular proliferation was evaluated longitudinally in responding and non-responding tumor-bearing cohorts. Experimental Design Mammary tumors from MMTV/HER2 transgenic female mice were transplanted into syngeneic female mice. BT474 human breast carcinoma cell line xenografts were grown in athymic nude mice. Tumor cell apoptosis (NIR700-Annexin-V accumulation), glucose metabolism ([18F]FDG-PET), and proliferation ([18F]FLT-PET) were evaluated throughout a bi-weekly trastuzumab regimen. Imaging metrics were validated by direct measurement of tumor size and immunohistochemical (IHC) analysis of cleaved caspase-3, phosphorylated AKT (p-AKT) and Ki67. Results NIR700-Annexin-V accumulated significantly in trastuzumab-treated MMTV/HER2 and BT474 tumors that ultimately regressed, but not in non-responding or vehicle-treated tumors. Uptake of [18F]FDG was not affected by trastuzumab treatment in MMTV/HER2 or BT474 tumors. [18F]FLT PET imaging predicted trastuzumab response in BT474 tumors but not in MMTV/HER2 tumors, which exhibited modest uptake of [18F]FLT. Close agreement was observed between imaging metrics and IHC analysis. Conclusions Molecular imaging of apoptosis accurately predicts trastuzumab-induced regression of HER2(+) tumors and may warrant clinical exploration to predict early response to neoadjuvant trastuzumab. Trastuzumab does not appear to alter glucose metabolism substantially enough to afford [18F]FDG-PET significant predictive value in this setting. Although promising in one preclinical model, further studies are required to determine the overall value of [18F]FLT-PET as a biomarker of response to trastuzumab in HER2+ breast cancer. PMID:19584166

  13. Automated gait analysis in the open-field test for laboratory mice.

    PubMed

    Leroy, Toon; Silva, Mitchell; D'Hooge, Rudi; Aerts, Jean-Marie; Berckmans, Daniel

    2009-02-01

    In this article, an automated and accurate mouse observation method, based on a conventional test for motor function evaluation, is outlined. The proposed measurement technique was integrated in a regular open-field test, where the trajectory and locomotion of a free-moving mouse were measured simultaneously. The system setup consisted of a transparent cage and a camera placed below it with its lens pointing upward, allowing for images to be captured from underneath the cage while the mouse was walking on the transparent cage floor. Thus, additional information was obtained about the position of the limbs of the mice for gait reconstruction. In a first step, the camera was calibrated as soon as it was fixed in place. A linear calibration factor, relating distances in image coordinates to real-world dimensions, was determined. In a second step, the mouse was located and its body contour segmented from the image by subtracting a previously taken "background" image of the empty cage from the camera image. In a third step, the movement of the mouse was analyzed and its speed estimated from its location in the past few images. If the speed was above a 1-sec threshold, the mouse was recognized to be running, and the image was further processed for footprint recognition. In a fourth step, color filtering was applied within the recovered mouse region to measure the position of the mouse's paws, which were visible in the image as small pink spots. Paws that were detected at the same location in a number of subsequent images were kept as footprints-that is, paws in contact with the cage floor. The footprints were classified by their position relative to the mouse's outline as corresponding to the front left or right paw or the hind left or right paw. Finally, eight parameters were calculated from the footprint pattern to describe the locomotion of the mouse: right/left overlap, front/hind base, right/left front limb stride, and right/left hind limb stride. As an application, the system was tested using normal mice and mice displaying pentobarbital-induced ataxia. The footprint parameters measured using the proposed system showed differences of 10% to 20% between normal and ataxic mice.

  14. A microarray analysis of retinal transcripts that are controlled by image contrast in mice

    PubMed Central

    Brand, Christine; Schaeffel, Frank

    2007-01-01

    Purpose The development of myopia is controlled by still largely unknown retinal signals. The aim of this study was to investigate the changes in retinal mRNA expression after different periods of visual deprivation in mice, while controlling for retinal illuminance. Methods Each group consisted of three male C57BL/6 mice. Treatment periods were 30 min, 4 h, and 6+6 h. High spatial frequencies were filtered from the retinal image by frosted diffusers over one eye while the fellow eyes were covered by clear neutral density (ND) filters that exhibited similar light attenuating properties (0.1 log units) as the diffusers. For the final 30 min of the respective treatment period mice were individually placed in a clear Perspex cylinder that was positioned in the center of a rotating (60 degrees) large drum. The inside of the drum was covered with a 0.1 cyc/degree vertical square wave grating. This visual environment was chosen to standardize illuminances and contrasts seen by the mice. Labeled cRNA was prepared and hybridized to Affymetrix GeneChip® Mouse Genome 430 2.0 arrays. Alterations in mRNA expression levels of candidate genes with potential biological relevance were confirmed by semi-quantitative real-time reverse transcription polymerase chain reaction (RT-PCR). Results In all groups, Egr-1 mRNA expression was reduced in diffuser-treated eyes. Furthermore, the degradation of the spatial frequency spectrum also changed the cFos mRNA level, with reduced expression after 4 h of diffuser treatment. Other interesting candidates were Akt2, which was up-regulated after 30 min of deprivation and Mapk8ip3, a neuron specific JNK binding and scaffolding protein that was temporally regulated in the diffuser-treated eyes only. Conclusions The microarray analysis demonstrated a pattern of differential transcriptional changes, even though differences in the retinal images were restricted to spatial features. The candidate genes may provide further insight into the biochemical short-term changes following retinal image degradation in mice. Because deprivation of spatial vision leads to increased eye growth and myopia in both animals and humans, it is believed some of the identified genes play a role in myopia development. PMID:17653032

  15. The embryonic mouse hindbrain as a qualitative and quantitative model for studying the molecular and cellular mechanisms of angiogenesis.

    PubMed

    Fantin, Alessandro; Vieira, Joaquim M; Plein, Alice; Maden, Charlotte H; Ruhrberg, Christiana

    2013-02-01

    The mouse embryo hindbrain is a robust and adaptable model for studying sprouting angiogenesis. It permits the spatiotemporal analysis of organ vascularization in normal mice and in mouse strains with genetic mutations that result in late embryonic or perinatal lethality. Unlike postnatal models such as retinal angiogenesis or Matrigel implants, there is no requirement for the breeding of conditional knockout mice. The unique architecture of the hindbrain vasculature allows whole-mount immunolabeling of blood vessels and high-resolution imaging, as well as easy quantification of angiogenic sprouting, network density and vessel caliber. The hindbrain model also permits the visualization of ligand binding to blood vessels in situ and the analysis of blood vessel growth within a natural multicellular microenvironment in which endothelial cells (ECs) interact with non-ECs to refine the 3D organ architecture. The entire procedure, from embryo isolation to imaging and through to results analysis, takes approximately 4 d.

  16. In vivo near-infrared imaging of fibrin deposition in thromboembolic stroke in mice.

    PubMed

    Zhang, Yi; Fan, Shufeng; Yao, Yuyu; Ding, Jie; Wang, Yu; Zhao, Zhen; Liao, Lei; Li, Peicheng; Zang, Fengchao; Teng, Gao-Jun

    2012-01-01

    Thrombus and secondary thrombosis plays a key role in stroke. Recent molecular imaging provides in vivo imaging of activated factor XIII (FXIIIa), an important mediator of thrombosis or fibrinolytic resistance. The present study was to investigate the fibrin deposition in a thromboembolic stroke mice model by FXIIIa-targeted near-infrared fluorescence (NIRF) imaging. The experimental protocol was approved by our institutional animal use committee. Seventy-six C57B/6J mice were subjected to thromboembolic middle cerebral artery occlusion or sham operation. Mice were either intravenously injected with the FXIIIa-targeted probe or control probe. In vivo and ex vivo NIRF imaging were performed thereafter. Probe distribution was assessed with fluorescence microscopy by spectral imaging and quantification system. MR scans were performed to measure lesion volumes in vivo, which were correlated with histology after animal euthanasia. In vivo significant higher fluorescence intensity over the ischemia-affected hemisphere, compared to the contralateral side, was detected in mice that received FXIIIa-targeted probe, but not in the controlled mice. Significantly NIRF signals showed time-dependent processes from 8 to 96 hours after injection of FXIIIa-targeted probes. Ex vivo NIRF image showed an intense fluorescence within the ischemic territory only in mice injected with FXIIIa-targeted probe. The fluorescence microscopy demonstrated distribution of FXIIIa-targeted probe in the ischemic region and nearby micro-vessels, and FXIIIa-targeted probe signals showed good overlap with immune-fluorescent fibrin staining images. There was a significant correlation between total targeted signal from in vivo or ex vivo NIRF images and lesion volume. Non-invasive detection of fibrin deposition in ischemic mouse brain using NIRF imaging is feasible and this technique may provide an in vivo experimental tool in studying the role of fibrin in stroke.

  17. In Vivo Near-Infrared Imaging of Fibrin Deposition in Thromboembolic Stroke in Mice

    PubMed Central

    Zhang, Yi; Fan, Shufeng; Yao, Yuyu; Ding, Jie; Wang, Yu; Zhao, Zhen; Liao, Lei; Li, Peicheng; Zang, Fengchao; Teng, Gao-Jun

    2012-01-01

    Objectives Thrombus and secondary thrombosis plays a key role in stroke. Recent molecular imaging provides in vivo imaging of activated factor XIII (FXIIIa), an important mediator of thrombosis or fibrinolytic resistance. The present study was to investigate the fibrin deposition in a thromboembolic stroke mice model by FXIIIa–targeted near-infrared fluorescence (NIRF) imaging. Materials and Methods The experimental protocol was approved by our institutional animal use committee. Seventy-six C57B/6J mice were subjected to thromboembolic middle cerebral artery occlusion or sham operation. Mice were either intravenously injected with the FXIIIa-targeted probe or control probe. In vivo and ex vivo NIRF imaging were performed thereafter. Probe distribution was assessed with fluorescence microscopy by spectral imaging and quantification system. MR scans were performed to measure lesion volumes in vivo, which were correlated with histology after animal euthanasia. Results In vivo significant higher fluorescence intensity over the ischemia-affected hemisphere, compared to the contralateral side, was detected in mice that received FXIIIa-targeted probe, but not in the controlled mice. Significantly NIRF signals showed time-dependent processes from 8 to 96 hours after injection of FXIIIa-targeted probes. Ex vivo NIRF image showed an intense fluorescence within the ischemic territory only in mice injected with FXIIIa-targeted probe. The fluorescence microscopy demonstrated distribution of FXIIIa-targeted probe in the ischemic region and nearby micro-vessels, and FXIIIa-targeted probe signals showed good overlap with immune-fluorescent fibrin staining images. There was a significant correlation between total targeted signal from in vivo or ex vivo NIRF images and lesion volume. Conclusion Non-invasive detection of fibrin deposition in ischemic mouse brain using NIRF imaging is feasible and this technique may provide an in vivo experimental tool in studying the role of fibrin in stroke. PMID:22272319

  18. Age-related T2 changes in hindlimb muscles of mdx mice.

    PubMed

    Vohra, Ravneet S; Mathur, Sunita; Bryant, Nathan D; Forbes, Sean C; Vandenborne, Krista; Walter, Glenn A

    2016-01-01

    Magnetic resonance imaging (MRI) was used to monitor changes in the transverse relaxation time constant (T2) in lower hindlimb muscles of mdx mice at different ages. Young (5 weeks), adult (44 weeks), and old mdx (96 weeks), and age-matched control mice were studied. Young mdx mice were imaged longitudinally, whereas adult and old mdx mice were imaged at a single time-point. Mean muscle T2 and percent of pixels with elevated T2 were significantly different between mdx and control mice at all ages. In young mdx mice, mean muscle T2 peaked at 7-8 weeks and declined at 9-11 weeks. In old mdx mice, mean muscle T2 was decreased compared with young and adult mice, which could be attributed to fibrosis. MRI captured longitudinal changes in skeletal muscle integrity of mdx mice. This information will be valuable for pre-clinical testing of potential therapeutic interventions for muscular dystrophy. © 2015 Wiley Periodicals, Inc.

  19. Molecular Imaging of Smoke-Induced Changes in Nuclear Factor-Kappa B Expression in Murine Tissues Including the Lung.

    PubMed

    Syrkina, Olga; Hales, Charles H; Bonab, Ali A; Hamrahi, Victoria; Paul, Kasie; Jung, Walter J; Tompkins, Ronald G; Fischman, Alan J; Carter, Edward A

    Many inflammatory responses are mediated by activation of the transcription factor, nuclear factor-kappa B (NF-κB), and a wide variety of human diseases involve abnormal regulation of its expression. In this investigation, we evaluated the effect of smoke inhalation injury on NF-κB expression in lung using two strains of NF-κB reporter mice. Groups of reporter mice with viral thymidine kinase (TK) or "fire fly" luciferase (Luc) genes under control by the NF-κB promoter (TK/NF-κB mice and Luc/NF-κB mice) were subjected to nonlethal smoke inhalation injury. Sham-treated animals served as controls. Twenty-four hours (each animal was injected intravenously with either 9-(4-18F-fluoro-3-[hydroxymethyl]butyl)guanine (FHBG) (~ 1.0 mCi) or luciferin (1.0 mg). One hour later, the TK/NF-κB mice were studied by micro-positron emission tomography (µ-PET) imaging using a Concord P4 µ-PET camera, and the Luc/NF-κB mice were studied by bioluminescence imaging with a charge-coupled device camera. The µ-PET data demonstrated that smoke injury produced massive increases in NF-κB expression (FHBG-standardized uptake value: 3.1 vs 0.0) 24 hours after smoke inhalation, which was reduced 48 hours after smoke inhalation, but still significantly different than the control. Qualitative analysis of the bioluminescence data revealed a remarkably similar effect of burn NF-κB luciferase expression in vivo. Biodistribution studies of FHBG uptake and luciferase activity in lung tissue demonstrated a similar increase 24 hours after injury, which was reduced 48 hours later, but still significantly higher than the sham. The present data with these models providing longitudinal imaging data on the same mouse may prove useful in the examination of the factors producing lung injury by smoke inhalation, as well as the treatment(s) for the damage produced with and without burn injury.

  20. Automatic analysis of altered gait in arylsulphatase A-deficient mice in the open field.

    PubMed

    Leroy, Toon; Stroobants, Stijn; Aerts, Jean-Marie; D'Hooge, Rudi; Berckmans, Daniel

    2009-08-01

    In current research with laboratory animals, observing their dynamic behavior or locomotion is a labor-intensive task. Automatic continuous monitoring can provide quantitative data on each animal's condition and coordination ability. The objective of the present work is to develop an automated mouse observation system integrated with a conventional open-field test for motor function evaluation. Data were acquired from 86 mice having a targeted disruption of the arylsulphatase A (ASA) gene and having lowered coordinated locomotion abilities as a symptom. The mice used were 36 heterozygotes (12 females) and 50 knockout mice (30 females) at the age of 6 months. The mice were placed one at a time into the test setup, which consisted of a Plexiglas cage (53x34.5x26 cm) and two fluorescent bulbs for proper illumination. The transparent cage allowed images to be captured from underneath the cage, so image information could be obtained about the dynamic variation of the positions of the limbs of the mice for gait reconstruction. Every mouse was recorded for 10 min. Background subtraction and color filtering were used to measure and calculate image features, which are variables that contain crucial information, such as the mouse's position, orientation, body outline, and possible locations for the mouse's paws. A set of heuristic rules was used to prune implausible paw features and label the remaining ones as front/hind and left/right. After we had pruned the implausible paw features, the paw features that were consistent over subsequent images were matched to footprints. Finally, from the measured footprint sequence, eight parameters were calculated in order to quantify the gait of the mouse. This automatic observation technique can be integrated with a regular open-field test, where the trajectory and motor function of a free-moving mouse are measured simultaneously.

  1. High-throughput high-volume nuclear imaging for preclinical in vivo compound screening§.

    PubMed

    Macholl, Sven; Finucane, Ciara M; Hesterman, Jacob; Mather, Stephen J; Pauplis, Rachel; Scully, Deirdre; Sosabowski, Jane K; Jouannot, Erwan

    2017-12-01

    Preclinical single-photon emission computed tomography (SPECT)/CT imaging studies are hampered by low throughput, hence are found typically within small volume feasibility studies. Here, imaging and image analysis procedures are presented that allow profiling of a large volume of radiolabelled compounds within a reasonably short total study time. Particular emphasis was put on quality control (QC) and on fast and unbiased image analysis. 2-3 His-tagged proteins were simultaneously radiolabelled by 99m Tc-tricarbonyl methodology and injected intravenously (20 nmol/kg; 100 MBq; n = 3) into patient-derived xenograft (PDX) mouse models. Whole-body SPECT/CT images of 3 mice simultaneously were acquired 1, 4, and 24 h post-injection, extended to 48 h and/or by 0-2 h dynamic SPECT for pre-selected compounds. Organ uptake was quantified by automated multi-atlas and manual segmentations. Data were plotted automatically, quality controlled and stored on a collaborative image management platform. Ex vivo uptake data were collected semi-automatically and analysis performed as for imaging data. >500 single animal SPECT images were acquired for 25 proteins over 5 weeks, eventually generating >3500 ROI and >1000 items of tissue data. SPECT/CT images clearly visualized uptake in tumour and other tissues even at 48 h post-injection. Intersubject uptake variability was typically 13% (coefficient of variation, COV). Imaging results correlated well with ex vivo data. The large data set of tumour, background and systemic uptake/clearance data from 75 mice for 25 compounds allows identification of compounds of interest. The number of animals required was reduced considerably by longitudinal imaging compared to dissection experiments. All experimental work and analyses were accomplished within 3 months expected to be compatible with drug development programmes. QC along all workflow steps, blinding of the imaging contract research organization to compound properties and automation provide confidence in the data set. Additional ex vivo data were useful as a control but could be omitted from future studies in the same centre. For even larger compound libraries, radiolabelling could be expedited and the number of imaging time points adapted to increase weekly throughput. Multi-atlas segmentation could be expanded via SPECT/MRI; however, this would require an MRI-compatible mouse hotel. Finally, analysis of nuclear images of radiopharmaceuticals in clinical trials may benefit from the automated analysis procedures developed.

  2. Quantitative fundus autofluorescence in mice: correlation with HPLC quantitation of RPE lipofuscin and measurement of retina outer nuclear layer thickness.

    PubMed

    Sparrow, Janet R; Blonska, Anna; Flynn, Erin; Duncker, Tobias; Greenberg, Jonathan P; Secondi, Roberta; Ueda, Keiko; Delori, François C

    2013-04-17

    Our study was conducted to establish procedures and protocols for quantitative autofluorescence (qAF) measurements in mice, and to report changes in qAF, A2E bisretinoid concentration, and outer nuclear layer (ONL) thickness in mice of different genotypes and age. Fundus autofluorescence (AF) images (55° lens, 488 nm excitation) were acquired in albino Abca4(-/-), Abca4(+/-), and Abca4(+/+) mice (ages 2-12 months) with a confocal scanning laser ophthalmoscope (cSLO). Gray levels (GLs) in each image were calibrated to an internal fluorescence reference. The bisretinoid A2E was measured by quantitative high performance liquid chromatography (HPLC). Histometric analysis of ONL thicknesses was performed. The Bland-Altman coefficient of repeatability (95% confidence interval) was ±18% for between-session qAF measurements. Mean qAF values increased with age (2-12 months) in all groups of mice. qAF was approximately 2-fold higher in Abca4(-/-) mice than in Abca4(+/+) mice and approximately 20% higher in heterozygous mice. HPLC measurements of the lipofuscin fluorophore A2E also revealed age-associated increases, and the fold difference between Abca4(-/-) and wild-type mice was more pronounced (approximately 3-4-fold) than measurable by qAF. Moreover, A2E levels declined after 8 months of age, a change not observed with qAF. The decline in A2E levels in the Abca4(-/-) mice corresponded to reduced photoreceptor cell viability as reflected in ONL thinning beginning at 8 months of age. The qAF method enables measurement of in vivo lipofuscin and the detection of genotype and age-associated differences. The use of this approach has the potential to aid in understanding retinal disease processes and will facilitate preclinical studies.

  3. Simultaneous measurement of arterial input function and tumor pharmacokinetics in mice by dynamic contrast enhanced imaging: effects of transcytolemmal water exchange.

    PubMed

    Zhou, Rong; Pickup, Stephen; Yankeelov, Thomas E; Springer, Charles S; Glickson, Jerry D

    2004-08-01

    A noninvasive technique for simultaneous measurement of the arterial input function (AIF) for gadodiamide (Omniscan) and its uptake in tumor was demonstrated in mice. Implantation of a tumor at a suitable location enabled its visualization in a cardiac short axis image. Sets of gated, low-resolution saturation recovery images were acquired from each of five tumor-bearing mice following intravenous administration of a bolus of contrast agent (CA). The AIF was extracted from the signal intensity changes in left ventricular blood using literature values of the CA relaxivity and a precontrast T1 map. The time-dependent 1H2O relaxation rate constant (R1 = 1/T1) in the tumor was modeled using the BOLus Enhanced Relaxation Overview (BOLERO) method in two modes regarding the equilibrium transcytolemmal water exchange system: 1) constraining it exclusively to the fast exchange limit (FXL) (the conventional assumption), and 2) allowing its transient departure from FXL and access to the fast exchange regime (FXR), thus designated FXL/FXR. The FXL/FXR analysis yielded better fittings than the FXL-constrained analysis for data from the tumor rims, whereas the results based on the two modes were indistinguishable for data from the tumor cores. For the tumor rims, the values of Ktrans (the rate constant for CA transfer from the vasculature to the interstitium) and ve (volume fraction of the tissue extracellular and extravascular space) returned from FXL/FXR analysis are consistently greater than those from the FXL-constrained analysis by a factor of 1.5 or more corresponding to a CA dose of 0.05 mmole/kg.

  4. Multimodal Fluorescence and Bioluminescence Imaging Reveals Transfection Potential of Intratracheally Administered Polyplexes for Breast Cancer Lung Metastases.

    PubMed

    Geyer, Antonia; Taschauer, Alexander; Alioglu, Fatih; Anton, Martina; Maier, Julia; Drothler, Elisabeth; Simlinger, Manuela; Yavuz, Sümeyye; Sami, Haider; Ogris, Manfred

    2017-12-01

    Local delivery of anticancer agents or gene therapeutics to lung tumors can circumvent side effects or accumulation in non-target organs, but accessibility via the alveolar side of the blood-air barrier remains challenging. Polyplexes based on plasmid and linear polyethylenimine (LPEI) transfect healthy lung tissue when applied intravenously (i.v.) in the mouse, but direct delivery into the lungs results in low transfection of lung tissue. Nevertheless, LPEI could offer the potential to transfect lung tumors selectively, if accessible from the alveolar side. This study combined near infrared fluorescent protein 720 (iRFP720) and firefly luciferase as reporter genes for detection of tumor lesions and transfection efficiency of LPEI polyplexes, after intratracheal microspraying in mice bearing 4T1 triple negative breast cancer lung metastases. Simultaneous flow cytometric analysis of iRFP720 and enhanced green fluorescent protein expression in vitro demonstrated the potential to combine these reporter genes within transfection studies. Polyplex biophysics was characterized by single nanoparticle tracking analysis (NTA) to monitor physical integrity after microspraying in vitro. 4T1 cells were transduced with iRFP720-encoding lentivirus and evaluated by flow cytometry for stable iRFP720 expression. Growth of 4T1-iRFP720 cells was monitored in Balb/c mice by tomographic near infrared imaging, tissue and tumor morphology by computed tomography and magnetic resonance imaging. In 4T1-iRFP720 tumor-bearing mice, intratracheal administration of luciferase-encoding plasmid DNA by LPEI polyplexes resulted in successful tumor transfection, as revealed by bioluminescence imaging.

  5. Detection of atherosclerotic plaques in ApoE-deficient mice using (99m)Tc-duramycin.

    PubMed

    Liu, Zhonglin; Larsen, Brandon T; Lerman, Lilach O; Gray, Brian D; Barber, Christy; Hedayat, Ahmad F; Zhao, Ming; Furenlid, Lars R; Pak, Koon Y; Woolfenden, James M

    2016-08-01

    Apoptosis of macrophages and smooth muscle cells is linked to atherosclerotic plaque destabilization. The apoptotic cascade leads to exposure of phosphatidylethanolamine (PE) on the outer leaflet of the cell membrane, thereby making apoptosis detectable using probes targeting PE. The objective of this study was to exploit capabilities of a PE-specific imaging probe, (99m)Tc-duramycin, in localizing atherosclerotic plaque and assessing plaque evolution in apolipoprotein-E knockout (ApoE(-/-)) mice. Atherosclerosis was induced in ApoE(-/-) mice by feeding an atherogenic diet. (99m)Tc-duramycin images were acquired using a small-animal SPECT imager. Six ApoE(-/-) mice at 20weeks of age (Group I) were imaged and then sacrificed for ex vivo analyses. Six additional ApoE(-/-) mice (Group II) were imaged at 20 and 40weeks of age before sacrifice. Six ApoE wild-type (ApoE(+/+)) mice (Group III) were imaged at 40weeks as controls. Five additional ApoE(-/-) mice (40weeks of age) (Group IV) were imaged with a (99m)Tc-labeled inactive peptide, (99m)Tc-LinDUR, to assess (99m)Tc-duramycin targeting specificity. Focal (99m)Tc-duramycin uptake in the ascending aorta and aortic arch was detected at 20 and 40weeks in the ApoE(-/-) mice but not in ApoE(+/+) mice. (99m)Tc-duramycin uptake in the aortic lesions increased 2.2-fold on quantitative imaging in the ApoE(-/-) mice between 20 and 40weeks. Autoradiographic and histological data indicated significantly increased (99m)Tc-duramycin uptake in the ascending aorta and aortic arch associated with advanced plaques. Quantitative autoradiography showed that the ratio of activity in the aortic arch to descending thoracic aorta, which had no plaques or radioactive uptake, was 2.1 times higher at 40weeks than at 20weeks (6.62±0.89 vs. 3.18±0.29, P<0.01). There was barely detectable focal uptake of (99m)Tc-duramycin in the aortic arch of ApoE(+/+) mice. No detectable (99m)Tc-LinDUR uptake was observed in the aortas of ApoE(-/-) mice. PE-targeting properties of (99m)Tc-duramycin in the atherosclerotic mouse aortas were noninvasively characterized. (99m)Tc-duramycin is promising in localizing advanced atherosclerotic plaques. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Intravital imaging of osteocytes in mouse calvaria using third harmonic generation microscopy

    PubMed Central

    Cisek, Richard; Wein, Marc N.; Turcotte, Raphaël; Haase, Christa; Yeh, Shu-Chi A.; Bharadwaj, Srinidhi; Raphael, Anthony P.; Paudel, Hari; Alt, Clemens; Liu, Tzu-Ming; Kronenberg, Henry M.; Lin, Charles P.

    2017-01-01

    Osteocytes are the most abundant cell in the bone, and have multiple functions including mechanosensing and regulation of bone remodeling activities. Since osteocytes are embedded in the bone matrix, their inaccessibility makes in vivo studies problematic. Therefore, a non-invasive technique with high spatial resolution is desired. The purpose of this study is to investigate the use of third harmonic generation (THG) microscopy as a noninvasive technique for high-resolution imaging of the lacunar-canalicular network (LCN) in live mice. By performing THG imaging in combination with two- and three-photon fluorescence microscopy, we show that THG signal is produced from the bone-interstitial fluid boundary of the lacuna, while the interstitial fluid-osteocyte cell boundary shows a weaker THG signal. Canaliculi are also readily visualized by THG imaging, with canaliculi oriented at small angles relative to the optical axis exhibiting stronger signal intensity compared to those oriented perpendicular to the optical axis (parallel to the image plane). By measuring forward- versus epi-detected THG signals in thinned versus thick bone samples ex vivo, we found that the epi-collected THG from the LCN of intact bone contains a superposition of backward-directed and backscattered forward-THG. As an example of a biological application, THG was used as a label-free imaging technique to study structural variations in the LCN of live mice deficient in both histone deacetylase 4 and 5 (HDAC4, HDAC5). Three-dimensional analyses were performed and revealed statistically significant differences between the HDAC4/5 double knockout and wild type mice in the number of osteocytes per volume and the number of canaliculi per lacunar surface area. These changes in osteocyte density and dendritic projections occurred without differences in lacunar size. This study demonstrates that THG microscopy imaging of the LCN in live mice enables quantitative analysis of osteocytes in animal models without the use of dyes or physical sectioning. PMID:29065178

  7. In vivo image analysis of BoHV-4-based vector in mice.

    PubMed

    Franceschi, Valentina; Stellari, Fabio Franco; Mangia, Carlo; Jacca, Sarah; Lavrentiadou, Sophia; Cavirani, Sandro; Heikenwalder, Mathias; Donofrio, Gaetano

    2014-01-01

    Due to its biological characteristics bovine herpesvirus 4 (BoHV-4) has been considered as an appropriate gene delivery vector. Its genomic clone, modified as a bacterial artificial chromosome (BAC), is better genetically manipulable and can be used as an efficient gene delivery and vaccine vector. Although a large amount of data have been accumulated in vitro on this specific aspect, the same cannot be asserted for the in vivo condition. Therefore, here we investigated the fate of a recombinant BoHV-4 strain expressing luciferase (BoHV-4-A-CMVlucΔTK) after intraperitoneal or intravenous inoculation in mice, by generating a novel recombinant BoHV-4 expressing luciferase (BoHV-4-A-CMVlucΔTK) and by following the virus replication through in vivo imaging analysis. BoHV-4-A-CMVlucΔTK was first characterized in vitro where it was shown, on one hand that its replication properties are identical to those of the parental virus, and on the other that the transduced/infected cells strongly express luciferase. When BoHV-4-A-CMVlucΔTK was inoculated in mice, either intraperitoneally or intravenously, BoHV-4-A-CMVlucΔTK infection/transduction was exclusively localized to the liver, as detected by in vivo image analysis, and in particular almost exclusively in the hepatocytes, as determined by immuno-histochemistry. These data, that add a new insight on the biology of BoHV-4 in vivo, provide the first indication for the potential use of a BoHV-4-based vector in gene-transfer in the liver.

  8. Establishment of nude mice with complete loss of lymphocytes and NK cells and application for in vivo bio-imaging.

    PubMed

    Kariya, Ryusho; Matsuda, Kouki; Gotoh, Kumiko; Vaeteewoottacharn, Kulthida; Hattori, Shinichiro; Okada, Seiji

    2014-01-01

    Nude mice are used in human xenograft research; however, only 25-35% of human tumors have been successfully transplanted into nude mice and their application is limited due to high natural killer (NK) cell activity. More severely immunodeficient mice with loss of NK activity are needed to overcome this limitation. Balb/c nude Rag-2(-/-)Jak3(-/-) (Nude-RJ) mice were established by crossing Rag-2(-/-)Jak3(-/-) mice and nude mice. The K562 cell line was implanted subcutaneously to compare tumorigenicity between Nude-RJ mice and Nude mice. The cholangiocarcinoma mCherry expressing cell line (KKU-M213) was implanted subcutaneously, and fluorescence intensity and tumor weight were measured. Nude R/J mice showed complete loss of lymphocytes and NK cells. Xeno-transplantation of K562 cells showed higher proliferation in Nude R/J mice than nude mice. Subcutaneously-transplanted mCherry-transduced KKU-M213 cells were successfully detected with a fluorescence imager. Nude-R/J mice are valuable tools for in vivo imaging studies in biomedical research. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  9. Imaging Tumor Cell Movement In Vivo

    PubMed Central

    Entenberg, David; Kedrin, Dmitriy; Wyckoff, Jeffrey; Sahai, Erik; Condeelis, John; Segall, Jeffrey E.

    2013-01-01

    This unit describes the methods that we have been developing for analyzing tumor cell motility in mouse and rat models of breast cancer metastasis. Rodents are commonly used both to provide a mammalian system for studying human tumor cells (as xenografts in immunocompromised mice) as well as for following the development of tumors from a specific tissue type in transgenic lines. The Basic Protocol in this unit describes the standard methods used for generation of mammary tumors and imaging them. Additional protocols for labeling macrophages, blood vessel imaging, and image analysis are also included. PMID:23456602

  10. Liposomal 64Cu-PET Imaging of Anti-VEGF Drug Effects on Liposomal Delivery to Colon Cancer Xenografts.

    PubMed

    Blocker, Stephanie J; Douglas, Kirk A; Polin, Lisa Anne; Lee, Helen; Hendriks, Bart S; Lalo, Enxhi; Chen, Wei; Shields, Anthony F

    2017-01-01

    Liposomes (LP) deliver drug to tumors due to enhanced permeability and retention (EPR). LP were labeled with 64 Cu for positron emission tomography (PET) to image tumor localization. Bevacizumab (bev), a VEGF targeted antibody, may modify LP delivery by altering tumor EPR and this change can also be imaged. Objective : Assess the utility of 64 Cu-labeled LP for PET in measuring altered LP delivery early after treatment with bev. Methods: HT-29 human colorectal adenocarcinoma tumors were grown subcutaneously in SCID mice. Empty LP MM-DX-929 (Merrimack Pharmaceuticals, Inc. Cambridge, MA) were labeled with 64 CuCl 2 chelated with 4-DEAP-ATSC. Tumor-bearing mice received ~200-300 μCi of 64 Cu-MM-DX-929 and imaged with microPET. All mice were scanned before and after the treatment period, in which half of the mice received bev for one week. Scans were compared for changes in LP accumulation during this time. Initially, tissues were collected after the second PET for biodistribution measurements and histological analysis. Subsequent groups were divided for further treatment. Tumor growth following bev treatment, with or without LP-I, was assessed compared to untreated controls. Results : PET scans of untreated mice showed increased uptake of 64 Cu-MM-DX-929, with a mean change in tumor SUV max of 43.9%±6.6% (n=10) after 7 days. Conversely, images of treated mice showed that liposome delivery did not increase, with changes in SUV max of 7.6%±4.8% (n=12). Changes in tumor SUV max were significantly different between both groups (p=0.0003). Histology of tumor tissues indicated that short-term bev was able to alter vessel size. Therapeutically, while bev monotherapy, LP-I monotherapy, and treatment with bev followed by LP-I all slowed HT-29 tumor growth compared to controls, combination provided no therapeutic benefit. Conclusions: PET with tracer LP 64 Cu-MM-DX-929 can detect significant differences in LP delivery to colon tumors treated with bev when compared to untreated controls. Imaging with 64 Cu-MM-DX-929 is sensitive enough to measure drug-induced changes in LP localization which can have an effect on outcomes of treatment with LP.

  11. “Glowing Head” Mice: A Genetic Tool Enabling Reliable Preclinical Image-Based Evaluation of Cancers in Immunocompetent Allografts

    PubMed Central

    Day, Chi-Ping; Carter, John; Ohler, Zoe Weaver; Bonomi, Carrie; El Meskini, Rajaa; Martin, Philip; Graff-Cherry, Cari; Feigenbaum, Lionel; Tüting, Thomas; Van Dyke, Terry; Hollingshead, Melinda; Merlino, Glenn

    2014-01-01

    Preclinical therapeutic assessment currently relies on the growth response of established human cell lines xenografted into immunocompromised mice, a strategy that is generally not predictive of clinical outcomes. Immunocompetent genetically engineered mouse (GEM)-derived tumor allograft models offer highly tractable preclinical alternatives and facilitate analysis of clinically promising immunomodulatory agents. Imageable reporters are essential for accurately tracking tumor growth and response, particularly for metastases. Unfortunately, reporters such as luciferase and GFP are foreign antigens in immunocompetent mice, potentially hindering tumor growth and confounding therapeutic responses. Here we assessed the value of reporter-tolerized GEMs as allograft recipients by targeting minimal expression of a luciferase-GFP fusion reporter to the anterior pituitary gland (dubbed the “Glowing Head” or GH mouse). The luciferase-GFP reporter expressed in tumor cells induced adverse immune responses in wildtype mouse, but not in GH mouse, as transplantation hosts. The antigenicity of optical reporters resulted in a decrease in both the growth and metastatic potential of the labeled tumor in wildtype mice as compared to the GH mice. Moreover, reporter expression can also alter the tumor response to chemotherapy or targeted therapy in a context-dependent manner. Thus the GH mice and experimental approaches vetted herein provide concept validation and a strategy for effective, reproducible preclinical evaluation of growth and response kinetics for traceable tumors. PMID:25369133

  12. Assessment of Chitosan-Affected Metabolic Response by Peroxisome Proliferator-Activated Receptor Bioluminescent Imaging-Guided Transcriptomic Analysis

    PubMed Central

    Kao, Chia-Hung; Hsiang, Chien-Yun; Ho, Tin-Yun

    2012-01-01

    Chitosan has been widely used in food industry as a weight-loss aid and a cholesterol-lowering agent. Previous studies have shown that chitosan affects metabolic responses and contributes to anti-diabetic, hypocholesteremic, and blood glucose-lowering effects; however, the in vivo targeting sites and mechanisms of chitosan remain to be clarified. In this study, we constructed transgenic mice, which carried the luciferase genes driven by peroxisome proliferator-activated receptor (PPAR), a key regulator of fatty acid and glucose metabolism. Bioluminescent imaging of PPAR transgenic mice was applied to report the organs that chitosan acted on, and gene expression profiles of chitosan-targeted organs were further analyzed to elucidate the mechanisms of chitosan. Bioluminescent imaging showed that constitutive PPAR activities were detected in brain and gastrointestinal tract. Administration of chitosan significantly activated the PPAR activities in brain and stomach. Microarray analysis of brain and stomach showed that several pathways involved in lipid and glucose metabolism were regulated by chitosan. Moreover, the expression levels of metabolism-associated genes like apolipoprotein B (apoB) and ghrelin genes were down-regulated by chitosan. In conclusion, these findings suggested the feasibility of PPAR bioluminescent imaging-guided transcriptomic analysis on the evaluation of chitosan-affected metabolic responses in vivo. Moreover, we newly identified that downregulated expression of apoB and ghrelin genes were novel mechanisms for chitosan-affected metabolic responses in vivo. PMID:22496881

  13. Live dynamic analysis of the developing cardiovascular system in mice

    NASA Astrophysics Data System (ADS)

    Lopez, Andrew L.; Wang, Shang; Larin, Kirill V.; Larina, Irina V.

    2017-02-01

    The study of the developing cardiovascular system in mice is important for understanding human cardiogenesis and congenital heart defects. Our research focuses on imaging early development in the mouse embryo to specifically understand cardiovascular development under the regulation of dynamic factors like contractile force and blood flow using optical coherence tomography (OCT). We have previously developed an OCT based approach that combines static embryo culture and advanced image processing with computational modeling to live-image mouse embryos and obtain 4D (3D+time) cardiodynamic datasets. Here we present live 4D dynamic blood flow imaging of the early embryonic mouse heart in correlation with heart wall movement. We are using this approach to understand how specific mutations impact heart wall dynamics, and how this influences flow patterns and cardiogenesis. We perform studies in mutant embryos with cardiac phenotypes such as myosin regulatory light chain 2, atrial isoform (Mlc2a). This work is brings us closer to understanding the connections between dynamic mechanical factors and gene programs responsible for early cardiovascular development.

  14. Neurochemistry in shiverer mouse depicted on MR spectroscopy.

    PubMed

    Takanashi, Jun-ichi; Nitta, Nobuhiro; Iwasaki, Nobuaki; Saito, Shigeyoshi; Tanaka, Ryuta; Barkovich, A James; Aoki, Ichio

    2014-06-01

    To evaluate the neurochemical changes associated with hypomyelination, especially to clarify whether increased total N-acetylaspartate (tNAA) with decreased choline (Cho) observed in the thalamus of msd mice with the plp1 mutation is a common finding for hypomyelinating disorders. We performed magnetic resonance imaging (MRI) and proton MR spectroscopy ((1) H-MRS) of the thalamus and cortex of postnatal 12-week shiverer mice devoid of myelin basic protein (mbp), heterozygous and wild-type mice with a 7.0T magnet. Luxol Fast Blue staining and immunohistochemical analysis with anti-Mbp, Gfap, Olig2, and NeuN antibodies were also performed. In the thalamus, decreased Cho and normal tNAA were observed in shiverer mice. In the cortex, tNAA, Cho, and glutamate were decreased in shiverer mice. Histological and immunohistochemical analysis of shiverer mice brains revealed hypomyelination in the thalamus, white matter, and cortex; astrogliosis and an increased number of total oligodendrocytes in the white matter; and a decreased number of neurons in the cortex. The reduction of Cho on (1) H-MRS might be a common marker for hypomyelinating disorders. A normal tNAA level in the thalamus of shiverer mice might be explained by the presence of mature oligodendrocytes, which enable neuron-to-oligodendrocyte NAA transport or NAA catabolism. Copyright © 2013 Wiley Periodicals, Inc.

  15. In Vivo Dark-Field Radiography for Early Diagnosis and Staging of Pulmonary Emphysema.

    PubMed

    Hellbach, Katharina; Yaroshenko, Andre; Meinel, Felix G; Yildirim, Ali Ö; Conlon, Thomas M; Bech, Martin; Mueller, Mark; Velroyen, Astrid; Notohamiprodjo, Mike; Bamberg, Fabian; Auweter, Sigrid; Reiser, Maximilian; Eickelberg, Oliver; Pfeiffer, Franz

    2015-07-01

    The aim of this study was to evaluate the suitability of in vivo x-ray dark-field radiography for early-stage diagnosis of pulmonary emphysema in mice. Furthermore, we aimed to analyze how the dark-field signal correlates with morphological changes of lung architecture at distinct stages of emphysema. Female 8- to 10-week-old C57Bl/6N mice were used throughout all experiments. Pulmonary emphysema was induced by orotracheal injection of porcine pancreatic elastase (80-U/kg body weight) (n = 30). Control mice (n = 11) received orotracheal injection of phosphate-buffered saline. To monitor the temporal patterns of emphysema development over time, the mice were imaged 7, 14, or 21 days after the application of elastase or phosphate-buffered saline. X-ray transmission and dark-field images were acquired with a prototype grating-based small-animal scanner. In vivo pulmonary function tests were performed before killing the animals. In addition, lungs were obtained for detailed histopathological analysis, including mean cord length (MCL) quantification as a parameter for the assessment of emphysema. Three blinded readers, all of them experienced radiologists and familiar with dark-field imaging, were asked to grade the severity of emphysema for both dark-field and transmission images. Histopathology and MCL quantification confirmed the introduction of different stages of emphysema, which could be clearly visualized and differentiated on the dark-field radiograms, whereas early stages were not detected on transmission images. The correlation between MCL and dark-field signal intensities (r = 0.85) was significantly higher than the correlation between MCL and transmission signal intensities (r = 0.37). The readers' visual ratings for dark-field images correlated significantly better with MCL (r = 0.85) than visual ratings for transmission images (r = 0.36). Interreader agreement and the diagnostic accuracy of both quantitative and visual assessment were significantly higher for dark-field imaging than those for conventional transmission images. X-ray dark-field radiography can reliably visualize different stages of emphysema in vivo and demonstrates significantly higher diagnostic accuracy for early stages of emphysema than conventional attenuation-based radiography.

  16. Superpixel-based spectral classification for the detection of head and neck cancer with hyperspectral imaging

    NASA Astrophysics Data System (ADS)

    Chung, Hyunkoo; Lu, Guolan; Tian, Zhiqiang; Wang, Dongsheng; Chen, Zhuo Georgia; Fei, Baowei

    2016-03-01

    Hyperspectral imaging (HSI) is an emerging imaging modality for medical applications. HSI acquires two dimensional images at various wavelengths. The combination of both spectral and spatial information provides quantitative information for cancer detection and diagnosis. This paper proposes using superpixels, principal component analysis (PCA), and support vector machine (SVM) to distinguish regions of tumor from healthy tissue. The classification method uses 2 principal components decomposed from hyperspectral images and obtains an average sensitivity of 93% and an average specificity of 85% for 11 mice. The hyperspectral imaging technology and classification method can have various applications in cancer research and management.

  17. Investigation and identification of etiologies involved in the development of acquired hydronephrosis in aged laboratory mice with the use of high-frequency ultrasound imaging

    PubMed Central

    Springer, Danielle A.; Allen, Michele; Hoffman, Victoria; Brinster, Lauren; Starost, Matthew F.; Bryant, Mark; Eckhaus, Michael

    2014-01-01

    Laboratory mice develop naturally occurring lesions that affect biomedical research. Hydronephrosis is a recognized pathologic abnormality of the mouse kidney. Acquired hydronephrosis can affect any mouse, as it is caused by any naturally occurring disease that impairs free urine flow. Many etiologies leading to this condition are of particular significance to aging mice. Non-invasive ultrasound imaging detects renal pelvic dilation, renal enlargement, and parenchymal loss for pre-mortem identification of this condition. High-frequency ultrasound transducers produce high-resolution images of small structures, ideal for detecting organ pathology in mice. Using a 40 MHz linear array transducer, we obtained high-resolution images of a diversity of pathologic lesions occurring within the abdomen of seven geriatric mice with acquired hydronephrosis that enabled a determination of the underlying etiology. Etiologies diagnosed from the imaging results include pyelonephritis, neoplasia, urolithiasis, mouse urologic syndrome, and spontaneous hydronephrosis, and were confirmed at necropsy. A retrospective review of abdominal scans from an additional 149 aging mice shows that the most common etiologies associated with acquired hydronephrosis are mouse urologic syndrome and abdominal neoplasia. This report highlights the utility of high-frequency ultrasound for surveying research mice for age-related pathology, and is the first comprehensive report of multiple cases of acquired hydronephrosis in mice. PMID:25143818

  18. Laser speckle contrast imaging of cerebral blood flow of newborn mice at optical clearing

    NASA Astrophysics Data System (ADS)

    Timoshina, Polina A.; Zinchenko, Ekaterina M.; Tuchina, Daria K.; Sagatova, Madina M.; Semyachkina-Glushkovskaya, Oxana V.; Tuchin, Valery V.

    2017-03-01

    In this work, we consider the use of optical clearing agents to improve imaging quality of the cerebral blood flow of newborn mice. Aqueous 60%-glycerol solution, aqueous 70%-OmnipaqueTM(300) solution and OmnipaqueTM (300) solution in water/DMSO(25%/5%) were selected as the optical clearing agents. Laser speckle contrast imaging (LSCI) was used for imaging of cerebral blood flow in newborn mice brain during topical optical clearing of tissuesin the area of the fontanelle. These results demonstrate the effectiveness of glycerol and Omnipaque solutions as optical clearing agents for investigation of cerebral blood flow in newborn mice without scalp removing and skull thinning.

  19. Dissociation Between Brown Adipose Tissue 18F-FDG Uptake and Thermogenesis in Uncoupling Protein 1-Deficient Mice.

    PubMed

    Hankir, Mohammed K; Kranz, Mathias; Keipert, Susanne; Weiner, Juliane; Andreasen, Sille G; Kern, Matthias; Patt, Marianne; Klöting, Nora; Heiker, John T; Brust, Peter; Hesse, Swen; Jastroch, Martin; Fenske, Wiebke K

    2017-07-01

    18 F-FDG PET imaging is routinely used to investigate brown adipose tissue (BAT) thermogenesis, which requires mitochondrial uncoupling protein 1 (UCP1). It remains uncertain, however, whether BAT 18 F-FDG uptake is a reliable surrogate measure of UCP1-mediated heat production. Methods: UCP1 knockout (KO) and wild-type (WT) mice housed at thermoneutrality were treated with the selective β3 adrenergic receptor agonist CL 316, 243 and underwent metabolic cage, infrared thermal imaging and 18 F-FDG PET/MRI experiments. Primary brown adipocytes were additionally examined for their bioenergetics by extracellular flux analysis as well as their uptake of 2-deoxy- 3 H-glucose. Results: In response to CL 316, 243 treatments, oxygen consumption, and BAT thermogenesis were diminished in UCP1 KO mice, but BAT 18 F-FDG uptake was fully retained. Isolated UCP1 KO brown adipocytes exhibited defective induction of uncoupled respiration whereas their glycolytic flux and 2-deoxy- 3 H-glucose uptake rates were largely unaffected. Conclusion: Adrenergic stimulation can increase BAT 18 F-FDG uptake independently of UCP1 thermogenic function. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  20. Gelatin-based Hydrogel Degradation and Tissue Interaction in vivo: Insights from Multimodal Preclinical Imaging in Immunocompetent Nude Mice.

    PubMed

    Tondera, Christoph; Hauser, Sandra; Krüger-Genge, Anne; Jung, Friedrich; Neffe, Axel T; Lendlein, Andreas; Klopfleisch, Robert; Steinbach, Jörg; Neuber, Christin; Pietzsch, Jens

    2016-01-01

    Hydrogels based on gelatin have evolved as promising multifunctional biomaterials. Gelatin is crosslinked with lysine diisocyanate ethyl ester (LDI) and the molar ratio of gelatin and LDI in the starting material mixture determines elastic properties of the resulting hydrogel. In order to investigate the clinical potential of these biopolymers, hydrogels with different ratios of gelatin and diisocyanate (3-fold (G10_LNCO3) and 8-fold (G10_LNCO8) molar excess of isocyanate groups) were subcutaneously implanted in mice (uni- or bilateral implantation). Degradation and biomaterial-tissue-interaction were investigated in vivo (MRI, optical imaging, PET) and ex vivo (autoradiography, histology, serum analysis). Multimodal imaging revealed that the number of covalent net points correlates well with degradation time, which allows for targeted modification of hydrogels based on properties of the tissue to be replaced. Importantly, the degradation time was also dependent on the number of implants per animal. Despite local mechanisms of tissue remodeling no adverse tissue responses could be observed neither locally nor systemically. Finally, this preclinical investigation in immunocompetent mice clearly demonstrated a complete restoration of the original healthy tissue.

  1. Dynamic of distribution of human bone marrow-derived mesenchymal stem cells after transplantation into adult unconditioned mice.

    PubMed

    Allers, Carolina; Sierralta, Walter D; Neubauer, Sonia; Rivera, Francisco; Minguell, José J; Conget, Paulette A

    2004-08-27

    The use of mesenchymal stem cells (MSC) for cell therapy relies on their capacity to engraft and survive long-term in the appropriate target tissue(s). Animal models have demonstrated that the syngeneic or xenogeneic transplantation of MSC results in donor engraftment into the bone marrow and other tissues of conditioned recipients. However, there are no reliable data showing the fate of human MSC infused into conditioned or unconditioned adult recipients. In the present study, the authors investigated, by using imaging, polymerase chain reaction (PCR), and in situ hybridization, the biodistribution of human bone marrow-derived MSC after intravenous infusion into unconditioned adult nude mice. As assessed by imaging (gamma camera), PCR, and in situ hybridization analysis, the authors' results demonstrate the presence of human MSC in bone marrow, spleen, and mesenchymal tissues of recipient mice. These results suggest that human MSC transplantation into unconditioned recipients represents an option for providing cellular therapy and avoids the complications associated with drugs or radiation conditioning.

  2. An image registration pipeline for analysis of transsynaptic tracing in mice

    NASA Astrophysics Data System (ADS)

    Kutten, Kwame S.; Eacker, Stephen M.; Dawson, Valina L.; Dawson, Ted M.; Ratnanather, Tilak; Miller, Michael I.

    2016-03-01

    Parkinson's Disease (PD) is a movement disorder characterized by the loss of dopamine neurons in the substantia nigra pars compacta (SNpc) and norepinephrine neurons in the locus coeruleus (LC). To further understand the pathophysiology of PD, the input neurons of the SNpc and LC will be transsynapticly traced in mice using a fluorescent recombinant rabies virus (RbV) and imaged using serial two-photon tomography (STP). A mapping between these images and a brain atlas must be found to accurately determine the locations of input neurons in the brain. Therefore a registration pipeline to align the Allen Reference Atlas (ARA) to these types of images was developed. In the preprocessing step, a brain mask was generated from the transsynaptic tracing images using simple morphological operators. The masks were then registered to the ARA using Large Deformation Diffeomorphic Metric Mapping (LDDMM), an algorithm specialized for calculating anatomically realistic transforms between images. The pipeline was then tested on an STP scan of a mouse brain labeled by an adeno-associated virus (AAV). Based on qualitative evaluation of the registration results, the pipeline was found to be sufficient for use with transsynaptic RbV tracing.

  3. Ratiometric spectral imaging for fast tumor detection and chemotherapy monitoring in vivo

    PubMed Central

    Hwang, Jae Youn; Gross, Zeev; Gray, Harry B.; Medina-Kauwe, Lali K.; Farkas, Daniel L.

    2011-01-01

    We report a novel in vivo spectral imaging approach to cancer detection and chemotherapy assessment. We describe and characterize a ratiometric spectral imaging and analysis method and evaluate its performance for tumor detection and delineation by quantitatively monitoring the specific accumulation of targeted gallium corrole (HerGa) into HER2-positive (HER2 +) breast tumors. HerGa temporal accumulation in nude mice bearing HER2 + breast tumors was monitored comparatively by a. this new ratiometric imaging and analysis method; b. established (reflectance and fluorescence) spectral imaging; c. more commonly used fluorescence intensity imaging. We also tested the feasibility of HerGa imaging in vivo using the ratiometric spectral imaging method for tumor detection and delineation. Our results show that the new method not only provides better quantitative information than typical spectral imaging, but also better specificity than standard fluorescence intensity imaging, thus allowing enhanced in vivo outlining of tumors and dynamic, quantitative monitoring of targeted chemotherapy agent accumulation into them. PMID:21721808

  4. Optimization of Dendritic Cell-Mediated Cytotoxic T-Cell Activation by Tracking of Dendritic Cell Migration Using Reporter Gene Imaging.

    PubMed

    Lee, Hongje; Lee, Ho Won; La Lee, You; Jeon, Yong Hyun; Jeong, Shin Young; Lee, Sang-Woo; Lee, Jaetae; Ahn, Byeong-Cheol

    2018-06-01

    The aim of this study is to optimize the dendritic cell (DC)-mediated T-cell activation using reporter gene imaging and flow cytometric analysis in living mice. A murine dendritic cell line (DC2.4) co-expressing effluc and Thy1.1 genes were established by transfection with retroviral vectors. Thy1.1 positive cells were sorted by magnetic bead separation system (DC2.4/effluc). Cell proliferation assay and phenotype analysis to determine the effects of gene transduction on the function of dendritic cells between parental DC2.4 and DC2.4/effluc were performed. To optimize the DC-mediated immune response by cell number or frequency, different cell numbers (5 × 10 5 , 1 × 10 6 , and 2 × 10 6  DC2.4/effluc) or different frequencies of DC2.4/effluc (first, second, and third injections) were injected in the right footpad of mice. The migration of the DC2.4/effluc into the draining popliteal lymph node of mice was monitored by bioluminescence imaging (BLI). Flow cytometric analysis was performed with splenocytes to determine the cytotoxic T-cell population after injection of DC2.4/effluc. Parental DC2.4 and DC2.4/effluc exhibit no significant differences in their proliferation and phenotype. BLI signals were observed in the draining popliteal lymph node at day 1 after injection of DC2.4/effluc in 1 × 10 6 and 2 × 10 6 cells-injected groups. The highest BLI signal intensity was detected in 2 × 10 6 cells-injected mice. On day 11, the BLI signal was detected in only 2 × 10 6 cell-injected group but not in other groups. Optimized cell numbers (2 × 10 6 ) were injected in three animal groups with a different frequency (first, second, and third injection groups). The BLI signal was detected at day 1 and maintained until day 7 in the first injection group, but there is low signal intensity in the second and the third injection groups. Although the expression levels of Thy1.1 gene in the first injection group were very high, there reveals no expression of Thy1.1 gene in the second and the third injection groups. The number of tumor-specific CD8 + T-cells in the spleen significantly increased, as the number of DC injections increases. Successful optimization of DC-mediated cytotoxic T-cell activation in living mice using reporter gene imaging and flow cytometric analysis was achieved. The optimization of DC-mediated cytotoxic T-cell activation could be applied for the future DC-based immunotherapy.

  5. Specific in vivo labeling with GFP retroviruses, lentiviruses, and adenoviruses for imaging

    NASA Astrophysics Data System (ADS)

    Hoffman, Robert M.; Kishimoto, Hiroyuki; Fujiwara, Toshiyoshi

    2008-02-01

    Fluorescent proteins have revolutionized the field of imaging. Our laboratory pioneered in vivo imaging with fluorescent proteins. Fluorescent proteins have enabled imaging at the subcellular level in mice. We review here the use of different vectors carrying fluorescent proteins to selectively label normal and tumor tissue in vivo. We show that a GFP retrovirus and telomerase-driven GFP adenovirus can selectively label tumors in mice. We also show that a GFP lentivirus can selectively label the liver in mice. The practical application of these results are discussed.

  6. Organ specific mapping of in vivo redox state in control and cigarette smoke-exposed mice using EPR/NMR co-imaging

    PubMed Central

    Caia, George L.; Efimova, Olga V.; Velayutham, Murugesan; El-Mahdy, Mohamed A.; Abdelghany, Tamer M.; Kesselring, Eric; Petryakov, Sergey; Sun, Ziqi; Samouilov, Alexandre; Zweier, Jay L.

    2014-01-01

    In vivo mapping of alterations in redox status is important for understanding organ specific pathology and disease. While electron paramagnetic resonance imaging (EPRI) enables spatial mapping of free radicals, it does not provide anatomic visualization of the body. Proton MRI is well suited to provide anatomical visualization. We applied EPR/NMR co-imaging instrumentation to map and monitor the redox state of living mice under normal or oxidative stress conditions induced by secondhand cigarette smoke (SHS) exposure. A hybrid co-imaging instrument, EPRI (1.2 GHz) / proton MRI (16.18 MHz), suitable for whole-body co-imaging of mice was utilized with common magnet and gradients along with dual EPR/NMR resonators that enable co-imaging without sample movement. The metabolism of the nitroxide probe, 3–carbamoyl–proxyl (3-CP), was used to map the redox state of control and SHS-exposed mice. Co-imaging allowed precise 3D mapping of radical distribution and reduction in major organs such as the heart, lungs, liver, bladder and kidneys. Reductive metabolism was markedly decreased in SHS-exposed mice and EPR/NMR co-imaging allowed quantitative assessment of this throughout the body. Thus, in vivo EPR/NMR co-imaging enables in vivo organ specific mapping of free radical metabolism and redox stress and the alterations that occur in the pathogenesis of disease. PMID:22296801

  7. Organ specific mapping of in vivo redox state in control and cigarette smoke-exposed mice using EPR/NMR co-imaging

    NASA Astrophysics Data System (ADS)

    Caia, George L.; Efimova, Olga V.; Velayutham, Murugesan; El-Mahdy, Mohamed A.; Abdelghany, Tamer M.; Kesselring, Eric; Petryakov, Sergey; Sun, Ziqi; Samouilov, Alexandre; Zweier, Jay L.

    2012-03-01

    In vivo mapping of alterations in redox status is important for understanding organ specific pathology and disease. While electron paramagnetic resonance imaging (EPRI) enables spatial mapping of free radicals, it does not provide anatomic visualization of the body. Proton MRI is well suited to provide anatomical visualization. We applied EPR/NMR co-imaging instrumentation to map and monitor the redox state of living mice under normal or oxidative stress conditions induced by secondhand cigarette smoke (SHS) exposure. A hybrid co-imaging instrument, EPRI (1.2 GHz)/proton MRI (16.18 MHz), suitable for whole-body co-imaging of mice was utilized with common magnet and gradients along with dual EPR/NMR resonators that enable co-imaging without sample movement. The metabolism of the nitroxide probe, 3-carbamoyl-proxyl (3-CP), was used to map the redox state of control and SHS-exposed mice. Co-imaging allowed precise 3D mapping of radical distribution and reduction in major organs such as the heart, lungs, liver, bladder and kidneys. Reductive metabolism was markedly decreased in SHS-exposed mice and EPR/NMR co-imaging allowed quantitative assessment of this throughout the body. Thus, in vivo EPR/NMR co-imaging enables in vivo organ specific mapping of free radical metabolism and redox stress and the alterations that occur in the pathogenesis of disease.

  8. External optical imaging of freely moving mice with green fluorescent protein-expressing metastatic tumors

    NASA Astrophysics Data System (ADS)

    Yang, Meng; Baranov, Eugene; Shimada, Hiroshi; Moossa, A. R.; Hoffman, Robert M.

    2000-04-01

    We report here a new approach to genetically engineering tumors to become fluorescence such that they can be imaged externally in freely-moving animals. We describe here external high-resolution real-time fluorescent optical imaging of metastatic tumors in live mice. Stable high-level green flourescent protein (GFP)-expressing human and rodent cell lines enable tumors and metastasis is formed from them to be externally imaged from freely-moving mice. Real-time tumor and metastatic growth were quantitated from whole-body real-time imaging in GFP-expressing melanoma and colon carcinoma models. This GFP optical imaging system is highly appropriate for high throughput in vivo drug screening.

  9. Three-dimensional self-gated cardiac MR imaging for the evaluation of myocardial infarction in mouse model on a 3T clinical MR system.

    PubMed

    Zhang, Xiaoyong; Qiu, Bensheng; Wei, Zijun; Yan, Fei; Shi, Caiyun; Su, Shi; Liu, Xin; Ji, Jim X; Xie, Guoxi

    2017-01-01

    To develop and assess a three-dimensional (3D) self-gated technique for the evaluation of myocardial infarction (MI) in mouse model without the use of external electrocardiogram (ECG) trigger and respiratory motion sensor on a 3T clinical MR system. A 3D T1-weighted GRE sequence with stack-of-stars sampling trajectories was developed and performed on six mice with MIs that were injected with a gadolinium-based contrast agent at a 3T clinical MR system. Respiratory and cardiac self-gating signals were derived from the Cartesian mapping of the k-space center along the partition encoding direction by bandpass filtering in image domain. The data were then realigned according to the predetermined self-gating signals for the following image reconstruction. In order to accelerate the data acquisition, image reconstruction was based on compressed sensing (CS) theory by exploiting temporal sparsity of the reconstructed images. In addition, images were also reconstructed from the same realigned data by conventional regridding method for demonstrating the advantageous of the proposed reconstruction method. Furthermore, the accuracy of detecting MI by the proposed method was assessed using histological analysis as the standard reference. Linear regression and Bland-Altman analysis were used to assess the agreement between the proposed method and the histological analysis. Compared to the conventional regridding method, the proposed CS method reconstructed images with much less streaking artifact, as well as a better contrast-to-noise ratio (CNR) between the blood and myocardium (4.1 ± 2.1 vs. 2.9 ± 1.1, p = 0.031). Linear regression and Bland-Altman analysis demonstrated that excellent correlation was obtained between infarct sizes derived from the proposed method and histology analysis. A 3D T1-weighted self-gating technique for mouse cardiac imaging was developed, which has potential for accurately evaluating MIs in mice at 3T clinical MR system without the use of external ECG trigger and respiratory motion sensor.

  10. Imaging Retinal Vascular Changes in the Mouse Model of Oxygen-Induced Retinopathy

    PubMed Central

    Furtado, João M.; Davies, Michael H.; Choi, Dongseok; Lauer, Andreas K.; Appukuttan, Binoy; Bailey, Steven T.; Rahman, Hassan T.; Payne, John F.; Stempel, Andrew J.; Mohs, Kathleen; Powers, Michael R.; Yeh, Steven; Smith, Justine R.

    2012-01-01

    Purpose Oxygen-induced retinopathy in the mouse is the standard experimental model of retinopathy of prematurity. Assessment of the pathology involves in vitro analysis of retinal vaso-obliteration and retinal neovascularization. The authors studied the clinical features of oxygen-induced retinopathy in vivo using topical endoscopy fundus imaging (TEFI), in comparison to standard investigations, and evaluated a system for grading these features. Methods Postnatal day (P)7 mice were exposed to 75% oxygen for five days to induce retinopathy or maintained in room air as controls. Retinal vascular competence was graded against standard photographs by three masked graders. Retinal photographs were obtained at predetermined ages using TEFI. Postmortem, retinal vaso-obliteration was measured in whole mounts with labeled vasculature, and retinal neovascularization was quantified in hematoxylin- and eosin-stained ocular cross sections. Results Fundus photography by TEFI was possible from P15, when retinal vascular incompetence, including dilatation and tortuosity, was significant in mice with oxygen-induced retinopathy in comparison to controls. Vascular incompetence peaked in severity at P17 and persisted through P25. Comparison with in vitro analyses indicated that vascular changes were most severe after retinal avascularity had begun to decrease in area, and coincident with the maximum of retinal neovascularization. A weighted Fleiss-Cohen kappa indicated good intra- and interobserver agreement for a 5-point grading system. Conclusions Topical endoscopy fundus imaging demonstrates retinal vascular incompetence in mice with oxygen-induced retinopathy. The technique complements standard postmortem analysis for following the course of the model. Translational Relevance Topical endoscopy fundus imaging has application in the evaluation of novel biologic drugs for retinopathy of prematurity. PMID:24049705

  11. ALA-PpIX variability quantitatively imaged in A431 epidermoid tumors using in vivo ultrasound fluorescence tomography and ex vivo assay

    NASA Astrophysics Data System (ADS)

    DSouza, Alisha V.; Flynn, Brendan P.; Gunn, Jason R.; Samkoe, Kimberley S.; Anand, Sanjay; Maytin, Edward V.; Hasan, Tayyaba; Pogue, Brian W.

    2014-03-01

    Treatment monitoring of Aminolevunilic-acid (ALA) - Photodynamic Therapy (PDT) of basal-cell carcinoma (BCC) calls for superficial and subsurface imaging techniques. While superficial imagers exist for this purpose, their ability to assess PpIX levels in thick lesions is poor; additionally few treatment centers have the capability to measure ALA-induced PpIX production. An area of active research is to improve treatments to deeper and nodular BCCs, because treatment is least effective in these. The goal of this work was to understand the logistics and technical capabilities to quantify PpIX at depths over 1mm, using a novel hybrid ultrasound-guided, fiber-based fluorescence molecular spectroscopictomography system. This system utilizes a 633nm excitation laser and detection using filtered spectrometers. Source and detection fibers are collinear so that their imaging plane matches that of ultrasound transducer. Validation with phantoms and tumor-simulating fluorescent inclusions in mice showed sensitivity to fluorophore concentrations as low as 0.025μg/ml at 4mm depth from surface, as presented in previous years. Image-guided quantification of ALA-induced PpIX production was completed in subcutaneous xenograft epidermoid cancer tumor model A431 in nude mice. A total of 32 animals were imaged in-vivo, using several time points, including pre-ALA, 4-hours post-ALA, and 24-hours post-ALA administration. On average, PpIX production in tumors increased by over 10-fold, 4-hours post-ALA. Statistical analysis of PpIX fluorescence showed significant difference among all groups; p<0.05. Results were validated by exvivo imaging of resected tumors. Details of imaging, analysis and results will be presented to illustrate variability and the potential for imaging these values at depth.

  12. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone

    PubMed Central

    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R.; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L.; Ferris, Craig F.

    2016-01-01

    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain signature that should, in the future, be compared to other μ opioid agonists. PMID:27857679

  13. Near-infrared fluorescence molecular imaging of amyloid beta species and monitoring therapy in animal models of Alzheimer’s disease

    PubMed Central

    Zhang, Xueli; Tian, Yanli; Zhang, Can; Tian, Xiaoyu; Ross, Alana W.; Moir, Robert D.; Sun, Hongbin; Tanzi, Rudolph E.; Moore, Anna; Ran, Chongzhao

    2015-01-01

    Near-infrared fluorescence (NIRF) molecular imaging has been widely applied to monitoring therapy of cancer and other diseases in preclinical studies; however, this technology has not been applied successfully to monitoring therapy for Alzheimer’s disease (AD). Although several NIRF probes for detecting amyloid beta (Aβ) species of AD have been reported, none of these probes has been used to monitor changes of Aβs during therapy. In this article, we demonstrated that CRANAD-3, a curcumin analog, is capable of detecting both soluble and insoluble Aβ species. In vivo imaging showed that the NIRF signal of CRANAD-3 from 4-mo-old transgenic AD (APP/PS1) mice was 2.29-fold higher than that from age-matched wild-type mice, indicating that CRANAD-3 is capable of detecting early molecular pathology. To verify the feasibility of CRANAD-3 for monitoring therapy, we first used the fast Aβ-lowering drug LY2811376, a well-characterized beta-amyloid cleaving enzyme-1 inhibitor, to treat APP/PS1 mice. Imaging data suggested that CRANAD-3 could monitor the decrease in Aβs after drug treatment. To validate the imaging capacity of CRANAD-3 further, we used it to monitor the therapeutic effect of CRANAD-17, a curcumin analog for inhibition of Aβ cross-linking. The imaging data indicated that the fluorescence signal in the CRANAD-17–treated group was significantly lower than that in the control group, and the result correlated with ELISA analysis of brain extraction and Aβ plaque counting. It was the first time, to our knowledge, that NIRF was used to monitor AD therapy, and we believe that our imaging technology has the potential to have a high impact on AD drug development. PMID:26199414

  14. Assessment of Collagen-Induced Arthritis Using Cyanine 5.5 Conjugated with Hydrophobically Modified Glycol Chitosan Nanoparticles: Correlation with 18F-Fluorodeoxyglucose Positron Emission Tomography Data

    PubMed Central

    Cha, Ji Hyeon; Lee, Sheen-Woo; Park, Kyeongsoon; Moon, Dae Hyuk; Kim, Kwangmeyung; Biswal, Sandip

    2012-01-01

    Objective To evaluate the potential and correlation between near-infrared fluorescence (NIRF) imaging using cyanine 5.5 conjugated with hydrophobically modified glycol chitosan nanoparticles (HGC-Cy5.5) and 18F-fluorodeoxyglucose-positron emission tomography (18F-FDG-PET) imaging of collagen-induced arthritis (CIA). Materials and Methods We used 10 CIA and 3 normal mice. Nine days after the injecting collagen twice, microPET imaging was performed 40 minutes after the intravenous injection of 9.3 MBq 18F-FDG in 200 µL PBS. One day later, NIRF imaging was performed two hours after the intravenous injection of HGC-cy5.5 (5 mg/kg). We assessed the correlation between these two modalities in the knees and ankles of CIA mice. Results The mean standardized uptake values of 18F-FDG for knees and ankles were 1.68 ± 0.76 and 0.79 ± 0.71, respectively, for CIA mice; and 0.57 ± 0.17 and 0.54 ± 0.20 respectively for control mice. From the NIRF images, the total photon counts per 30 mm2 for knees and ankles were 2.32 ± 1.54 × 105 and 2.75 ± 1.51 × 105, respectively, for CIA mice, and 1.22 ± 0.27 × 105 and 0.88 ± 0.24 × 105, respectively, for control mice. These two modalities showed a moderate correlation for knees (r = 0.604, p = 0.005) and ankles (r = 0.464, p = 0.039). Moreover, both HGC-Cy5.5 (p = 0.002) and 18F-FDG-PET (p = 0.005) imaging also showed statistically significant differences between CIA and normal mice. Conclusion NIRF imaging using HGC-Cy5.5 was moderately correlated with 18F-FDG-PET imaging in the CIA model. As such, HGC-Cy5.5 imaging can be used for the early detection of rheumatoid arthritis. PMID:22778567

  15. Albumin microvascular leakage in brains with diabetes mellitus.

    PubMed

    Fujihara, Ryuji; Chiba, Yoichi; Nakagawa, Toshitaka; Nishi, Nozomu; Murakami, Ryuta; Matsumoto, Koichi; Kawauchi, Machi; Yamamoto, Tetsuji; Ueno, Masaki

    2016-09-01

    Their aim was to examine whether microvascular leakage of endogenous albumin, a representative marker for blood-brain barrier (BBB) damage, was induced in the periventricular area of diabetic db/db mice because periventricular white matter hyperintensity formation in magnetic resonance images was accelerating in elderly patients with diabetes mellitus. Using light and electron microscopes, and semi-quantitative analysis techniques, immunoreactivity of endogenous albumin, indicating vascular permeability, was examined in the periventricular area and spinal cord of db/db mice and db/+m control mice. Greater immunoreactivity of albumin was observed in the vessel wall of the periventricular area of db/db mice than in controls. Additionally, weak immunoreactivity was observed in the spinal cord of both db/db mice and controls. The number of gold particles, indicating immunoreactivity of albumin, in the perivascular area of db/db mice was significantly higher than that of control mice, but there was no significant difference in the number of particles in the spinal cord between db/db mice and controls. These findings suggest that albumin microvascular leakage, or BBB breakdown, is induced in the periventricular area of diabetic mice. Microsc. Res. Tech. 79:833-837, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. αVβ3 integrin-targeted microSPECT/CT imaging of inflamed atherosclerotic plaques in mice.

    PubMed

    Vancraeynest, David; Roelants, Véronique; Bouzin, Caroline; Hanin, François-Xavier; Walrand, Stephan; Bol, Vanesa; Bol, Anne; Pouleur, Anne-Catherine; Pasquet, Agnès; Gerber, Bernhard; Lesnik, Philippe; Huby, Thierry; Jamar, François; Vanoverschelde, Jean-Louis

    2016-12-01

    αVβ3-integrin is expressed by activated endothelial cells and macrophages in atherosclerotic plaques and may represent a valuable marker of high-risk plaques. We evaluated (99m)Tc-maraciclatide, an integrin-specific tracer, for imaging vascular inflammation in atherosclerotic lesions in mice. Apolipoprotein E-negative (ApoE(-/-)) mice on a Western diet (n = 10) and normally fed adult C57BL/6 control mice (n = 4) were injected with (99m)Tc-maraciclatide (51.8 ± 3.7 MBq). A blocking peptide was infused in three ApoE(-/-) mice; this condition served as another control. After 90 min, the animals were imaged via single-photon emission computed tomography (SPECT). While maintained in the same position, the mice were transferred to computed tomography (CT) to obtain contrast-enhanced images of the aortic arch. Images from both modalities were fused, and signal was quantified in the aortic arch and in the vena cava for subtraction of blood-pool activity. The aorta was carefully dissected after imaging for gamma counting, autoradiography, and histology. Tracer uptake was significantly higher in ApoE(-/-) mice than in both groups of control mice (1.56 ± 0.33 vs. 0.82 ± 0.24 vs. 0.98 ± 0.11, respectively; P = 0.006). Furthermore, higher tracer activity was detected via gamma counting in the aorta of hypercholesterolemic mice than in both groups of control mice (1.52 ± 0.43 vs. 0.78 ± 0.19 vs. 0.47 ± 0.31 (99m)Tc-maraciclatide %ID/g, respectively; P = 0.018). Autoradiography showed significantly higher tracer uptake in the atherosclerotic aorta than in the control aorta (P = 0.026). Finally, in the atherosclerotic aorta, immunostaining indicated that the integrin signal came predominantly from macrophages and was correlated with the macrophage CD68 immunomarker (r = 0.73). (99m)Tc-maraciclatide allows in vivo detection of inflamed atherosclerotic plaques in mice and may represent a non-invasive approach for identifying high-risk plaques in patients.

  17. Magnetic resonance and photoacoustic imaging of brain tumor mediated by mesenchymal stem cell labeled with multifunctional nanoparticle introduced via carotid artery injection.

    PubMed

    Qiao, Yang; Gumin, Joy; MacLellan, Christopher J; Gao, Feng; Bouchard, Richard; Lang, Frederick F; Stafford, R Jason; Melancon, Marites P

    2018-04-20

    To evaluate the feasibility of visualizing bone marrow-derived human mesenchymal stem cells (MSCs) labeled with a gold-coated magnetic resonance (MR)-active multifunctional nanoparticle and injected via the carotid artery for assessing the extent of MSC homing in glioma-bearing mice. Nanoparticles containing superparamagnetic iron oxide coated with gold (SPIO@Au) with a diameter of ∼82 nm and maximum absorbance in the near infrared region were synthesized. Bone marrow-derived MSCs conjugated with green fluorescent protein (GFP) were successfully labeled with SPIO@Au at 4 μg ml -1 and injected via the internal carotid artery in six mice bearing orthotopic U87 tumors. Unlabeled MSCs were used as a control. The ability of SPIO@Au-loaded MSCs to be imaged using MR and photoacoustic (PA) imaging at t = 0 h, 2 h, 24 h, and 72 h was assessed using a 7 T Bruker Biospec experimental MR scanner and a Vevo LAZR PA imaging system with a 5 ns laser as the excitation source. Histological analysis of the brain tissue was performed 72 h after MSC injection using GFP fluorescence, Prussian blue staining, and hematoxylin-and-eosin staining. MSCs labeled with SPIO@Au at 4 μg ml -1 did not exhibit cell death or any adverse effects on differentiation or migration. The PA signal in tumors injected with SPIO@Au-loaded MSCs was clearly more enhanced post-injection, as compared with the tumors injected with unlabeled MSCs at t = 72 h. Using the same mice, T2-weighted MR imaging results taken before injection and at t = 2 h, 24 h, and 72 h were consistent with the PA imaging results, showing significant hypointensity of the tumor in the presence of SPIO@Au-loaded MSCs. Histological analysis also showed co-localization of GFP fluorescence and iron, thereby confirming that SPIO@Au-labeled MSCs continue to carry their nanoparticle payloads even at 72 h after injection. Our results demonstrated the feasibility of tracking carotid artery-injected SPIO@Au-labeled MSCs in vivo via MR and PA imaging.

  18. Magnetic resonance and photoacoustic imaging of brain tumor mediated by mesenchymal stem cell labeled with multifunctional nanoparticle introduced via carotid artery injection

    NASA Astrophysics Data System (ADS)

    Qiao, Yang; Gumin, Joy; MacLellan, Christopher J.; Gao, Feng; Bouchard, Richard; Lang, Frederick F.; Stafford, R. Jason; Melancon, Marites P.

    2018-04-01

    Objective. To evaluate the feasibility of visualizing bone marrow-derived human mesenchymal stem cells (MSCs) labeled with a gold-coated magnetic resonance (MR)-active multifunctional nanoparticle and injected via the carotid artery for assessing the extent of MSC homing in glioma-bearing mice. Materials and methods. Nanoparticles containing superparamagnetic iron oxide coated with gold (SPIO@Au) with a diameter of ˜82 nm and maximum absorbance in the near infrared region were synthesized. Bone marrow-derived MSCs conjugated with green fluorescent protein (GFP) were successfully labeled with SPIO@Au at 4 μg ml-1 and injected via the internal carotid artery in six mice bearing orthotopic U87 tumors. Unlabeled MSCs were used as a control. The ability of SPIO@Au-loaded MSCs to be imaged using MR and photoacoustic (PA) imaging at t = 0 h, 2 h, 24 h, and 72 h was assessed using a 7 T Bruker Biospec experimental MR scanner and a Vevo LAZR PA imaging system with a 5 ns laser as the excitation source. Histological analysis of the brain tissue was performed 72 h after MSC injection using GFP fluorescence, Prussian blue staining, and hematoxylin-and-eosin staining. Results. MSCs labeled with SPIO@Au at 4 μg ml-1 did not exhibit cell death or any adverse effects on differentiation or migration. The PA signal in tumors injected with SPIO@Au-loaded MSCs was clearly more enhanced post-injection, as compared with the tumors injected with unlabeled MSCs at t = 72 h. Using the same mice, T2-weighted MR imaging results taken before injection and at t = 2 h, 24 h, and 72 h were consistent with the PA imaging results, showing significant hypointensity of the tumor in the presence of SPIO@Au-loaded MSCs. Histological analysis also showed co-localization of GFP fluorescence and iron, thereby confirming that SPIO@Au-labeled MSCs continue to carry their nanoparticle payloads even at 72 h after injection. Conclusions. Our results demonstrated the feasibility of tracking carotid artery-injected SPIO@Au-labeled MSCs in vivo via MR and PA imaging.

  19. Postnatal Development of the Spheno-occipital Synchondrosis: A Histological Analysis.

    PubMed

    Dai, Jiewen; Lin, Yuheng; Ningjuan, Ouyang; Shi, Jun; Yu, Dedong; Shen, Guofang

    2017-09-01

    The spheno-occipital synchondrosis (SOS) in cranial base is an important growth center for the craniofacial skeleton, and also is a guide rail for development of the maxilla, midface, and mandible. Previous studies showed that SOS may be a treatment target for youngsters with midfacial hypoplasia and small cranial vault secondary to craniosynostosis. However, most of studies about the SOS are based on imaging data. In this study, we try to explore the characteristics of postnatal development of the mouse SOS based on histological analysis. Our findings showed that the width of the SOS in mice were gradually decreased from newborn mice to adult mice, and the SOS cartilage was gradually became small, then almost completely ossificated in adult mice. The resting and proliferative layers in SOS cartilage were gradually decreased, and almost only hypertrophic chondrocytes while no resting and proliferative layer chondrocytes in adult mice. The proliferative ability of SOS chondrocytes also gradually decreased. These findings will be of benefit for the further clinical treatment for patients with midfacial hypoplasia or small cranial vault secondary to craniosynostosis. Further evidence-based research about the clinical implication is necessary in future.

  20. Long-term imaging in awake mice using removable cranial windows

    PubMed Central

    Glickfeld, Lindsey L.; Kerlin, Aaron M.; Reid, R. Clay; Bonin, Vincent; Schafer, Dorothy P.; Andermann, Mark L.

    2015-01-01

    Cranial window implants in head-fixed rodents are becoming a preparation of choice for stable optical access to large areas of cortex over extended periods of time. Here, we provide a highly detailed and reliable surgical protocol for a cranial window implantation procedure for chronic widefield and cellular imaging in awake, head-fixed mice, which enables subsequent window removal and replacement in the weeks and months following the initial craniotomy. This protocol has facilitated awake, chronic imaging in adolescent as well as adult mice over several months from a large number of cortical brain regions; targeted virus and tracer injections from data obtained using prior awake functional mapping; and functionally-targeted two-photon imaging across all cortical layers in awake mice using a microprism attachment to the cranial window. Collectively, these procedures extend the reach of chronic imaging of cortical function and dysfunction in behaving animals. PMID:25275789

  1. ELHnet: a convolutional neural network for classifying cochlear endolymphatic hydrops imaged with optical coherence tomography.

    PubMed

    Liu, George S; Zhu, Michael H; Kim, Jinkyung; Raphael, Patrick; Applegate, Brian E; Oghalai, John S

    2017-10-01

    Detection of endolymphatic hydrops is important for diagnosing Meniere's disease, and can be performed non-invasively using optical coherence tomography (OCT) in animal models as well as potentially in the clinic. Here, we developed ELHnet, a convolutional neural network to classify endolymphatic hydrops in a mouse model using learned features from OCT images of mice cochleae. We trained ELHnet on 2159 training and validation images from 17 mice, using only the image pixels and observer-determined labels of endolymphatic hydrops as the inputs. We tested ELHnet on 37 images from 37 mice that were previously not used, and found that the neural network correctly classified 34 of the 37 mice. This demonstrates an improvement in performance from previous work on computer-aided classification of endolymphatic hydrops. To the best of our knowledge, this is the first deep CNN designed for endolymphatic hydrops classification.

  2. ELHnet: a convolutional neural network for classifying cochlear endolymphatic hydrops imaged with optical coherence tomography

    PubMed Central

    Liu, George S.; Zhu, Michael H.; Kim, Jinkyung; Raphael, Patrick; Applegate, Brian E.; Oghalai, John S.

    2017-01-01

    Detection of endolymphatic hydrops is important for diagnosing Meniere’s disease, and can be performed non-invasively using optical coherence tomography (OCT) in animal models as well as potentially in the clinic. Here, we developed ELHnet, a convolutional neural network to classify endolymphatic hydrops in a mouse model using learned features from OCT images of mice cochleae. We trained ELHnet on 2159 training and validation images from 17 mice, using only the image pixels and observer-determined labels of endolymphatic hydrops as the inputs. We tested ELHnet on 37 images from 37 mice that were previously not used, and found that the neural network correctly classified 34 of the 37 mice. This demonstrates an improvement in performance from previous work on computer-aided classification of endolymphatic hydrops. To the best of our knowledge, this is the first deep CNN designed for endolymphatic hydrops classification. PMID:29082086

  3. Near-infrared fluorescent peptide probes for imaging of tumor in vivo and their biotoxicity evaluation.

    PubMed

    Liu, Liwei; Lin, Guimiao; Yin, Feng; Law, Wing-Cheung; Yong, Ken-Tye

    2016-04-01

    Optical imaging techniques are becoming increasingly urgent for the early detection and monitoring the progression of tumor development. However, tumor vasculature imaging has so far been largely unexplored because of the lack of suitable optical probes. In this study, we demonstrated the preparation of near-infrared (NIR) fluorescent RGD peptide probes for noninvasive imaging of tumor vasculature during tumor angiogenesis. The peptide optical probes combined the advantages of NIR emission and RGD peptide, which possesses minimal biological absorption and specially targets the integrin, which highly expressed on activated tumor endothelial cells. In vivo optical imaging of nude mice bearing pancreatic tumor showed that systemically delivered NIR probes enabled us to visualize the tumors at 24 hours post-injection. In addition, we have performed in vivo toxicity study on the prepared fluorescent RGD peptide probes formulation. The blood test results and histological analysis demonstrated that no obvious toxicity was found for the mice treated with RGD peptide probes for two weeks. These studies suggest that the NIR fluorescent peptide probes can be further designed and employed for ultrasensitive fluorescence imaging of angiogenic tumor vasculature, as well as imaging of other pathophysiological processes accompanied by activation of endothelial cells. © 2016 Wiley Periodicals, Inc.

  4. Biodistribution and predictive value of 18F-fluorocyclophosphamide in mice bearing human breast cancer xenografts.

    PubMed

    Kesner, Amanda L; Hsueh, Wei-Ann; Htet, Nwe Linn; Pio, Betty S; Czernin, Johannes; Pegram, Mark D; Phelps, Michael E; Silverman, Daniel H S

    2007-12-01

    In mice bearing human breast cancer xenografts, we examined the biodistribution of (18)F-fluorocyclophosphamide ((18)F-F-CP) to evaluate its potential as a noninvasive prognostic tool for predicting the resistance of tumors to cyclophosphamide therapy. (18)F-F-CP was synthesized as we recently described, and PET data were acquired after administration of (18)F-F-CP in mice bearing human breast cancer xenografts (MCF-7 cells). Tracer biodistribution in reconstructed images was quantified by region-of-interest analysis. Distribution was also assessed by harvesting dissected organs, tumors, and blood, determining (18)F content in each tissue with a gamma-well counter. The mice were subsequently treated with cyclophosphamide, and tumor size was monitored for at least 3 wk after chemotherapy administration. The distribution of harvested activity correlated strongly with distribution observed in PET images. Target organs were related to routes of metabolism and excretion. (18)F-F-CP uptake was highest in kidneys, lowest in brain, and intermediate in tumors, as determined by both image-based and tissue-based measurements. (18)F-F-CP uptake was not inhibited by coadministration of an approximately x700 concentration of unlabeled cyclophosphamide. PET measures of (18)F-F-CP uptake in tumor predicted the magnitude of the response to subsequent administration of cyclophosphamide. Noninvasive assessment of (18)F-F-CP uptake using PET may potentially be helpful for predicting the response of breast tumors to cyclophosphamide before therapy begins.

  5. Preclinical evaluation of 18F-ML-10 to determine timing of apoptotic response to chemotherapy in solid tumors

    DOE PAGES

    Demirci, Emre; Ahmed, Rafay; Ocak, Meltem; ...

    2017-01-10

    Here, we investigated 2-(5-fluoro-pentyl)-2-methyl-malonic acid ( 18F-ML-10) positron emission tomography (PET) imaging of apoptosis posttherapy to determine optimal timing for predicting chemotherapy response in a mouse head/neck xenograft cancer model. BALB/c nude mice (4-8 weeks old) were implanted with UM-SCC-22B tumors. The treatment group received 2 doses of doxorubicin (10 mg/kg, days 0, 2). Small animal 18F-ML-10 PET/computed tomography was performed before and on days 1, 3, and 7 postchemotherapy. Using regions of interest around tumors, 18F-ML-10 uptake change was measured as %ID/g and uptake relative to liver. Terminal Uridine Nick-End Labeling (TUNEL) immunohistochemistry assay was performed using tumor samplesmore » of baseline and on days 1, 3, and 7 posttreatment. As a result, treated mice demonstrated increased 18F-ML-10 uptake compared to baseline and controls, and 10 of 13 mice showed tumor volume decreases. All control mice showed tumor volume increases. Tumor-to-liver (T/L) ratios from the control group mice did not show significant change from baseline ( P > .05); however, T/L ratios of the treatment group showed significant 18F-ML-10 uptake differences from baseline compared to days 3 and 7 posttreatment ( P < .05), but no significant difference at 1 day posttreatment. In conclusion, 2-(5-Fluoro-pentyl)-2-methyl-malonic acid PET imaging has the potential for early assessment of treatment-induced apoptosis. Timing and image analysis strategies may require optimization, depending on the type of tumor and cancer treatment.« less

  6. Preclinical evaluation of 18F-ML-10 to determine timing of apoptotic response to chemotherapy in solid tumors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Demirci, Emre; Ahmed, Rafay; Ocak, Meltem

    Here, we investigated 2-(5-fluoro-pentyl)-2-methyl-malonic acid ( 18F-ML-10) positron emission tomography (PET) imaging of apoptosis posttherapy to determine optimal timing for predicting chemotherapy response in a mouse head/neck xenograft cancer model. BALB/c nude mice (4-8 weeks old) were implanted with UM-SCC-22B tumors. The treatment group received 2 doses of doxorubicin (10 mg/kg, days 0, 2). Small animal 18F-ML-10 PET/computed tomography was performed before and on days 1, 3, and 7 postchemotherapy. Using regions of interest around tumors, 18F-ML-10 uptake change was measured as %ID/g and uptake relative to liver. Terminal Uridine Nick-End Labeling (TUNEL) immunohistochemistry assay was performed using tumor samplesmore » of baseline and on days 1, 3, and 7 posttreatment. As a result, treated mice demonstrated increased 18F-ML-10 uptake compared to baseline and controls, and 10 of 13 mice showed tumor volume decreases. All control mice showed tumor volume increases. Tumor-to-liver (T/L) ratios from the control group mice did not show significant change from baseline ( P > .05); however, T/L ratios of the treatment group showed significant 18F-ML-10 uptake differences from baseline compared to days 3 and 7 posttreatment ( P < .05), but no significant difference at 1 day posttreatment. In conclusion, 2-(5-Fluoro-pentyl)-2-methyl-malonic acid PET imaging has the potential for early assessment of treatment-induced apoptosis. Timing and image analysis strategies may require optimization, depending on the type of tumor and cancer treatment.« less

  7. Mechanisms of Radiation-Induced Bone Loss and Effect on Prostate Cancer Bone Metastases

    DTIC Science & Technology

    2012-06-01

    Develop intravital multiphoton fluorescence microscopy (IVFM) for real-time imaging of osteocytes in calvariae of transgenic mice using i) GFP to...OT, OB counting) and in vivo bone imaging (months 6-10) 8 20 week old female C57Bl/6 mice (n=30) were used in this experiment. The mice were...divided into 2 groups. One group (group A, n=15) was imaged twice by microCT during the experiment that included a baseline microCT that was given 2 days

  8. An integrative approach for analyzing hundreds of neurons in task performing mice using wide-field calcium imaging.

    PubMed

    Mohammed, Ali I; Gritton, Howard J; Tseng, Hua-an; Bucklin, Mark E; Yao, Zhaojie; Han, Xue

    2016-02-08

    Advances in neurotechnology have been integral to the investigation of neural circuit function in systems neuroscience. Recent improvements in high performance fluorescent sensors and scientific CMOS cameras enables optical imaging of neural networks at a much larger scale. While exciting technical advances demonstrate the potential of this technique, further improvement in data acquisition and analysis, especially those that allow effective processing of increasingly larger datasets, would greatly promote the application of optical imaging in systems neuroscience. Here we demonstrate the ability of wide-field imaging to capture the concurrent dynamic activity from hundreds to thousands of neurons over millimeters of brain tissue in behaving mice. This system allows the visualization of morphological details at a higher spatial resolution than has been previously achieved using similar functional imaging modalities. To analyze the expansive data sets, we developed software to facilitate rapid downstream data processing. Using this system, we show that a large fraction of anatomically distinct hippocampal neurons respond to discrete environmental stimuli associated with classical conditioning, and that the observed temporal dynamics of transient calcium signals are sufficient for exploring certain spatiotemporal features of large neural networks.

  9. Non-invasive in vivo imaging of arthritis in a collagen-induced murine model with phosphatidylserine-binding near-infrared (NIR) dye.

    PubMed

    Chan, Marion M; Gray, Brian D; Pak, Koon Y; Fong, Dunne

    2015-03-09

    Development of non-invasive molecular imaging techniques that are based on cellular changes in inflammation has been of active interest for arthritis diagnosis. This technology will allow real-time detection of tissue damage and facilitate earlier treatment of the disease, thus representing an improvement over X-rays, which detect bone damage at the advanced stage. Tracing apoptosis, an event occurring in inflammation, has been a strategy used. PSVue 794 is a low-molecular-weight, near-infrared (NIR)-emitting complex of bis(zinc2+-dipicolylamine) (Zn-DPA) that binds to phosphatidylserine (PS), a plasma membrane anionic phospholipid that becomes flipped externally upon cell death by apoptosis. In this study, we evaluated the capacity of PSVue 794 to act as an in vivo probe for non-invasive molecular imaging assessment of rheumatoid arthritis (RA) via metabolic function in murine collagen-induced arthritis, a widely adopted animal model for RA. Male DBA/1 strain mice were treated twice with chicken collagen type II in Freund's adjuvant. Their arthritis development was determined by measuring footpad thickness and confirmed with X-ray analysis and histology. In vivo imaging was performed with the NIR dye and the LI-COR Odyssey Image System. The level of emission was compared among mice with different disease severity, non-arthritic mice and arthritic mice injected with a control dye without the Zn-DPA targeting moiety. Fluorescent emission correlated reliably with the degree of footpad swelling and the manifestation of arthritis. Ex vivo examination showed emission was from the joint. Specificity of binding was confirmed by the lack of emission when arthritic mice were given the control dye. Furthermore, the PS-binding protein annexin V displaced the NIR dye from binding, and the difference in emission was numerically measurable on a scale. This report introduces an economical alternative method for assessing arthritis non-invasively in murine models. Inflammation in feet and ankles can be measured longitudinally using the PSVue 794 probe for cell death and with a commonly available multipurpose imager. This technique provides metabolic and functional information that anatomical measurement of footpad swelling or visual determination of arthritic index cannot. It also may decrease the number of animals required per experiment because tissue damage will not necessarily require evaluation by harvesting joints for histology.

  10. Investigation of injection dose and camera integration time on quantifying pharmacokinetics of a Cy5.5-GX1 probe with dynamic fluorescence imaging in vivo

    NASA Astrophysics Data System (ADS)

    Dai, Yunpeng; Chen, Xueli; Yin, Jipeng; Kang, Xiaoyu; Wang, Guodong; Zhang, Xianghan; Nie, Yongzhan; Wu, Kaichun; Liang, Jimin

    2016-08-01

    The aim of this article is to investigate the influence of a tracer injection dose (ID) and camera integration time (IT) on quantifying pharmacokinetics of Cy5.5-GX1 in gastric cancer BGC-823 cell xenografted mice. Based on three factors, including whether or not to inject free GX1, the ID of Cy5.5-GX1, and the camera IT, 32 mice were randomly divided into eight groups and received 60-min dynamic fluorescence imaging. Gurfinkel exponential model (GEXPM) and Lammertsma simplified reference tissue model (SRTM) combined with a singular value decomposition analysis were used to quantitatively analyze the acquired dynamic fluorescent images. The binding potential (Bp) and the sum of the pharmacokinetic rate constants (SKRC) of Cy5.5-GX1 were determined by the SRTM and EXPM, respectively. In the tumor region, the SKRC value exhibited an obvious trend with change in the tracer ID, but the Bp value was not sensitive to it. Both the Bp and SKRC values were independent of the camera IT. In addition, the ratio of the tumor-to-muscle region was correlated with the camera IT but was independent of the tracer ID. Dynamic fluorescence imaging in conjunction with a kinetic analysis may provide more quantitative information than static fluorescence imaging, especially for a priori information on the optimal ID of targeted probes for individual therapy.

  11. In Vivo Tracking of Streptococcal Infections of Subcutaneous Origin in a Murine Model.

    PubMed

    Davis, Richard W; Eggleston, Heather; Johnson, Frances; Nahrendorf, Matthias; Bock, Paul E; Peterson, Tiffany; Panizzi, Peter

    2015-12-01

    Generation of plasmin in vivo by Streptococcus pyogenes is thought to localize the active protease complexes to the pathogen surface to aid in tissue dissemination. Here, we chose to follow cutaneous streptococcal infections by the use of non-invasive bioluminescence imaging to determine if this pathogen can be followed by this approach and the extent of bacterial spread in the absence of canonical plasminogen activation by streptokinase. Mice were injected subcutaneously with either bioluminescent strains of streptococci, namely Xen20 and Xen10 or S. pyogenes ALAB49. Bioluminescence imaging was performed daily and results were correlated with microbiological and histological analyses. Comparative analysis of chronologic non-invasive datasets indicated that Xen20 did not disseminate from the initial infection site. Contrary to this, microbiological and histological analyses of Xen20 mice for total bacterial burden indicated sepsis and widespread pathogen involvement. The use of bioluminescence in microbe-based studies requires genomic and pathologic characterization to correlate imaging results with underlying pathology.

  12. In Vivo Tracking of Streptococcal Infections of Subcutaneous Origin in a Murine Model

    PubMed Central

    Davis, Richard W.; Eggleston, Heather; Johnson, Frances; Nahrendorf, Matthias; Bock, Paul E.; Peterson, Tiffany; Panizzi, Peter

    2016-01-01

    Purpose Generation of plasmin in vivo by Streptococcus pyogenes is thought to localize the active protease complexes to the pathogen surface to aid in tissue dissemination. Here, we chose to follow cutaneous streptococcal infections by the use of non-invasive bioluminescence imaging to determine if this pathogen can be followed by this approach and the extent of bacterial spread in the absence of canonical plasminogen activation by streptokinase. Procedures Mice were injected subcutaneously with either bioluminescent strains of streptococci, namely Xen20 and Xen10 or S. pyogenes ALAB49. Bioluminescence imaging was performed daily and results were correlated with microbiological and histological analyses. Results Comparative analysis of chronologic non-invasive datasets indicated that Xen20 did not disseminate from the initial infection site. Contrary to this, microbiological and histological analyses of Xen20 mice for total bacterial burden indicated sepsis and widespread pathogen involvement. Conclusions The use of bioluminescence in microbe-based studies requires genomic and pathologic characterization to correlate imaging results with underlying pathology. PMID:25921659

  13. High-frequency Ultrasound Imaging of Mouse Cervical Lymph Nodes.

    PubMed

    Walk, Elyse L; McLaughlin, Sarah L; Weed, Scott A

    2015-07-25

    High-frequency ultrasound (HFUS) is widely employed as a non-invasive method for imaging internal anatomic structures in experimental small animal systems. HFUS has the ability to detect structures as small as 30 µm, a property that has been utilized for visualizing superficial lymph nodes in rodents in brightness (B)-mode. Combining power Doppler with B-mode imaging allows for measuring circulatory blood flow within lymph nodes and other organs. While HFUS has been utilized for lymph node imaging in a number of mouse  model systems, a detailed protocol describing HFUS imaging and characterization of the cervical lymph nodes in mice has not been reported. Here, we show that HFUS can be adapted to detect and characterize cervical lymph nodes in mice. Combined B-mode and power Doppler imaging can be used to detect increases in blood flow in immunologically-enlarged cervical nodes. We also describe the use of B-mode imaging to conduct fine needle biopsies of cervical lymph nodes to retrieve lymph tissue for histological  analysis. Finally, software-aided steps are described to calculate changes in lymph node volume and to visualize changes in lymph node morphology following image reconstruction. The ability to visually monitor changes in cervical lymph node biology over time provides a simple and powerful technique for the non-invasive monitoring of cervical lymph node alterations in preclinical mouse models of oral cavity disease.

  14. Immune Rejection after Pancreatic Islet Cell Transplantation: In Vivo Dual Contrast-enhanced MR Imaging in a Mouse Model

    PubMed Central

    Wang, Ping; Schuetz, Christian; Ross, Alana; Dai, Guangping; Markmann, James F.

    2013-01-01

    Purpose: To detect adoptively transferred immune attack in a mouse model of islet cell transplantation by using a long-circulating paramagnetic T1 contrast agent, a protected graft copolymer (PGC) that is covalently linked to gadolinium–diethylenetriaminepentaacetic acid with fluorescein isothiocyanate (Gd-DTPA-F), which accumulates in the sites of inflammation that are characterized by vascular disruption. Materials and Methods: All animal experiments were performed in compliance with institutional guidelines and approved by the subcommittee on research animal care. Six nonobese diabetic severe combined immunodeficiency mice received transplanted human islet cells under the kidney capsule and adoptively transferred 5 × 106 splenocytes from 6-week-old nonobese diabetic mice. These mice also served as control subjects for comparison of pre- and postadoptive transfer MR imaging results. Mice that received phosphate-buffered saline solution only were included as nonadoptive-transfer control subjects (n = 2). In vivo magnetic resonance (MR) imaging was performed before and 17 hours after intravenous injections of PGC-Gd-DTPA-F, followed by histologic examination. Statistical differences were analyzed by means of a paired Student t test and repeated two-way analysis of variance. Results: MR imaging results showed significantly greater accumulation of PGC-Gd-DTPA-F in the graft area after immune attack initiated by adoptive transfer of splenocytes compared with that of the same area before the transfer (T1, 137.2 msec ± 39.3 and 239.5 msec ± 17.6, respectively; P < .001). These results were confirmed at histologic examination, which showed considerable leakage of the contrast agent into the islet cell interstitium. Conclusion: PGC-Gd-DTPA-F–enhanced MR imaging allows for the in vivo assessment of vascular damage of the graft T cell challenge. © RSNA, 2012 Supplemental material: http://radiology.rsna.org/lookup/suppl/doi:10.1148/radiol.12121129/-/DC1 PMID:23264346

  15. Novel analysis of 4DCT imaging quantifies progressive increases in anatomic dead space during mechanical ventilation in mice.

    PubMed

    Kim, Elizabeth H; Preissner, Melissa; Carnibella, Richard P; Samarage, Chaminda R; Bennett, Ellen; Diniz, Marcio A; Fouras, Andreas; Zosky, Graeme R; Jones, Heather D

    2017-09-01

    Increased dead space is an important prognostic marker in early acute respiratory distress syndrome (ARDS) that correlates with mortality. The cause of increased dead space in ARDS has largely been attributed to increased alveolar dead space due to ventilation/perfusion mismatching and shunt. We sought to determine whether anatomic dead space also increases in response to mechanical ventilation. Mice received intratracheal lipopolysaccharide (LPS) or saline and mechanical ventilation (MV). Four-dimensional computed tomography (4DCT) scans were performed at onset of MV and after 5 h of MV. Detailed measurements of airway volumes and lung tidal volumes were performed using image analysis software. The forced oscillation technique was used to obtain measures of airway resistance, tissue damping, and tissue elastance. The ratio of airway volumes to total tidal volume increased significantly in response to 5 h of mechanical ventilation, regardless of LPS exposure, and airways demonstrated significant variation in volumes over the respiratory cycle. These findings were associated with an increase in tissue elastance (decreased lung compliance) but without changes in tidal volumes. Airway volumes increased over time with exposure to mechanical ventilation without a concomitant increase in tidal volumes. These findings suggest that anatomic dead space fraction increases progressively with exposure to positive pressure ventilation and may represent a pathological process. NEW & NOTEWORTHY We demonstrate that anatomic dead space ventilation increases significantly over time in mice in response to mechanical ventilation. The novel functional lung-imaging techniques applied here yield sensitive measures of airway volumes that may have wide applications. Copyright © 2017 the American Physiological Society.

  16. Fundus Autofluorescence and Photoreceptor Cell Rosettes in Mouse Models

    PubMed Central

    Flynn, Erin; Ueda, Keiko; Auran, Emily; Sullivan, Jack M.; Sparrow, Janet R.

    2014-01-01

    Purpose. This study was conducted to study correlations among fundus autofluorescence (AF), RPE lipofuscin accumulation, and photoreceptor cell degeneration and to investigate the structural basis of fundus AF spots. Methods. Fundus AF images (55° lens; 488-nm excitation) and spectral-domain optical coherence tomography (SD-OCT) scans were acquired in pigmented Rdh8−/−/Abca4−/− mice (ages 1–9 months) with a confocal scanning laser ophthalmoscope (cSLO). For quantitative fundus AF (qAF), gray levels (GLs) were calibrated to an internal fluorescence reference. Retinal bisretinoids were measured by quantitative HPLC. Histometric analysis of outer nuclear layer (ONL) thicknesses was performed, and cryostat sections of retina were examined by fluorescence microscopy. Results. Quantified A2E and qAF intensities increased until age 4 months in the Rdh8−/−/Abca4−/− mice. The A2E levels declined after 4 months of age, but qAF intensity values continued to rise. The decline in A2E levels in the Rdh8−/−/Abca4−/− mice paralleled reduced photoreceptor cell viability as reflected in ONL thinning. Hyperautofluorescent puncta in fundus AF images corresponded to photoreceptor cell rosettes in SD-OCT images and histological sections stained with hematoxylin and eosin. The inner segment/outer segment–containing core of the rosette emitted an autofluorescence detected by fluorescence microscopy. Conclusions. When neural retina is disordered, AF from photoreceptor cells can contribute to noninvasive fundus AF images. Hyperautofluorescent puncta in fundus AF images are attributable, in at least some cases, to photoreceptor cell rosettes. PMID:25015357

  17. Perylene-diimide-based nanoparticles as highly efficient photoacoustic agents for deep brain tumor imaging in living mice

    DOE PAGES

    Fan, Quli; Cheng, Kai; Yang, Zhen; ...

    2014-11-06

    In order to promote preclinical and clinical applications of photoacoustic imaging, novel photoacoustic contrast agents are highly desired for molecular imaging of diseases, especially for deep tumor imaging. In this paper, perylene-3,4,9,10-tetracarboxylic diiimide-based near-infrared-absorptive organic nanoparticles are reported as an efficient agent for photoacoustic imaging of deep brain tumors in living mice with enhanced permeability and retention effect

  18. Radiolabelled polymeric IgA: from biodistribution to a new molecular imaging tool in colorectal cancer lung metastases

    PubMed Central

    Carpenet, Helene; Cuvillier, Armelle; Perraud, Aurélie; Martin, Ophélie; Champier, Gaël; Jauberteau, Marie-Odile; Monteil, Jacques; Quelven, Isabelle

    2017-01-01

    By radiolabelling monomeric (m) and polymeric (p) IgA with technetium 99m (99mTc), this study assessed IgA biodistribution and tumour-targeting potency. IgA directed against carcinoembryonic antigen (CEA), a colorectal cancer marker, was selected to involve IgA mucosal tropism. Ig was radiolabelled with 99mTc-tricarbonyl after derivatisation by 2-iminothiolane. 99mTc-IgA was evaluated by in vitro analysis. The biodistributions of radiolabelled anti-CEA mIgA, pIgA and IgG were compared in normal mice. Anti-CEA pIgA tumour uptake was studied in mice bearing the WiDr caecal orthotopic graft. IgA radiolabelling was obtained with a high yield, was stable in PBS and murine plasma, and did not alter IgA binding functionality (Kd ≈ 25 nM). Biodistribution studies in normal mice confirmed that radiolabelled pIgA – and to a lesser extent, mIgA – showed strong and fast mucosal tropism and a shorter serum half-life than IgG. In caecal tumour model mice, evaluation of the anti-CEA-pIgA biodistribution showed a high uptake in lung metastases, confirmed by histological analysis. However, no radioactivity uptake increase in the tumoural caecum was discerned from normal intestinal tissue, probably due to high IgA caecal natural tropism. In microSPECT/CT imaging, 99mTc-IgA confirmed its diagnostic potency of tumour in mucosal tissue, even if detection threshold by in vivo imaging was higher than post mortem studies. Contribution of the FcαRI receptor, studied with transgenic mouse model (Tsg SCID-CD89), did not appear to be determinant in 99mTc-IgA uptake. Pre-clinical experiments highlighted significant differences between 99mTc-IgA and 99mTc-IgG biodistributions. Furthermore, tumoural model studies suggested potential targeting potency of pIgA in mucosal tissues. PMID:29156712

  19. Measuring the effect of a Western diet on liver tissue architecture by FLIM autofluorescence and harmonic generation microscopy

    PubMed Central

    Ranjit, Suman; Dvornikov, Alexander; Dobrinskikh, Evgenia; Wang, Xiaoxin; Luo, Yuhuan; Levi, Moshe; Gratton, Enrico

    2017-01-01

    The phasor approach to auto-fluorescence lifetime imaging was used to identify and characterize a long lifetime species (LLS) (~7.8 ns) in livers of mice fed with a Western diet. The size of the areas containing this LLS species depends on the type of diet and the size distribution shows Western diet has much larger LLS sizes. Combination of third harmonic generation images with FLIM identified the LLS species with fat droplets and the droplet size distribution was estimated. Second harmonic generation microscopy combined with phasor FLIM shows that there is an increase in fibrosis with a Western diet. A new decomposition in three components of the phasor plot shows that a Western diet is correlated with a higher fraction of free NADH, signifying more reducing condition and more glycolytic condition. Multiparametric analysis of phasor distribution shows that from the distribution of phasor points, a Western diet fed versus a low fat diet fed samples of mice livers can be separated. The phasor approach for the analysis of FLIM images of autofluorescence in liver specimens can result in discovery of new fluorescent species and then these new fluorescent species can help assess tissue architecture. Finally integrating FLIM and second and third harmonic analysis provides a measure of the advancement of fibrosis as an effect of diet. PMID:28717559

  20. Analysis of Stroma Labeling During Multiple Passage of a Sarcoma Imageable Patient-Derived Orthotopic Xenograft (iPDOX) in Red Fluorescent Protein Transgenic Nude Mice.

    PubMed

    Kiyuna, Tasuku; Murakami, Takashi; Tome, Yasunori; Kawaguchi, Kei; Igarashi, Kentaro; Miyake, Kentaro; Kanaya, Fuminori; Singh, Arun; Eilber, Fritz C; Hoffman, Robert M

    2017-10-01

    A patient-derived orthotopic xenograft (PDOX) model of undifferentiated pleomorphic sarcoma (UPS) was previously established that acquired red fluorescent protein (RFP)-expressing stroma by growth in an RFP transgenic nude mouse. In the present study, an imageable PDOX model (iPDOX) of UPS was established by orthotopic implantation in the biceps femoris of transgenic RFP nude mice. After the tumors grew to a diameter of 10 mm, they were harvested and the brightest portion of the tumors were subsequently orthotopically transplanted to both RFP and non-colored nude mice. The UPS PDOX tumor was again transplanted to RFP transgenic and non-colored nude mice, and finally a 3rd passage was made in the same manner. Five UPS tumors from each passage in both RFP and non-colored mouse models were harvested. The FV1,000 confocal microscope was used to visualize and quantitate the RFP area of the resected tumors. The average percent fluorescent area in the first passage of RFP mice was 34 ± 22%; in the second passage, 34 ± 20%; and 36 ± 11% in the third passage of RFP transgenic nude mice. The average tumor RFP area in the first passage from RFP mice to non-colored mice was 20 ± 7%; in the second passage, 28 ± 11%; in the third passage was 27 ± 13%. The present results demonstrate the extensive and stable acquisition of stroma by the UPS-tumor growing orthotopically in transgenic RFP nude mice (iPDOX). This model can be used for screening for effective drugs for individual patients and drug discovery. J. Cell. Biochem. 118: 3367-3371, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. 3D morphological analysis of the mouse cerebral vasculature: Comparison of in vivo and ex vivo methods

    PubMed Central

    Steinman, Joe; Koletar, Margaret M.; Stefanovic, Bojana; Sled, John G.

    2017-01-01

    Ex vivo 2-photon fluorescence microscopy (2PFM) with optical clearing enables vascular imaging deep into tissue. However, optical clearing may also produce spherical aberrations if the objective lens is not index-matched to the clearing material, while the perfusion, clearing, and fixation procedure may alter vascular morphology. We compared in vivo and ex vivo 2PFM in mice, focusing on apparent differences in microvascular signal and morphology. Following in vivo imaging, the mice (four total) were perfused with a fluorescent gel and their brains fructose-cleared. The brain regions imaged in vivo were imaged ex vivo. Vessels were segmented in both images using an automated tracing algorithm that accounts for the spatially varying PSF in the ex vivo images. This spatial variance is induced by spherical aberrations caused by imaging fructose-cleared tissue with a water-immersion objective. Alignment of the ex vivo image to the in vivo image through a non-linear warping algorithm enabled comparison of apparent vessel diameter, as well as differences in signal. Shrinkage varied as a function of diameter, with capillaries rendered smaller ex vivo by 13%, while penetrating vessels shrunk by 34%. The pial vasculature attenuated in vivo microvascular signal by 40% 300 μm below the tissue surface, but this effect was absent ex vivo. On the whole, ex vivo imaging was found to be valuable for studying deep cortical vasculature. PMID:29053753

  2. Multimodal detection of GM2 and GM3 lipid species in the brain of mucopolysaccharidosis type II mouse by serial imaging mass spectrometry and immunohistochemistry.

    PubMed

    Dufresne, Martin; Guneysu, Daniel; Patterson, Nathan Heath; Marcinkiewicz, Mieczyslaw Martin; Regina, Anthony; Demeule, Michel; Chaurand, Pierre

    2017-02-01

    Mucopolysaccharidosis type II (Hunter's disease) mouse model (IdS-KO) was investigated by both imaging mass spectrometry (IMS) and immunohistochemistry (IHC) performed on the same tissue sections. For this purpose, IdS-KO mice brain sections were coated with sublimated 1,5-diaminonaphtalene and analyzed by high spatial resolution IMS (5 μm) and anti-GM3 IHC on the same tissue sections to characterize the ganglioside monosialated ganglioside (GM) deposits found in Hunter's disease. IMS analysis have found that two species of GM3 and GM2 that are only different due to the length of their fatty acid residue (stearic or arachidic residue) were overexpressed in the IdS-KO mice compared to a control mouse. GM3 and GM2 were characterized by on-tissue exact mass and MS/MS compared to a GM3 standard. Realignment of both IMS and IHC data sets further confirmed the observed regioselective signal previously detected by providing direct correlation of the IMS image for the two GM3 overly expressed MS signals with the anti-GM3 IHC image. Furthermore, these regioselective GM MS signals were also found to have highly heterogeneous distributions within the GM3-IHC staining. Some deposits showed high content in GM3 and GM2 stearic species (r = 0.74) and others had more abundant GM3 and GM2 arachidic species (r = 0.76). Same-section analysis of Hunter's disease mouse model by both high spatial resolution IMS and IHC provides a more in-depth analysis of the composition of the GM aggregates while providing spatial distribution of the observed molecular species. Graphical Abstract Ganglioside imaging mass spectrometry followed by immunohistochemistry performed on the same tissue section.

  3. Recovery of the sub-basal nerve plexus and superficial nerve terminals after corneal epithelial injury in mice.

    PubMed

    Downie, Laura E; Naranjo Golborne, Cecilia; Chen, Merry; Ho, Ngoc; Hoac, Cam; Liyanapathirana, Dasun; Luo, Carol; Wu, Ruo Bing; Chinnery, Holly R

    2018-06-01

    Our aim was to compare regeneration of the sub-basal nerve plexus (SBNP) and superficial nerve terminals (SNT) following corneal epithelial injury. We also sought to compare agreement when quantifying nerve parameters using different image analysis techniques. Anesthetized, female C57BL/6 mice received central 1-mm corneal epithelial abrasions. Four-weeks post-injury, eyes were enucleated and processed for PGP9.5 to visualize the corneal nerves using wholemount immunofluorescence staining and confocal microscopy. The percentage area of the SBNP and SNT were quantified using: ImageJ automated thresholds, ImageJ manual thresholds and manual tracings in NeuronJ. Nerve sum length was quantified using NeuronJ and Imaris. Agreement between methods was considered with Bland-Altman analyses. Four-weeks post-injury, the sum length of nerve fibers in the SBNP, but not the SNT, was reduced compared with naïve eyes. In the periphery, but not central cornea, of both naïve and injured eyes, nerve fiber lengths in the SBNP and SNT were strongly correlated. For quantifying SBNP nerve axon area, all image analysis methods were highly correlated. In the SNT, there was poor correlation between manual methods and auto-thresholding, with a trend towards underestimating nerve fiber area using auto-thresholding when higher proportions of nerve fibers were present. In conclusion, four weeks after superficial corneal injury, there is differential recovery of epithelial nerve axons; SBNP sum length is reduced, however the sum length of SNTs is similar to naïve eyes. Care should be taken when selecting image analysis methods to compare nerve parameters in different depths of the corneal epithelium due to differences in background autofluorescence. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Reversal of the hair loss phenotype by modulating the estradiol-ANGPT2 axis in the mouse model of female pattern hair loss.

    PubMed

    Endo, Yujiro; Obayashi, Yuko; Ono, Tomoji; Serizawa, Tetsushi; Murakoshi, Michiaki; Ohyama, Manabu

    2018-07-01

    Despite high demand for a remedy, the treatment options for female pattern hair loss (FPHL) are limited. FPHL is frequent in postmenopausal women. In ovariectomized (OVX) mice, which lack β-estradiol (E2) and manifest hair loss mimicking FPHL, E2 supplementation has been shown to increase hair density. However, the mechanism by which E2 exhibits its biological activity remains elusive. To identify the downstream targets of E2 in the context of FPHL pathophysiology and discover a potential therapeutic agent for the E2-dependent subtype of FPHL. Human dermal papilla cells (hDPCs) were cultured with E2, and a microarray analysis was performed to identify the genes regulated by E2. Using OVX mice, the identified gene product was intradermally administered and then quantitative image analysis of hair density was conducted. In silico analysis to link E2 and the identified gene was performed. Global gene expression and bioinformatics analyses revealed that the genes associated with the angiopoietin-2 (ANGPT2) pathway were upregulated by E2 in hDPCs. ANGPT2 was significantly downregulated in OVX mice than in sham-operated mice (P < 0.01). Importantly, hair density was higher in OVX mice treated with ANGPT2 than in control mice (P < 0.05). In silico analysis showed DNA sequences with high possibility of estrogen receptor binding in the promoter region of ANGPT2. The E2-ANGPT2 axis is present in hair follicles. ANGPT2 provides a strategy for the management of E2-dependent and postmenopausal subsets of FPHL. Copyright © 2018 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  5. Theranostic nanoparticles carrying doxorubicin attenuate targeting ligand specific antibody responses following systemic delivery.

    PubMed

    Yang, Emmy; Qian, Weiping; Cao, Zehong; Wang, Liya; Bozeman, Erica N; Ward, Christina; Yang, Bin; Selvaraj, Periasamy; Lipowska, Malgorzata; Wang, Y Andrew; Mao, Hui; Yang, Lily

    2015-01-01

    Understanding the effects of immune responses on targeted delivery of nanoparticles is important for clinical translations of new cancer imaging and therapeutic nanoparticles. In this study, we found that repeated administrations of magnetic iron oxide nanoparticles (IONPs) conjugated with mouse or human derived targeting ligands induced high levels of ligand specific antibody responses in normal and tumor bearing mice while injections of unconjugated mouse ligands were weakly immunogenic and induced a very low level of antibody response in mice. Mice that received intravenous injections of targeted and polyethylene glycol (PEG)-coated IONPs further increased the ligand specific antibody production due to differential uptake of PEG-coated nanoparticles by macrophages and dendritic cells. However, the production of ligand specific antibodies was markedly inhibited following systemic delivery of theranostic nanoparticles carrying a chemotherapy drug, doxorubicin. Targeted imaging and histological analysis revealed that lack of the ligand specific antibodies led to an increase in intratumoral delivery of targeted nanoparticles. Results of this study support the potential of further development of targeted theranostic nanoparticles for the treatment of human cancers.

  6. Synthesis and characterization of theranostic poly(HPMA)-c(RGDyK)-DOTA-64Cu copolymer targeting tumor angiogenesis: tumor localization visualized by positron emission tomography.

    PubMed

    Yuan, Jianchao; Zhang, Haiyuan; Kaur, Harpreet; Oupicky, David; Peng, Fangyu

    2013-05-01

    Poly(HPMA)-c(RGDyK)-DOTA-64Cu copolymers were synthesized and characterized for tumor localization in vivo as a theranostic scaffold for cancer imaging and anticancer drug delivery targeting tumor angiogenesis. Tumor localization of the poly(HPMA)-c(RGDyK)-DOTA-64Cu copolymers was visualized in mice bearing human prostate cancer xenografts by positron emission tomography (PET) using a microPET scanner. PET quantitative analysis demonstrated that tumor 64Cu radioactivity (2.75 ± 0.34 %ID/g) in tumor-bearing mice 3 hours following intravenous injection of the poly(HPMA)-c(RGDyK)-DOTA-64Cu copolymers was significantly higher than the tumor 64Cu radioactivity (1.29 ± 0.26 %ID/g) in tumor-bearing mice injected with the nontargeted poly(HPMA)-DOTA-64Cu copolymers (p = .004). The poly(HPMA)-c(RGDyK)-DOTA-64Cu copolymers hold potential as a theranostic scaffold for cancer imaging and radiochemotherapy of prostate cancer targeting tumor angiogenesis by noninvasive tracking with PET.

  7. Association between sociability and diffusion tensor imaging in BALB/cJ mice.

    PubMed

    Kim, Sungheon; Pickup, Stephen; Fairless, Andrew H; Ittyerah, Ranjit; Dow, Holly C; Abel, Ted; Brodkin, Edward S; Poptani, Harish

    2012-01-01

    The purpose of this study was to use high-resolution diffusion tensor imaging (DTI) to investigate the association between DTI metrics and sociability in BALB/c inbred mice. The sociability of prepubescent (30-day-old) BALB/cJ mice was operationally defined as the time that the mice spent sniffing a stimulus mouse in a social choice test. High-resolution ex vivo DTI data on 12 BALB/cJ mouse brains were acquired using a 9.4-T vertical-bore magnet. Regression analysis was conducted to investigate the association between DTI metrics and sociability. Significant positive regression (p < 0.001) between social sniffing time and fractional anisotropy was found in 10 regions located in the thalamic nuclei, zona incerta/substantia nigra, visual/orbital/somatosensory cortices and entorhinal cortex. In addition, significant negative regression (p < 0.001) between social sniffing time and mean diffusivity was found in five areas located in the sensory cortex, motor cortex, external capsule and amygdaloid region. In all regions showing significant regression with either the mean diffusivity or fractional anisotropy, the tertiary eigenvalue correlated negatively with the social sniffing time. This study demonstrates the feasibility of using DTI to detect brain regions associated with sociability in a mouse model system. Copyright © 2011 John Wiley & Sons, Ltd.

  8. Targeted photodynamic therapy for infected wounds in mice

    NASA Astrophysics Data System (ADS)

    Hamblin, Michael R.; O'Donnell, David A.; Zahra, Touqir; Contag, Christopher H.; McManus, Albert T.; Hasan, Tayyaba

    2002-06-01

    Although many workers have used photodynamic therapy to kill bacteria in vitro, the use of this approach has seldom been reported in vivo in animal models of infection. We report on the use of a targeted polycationic photosensitizer conjugate between poly-L-lysine and chlorin(e6) that can penetrate the Gram (-) outer membrane together with red laser light to kill Escherichia coli and Pseudomonas aeruginosa infecting excisional wounds in mice. We used genetically engineered luminescent bacteria that allowed the infection to be imaged in mouse wounds using a sensitive CCD camera. Wounds were infected with 5x106 bacteria, followed by application of the conjugate in solution and illumination. There was a light-dose dependent loss of luminescence as measured by image analysis in the wound treated with conjugate and light, not seen in control wounds. This strain of E coli is non-invasive and the infection in untreated wounds spontaneously resolved in a few days and all wounds healed equally well showing the photodynamic treatment did not damage the host tissue. P aeruginosa is highly invasive and mice with untreated or control wounds all died while 90% of PDT treated mice survived. PDT may have a role to play in the rapid treatment of infected wounds in view of the worldwide rise in antibiotic resistance.

  9. Searching for biomarkers of CDKL5 disorder: early-onset visual impairment in CDKL5 mutant mice

    PubMed Central

    Mazziotti, Raffaele; Lupori, Leonardo; Sagona, Giulia; Gennaro, Mariangela; Della Sala, Grazia; Putignano, Elena

    2017-01-01

    Abstract CDKL5 disorder is a neurodevelopmental disorder still without a cure. Murine models of CDKL5 disorder have been recently generated raising the possibility of preclinical testing of treatments. However, unbiased, quantitative biomarkers of high translational value to monitor brain function are still missing. Moreover, the analysis of treatment is hindered by the challenge of repeatedly and non-invasively testing neuronal function. We analyzed the development of visual responses in a mouse model of CDKL5 disorder to introduce visually evoked responses as a quantitative method to assess cortical circuit function. Cortical visual responses were assessed in CDKL5 null male mice, heterozygous females, and their respective control wild-type littermates by repeated transcranial optical imaging from P27 until P32. No difference between wild-type and mutant mice was present at P25-P26 whereas defective responses appeared from P27-P28 both in heterozygous and homozygous CDKL5 mutant mice. These results were confirmed by visually evoked potentials (VEPs) recorded from the visual cortex of a different cohort. The previously imaged mice were also analyzed at P60–80 using VEPs, revealing a persistent reduction of response amplitude, reduced visual acuity and defective contrast function. The level of adult impairment was significantly correlated with the reduction in visual responses observed during development. Support vector machine showed that multi-dimensional visual assessment can be used to automatically classify mutant and wt mice with high reliability. Thus, monitoring visual responses represents a promising biomarker for preclinical and clinical studies on CDKL5 disorder. PMID:28369421

  10. Quantitative intravital two-photon excitation microscopy reveals absence of pulmonary vaso-occlusion in unchallenged Sickle Cell Disease mice

    PubMed Central

    Bennewitz, Margaret F; Watkins, Simon C; Sundd, Prithu

    2014-01-01

    Sickle cell disease (SCD) is a genetic disorder that leads to red blood cell (RBC) sickling, hemolysis and the upregulation of adhesion molecules on sickle RBCs. Chronic hemolysis in SCD results in a hyper-inflammatory state characterized by activation of circulating leukocytes, platelets and endothelial cells even in the absence of a crisis. A crisis in SCD is often triggered by an inflammatory stimulus and can lead to the acute chest syndrome (ACS), which is a type of lung injury and a leading cause of mortality among SCD patients. Although it is believed that pulmonary vaso-occlusion could be the phenomenon contributing to the development of ACS, the role of vaso-occlusion in ACS remains elusive. Intravital imaging of the cremaster microcirculation in SCD mice has been instrumental in establishing the role of neutrophil-RBC-endothelium interactions in systemic vaso-occlusion; however, such studies, although warranted, have never been done in the pulmonary microcirculation of SCD mice. Here, we show that two-photon excitation fluorescence microscopy can be used to perform quantitative analysis of neutrophil and RBC trafficking in the pulmonary microcirculation of SCD mice. We provide the experimental approach that enables microscopic observations under physiological conditions and use it to show that RBC and neutrophil trafficking is comparable in SCD and control mice in the absence of an inflammatory stimulus. The intravital imaging scheme proposed in this study can be useful in elucidating the cellular and molecular mechanism of pulmonary vaso-occlusion in SCD mice following an inflammatory stimulus. PMID:25995970

  11. High-throughput automated home-cage mesoscopic functional imaging of mouse cortex

    PubMed Central

    Murphy, Timothy H.; Boyd, Jamie D.; Bolaños, Federico; Vanni, Matthieu P.; Silasi, Gergely; Haupt, Dirk; LeDue, Jeff M.

    2016-01-01

    Mouse head-fixed behaviour coupled with functional imaging has become a powerful technique in rodent systems neuroscience. However, training mice can be time consuming and is potentially stressful for animals. Here we report a fully automated, open source, self-initiated head-fixation system for mesoscopic functional imaging in mice. The system supports five mice at a time and requires minimal investigator intervention. Using genetically encoded calcium indicator transgenic mice, we longitudinally monitor cortical functional connectivity up to 24 h per day in >7,000 self-initiated and unsupervised imaging sessions up to 90 days. The procedure provides robust assessment of functional cortical maps on the basis of both spontaneous activity and brief sensory stimuli such as light flashes. The approach is scalable to a number of remotely controlled cages that can be assessed within the controlled conditions of dedicated animal facilities. We anticipate that home-cage brain imaging will permit flexible and chronic assessment of mesoscale cortical function. PMID:27291514

  12. Nuclear microscopy of diffuse plaques in the brains of transgenic mice

    NASA Astrophysics Data System (ADS)

    Rajendran, Reshmi; Ren, Minqin; Casadesus, Gemma; Smith, Mark A.; Perry, George; Huang, En; Ong, Wei Yi; Halliwell, Barry; Watt, Frank

    2005-04-01

    Using nuclear microscopy, extracellular diffuse amyloid deposits in fresh unstained brain tissue from Alzheimer's disease transgenic mice Tg2576 have been identified and analyzed for trace element content. Off-axis scanning transmission ion microscopy (STIM) images can be obtained which are similar to the images produced using direct STIM. Since the proton beam current required for off-axis STIM is compatible with PIXE and RBS, we can identify the plaque location and analyze for trace elements simultaneously. Analysis of the diffuse plaques showed an increase in the transition metals iron and zinc compared with the surrounding area of comparable areal density. This supports the theory that redox interactions between Aβ and metals could be at the heart of a pathological feedback system wherein Aβ amyloidosis and oxidative stress promote each other, possibly via Fenton chemistry.

  13. High-sensitivity detection of breast tumors in vivo by use of a pH-sensitive near-infrared fluorescence probe

    NASA Astrophysics Data System (ADS)

    Mathejczyk, Julia Eva; Pauli, Jutta; Dullin, Christian; Resch-Genger, Ute; Alves, Frauke; Napp, Joanna

    2012-07-01

    We investigated the potential of the pH-sensitive dye, CypHer5E, conjugated to Herceptin (pH-Her) for the sensitive detection of breast tumors in mice using noninvasive time-domain near-infrared fluorescence imaging and different methods of data analysis. First, the fluorescence properties of pH-Her were analyzed as function of pH and/or dye-to-protein ratio, and binding specificity was confirmed in cell-based assays. Subsequently, the performance of pH-Her in nude mice bearing orthotopic HER2-positive (KPL-4) and HER2-negative (MDA-MB-231) breast carcinoma xenografts was compared to that of an always-on fluorescent conjugate Alexa Fluor 647-Herceptin (Alexa-Her). Subtraction of autofluorescence and lifetime (LT)-gated image analyses were performed for background fluorescence suppression. In mice bearing HER2-positive tumors, autofluorescence subtraction together with the selective fluorescence enhancement of pH-Her solely in the tumor's acidic environment provided high contrast-to-noise ratios (CNRs). This led to an improved sensitivity of tumor detection compared to Alexa-Her. In contrast, LT-gated imaging using LTs determined in model systems did not improve tumor-detection sensitivity in vivo for either probe. In conclusion, pH-Her is suitable for sensitive in vivo monitoring of HER2-expressing breast tumors with imaging in the intensity domain and represents a promising tool for detection of weak fluorescent signals deriving from small tumors or metastases.

  14. Longitudinal study of arteriogenesis with swept source optical coherence tomography and hyperspectral imaging

    NASA Astrophysics Data System (ADS)

    Poole, Kristin M.; Patil, Chetan A.; Nelson, Christopher E.; McCormack, Devin R.; Madonna, Megan C.; Duvall, Craig L.; Skala, Melissa C.

    2014-03-01

    Peripheral arterial disease (PAD) is an atherosclerotic disease of the extremities that leads to high rates of myocardial infarction and stroke, increased mortality, and reduced quality of life. PAD is especially prevalent in diabetic patients, and is commonly modeled by hind limb ischemia in mice to study collateral vessel development and test novel therapies. Current techniques used to assess recovery cannot obtain quantitative, physiological data non-invasively. Here, we have applied hyperspectral imaging and swept source optical coherence tomography (OCT) to study longitudinal changes in blood oxygenation and vascular morphology, respectively, intravitally in the diabetic mouse hind limb ischemia model. Additionally, recommended ranges for controlling physiological variability in blood oxygenation with respect to respiration rate and body core temperature were determined from a control animal experiment. In the longitudinal study with diabetic mice, hyperspectral imaging data revealed the dynamics of blood oxygenation recovery distally in the ischemic footpad. In diabetic mice, there is an early increase in oxygenation that is not sustained in the long term. Quantitative analysis of vascular morphology obtained from Hessian-filtered speckle variance OCT volumes revealed temporal dynamics in vascular density, total vessel length, and vessel diameter distribution in the adductor muscle of the ischemic limb. The combination of hyperspectral imaging and speckle variance OCT enabled acquisition of novel functional and morphological endpoints from individual animals, and provides a more robust platform for future preclinical evaluations of novel therapies for PAD.

  15. Spectral unmixing of multi-color tissue specific in vivo fluorescence in mice

    NASA Astrophysics Data System (ADS)

    Zacharakis, Giannis; Favicchio, Rosy; Garofalakis, Anikitos; Psycharakis, Stylianos; Mamalaki, Clio; Ripoll, Jorge

    2007-07-01

    Fluorescence Molecular Tomography (FMT) has emerged as a powerful tool for monitoring biological functions in vivo in small animals. It provides the means to determine volumetric images of fluorescent protein concentration by applying the principles of diffuse optical tomography. Using different probes tagged to different proteins or cells, different biological functions and pathways can be simultaneously imaged in the same subject. In this work we present a spectral unmixing algorithm capable of separating signal from different probes when combined with the tomographic imaging modality. We show results of two-color imaging when the algorithm is applied to separate fluorescence activity originating from phantoms containing two different fluorophores, namely CFSE and SNARF, with well separated emission spectra, as well as Dsred- and GFP-fused cells in F5-b10 transgenic mice in vivo. The same algorithm can furthermore be applied to tissue-specific spectroscopy data. Spectral analysis of a variety of organs from control, DsRed and GFP F5/B10 transgenic mice showed that fluorophore detection by optical systems is highly tissue-dependent. Spectral data collected from different organs can provide useful insight into experimental parameter optimisation (choice of filters, fluorophores, excitation wavelengths) and spectral unmixing can be applied to measure the tissue-dependency, thereby taking into account localized fluorophore efficiency. Summed up, tissue spectral unmixing can be used as criteria in choosing the most appropriate tissue targets as well as fluorescent markers for specific applications.

  16. Fluence compensated photoacoustic tomography in small animals (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Hussain, Altaf; Pool, Martin; Daoudi, Khalid; de Vries, Liesbeth G.; Steenbergen, Wiendelt

    2017-03-01

    Light fluence inside turbid media can be experimentally mapped by measuring ultrasonically modulated light (Acousto-optics). To demonstrate the feasibility of fluence corrected Photoacoustic (PA) imaging, we have realized a tri-modality (i.e. photoacoustic, acousto-optic and ultrasound) tomographic small animal imaging system. Wherein PA imaging provides high resolution map of absorbed optical energy density, Acousto-optics yields the fluence distribution map in the corresponding PA imaging plane and Ultrasound provides morphological information. Further, normalization of the PA image with the acousto-optically measured fluence map results in an image that directly represents the optical absorption. Human epidermal growth factor receptor 2 (HER2) is commonly found overexpressed in human cancers, among which breast cancers, resulting in a more aggressive tumor phenotype. Identification of HER2-expression is clinically relevant, because cancers overexpressing this marker are amenable to HER2-directed therapies, among which antibodies trastuzumab and pertuzumab. Here, we investigate the feasibility and advantage of acousto-optically assisted fluence compensated PA imaging over PA imaging alone in visualizing and quantifying HER2 expression. For this experiment, nude mice were xenografted with human breast cancer cell lines SKBR3 and BT474 (both HER2 overexpressing), as well as HER2-negative MDA-MB-231. To visualize HER2 expression in these mice, HER2 monoclonal antibody pertuzumab (Perjeta®, Roche), was conjugated to near-infrared dye IRDye 800CW (800CW, LICOR Biosciences) at a ratio of 1∶2 antibody to 800CW. When xenograft tumors measured ≥ 100 mm3, mice received 100 µg 800CW-pertuzumab intravenously. Three days post injection, mice were scanned for fluorescence signal with an IVIS scanner. After fluorescence scans, mice were euthanized and imaged in our PA tomographic imaging system.

  17. Construction and evaluation of quantitative small-animal PET probabilistic atlases for [¹⁸F]FDG and [¹⁸F]FECT functional mapping of the mouse brain.

    PubMed

    Casteels, Cindy; Vunckx, Kathleen; Aelvoet, Sarah-Ann; Baekelandt, Veerle; Bormans, Guy; Van Laere, Koen; Koole, Michel

    2013-01-01

    Automated voxel-based or pre-defined volume-of-interest (VOI) analysis of small-animal PET data in mice is necessary for optimal information usage as the number of available resolution elements is limited. We have mapped metabolic ([(18)F]FDG) and dopamine transporter ([(18)F]FECT) small-animal PET data onto a 3D Magnetic Resonance Microscopy (MRM) mouse brain template and aligned them in space to the Paxinos co-ordinate system. In this way, ligand-specific templates for sensitive analysis and accurate anatomical localization were created. Next, using a pre-defined VOI approach, test-retest and intersubject variability of various quantification methods were evaluated. Also, the feasibility of mouse brain statistical parametric mapping (SPM) was explored for [(18)F]FDG and [(18)F]FECT imaging of 6-hydroxydopamine-lesioned (6-OHDA) mice. Twenty-three adult C57BL6 mice were scanned with [(18)F]FDG and [(18)F]FECT. Registrations and affine spatial normalizations were performed using SPM8. [(18)F]FDG data were quantified using (1) an image-derived-input function obtained from the liver (cMRglc), using (2) standardized uptake values (SUVglc) corrected for blood glucose levels and by (3) normalizing counts to the whole-brain uptake. Parametric [(18)F]FECT binding images were constructed by reference to the cerebellum. Registration accuracy was determined using random simulated misalignments and vectorial mismatch determination. Registration accuracy was between 0.21-1.11 mm. Regional intersubject variabilities of cMRglc ranged from 15.4% to 19.2%, while test-retest values were between 5.0% and 13.0%. For [(18)F]FECT uptake in the caudate-putamen, these values were 13.0% and 10.3%, respectively. Regional values of cMRglc positively correlated to SUVglc measured within the 45-60 min time frame (spearman r = 0.71). Next, SPM analysis of 6-OHDA-lesioned mice showed hypometabolism in the bilateral caudate-putamen and cerebellum, and an unilateral striatal decrease in DAT availability. MRM-based small-animal PET templates facilitate accurate assessment and spatial localization of mouse brain function using VOI or voxel-based analysis. Regional intersubject- and test-retest variations indicate that for these targets accuracy comparable to humans can be achieved.

  18. Noninvasive Imaging of Retinal Morphology and Microvasculature in Obese Mice Using Optical Coherence Tomography and Optical Microangiography

    PubMed Central

    Zhi, Zhongwei; Chao, Jennifer R.; Wietecha, Tomasz; Hudkins, Kelly L.; Alpers, Charles E.; Wang, Ruikang K.

    2014-01-01

    Purpose. To evaluate early diabetes-induced changes in retinal thickness and microvasculature in a type 2 diabetic mouse model by using optical coherence tomography (OCT)/optical microangiography (OMAG). Methods. Twenty-two-week-old obese (OB) BTBR mice (n = 10) and wild-type (WT) control mice (n = 10) were imaged. Three-dimensional (3D) data volumes were captured with spectral domain OCT using an ultrahigh-sensitive OMAG scanning protocol for 3D volumetric angiography of the retina and dense A-scan protocol for measurement of the total retinal blood flow (RBF) rate. The thicknesses of the nerve fiber layer (NFL) and that of the NFL to the inner plexiform layer (IPL) were measured and compared between OB and WT mice. The linear capillary densities within intermediate and deep capillary layers were determined by the number of capillaries crossing a 500-μm line. The RBF rate was evaluated using an en face Doppler approach. These quantitative measurements were compared between OB and WT mice. Results. The retinal thickness of the NFL to IPL was significantly reduced in OB mice (P < 0.01) compared to that in WT mice, whereas the NFL thickness between the two was unchanged. 3D depth-resolved OMAG angiography revealed the first in vivo 3D model of mouse retinal microcirculation. Although no obvious differences in capillary vessel densities of the intermediate and deep capillary layers were detected between normal and OB mice, the total RBF rate was significantly lower (P < 0.05) in OB mice than in WT mice. Conclusions. We conclude that OB BTBR mice have significantly reduced NFL–IPL thicknesses and total RBF rates compared with those of WT mice, as imaged by OCT/OMAG. OMAG provides an unprecedented capability for high-resolution depth-resolved imaging of mouse retinal vessels and blood flow that may play a pivotal role in providing a noninvasive method for detecting early microvascular changes in patients with diabetic retinopathy. PMID:24458155

  19. Intracellular Protein Delivery for Treating Breast Cancer

    DTIC Science & Technology

    2013-06-01

    accumulation of Dox in tumors. (A) Preparation of 64Cu-AmBaSar-labeled liposomes. (B) In vivo PET images of C57/ BL6 mice bearing B16 tumors at 1, 3, and 24 h...Knoxville, TN). The B16 -F10 tumor-bearing C57/ BL6 mice were imaged in the prone position in the microPET scanner. The mice were injected with

  20. Single Stem Cell Imaging and Analysis Reveals Telomere Length Differences in Diseased Human and Mouse Skeletal Muscles.

    PubMed

    Tichy, Elisia D; Sidibe, David K; Tierney, Matthew T; Stec, Michael J; Sharifi-Sanjani, Maryam; Hosalkar, Harish; Mubarak, Scott; Johnson, F Brad; Sacco, Alessandra; Mourkioti, Foteini

    2017-10-10

    Muscle stem cells (MuSCs) contribute to muscle regeneration following injury. In many muscle disorders, the repeated cycles of damage and repair lead to stem cell dysfunction. While telomere attrition may contribute to aberrant stem cell functions, methods to accurately measure telomere length in stem cells from skeletal muscles have not been demonstrated. Here, we have optimized and validated such a method, named MuQ-FISH, for analyzing telomere length in MuSCs from either mice or humans. Our analysis showed no differences in telomere length between young and aged MuSCs from uninjured wild-type mice, but MuSCs isolated from young dystrophic mice exhibited significantly shortened telomeres. In corroboration, we demonstrated that telomere attrition is present in human dystrophic MuSCs, which underscores its importance in diseased regenerative failure. The robust technique described herein provides analysis at a single-cell resolution and may be utilized for other cell types, especially rare populations of cells. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Assessment of amiodarone-induced phospholipidosis in chimeric mice with a humanized liver.

    PubMed

    Sanoh, Seigo; Yamachika, Yuto; Tamura, Yuka; Kotake, Yaichiro; Yoshizane, Yasumi; Ishida, Yuji; Tateno, Chise; Ohta, Shigeru

    2017-01-01

    It is important to consider susceptibility to drug-induced toxicity between animals and humans. Chimeric mice with a humanized liver are expected to predict hepatotoxicity in humans. Drug-induced phospholipidosis (DIPL), in which phospholipids accumulate, is a known entity. In this study, we examined whether chimeric mice can reveal species differences in DIPL. Changes in various phosphatidylcholine (PhC) molecules were investigated in the liver of chimeric mice after administering amiodarone, which induces phospholipidosis. Liquid chromatography-tandem mass spectrometry revealed that levels of PhCs tended to increase in the liver after administration of amiodarone. The liver of chimeric mice consists of human hepatocytes and residual mouse hepatocytes. We used imaging mass spectrometry (IMS) to evaluate the increase of PhCs in human and mouse hepatocytes after administration of amiodarone. IMS visualizes localization of endogenous and exogenous molecules in tissues. The IMS analysis suggested that the localized levels of several PhCs tended to be higher in the human hepatocytes than those in mouse hepatocytes, and PhC levels changed in response to amiodarone. Chimeric mice with a humanized liver will be useful to evaluate species differences in DIPL between mice and humans.

  2. Quantitative 17O imaging towards oxygen consumption study in tumor bearing mice at 7 T.

    PubMed

    Narazaki, Michiko; Kanazawa, Yoko; Koike, Sachiko; Ando, Koichi; Ikehira, Hiroo

    2013-06-01

    (17)O magnetic resonance imaging (MRI) using a conventional pulse sequence was explored as a method of quantitative imaging towards regional oxygen consumption rate measurement for tumor evaluation in mice. At 7 T, fast imaging with steady state (FISP) was the best among gradient echo, fast spin echo and FISP for the purpose. The distribution of natural abundance H2(17)O in mice was visualized under spatial resolution of 2.5 × 2.5mm(2) by FISP in 10 min. The signal intensity by FISP showed a linear relationship with (17)O quantity both in phantom and mice. Following the injection of 5% (17)O enriched saline, (17)O re-distribution was monitored in temporal resolution down to 5 sec with an image quality sufficient to distinguish each organ. The image of labeled water produced from inhaled (17)O2 gas was also obtained. The present method provides quantitative (17)O images under sufficient temporal and spatial resolution for the evaluation of oxygen consumption rate in each organ. Experiments using various model compounds of R-OH type clarified that the signal contribution of body constituents other than water in the present in vivo(17)O FISP image was negligible. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Mice overexpressing corticotropin-releasing factor show brain atrophy and motor dysfunctions.

    PubMed

    Goebel, Miriam; Fleming, Sheila M; Million, Mulugeta; Stengel, Andreas; Taché, Yvette; Wang, Lixin

    2010-03-31

    Chronic stress and persistently high glucocorticoid levels can induce brain atrophy. Corticotropin-releasing factor (CRF)-overexpressing (OE) mice are a genetic model of chronic stress with elevated brain CRF and plasma corticosterone levels and Cushing's syndrome. The brain structural alterations in the CRF-OE mice, however, are not well known. We found that adult male and female CRF-OE mice had significantly lower whole brain and cerebellum weights than their wild type (WT) littermates (347.7+/-3.6mg vs. 460.1+/-4.3mg and 36.3+/-0.8mg vs. 50.0+/-1.3mg, respectively) without sex-related difference. The epididymal/parametrial fat mass was significantly higher in CRF-OE mice. The brain weight was inversely correlated to epididymal/parametrial fat weight, but not to body weight. Computerized image analysis system in Nissl-stained brain sections of female mice showed that the anterior cingulate and sensorimotor cortexes of CRF-OE mice were significantly thinner, and the volumes of the hippocampus, hypothalamic paraventricular nucleus and amygdala were significantly reduced compared to WT, while the locus coeruleus showed a non-significant increase. Motor functions determined by beam crossing and gait analysis showed that CRF-OE mice took longer time and more steps to traverse a beam with more errors, and displayed reduced stride length compared to their WT littermates. These data show that CRF-OE mice display brain size reduction associated with alterations of motor coordination and an increase in visceral fat mass providing a novel animal model to study mechanisms involved in brain atrophy under conditions of sustained elevation of brain CRF and circulating glucocorticoid levels. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  4. Acid sphingomyelinase (aSMase) deficiency leads to abnormal microglia behavior and disturbed retinal function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dannhausen, Katharina; Karlstetter, Marcus; Caramoy, Albert

    Mutations in the acid sphingomyelinase (aSMase) coding gene sphingomyelin phosphodiesterase 1 (SMPD1) cause Niemann-Pick disease (NPD) type A and B. Sphingomyelin storage in cells of the mononuclear phagocyte system cause hepatosplenomegaly and severe neurodegeneration in the brain of NPD patients. However, the effects of aSMase deficiency on retinal structure and microglial behavior have not been addressed in detail yet. Here, we demonstrate that retinas of aSMase{sup −/−} mice did not display overt neuronal degeneration but showed significantly reduced scotopic and photopic responses in electroretinography. In vivo fundus imaging of aSMase{sup −/−} mice showed many hyperreflective spots and staining for the retinalmore » microglia marker Iba1 revealed massive proliferation of retinal microglia that had significantly enlarged somata. Nile red staining detected prominent phospholipid inclusions in microglia and lipid analysis showed significantly increased sphingomyelin levels in retinas of aSMase{sup −/−} mice. In conclusion, the aSMase-deficient mouse is the first example in which microglial lipid inclusions are directly related to a loss of retinal function. - Highlights: • aSMase-deficient mice show impaired retinal function and reactive microgliosis. • aSMase-deficient microglia express pro-inflammatory transcripts. • aSMase-deficient microglia proliferate and have increased cell body size. • In vivo imaging shows hyperreflective spots in the fundus of aSMase-deficient mice. • aSMase-deficient microglia accumulate sphingolipid-rich intracellular deposits.« less

  5. Noninvasive Quantification of Retinal Microglia Using Widefield Autofluorescence Imaging.

    PubMed

    Kokona, Despina; Schneider, Nadia; Giannakaki-Zimmermann, Helena; Jovanovic, Joel; Ebneter, Andreas; Zinkernagel, Martin

    2017-04-01

    To validate widefield autofluorescence (AF) in vivo imaging of the retina in mice expressing green fluorescent protein (gfp) in microglia, and to monitor retinal microglia reconstitution in vivo after lethal irradiation and bone marrow transplantation. Transgenic Cx3cr1gfp/gfp and wildtype Balb/c mice were used in this study. A confocal scanning laser ophthalmoscope was used for AF imaging with a 55° and a widefield 102° lens. Intrasession reproducibility was assessed for each lens. To investigate reconstitution in vivo, bone marrow from Cx3cr1gfp/gfp mice was used to rescue lethally irradiated wildtype mice. Data were compared to confocal microscopy of retinal flat mounts. Both the 55° and the 102° lens produced high resolution images of retinal microglia with similar microglia density. However, compared to the 55° lens, the widefield 102° lens captured approximately 3.6 times more microglia cells (1515 ± 123 cells versus 445 ± 76 cells [mean ± SD], for 102° and 55°, respectively, P < 0.001). No statistical difference in the number of gfp positive cells within corresponding areas was observed within the same imaging session. Imaging of microglia reconstitution showed a similar time course compared to flat mount preparations with an excellent correlation between microglia cell numbers in AF and gfp-stained flat mounts (R = 0.92, P < 0.0001). Widefield AF imaging of mice with gfp expressing microglia can be used to quantify retinal microglia. In vivo microglia counts corresponded very well with ex vivo counts on retinal flat mounts. As such, AF imaging can largely replace ex vivo quantification.

  6. Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hatazawa, Yukino; Research Fellow of Japan Society for the Promotion of Science, Tokyo; Minami, Kimiko

    The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared withmore » that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α’s function in the oxidative energy metabolism of skeletal muscles. - Highlights: • Microarray analysis was performed in the skeletal muscle of PGC1α KO mice. • Expression of genes in the oxidative energy metabolism was decreased. • Bioinformatic analysis of promoter region of the genes predicted involvement of ERR. • PGC1α KO microarray data in this study show the mirror image of transgenic data.« less

  7. Dextran sulfate sodium-induced acute colitis impairs dermal lymphatic function in mice.

    PubMed

    Agollah, Germaine D; Wu, Grace; Peng, Ho-Lan; Kwon, Sunkuk

    2015-12-07

    To investigate whether dermal lymphatic function and architecture are systemically altered in dextran sulfate sodium (DSS)-induced acute colitis. Balb/c mice were administered 4% DSS in lieu of drinking water ad libitum for 7 d and monitored to assess disease activity including body weight, diarrhea severity, and fecal bleeding. Control mice received standard drinking water with no DSS. Changes in mesenteric lymphatics were assessed following oral administration of a fluorescently-labelled fatty acid analogue, while dermal lymphatic function and architecture was longitudinally characterized using dynamic near-infrared fluorescence (NIRF) imaging following intradermal injection of indocyanine green (ICG) at the base of the tail or to the dorsal aspect of the left paw prior to, 4, and 7 d after DSS administration. We also measured dye clearance rate after injection of Alexa680-bovine serum albumin (BSA). NIRF imaging data was analyzed to reveal lymphatic contractile activity after selecting fixed regions of interest (ROIs) of the same size in fluorescent lymphatic vessels on fluorescence images. The averaged fluorescence intensity within the ROI of each fluorescence image was plotted as a function of imaging time and the lymphatic contraction frequency was computed by assessing the number of fluorescent pulses arriving at a ROI. Mice treated with DSS developed acute inflammation with clinical symptoms of loss of body weight, loose feces/watery diarrhea, and fecal blood, all of which were aggravated as disease progressed to 7 d. Histological examination of colons of DSS-treated mice confirmed acute inflammation, characterized by segmental to complete loss of colonic mucosa with an associated chronic inflammatory cell infiltrate that extended into the deeper layers of the wall of the colon, compared to control mice. In situ intravital imaging revealed that mice with acute colitis showed significantly fewer fluorescent mesenteric lymphatic vessels, indicating impaired uptake of a lipid tracer within mesenteric lymphatics. Our in vivo NIRF imaging data demonstrated dilated dermal lymphatic vessels, which were confirmed by immunohistochemical staining of lymphatic vessels, and significantly reduced lymphatic contractile function in the skin of mice with DSS-induced acute colitis. Quantification of the fluorescent intensity remaining in the depot as a function of time showed that there was significantly higher Alexa680-BSA fluorescence in mice with DSS-induced acute colitis compared to pre-treatment with DSS, indicative of impaired lymphatic drainage. The lymphatics are locally and systemically altered in acute colitis, and functional NIRF imaging is useful for noninvasively monitoring systemic lymphatic changes during inflammation.

  8. Iodine 125 Imaging in Mice Using NaI(Tl)/Flat Panel PMT Integral Assembly

    NASA Astrophysics Data System (ADS)

    Cinti, M. N.; Majewski, S.; Williams, M. B.; Bachmann, C.; Cominelli, F.; Kundu, B. K.; Stolin, A.; Popov, V.; Welch, B. L.; De Vincentis, G.; Bennati, P.; Betti, M.; Ridolfi, S.; Pani, R.

    2007-06-01

    Radiolabeled agents that bind to specific receptors have shown great promise in diagnosing and characterizing tumor cell biology. In vivo imaging of gene transcription and protein expression represents an other area of interest. The radioisotope I is commercially available as a label for molecular probes and utilized by researchers in small animal studies. We propose an advanced imaging detector based on planar NaI(T1) integral assembly with a Hamamatsu Flat Panel Photomultiplier (MA-PMT) representing one of the best trade-offs between spatial resolution and detection efficiency. We characterized the imaging performances of this planar detector, in comparison with a gamma camera based on a pixellated scintillator. We also tested the in-vivo image capability by acquiring images of mice as a part of a study of inflammatory bowel disease (IBD). In this study, four 25g mice with an IBD-like phenotype (SAMP1/YitFc) were injected with 375, 125, 60 and 30 muCi of I-labelled antibody against mucosal vascular addressin cell adhesion molecule (MAdCAM-1), which is up-regulated in the presence of inflammation. Two mice without bowel inflammation were injected with 150 and 60 muCi of the labeled anti-MAdCAM-1 antibody as controls. To better evaluate the performances of the integral assembly detector, we also acquired mice images with a dual modality (X and Gamma Ray) camera dedicated for small animal imaging. The results coming from this new detector are considerable: images of SAMP1/YitFc injected with 30 muCi activity show inflammation throughout the intestinal tract, with the disease very well defined at two hours post-injection.

  9. Subcellular real-time in vivo imaging of intralymphatic and intravascular cancer-cell trafficking

    NASA Astrophysics Data System (ADS)

    McElroy, M.; Hayashi, K.; Kaushal, S.; Bouvet, M.; Hoffman, Robert M.

    2008-02-01

    With the use of fluorescent cells labeled with green fluorescent protein (GFP) in the nucleus and red fluorescent protein (RFP) in the cytoplasm and a highly sensitive small animal imaging system with both macro-optics and micro-optics, we have developed subcellular real-time imaging of cancer cell trafficking in live mice. Dual-color cancer cells were injected by a vascular route in an abdominal skin flap in nude mice. The mice were imaged with an Olympus OV100 small animal imaging system with a sensitive CCD camera and four objective lenses, parcentered and parfocal, enabling imaging from macrocellular to subcellular. We observed the nuclear and cytoplasmic behavior of cancer cells in real time in blood vessels as they moved by various means or adhered to the vessel surface in the abdominal skin flap. During extravasation, real-time dual-color imaging showed that cytoplasmic processes of the cancer cells exited the vessels first, with nuclei following along the cytoplasmic projections. Both cytoplasm and nuclei underwent deformation during extravasation. Different cancer cell lines seemed to strongly vary in their ability to extravasate. We have also developed real-time imaging of cancer cell trafficking in lymphatic vessels. Cancer cells labeled with GFP and/or RFP were injected into the inguinal lymph node of nude mice. The labeled cancer cells trafficked through lymphatic vessels where they were imaged via a skin flap in real-time at the cellular level until they entered the axillary lymph node. The bright dual-color fluorescence of the cancer cells and the real-time microscopic imaging capability of the Olympus OV100 enabled imaging the trafficking cancer cells in both blood vessels and lymphatics. With the dual-color cancer cells and the highly sensitive imaging system described here, the subcellular dynamics of cancer metastasis can now be observed in live mice in real time.

  10. Validation study of ¹³¹I-RRL: assessment of biodistribution, SPECT imaging and radiation dosimetry in mice.

    PubMed

    Zhao, Qian; Yan, Ping; Yin, Lei; Li, Ling; Chen, Xue Qi; Ma, Chao; Wang, Rong Fu

    2013-04-01

    Tumor angiogenesis is important in the growth and metastasis of malignant tumors. In our previous study, we demonstrated that an arginine-arginine-leucine (RRL) peptide is a tumor endothelial cell-specific binding sequence that may be used as a molecular probe for the imaging of malignant tumors in vivo. The aim of the present study was to further explore the characteristics of 131I‑RRL by biodistribution tests, and to estimate the radiation dosimetry of 131I‑RRL for humans using mice data. The RRL peptide was radiolabeled with 131I by a chloramine-T (CH-T) method. The radiolabeling efficiency and radiochemical purity were then characterized in vitro. 131I‑RRL was injected intravenously into B16 xenograft-bearing Kunming mice. Biodistribution analysis and in vivo imaging were performed periodically. The radiation dosimetry in humans was calculated according to the organ distribution and the standard medical internal radiation dose (MIRD) method in mice. All data were analyzed by statistical and MIRDOSE 3.1 software. The labeling efficiency of 131I‑RRL reached 70.0±2.91% (n=5), and the radiochemical purity exceeded 95% following purification. In mice bearing B16 xenografts, 131I‑RRL rapidly cleared from the blood and predominantly accumulated in the kidneys, the stomach and the tumor tissue. The specific uptake of 131I‑RRL in the tumor increased over time and was significantly higher than that of the other organs, 24-72 h following injection (P<0.05). The ratio of tumor-to-skeletal muscle (T/SM) tissue exceeded 4.75, and the ratio of the tumor-to-blood (T/B) tissue peaked at 3.36. In the single-photon emission computed tomography (SPECT) imaging of Kunming mice bearing B16 xenografts, the tumors were clearly identifiable at 6 h, and significant uptake was evident 24-72 h following administration of 131I‑RRL. The effective dose for the adult male dosimetric model was estimated to be 0.0293 mSv/MBq. Higher absorbed doses were estimated for the stomach (0.102 mGy/MBq), the small intestines (0.0699 mGy/MBq), the kidneys (0.0611 mGy/MBq) and the liver (0.055 mGy/MBq). These results highlight the potential of 131I‑RRL as a ligand for the SPECT imaging of tumors. Administration of 131I‑RRL led to a reasonable radiation dose burden and was safe for human use.

  11. Porphyromonas gingivalis Accelerates Inflammatory Atherosclerosis in the Innominate Artery of ApoE Deficient Mice

    PubMed Central

    Hayashi, Chie; Viereck, Jason; Hua, Ning; Phinikaridou, Alkystis; Madrigal, Andres G.; Gibson, Frank C.; Hamilton, James A.; Genco, Caroline A.

    2011-01-01

    Objective Studies in humans support a role for the oral pathogen Porphyromonas gingivalis in the development of inflammatory atherosclerosis. The goal of this study was to determine if P. gingivalis infection accelerates inflammation and atherosclerosis in the innominate artery of mice, an artery which has been reported to exhibit many features of human atherosclerotic disease, including plaque rupture. Methods and Results Apolipoprotein E-deficient (ApoE−/−) mice were orally infected with P. gingivalis, and Magnetic Resonance Imaging (MRI) was used to monitor the progression of atherosclerosis in live mice. P. gingivalis infected mice exhibited a statistically significant increase in atherosclerotic plaque in the innominate artery as compared to uninfected mice. Polarized light microscopy and immunohistochemistry revealed that the innominate arteries of infected mice had increased lipids, macrophages and T cells as compared to uninfected mice. Increases in plaque, total cholesterol esters and cholesterol monohydrate crystals, macrophages, and T cells were prevented by immunization with heat-killed P. gingivalis prior to pathogen exposure. Conclusions These are the first studies to demonstrate progression of inflammatory plaque accumulation in the innominate arteries by in-vivo MRI analysis following pathogen exposure, and to document protection from plaque progression in the innominate artery via immunization. PMID:21251656

  12. Sickle cell anemia mice develop a unique cardiomyopathy with restrictive physiology

    PubMed Central

    Bakeer, Nihal; James, Jeanne; Roy, Swarnava; Wansapura, Janaka; Shanmukhappa, Shiva Kumar; Lorenz, John N.; Osinska, Hanna; Backer, Kurt; Huby, Anne-Cecile; Shrestha, Archana; Niss, Omar; Fleck, Robert; Quinn, Charles T.; Taylor, Michael D.; Purevjav, Enkhsaikhan; Aronow, Bruce J.; Towbin, Jeffrey A.; Malik, Punam

    2016-01-01

    Cardiopulmonary complications are the leading cause of mortality in sickle cell anemia (SCA). Elevated tricuspid regurgitant jet velocity, pulmonary hypertension, diastolic, and autonomic dysfunction have all been described, but a unifying pathophysiology and mechanism explaining the poor prognosis and propensity to sudden death has been elusive. Herein, SCA mice underwent a longitudinal comprehensive cardiac analysis, combining state-of-the-art cardiac imaging with electrocardiography, histopathology, and molecular analysis to determine the basis of cardiac dysfunction. We show that in SCA mice, anemia-induced hyperdynamic physiology was gradually superimposed with restrictive physiology, characterized by progressive left atrial enlargement and diastolic dysfunction with preserved systolic function. This phenomenon was absent in WT mice with experimentally induced chronic anemia of similar degree and duration. Restrictive physiology was associated with microscopic cardiomyocyte loss and secondary fibrosis detectable as increased extracellular volume by cardiac-MRI. Ultrastructural mitochondrial changes were consistent with severe chronic hypoxia/ischemia and sarcomere diastolic-length was shortened. Transcriptome analysis revealed up-regulation of genes involving angiogenesis, extracellular-matrix, circadian-rhythm, oxidative stress, and hypoxia, whereas ion-channel transport and cardiac conduction were down-regulated. Indeed, progressive corrected QT prolongation, arrhythmias, and ischemic changes were noted in SCA mice before sudden death. Sudden cardiac death is common in humans with restrictive cardiomyopathies and long QT syndromes. Our findings may thus provide a unifying cardiac pathophysiology that explains the reported cardiac abnormalities and sudden death seen in humans with SCA. PMID:27503873

  13. Holographic intravital microscopy for 2-D and 3-D imaging intact circulating blood cells in microcapillaries of live mice

    NASA Astrophysics Data System (ADS)

    Kim, Kyoohyun; Choe, Kibaek; Park, Inwon; Kim, Pilhan; Park, Yongkeun

    2016-09-01

    Intravital microscopy is an essential tool that reveals behaviours of live cells under conditions close to natural physiological states. So far, although various approaches for imaging cells in vivo have been proposed, most require the use of labelling and also provide only qualitative imaging information. Holographic imaging approach based on measuring the refractive index distributions of cells, however, circumvent these problems and offer quantitative and label-free imaging capability. Here, we demonstrate in vivo two- and three-dimensional holographic imaging of circulating blood cells in intact microcapillaries of live mice. The measured refractive index distributions of blood cells provide morphological and biochemical properties including three-dimensional cell shape, haemoglobin concentration, and haemoglobin contents at the individual cell level. With the present method, alterations in blood flow dynamics in live healthy and sepsis-model mice were also investigated.

  14. Panretinal, high-resolution color photography of the mouse fundus.

    PubMed

    Paques, Michel; Guyomard, Jean-Laurent; Simonutti, Manuel; Roux, Michel J; Picaud, Serge; Legargasson, Jean-François; Sahel, José-Alain

    2007-06-01

    To analyze high-resolution color photographs of the mouse fundus. A contact fundus camera based on topical endoscopy fundus imaging (TEFI) was built. Fundus photographs of C57 and Balb/c mice obtained by TEFI were qualitatively analyzed. High-resolution digital imaging of the fundus, including the ciliary body, was routinely obtained. The reflectance and contrast of retinal vessels varied significantly with the amount of incident and reflected light and, thus, with the degree of fundus pigmentation. The combination of chromatic and spherical aberration favored blue light imaging, in term of both field and contrast. TEFI is a small, low-cost system that allows high-resolution color fundus imaging and fluorescein angiography in conscious mice. Panretinal imaging is facilitated by the presence of the large rounded lens. TEFI significantly improves the quality of in vivo photography of retina and ciliary process of mice. Resolution is, however, affected by chromatic aberration, and should be improved by monochromatic imaging.

  15. Reproducibility of cine displacement encoding with stimulated echoes (DENSE) cardiovascular magnetic resonance for measuring left ventricular strains, torsion, and synchrony in mice.

    PubMed

    Haggerty, Christopher M; Kramer, Sage P; Binkley, Cassi M; Powell, David K; Mattingly, Andrea C; Charnigo, Richard; Epstein, Frederick H; Fornwalt, Brandon K

    2013-08-27

    Advanced measures of cardiac function are increasingly important to clinical assessment due to their superior diagnostic and predictive capabilities. Cine DENSE cardiovascular magnetic resonance (CMR) is ideal for quantifying advanced measures of cardiac function based on its high spatial resolution and streamlined post-processing. While many studies have utilized cine DENSE in both humans and small-animal models, the inter-test and inter-observer reproducibility for quantification of advanced cardiac function in mice has not been evaluated. This represents a critical knowledge gap for both understanding the capabilities of this technique and for the design of future experiments. We hypothesized that cine DENSE CMR would show excellent inter-test and inter-observer reproducibility for advanced measures of left ventricular (LV) function in mice. Five normal mice (C57BL/6) and four mice with depressed cardiac function (diet-induced obesity) were imaged twice, two days apart, on a 7T ClinScan MR system. Images were acquired with 15-20 frames per cardiac cycle in three short-axis (basal, mid, apical) and two long-axis orientations (4-chamber and 2-chamber). LV strain, twist, torsion, and measures of synchrony were quantified. Images from both days were analyzed by one observer to quantify inter-test reproducibility, while inter-observer reproducibility was assessed by a second observer's analysis of day-1 images. The coefficient of variation (CoV) was used to quantify reproducibility. LV strains and torsion were highly reproducible on both inter-observer and inter-test bases with CoVs ≤ 15%, and inter-observer reproducibility was generally better than inter-test reproducibility. However, end-systolic twist angles showed much higher variance, likely due to the sensitivity of slice location within the sharp longitudinal gradient in twist angle. Measures of synchrony including the circumferential (CURE) and radial (RURE) uniformity of strain indices, showed excellent reproducibility with CoVs of 1% and 3%, respectively. Finally, peak measures (e.g., strains) were generally more reproducible than the corresponding rates of change (e.g., strain rate). Cine DENSE CMR is a highly reproducible technique for quantification of advanced measures of left ventricular cardiac function in mice including strains, torsion and measures of synchrony. However, myocardial twist angles are not reproducible and future studies should instead report torsion.

  16. In vivo bioluminescence imaging using orthotopic xenografts towards patient's derived-xenograft Medulloblastoma models.

    PubMed

    Asadzadeh, Fatemeh; Ferrucci, Veronica; DE Antonellis, Pasqualino; Zollo, Massimo

    2017-03-01

    Medulloblastoma is a cerebellar neoplasia of the central nervous system. Four molecular subgrups have been identified (MBWNT, MBSHH, MBgroup3 and MBgroup4) with distinct genetics and clinical outcome. Among these, MBgroup3-4 are highly metastatic with the worst prognosis. The current standard therapy includes surgery, radiation and chemotherapy. Thus, specific treatments adapted to cure those different molecular subgroups are needed. The use of orthotopic xenograft models, together with the non-invasive in vivo biolumiscence imaging (BLI) technology, is emerging during preclinical studies to test novel therapeutics for medulloblastoma treatment. Orthotopic MB xenografts were performed by injection of Daoy-luc cells, that had been previously infected with lentiviral particles to stably express luciferase gene, into the fourth right ventricle of the cerebellum of ten nude mice. For the implantation, specific stereotactic coordinates were used. Seven days after the implantation the mice were imaged by acquisitions of bioluminescence imaging (BLI) using IVIS 3D Illumina Imaging System (Xenogen). Tumor growth was evaluated by quantifying the bioluminescence signals using the integrated fluxes of photons within each area of interest using the Living Images Software Package 3.2 (Xenogen-Perkin Elmer). Finally, histological analysis using hematoxylin-eosin staining was performed to confirm the presence of tumorigenic cells into the cerebellum of the mice. We describe a method to use the in vivo bioluminescent imaging (BLI) showing the potential to be used to investigate the potential antitumorigenic effects of a drug for in vivo medulloblastoma treatment. We also discuss other studies in which this technology has been applied to obtain a more comprehensive knowledge of medulloblastoma using orthotopic xenograft mouse models. There is a need to develop patient's derived-xenograft (PDX) model systems to test novel drugs for medulloblastoma treatment within each molecular sub-groups with a higher predictive value. Here we show how this technology should be applied with hopes on generations of new treatments to be applied then in human.

  17. Contributions of structural connectivity and cerebrovascular parameters to functional magnetic resonance imaging signals in mice at rest and during sensory paw stimulation.

    PubMed

    Schroeter, Aileen; Grandjean, Joanes; Schlegel, Felix; Saab, Bechara J; Rudin, Markus

    2017-07-01

    Previously, we reported widespread bilateral increases in stimulus-evoked functional magnetic resonance imaging signals in mouse brain to unilateral sensory paw stimulation. We attributed the pattern to arousal-related cardiovascular changes overruling cerebral autoregulation thereby masking specific signal changes elicited by local neuronal activity. To rule out the possibility that interhemispheric neuronal communication might contribute to bilateral functional magnetic resonance imaging responses, we compared stimulus-evoked functional magnetic resonance imaging responses to unilateral hindpaw stimulation in acallosal I/LnJ, C57BL/6, and BALB/c mice. We found bilateral blood-oxygenation-level dependent signal changes in all three strains, ruling out a dominant contribution of transcallosal communication as reason for bilaterality. Analysis of functional connectivity derived from resting-state functional magnetic resonance imaging, revealed that bilateral cortical functional connectivity is largely abolished in I/LnJ animals. Cortical functional connectivity in all strains correlated with structural connectivity in corpus callosum as revealed by diffusion tensor imaging. Given the profound influence of systemic hemodynamics on stimulus-evoked functional magnetic resonance imaging outcomes, we evaluated whether functional connectivity data might be affected by cerebrovascular parameters, i.e. baseline cerebral blood volume, vascular reactivity, and reserve. We found that effects of cerebral hemodynamics on functional connectivity are largely outweighed by dominating contributions of structural connectivity. In contrast, contributions of transcallosal interhemispheric communication to the occurrence of ipsilateral functional magnetic resonance imaging response of equal amplitude to unilateral stimuli seem negligible.

  18. [In situ visual imaging of oral squamous cell carcinoma in mice by using near-infrared quantum dots conjugated with arginine-glycine-aspartic acid peptide fluorescent probes].

    PubMed

    Yunlong, Bai; Hao, Huang; Kai, Yang; Hong, Tang

    2014-10-01

    To investigate in situ visualization using near-infrared quantum dots (QDs) conjugated with arginine- glycine-aspartic acid (ROD) peptide fluorescent probes in oral squamous cell carcinoma (08CC). QDs with emission wavelength of 800 nm (QD800) were conjugated with RGD peptides to produce QD800-RGD fluorescent probes. Human OSCC cell line BcaCD885 was inoculated in nude mice cheeks to establish OSCC mouse models. Frozen BcaCD885 tumor slices were immunofluorescence double stained by using QD800-RGD and CD105 monoclonal antibody and were observed using a laser scanning confocal microscope. QD800-RGD was injected into the OSCC models through the tail veins, and the in situ visualization was analyzed at different time points. The mice were sacrificed 12 h after injection to isolate tumors for the ex vivo analysis of probe localization in the tumors. QD800-RGD specifically targeted the integrin avβ3 expressed in the endothelial cells of tumor angiogenic vessels in vitro and in vivo, producing clear tumor fluorescence images after intravenous injection. The most complete tumor images with maximal signal-to-noise ratios were observed 0.5 h to 6 h after injection of the probe and significantly reduced 9 h after the injection. However, the tumor image was still clearly visible at 12 h. Using intravenously injected QD800-RGD generates high quality OSCC images when integrin avβ3, which is expressed in the endothelial cells of tumor angiogenic vessels, is used as the target. The technique offers great potential in the diagnosis and individual treatment of OSCC.

  19. In Vivo Imaging of Tau Pathology Using Magnetic Resonance Imaging Textural Analysis

    PubMed Central

    Colgan, Niall; Ganeshan, Balaji; Harrison, Ian F.; Ismail, Ozama; Holmes, Holly E.; Wells, Jack A.; Powell, Nick M.; O'Callaghan, James M.; O'Neill, Michael J.; Murray, Tracey K.; Ahmed, Zeshan; Collins, Emily C.; Johnson, Ross A.; Groves, Ashley; Lythgoe, Mark F.

    2017-01-01

    Background: Non-invasive characterization of the pathological features of Alzheimer's disease (AD) could enhance patient management and the development of therapeutic strategies. Magnetic resonance imaging texture analysis (MRTA) has been used previously to extract texture descriptors from structural clinical scans in AD to determine cerebral tissue heterogeneity. In this study, we examined the potential of MRTA to specifically identify tau pathology in an AD mouse model and compared the MRTA metrics to histological measures of tau burden. Methods: MRTA was applied to T2 weighted high-resolution MR images of nine 8.5-month-old rTg4510 tau pathology (TG) mice and 16 litter matched wild-type (WT) mice. MRTA comprised of the filtration-histogram technique, where the filtration step extracted and enhanced features of different sizes (fine, medium, and coarse texture scales), followed by quantification of texture using histogram analysis (mean gray level intensity, mean intensity, entropy, uniformity, skewness, standard-deviation, and kurtosis). MRTA was applied to manually segmented regions of interest (ROI) drawn within the cortex, hippocampus, and thalamus regions and the level of tau burden was assessed in equivalent regions using histology. Results: Texture parameters were markedly different between WT and TG in the cortex (E, p < 0.01, K, p < 0.01), the hippocampus (K, p < 0.05) and in the thalamus (K, p < 0.01). In addition, we observed significant correlations between histological measurements of tau burden and kurtosis in the cortex, hippocampus and thalamus. Conclusions: MRTA successfully differentiated WT and TG in brain regions with varying degrees of tau pathology (cortex, hippocampus, and thalamus) based on T2 weighted MR images. Furthermore, the kurtosis measurement correlated with histological measures of tau burden. This initial study indicates that MRTA may have a role in the early diagnosis of AD and the assessment of tau pathology using routinely acquired structural MR images. PMID:29163005

  20. Harmonic Motion Imaging for Abdominal Tumor Detection and High-intensity Focused Ultrasound Ablation Monitoring: A Feasibility Study in a Transgenic Mouse Model of Pancreatic Cancer

    PubMed Central

    Chen, Hong; Hou, Gary Y.; Han, Yang; Payen, Thomas; Palermo, Carmine F.; Olive, Kenneth P.; Konofagou, Elisa E.

    2015-01-01

    Harmonic motion imaging (HMI) is a radiation force-based elasticity imaging technique that tracks oscillatory tissue displacements induced by sinusoidal ultrasonic radiation force to assess relative tissue stiffness. The objective of this study was to evaluate the feasibility of HMI in pancreatic tumor detection and high-intensity focused ultrasound (HIFU) treatment monitoring. The HMI system consisted of a focused ultrasound transducer, which generated sinusoidal radiation force to induce oscillatory tissue motion at 50 Hz, and a diagnostic ultrasound transducer, which detected the axial tissue displacements based on acquired radiofrequency signals using a 1D cross-correlation algorithm. For pancreatic tumor detection, HMI images were generated for pancreatic tumors in transgenic mice and normal pancreases in wild-type mice. The obtained HMI images showed a high contrast between normal and malignant pancreases with an average peak-to-peak HMI displacement ratio of 3.2. Histological analysis showed that no tissue damage was associated with HMI when it was used for the sole purpose of elasticity imaging. For pancreatic tumor ablation monitoring, the focused ultrasound transducer was operated with a higher acoustic power and longer pulse length than that used in tumor detection to simultaneously induce HIFU thermal ablation and oscillatory tissue displacements, allowing HMI monitoring without interrupting tumor ablation. HMI monitoring of HIFU ablation found significant decreases in the peak-to-peak HMI displacements before and after HIFU ablation with a reduction rate ranging from 15.8% to 57.0%. The formation of thermal lesions after HIFU exposure was confirmed by histological analysis. This study demonstrated the feasibility of HMI in abdominal tumor detection and HIFU ablation monitoring. PMID:26415128

  1. Harmonic motion imaging for abdominal tumor detection and high-intensity focused ultrasound ablation monitoring: an in vivo feasibility study in a transgenic mouse model of pancreatic cancer.

    PubMed

    Chen, Hong; Hou, Gary Y; Han, Yang; Payen, Thomas; Palermo, Carmine F; Olive, Kenneth P; Konofagou, Elisa E

    2015-09-01

    Harmonic motion imaging (HMI) is a radiationforce- based elasticity imaging technique that tracks oscillatory tissue displacements induced by sinusoidal ultrasonic radiation force to assess the resulting oscillatory displacement denoting the underlying tissue stiffness. The objective of this study was to evaluate the feasibility of HMI in pancreatic tumor detection and high-intensity focused ultrasound (HIFU) treatment monitoring. The HMI system consisted of a focused ultrasound transducer, which generated sinusoidal radiation force to induce oscillatory tissue motion at 50 Hz, and a diagnostic ultrasound transducer, which detected the axial tissue displacements based on acquired radio-frequency signals using a 1-D cross-correlation algorithm. For pancreatic tumor detection, HMI images were generated for pancreatic tumors in transgenic mice and normal pancreases in wild-type mice. The obtained HMI images showed a high contrast between normal and malignant pancreases with an average peak-to-peak HMI displacement ratio of 3.2. Histological analysis showed that no tissue damage was associated with HMI when it was used for the sole purpose of elasticity imaging. For pancreatic tumor ablation monitoring, the focused ultrasound transducer was operated at a higher acoustic power and longer pulse length than that used in tumor detection to simultaneously induce HIFU thermal ablation and oscillatory tissue displacements, allowing HMI monitoring without interrupting tumor ablation. HMI monitoring of HIFU ablation found significant decreases in the peak-to-peak HMI displacements before and after HIFU ablation with a reduction rate ranging from 15.8% to 57.0%. The formation of thermal lesions after HIFU exposure was confirmed by histological analysis. This study demonstrated the feasibility of HMI in abdominal tumor detection and HIFU ablation monitoring.

  2. A novel near-infrared nanomaterial with high quantum efficiency and its applications in real time in vivo imaging

    NASA Astrophysics Data System (ADS)

    Cui, X. X.; Fan, Q.; Shi, S. J.; Wen, W. H.; Chen, D. F.; Guo, H. T.; Xu, Y. T.; Gao, F.; Nie, R. Z.; Ford, Harold D.; Tang, Gordon H.; Hou, C. Q.; Peng, B.

    2018-05-01

    Fluorescence imaging signal is severely limited by the quantum efficiency and emission wavelength. To overcome these challenges, novel NIR-emitting K5NdLi2F10 nanoparticles under NIR excitation was introduced as fluorescence imaging probe for the first time. The photostability of K5NdLi2F10 nanoparticles in the water, phosphate buffer saline, fetal bovine serum and living mice was investigated. The fluorescence signal was detected with depths of 3.5 and 2.0 cm in phantom and pork tissue, respectively. Fluorescence spectrum with a significant signal-to-background ratio of 10:1 was captured in living mice. Moreover, clear NIR images were virtualized for the living mice after intravenous injection. The imaging ability of nanoparticles in tumor-beard mice were evaluated, the enrichment of K5NdLi2F10 nanoparticles in tumor site due to the enhanced permeability and retention effect was confirmed. The systematic studies of toxicity, bio-distribution and in-vivo dynamic imaging suggest that these materials give high biocompatibility and low toxicity. These NIR-emitting nanoparticles with high quantum efficiency, high penetration and low toxicity might facilitate tumor identification in deep tissues more sensitively.

  3. Two-Photon Functional Imaging of the Auditory Cortex in Behaving Mice: From Neural Networks to Single Spines.

    PubMed

    Li, Ruijie; Wang, Meng; Yao, Jiwei; Liang, Shanshan; Liao, Xiang; Yang, Mengke; Zhang, Jianxiong; Yan, Junan; Jia, Hongbo; Chen, Xiaowei; Li, Xingyi

    2018-01-01

    In vivo two-photon Ca 2+ imaging is a powerful tool for recording neuronal activities during perceptual tasks and has been increasingly applied to behaving animals for acute or chronic experiments. However, the auditory cortex is not easily accessible to imaging because of the abundant temporal muscles, arteries around the ears and their lateral locations. Here, we report a protocol for two-photon Ca 2+ imaging in the auditory cortex of head-fixed behaving mice. By using a custom-made head fixation apparatus and a head-rotated fixation procedure, we achieved two-photon imaging and in combination with targeted cell-attached recordings of auditory cortical neurons in behaving mice. Using synthetic Ca 2+ indicators, we recorded the Ca 2+ transients at multiple scales, including neuronal populations, single neurons, dendrites and single spines, in auditory cortex during behavior. Furthermore, using genetically encoded Ca 2+ indicators (GECIs), we monitored the neuronal dynamics over days throughout the process of associative learning. Therefore, we achieved two-photon functional imaging at multiple scales in auditory cortex of behaving mice, which extends the tool box for investigating the neural basis of audition-related behaviors.

  4. A novel near-infrared nanomaterial with high quantum efficiency and its applications in real time in vivo imaging.

    PubMed

    Cui, X X; Fan, Q; Shi, S J; Wen, W H; Chen, D F; Guo, H T; Xu, Y T; Gao, F; Nie, R Z; Ford, Harold D; Tang, Gordon H; Hou, C Q; Peng, B

    2018-05-18

    Fluorescence imaging signal is severely limited by the quantum efficiency and emission wavelength. To overcome these challenges, novel NIR-emitting K 5 NdLi 2 F 10 nanoparticles under NIR excitation was introduced as fluorescence imaging probe for the first time. The photostability of K 5 NdLi 2 F 10 nanoparticles in the water, phosphate buffer saline, fetal bovine serum and living mice was investigated. The fluorescence signal was detected with depths of 3.5 and 2.0 cm in phantom and pork tissue, respectively. Fluorescence spectrum with a significant signal-to-background ratio of 10:1 was captured in living mice. Moreover, clear NIR images were virtualized for the living mice after intravenous injection. The imaging ability of nanoparticles in tumor-beard mice were evaluated, the enrichment of K 5 NdLi 2 F 10 nanoparticles in tumor site due to the enhanced permeability and retention effect was confirmed. The systematic studies of toxicity, bio-distribution and in-vivo dynamic imaging suggest that these materials give high biocompatibility and low toxicity. These NIR-emitting nanoparticles with high quantum efficiency, high penetration and low toxicity might facilitate tumor identification in deep tissues more sensitively.

  5. Two-Photon Functional Imaging of the Auditory Cortex in Behaving Mice: From Neural Networks to Single Spines

    PubMed Central

    Li, Ruijie; Wang, Meng; Yao, Jiwei; Liang, Shanshan; Liao, Xiang; Yang, Mengke; Zhang, Jianxiong; Yan, Junan; Jia, Hongbo; Chen, Xiaowei; Li, Xingyi

    2018-01-01

    In vivo two-photon Ca2+ imaging is a powerful tool for recording neuronal activities during perceptual tasks and has been increasingly applied to behaving animals for acute or chronic experiments. However, the auditory cortex is not easily accessible to imaging because of the abundant temporal muscles, arteries around the ears and their lateral locations. Here, we report a protocol for two-photon Ca2+ imaging in the auditory cortex of head-fixed behaving mice. By using a custom-made head fixation apparatus and a head-rotated fixation procedure, we achieved two-photon imaging and in combination with targeted cell-attached recordings of auditory cortical neurons in behaving mice. Using synthetic Ca2+ indicators, we recorded the Ca2+ transients at multiple scales, including neuronal populations, single neurons, dendrites and single spines, in auditory cortex during behavior. Furthermore, using genetically encoded Ca2+ indicators (GECIs), we monitored the neuronal dynamics over days throughout the process of associative learning. Therefore, we achieved two-photon functional imaging at multiple scales in auditory cortex of behaving mice, which extends the tool box for investigating the neural basis of audition-related behaviors. PMID:29740289

  6. Binding of 2-[18F]fluoro-CP-118,954 to mouse acetylcholinesterase: microPET and ex vivo Cerenkov luminescence imaging studies.

    PubMed

    Kim, Dong Hyun; Choe, Yearn Seong; Choi, Joon Young; Lee, Kyung-Han; Kim, Byung-Tae

    2011-05-01

    Acetylcholinesterase (AChE) has been an important cholinergic factor for the diagnosis of Alzheimer's disease (AD), because of reduced AChE activity in the postmortem brains of AD patients. We previously developed 5,7-dihydro-3-(2-(1-(2-[(18)F]fluorobenzyl)-4-piperidinyl)ethyl)-6H-pyrrolo(3,2,f)-1,2-benzisoxazol-6-one (2-[(18)F]fluoro-CP-118,954) for in vivo studies of AChE in mice. In the present study, we automated the synthesis of 2-[(18)F]fluoro-CP-118,954 for the routine use and evaluated the radioligand by microPET and ex vivo Cerenkov luminescence imaging of mouse AChE. 4-[(18)F]Fluoro-donepezil, another AChE inhibitor, was used for comparison. Automated syntheses of 2-[(18)F]fluoro-CP-118,954 and 4-[(18)F]fluoro-donepezil resulted in high radiochemical yields (25-33% and 30-40%) and high specific activity (27.1-35.4 and 29.7-37.3 GBq/μmol). Brain microPET images of two ICR mice injected with 2-[(18)F]fluoro-CP-118,954 demonstrated high uptake in the striatum (ROI analysis: 5.1 %ID/g for the first 30 min and 4.1 %ID/g for another 30 min), and a blocking study with injection of CP-118,954 into one of the mice at 30 min after radioligand injection led to complete blocking of radioligand uptake in the striatum (ROI analysis: 1.9 %ID/g), whereas (18)F-labeled donepezil did not show specific uptake in the striatum. In another set of experiments, the brain tissues (striatum, parietal cortex, frontal cortex and cerebellum) were excised after brain microPET/CT imaging of mouse injected with 2-[(18)F]fluoro-CP-118,954, and a high striatal uptake was also detected in ex vivo optical and microPET images (ROI analysis: 1.4 %ID/g) and in γ-counting data (2.1 %ID/g at 50 min post-injection) of the brain tissues. Taken together, these results demonstrated that 2-[(18)F]fluoro-CP-118,954 specifically binds to AChE in mouse brains. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. MALDI MS imaging investigation of the host response to visceral leishmaniasis.

    PubMed

    Jaegger, C F; Negrão, F; Assis, D M; Belaz, K R A; Angolini, C F F; Fernandes, A M A P; Santos, V G; Pimentel, A; Abánades, D R; Giorgio, S; Eberlin, M N; Rocha, D F O

    2017-09-26

    Mass spectrometry imaging (MSI) of animal tissues has become an important tool for in situ molecular analyses and biomarker studies in several clinical areas, but there are few applications in parasitological studies. Leishmaniasis is a neglected tropical disease, and experimental mouse models have been essential to evaluate pathological and immunological processes and to develop diagnostic methods. Herein we have employed MALDI MSI to examine peptides and low molecular weight proteins (2 to 20 kDa) differentially expressed in the liver during visceral leishmaniasis in mice models. We analyzed liver sections of Balb/c mice infected with Leishmania infantum using the SCiLS Lab software for statistical analysis, which facilitated data interpretation and thus highlighted several key proteins and/or peptides. We proposed a decision tree classification for visceral leishmaniasis with distinct phases of the disease, which are named here as healthy, acute infection and chronic infection. Among others, the ion of m/z 4963 was the most important to identify acute infection and was tentatively identified as Thymosin β4. This peptide was previously established as a recovery factor in the human liver and might participate in the response of mice to Leishmania infection. This preliminary investigation shows the potential of MALDI MSI to complement classical compound selective imaging techniques and to explore new features not yet recognized by these approaches.

  8. Structured Illumination Diffuse Optical Tomography for Mouse Brain Imaging

    NASA Astrophysics Data System (ADS)

    Reisman, Matthew David

    As advances in functional magnetic resonance imaging (fMRI) have transformed the study of human brain function, they have also widened the divide between standard research techniques used in humans and those used in mice, where high quality images are difficult to obtain using fMRI given the small volume of the mouse brain. Optical imaging techniques have been developed to study mouse brain networks, which are highly valuable given the ability to study brain disease treatments or development in a controlled environment. A planar imaging technique known as optical intrinsic signal (OIS) imaging has been a powerful tool for capturing functional brain hemodynamics in rodents. Recent wide field-of-view implementations of OIS have provided efficient maps of functional connectivity from spontaneous brain activity in mice. However, OIS requires scalp retraction and is limited to imaging a 2-dimensional view of superficial cortical tissues. Diffuse optical tomography (DOT) is a non-invasive, volumetric neuroimaging technique that has been valuable for bedside imaging of patients in the clinic, but previous DOT systems for rodent neuroimaging have been limited by either sparse spatial sampling or by slow speed. My research has been to develop diffuse optical tomography for whole brain mouse neuroimaging by expanding previous techniques to achieve high spatial sampling using multiple camera views for detection and high speed using structured illumination sources. I have shown the feasibility of this method to perform non-invasive functional neuroimaging in mice and its capabilities of imaging the entire volume of the brain. Additionally, the system has been built with a custom, flexible framework to accommodate the expansion to imaging multiple dynamic contrasts in the brain and populations that were previously difficult or impossible to image, such as infant mice and awake mice. I have contributed to preliminary feasibility studies of these more advanced techniques using OIS, which can now be carried out using the structured illumination diffuse optical tomography technique to perform longitudinal, non-invasive studies of the whole volume of the mouse brain.

  9. SPION-enhanced magnetic resonance imaging of Alzheimer's disease plaques in AβPP/PS-1 transgenic mouse brain.

    PubMed

    Sillerud, Laurel O; Solberg, Nathan O; Chamberlain, Ryan; Orlando, Robert A; Heidrich, John E; Brown, David C; Brady, Christina I; Vander Jagt, Thomas A; Garwood, Michael; Vander Jagt, David L

    2013-01-01

    In our program to develop non-invasive magnetic resonance imaging (MRI) methods for the diagnosis of Alzheimer's disease (AD), we have synthesized antibody-conjugated, superparamagnetic iron oxide nanoparticles (SPIONs) for use as an in vivo agent for MRI detection of amyloid-β plaques in AD. Here we report studies in AβPP/PS1 transgenic mice, which demonstrate the ability of novel anti-AβPP conjugated SPIONs to penetrate the blood-brain barrier to act as a contrast agent for MR imaging of plaques. The conspicuity of the plaques increased from an average Z-score of 5.1 ± 0.5 to 8.3 ± 0.2 when the plaque contrast to noise ratio was compared in control AD mice with AD mice treated with SPIONs. The number of MRI-visible plaques per brain increased from 347 ± 45 in the control AD mice, to 668 ± 86 in the SPION treated mice. These results indicated that our SPION enhanced amyloid-β detection method delivers an efficacious, non-invasive MRI detection method in transgenic mice.

  10. SPION-Enhanced Magnetic Resonance Imaging of Alzheimer’s Disease Plaques in AβPP/PS-1 Transgenic Mouse Brain

    PubMed Central

    Sillerud, Laurel O.; Solberg, Nathan O.; Chamberlain, Ryan; Orlando, Robert A.; Heidrich, John E.; Brown, David C.; Brady, Christina I.; Vander Jagt, Thomas A.; Garwood, Michael; Vander Jagt, David L.

    2016-01-01

    In our program to develop non-invasive magnetic resonance imaging (MRI) methods for the diagnosis of Alzheimer’s disease (AD), we have synthesized antibody-conjugated, superparamagnetic iron oxide nanoparticles (SPIONs) for use as an in vivo agent for MRI detection of amyloid-β plaques in AD. Here we report studies in AβPP/PS1 transgenic mice, which demonstrate the ability of novel anti-AβPP conjugated SPIONs to penetrate the blood-brain barrier to act as a contrast agent for MR imaging of plaques. The conspicuity of the plaques increased from an average Z-score of 5.1 ± 0.5 to 8.3 ± 0.2 when the plaque contrast to noise ratio was compared in control AD mice with AD mice treated with SPIONs. The number of MRI-visible plaques per brain increased from 347 ± 45 in the control AD mice, to 668 ± 86 in the SPION treated mice. These results indicated that our SPION enhanced amyloid-β detection method delivers an efficacious, non-invasive MRI detection method in transgenic mice. PMID:23229079

  11. The application of anti-ESAT-6 monoclonal antibody fluorescent probe in ex vivo near-infrared fluorescence imaging in mice with pulmonary tuberculosis.

    PubMed

    Feng, Feng; Zhang, Haoling; Zhu, Zhaoqin; Li, Cong; Shi, Yuxin; Zhang, Zhiyong

    2014-09-01

    Here, we aimed to assess the feasibility of anti-ESAT-6 monoclonal antibody (mAb) coupling with IR783 and rhodamine fluorescent probe in the detection of ESAT-6 expression in tuberculosis tissue of mice using near-infrared fluorescence imaging. IR783 and rhodamine were conjugated to the anti-ESAT-6 mAb or IgG. Mice in the experimental group were injected with fluorescence-labeled mAb probe, and mice in the control group were injected with fluorescence-labeled non-specific IgG antibody. Twenty-four hours later, the lung tissue of mice was examined using ex vivo near-infrared fluorescence imaging. In addition, the contrast-to-noise ratio (CNR) was calculated by measuring the signal intensities of the pulmonary lesions, normal lung tissue and background noise. The frozen lung tissue section was examined under fluorescence microscopy and compared with hemoxylin and eosin (HE) staining. The ex vivo near-infrared fluorescence imaging showed that the fluorescence signal in the lung tuberculosis lesions in the experimental group was significantly enhanced, whereas there was only a weak fluorescence signal or even no fluorescence signal in the control group. CNR values were 64.40 ± 7.02 (n = 6) and 8.75 ± 3.87 (n = 6), respectively (t = 17.01, p < 0.001). The fluorescence accumulation distribution detected under fluorescence microscopy was consistent with HE staining of the tuberculosis region. In conclusion, anti-ESAT-6 mAb fluorescent probe could target and be applied in specific ex vivo imaging of mice tuberculosis, and may be of further use in tuberculosis in living mice. Copyright © 2013 John Wiley & Sons, Ltd.

  12. Searching for biomarkers of CDKL5 disorder: early-onset visual impairment in CDKL5 mutant mice.

    PubMed

    Mazziotti, Raffaele; Lupori, Leonardo; Sagona, Giulia; Gennaro, Mariangela; Della Sala, Grazia; Putignano, Elena; Pizzorusso, Tommaso

    2017-06-15

    CDKL5 disorder is a neurodevelopmental disorder still without a cure. Murine models of CDKL5 disorder have been recently generated raising the possibility of preclinical testing of treatments. However, unbiased, quantitative biomarkers of high translational value to monitor brain function are still missing. Moreover, the analysis of treatment is hindered by the challenge of repeatedly and non-invasively testing neuronal function. We analyzed the development of visual responses in a mouse model of CDKL5 disorder to introduce visually evoked responses as a quantitative method to assess cortical circuit function. Cortical visual responses were assessed in CDKL5 null male mice, heterozygous females, and their respective control wild-type littermates by repeated transcranial optical imaging from P27 until P32. No difference between wild-type and mutant mice was present at P25-P26 whereas defective responses appeared from P27-P28 both in heterozygous and homozygous CDKL5 mutant mice. These results were confirmed by visually evoked potentials (VEPs) recorded from the visual cortex of a different cohort. The previously imaged mice were also analyzed at P60-80 using VEPs, revealing a persistent reduction of response amplitude, reduced visual acuity and defective contrast function. The level of adult impairment was significantly correlated with the reduction in visual responses observed during development. Support vector machine showed that multi-dimensional visual assessment can be used to automatically classify mutant and wt mice with high reliability. Thus, monitoring visual responses represents a promising biomarker for preclinical and clinical studies on CDKL5 disorder. © The Author 2017. Published by Oxford University Press.

  13. The bioluminescent Listeria monocytogenes strain Xen32 is defective in flagella expression and highly attenuated in orally infected BALB/cJ mice.

    PubMed

    Bergmann, Silke; Rohde, Manfred; Schughart, Klaus; Lengeling, Andreas

    2013-07-15

    In vivo bioluminescence imaging (BLI) is a powerful method for the analysis of host-pathogen interactions in small animal models. The commercially available bioluminescent Listeria monocytogenes strain Xen32 is commonly used to analyse immune functions in knockout mice and pathomechanisms of listeriosis. To analyse and image listerial dissemination after oral infection we have generated a murinised Xen32 strain (Xen32-mur) which expresses a previously described mouse-adapted internalin A. This strain was used alongside the Xen32 wild type strain and the bioluminescent L. monocytogenes strains EGDe-lux and murinised EGDe-mur-lux to characterise bacterial dissemination in orally inoculated BALB/cJ mice. After four days of infection, Xen32 and Xen32-mur infected mice displayed consistently higher rates of bioluminescence compared to EGDe-lux and EGDe-mur-lux infected animals. However, surprisingly both Xen32 strains showed attenuated virulence in orally infected BALB/c mice that correlated with lower bacterial burden in internal organs at day 5 post infection, smaller losses in body weights and increased survival compared to EGDe-lux or EGDe-mur-lux inoculated animals. The Xen32 strain was made bioluminescent by integration of a lux-kan transposon cassette into the listerial flaA locus. We show here that this integration results in Xen32 in a flaA frameshift mutation which makes this strain flagella deficient. The bioluminescent L. monocytogenes strain Xen32 is deficient in flagella expression and highly attenuated in orally infected BALB/c mice. As this listerial strain has been used in many BLI studies of murine listeriosis, it is important that the scientific community is aware of its reduced virulence in vivo.

  14. Near-infrared lymphatic imaging demonstrates the dynamics of lymph flow and lymphangiogenesis during the acute versus chronic phases of arthritis in mice.

    PubMed

    Zhou, Quan; Wood, Ronald; Schwarz, Edward M; Wang, Yong-Jun; Xing, Lianping

    2010-07-01

    To develop an in vivo imaging method to assess lymphatic draining function in the K/BxN mouse model of inflammatory arthritis. Indocyanine green, a near-infrared fluorescent dye, was injected intradermally into the footpads of wild-type mice, mouse limbs were illuminated with an 806-nm near-infrared laser, and the movement of indocyanine green from the injection site to the draining popliteal lymph node (LN) was recorded with a CCD camera. Indocyanine green near-infrared images were analyzed to obtain 5 measures of lymphatic function across time. Images of K/BxN arthritic mice and control nonarthritic littermates were obtained at 1 month of age, when acute joint inflammation commenced, and again at 3 months of age, when joint inflammation became chronic. Lymphangiogenesis in popliteal LNs was assessed by immunochemistry. Indocyanine green and its transport within lymphatic vessels were readily visualized, and quantitative measures were derived. During the acute phase of arthritis, the lymphatic vessels were dilated, with increased indocyanine green signal intensity and lymphatic pulses, and popliteal LNs became fluorescent quickly. During the chronic phase, new lymphatic vessels were present near the foot. However, the appearance of indocyanine green in lymphatic vessels was delayed. The size and area of popliteal LN lymphatic sinuses progressively increased in the K/BxN mice. Our findings indicate that indocyanine green near-infrared lymphatic imaging is a valuable method for assessing the lymphatic draining function in mice with inflammatory arthritis. Indocyanine green-near-infrared imaging of K/BxN mice identified 2 distinct lymphatic phenotypes during the acute and chronic phase of inflammation. This technique can be used to assess new therapies for lymphatic disorders.

  15. Near infrared lymphatic imaging demonstrates the dynamics of lymph flow and lymphangiogenesis during the acute vs. chronic phases of arthritis in mice

    PubMed Central

    Zhou, Quan; Wood, Ronald; Schwarz, Edward M.; Wang, Yong-Jun; Xing, Lianping

    2010-01-01

    Objective Development of an in vivo imaging method to assess lymphatic draining function in the K/B×N mouse model of inflammatory arthritis. Methods Indocyanine green (ICG), a near-infrared (NIR) fluorescent dye, was injected intradermally into the footpad of wild-type mice, the limb was illuminated with an 806 nm NIR laser, and the movement of ICG from the injection site to the draining popliteal lymph node (PLN) was recorded with a CCD camera. ICG-NIR images were analyzed to obtain 5 measures of lymphatic function across time. K/B×N arthritic mice and control non-arthritic littermates were imaged at one-month of age when acute joint inflammation commenced, and repeated at 3 months when joint inflammation became chronic. Lymphangiogenesis in PLNs was assessed by immunochemistry. Results ICG and its transport within lymphatic vessels were readily visualized and quantitative measures derived. During the acute phase of arthritis, the lymphatic vessels were dilated with increased ICG signal intensity and lymphatic pulses, and PLNs became fluorescent quickly. During the chronic phase, new lymphatic vessels were present near the foot. However, ICG appearance in lymphatic vessels was delayed. The size and area of PLN lymphatic sinuses progressively increased in the K/B×N mice. Conclusion ICG-NIR lymphatic imaging is a valuable method to assess the lymphatic draining function in mice with inflammatory arthritis. ICG-NIR imaging of K/B×N mice identified two distinct lymphatic phenotypes during the acute and chronic phase of inflammation. This technique can be used to assess new therapies for lymphatic disorders. PMID:20309866

  16. Noninvasive measurement of pharmacokinetics by near-infrared fluorescence imaging in the eye of mice

    NASA Astrophysics Data System (ADS)

    Dobosz, Michael; Strobel, Steffen; Stubenrauch, Kay-Gunnar; Osl, Franz; Scheuer, Werner

    2014-01-01

    Purpose: For generating preclinical pharmacokinetics (PKs) of compounds, blood is drawn at different time points and levels are quantified by different analytical methods. In order to receive statistically meaningful data, 3 to 5 animals are used for each time point to get serum peak-level and half-life of the compound. Both characteristics are determined by data interpolation, which may influence the accuracy of these values. We provide a method that allows continuous monitoring of blood levels noninvasively by measuring the fluorescence intensity of labeled compounds in the eye and other body regions of anesthetized mice. Procedures: The method evaluation was performed with four different fluorescent compounds: (i) indocyanine green, a nontargeting dye; (ii) OsteoSense750, a bone targeting agent; (iii) tumor targeting Trastuzumab-Alexa750; and (iv) its F(-alxea750 fragment. The latter was used for a direct comparison between fluorescence imaging and classical blood analysis using enzyme-linked immunosorbent assay (ELISA). Results: We found an excellent correlation between blood levels measured by noninvasive eye imaging with the results generated by classical methods. A strong correlation between eye imaging and ELISA was demonstrated for the F( fragment. Whole body imaging revealed a compound accumulation in the expected regions (e.g., liver, bone). Conclusions: The combination of eye and whole body fluorescence imaging enables the simultaneous measurement of blood PKs and biodistribution of fluorescent-labeled compounds.

  17. Novel Inhibitors of Protein-Protein Interaction for Prostate Cancer Therapy

    DTIC Science & Technology

    2014-04-01

    treated mice compared to vehicle control. A subset of mice was followed by longitudinal MRI imaging for prostate tumor growth. As shown in Figure...treated (N=7) mice were followed by longitudinal MRI imaging for tumor growth (bottom panel). 9 KEY RESEARCH ACCOMPLISHMENTS • Identified...EDTA) containing a tablet of complete protease inhibitors from Roche (Indianapolis, IN). Total protein from each sample was separated on a 4–12% Bis

  18. Quantitative CT imaging for adipose tissue analysis in mouse model of obesity

    NASA Astrophysics Data System (ADS)

    Marchadier, A.; Vidal, C.; Tafani, J.-P.; Ordureau, S.; Lédée, R.; Léger, C.

    2011-03-01

    In obese humans CT imaging is a validated method for follow up studies of adipose tissue distribution and quantification of visceral and subcutaneous fat. Equivalent methods in murine models of obesity are still lacking. Current small animal micro-CT involves long-term X-ray exposure precluding longitudinal studies. We have overcome this limitation by using a human medical CT which allows very fast 3D imaging (2 sec) and minimal radiation exposure. This work presents novel methods fitted to in vivo investigations of mice model of obesity, allowing (i) automated detection of adipose tissue in abdominal regions of interest, (ii) quantification of visceral and subcutaneous fat. For each mouse, 1000 slices (100μm thickness, 160 μm resolution) were acquired in 2 sec using a Toshiba medical CT (135 kV, 400mAs). A Gaussian mixture model of the Hounsfield curve of 2D slices was computed with the Expectation Maximization algorithm. Identification of each Gaussian part allowed the automatic classification of adipose tissue voxels. The abdominal region of interest (umbilical) was automatically detected as the slice showing the highest ratio of the Gaussian proportion between adipose and lean tissues. Segmentation of visceral and subcutaneous fat compartments was achieved with 2D 1/2 level set methods. Our results show that the application of human clinical CT to mice is a promising approach for the study of obesity, allowing valuable comparison between species using the same imaging materials and software analysis.

  19. Semi-automated method to measure pneumonia severity in mice through computed tomography (CT) scan analysis

    NASA Astrophysics Data System (ADS)

    Johri, Ansh; Schimel, Daniel; Noguchi, Audrey; Hsu, Lewis L.

    2010-03-01

    Imaging is a crucial clinical tool for diagnosis and assessment of pneumonia, but quantitative methods are lacking. Micro-computed tomography (micro CT), designed for lab animals, provides opportunities for non-invasive radiographic endpoints for pneumonia studies. HYPOTHESIS: In vivo micro CT scans of mice with early bacterial pneumonia can be scored quantitatively by semiautomated imaging methods, with good reproducibility and correlation with bacterial dose inoculated, pneumonia survival outcome, and radiologists' scores. METHODS: Healthy mice had intratracheal inoculation of E. coli bacteria (n=24) or saline control (n=11). In vivo micro CT scans were performed 24 hours later with microCAT II (Siemens). Two independent radiologists scored the extent of airspace abnormality, on a scale of 0 (normal) to 24 (completely abnormal). Using the Amira 5.2 software (Mercury Computer Systems), a histogram distribution of voxel counts between the Hounsfield range of -510 to 0 was created and analyzed, and a segmentation procedure was devised. RESULTS: A t-test was performed to determine whether there was a significant difference in the mean voxel value of each mouse in the three experimental groups: Saline Survivors, Pneumonia Survivors, and Pneumonia Non-survivors. It was found that the voxel count method was able to statistically tell apart the Saline Survivors from the Pneumonia Survivors, the Saline Survivors from the Pneumonia Non-survivors, but not the Pneumonia Survivors vs. Pneumonia Non-survivors. The segmentation method, however, was successfully able to distinguish the two Pneumonia groups. CONCLUSION: We have pilot-tested an evaluation of early pneumonia in mice using micro CT and a semi-automated method for lung segmentation and scoring system. Statistical analysis indicates that the system is reliable and merits further evaluation.

  20. Utility of magnetic resonance imaging and nuclear magnetic resonance-based metabolomics for quantification of inflammatory lung injury

    PubMed Central

    Serkova, Natalie J.; Van Rheen, Zachary; Tobias, Meghan; Pitzer, Joshua E.; Wilkinson, J. Erby; Stringer, Kathleen A.

    2008-01-01

    Magnetic resonance imaging (MRI) and metabolic nuclear magnetic resonance (NMR) spectroscopy are clinically available but have had little application in the quantification of experimental lung injury. There is a growing and unfulfilled need for predictive animal models that can improve our understanding of disease pathogenesis and therapeutic intervention. Integration of MRI and NMR could extend the application of experimental data into the clinical setting. This study investigated the ability of MRI and metabolic NMR to detect and quantify inflammation-mediated lung injury. Pulmonary inflammation was induced in male B6C3F1 mice by intratracheal administration of IL-1β and TNF-α under isoflurane anesthesia. Mice underwent MRI at 2, 4, 6, and 24 h after dosing. At 6 and 24 h lungs were harvested for metabolic NMR analysis. Data acquired from IL-1β+TNF-α-treated animals were compared with saline-treated control mice. The hyperintense-to-total lung volume (HTLV) ratio derived from MRI was higher in IL-1β+TNF-α-treated mice compared with control at 2, 4, and 6 h but returned to control levels by 24 h. The ability of MRI to detect pulmonary inflammation was confirmed by the association between HTLV ratio and histological and pathological end points. Principal component analysis of NMR-detectable metabolites also showed a temporal pattern for which energy metabolism-based biomarkers were identified. These data demonstrate that both MRI and metabolic NMR have utility in the detection and quantification of inflammation-mediated lung injury. Integration of these clinically available techniques into experimental models of lung injury could improve the translation of basic science knowledge and information to the clinic. PMID:18441091

  1. SPECT-imaging of activity-dependent changes in regional cerebral blood flow induced by electrical and optogenetic self-stimulation in mice.

    PubMed

    Kolodziej, Angela; Lippert, Michael; Angenstein, Frank; Neubert, Jenni; Pethe, Annette; Grosser, Oliver S; Amthauer, Holger; Schroeder, Ulrich H; Reymann, Klaus G; Scheich, Henning; Ohl, Frank W; Goldschmidt, Jürgen

    2014-12-01

    Electrical and optogenetic methods for brain stimulation are widely used in rodents for manipulating behavior and analyzing functional connectivities in neuronal circuits. High-resolution in vivo imaging of the global, brain-wide, activation patterns induced by these stimulations has remained challenging, in particular in awake behaving mice. We here mapped brain activation patterns in awake, intracranially self-stimulating mice using a novel protocol for single-photon emission computed tomography (SPECT) imaging of regional cerebral blood flow (rCBF). Mice were implanted with either electrodes for electrical stimulation of the medial forebrain bundle (mfb-microstim) or with optical fibers for blue-light stimulation of channelrhodopsin-2 expressing neurons in the ventral tegmental area (vta-optostim). After training for self-stimulation by current or light application, respectively, mice were implanted with jugular vein catheters and intravenously injected with the flow tracer 99m-technetium hexamethylpropyleneamine oxime (99mTc-HMPAO) during seven to ten minutes of intracranial self-stimulation or ongoing behavior without stimulation. The 99mTc-brain distributions were mapped in anesthetized animals after stimulation using multipinhole SPECT. Upon self-stimulation rCBF strongly increased at the electrode tip in mfb-microstim mice. In vta-optostim mice peak activations were found outside the stimulation site. Partly overlapping brain-wide networks of activations and deactivations were found in both groups. When testing all self-stimulating mice against all controls highly significant activations were found in the rostromedial nucleus accumbens shell. SPECT-imaging of rCBF using intravenous tracer-injection during ongoing behavior is a new tool for imaging regional brain activation patterns in awake behaving rodents providing higher spatial and temporal resolutions than 18F-2-fluoro-2-dexoyglucose positron emission tomography. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  2. In vivo bioluminescence imaging to evaluate systemic and topical antibiotics against community-acquired methicillin-resistant Staphylococcus aureus-infected skin wounds in mice.

    PubMed

    Guo, Yi; Ramos, Romela Irene; Cho, John S; Donegan, Niles P; Cheung, Ambrose L; Miller, Lloyd S

    2013-02-01

    Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) frequently causes skin and soft tissue infections, including impetigo, cellulitis, folliculitis, and infected wounds and ulcers. Uncomplicated CA-MRSA skin infections are typically managed in an outpatient setting with oral and topical antibiotics and/or incision and drainage, whereas complicated skin infections often require hospitalization, intravenous antibiotics, and sometimes surgery. The aim of this study was to develop a mouse model of CA-MRSA wound infection to compare the efficacy of commonly used systemic and topical antibiotics. A bioluminescent USA300 CA-MRSA strain was inoculated into full-thickness scalpel wounds on the backs of mice and digital photography/image analysis and in vivo bioluminescence imaging were used to measure wound healing and the bacterial burden. Subcutaneous vancomycin, daptomycin, and linezolid similarly reduced the lesion sizes and bacterial burden. Oral linezolid, clindamycin, and doxycycline all decreased the lesion sizes and bacterial burden. Oral trimethoprim-sulfamethoxazole decreased the bacterial burden but did not decrease the lesion size. Topical mupirocin and retapamulin ointments both reduced the bacterial burden. However, the petrolatum vehicle ointment for retapamulin, but not the polyethylene glycol vehicle ointment for mupirocin, promoted wound healing and initially increased the bacterial burden. Finally, in type 2 diabetic mice, subcutaneous linezolid and daptomycin had the most rapid therapeutic effect compared with vancomycin. Taken together, this mouse model of CA-MRSA wound infection, which utilizes in vivo bioluminescence imaging to monitor the bacterial burden, represents an alternative method to evaluate the preclinical in vivo efficacy of systemic and topical antimicrobial agents.

  3. Two-photon imaging in mice shows striosomes and matrix have overlapping but differential reinforcement-related responses

    PubMed Central

    Sur, Mriganka

    2017-01-01

    Striosomes were discovered several decades ago as neurochemically identified zones in the striatum, yet technical hurdles have hampered the study of the functions of these striatal compartments. Here we used 2-photon calcium imaging in neuronal birthdate-labeled Mash1-CreER;Ai14 mice to image simultaneously the activity of striosomal and matrix neurons as mice performed an auditory conditioning task. With this method, we identified circumscribed zones of tdTomato-labeled neuropil that correspond to striosomes as verified immunohistochemically. Neurons in both striosomes and matrix responded to reward-predicting cues and were active during or after consummatory licking. However, we found quantitative differences in response strength: striosomal neurons fired more to reward-predicting cues and encoded more information about expected outcome as mice learned the task, whereas matrix neurons were more strongly modulated by recent reward history. These findings open the possibility of harnessing in vivo imaging to determine the contributions of striosomes and matrix to striatal circuit function. PMID:29251596

  4. Murine cutaneous leishmaniasis investigated by MALDI mass spectrometry imaging.

    PubMed

    Negrão, Fernanda; de O Rocha, Daniele F; Jaeeger, Caroline F; Rocha, Francisca J S; Eberlin, Marcos N; Giorgio, Selma

    2017-09-26

    Imaging mass spectrometry (IMS) is recognized as a powerful tool to investigate the spatial distribution of untargeted or targeted molecules of a wide variety of samples including tissue sections. Leishmania is a protozoan parasite that causes different clinical manifestations in mammalian hosts. Leishmaniasis is a major public health risk in different continents and represents one of the most important neglected diseases. Cutaneous lesions from mice experimentally infected with Leishmania spp. were investigated by matrix-assisted laser desorption ionization MS using the SCiLS Lab software for statistical analysis. Being applied to cutaneous leishmaniasis (CL) for the first time, MALDI-IMS was used to search for peptides and low molecular weight proteins (2-10 kDa) as candidates for potential biomarkers. Footpad sections of Balb/c mice infected with (i) Leishmania amazonensis or (ii) Leishmania major were imaged. The comparison between healthy and infected skin highlighted a set of twelve possible biomarker proteins for L. amazonenis and four proteins for L. major. Further characterization of these proteins could reveal how these proteins act in pathology progression and confirm their values as biomarkers.

  5. Effects of nanoencapsulation and PEGylation on biodistribution of indocyanine green in healthy mice: quantitative fluorescence imaging and analysis of organs

    PubMed Central

    Bahmani, Baharak; Lytle, Christian Y; Walker, Ameae M; Gupta, Sharad; Vullev, Valentine I; Anvari, Bahman

    2013-01-01

    Near-infrared nanoconstructs present a potentially effective platform for site-specific and deep tissue optical imaging and phototherapy. We have engineered a polymeric nanocapsule composed of polyallylamine hydrochloride (PAH) chains cross-linked with sodium phosphate and doped with indocyanine green (ICG) toward such endeavors. The ICG-doped nanocapsules were coated covalently with polyethylene glycol (5000 daltons) through reductive amination. We administrated the constructs by tail vein injection to healthy mice. To characterize the biodistribution of the constructs, we performed in vivo quantitative fluorescence imaging and subsequently analyzed the various extracted organs. Our results suggest that encapsulation of ICG in these PEGylated constructs is an effective approach to prolong the circulation time of ICG and delay its hepatic accumulation. Increased bioavailability of ICG, due to encapsulation, offers the potential of extending the clinical applications of ICG, which are currently limited due to rapid elimination of ICG from the vasculature. Our results also indicate that PAH and ICG-doped nanocapsules (ICG-NCs) are not cytotoxic at the levels used in this study. PMID:23637530

  6. A Real-Time Near-Infrared Fluorescence Imaging Method for the Detection of Oral Cancers in Mice Using an Indocyanine Green-Labeled Podoplanin Antibody.

    PubMed

    Ito, Akihiro; Ohta, Mitsuhiko; Kato, Yukinari; Inada, Shunko; Kato, Toshio; Nakata, Susumu; Yatabe, Yasushi; Goto, Mitsuo; Kaneda, Norio; Kurita, Kenichi; Nakanishi, Hayao; Yoshida, Kenji

    2018-01-01

    Podoplanin is distinctively overexpressed in oral squamous cell carcinoma than oral benign neoplasms and plays a crucial role in the pathogenesis and metastasis of oral squamous cell carcinoma but its diagnostic application is quite limited. Here, we report a new near-infrared fluorescence imaging method using an indocyanine green (ICG)-labeled anti-podoplanin antibody and a desktop/a handheld ICG detection device for the visualization of oral squamous cell carcinoma-xenografted tumors in nude mice. Both near-infrared imaging methods using a desktop (in vivo imaging system: IVIS) and a handheld device (photodynamic eye: PDE) successfully detected oral squamous cell carcinoma tumors in nude mice in a podoplanin expression-dependent manner with comparable sensitivity. Of these 2 devices, only near-infrared imaging methods using a handheld device visualized oral squamous cell carcinoma xenografts in mice in real time. Furthermore, near-infrared imaging methods using the handheld device (PDE) could detect smaller podoplanin-positive oral squamous cell carcinoma tumors than a non-near-infrared, autofluorescence-based imaging method. Based on these results, a near-infrared imaging method using an ICG-labeled anti-podoplanin antibody and a handheld detection device (PDE) allows the sensitive, semiquantitative, and real-time imaging of oral squamous cell carcinoma tumors and therefore represents a useful tool for the detection and subsequent monitoring of malignant oral neoplasms in both preclinical and some clinical settings.

  7. A Real-Time Near-Infrared Fluorescence Imaging Method for the Detection of Oral Cancers in Mice Using an Indocyanine Green–Labeled Podoplanin Antibody

    PubMed Central

    Ito, Akihiro; Ohta, Mitsuhiko; Kato, Yukinari; Inada, Shunko; Kato, Toshio; Nakata, Susumu; Yatabe, Yasushi; Goto, Mitsuo; Kaneda, Norio; Kurita, Kenichi; Nakanishi, Hayao; Yoshida, Kenji

    2018-01-01

    Podoplanin is distinctively overexpressed in oral squamous cell carcinoma than oral benign neoplasms and plays a crucial role in the pathogenesis and metastasis of oral squamous cell carcinoma but its diagnostic application is quite limited. Here, we report a new near-infrared fluorescence imaging method using an indocyanine green (ICG)–labeled anti-podoplanin antibody and a desktop/a handheld ICG detection device for the visualization of oral squamous cell carcinoma–xenografted tumors in nude mice. Both near-infrared imaging methods using a desktop (in vivo imaging system: IVIS) and a handheld device (photodynamic eye: PDE) successfully detected oral squamous cell carcinoma tumors in nude mice in a podoplanin expression–dependent manner with comparable sensitivity. Of these 2 devices, only near-infrared imaging methods using a handheld device visualized oral squamous cell carcinoma xenografts in mice in real time. Furthermore, near-infrared imaging methods using the handheld device (PDE) could detect smaller podoplanin-positive oral squamous cell carcinoma tumors than a non-near-infrared, autofluorescence-based imaging method. Based on these results, a near-infrared imaging method using an ICG-labeled anti-podoplanin antibody and a handheld detection device (PDE) allows the sensitive, semiquantitative, and real-time imaging of oral squamous cell carcinoma tumors and therefore represents a useful tool for the detection and subsequent monitoring of malignant oral neoplasms in both preclinical and some clinical settings. PMID:29649929

  8. Application of a Novel Murine Ear Vein Model to Evaluate the Effects of a Vascular Radioprotectant on Radiation-Induced Vascular Permeability and Leukocyte Adhesion.

    PubMed

    Ashcraft, Kathleen A; Choudhury, Kingshuk Roy; Birer, Sam R; Hendargo, Hansford C; Patel, Pranalee; Eichenbaum, Gary; Dewhirst, Mark W

    2018-04-19

    Vascular injury after radiation exposure contributes to multiple types of tissue injury through a cascade of events. Some of the earliest consequences of radiation damage include increased vascular permeability and promotion of inflammation, which is partially manifested by increased leukocyte-endothelial (L/E) interactions. We describe herein a novel intravital imaging method to evaluate L/E interactions, as a function of shear stress, and vascular permeability at multiple time points after local irradiation to the ear. This model permitted analysis of quiescent vasculature that was not perturbed by any surgical manipulation prior to imaging. To evaluate the effects of radiation on vascular integrity, fluorescent dextran was injected intravenously and its extravasation in the extravascular space surrounding the ear vasculature was measured at days 3 and 7 after 6 Gy irradiation. The vascular permeability rate increased approximately twofold at both days 3 and 7 postirradiation ( P < 0.05). Leukocyte rolling, which is indicative of L/E interactions, was significantly increased in mice at 24 h postirradiation compared to that of nonirradiated mice. To assess our model, as a means for assessing vascular radioprotectants, we treated additional cohorts of mice with a thrombopoietin mimetic, TPOm (RWJ-800088). In addition to stimulating platelet formation, thrombopoietin can protect vasculature after several forms of injury. Thus, we hypothesized that TPOm would reduce vascular permeability and L/E adhesion after localized irradiation to the ear vasculature of mice. If TPOm reduced these consequences of radiation, it would validate the utility of our intravital imaging method. TPOm reduced radiation-induced vascular leakage to control levels at day 7. Furthermore, L/E cell interactions were also reduced in irradiated mice treated with TPOm, compared with mice receiving irradiation alone, particularly at high shear stress ( P = 0.03, Kruskal-Wallis). We conclude that the ear model is useful for monitoring quiescent normal tissue vascular injury after radiation exposure. Furthermore, the application of TPOm, for preventing early inflammatory response created by damage to vascular endothelium, suggests that this drug may prove useful in reducing toxicities from radiotherapy, which damage microvasculature that critically important to tissue function.

  9. In-vivo and in-situ detection of atherosclerotic plaques using full-range complex-conjugate-free spectral domain optical coherence tomography in the murine carotid

    NASA Astrophysics Data System (ADS)

    Huang, Yong; Wicks, Robert; Zhang, Kang; Zhao, Mingtao; Tyler, Betty M.; Hwang, Lee; Pradilla, Gustavo; Kang, Jin U.

    2013-03-01

    Carotid endarterectomy is a common vascular surgical procedure which may help prevent patients' risk of having a stroke. A high resolution real-time imaging technique that can detect the position and size of vascular plaques would provide great value to reduce the risk level and increase the surgical outcome. Optical coherence tomography (OCT), as a high resolution high speed noninvasive imaging technique, was evaluated in this study. Twenty-four 24-week old apolipoprotein E-deficient (ApoE-/-) mice were divided into three groups with 8 in each. One served as the control group fed with normal diet. One served as the study group fed with high-fat diet to induce atherosclerosis. The last served as the treatment group fed with both high-fat diet and medicine to treat atherosclerosis. Full-range, complex-conjugate-free spectral-domain OCT was used to image the mouse aorta near the neck area in-vivo with aorta exposed to the imaging head through surgical procedure. 2D and 3D images of the area of interest were presented real-time through graphics processing unit accelerated algorithm. In-situ imaging of all the mice after perfusion were performed again to validate the invivo detection result and to show potential capability of OCT if combined with surgical saline flush. Later all the imaged arteries were stained with H and E to perform histology analysis. Preliminary results confirmed the accuracy and fast imaging speed of OCT imaging technique in determining atherosclerosis.

  10. Analysis of Tumor Vessel Supply in Lewis Lung Carcinoma in Mice by Fluorescent Microsphere Distribution and Imaging with Micro- and Flat-Panel Computed Tomography

    PubMed Central

    Savai, Rajkumar; Wolf, Joachim C.; Greschus, Susanne; Eul, Bastian G.; Schermuly, Ralph T.; Hänze, Jörg; Voswinckel, Robert; Langheinrich, Alexander C.; Grimminger, Friedrich; Traupe, Horst; Seeger, Werner; Rose, Frank

    2005-01-01

    In lung carcinomas the blood supply varies depending on tumor type and stage and can develop from pulmonary or bronchial circulation, or both. To examine this in vivo, primary bronchogenic Lewis lung carcinoma cells were intratracheally instilled in C57BL/6 mice. Within 7 days, histological examinations showed progressive tumor growth at the peripheral parenchymal region. The relative contribution of tumor blood supply via the pulmonary and systemic arteries was studied in detail using fluorescent microspheres (10 μm). When compared to healthy lung parenchyma (13:1), Lewis lung carcinoma tumor tissue (52:1) showed a fourfold increase in pulmonary to systemic microspheres, indicating that the pulmonary arteries are the predominant tumor-feeding vessels. After filling the vessels with a vascular cast, the microanatomy of vessels being derived from the pulmonary artery was visualized with micro computed tomography. Flat-panel volumetric computed tomography provided longitudinal visualization of tissue bridges between the growing tumor and the pulmonary vasculature. In this model of peripheral parenchymal malignancy, new imaging techniques allowed effective visualization of lung tumor growth and vascularization in living mice, demonstrating a pulmonary blood supply for lung tumors. PMID:16192630

  11. Boron nitride nanotubes radiolabeled with ⁹⁹mTc: preparation, physicochemical characterization, biodistribution study, and scintigraphic imaging in Swiss mice.

    PubMed

    Soares, Daniel Crístian Ferreira; Ferreira, Tiago Hilário; Ferreira, Carolina de Aguiar; Cardoso, Valbert Nascimento; de Sousa, Edésia Martins Barros

    2012-02-28

    In the present study, boron nitride nanotubes (BNNTs) were synthesized from an innovative process and functionalized with a glycol chitosan polymer in CDTN (Centro de Desenvolvimento da Tecnologia Nuclear) laboratories. As a means of studying their in vivo biodistribution behavior, these nanotubes were radiolabeled with (99m)Tc and injected in mice. Their size, distribution, and homogeneity were determined by photon correlation spectroscopy (PCS), while their zeta potential was determined by laser Doppler anemometry. The morphology and structural organization were evaluated by scanning electron microscopy (SEM). The functionalization in the nanotubes was evaluated by thermogravimetry analysis (TGA) and Fourier transformer infrared spectroscopy. The results showed that BNNTs were obtained and functionalized successfully, reaching a mean size and dispersity deemed adequate for in vivo studies. The BNNTs were also evaluated by ex vivo biodistribution studies and scintigraphic imaging in healthy mice. The results showed that nanostructures, after 24h, having accumulated in the liver, spleen and gut, and eliminated via renal excretion. The findings from this study reveal a potential application of functionalized BNNTs as new potential drugs or radioisotope nanocarriers to be applied in therapeutic procedures. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Cerebral edema induced in mice by a convulsive dose of soman. Evaluation through diffusion-weighted magnetic resonance imaging and histology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Testylier, Guy; Lahrech, Hana; Universite Joseph Fourier, Grenoble, F-38043

    2007-04-15

    Purpose: In the present study, diffusion-weighted magnetic resonance imaging (DW-MRI) and histology were used to assess cerebral edema and lesions in mice intoxicated by a convulsive dose of soman, an organophosphate compound acting as an irreversible cholinesterase inhibitor. Methods: Three hours and 24 h after the intoxication with soman (172 {mu}g/kg), the mice were anesthetized with an isoflurane/N{sub 2}O mixture and their brain examined with DW-MRI. After the imaging sessions, the mice were sacrificed for histological analysis of their brain. Results: A decrease in the apparent diffusion coefficient (ADC) was detected as soon as 3 h after the intoxication andmore » was found strongly enhanced at 24 h. A correlation was obtained between the ADC change and the severity of the overall brain damage (edema and cellular degeneration): the more severe the damage, the stronger the ADC drop. Anesthesia was shown to interrupt soman-induced seizures and to attenuate edema and cell change in certain sensitive brain areas. Finally, brain water content was assessed using the traditional dry/wet weight method. A significant increase of brain water was observed following the intoxication. Conclusions: The ADC decrease observed in the present study suggests that brain edema in soman poisoning is mainly intracellular and cytotoxic. Since entry of water into Brain was also evidenced, this type of edema is certainly mixed with others (vasogenic, hydrostatic, osmotic). The present study confirms the potential of DW-MRI as a non-invasive tool for monitoring the acute neuropathological consequences (edema and neurodegeneration) of soman-induced seizures.« less

  13. Preparation and Identification of HER2 Radioactive Ligands and Imaging Study of Breast Cancer-Bearing Nude Mice.

    PubMed

    Zhang, Meng-Zhi; Guan, Yan-Xing; Zhong, Jin-Xiu; Chen, Xue-Zhong

    2017-08-01

    A micro-molecule peptide TP1623 of 99m Tc-human epithelial growth factor receptor 2 (HER2) was prepared and the feasibility of using it as a HER2-positive molecular imaging agent for breast cancer was evaluated. TP1623 was chemically synthesized and labeled with 99m Tc. The labeling ratio and stability were detected. HER2 expression levels of breast cancer cells (SKBR3 and MDA-MB-231) and cell binding activity were measured. Biodistribution of 99m TC-TP1623 in normal mice was detected. SKBR3/MDA-MB-231-bearing nude mice models with high/low expressions of HER2 were established. Tumor tissues were stained with hematoxylin-eosin (HE) and measured by immunohistochemistry to confirm the formation of tumors and HER2 expression. SPECT imaging was conducted for HER2-overexpressing SKBR3-bearing nude mice. The T/NT ratio was calculated and compared with that of MDA-MB-231-bearing nude mice with low HER2 expression. The competitive inhibition image was used to discuss the specific binding of 99m Tc- TP1623 and the tumor. The labeling ratio of 99m Tc-TP1623, specific activity, and radiochemical purity (RCP) after 6 h at room temperature were (97.39 ± 0.23)%, (24.61 ± 0.06) TBq/mmol, and (93.25 ± 0.06)%, respectively. HER2 of SKBR3 and MDA-MB-231 cells showed high and low expression levels by immunohistochemistry, respectively. The in vitro receptor assays indicated that specific binding of TP1623 and HER2 was retained. Radioactivity in the brain was always at the lowest level, while the clearance rate of blood and the excretion rate of the kidneys were fast. HE staining showed that tumor cells were observed in SKBR3- and MDA-MB-231-bearing nude mice, with significant heteromorphism and increased mitotic count. The imaging of mice showed that targeted images could be made of 99m Tc-TP1623 in high HER2-expressing tumors, while no obvious development was shown in tumors in low HER2-expressing nude mice. No development was visible in tumors in competitive inhibition of imaging, which indicates the combination of 99m Tc-TP1623 and tumor was mediated by HER2. High labeling ratio and specific activity of 99m Tc-TP1623 is successfully prepared; it is a molecular imaging agent for HER2-positive tumors that has potential applicative value. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Micro–Single-Photon Emission Computed Tomography Image Acquisition and Quantification of Sodium-Iodide Symporter–Mediated Radionuclide Accumulation in Mouse Thyroid and Salivary Glands

    PubMed Central

    Brandt, Michael P.; Kloos, Richard T.; Shen, Daniel H.; Zhang, Xiaoli; Liu, Yu-Yu

    2012-01-01

    Background Micro–single-photon emission computed tomography (SPECT) provides a noninvasive way to evaluate the effects of genetic and/or pharmacological modulation on sodium-iodide symporter (NIS)–mediated radionuclide accumulation in mouse thyroid and salivary glands. However, parameters affecting image acquisition and analysis of mouse thyroids and salivary glands have not been thoroughly investigated. In this study, we investigated the effects of region-of-interest (ROI) selection, collimation, scan time, and imaging orbit on image acquisition and quantification of thyroidal and salivary radionuclide accumulation in mice. Methods The effects of data window minima and maxima on thyroidal and salivary ROI selection using a visual boundary method were examined in SPECT images acquired from mice injected with 123I NaI. The effects of collimation, scan time, and imaging orbit on counting linearity and signal intensity were investigated using phantoms filled with various activities of 123I NaI or Tc-99m pertechnetate. Spatial resolution of target organs in whole-animal images was compared between circular orbit with parallel-hole collimation and spiral orbit with five-pinhole collimation. Lastly, the inter-experimental variability of the same mouse scanned multiple times was compared with the intra-experimental variability among different mice scanned at the same time. Results Thyroid ROI was separated from salivary glands by empirically increasing the data window maxima. Counting linearity within the range of 0.5–14.2 μCi was validated by phantom imaging using single- or multiple-pinhole collimators with circular or spiral imaging orbit. Scanning time could be shortened to 15 minutes per mouse without compromising counting linearity despite proportionally decreased signal intensity. Whole-animal imaging using a spiral orbit with five-pinhole collimators achieved a high spatial resolution and counting linearity. Finally, the extent of inter-experimental variability of NIS-mediated radionuclide accumulation in the thyroid and salivary glands by SPECT imaging in the same mouse was less than the magnitude of variability among the littermates. Conclusions The impacts of multiple variables and experimental designs on micro-SPECT imaging and quantification of radionuclide accumulation in mouse thyroid and salivary glands can be minimized. This platform will serve as an invaluable tool to screen for pharmacologic reagents that differentially modulate thyroidal and salivary radioiodine accumulation in preclinical mouse models. PMID:22540327

  15. Imaging Lung Clearance of Radiolabeled Tumor Cells to Study Mice with Normal, Activated or Depleted Natural Killer (NK) Cells

    NASA Astrophysics Data System (ADS)

    Kulkarni, P. V.; Bennett, M.; Constantinescu, A.; Arora, V.; Viguet, M.; Antich, P.; Parkey, R. W.; Mathews, D.; Mason, R. P.; Oz, O. K.

    2003-08-01

    Lung clearance of 51CR and 125I iododeoxyuridine (IUDR) labeled cancer cells assess NK cell activity. It is desirable to develop noninvasive imaging technique to assess NK activity in mice. We labeled target YAC-1 tumor cells with 125I, 111In, 99mTc, or 67Ga and injected I.V. into three groups of BALB/c mice. Animals were treated with medium (group I), 300mg/kg cyclophosmamide (CY) to kill NK cell (group II), or anti-LY49C/1) (ab')2 mAb to augment NK function (group III). Lungs were removed 15 min or 2 h later for tissue counting. Control and treated mice were imaged every 5 min with a scintillating camera for 1 h after 15 min of infusion of the 111In labeled cells. Lung clearance increased after 15 min (lodging: 60-80%) and (2 h retention: 3-7%). Similar results were obtained with all the isotopes studied. Images distinguished the control and treated mice for lung activity. Cells labeled with 111In, 99mTc or 67Ga are cleared similar to those labeled with 51Cr or 125I. NK cell destruction of tumor cells may be assessed by noninvasive imaging method either by SPECT (99mTc, 111In, 67Ga) or by PET (68Ga).

  16. Visualization and body distribution of [¹³¹I]-herceptin in nude mice with BT-474 breast carcinoma.

    PubMed

    Yang, Z X; Cao, H; Xing, C G; Wei, S H; Jiang, G Q; Liu, Z L

    2014-08-29

    The study aimed to investigate the bio-distribution and radio-immuno-imaging features of [(131)I]-herceptin in nude mice with BT-474 breast carcinoma. [(131)I]-Herceptin was administrated by tail intravenous injection to the nude mice with BT-474 breast carcinoma. Radiocounting was performed at 4, 12, 24, 48, and 96 h after administration. The activity ratio in the tumor tissue and non-tumor tissue (T/NT) and the radiocounting percentage per gram tissue to the injected dose (%ID/g) were calculated. The nude mice with BT-474 breast carcinoma were also visualized continuously by single photon emission computed tomography at 2, 4, 8, 12, 24, 48, and 96 h after the injection of [(131)I]-herceptin. Nude mice with MDA-MB-231 used as the control group were subjected to the same analyses. Clear tumor images were obtained after the injection of [(131)I]-herceptin in nude mice with BT-474 breast carcinoma. The images were the clearest at 24 h after the injection and remained clear even at 96 h. The T/NT ratio and %ID/g in the tumor tissues of nude mice with BT-474 were both significantly higher than those of the control group (P < 0.01). [(131)I]-Herceptin displays tumors clearly in the nude mice with BT-474 and accumulates well in the tumor tissues.

  17. Quantitative analysis of antigen for the induction of tolerance in carcinoembryonic antigen transgenic mice.

    PubMed Central

    Hasegawa, T; Isobe, K; Nakashima, I; Shimokata, K

    1992-01-01

    In order to analyse the amounts of antigen in the thymus for the induction of tolerance, several carcinoembryonic antigen (CEA) transgenic lines were established which expressed human CEA antigen with different amounts. The chimeric KSN nude mice transplanted with the thymus of the B601 line (in which CEA mRNA and CEA protein could be detected in various tissues) to kidney capsule showed tolerance to human CEA. On the other hand, the chimeric KSN nude mice transplanted with the thymus of the B602 or BC60 line (in which neither CEA mRNA nor CEA protein could be detected by Northern blot analysis and flow cytometry analysis) or normal C57BL/6 (B6) did not develop the tolerance to human CEA. However, the chimeric KSN nude mice transplanted simultaneously with thymus of the B6 and spleen of the B601 line became tolerant to human CEA antigen. In the case of systemic immunization with cells which had CEA antigen, the B601 line was tolerant to human CEA. Surprisingly, the B602 and BC60 lines were also tolerant to CEA molecule. These results indicate that not only the antigen present in the thymus but also the antigen which flows from the peripheral organs to the thymus may be necessary for the induction of CEA tolerance. Images Figure 1 PMID:1493931

  18. Development of a multi-scale and multi-modality imaging system to characterize tumours and their microenvironment in vivo

    NASA Astrophysics Data System (ADS)

    Rouffiac, Valérie; Ser-Leroux, Karine; Dugon, Emilie; Leguerney, Ingrid; Polrot, Mélanie; Robin, Sandra; Salomé-Desnoulez, Sophie; Ginefri, Jean-Christophe; Sebrié, Catherine; Laplace-Builhé, Corinne

    2015-03-01

    In vivo high-resolution imaging of tumor development is possible through dorsal skinfold chamber implantable on mice model. However, current intravital imaging systems are weakly tolerated along time by mice and do not allow multimodality imaging. Our project aims to develop a new chamber for: 1- long-term micro/macroscopic visualization of tumor (vascular and cellular compartments) and tissue microenvironment; and 2- multimodality imaging (photonic, MRI and sonography). Our new experimental device was patented in March 2014 and was primarily assessed on 75 mouse engrafted with 4T1-Luc tumor cell line, and validated in confocal and multiphoton imaging after staining the mice vasculature using Dextran 155KDa-TRITC or Dextran 2000kDa-FITC. Simultaneously, a universal stage was designed for optimal removal of respiratory and cardiac artifacts during microscopy assays. Experimental results from optical, ultrasound (Bmode and pulse subtraction mode) and MRI imaging (anatomic sequences) showed that our patented design, unlike commercial devices, improves longitudinal monitoring over several weeks (35 days on average against 12 for the commercial chamber) and allows for a better characterization of the early and late tissue alterations due to tumour development. We also demonstrated the compatibility for multimodality imaging and the increase of mice survival was by a factor of 2.9, with our new skinfold chamber. Current developments include: 1- defining new procedures for multi-labelling of cells and tissue (screening of fluorescent molecules and imaging protocols); 2- developing ultrasound and MRI imaging procedures with specific probes; 3- correlating optical/ultrasound/MRI data for a complete mapping of tumour development and microenvironment.

  19. Combined behavioral studies and in vivo imaging of inflammatory response and expression of mGlu5 receptors in schnurri-2 knockout mice.

    PubMed

    Choi, Ji-Kyung; Zhu, Aijun; Jenkins, Bruce G; Hattori, Satoko; Kil, Kun-Eek; Takagi, Tsuyoshi; Ishii, Shunsuke; Miyakawa, Tsuyoshi; Brownell, Anna-Liisa

    2015-11-16

    Schnurri-2 (Shn-2) knockout (KO) mice have been proposed as a preclinical neuroinflammatory schizophrenia model. We used behavioral studies and imaging markers that can be readily translated to human populations to explore brain effects of inflammation. Shn-2 KO mice and their littermate control mice were imaged with two novel PET ligands; an inflammation marker [(11)C]PBR28 and the mGluR5 ligand [(18)F]FPEB. Locomotor activity was measured using open field exploration with saline, methamphetamine or amphetamine challenge. A significantly increased accumulation of [(11)C]PBR28 was found in the cortex, striatum, hippocampus and olfactory bulb of Shn-2 KO mice. Increased mGluR5 binding was also observed in the cortex and hippocampus of the Shn-2 KO mice. Open field locomotor testing revealed a large increase in novelty-induced hyperlocomotion in Shn-2 KO mice with abnormal (decreased) responses to either methamphetamine or amphetamine. These data provide additional support to demonstrate that the Shn-2 KO mouse model exhibits several behavioral and pathological markers resembling human schizophrenia making it an attractive translational model for the disease. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Spectral-spatial classification using tensor modeling for cancer detection with hyperspectral imaging

    NASA Astrophysics Data System (ADS)

    Lu, Guolan; Halig, Luma; Wang, Dongsheng; Chen, Zhuo Georgia; Fei, Baowei

    2014-03-01

    As an emerging technology, hyperspectral imaging (HSI) combines both the chemical specificity of spectroscopy and the spatial resolution of imaging, which may provide a non-invasive tool for cancer detection and diagnosis. Early detection of malignant lesions could improve both survival and quality of life of cancer patients. In this paper, we introduce a tensor-based computation and modeling framework for the analysis of hyperspectral images to detect head and neck cancer. The proposed classification method can distinguish between malignant tissue and healthy tissue with an average sensitivity of 96.97% and an average specificity of 91.42% in tumor-bearing mice. The hyperspectral imaging and classification technology has been demonstrated in animal models and can have many potential applications in cancer research and management.

  1. Isolation and (111)In-Oxine Labeling of Murine NK Cells for Assessment of Cell Trafficking in Orthotopic Lung Tumor Model.

    PubMed

    Malviya, Gaurav; Nayak, Tapan; Gerdes, Christian; Dierckx, Rudi A J O; Signore, Alberto; de Vries, Erik F J

    2016-04-04

    A noninvasive in vivo imaging method for NK cell trafficking is essential to gain further understanding of the pathogenesis of NK cell mediated immune response to the novel cancer treatment strategies, and to discover the homing sites and physiological distribution of NK cells. Although human NK cells can be labeled for in vivo imaging, little is known about the murine NK cell labeling and its application in animal models. This study describes the isolation and ex vivo radiolabeling of murine NK cells for the evaluation of cell trafficking in an orthotopic model of human lung cancer in mice. Scid-Tg(FCGR3A)Blt transgenic SCID mice were used to isolate NK cells from mouse splenocytes using the CD49b (DX5) MicroBeads positive selection method. The purity and viability of the isolated NK cells were confirmed by FACS analysis. Different labeling buffers and incubation times were evaluated to optimize (111)In-oxine labeling conditions. Functionality of the radiolabeled NK cell was assessed by (51)Cr-release assay. We evaluated physiological distribution of (111)In-oxine labeled murine NK cells in normal SCID mice and biodistribution in irradiated and nonirradiated SCID mice with orthotopic A549 human lung tumor lesions. Imaging findings were confirmed by histology. Results showed that incubation with 0.011 MBq of (111)In-oxine per million murine NK cells in PBS (pH 7.4) for 20 min is the best condition that provides optimum labeling efficiency without affecting cell viability and functionality. Physiological distribution in normal SCID mice demonstrated NK cells homing mainly in the spleen, while (111)In released from NK cells was excreted via kidneys into urine. Biodistribution studies demonstrated a higher lung uptake in orthotopic lung tumor-bearing mice than control mice. In irradiated mice, lung tumor uptake of radiolabeled murine NK cells decreased between 24 h and 72 h postinjection (p.i.), which was accompanied by tumor regression, while in nonirradiated mice, radiolabeled NK cells were retained in the lung tumor lesions up to 72 h p.i. without tumor regression. In tumor-bearing mice that were only irradiated but did not receive radiolabeled murine NK cells, a high tumor burden was observed at 72 h p.i., which indicates that irradiation in combination with murine NK cell allocation, but not irradiation alone, induced a remarkable antitumor effect in the orthotopic A549 lung tumor bearing mouse model. In conclusion, we describe a method to evaluate murine NK cell trafficking and biodistribution, which can be used to determine potential effects of immune-mediated therapeutic agents on NK cell biodistribution.

  2. Simultaneous scanning of two mice in a small-animal PET scanner: a simulation-based assessment of the signal degradation

    NASA Astrophysics Data System (ADS)

    Reilhac, Anthonin; Boisson, Frédéric; Wimberley, Catriona; Parmar, Arvind; Zahra, David; Hamze, Hasar; Davis, Emma; Arthur, Andrew; Bouillot, Caroline; Charil, Arnaud; Grégoire, Marie-Claude

    2016-02-01

    In PET imaging, research groups have recently proposed different experimental set ups allowing multiple animals to be simultaneously imaged in a scanner in order to reduce the costs and increase the throughput. In those studies, the technical feasibility was demonstrated and the signal degradation caused by additional mice in the FOV characterized, however, the impact of the signal degradation on the outcome of a PET study has not yet been studied. Here we thoroughly investigated, using Monte Carlo simulated [18F]FDG and [11C]Raclopride PET studies, different experimental designs for whole-body and brain acquisitions of two mice and assessed the actual impact on the detection of biological variations as compared to a single-mouse setting. First, we extended the validation of the PET-SORTEO Monte Carlo simulation platform for the simultaneous simulation of two animals. Then, we designed [18F]FDG and [11C]Raclopride input mouse models for the simulation of realistic whole-body and brain PET studies. Simulated studies allowed us to accurately estimate the differences in detection between single- and dual-mode acquisition settings that are purely the result of having two animals in the FOV. Validation results showed that PET-SORTEO accurately reproduced the spatial resolution and noise degradations that were observed with actual dual phantom experiments. The simulated [18F]FDG whole-body study showed that the resolution loss due to the off-center positioning of the mice was the biggest contributing factor in signal degradation at the pixel level and a minimal inter-animal distance as well as the use of reconstruction methods with resolution modeling should be preferred. Dual mode acquisition did not have a major impact on ROI-based analysis except in situations where uptake values in organs from the same subject were compared. The simulated [11C]Raclopride study however showed that dual-mice imaging strongly reduced the sensitivity to variations when mice were positioned side-by-side while no sensitivity reduction was observed when they were facing each other. This is the first study showing the impact of different experimental designs for whole-body and brain acquisitions of two mice on the quality of the results using Monte Carlo simulated [18F]FDG and [11C]Raclopride PET studies.

  3. NanoLuc reporter for dual luciferase imaging in living animals.

    PubMed

    Stacer, Amanda C; Nyati, Shyam; Moudgil, Pranav; Iyengar, Rahul; Luker, Kathryn E; Rehemtulla, Alnawaz; Luker, Gary D

    2013-10-01

    Bioluminescence imaging is widely used for cell-based assays and animal imaging studies in biomedical research and drug development, capitalizing on the high signal to background of this technique. A relatively small number of luciferases are available for imaging studies, substantially limiting the ability to image multiple molecular and cellular events, as done commonly with fluorescence imaging. To advance dual reporter bioluminescence molecular imaging, we tested a recently developed, adenosine triphosphate–independent luciferase enzyme from Oplophorus gracilirostris (NanoLuc [NL]) as a reporter for animal imaging. We demonstrated that NL could be imaged in superficial and deep tissues in living mice, although the detection of NL in deep tissues was limited by emission of predominantly blue light by this enzyme. Changes in bioluminescence from NL over time could be used to quantify tumor growth, and secreted NL was detectable in small volumes of serum. We combined NL and firefly luciferase reporters to quantify two key steps in transforming growth factor β signaling in intact cells and living mice, establishing a novel dual luciferase imaging strategy for quantifying signal transduction and drug targeting. Our results establish NL as a new reporter for bioluminescence imaging studies in intact cells and living mice that will expand imaging of signal transduction in normal physiology, disease, and drug development.

  4. NanoLuc Reporter for Dual Luciferase Imaging in Living Animals

    PubMed Central

    Stacer, Amanda C.; Nyati, Shyam; Moudgil, Pranav; Iyengar, Rahul; Luker, Kathryn E.; Rehemtulla, Alnawaz; Luker, Gary D.

    2014-01-01

    Bioluminescence imaging is utilized widely for cell-based assays and animal imaging studies in biomedical research and drug development, capitalizing on high signal-to-background of this technique. A relatively small number of luciferases are available for imaging studies, substantially limiting the ability to image multiple molecular and cellular events as done commonly with fluorescence imaging. To advance dual reporter bioluminescence molecular imaging, we tested a recently developed, ATP-independent luciferase enzyme from Oplophorus gracilirostris (NanoLuc, NL) as a reporter for animal imaging. We demonstrated that NL could be imaged in superficial and deep tissues in living mice, although detection of NL in deep tissues was limited by emission of predominantly blue light by this enzyme. Changes in bioluminescence from NL over time could be used to quantify tumor growth, and secreted NL was detectable in small volumes of serum. We combined NL and firefly luciferase reporters to quantify two key steps in TGF-β signaling in intact cells and living mice, establishing a novel dual luciferase imaging strategy for quantifying signal transduction and drug targeting. Our results establish NL as new reporter for bioluminescence imaging studies in intact cells and living mice that will expand imaging of signal transduction in normal physiology, disease, and drug development. PMID:24371848

  5. Imaging techniques for visualizing and phenotyping congenital heart defects in murine models.

    PubMed

    Liu, Xiaoqin; Tobita, Kimimasa; Francis, Richard J B; Lo, Cecilia W

    2013-06-01

    Mouse model is ideal for investigating the genetic and developmental etiology of congenital heart disease. However, cardiovascular phenotyping for the precise diagnosis of structural heart defects in mice remain challenging. With rapid advances in imaging techniques, there are now high throughput phenotyping tools available for the diagnosis of structural heart defects. In this review, we discuss the efficacy of four different imaging modalities for congenital heart disease diagnosis in fetal/neonatal mice, including noninvasive fetal echocardiography, micro-computed tomography (micro-CT), micro-magnetic resonance imaging (micro-MRI), and episcopic fluorescence image capture (EFIC) histopathology. The experience we have gained in the use of these imaging modalities in a large-scale mouse mutagenesis screen have validated their efficacy for congenital heart defect diagnosis in the tiny hearts of fetal and newborn mice. These cutting edge phenotyping tools will be invaluable for furthering our understanding of the developmental etiology of congenital heart disease. Copyright © 2013 Wiley Periodicals, Inc.

  6. Losartan Decreases Cardiac Muscle Fibrosis and Improves Cardiac Function in Dystrophin-Deficient Mdx Mice

    PubMed Central

    Spurney, Christopher F.; Sali, Arpana; Guerron, Alfredo D.; Iantorno, Micaela; Yu, Qing; Gordish-Dressman, Heather; Rayavarapu, Sree; van der Meulen, Jack; Hoffman, Eric P.; Nagaraju, Kanneboyina

    2014-01-01

    Recent studies showed that chronic administration of losartan, an angiotensin II type I receptor antagonist, improved skeletal muscle function in dystrophin-deficient mdx mice. In this study, C57BL/10ScSn-Dmdmdx/J female mice were either untreated or treated with losartan (n = 15) in the drinking water at a dose of 600 mg/L over a 6-month period. Cardiac function was assessed via in vivo high frequency echocardiography and skeletal muscle function was assessed using grip strength testing, Digiscan monitoring, Rotarod timing, and in vitro force testing. Fibrosis was assessed using picrosirius red staining and Image J analysis. Gene expression was evaluated using real-time polymerized chain reaction (RT-PCR). Percentage shortening fraction was significantly decreased in untreated (26.9% ± 3.5%) mice compared to losartan-treated (32.2% ± 4.2%; P < .01) mice. Systolic blood pressure was significantly reduced in losartan-treated mice (56 ± 6 vs 69 ± 7 mm Hg; P < .0005). Percentage cardiac fibrosis was significantly reduced in losartan-treated hearts (P < .05) along with diaphragm (P < .01), extensor digitorum longus (P < .05), and gastrocnemius (P < .05) muscles compared to untreated mdx mice. There were no significant differences in skeletal muscle function between treated and untreated groups. Chronic treatment with losartan decreases cardiac and skeletal muscle fibrosis and improves cardiac systolic function in dystrophin-deficient mdx mice. PMID:21304057

  7. Transcranial fluorescence imaging of auditory cortical plasticity regulated by acoustic environments in mice.

    PubMed

    Takahashi, Kuniyuki; Hishida, Ryuichi; Kubota, Yamato; Kudoh, Masaharu; Takahashi, Sugata; Shibuki, Katsuei

    2006-03-01

    Functional brain imaging using endogenous fluorescence of mitochondrial flavoprotein is useful for investigating mouse cortical activities via the intact skull, which is thin and sufficiently transparent in mice. We applied this method to investigate auditory cortical plasticity regulated by acoustic environments. Normal mice of the C57BL/6 strain, reared in various acoustic environments for at least 4 weeks after birth, were anaesthetized with urethane (1.7 g/kg, i.p.). Auditory cortical images of endogenous green fluorescence in blue light were recorded by a cooled CCD camera via the intact skull. Cortical responses elicited by tonal stimuli (5, 10 and 20 kHz) exhibited mirror-symmetrical tonotopic maps in the primary auditory cortex (AI) and anterior auditory field (AAF). Depression of auditory cortical responses regarding response duration was observed in sound-deprived mice compared with naïve mice reared in a normal acoustic environment. When mice were exposed to an environmental tonal stimulus at 10 kHz for more than 4 weeks after birth, the cortical responses were potentiated in a frequency-specific manner in respect to peak amplitude of the responses in AI, but not for the size of the responsive areas. Changes in AAF were less clear than those in AI. To determine the modified synapses by acoustic environments, neural responses in cortical slices were investigated with endogenous fluorescence imaging. The vertical thickness of responsive areas after supragranular electrical stimulation was significantly reduced in the slices obtained from sound-deprived mice. These results suggest that acoustic environments regulate the development of vertical intracortical circuits in the mouse auditory cortex.

  8. Silica nanoparticle-based dual imaging colloidal hybrids: cancer cell imaging and biodistribution

    PubMed Central

    Lee, Haisung; Sung, Dongkyung; Kim, Jinhoon; Kim, Byung-Tae; Wang, Tuntun; An, Seong Soo A; Seo, Soo-Won; Yi, Dong Kee

    2015-01-01

    In this study, fluorescent dye-conjugated magnetic resonance (MR) imaging agents were investigated in T mode. Gadolinium-conjugated silica nanoparticles were successfully synthesized for both MR imaging and fluorescence diagnostics. Polyamine and polycarboxyl functional groups were modified chemically on the surface of the silica nanoparticles for efficient conjugation of gadolinium ions. The derived gadolinium-conjugated silica nanoparticles were investigated by zeta potential analysis, transmission electron microscopy, inductively coupled plasma mass spectrometry, and energy dispersive x-ray spectroscopy. MR equipment was used to investigate their use as contrast-enhancing agents in T1 mode under a 9.4 T magnetic field. In addition, we tracked the distribution of the gadolinium-conjugated nanoparticles in both lung cancer cells and organs in mice. PMID:26357472

  9. Left ventricular remodeling leads to heart failure in mice with cardiac-specific overexpression of VEGF-B167: echocardiography and magnetic resonance imaging study.

    PubMed

    Lottonen-Raikaslehto, Line; Rissanen, Riina; Gurzeler, Erika; Merentie, Mari; Huusko, Jenni; Schneider, Jurgen E; Liimatainen, Timo; Ylä-Herttuala, Seppo

    2017-03-01

    Cardiac-specific overexpression of vascular endothelial growth factor (VEGF)-B 167 is known to induce left ventricular hypertrophy due to altered lipid metabolism, in which ceramides accumulate to the heart and cause mitochondrial damage. The aim of this study was to evaluate and compare different imaging methods to find the most sensitive way to diagnose at early stage the progressive left ventricular remodeling leading to heart failure. Echocardiography and cardiovascular magnetic resonance imaging were compared for imaging the hearts of transgenic mice with cardiac-specific overexpression of VEGF-B 167 and wild-type mice from 5 to 14 months of age at several time points. Disease progression was verified by molecular biology methods and histology. We showed that left ventricular remodeling is already ongoing at the age of 5 months in transgenic mice leading to heart failure by the age of 14 months. Measurements from echocardiography and cardiovascular magnetic resonance imaging revealed similar changes in cardiac structure and function in the transgenic mice. Changes in histology, gene expressions, and electrocardiography supported the progression of left ventricular hypertrophy. Longitudinal relaxation time in rotating frame (T 1 ρ ) in cardiovascular magnetic resonance imaging could be suitable for detecting severe fibrosis in the heart. We conclude that cardiac-specific overexpression of VEGF-B 167 leads to left ventricular remodeling at early age and is a suitable model to study heart failure development with different imaging methods. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  10. Optical imaging of Renilla luciferase, synthetic Renilla luciferase, and firefly luciferase reporter gene expression in living mice.

    PubMed

    Bhaumik, S; Lewis, X Z; Gambhir, S S

    2004-01-01

    We have recently demonstrated that Renilla luciferase (Rluc) is a promising bioluminescence reporter gene that can be used for noninvasive optical imaging of reporter gene expression in living mice, with the aid of a cooled charged couple device (CCD) camera. In the current study, we explore the expression of a novel synthetic Renilla luciferase reporter gene (hRluc) in living mice, which has previously been reported to be a more sensitive reporter than native Rluc in mammalian cells. We explore the strategies of simultaneous imaging of both Renilla luciferase enzyme (RL) and synthetic Renilla luciferase enzyme (hRL):coelenterazine (substrate for RL/hRL) in the same living mouse. We also demonstrate that hRL:coelenterazine can yield a higher signal when compared to Firefly luciferase enzyme (FL): D-Luciferin, both in cell culture studies and when imaged from cells at the surface and from lungs of living mice. These studies demonstrate that hRluc should be a useful primary reporter gene with high sensitivity when used alone or in conjunction with other bioluminescence reporter genes for imaging in living rodents. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

  11. Variable flip angle 3D ultrashort echo time (UTE) T1 mapping of mouse lung: A repeatability assessment.

    PubMed

    Alamidi, Daniel F; Smailagic, Amir; Bidar, Abdel W; Parker, Nicole S; Olsson, Marita; Hockings, Paul D; Lagerstrand, Kerstin M; Olsson, Lars E

    2018-03-08

    Lung T 1 is a potential translational biomarker of lung disease. The precision and repeatability of variable flip angle (VFA) T 1 mapping using modern 3D ultrashort echo time (UTE) imaging of the whole lung needs to be established before it can be used to assess response to disease and therapy. To evaluate the feasibility of regional lung T 1 quantification with VFA 3D-UTE and to investigate long- and short-term T 1 repeatability in the lungs of naive mice. Prospective preclinical animal study. Eight naive mice and phantoms. 3D free-breathing radial UTE (8 μs) at 4.7T. VFA 3D-UTE T 1 calculations were validated against T 1 values measured with inversion recovery (IR) in phantoms. Lung T 1 and proton density (S 0 ) measurements of whole lung and muscle were repeated five times over 1 month in free-breathing naive mice. Two consecutive T 1 measurements were performed during one of the imaging sessions. Agreement in T 1 between VFA 3D-UTE and IR in phantoms was assessed using Bland-Altman and Pearson 's correlation analysis. The T 1 repeatability in mice was evaluated using coefficient of variation (CV), repeated-measures analysis of variance (ANOVA), and paired t-test. Good T 1 agreement between the VFA 3D-UTE and IR methods was found in phantoms. T 1 in lung and muscle showed a 5% and 3% CV (1255 ± 63 msec and 1432 ± 42 msec, respectively, mean ± SD) with no changes in T 1 or S 0 over a month. Consecutive measurements resulted in an increase of 2% in both lung T 1 and S 0 . VFA 3D-UTE shows promise as a reliable T 1 mapping method that enables full lung coverage, high signal-to-noise ratio (∼25), and spatial resolution (300 μm) in freely breathing animals. The precision of the VFA 3D-UTE method will enable better design and powering of studies. 1 Technical Efficacy: Stage 2 J. Magn. Reson. Imaging 2018. © 2018 International Society for Magnetic Resonance in Medicine.

  12. In Vivo PET Imaging of Myelin Damage and Repair in the Spinal Cord

    DTIC Science & Technology

    2013-12-01

    100, 110, 120 min(Pɘ.0001, two-tailed t- test , CI 99%). (B) the average radiance of wild-type mice after injection of DBT (blue) and vehicle ( red ...radiance between the Plp-Akt-DD mice ( red ) and wild-type mice (blue) after deducting the vehicle signals (P=0.0012, two-tailed t- test , CI 99...demyelination and remyelination in the intact brain and spinal cord. We have also begun to test the ability of the imaging probes to assay remyelination in

  13. Quantitative analysis on PUVA-induced skin photodamages using optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Zhai, Juan; Guo, Zhouyi; Liu, Zhiming; Xiong, Honglian; Zeng, Changchun; Jin, Ying

    2009-08-01

    Psoralen plus ultraviolet A radiation (PUVA) therapy is a very important clinical treatment of skin diseases such as vitiligo and psoriasis, but associated with an increased risk of skin photodamages especially photoaging. Since skin biopsy alters the original skin morphology and always requires an iatrogenic trauma, optical coherence tomography (OCT) appears to be a promising technique to study skin damage in vivo. In this study, the Balb/c mice had 8-methoxypsralen (8-MOP) treatment prior to UVA radiation was used as PUVA-induced photo-damaged modal. The OCT imaging of photo-damaged group (modal) and normal group (control) in vivo was obtained of mice dorsal skin at 0, 24, 48, 72 hours after irradiation respectively. And then the results were quantitatively analyzed combined with histological information. The experimental results showed that, PUVA-induced photo-damaged skin had an increase in epidermal thickness (ET), a reduction of attenuation coefficient in OCT images signal, and an increase in brightness of the epidermis layer compared with the control group. In conclusion, noninvasive high-resolution imaging techniques such as OCT may be a promising tool for photobiological studies aimed at assessing photo-damage and repair processes in vivo. It can be used to quantitative analysis of changes in photo-damaged skin, such as the ET and collagen in dermis, provides a theoretical basis for treatment and prevention of skin photodamages.

  14. Molecular Imaging of Conscious, Unrestrained Mice with AwakeSPECT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baba, Justin S; Endres, Christopher; Foss, Catherine

    2013-01-01

    We have developed a SPECT imaging system, AwakeSPECT, to enable molecular brain imaging of untrained mice that are conscious, unanesthetized, and unrestrained. We accomplished this with head tracking and motion correction techniques. Methods: The capability of the system for motion-corrected imaging was demonstrated with a 99mTc-pertechnetate phantom, 99mTcmethylene diphosphonate bone imaging, and measurement of the binding potential of the dopamine transporter radioligand 123I-ioflupane in mouse brain in the awake and anesthetized (isoflurane) states. Stress induced by imaging in the awake state was assessed through measurement of plasma corticosterone levels. Results: AwakeSPECT provided high-resolution bone images reminiscent of those obtained frommore » CT. The binding potential of 123I-ioflupane in the awake state was on the order of 50% of that obtained with the animal under anesthesia, consistent with previous studies in nonhuman primates. Levels of stress induced were on the order of those seen in other behavioral tasks and imaging studies of awake animals. Conclusion: These results demonstrate the feasibility of SPECT molecular brain imaging of mice in the conscious, unrestrained state and demonstrate the effects of isoflurane anesthesia on radiotracer uptake.« less

  15. Molecular Imaging of Conscious, Unrestrained Mice with AwakeSPECT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baba, Justin S.; Endres, Christopher J.; Foss, Catherine A.

    2013-06-01

    We have developed a SPECT imaging system, AwakeSPECT, to enable molecular brain imaging of untrained mice that are conscious, unanesthetized, and unrestrained. We accomplished this with head tracking and motion correction techniques. Methods: The capability of the system for motion-corrected imaging was demonstrated with a ^99mTc-pertechnetate phantom, ^99mTc-methylene diphosphonate bone imaging, and measurement of the binding potential of the dopamine transporter radioligand ^123I-ioflupane in mouse brain in the awake and anesthetized (isoflurane) states. Stress induced by imaging in the awake state was assessed through measurement of plasma corticosterone levels. Results: AwakeSPECT provided high-resolution bone images reminiscent of those obtained frommore » CT. The binding potential of ^123I-ioflupane in the awake state was on the order of 50% of that obtained with the animal under anesthesia, consistent with previous studies in nonhuman primates. Levels of stress induced were on the order of those seen in other behavioral tasks and imaging studies of awake animals. Conclusion: These results demonstrate the feasibility of SPECT molecular brain imaging of mice in the conscious, unrestrained state and demonstrate the effects of isoflurane anesthesia on radiotracer uptake.« less

  16. Effects of high-fat diet and losartan on renal cortical blood flow using contrast ultrasound imaging.

    PubMed

    Declèves, Anne-Emilie; Rychak, Joshua J; Smith, Dan J; Sharma, Kumar

    2013-11-01

    Obesity-related kidney disease occurs as a result of complex interactions between metabolic and hemodynamic effects. Changes in microvascular perfusion may play a major role in kidney disease; however, these changes are difficult to assess in vivo. Here, we used perfusion ultrasound imaging to evaluate cortical blood flow in a mouse model of high-fat diet-induced kidney disease. C57BL/6J mice were randomized to a standard diet (STD) or a high-fat diet (HFD) for 30 wk and then treated either with losartan or a placebo for an additional 6 wk. Noninvasive ultrasound perfusion imaging of the kidney was performed during infusion of a microbubble contrast agent. Blood flow within the microvasculature of the renal cortex and medulla was derived from imaging data. An increase in the time required to achieve full cortical perfusion was observed for HFD mice relative to STD. This was reversed following treatment with losartan. These data were concurrent with an increased glomerular filtration rate in HFD mice compared with STD- or HFD-losartan-treated mice. Losartan treatment also abrogated fibro-inflammatory disease, assessed by markers at the protein and messenger level. Finally, a reduction in capillary density was found in HFD mice, and this was reversed upon losartan treatment. This suggests that alterations in vascular density may be responsible for the elevated perfusion time observed by imaging. These data demonstrate that ultrasound contrast imaging is a robust and sensitive method for evaluating changes in renal microvascular perfusion and that cortical perfusion time may be a useful parameter for evaluating obesity-related renal disease.

  17. Evaluation of (64)Cu-labeled DOTA-D-Phe(1)-Tyr (3)-octreotide ((64)Cu-DOTA-TOC) for imaging somatostatin receptor-expressing tumors.

    PubMed

    Hanaoka, Hirofumi; Tominaga, Hideyuki; Yamada, Keiich; Paudyal, Pramila; Iida, Yasuhiko; Watanabe, Shigeki; Paudyal, Bishnuhari; Higuchi, Tetsuya; Oriuchi, Noboru; Endo, Keigo

    2009-08-01

    In-111 ((111)In)-labeled octreotide has been clinically used for imaging somatostatin receptor-positive tumors, and radiolabeled octreotide analogs for positron emission tomography (PET) have been developed. Cu-64 ((64)Cu; half-life, 12.7 h) is an attractive radionuclide for PET imaging and is produced with high specific activity using a small biomedical cyclotron. The aim of this study is to produce and fundamentally examine a (64)Cu-labeled octreotide analog, (64)Cu-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-D: -Phe(1)-Tyr(3)-octreotide ((64)Cu-DOTA-TOC). (64)Cu produced using a biomedical cyclotron was reacted with DOTA-TOC for 30 min at 45 degrees C. The stability of (64)Cu-DOTA-TOC was evaluated in vitro (incubated with serum) and in vivo (blood collected after administration) by HPLC analysis. Biodistribution studies were performed in normal mice by administration of mixed solution of (64)Cu-DOTA-TOC and (111)In-DOTA-TOC and somatostatin receptor-positive U87MG tumor-bearing mice by administration of (64)Cu-DOTA-TOC or (64)Cu-1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid-octreotide ((64)Cu-TETA-OC). The tumor was imaged using (64)Cu-DOTA-TOC, (64)Cu-TETA-OC, and FDG with an animal PET scanner. (64)Cu-DOTA-TOC can be produced in amounts sufficient for clinical study with high radiochemical yield. (64)Cu-DOTA-TOC was stable in vitro, but time-dependent transchelation to protein was observed after injection into mice. In biodistribution studies, the radioactivity of (64)Cu was higher than that of (111)In in all organs except kidney. In tumor-bearing mice, (64)Cu-DOTA-TOC showed a high accumulation in the tumor, and the tumor-to-blood ratio reached as high as 8.81 +/- 1.17 at 6 h after administration. (64)Cu-DOTA-TOC showed significantly higher accumulation in the tumor than (64)Cu-TETA-OC. (64)Cu-DOTA-TOC PET showed a very clear image of the tumor, which was comparable to that of (18)F-FDG PET and very similar to that of (64)Cu-TETA-OC. (64)Cu-DOTA-TOC clearly imaged a somatostatin receptor-positive tumor and seemed to be a potential PET tracer in the clinical phase.

  18. Assessment of Acridine Orange and SYTO 16 for in vivo imaging of the peritoneal tissues in mice

    PubMed Central

    Udovich, Joshua Anthony; Besselsen, David G.; Gmitro, Arthur F.

    2009-01-01

    The effect of peritoneal injection of Acridine Orange (AO) and SYTO 16 in mice was investigated. Images of peritoneal tissues stained with these dyes and obtained through a confocal microendoscope are presented. Seventy-five Balb/c mice were split into five groups and given peritoneal injections of dye or saline. The proportions of negative outcomes in each group were compared using confidence intervals and the Fisher's exact statistical test. A statistically significant increase in adverse events due to dye injection was not observed.These data provide an initial investigation into the safety of AO and SYTO 16 for in vivo imaging. PMID:19397741

  19. In vivo axonal transport deficits in a mouse model of fronto-temporal dementia

    PubMed Central

    Majid, Tabassum; Ali, Yousuf O.; Venkitaramani, Deepa V.; Jang, Ming-Kuei; Lu, Hui-Chen; Pautler, Robia G.

    2014-01-01

    Background Axonal transport is vital for neurons and deficits in this process have been previously reported in a few mouse models of Alzheimer's disease prior to the appearance of plaques and tangles. However, it remains to be determined whether axonal transport is defective prior to the onset of neurodegeneration. The rTg4510 mouse, a fronto-temporal dementia and parkinsonism-17 (FTDP-17) tauopathy model, over-express tau-P301L mutation found in familial forms of FTDP-17, in the forebrain driven by the calcium–calmodulin kinase II promoter. This mouse model exhibits tau pathology, neurodegeneration in the forebrain, and associated behavioral deficits beginning at 4–5 months of age. Animal model rTg4510 transgenic mice were used in these studies. Mice were given 2 μL of MnCl2 in each nostril 1 h prior to Magnetic Resonance Imaging (MRI). Following MnCl2 nasal lavage, mice were imaged using Manganese enhanced Magnetic Resonance Imaging (MEMRI) Protocol with TE = 8.5 ms, TR = 504 ms, FOV = 3.0 cm, matrix size = 128 × 128 × 128, number of cycles = 15 with each cycle taking approximately 2 min, 9 s, and 24 ms using Paravision software (BrukerBioSpin, Billerica, MA). During imaging, body temperature was maintained at 37.0 °C using an animal heating system (SA Instruments, Stony Brook, NY). Data analysis Resulting images were analyzed using Paravision software. Regions of interest (ROI) within the olfactory neuronal layer (ONL) and the water phantom consisting of one pixel (ONL) and 9 pixels (water) were selected and copied across each of the 15 cycles. Signal intensities (SI) of ONL and water phantom ROIs were measured. SI values obtained for ONL were then normalized the water phantom SI values. The correlation between normalized signal intensity in the ONL and time were assessed using Prism (GraphPad Software, San Diego, CA). Results Using the MEMRI technique on 1.5, 3, 5, and 10-month old rTg4510 mice and littermate controls, we found significant axonal transport deficits present in the rTg4510 mice beginning at 3 months of age in an age-dependent manner. Using linear regression analysis, we measured rates of axonal transport at 1.5, 3, 5, and 10 months of age in rTg4510 and WT mice. Axonal transport rates were observed in rTg4510 mice at 48% of WT levels at 3 months, 40% of WT levels at 5 months, and 30% of WT levels at 10 months of age. In order to determine the point at which tau appears in the cortex, we probed for phosphorylated tau levels, and found that pSer262 is present at 3 months of age, not earlier at 1.5 months of age, but observed no pathological tau species until 6 months of age, months after the onset of the transport deficits. In addition, we saw localization of tau in the ONL at 6 months of age. Discussion In our study, we identified the presence of age-dependent axonal transport deficits beginning at 3 months of age in rTg4510 mice. We correlated these deficits at 3 months to the presence of hyperphosphorylated tau in the brain and the presence within the olfactory epithelium. We observed tau pathology not only in the soma of these neurons but also within the axons and processes of these neurons. Our characterization of axonal transport in this tauopathy model provides a functional time point that can be used for future therapeutic interventions. PMID:24936422

  20. Trypanosoma cruzi infection induced changes in the innervation, structure and function of the murine bladder.

    PubMed

    Boczko, Judd; Tar, Moses; Melman, Arnold; Jelicks, Linda A; Wittner, Murray; Factor, Stephen M; Zhao, Dazhi; Hafron, Jason; Weiss, Louis M; Tanowitz, Herbert B; Christ, George J

    2005-05-01

    The involvement of the lower urinary tract in chronic Chagas' disease has received little attention. Therefore, we investigated pathology and functional alterations in the bladder of Trypanosoma cruzi infected mice. CD1 mice were infected with 5 x 10 T. cruzi trypomastigotes of the Brazil strain of T. cruzi. At day 100 after infection bladder structure and function were examined by pathological evaluation, magnetic resonance imaging and cystometric studies. The bladder in infected mice weighed more and were large, dilated, deformed, friable and thin walled compared with control mice. Magnetic resonance imaging confirmed these observations. Inflammation, fibrosis and ganglionitis was observed. Cystometric studies revealed that baseline, threshold and micturition pressures were increased in infected mice. Bladder overactivity and decreased bladder compliance were also noted in infected mice. There were no detectable differences in bladder capacity, micturition volume or residual volume between infected and uninfected mice. Bladder abnormalities may be a more common clinical sequelae of T. cruzi infection than previously appreciated.

  1. The targeted behavior of folate-decorated N-succinyl-N'-octyl chitosan evaluated by NIR system in mouse model

    NASA Astrophysics Data System (ADS)

    Zhu, Hongyan; Deng, Dawei; Chen, Haiyan; Qian, Zhiyu; Gu, Yueqing

    2010-11-01

    The development of more selective delivery systems for cancer diagnosis and chemotherapy is one of the most important goals of current anticancer research. The purpose of this study is to construct and evaluate the folate-decorated, self-assembled nanoparticles as candidates to deliver near infrared fluorescent dyes into tumors and to investigate the mechanisms underlying the tumor targeting with folate-decorated, self-assembled nanoparticles. Folate-decorated N-succinyl-N'-octyl chitosan (folate-SOC) were synthesized. The chemical modification chitosan could self-assemble into stable micelles in aqueous medium. Micelle size determined by size analysis was around 140 nm in a phosphate-buffered saline (PBS, PH 7.4). Folate-SOC could maintain their structure for up to 15 days in PBS. Near infrared dye ICG-Der-01 as a mode drug was loaded in the micelles, and the entrapment efficiency (EE) and drug loading (DL) were investigated. The targeted behavior of folate-SOC was evaluated by near-infrared fluorescence imaging in vivo on different groups of denuded mice, with A549 or Bel-7402 tumors. The optical imaging results indicated that folated-decorated SOC showed an excellent tumor specificity in Bel-7402 tumor-bearing mice, and weak tumor specificity in A549 tumor bearing mice. We believe that this work can provide insight for the engineering of nanoparticles and be extended to cancer therapy and diagnosis so as to deliver multiple therapeutic agents and imaging probes at high local concentrations.

  2. Feasibility of using optical coherence tomography to detect acute radiation-induced esophageal damage in small animal models

    NASA Astrophysics Data System (ADS)

    Jelvehgaran, Pouya; de Bruin, Daniel Martijn; Salguero, F. Javier; Borst, Gerben Roelof; Song, Ji-Ying; van Leeuwen, Ton G.; de Boer, Johannes F.; Alderliesten, Tanja; van Herk, Marcel

    2018-04-01

    Lung cancer survival is poor, and radiation therapy patients often suffer serious treatment side effects. The esophagus is particularly sensitive leading to acute radiation-induced esophageal damage (ARIED). We investigated the feasibility of optical coherence tomography (OCT) for minimally invasive imaging of the esophagus with high resolution (10 μm) to detect ARIED in mice. Thirty mice underwent cone-beam computed tomography imaging for initial setup assessment and dose planning followed by a single-dose delivery of 4.0, 10.0, 16.0, and 20.0 Gy on 5.0-mm spots, spaced 10.0 mm apart in the esophagus. They were repeatedly imaged using OCT up to three months postirradiation. We compared OCT findings with histopathology obtained three months postirradiation qualitatively and quantitatively using the contrast-to-background-noise ratio (CNR). Histopathology mostly showed inflammatory infiltration and edema at higher doses; OCT findings were in agreement with most of the histopathological reports. We were able to identify the ARIED on OCT as a change in tissue scattering and layer thickness. Our statistical analysis showed significant difference between the CNR values of healthy tissue, edema, and inflammatory infiltration. Overall, the average CNR for inflammatory infiltration and edema damages was 1.6-fold higher and 1.6-fold lower than for the healthy esophageal wall, respectively. Our results showed the potential role of OCT to detect and monitor the ARIED in mice, which may translate to humans.

  3. Robotically assisted small animal MRI-guided mouse biopsy

    NASA Astrophysics Data System (ADS)

    Wilson, Emmanuel; Chiodo, Chris; Wong, Kenneth H.; Fricke, Stanley; Jung, Mira; Cleary, Kevin

    2010-02-01

    Small mammals, namely mice and rats, play an important role in biomedical research. Imaging, in conjunction with accurate therapeutic agent delivery, has tremendous value in small animal research since it enables serial, non-destructive testing of animals and facilitates the study of biomarkers of disease progression. The small size of organs in mice lends some difficulty to accurate biopsies and therapeutic agent delivery. Image guidance with the use of robotic devices should enable more accurate and repeatable targeting for biopsies and delivery of therapeutic agents, as well as the ability to acquire tissue from a pre-specified location based on image anatomy. This paper presents our work in integrating a robotic needle guide device, specialized stereotaxic mouse holder, and magnetic resonance imaging, with a long-term goal of performing accurate and repeatable targeting in anesthetized mice studies.

  4. In Vivo Imaging of Influenza Virus Infection in Immunized Mice

    PubMed Central

    Czakó, Rita; Vogel, Leatrice; Lamirande, Elaine W.; Bock, Kevin W.; Moore, Ian N.; Ellebedy, Ali H.; Ahmed, Rafi

    2017-01-01

    ABSTRACT Immunization is the cornerstone of seasonal influenza control and represents an important component of pandemic preparedness strategies. Using a bioluminescent reporter virus, we demonstrate the application of noninvasive in vivo imaging system (IVIS) technology to evaluate the preclinical efficacy of candidate vaccines and immunotherapy in a mouse model of influenza. Sequential imaging revealed distinct spatiotemporal kinetics of bioluminescence in groups of mice passively or actively immunized by various strategies that accelerated the clearance of the challenge virus at different rates and by distinct mechanisms. Imaging findings were consistent with conclusions derived from virus titers in the lungs and, notably, were more informative than conventional efficacy endpoints in some cases. Our findings demonstrate the reliability of IVIS as a qualitative approach to support preclinical evaluation of candidate medical countermeasures for influenza in mice. PMID:28559489

  5. Structured illumination diffuse optical tomography for noninvasive functional neuroimaging in mice.

    PubMed

    Reisman, Matthew D; Markow, Zachary E; Bauer, Adam Q; Culver, Joseph P

    2017-04-01

    Optical intrinsic signal (OIS) imaging has been a powerful tool for capturing functional brain hemodynamics in rodents. Recent wide field-of-view implementations of OIS have provided efficient maps of functional connectivity from spontaneous brain activity in mice. However, OIS requires scalp retraction and is limited to superficial cortical tissues. Diffuse optical tomography (DOT) techniques provide noninvasive imaging, but previous DOT systems for rodent neuroimaging have been limited either by sparse spatial sampling or by slow speed. Here, we develop a DOT system with asymmetric source-detector sampling that combines the high-density spatial sampling (0.4 mm) detection of a scientific complementary metal-oxide-semiconductor camera with the rapid (2 Hz) imaging of a few ([Formula: see text]) structured illumination (SI) patterns. Analysis techniques are developed to take advantage of the system's flexibility and optimize trade-offs among spatial sampling, imaging speed, and signal-to-noise ratio. An effective source-detector separation for the SI patterns was developed and compared with light intensity for a quantitative assessment of data quality. The light fall-off versus effective distance was also used for in situ empirical optimization of our light model. We demonstrated the feasibility of this technique by noninvasively mapping the functional response in the somatosensory cortex of the mouse following electrical stimulation of the forepaw.

  6. Whole-Mount Adult Ear Skin Imaging Reveals Defective Neuro-Vascular Branching Morphogenesis in Obese and Type 2 Diabetic Mouse Models.

    PubMed

    Yamazaki, Tomoko; Li, Wenling; Yang, Ling; Li, Ping; Cao, Haiming; Motegi, Sei-Ichiro; Udey, Mark C; Bernhard, Elise; Nakamura, Takahisa; Mukouyama, Yoh-Suke

    2018-01-11

    Obesity and type 2 diabetes are frequently associated with peripheral neuropathy. Though there are multiple methods for diagnosis and analysis of morphological changes of peripheral nerves and blood vessels, three-dimensional high-resolution imaging is necessary to appreciate the pathogenesis with an anatomically recognizable branching morphogenesis and patterning. Here we established a novel technique for whole-mount imaging of adult mouse ear skin to visualize branching morphogenesis and patterning of peripheral nerves and blood vessels. Whole-mount immunostaining of adult mouse ear skin showed that peripheral sensory and sympathetic nerves align with large-diameter blood vessels. Diet-induced obesity (DIO) mice exhibit defective vascular smooth muscle cells (VSMCs) coverage, while there is no significant change in the amount of peripheral nerves. The leptin receptor-deficient db/db mice, a severe obese and type 2 diabetic mouse model, exhibit defective VSMC coverage and a large increase in the amount of smaller-diameter nerve bundles with myelin sheath and unmyelinated nerve fibers. Interestingly, an increase in the amount of myeloid immune cells was observed in the DIO but not db/db mouse skin. These data suggest that our whole-mount imaging method enables us to investigate the neuro-vascular and neuro-immune phenotypes in the animal models of obesity and diabetes.

  7. Functionalized near-infrared quantum dots for in vivo tumor vasculature imaging

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Yong, Ken-Tye; Roy, Indrajit; Ding, Hong; Law, Wing-Cheung; Cai, Hongxing; Zhang, Xihe; Vathy, Lisa A.; Bergey, Earl J.; Prasad, Paras N.

    2010-04-01

    In this paper, we report the use of near-infrared (NIR)-emitting alloyed quantum dots (QDs) as efficient optical probes for high contrast in vivo imaging of tumors. Alloyed CdTe1 - xSex/CdS QDs were prepared in the non-aqueous phase using the hot colloidal synthesis approach. Water dispersion of the QDs were accomplished by their encapsulation within polyethyleneglycol (PEG)-grafted phospholipid micelles. For tumor-specific delivery in vivo, the micelle-encapsulated QDs were conjugated with the cyclic arginine-glycine-aspartic acid (cRGD) peptide, which targets the αvβ3 integrins overexpressed in the angiogenic tumor vasculatures. Using in vivo NIR optical imaging of mice bearing pancreatic cancer xenografts, implanted both subcutaneously and orthotopically, we have demonstrated that systemically delivered cRGD-conjugated QDs, but not the unconjugated ones, can efficiently target and label the tumors with high signal-to-noise ratio. Histopathological analysis of major organs of the treated mice showed no evidence of systemic toxicity associated with these QDs. These experiments suggest that cRGD-conjugated NIR QDs can serve as safe and efficient probes for optical bioimaging of tumors in vivo. Furthermore, by co-encapsulating these QDs and anticancer drugs within these micelles, we have demonstrated a promising theranostic, nanosized platform for both cancer imaging and therapy.

  8. USPIO-enhanced 3D-cine self-gated cardiac MRI based on a stack-of-stars golden angle short echo time sequence: Application on mice with acute myocardial infarction.

    PubMed

    Trotier, Aurélien J; Castets, Charles R; Lefrançois, William; Ribot, Emeline J; Franconi, Jean-Michel; Thiaudière, Eric; Miraux, Sylvain

    2016-08-01

    To develop and assess a 3D-cine self-gated method for cardiac imaging of murine models. A 3D stack-of-stars (SOS) short echo time (STE) sequence with a navigator echo was performed at 7T on healthy mice (n = 4) and mice with acute myocardial infarction (MI) (n = 4) injected with ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles. In all, 402 spokes were acquired per stack with the incremental or the golden angle method using an angle increment of (360/402)° or 222.48°, respectively. A cylindrical k-space was filled and repeated with a maximum number of repetitions (NR) of 10. 3D cine cardiac images at 156 μm resolution were reconstructed retrospectively and compared for the two methods in terms of contrast-to-noise ratio (CNR). The golden angle images were also reconstructed with NR = 10, 6, and 3, to assess cardiac functional parameters (ejection fraction, EF) on both animal models. The combination of 3D SOS-STE and USPIO injection allowed us to optimize the identification of cardiac peaks on navigator signal and generate high CNR between blood and myocardium (15.3 ± 1.0). The golden angle method resulted in a more homogeneous distribution of the spokes inside a stack (P < 0.05), enabling reducing the acquisition time to 15 minutes. EF was significantly different between healthy and MI mice (P < 0.05). The method proposed here showed that 3D-cine images could be obtained without electrocardiogram or respiratory gating in mice. It allows precise measurement of cardiac functional parameters even on MI mice. J. Magn. Reson. Imaging 2016;44:355-365. © 2016 Wiley Periodicals, Inc.

  9. Development of an inflammation imaging tracer, 111In-DOTA-DAPTA, targeting chemokine receptor CCR5 and preliminary evaluation in an ApoE-/- atherosclerosis mouse model.

    PubMed

    Wei, Lihui; Petryk, Julia; Gaudet, Chantal; Kamkar, Maryam; Gan, Wei; Duan, Yin; Ruddy, Terrence D

    2018-02-07

    Chemokine receptor 5 (CCR5) plays an important role in atherosclerosis. Our objective was to develop a SPECT tracer targeting CCR5 for imaging plaque inflammation by radiolabeling D-Ala-peptide T-amide (DAPTA), a CCR5 antagonist, with 111 In. 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) conjugated DAPTA (DOTA-DAPTA) was labeled with 111 In. Cell uptake studies were conducted in U87-CD4-CCR5 and U87-MG cells. Biodistribution was determined in C57BL/6 mice. Autoradiography, en face and Oil Red O (ORO) imaging studies were performed in ApoE -/- mice. DOTA-DAPTA was radiolabeled with 111 In with high radiochemical purity (> 98%) and specific activity (70 MBq·nmol). 111 In-DOTA-DAPTA exhibited fast blood and renal clearance and high spleen uptake. The U87-CD4-CCR5 cells had significantly higher uptake in comparison to the U87-MG cells. The cell uptake was reduced by three times with DAPTA, indicating the receptor specificity of the uptake. Autoradiographic images showed significantly higher lesion uptake of 111 In-DOTA-DAPTA in ApoE -/- mice than that in C57BL/6 mice. The tracer uptake in 4 month old ApoE -/- high fat diet (HFD) mice with blocking agent was twofold lower than the same mice without the blocking agent, demonstrating the specificity of the tracer for the CCR5 receptor. 111 In-DOTA-DAPTA, specifically targeting chemokine receptor CCR5, is a potential SPECT agent for imaging inflammation in atherosclerosis.

  10. Near-infrared fluorescent proteins for multicolor in vivo imaging

    PubMed Central

    Shcherbakova, Daria M.; Verkhusha, Vladislav V.

    2013-01-01

    Near-infrared fluorescent proteins are in high demand for in vivo imaging. We developed four spectrally distinct fluorescent proteins, iRFP670, iRFP682, iRFP702, and iRFP720, from bacterial phytochromes. iRFPs exhibit high brightness in mammalian cells and tissues and are suitable for long-term studies. iRFP670 and iRFP720 enable two-color imaging in living cells and mice using standard approaches. Five iRFPs including previously engineered iRFP713 allow multicolor imaging in living mice with spectral unmixing. PMID:23770755

  11. Alterations in phosphorylated cyclic adenosine monophosphate response element of binding protein activity: a pathway for fetal alcohol syndrome-related neurotoxicity.

    PubMed

    Roberson, Robin; Cameroni, Irene; Toso, Laura; Abebe, Daniel; Bissel, Stephanie; Spong, Catherine Y

    2009-02-01

    Fetal alcohol syndrome (FAS) is the leading cause of a spectrum of preventable nongenetic learning and behavioral disorders. In adult (FAS) mice, we measured phosphorylated cyclic adenosine monophosphate response element of binding protein (pCREB) staining in hippocampal subregions to evaluate a possible mechanism underlying FAS learning deficits. Pregnant C57BL6/J mice were treated on gestational day 8 with alcohol or control (saline). After learning assessment, the offspring were perfused for immunohistochemistry and brain sections probed using SER 133 pCREB antibody. Relative staining density was assessed using National Institutes of Health Image software. Statistical analysis included analysis of variance with P < .05 considered significant. In all hippocampal subregions, pCREB staining was greater in the control animals than in the alcohol-treated group (P < or = .0001). In utero alcohol exposure decreased pCREB activity in hippocampal subregions of adult mice. The dentate gyrus had the most robust cumulative decrease in pCREB staining, suggesting FAS adult learning deficits may correlate to enhanced dentate gyrus neurodegeneration.

  12. Classification and recognition of texture collagen obtaining by multiphoton microscope with neural network analysis

    NASA Astrophysics Data System (ADS)

    Wu, Shulian; Peng, Yuanyuan; Hu, Liangjun; Zhang, Xiaoman; Li, Hui

    2016-01-01

    Second harmonic generation microscopy (SHGM) was used to monitor the process of chronological aging skin in vivo. The collagen structures of mice model with different ages were obtained using SHGM. Then, texture feature with contrast, correlation and entropy were extracted and analysed using the grey level co-occurrence matrix. At last, the neural network tool of Matlab was applied to train the texture of collagen in different statues during the aging process. And the simulation of mice collagen texture was carried out. The results indicated that the classification accuracy reach 85%. Results demonstrated that the proposed approach effectively detected the target object in the collagen texture image during the chronological aging process and the analysis tool based on neural network applied the skin of classification and feature extraction method is feasible.

  13. Serial optical coherence scanning reveals an association between cardiac function and the heart architecture in the aging rodent heart

    PubMed Central

    Castonguay, Alexandre; Lefebvre, Joël; Pouliot, Philippe; Avti, Pramod; Moeini, Mohammad; Lesage, Frédéric

    2017-01-01

    Normal aging is accompanied by structural changes in the heart architecture. To explore this remodeling, we used a serial optical coherence tomography scanner to image entire mouse hearts at micron scale resolution. Ex vivo hearts of 7 young (4 months) and 5 old (24 months) C57BL/6 mice were acquired with the imaging platform. OCT of the myocardium revealed myofiber orientation changing linearly from the endocardium to the epicardium. In old mice, this rate of change was lower when compared to young mice while the average volume of old mice hearts was significantly larger (p<0.05). Myocardial wall thickening was also accompanied by extracellular spacing in the endocardium, resulting in a lower OCT attenuation coefficient in old mice endocardium (p<0.05). Prior to serial sectioning, cardiac function of the same hearts was imaged in vivo using MRI and revealed a reduced ejection fraction with aging. The use of a serial optical coherence tomography scanner allows new insight into fine age-related changes of the heart associated with changes in heart function. PMID:29188099

  14. Effect of Sustained Postnatal Systemic Inflammation on Hippocampal Volume and Function in Mice

    PubMed Central

    Malaeb, Shadi N.; Davis, Jonathan M.; Pinz, Ilka M.; Newman, Jennifer L.; Dammann, Olaf; Rios, Maribel

    2014-01-01

    Background Premature infants are at risk for persistent neurodevelopmental impairment. Children born preterm often exhibit reduced hippocampal volumes that correlate with deficits in working memory. Perinatal inflammation is associated with preterm birth and brain abnormalities. Here we examine the effects of postnatal systemic inflammation on the developing hippocampus in mice. Methods Pups received daily intraperitoneal injections of lipopolysaccharide (LPS) or saline between days 3–13. Ex-vivo magnetic resonance imaging (MRI) and microscopic analysis of brain tissue was performed on day 14. Behavioral testing was conducted at 8–9 weeks of age. Results MR and microscopic analysis revealed a 15–20% reduction in hippocampal volume in LPS-treated mice compared to controls. Behavioral testing revealed deficits in hippocampal-related tasks in LPS-treated animals. Adult mice exposed to LPS during the postnatal period were unable to select a novel environment when re-placed within a 1-minute delay, were less able to remember a familiar object after a 1-hour delay and had impaired retention of associative fear learning after 24 hours. Conclusion Systemic inflammation sustained during the postnatal period contributes to reduced hippocampal volume and deficits in hippocampus-dependent working memory. These findings support the novel and emerging concept that sustained systemic inflammation contributes to neurodevelopmental impairment among preterm infants. PMID:25003911

  15. Morphological restoration of gonadotrope population by thymulin gene therapy in nude mice

    PubMed Central

    Reggiani, Paula; Martines, Eliana; Ferese, Celia; Goya, Rodolfo; Cónsole, Gloria

    2009-01-01

    Summary The integrity of the thymus during the first week of life is necessary for a proper maturation of the pituitary-gonadal axis as revealed by the significantly reduced levels of circulating gonadotropins in congenitally athymic (nude) mice. In the present work we studied the impact of athymia and the effect of neonatal thymulin gene therapy on the pituitaries of adult nude mice. Also circulating thymulin and gonadotropin levels were evaluated. We used an adenoviral vector expressing a synthetic gene for the thymic peptide thymulin (metFTS) termed RAd-FTS. On postnatal day 1, each experimental heterozygous (nu/+) and homozygous (nu/nu) pup of both sexes received a single bilateral i.m. injection of RAd-FTS or RAd-GFP/TK, a control vector expressing green fluorescent protein. On postnatal days 51-52, mice were bled and sacrificed, their pituitaries were immediately dissected, fixed and immunostained. Morphometry was performed by means of an image analysis system. The following parameters were calculated: volume density (VD: cell area/reference area), cell density (CD: number of cells/reference area), and cell size (expressed in μm2). Serum thymulin levels were measured by a bioassay and gonadotropin levels were assayed by RIA. It was observed that neonatal thymulin gene therapy in the athymic mice restored their serum thymulin levels and prevented the reduction in circulating gonadotropin levels. The histometrical analysis revealed that the treatment prevented the reduction in gonadotrope CD and the VD in athymic mice. Our data suggest that thymulin gene therapy may be an effective strategy to approach reproductive deficits associated with endocrine thymus dysfunction. PMID:19337971

  16. Murine chronic lymph node window for longitudinal intravital lymph node imaging.

    PubMed

    Meijer, Eelco F J; Jeong, Han-Sin; Pereira, Ethel R; Ruggieri, Thomas A; Blatter, Cedric; Vakoc, Benjamin J; Padera, Timothy P

    2017-08-01

    Chronic imaging windows in mice have been developed to allow intravital microscopy of many different organs and have proven to be of paramount importance in advancing our knowledge of normal and disease processes. A model system that allows long-term intravital imaging of lymph nodes would facilitate the study of cell behavior in lymph nodes during the generation of immune responses in a variety of disease settings and during the formation of metastatic lesions in cancer-bearing mice. We describe a chronic lymph node window (CLNW) surgical preparation that allows intravital imaging of the inguinal lymph node in mice. The CLNW is custom-made from titanium and incorporates a standard coverslip. It allows stable longitudinal imaging without the need for serial surgeries while preserving lymph node blood and lymph flow. We also describe how to build and use an imaging stage specifically designed for the CLNW to prevent (large) rotational changes as well as respiratory movement during imaging. The entire procedure takes approximately half an hour per mouse, and subsequently allows for longitudinal intravital imaging of the murine lymph node and surrounding structures for up to 14 d. Small-animal surgery experience is required to successfully carry out the protocol.

  17. In Vivo Bioluminescence Imaging To Evaluate Systemic and Topical Antibiotics against Community-Acquired Methicillin-Resistant Staphylococcus aureus-Infected Skin Wounds in Mice

    PubMed Central

    Guo, Yi; Ramos, Romela Irene; Cho, John S.; Donegan, Niles P.; Cheung, Ambrose L.

    2013-01-01

    Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) frequently causes skin and soft tissue infections, including impetigo, cellulitis, folliculitis, and infected wounds and ulcers. Uncomplicated CA-MRSA skin infections are typically managed in an outpatient setting with oral and topical antibiotics and/or incision and drainage, whereas complicated skin infections often require hospitalization, intravenous antibiotics, and sometimes surgery. The aim of this study was to develop a mouse model of CA-MRSA wound infection to compare the efficacy of commonly used systemic and topical antibiotics. A bioluminescent USA300 CA-MRSA strain was inoculated into full-thickness scalpel wounds on the backs of mice and digital photography/image analysis and in vivo bioluminescence imaging were used to measure wound healing and the bacterial burden. Subcutaneous vancomycin, daptomycin, and linezolid similarly reduced the lesion sizes and bacterial burden. Oral linezolid, clindamycin, and doxycycline all decreased the lesion sizes and bacterial burden. Oral trimethoprim-sulfamethoxazole decreased the bacterial burden but did not decrease the lesion size. Topical mupirocin and retapamulin ointments both reduced the bacterial burden. However, the petrolatum vehicle ointment for retapamulin, but not the polyethylene glycol vehicle ointment for mupirocin, promoted wound healing and initially increased the bacterial burden. Finally, in type 2 diabetic mice, subcutaneous linezolid and daptomycin had the most rapid therapeutic effect compared with vancomycin. Taken together, this mouse model of CA-MRSA wound infection, which utilizes in vivo bioluminescence imaging to monitor the bacterial burden, represents an alternative method to evaluate the preclinical in vivo efficacy of systemic and topical antimicrobial agents. PMID:23208713

  18. Computer-based analysis of microvascular alterations in a mouse model for Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Heinzer, Stefan; Müller, Ralph; Stampanoni, Marco; Abela, Rafael; Meyer, Eric P.; Ulmann-Schuler, Alexandra; Krucker, Thomas

    2007-03-01

    Vascular factors associated with Alzheimer's disease (AD) have recently gained increased attention. To investigate changes in vascular, particularly microvascular architecture, we developed a hierarchical imaging framework to obtain large-volume, high-resolution 3D images from brains of transgenic mice modeling AD. In this paper, we present imaging and data analysis methods which allow compiling unique characteristics from several hundred gigabytes of image data. Image acquisition is based on desktop micro-computed tomography (µCT) and local synchrotron-radiation µCT (SRµCT) scanning with a nominal voxel size of 16 µm and 1.4 µm, respectively. Two visualization approaches were implemented: stacks of Z-buffer projections for fast data browsing, and progressive-mesh based surface rendering for detailed 3D visualization of the large datasets. In a first step, image data was assessed visually via a Java client connected to a central database. Identified characteristics of interest were subsequently quantified using global morphometry software. To obtain even deeper insight into microvascular alterations, tree analysis software was developed providing local morphometric parameters such as number of vessel segments or vessel tortuosity. In the context of ever increasing image resolution and large datasets, computer-aided analysis has proven both powerful and indispensable. The hierarchical approach maintains the context of local phenomena, while proper visualization and morphometry provide the basis for detailed analysis of the pathology related to structure. Beyond analysis of microvascular changes in AD this framework will have significant impact considering that vascular changes are involved in other neurodegenerative diseases as well as in cancer, cardiovascular disease, asthma, and arthritis.

  19. Magnetic resonance imaging study of eye congenital birth defects in mouse model

    PubMed Central

    Tucker, Zachary; Mongan, Maureen; Meng, Qinghang; Xia, Ying

    2017-01-01

    Purpose Embryonic eyelid closure is a well-documented morphogenetic episode in mammalian eye development. Detection of eyelid closure defect in humans is a major challenge because eyelid closure and reopen occur entirely in utero. As a consequence, congenital eye defects that are associated with failure of embryonic eyelid closure remain unknown. To fill the gap, we developed a mouse model of defective eyelid closure. This preliminary work demonstrates that the magnetic resonance imaging (MRI) approach can be used for the detection of extraocular muscle abnormalities in the mouse model. Methods Mice with either normal (Map3k1+/−) or defective (Map3k1−/−) embryonic eyelid closure were used in this study. Images of the extraocular muscles were obtained with a 9.4 T high resolution microimaging MRI system. The extraocular muscles were identified, segmented, and measured in each imaging slice using an in-house program. Results In agreement with histological findings, the imaging data show that mice with defective embryonic eyelid closure develop less extraocular muscle than normal mice. In addition, the size of the eyeballs was noticeably reduced in mice with defective embryonic eyelid closure. Conclusions We demonstrated that MRI can potentially be used for the study of extraocular muscle in the mouse model of the eye open-at-birth defect, despite the lack of specificity of muscle group provided by the current imaging resolution. PMID:28848319

  20. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    NASA Astrophysics Data System (ADS)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.

    2012-02-01

    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  1. Automatic pelvis segmentation from x-ray images of a mouse model

    NASA Astrophysics Data System (ADS)

    Al Okashi, Omar M.; Du, Hongbo; Al-Assam, Hisham

    2017-05-01

    The automatic detection and quantification of skeletal structures has a variety of different applications for biological research. Accurate segmentation of the pelvis from X-ray images of mice in a high-throughput project such as the Mouse Genomes Project not only saves time and cost but also helps achieving an unbiased quantitative analysis within the phenotyping pipeline. This paper proposes an automatic solution for pelvis segmentation based on structural and orientation properties of the pelvis in X-ray images. The solution consists of three stages including pre-processing image to extract pelvis area, initial pelvis mask preparation and final pelvis segmentation. Experimental results on a set of 100 X-ray images showed consistent performance of the algorithm. The automated solution overcomes the weaknesses of a manual annotation procedure where intra- and inter-observer variations cannot be avoided.

  2. Preclinical Evaluation of RYM1, a Matrix Metalloproteinase-Targeted Tracer for Imaging Aneurysm.

    PubMed

    Toczek, Jakub; Ye, Yunpeng; Gona, Kiran; Kim, Hye-Yeong; Han, Jinah; Razavian, Mahmoud; Golestani, Reza; Zhang, Jiasheng; Wu, Terence L; Jung, Jae-Joon; Sadeghi, Mehran M

    2017-08-01

    Matrix metalloproteinases (MMPs) play a key role in abdominal aortic aneurysm (AAA) development. Accordingly, MMP-targeted imaging provides important information regarding vessel wall biology in the course of aneurysm development. Given the small size of the vessel wall and its proximity with blood, molecular imaging of aneurysm optimally requires highly sensitive tracers with rapid blood clearance. To this end, we developed a novel hydrosoluble zwitterionic MMP inhibitor, RYM, on the basis of which a pan-MMP tracer, RYM1, was designed. Here, we describe the development and preclinical evaluation of RYM1 in comparison with RP805, a commonly used pan-MMP tracer in murine models of aneurysm. Methods: The macrocyclic hydroxamate-based pan-MMP inhibitor coupled with 6-hydrazinonicotinamide, RYM1, was synthesized and labeled with 99m Tc. Radiochemical stability of 99m Tc-RYM1 was evaluated by radio-high-performance liquid chromatography analysis. Tracer blood kinetics and biodistribution were compared with 99m Tc-RP805 in C57BL/6J mice ( n = 10). 99m Tc-RYM1 binding to aneurysm and specificity were evaluated by quantitative autoradiography in apolipoprotein E-deficient (apoE -/- ) mice with CaCl 2 -induced carotid aneurysm ( n = 11). Angiotensin II-infused apoE -/- ( n = 16) mice were used for small-animal SPECT/CT imaging. Aortic tissue MMP activity and macrophage marker CD68 expression were assessed by zymography and reverse-transcription polymerase chain reaction. Results: RYM1 showed nanomolar range inhibition constants for several MMPs. 99m Tc-RYM1 was radiochemically stable in mouse blood for 5 h and demonstrated rapid renal clearance and lower blood levels in vivo compared with 99m Tc-RP805. 99m Tc-RYM1 binding to aneurysm and its specificity were shown by autoradiography in carotid aneurysm. Angiotensin II infusion in apoE -/- mice for 4 wk resulted in AAA formation in 36% (4/11) of surviving animals. In vivo 99m Tc-RYM1 small-animal SPECT/CT images showed higher uptake of the tracer in AAA than nondilated aortae. Finally, aortic uptake of 99m Tc-RYM1 in vivo correlated with aortic MMP activity and CD68 expression. Conclusion: The newly developed pan-MMP inhibitor-based tracer 99m Tc-RYM1 displays favorable pharmacokinetics for early vascular imaging and enables specific detection of inflammation and MMP activity in aneurysm. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  3. Non local means denoising in photoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Siregar, Syahril; Nagaoka, Ryo; Haq, Israr Ul; Saijo, Yoshifumi

    2018-07-01

    Photoacoustic (PA) imaging has the ability to visualize human organs with high spatial resolution and high contrast. Like digital images, PA images are contaminated with random noise due to some parameters. The band-pass filter does not effectively remove the noise because noise is randomly distributed in the bandwidth frequency. We present noise removal method in PA images by using non local means denoising (NLMD) method. The NLMD can be used if there are similarities or redundancies in the image. PA images contain of blood vessel which repeating on the small patch. The method was tested on PA images of carbon nanotubes in micropipe, in vivo mice brain and in vivo mice ear. We estimated the suggested input parameters of NLMD, so it can be automatically applied after scanning the image in PA imaging system. Our results declared that the NLMD enhanced the image quality of PA images.

  4. Beta cells transfer vesicles containing insulin to phagocytes for presentation to T cells.

    PubMed

    Vomund, Anthony N; Zinselmeyer, Bernd H; Hughes, Jing; Calderon, Boris; Valderrama, Carolina; Ferris, Stephen T; Wan, Xiaoxiao; Kanekura, Kohsuke; Carrero, Javier A; Urano, Fumihiko; Unanue, Emil R

    2015-10-06

    Beta cells from nondiabetic mice transfer secretory vesicles to phagocytic cells. The passage was shown in culture studies where the transfer was probed with CD4 T cells reactive to insulin peptides. Two sets of vesicles were transferred, one containing insulin and another containing catabolites of insulin. The passage required live beta cells in a close cell contact interaction with the phagocytes. It was increased by high glucose concentration and required mobilization of intracellular Ca2+. Live images of beta cell-phagocyte interactions documented the intimacy of the membrane contact and the passage of the granules. The passage was found in beta cells isolated from islets of young nonobese diabetic (NOD) mice and nondiabetic mice as well as from nondiabetic humans. Ultrastructural analysis showed intraislet phagocytes containing vesicles having the distinct morphology of dense-core granules. These findings document a process whereby the contents of secretory granules become available to the immune system.

  5. Monitoring of benzene-induced hematotoxicity in mice by serial leukocyte counting using a microcavity array.

    PubMed

    Hosokawa, Masahito; Asami, Marie; Yoshino, Tomoko; Tsujimura, Noriyuki; Takahashi, Masayuki; Nakasono, Satoshi; Tanaka, Tsuyoshi; Matsunaga, Tadashi

    2013-02-15

    Monitoring of hematotoxicity, which requires serial blood collection, is difficult to carry out in small animals due to a lack of non-invasive, individual animal-appropriate techniques that enable enumeration of leukocyte subsets from limited amounts of whole blood. In this study, a microfluidic device equipped with a microcavity array that enables highly efficient separation of leukocytes from submicroliters of whole blood was applied for hematotoxicity monitoring in mice. The microcavity array can specifically separate leukocytes from whole blood based on differences in the size and deformability between leukocytes and other blood cells. Mouse leukocytes recovered on aligned microcavities were continuously processed for image-based immunophenotypic analysis. Our device successfully recovered almost 100% of mouse leukocytes in 0.1 μL of whole blood without the effect of serial blood collection such as changes in body weight and total leukocyte count. We assessed benzene-associated hematotoxicity in mice using this system. Mice were administered with benzene once daily and the depression of leukocyte numbers induced in individual mice was successfully monitored from tail vein blood collected every other day for 2 weeks. Serial monitoring of the leukocyte number in individual mice will contribute to the understanding of hematotoxicity and reduction of the number of animal experiment trials. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Quantitative analysis of the therapeutic effect of magnolol on MPTP-induced mouse model of Parkinson's disease using in vivo 18F-9-fluoropropyl-(+)-dihydrotetrabenazine PET imaging.

    PubMed

    Weng, Chi-Chang; Chen, Zi-An; Chao, Ko-Ting; Ee, Ting-Wei; Lin, Kun-Ju; Chan, Ming-Huan; Hsiao, Ing-Tsung; Yen, Tzu-Chen; Kung, Mei-Ping; Hsu, Ching-Han; Wey, Shiaw-Pyng

    2017-01-01

    18F-9-Fluoropropyl-(+)-dihydrotetrabenazine [18F-FP-(+)-DTBZ] positron emission tomography (PET) has been shown to detect dopaminergic neuron loss associated with Parkinson's disease (PD) in human and neurotoxin-induced animal models. A polyphenol compound, magnolol, was recently proposed as having a potentially restorative effect in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)- or 6-hydroxydopamine-treated animal models. In this study, 18F-FP-(+)-DTBZ PET was used to determine the therapeutic efficacy of magnolol in an MPTP-PD mouse model that was prepared by giving an intraperitoneally (i.p.) daily dose of 25 mg/kg MPTP to male C57BL/6 mice for 5 consecutive days. Twenty-minute static 18F-FP-(+)-DTBZ PET scans were performed before MPTP treatment and 5 days after the termination of MPTP treatment to set up the baseline control. Half of the MPTP-treated mice then received a daily dose of magnolol (10 mg/kg dissolved in corn oil, i.p.) for 6 days. 18F-FP-(+)-DTBZ PET imaging was performed the day after the final treatment. All 18F-FP-(+)-DTBZ PET images were analysed and the specific uptake ratio (SUr) was calculated. Ex vivo autoradiography (ARG) and corresponding immunohistochemistry (IHC) studies were conducted to confirm the distribution of dopaminergic terminals in the striatum. The striatal SUr ratios of 18F-FP-(+)-DTBZ PET images for the Sham, the MPTP, and the MPTP + Magnolol-treated groups were 1.25 ± 0.05, 0.75 ± 0.06, and 1.00 ± 0.11, respectively (n = 4 for each group). The ex vivo 18F-FP-(+)-DTBZ ARG and IHC results correlated favourably with the PET imaging results. 18F-FP-(+)-DTBZ PET imaging suggested that magnolol post-treatment may reverse the neuronal damage in the MPTP-lesioned PD mice. In vivo imaging of the striatal vesicular monoamine transporter type 2 (VMAT2) distribution using 18F-FP-(+)-DTBZ animal PET is a useful method to evaluate the efficacy of therapeutic drugs i.e., magnolol, for the management of PD.

  7. Quantitative analysis of the therapeutic effect of magnolol on MPTP-induced mouse model of Parkinson’s disease using in vivo 18F-9-fluoropropyl-(+)-dihydrotetrabenazine PET imaging

    PubMed Central

    Chao, Ko-Ting; Ee, Ting-Wei; Lin, Kun-Ju; Chan, Ming-Huan; Hsiao, Ing-Tsung; Yen, Tzu-Chen; Kung, Mei-Ping; Hsu, Ching-Han

    2017-01-01

    18F-9-Fluoropropyl-(+)-dihydrotetrabenazine [18F-FP-(+)-DTBZ] positron emission tomography (PET) has been shown to detect dopaminergic neuron loss associated with Parkinson’s disease (PD) in human and neurotoxin-induced animal models. A polyphenol compound, magnolol, was recently proposed as having a potentially restorative effect in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)- or 6-hydroxydopamine-treated animal models. In this study, 18F-FP-(+)-DTBZ PET was used to determine the therapeutic efficacy of magnolol in an MPTP–PD mouse model that was prepared by giving an intraperitoneally (i.p.) daily dose of 25 mg/kg MPTP to male C57BL/6 mice for 5 consecutive days. Twenty-minute static 18F-FP-(+)-DTBZ PET scans were performed before MPTP treatment and 5 days after the termination of MPTP treatment to set up the baseline control. Half of the MPTP-treated mice then received a daily dose of magnolol (10 mg/kg dissolved in corn oil, i.p.) for 6 days. 18F-FP-(+)-DTBZ PET imaging was performed the day after the final treatment. All 18F-FP-(+)-DTBZ PET images were analysed and the specific uptake ratio (SUr) was calculated. Ex vivo autoradiography (ARG) and corresponding immunohistochemistry (IHC) studies were conducted to confirm the distribution of dopaminergic terminals in the striatum. The striatal SUr ratios of 18F-FP-(+)-DTBZ PET images for the Sham, the MPTP, and the MPTP + Magnolol-treated groups were 1.25 ± 0.05, 0.75 ± 0.06, and 1.00 ± 0.11, respectively (n = 4 for each group). The ex vivo 18F-FP-(+)-DTBZ ARG and IHC results correlated favourably with the PET imaging results. 18F-FP-(+)-DTBZ PET imaging suggested that magnolol post-treatment may reverse the neuronal damage in the MPTP-lesioned PD mice. In vivo imaging of the striatal vesicular monoamine transporter type 2 (VMAT2) distribution using 18F-FP-(+)-DTBZ animal PET is a useful method to evaluate the efficacy of therapeutic drugs i.e., magnolol, for the management of PD. PMID:28257461

  8. A Novel Modality for Functional Imaging in Acute Intervertebral Disk Herniation via Tracking Leukocyte Infiltration.

    PubMed

    Xiao, Li; Ding, Mengmeng; Zhang, Yi; Chordia, Mahendra; Pan, Dongfeng; Shimer, Adam; Shen, Francis; Glover, David; Jin, Li; Li, Xudong

    2017-10-01

    Inflammation plays a key role in the progression of intervertebral disk (IVD) herniation and associated low back pain. However, real-time spatial diagnosis of inflammation associated with acute disk herniation has not been investigated. We sought to detect local neutrophil and macrophage infiltration near disk herniation via the formyl peptide receptor 1 (FPR1)-mediated molecular imaging in a disk puncture mouse model to elucidate pathophysiological process of disk herniation. Disk herniation was induced in mouse with an established needle puncture procedure. Degenerative change of disk and infiltration of neutrophils and macrophages were detected with Safranin-O, hematoxylin and eosin (H&E), and immunohistochemical staining after injury. FPR1-specific imaging probes cFLFLF-PEG-Cy7 and [ 99m Tc]HYNIC-PEG-cFLFLF were administered systemically to sham and disk injury mice. Leukocyte infiltration was tracked by in vivo near-infrared fluorescence (NIRF) and single-photon emission tomography (SPECT) imaging. The peptide-receptor binding specificity was further investigated with FPR1 -/- mice via ex vivo NIRF scan and in vitro binding assays. Safranin-O staining exhibited disorganized disk structure and loss of proteoglycan after puncture. Massive inflammatory cells were observed in the anterior region of punctured annulus in the injury group. The majority of neutrophils were detected at 1 through 3 days, while infiltration of macrophages appeared the most at 7 days after injury. NIRF and SPECT images revealed preferential accumulation of cFLFLF probes in herniation site in wild-type mice but not in FPR1 -/- mice. Binding of the cFLFLF peptide to FPR1 was also observed in RAW 267.4 cells and macrophages isolated from wild-type mice, whereas much less signal was observed in macrophages from FPR1 -/- mice. The presence of macrophage infiltration was also detected in human-herniated disk samples by immunohistochemistry. For the first time, leukocyte infiltration around acute disk herniation site was detected directly and non-invasively in a timely fashion using FPR1-targeted molecular imaging modalities. Such functional imaging of disk herniation via infiltrated leukocytes would advance the understanding of etiology and facilitate drug delivery and treatment monitoring of disk herniation.

  9. Micro-CT Based Experimental Liver Imaging Using a Nanoparticulate Contrast Agent: A Longitudinal Study in Mice

    PubMed Central

    Boll, Hanne; Nittka, Stefanie; Doyon, Fabian; Neumaier, Michael; Marx, Alexander; Kramer, Martin; Groden, Christoph; Brockmann, Marc A.

    2011-01-01

    Background Micro-CT imaging of liver disease in mice relies on high soft tissue contrast to detect small lesions like liver metastases. Purpose of this study was to characterize the localization and time course of contrast enhancement of a nanoparticular alkaline earth metal-based contrast agent (VISCOVER ExiTron nano) developed for small animal liver CT imaging. Methodology ExiTron nano 6000 and ExiTron nano 12000, formulated for liver/spleen imaging and angiography, respectively, were intravenously injected in C57BL/6J-mice. The distribution and time course of contrast enhancement were analysed by repeated micro-CT up to 6 months. Finally, mice developing liver metastases after intrasplenic injection of colon carcinoma cells underwent longitudinal micro-CT imaging after a single injection of ExiTron nano. Principal Findings After a single injection of ExiTron nano the contrast of liver and spleen peaked after 4–8 hours, lasted up to several months and was tolerated well by all mice. In addition, strong contrast enhancement of abdominal and mediastinal lymph nodes and the adrenal glands was observed. Within the first two hours after injection, particularly ExiTron nano 12000 provided pronounced contrast for imaging of vascular structures. ExiTron nano facilitated detection of liver metastases and provided sufficient contrast for longitudinal observation of tumor development over weeks. Conclusions The nanoparticulate contrast agents ExiTron nano 6000 and 12000 provide strong contrast of the liver, spleen, lymph nodes and adrenal glands up to weeks, hereby allowing longitudinal monitoring of pathological processes of these organs in small animals, with ExiTron nano 12000 being particularly optimized for angiography due to its very high initial vessel contrast. PMID:21984939

  10. Unexpected Cartilage Phenotype in CD4-Cre-Conditional SOS-Deficient Mice.

    PubMed

    Guittard, Geoffrey; Gallardo, Devorah L; Li, Wenmei; Melis, Nicolas; Lui, Julian C; Kortum, Robert L; Shakarishvili, Nicholas G; Huh, Sunmee; Baron, Jeffrey; Weigert, Roberto; Kramer, Joshua A; Samelson, Lawrence E; Sommers, Connie L

    2017-01-01

    RAS signaling is central to many cellular processes and SOS proteins promote RAS activation. To investigate the role of SOS proteins in T cell biology, we crossed Sos1 f/f Sos2 -/- mice to CD4-Cre transgenic mice. We previously reported an effect of these mutations on T cell signaling and T cell migration. Unexpectedly, we observed nodules on the joints of greater than 90% of these mutant mice at 5 months of age, especially on the carpal joints. As the mice aged further, some also displayed joint stiffness, hind limb paralysis, and lameness. Histological analysis indicated that the abnormal growth in joints originated from dysplastic chondrocytes. Second harmonic generation imaging of the carpal nodules revealed that nodules were encased by rich collagen fibrous networks. Nodules formed in mice also deficient in RAG2, indicating that conventional T cells, which undergo rearrangement of the T cell antigen receptor, are not required for this phenotype. CD4-Cre expression in a subset of cells, either immune lineage cells (e.g., non-conventional T cells) or non-immune lineage cells (e.g., chondrocytes) likely mediates the dramatic phenotype observed in this study. Disruptions of genes in the RAS signaling pathway are especially likely to cause this phenotype. These results also serve as a cautionary tale to those intending to use CD4-Cre transgenic mice to specifically delete genes in conventional T cells.

  11. Bioluminescent system for dynamic imaging of cell and animal behavior

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hara-Miyauchi, Chikako; Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, Saitama 351-0198; Department of Biophysics and Biochemistry, Graduate School of Health Care Sciences, Tokyo Medical and Dental University, Tokyo 113-8510

    2012-03-09

    Highlights: Black-Right-Pointing-Pointer We combined a yellow variant of GFP and firefly luciferase to make ffLuc-cp156. Black-Right-Pointing-Pointer ffLuc-cp156 showed improved photon yield in cultured cells and transgenic mice. Black-Right-Pointing-Pointer ffLuc-cp156 enabled video-rate bioluminescence imaging of freely-moving animals. Black-Right-Pointing-Pointer ffLuc-cp156 mice enabled tracking real-time drug delivery in conscious animals. -- Abstract: The current utility of bioluminescence imaging is constrained by a low photon yield that limits temporal sensitivity. Here, we describe an imaging method that uses a chemiluminescent/fluorescent protein, ffLuc-cp156, which consists of a yellow variant of Aequorea GFP and firefly luciferase. We report an improvement in photon yield by over threemore » orders of magnitude over current bioluminescent systems. We imaged cellular movement at high resolution including neuronal growth cones and microglial cell protrusions. Transgenic ffLuc-cp156 mice enabled video-rate bioluminescence imaging of freely moving animals, which may provide a reliable assay for drug distribution in behaving animals for pre-clinical studies.« less

  12. Ultrasound Biomicroscopy in Small Animal Research: Applications in Molecular and Preclinical Imaging

    PubMed Central

    Greco, A.; Mancini, M.; Gargiulo, S.; Gramanzini, M.; Claudio, P. P.; Brunetti, A.; Salvatore, M.

    2012-01-01

    Ultrasound biomicroscopy (UBM) is a noninvasive multimodality technique that allows high-resolution imaging in mice. It is affordable, widely available, and portable. When it is coupled to Doppler ultrasound with color and power Doppler, it can be used to quantify blood flow and to image microcirculation as well as the response of tumor blood supply to cancer therapy. Target contrast ultrasound combines ultrasound with novel molecular targeted contrast agent to assess biological processes at molecular level. UBM is useful to investigate the growth and differentiation of tumors as well as to detect early molecular expression of cancer-related biomarkers in vivo and to monitor the effects of cancer therapies. It can be also used to visualize the embryological development of mice in uterus or to examine their cardiovascular development. The availability of real-time imaging of mice anatomy allows performing aspiration procedures under ultrasound guidance as well as the microinjection of cells, viruses, or other agents into precise locations. This paper will describe some basic principles of high-resolution imaging equipment, and the most important applications in molecular and preclinical imaging in small animal research. PMID:22163379

  13. PC-based high-speed video-oculography for measuring rapid eye movements in mice.

    PubMed

    Sakatani, Tomoya; Isa, Tadashi

    2004-05-01

    We newly developed an infrared video-oculographic system for on-line tracking of the eye position in awake and head-fixed mice, with high temporal resolution (240 Hz). The system consists of a commercially available high-speed CCD camera and an image processing software written in LabVIEW run on IBM-PC with a plug-in video grabber board. This software calculates the center and area of the pupil by fitting circular function to the pupil boundary, and allows robust and stable tracking of the eye position in small animals like mice. On-line calculation is performed to obtain reasonable circular fitting of the pupil boundary even if a part of the pupil is covered with shadows or occluded by eyelids or corneal reflections. The pupil position in the 2-D video plane is converted to the rotation angle of the eyeball by estimating its rotation center based on the anatomical eyeball model. By this recording system, it is possible to perform quantitative analysis of rapid eye movements such as saccades in mice. This will provide a powerful tool for analyzing molecular basis of oculomotor and cognitive functions by using various lines of mutant mice.

  14. Hippocampus-dependent place learning enables spatial flexibility in C57BL6/N mice

    PubMed Central

    Kleinknecht, Karl R.; Bedenk, Benedikt T.; Kaltwasser, Sebastian F.; Grünecker, Barbara; Yen, Yi-Chun; Czisch, Michael; Wotjak, Carsten T.

    2012-01-01

    Spatial navigation is a fundamental capability necessary in everyday life to locate food, social partners, and shelter. It results from two very different strategies: (1) place learning which enables for flexible way finding and (2) response learning that leads to a more rigid “route following.” Despite the importance of knockout techniques that are only available in mice, little is known about mice' flexibility in spatial navigation tasks. Here we demonstrate for C57BL6/N mice in a water-cross maze (WCM) that only place learning enables spatial flexibility and relearning of a platform position, whereas response learning does not. This capability depends on an intact hippocampal formation, since hippocampus lesions by ibotenic acid (IA) disrupted relearning. In vivo manganese-enhanced magnetic resonance imaging revealed a volume loss of ≥60% of the hippocampus as a critical threshold for relearning impairments. In particular the changes in the left ventral hippocampus were indicative of relearning deficits. In summary, our findings establish the importance of hippocampus-dependent place learning for spatial flexibility and provide a first systematic analysis on spatial flexibility in mice. PMID:23293591

  15. Imaging thiol redox status in murine tumors in vivo with rapid-scan electron paramagnetic resonance

    NASA Astrophysics Data System (ADS)

    Epel, Boris; Sundramoorthy, Subramanian V.; Krzykawska-Serda, Martyna; Maggio, Matthew C.; Tseytlin, Mark; Eaton, Gareth R.; Eaton, Sandra S.; Rosen, Gerald M.; Kao, Joseph P. Y.; Halpern, Howard J.

    2017-03-01

    Thiol redox status is an important physiologic parameter that affects the success or failure of cancer treatment. Rapid scan electron paramagnetic resonance (RS EPR) is a novel technique that has shown higher signal-to-noise ratio than conventional continuous-wave EPR in in vitro studies. Here we used RS EPR to acquire rapid three-dimensional images of the thiol redox status of tumors in living mice. This work presents, for the first time, in vivo RS EPR images of the kinetics of the reaction of 2H,15N-substituted disulfide-linked dinitroxide (PxSSPx) spin probe with intracellular glutathione. The cleavage rate is proportional to the intracellular glutathione concentration. Feasibility was demonstrated in a FSa fibrosarcoma tumor model in C3H mice. Similar to other in vivo and cell model studies, decreasing intracellular glutathione concentration by treating mice with L-buthionine sulfoximine (BSO) markedly altered the kinetic images.

  16. Quantitative analysis of nanoscale intranuclear structural alterations in hippocampal cells in chronic alcoholism via transmission electron microscopy imaging.

    PubMed

    Sahay, Peeyush; Shukla, Pradeep K; Ghimire, Hemendra M; Almabadi, Huda M; Tripathi, Vibha; Mohanty, Samarendra K; Rao, Radhakrishna; Pradhan, Prabhakar

    2017-03-01

    Chronic alcoholism is known to alter the morphology of the hippocampus, an important region of cognitive function in the brain. Therefore, to understand the effect of chronic alcoholism on hippocampal neural cells, we employed a mouse model of chronic alcoholism and quantified intranuclear nanoscale structural alterations in these cells. Transmission electron microscopy (TEM) images of hippocampal neurons were obtained, and the degree of structural alteration in terms of mass density fluctuation was determined using the light-localization properties of optical media generated from TEM imaging. The results, which were obtained at length scales ranging from ~30 to 200 nm, show that 10-12 week-old mice fed a Lieber-DeCarli liquid (alcoholic) diet had a higher degree of structural alteration than control mice fed a normal diet without alcohol. The degree of structural alteration became significantly distinguishable at a sample length of ~100 nm, which is the typical length scale of the building blocks of cells, such as DNA, RNA, proteins and lipids. Interestingly, different degrees of structural alteration at such length scales suggest possible structural rearrangement of chromatin inside the nuclei in chronic alcoholism.

  17. Quantitative analysis of nanoscale intranuclear structural alterations in hippocampal cells in chronic alcoholism via transmission electron microscopy imaging

    NASA Astrophysics Data System (ADS)

    Sahay, Peeyush; Shukla, Pradeep K.; Ghimire, Hemendra M.; Almabadi, Huda M.; Tripathi, Vibha; Mohanty, Samarendra K.; Rao, Radhakrishna; Pradhan, Prabhakar

    2017-04-01

    Chronic alcoholism is known to alter the morphology of the hippocampus, an important region of cognitive function in the brain. Therefore, to understand the effect of chronic alcoholism on hippocampal neural cells, we employed a mouse model of chronic alcoholism and quantified intranuclear nanoscale structural alterations in these cells. Transmission electron microscopy (TEM) images of hippocampal neurons were obtained, and the degree of structural alteration in terms of mass density fluctuation was determined using the light-localization properties of optical media generated from TEM imaging. The results, which were obtained at length scales ranging from ~30 to 200 nm, show that 10-12 week-old mice fed a Lieber-DeCarli liquid (alcoholic) diet had a higher degree of structural alteration than control mice fed a normal diet without alcohol. The degree of structural alteration became significantly distinguishable at a sample length of ~100 nm, which is the typical length scale of the building blocks of cells, such as DNA, RNA, proteins and lipids. Interestingly, different degrees of structural alteration at such length scales suggest possible structural rearrangement of chromatin inside the nuclei in chronic alcoholism.

  18. Small animal bone density and morphometry analysis with a dual energy x-ray absorptiometry bone densitometer using a 2D digital radiographic detector

    NASA Astrophysics Data System (ADS)

    Boudousq, V.; Bordy, T.; Gonon, G.; Dinten, J. M.

    2005-04-01

    The LEXXOS (DMS, Montpellier, France) is the first axial and total body cone beam bone densitometer using a 2D digital radiographic detector. Technical principles and performances for BMD measurements have been presented in previous papers. Bone densitometers are also used on small animals for drug development. In this paper, we show how the LEXXOS system can be adapted to small animals examinations, and its performances are evaluated. At first, in order to take advantage of the whole area of the digital flat panel X-ray detector, the geometrical configuration has been adapted. Secondly, as small animals present low BMD, a specific dual energy calibration has been defined. This adapted system has then been evaluated on two sets of mice: six reference mice and six ovariectomized mice. Each month, these two populations have been examined and the total body BMD has been measured. This evaluation has shown that the right order of BMD magnitude has been obtained and, as expected, BMD increases on the two sets until age of puberty and after this period, decreases significantly for the ovariectomized set. Moreover, the bone image obtained by dual energy processing on LEXXOS presents a radiographic image quality providing with useful complementary information on bone morphometry and architecture.

  19. Transient repetitive exposure to low level light therapy enhances collateral blood vessel growth in the ischemic hindlimb of the tight skin mouse.

    PubMed

    Zaidi, Maria; Krolikowki, John G; Jones, Deron W; Pritchard, Kirkwood A; Struve, Janine; Nandedkar, Sandhya D; Lohr, Nicole L; Pagel, Paul S; Weihrauch, Dorothée

    2013-01-01

    The tight skin mouse (Tsk(-/+)) is a model of scleroderma characterized by impaired vasoreactivity, increased oxidative stress, attenuated angiogenic response to VEGF and production of the angiogenesis inhibitor angiostatin. Low-level light therapy (LLLT) stimulates angiogenesis in myocardial infarction and chemotherapy-induced mucositis. We hypothesize that repetitive LLLT restores vessel growth in the ischemic hindlimb of Tsk(-/+) mice by attenuating angiostatin and enhancing angiomotin effects in vivo. C57Bl/6J and Tsk(-/+) mice underwent ligation of the femoral artery. Relative blood flow to the foot was measured using a laser Doppler imager. Tsk(-/+) mice received LLLT (670 nm, 50 mW cm(-2), 30 J cm(-2)) for 10 min per day for 14 days. Vascular density was determined using lycopersicom lectin staining. Immunofluorescent labeling, Western blot analysis and immunoprecipitation were used to determine angiostatin and angiomotin expression. Recovery of blood flow to the ischemic limb was reduced in Tsk(-/+) compared with C57Bl/6 mice 2 weeks after surgery. LLLT treatment of Tsk(-/+) mice restored blood flow to levels observed in C57Bl/6 mice. Vascular density was decreased, angiostatin expression was enhanced and angiomotin depressed in the ischemic hindlimb of Tsk(-/+) mice. LLLT treatment reversed these abnormalities. LLLT stimulates angiogenesis by increasing angiomotin and decreasing angiostatin expression in the ischemic hindlimb of Tsk(-/+) mice. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.

  20. Enhanced delivery of paclitaxel liposomes using focused ultrasound with microbubbles for treating nude mice bearing intracranial glioblastoma xenografts.

    PubMed

    Shen, Yuanyuan; Pi, Zhaoke; Yan, Fei; Yeh, Chih-Kuang; Zeng, Xiaojun; Diao, Xianfen; Hu, Yaxin; Chen, Siping; Chen, Xin; Zheng, Hairong

    2017-01-01

    Paclitaxel liposomes (PTX-LIPO) are a clinically promising antineoplastic drug formulation for the treatment of various extracranial cancers, excluding glioblastoma. A main reason for this is the presence of the blood-brain barrier (BBB) or blood-tumor barrier (BTB), preventing liposomal drugs from crossing at a therapeutically meaningful level. Focused ultrasound (FUS) in conjunction with microbubbles (MBs) has been suggested in many studies to be an effective approach to increase the BBB or BTB permeability. In this study, we investigated the feasibility of enhancing the delivery of PTX-LIPO in intracranial glioblastoma-bearing nude mice using pulsed low-intensity FUS exposure in the presence of MBs. Our results showed that the delivery efficiency of PTX-LIPO could be effectively improved in terms of the penetration of both the BBB in vitro and BTB in vivo by pulsed FUS sonication with a 10 ms pulse length and 1 Hz pulse repetition frequency at 0.64 MPa peak-rarefactional pressure in the presence of MBs. Quantitative analysis showed that a 2-fold higher drug concentration had accumulated in the glioblastoma 3 h after FUS treatment, with 7.20±1.18 µg PTX per g glioma tissue. Longitudinal magnetic resonance imaging analysis illustrated that the intracranial glioblastoma progression in nude mice treated with PTX-LIPO delivered via FUS with MBs was suppressed consistently for 4 weeks compared to the untreated group. The medium survival time of these tumor-bearing nude mice was significantly prolonged by 20.8%, compared to the untreated nude mice. Immunohistochemical analysis further confirmed the antiproliferation effect and cell apoptosis induction. Our study demonstrated that noninvasive low-intensity FUS with MBs can be used as an effective approach to deliver PTX-LIPO in order to improve their chemotherapy efficacy toward glioblastoma.

  1. Assessing Cardiac Injury in Mice With Dual Energy-MicroCT, 4D-MicroCT, and MicroSPECT Imaging After Partial Heart Irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Chang-Lung; Min, Hooney; Befera, Nicholas

    Purpose: To develop a mouse model of cardiac injury after partial heart irradiation (PHI) and to test whether dual energy (DE)-microCT and 4-dimensional (4D)-microCT can be used to assess cardiac injury after PHI to complement myocardial perfusion imaging using micro-single photon emission computed tomography (SPECT). Methods and Materials: To study cardiac injury from tangent field irradiation in mice, we used a small-field biological irradiator to deliver a single dose of 12 Gy x-rays to approximately one-third of the left ventricle (LV) of Tie2Cre; p53{sup FL/+} and Tie2Cre; p53{sup FL/−} mice, where 1 or both alleles of p53 are deleted in endothelialmore » cells. Four and 8 weeks after irradiation, mice were injected with gold and iodinated nanoparticle-based contrast agents, and imaged with DE-microCT and 4D-microCT to evaluate myocardial vascular permeability and cardiac function, respectively. Additionally, the same mice were imaged with microSPECT to assess myocardial perfusion. Results: After PHI with tangent fields, DE-microCT scans showed a time-dependent increase in accumulation of gold nanoparticles (AuNp) in the myocardium of Tie2Cre; p53{sup FL/−} mice. In Tie2Cre; p53{sup FL/−} mice, extravasation of AuNp was observed within the irradiated LV, whereas in the myocardium of Tie2Cre; p53{sup FL/+} mice, AuNp were restricted to blood vessels. In addition, data from DE-microCT and microSPECT showed a linear correlation (R{sup 2} = 0.97) between the fraction of the LV that accumulated AuNp and the fraction of LV with a perfusion defect. Furthermore, 4D-microCT scans demonstrated that PHI caused a markedly decreased ejection fraction, and higher end-diastolic and end-systolic volumes, to develop in Tie2Cre; p53{sup FL/−} mice, which were associated with compensatory cardiac hypertrophy of the heart that was not irradiated. Conclusions: Our results show that DE-microCT and 4D-microCT with nanoparticle-based contrast agents are novel imaging approaches complementary to microSPECT for noninvasive assessment of the change in myocardial vascular permeability and cardiac function of mice in whom myocardial injury develops after PHI.« less

  2. Validation of luminescent source reconstruction using spectrally resolved bioluminescence images

    NASA Astrophysics Data System (ADS)

    Virostko, John M.; Powers, Alvin C.; Jansen, E. D.

    2008-02-01

    This study examines the accuracy of the Living Image® Software 3D Analysis Package (Xenogen, Alameda, CA) in reconstruction of light source depth and intensity. Constant intensity light sources were placed in an optically homogeneous medium (chicken breast). Spectrally filtered images were taken at 560, 580, 600, 620, 640, and 660 nanometers. The Living Image® Software 3D Analysis Package was employed to reconstruct source depth and intensity using these spectrally filtered images. For sources shallower than the mean free path of light there was proportionally higher inaccuracy in reconstruction. For sources deeper than the mean free path, the average error in depth and intensity reconstruction was less than 4% and 12%, respectively. The ability to distinguish multiple sources decreased with increasing source depth and typically required a spatial separation of twice the depth. The constant intensity light sources were also implanted in mice to examine the effect of optical inhomogeneity. The reconstruction accuracy suffered in inhomogeneous tissue with accuracy influenced by the choice of optical properties used in reconstruction.

  3. Imaging system for creating 3D block-face cryo-images of whole mice

    NASA Astrophysics Data System (ADS)

    Roy, Debashish; Breen, Michael; Salvado, Olivier; Heinzel, Meredith; McKinley, Eliot; Wilson, David

    2006-03-01

    We developed a cryomicrotome/imaging system that provides high resolution, high sensitivity block-face images of whole mice or excised organs, and applied it to a variety of biological applications. With this cryo-imaging system, we sectioned cryo-preserved tissues at 2-40 μm thickness and acquired high resolution brightfield and fluorescence images with microscopic in-plane resolution (as good as 1.2 μm). Brightfield images of normal and pathological anatomy show exquisite detail, especially in the abdominal cavity. Multi-planar reformatting and 3D renderings allow one to interrogate 3D structures. In this report, we present brightfield images of mouse anatomy, as well as 3D renderings of organs. For BPK mice model of polycystic kidney disease, we compared brightfield cryo-images and kidney volumes to MRI. The color images provided greater contrast and resolution of cysts as compared to in vivo MRI. We note that color cryo-images are closer to what a researcher sees in dissection, making it easier for them to interpret image data. The combination of field of view, depth of field, ultra high resolution and color/fluorescence contrast enables cryo-image volumes to provide details that cannot be found through in vivo imaging or other ex vivo optical imaging approaches. We believe that this novel imaging system will have applications that include identification of mouse phenotypes, characterization of diseases like blood vessel disease, kidney disease, and cancer, assessment of drug and gene therapy delivery and efficacy and validation of other imaging modalities.

  4. Detection and Evaluation of Early Breast Cancer via Magnetic Resonance Imaging: Studies of Mouse Models and Clinical Implementation

    DTIC Science & Technology

    2007-03-01

    Krausz 3 M.D., Marta Zamora1 B.Sc., Erica Markewicz1 B.Sc., Sean Foxley1 M.Sc., Xiaobing Fan1 Ph.D., Dianna Pang2 B.Sc., Brad Williams2 B.Sc., So...of prostate tumors in mice. NMR Biomed 2005; 18:285-292. 28. Szabo BK, Aspelin P, Wiberg MK, Bone B. Dynamic MR imaging of the breast. Analysis of...enhancement (E1, Epeak) and time to peak enhancement (Tpeak) were measured for each curve as performed by Szabo et al (24). The signal enhancement

  5. Electron-tracking Compton gamma-ray camera for small animal and phantom imaging

    NASA Astrophysics Data System (ADS)

    Kabuki, Shigeto; Kimura, Hiroyuki; Amano, Hiroo; Nakamoto, Yuji; Kubo, Hidetoshi; Miuchi, Kentaro; Kurosawa, Shunsuke; Takahashi, Michiaki; Kawashima, Hidekazu; Ueda, Masashi; Okada, Tomohisa; Kubo, Atsushi; Kunieda, Etuso; Nakahara, Tadaki; Kohara, Ryota; Miyazaki, Osamu; Nakazawa, Tetsuo; Shirahata, Takashi; Yamamoto, Etsuji; Ogawa, Koichi; Togashi, Kaori; Saji, Hideo; Tanimori, Toru

    2010-11-01

    We have developed an electron-tracking Compton camera (ETCC) for medical use. Our ETCC has a wide energy dynamic range (200-1300 keV) and wide field of view (3 sr), and thus has potential for advanced medical use. To evaluate the ETCC, we imaged the head (brain) and bladder of mice that had been administered with F-18-FDG. We also imaged the head and thyroid gland of mice using double tracers of F-18-FDG and I-131 ions.

  6. Role of Proinflammatory Cytokines in Thermal Activation of Lymphocyte Recruitment to Breast Tumor Microvessels

    DTIC Science & Technology

    2007-03-01

    Photomicrographs show typical images. Scale bar, 50 µm. Data are the mean ± SE and are representative of ≥ 3 independent experiments. P values represent the...not affect ICAM-1 expression in normal islets of RIP-Tag5 pancreas. Photomicrographs show typical images. Scale bar, 50 µm. 2 We have identified the...WBH-treated mice. Thermal upregulation of vascular ICAM-1 expression was abolished in IL-6 KO mice. Photomicrographs show typical images. Scale bar

  7. Accelerated dual-contrast first-pass perfusion MRI of the mouse heart: development and application to diet-induced obese mice.

    PubMed

    Naresh, Nivedita K; Chen, Xiao; Roy, Rene J; Antkowiak, Patrick F; Annex, Brian H; Epstein, Frederick H

    2015-03-01

    Gene-modified mice may be used to elucidate molecular mechanisms underlying abnormal myocardial blow flow (MBF). We sought to develop a quantitative myocardial perfusion imaging technique for mice and to test the hypothesis that myocardial perfusion reserve (MPR) is reduced in a mouse model of diet-induced obesity (DIO). A dual-contrast saturation-recovery sequence with ky -t undersampling and a motion-compensated compressed sensing reconstruction algorithm was developed for first-pass MRI on a small-bore 7 Tesla system. Control mice were imaged at rest and with the vasodilators ATL313 and Regadenoson (n = 6 each). In addition, we imaged mice fed a high-fat diet (HFD) for 24 weeks. In control mice, MBF was 5.7 ± 0.8 mL/g/min at rest and it increased to 11.8 ± 0.6 mL/g/min with ATL313 and to 10.4 ± 0.3 mL/g/min with Regadenoson. In HFD mice, we detected normal resting MBF (5.6 ± 0.4 versus 5.0 ± 0.3 on control diet), low MBF at stress (7.7 ± 0.4 versus 10.4 ± 0.3 on control diet, P < 0.05), and reduced MPR (1.4 ± 0.2 versus 2.0 ± 0.3 on control diet, P < 0.05). Accelerated dual-contrast first-pass MRI with motion-compensated compressed sensing provides spatiotemporal resolution suitable for measuring MBF in free-breathing mice, and detected reduced MPR in DIO mice. These techniques may be used to study molecular mechanisms that underlie abnormal myocardial perfusion. © 2014 Wiley Periodicals, Inc.

  8. Accelerated Dual-contrast First-pass Perfusion MRI of the Mouse Heart: Development and Application to Diet-induced Obese Mice

    PubMed Central

    Naresh, Nivedita K.; Chen, Xiao; Roy, Rene J.; Antkowiak, Patrick F.; Annex, Brian H.; Epstein, Frederick H.

    2014-01-01

    Background Gene-modified mice may be used to elucidate molecular mechanisms underlying abnormal myocardial blood flow (MBF). We sought to develop a quantitative myocardial perfusion imaging technique for mice and to test the hypothesis that myocardial perfusion reserve (MPR) is reduced in a mouse model of diet-induced obesity (DIO). Methods A dual-contrast saturation-recovery sequence with ky-t undersampling and a motion-compensated compressed sensing reconstruction algorithm was developed for first-pass MRI on a small-bore 7T system. Control mice were imaged at rest and with the vasodilators ATL313 and Regadenoson (n=6 each). In addition, we imaged mice fed a high-fat diet (HFD) for 24 weeks. Results In control mice, MBF was 5.7±0.8 ml/g/min at rest and it increased to 11.8±0.6 ml/g/min with ATL313 and to 10.4±0.3 ml/g/min with Regadenoson. In HFD mice we detected normal resting MBF (5.6±0.4 vs. 5.0±0.3 on control diet), low MBF at stress (7.7±0.4 vs. 10.4±0.3 on control diet, p<0.05), and reduced MPR (1.4±0.2 vs. 2.0±0.3 on control diet, p<0.05). Conclusions Accelerated dual-contrast first-pass MRI with motion-compensated compressed sensing provides spatiotemporal resolution suitable for measuring MBF in free-breathing mice, and detected reduced MPR in DIO mice. These techniques may be used to study molecular mechanisms that underlie abnormal myocardial perfusion. PMID:24760707

  9. Multi-Modal Imaging in a Mouse Model of Orthotopic Lung Cancer

    PubMed Central

    Patel, Priya; Kato, Tatsuya; Ujiie, Hideki; Wada, Hironobu; Lee, Daiyoon; Hu, Hsin-pei; Hirohashi, Kentaro; Ahn, Jin Young; Zheng, Jinzi; Yasufuku, Kazuhiro

    2016-01-01

    Background Investigation of CF800, a novel PEGylated nano-liposomal imaging agent containing indocyanine green (ICG) and iohexol, for real-time near infrared (NIR) fluorescence and computed tomography (CT) image-guided surgery in an orthotopic lung cancer model in nude mice. Methods CF800 was intravenously administered into 13 mice bearing the H460 orthotopic human lung cancer. At 48 h post-injection (peak imaging agent accumulation time point), ex vivo NIR and CT imaging was performed. A clinical NIR imaging system (SPY®, Novadaq) was used to measure fluorescence intensity of tumor and lung. Tumor-to-background-ratios (TBR) were calculated in inflated and deflated states. The mean Hounsfield unit (HU) of lung tumor was quantified using the CT data set and a semi-automated threshold-based method. Histological evaluation using H&E, the macrophage marker F4/80 and the endothelial cell marker CD31, was performed, and compared to the liposomal fluorescence signal obtained from adjacent tissue sections Results The fluorescence TBR measured when the lung is in the inflated state (2.0 ± 0.58) was significantly greater than in the deflated state (1.42 ± 0.380 (n = 7, p<0.003). Mean fluorescent signal in tumor was highly variable across samples, (49.0 ± 18.8 AU). CT image analysis revealed greater contrast enhancement in lung tumors (a mean increase of 110 ± 57 HU) when CF800 is administered compared to the no contrast enhanced tumors (p = 0.0002). Conclusion Preliminary data suggests that the high fluorescence TBR and CT tumor contrast enhancement provided by CF800 may have clinical utility in localization of lung cancer during CT and NIR image-guided surgery. PMID:27584018

  10. Multi-Modal Imaging in a Mouse Model of Orthotopic Lung Cancer.

    PubMed

    Patel, Priya; Kato, Tatsuya; Ujiie, Hideki; Wada, Hironobu; Lee, Daiyoon; Hu, Hsin-Pei; Hirohashi, Kentaro; Ahn, Jin Young; Zheng, Jinzi; Yasufuku, Kazuhiro

    2016-01-01

    Investigation of CF800, a novel PEGylated nano-liposomal imaging agent containing indocyanine green (ICG) and iohexol, for real-time near infrared (NIR) fluorescence and computed tomography (CT) image-guided surgery in an orthotopic lung cancer model in nude mice. CF800 was intravenously administered into 13 mice bearing the H460 orthotopic human lung cancer. At 48 h post-injection (peak imaging agent accumulation time point), ex vivo NIR and CT imaging was performed. A clinical NIR imaging system (SPY®, Novadaq) was used to measure fluorescence intensity of tumor and lung. Tumor-to-background-ratios (TBR) were calculated in inflated and deflated states. The mean Hounsfield unit (HU) of lung tumor was quantified using the CT data set and a semi-automated threshold-based method. Histological evaluation using H&E, the macrophage marker F4/80 and the endothelial cell marker CD31, was performed, and compared to the liposomal fluorescence signal obtained from adjacent tissue sections. The fluorescence TBR measured when the lung is in the inflated state (2.0 ± 0.58) was significantly greater than in the deflated state (1.42 ± 0.380 (n = 7, p<0.003). Mean fluorescent signal in tumor was highly variable across samples, (49.0 ± 18.8 AU). CT image analysis revealed greater contrast enhancement in lung tumors (a mean increase of 110 ± 57 HU) when CF800 is administered compared to the no contrast enhanced tumors (p = 0.0002). Preliminary data suggests that the high fluorescence TBR and CT tumor contrast enhancement provided by CF800 may have clinical utility in localization of lung cancer during CT and NIR image-guided surgery.

  11. Automatic Stem Cell Detection in Microscopic Whole Mouse Cryo-imaging

    PubMed Central

    Wuttisarnwattana, Patiwet; Gargesha, Madhusudhana; Hof, Wouter van’t; Cooke, Kenneth R.

    2016-01-01

    With its single cell sensitivity over volumes as large as or larger than a mouse, cryo-imaging enables imaging of stem cell biodistribution, homing, engraftment, and molecular mechanisms. We developed and evaluated a highly automated software tool to detect fluorescently labeled stem cells within very large (~200GB) cryo-imaging datasets. Cell detection steps are: preprocess, remove immaterial regions, spatially filter to create features, identify candidate pixels, classify pixels using bagging decision trees, segment cell patches, and perform 3D labeling. There are options for analysis and visualization. To train the classifier, we created synthetic images by placing realistic digital cell models onto cryo-images of control mice devoid of cells. Very good cell detection results were (precision=98.49%, recall=99.97%) for synthetic cryo-images, (precision=97.81%, recall=97.71%) for manually evaluated, actual cryo-images, and <1% false positives in control mice. An α-multiplier applied to features allows one to correct for experimental variations in cell brightness due to labeling. On dim cells (37% of standard brightness), with correction, we improved recall (49.26%→99.36%) without a significant drop in precision (99.99%→99.75%). With tail vein injection, multipotent adult progenitor cells in a graft-versus-host-disease model in the first days post injection were predominantly found in lung, liver, spleen, and bone marrow. Distribution was not simply related to blood flow. The lung contained clusters of cells while other tissues contained single cells. Our methods provided stem cell distribution anywhere in mouse with single cell sensitivity. Methods should provide a rational means of evaluating dosing, delivery methods, cell enhancements, and mechanisms for therapeutic cells. PMID:26552080

  12. Quantitative T2 combined with texture analysis of nuclear magnetic resonance images identify different degrees of muscle involvement in three mouse models of muscle dystrophy: mdx, Largemyd and mdx/Largemyd.

    PubMed

    Martins-Bach, Aurea B; Malheiros, Jackeline; Matot, Béatrice; Martins, Poliana C M; Almeida, Camila F; Caldeira, Waldir; Ribeiro, Alberto F; Loureiro de Sousa, Paulo; Azzabou, Noura; Tannús, Alberto; Carlier, Pierre G; Vainzof, Mariz

    2015-01-01

    Quantitative nuclear magnetic resonance imaging (MRI) has been considered a promising non-invasive tool for monitoring therapeutic essays in small size mouse models of muscular dystrophies. Here, we combined MRI (anatomical images and transverse relaxation time constant-T2-measurements) to texture analyses in the study of four mouse strains covering a wide range of dystrophic phenotypes. Two still unexplored mouse models of muscular dystrophies were analyzed: The severely affected Largemyd mouse and the recently generated and worst double mutant mdx/Largemyd mouse, as compared to the mildly affected mdx and normal mice. The results were compared to histopathological findings. MRI showed increased intermuscular fat and higher muscle T2 in the three dystrophic mouse models when compared to the wild-type mice (T2: mdx/Largemyd: 37.6±2.8 ms; mdx: 35.2±4.5 ms; Largemyd: 36.6±4.0 ms; wild-type: 29.1±1.8 ms, p<0.05), in addition to higher muscle T2 in the mdx/Largemyd mice when compared to mdx (p<0.05). The areas with increased muscle T2 in the MRI correlated spatially with the identified histopathological alterations such as necrosis, inflammation, degeneration and regeneration foci. Nevertheless, muscle T2 values were not correlated with the severity of the phenotype in the 3 dystrophic mouse strains, since the severely affected Largemyd showed similar values than both the mild mdx and worst mdx/Largemyd lineages. On the other hand, all studied mouse strains could be unambiguously identified with texture analysis, which reflected the observed differences in the distribution of signals in muscle MRI. Thus, combined T2 intensity maps and texture analysis is a powerful approach for the characterization and differentiation of dystrophic muscles with diverse genotypes and phenotypes. These new findings provide important noninvasive tools in the evaluation of the efficacy of new therapies, and most importantly, can be directly applied in human translational research.

  13. Quantitative T2 Combined with Texture Analysis of Nuclear Magnetic Resonance Images Identify Different Degrees of Muscle Involvement in Three Mouse Models of Muscle Dystrophy: mdx, Largemyd and mdx/Largemyd

    PubMed Central

    Martins-Bach, Aurea B.; Malheiros, Jackeline; Matot, Béatrice; Martins, Poliana C. M.; Almeida, Camila F.; Caldeira, Waldir; Ribeiro, Alberto F.; Loureiro de Sousa, Paulo; Azzabou, Noura; Tannús, Alberto; Carlier, Pierre G.; Vainzof, Mariz

    2015-01-01

    Quantitative nuclear magnetic resonance imaging (MRI) has been considered a promising non-invasive tool for monitoring therapeutic essays in small size mouse models of muscular dystrophies. Here, we combined MRI (anatomical images and transverse relaxation time constant—T2—measurements) to texture analyses in the study of four mouse strains covering a wide range of dystrophic phenotypes. Two still unexplored mouse models of muscular dystrophies were analyzed: The severely affected Largemyd mouse and the recently generated and worst double mutant mdx/Largemyd mouse, as compared to the mildly affected mdx and normal mice. The results were compared to histopathological findings. MRI showed increased intermuscular fat and higher muscle T2 in the three dystrophic mouse models when compared to the wild-type mice (T2: mdx/Largemyd: 37.6±2.8 ms; mdx: 35.2±4.5 ms; Largemyd: 36.6±4.0 ms; wild-type: 29.1±1.8 ms, p<0.05), in addition to higher muscle T2 in the mdx/Largemyd mice when compared to mdx (p<0.05). The areas with increased muscle T2 in the MRI correlated spatially with the identified histopathological alterations such as necrosis, inflammation, degeneration and regeneration foci. Nevertheless, muscle T2 values were not correlated with the severity of the phenotype in the 3 dystrophic mouse strains, since the severely affected Largemyd showed similar values than both the mild mdx and worst mdx/Largemyd lineages. On the other hand, all studied mouse strains could be unambiguously identified with texture analysis, which reflected the observed differences in the distribution of signals in muscle MRI. Thus, combined T2 intensity maps and texture analysis is a powerful approach for the characterization and differentiation of dystrophic muscles with diverse genotypes and phenotypes. These new findings provide important noninvasive tools in the evaluation of the efficacy of new therapies, and most importantly, can be directly applied in human translational research. PMID:25710816

  14. Framework for hyperspectral image processing and quantification for cancer detection during animal tumor surgery.

    PubMed

    Lu, Guolan; Wang, Dongsheng; Qin, Xulei; Halig, Luma; Muller, Susan; Zhang, Hongzheng; Chen, Amy; Pogue, Brian W; Chen, Zhuo Georgia; Fei, Baowei

    2015-01-01

    Hyperspectral imaging (HSI) is an imaging modality that holds strong potential for rapid cancer detection during image-guided surgery. But the data from HSI often needs to be processed appropriately in order to extract the maximum useful information that differentiates cancer from normal tissue. We proposed a framework for hyperspectral image processing and quantification, which includes a set of steps including image preprocessing, glare removal, feature extraction, and ultimately image classification. The framework has been tested on images from mice with head and neck cancer, using spectra from 450- to 900-nm wavelength. The image analysis computed Fourier coefficients, normalized reflectance, mean, and spectral derivatives for improved accuracy. The experimental results demonstrated the feasibility of the hyperspectral image processing and quantification framework for cancer detection during animal tumor surgery, in a challenging setting where sensitivity can be low due to a modest number of features present, but potential for fast image classification can be high. This HSI approach may have potential application in tumor margin assessment during image-guided surgery, where speed of assessment may be the dominant factor.

  15. Framework for hyperspectral image processing and quantification for cancer detection during animal tumor surgery

    NASA Astrophysics Data System (ADS)

    Lu, Guolan; Wang, Dongsheng; Qin, Xulei; Halig, Luma; Muller, Susan; Zhang, Hongzheng; Chen, Amy; Pogue, Brian W.; Chen, Zhuo Georgia; Fei, Baowei

    2015-12-01

    Hyperspectral imaging (HSI) is an imaging modality that holds strong potential for rapid cancer detection during image-guided surgery. But the data from HSI often needs to be processed appropriately in order to extract the maximum useful information that differentiates cancer from normal tissue. We proposed a framework for hyperspectral image processing and quantification, which includes a set of steps including image preprocessing, glare removal, feature extraction, and ultimately image classification. The framework has been tested on images from mice with head and neck cancer, using spectra from 450- to 900-nm wavelength. The image analysis computed Fourier coefficients, normalized reflectance, mean, and spectral derivatives for improved accuracy. The experimental results demonstrated the feasibility of the hyperspectral image processing and quantification framework for cancer detection during animal tumor surgery, in a challenging setting where sensitivity can be low due to a modest number of features present, but potential for fast image classification can be high. This HSI approach may have potential application in tumor margin assessment during image-guided surgery, where speed of assessment may be the dominant factor.

  16. Quantification of dopamine transporters in the mouse brain using ultra-high resolution single-photon emission tomography.

    PubMed

    Acton, Paul D; Choi, Seok-Rye; Plössl, Karl; Kung, Hank F

    2002-05-01

    Functional imaging of small animals, such as mice and rats, using ultra-high resolution positron emission tomography (PET) and single-photon emission tomography (SPET), is becoming a valuable tool for studying animal models of human disease. While several studies have shown the utility of PET imaging in small animals, few have used SPET in real research applications. In this study we aimed to demonstrate the feasibility of using ultra-high resolution SPET in quantitative studies of dopamine transporters (DAT) in the mouse brain. Four healthy ICR male mice were injected with (mean+/-SD) 704+/-154 MBq [(99m)Tc]TRODAT-1, and scanned using an ultra-high resolution SPET system equipped with pinhole collimators (spatial resolution 0.83 mm at 3 cm radius of rotation). Each mouse had two studies, to provide an indication of test-retest reliability. Reference tissue kinetic modeling analysis of the time-activity data in the striatum and cerebellum was used to quantitate the availability of DAT. A simple equilibrium ratio of striatum to cerebellum provided another measure of DAT binding. The SPET imaging results were compared against ex vivo biodistribution data from the striatum and cerebellum. The mean distribution volume ratio (DVR) from the reference tissue kinetic model was 2.17+/-0.34, with a test-retest reliability of 2.63%+/-1.67%. The ratio technique gave similar results (DVR=2.03+/-0.38, test-retest reliability=6.64%+/-3.86%), and the ex vivo analysis gave DVR=2.32+/-0.20. Correlations between the kinetic model and the ratio technique ( R(2)=0.86, P<0.001) and the ex vivo data ( R(2)=0.92, P=0.04) were both excellent. This study demonstrated clearly that ultra-high resolution SPET of small animals is capable of accurate, repeatable, and quantitative measures of DAT binding, and should open up the possibility of further studies of cerebral binding sites in mice using pinhole SPET.

  17. Optic tract injury after closed head traumatic brain injury in mice: A model of indirect traumatic optic neuropathy.

    PubMed

    Evanson, Nathan K; Guilhaume-Correa, Fernanda; Herman, James P; Goodman, Michael D

    2018-01-01

    Adult male C57BL/6J mice have previously been reported to have motor and memory deficits after experimental closed head traumatic brain injury (TBI), without associated gross pathologic damage or neuroimaging changes detectable by magnetic resonance imaging or diffusion tensor imaging protocols. The presence of neurologic deficits, however, suggests neural damage or dysfunction in these animals. Accordingly, we undertook a histologic analysis of mice after TBI. Gross pathology and histologic analysis using Nissl stain and NeuN immunohistochemistry demonstrated no obvious tissue damage or neuron loss. However, Luxol Fast Blue stain revealed myelin injury in the optic tract, while Fluoro Jade B and silver degeneration staining revealed evidence of axonal neurodegeneration in the optic tract as well as the lateral geniculate nucleus of the thalamus and superior colliculus (detectable at 7 days, but not 24 hours, after injury). Fluoro Jade B staining was not detectable in other white matter tracts, brain regions or in cell somata. In addition, there was increased GFAP staining in these optic tract, lateral geniculate, and superior colliculus 7 days post-injury, and morphologic changes in optic tract microglia that were detectable 24 hours after injury but were more prominent 7 days post-injury. Interestingly, there were no findings of degeneration or gliosis in the suprachiasmatic nucleus, which is also heavily innervated by the optic tract. Using micro-computed tomography imaging, we also found that the optic canal appears to decrease in diameter with a dorsal-ventral load on the skull, which suggests that the optic canal may be the site of injury. These results suggest that there is axonal degeneration in the optic tract and a subset of directly innervated areas, with associated neuroinflammation and astrocytosis, which develop within 7 days of injury, and also suggest that this weight drop injury may be a model for studying indirect traumatic optic neuropathy.

  18. A Novel Liposomal Nanoparticle for the Imaging of Amyloid Plaque by Magnetic Resonance Imaging.

    PubMed

    Tanifum, Eric A; Ghaghada, Ketan; Vollert, Craig; Head, Elizabeth; Eriksen, Jason L; Annapragada, Ananth

    2016-01-01

    Amyloid binding molecules with greater hydrophilicity than existing ligands were synthesized. The lead candidate ET6-21 bound amyloid fibrils, and amyloid deposits in dog brain and human brain tissue ex vivo. The ligand was used to prepare novel amyloid-targeted liposomal nanoparticles. The preparation was tested in the Tg2576 and TetO/APP mouse models of amyloid deposition. Gd chelates and Indocyanine green were included in the particles for visualization by MRI and near-infrared microscopy. Upon intravenous injection, the particles successfully traversed the blood-brain barrier in these mice, and bound to the plaques. Magnetic resonance imaging (T1-MRI) conducted 4 days after injection demonstrated elevated signal in the brains of mice with amyloid plaques present. No signal was observed in amyloid-negative mice, or in amyloid-positive mice injected with an untargeted version of the same agent. The MRI results were confirmed by immunohistochemical and fluorescent microscopic examination of mouse brain sections, showing colocalization of the fluorescent tags and amyloid deposits.

  19. Dentate gyrus volume is reduced before onset of plaque formation in PDAPP mice: A magnetic resonance microscopy and stereologic analysis

    PubMed Central

    Redwine, Jeffrey M.; Kosofsky, Barry; Jacobs, Russell E.; Games, Dora; Reilly, John F.; Morrison, John H.; Young, Warren G.; Bloom, Floyd E.

    2003-01-01

    High-resolution magnetic resonance microscopy (MRM) was used to determine regional brain volumetric changes in a mouse model of Alzheimer's disease. These transgenic (Tg) mice overexpress human mutant amyloid precursor protein (APP) V717F under control of platelet-derived growth factor promoter (PDAPP mice), and cortical and hippocampal β-amyloid (Aβ) deposits accumulate in heterozygotes after 8–10 mos. We used MRM to obtain 3D volumetric data on mouse brains imaged in their skulls to define genotype- and age-related changes. Hippocampal, cerebellar, and brain volumes and corpus callosum length were quantified in 40-, 100-, 365-, and 630-day-old mice. Measurements taken at age 100 days, before Aβ deposition, revealed a 12.3% reduction of hippocampus volume in Tg mice compared with WT controls. This reduction persisted without progression to age 21 mos. A significant 18% increase in hippocampal volume occurred between 40 and 630 days in WT mice, and no corresponding significant increase occurred in Tg mice. Cavalieri volume estimates of hippocampal subfields from 100-day-old Tg mice further localized a 28% volume deficit in the dentate gyrus. In addition, corpus callosum length was reduced by ≈25% in Tg mice at all ages analyzed. In summary, reduced hippocampal volume and corpus callosum length can be detected by MRM before Aβ deposition. We conclude that overexpression of APP and amyloid may initiate pathologic changes before the appearance of plaques, suggesting novel targets for the treatment of Alzheimer's disease and further reinforcing the need for early diagnosis and treatment. PMID:12552120

  20. Self-illuminating in vivo lymphatic imaging using a bioluminescence resonance energy transfer quantum dot nano-particle.

    PubMed

    Kosaka, Nobuyuki; Mitsunaga, Makoto; Bhattacharyya, Sukanta; Miller, Steven C; Choyke, Peter L; Kobayashi, Hisataka

    2011-01-01

    Autofluorescence arising from normal tissues can compromise the sensitivity and specificity of in vivo fluorescence imaging by lowering the target-to-background signal ratio. Since bioluminescence resonance energy transfer quantum dot (BRET-QDot) nano-particles can self-illuminate in near-infrared in the presence of the substrate, coelenterazine, without irradiating excitation lights, imaging using BRET-QDots does not produce any autofluorescence. In this study, we applied this BRET-QDot nano-particle to the in vivo lymphatic imaging in mice in order to compare with BRET, fluorescence or bioluminescence lymphatic imaging. BRET-QDot655, in which QDot655 is contained as a core, was injected at different sites (e.g. chin, ear, forepaws and hind paws) in mice followed by the intravenous coelenterazine injection, and then bioluminescence and fluorescence imaging were serially performed. In all mice, each lymphatic basin was clearly visualized in the BRET imaging with minimal background signals. The BRET signal in the lymph nodes lasted at least 30 min after coelenterazine injections. Furthermore, the BRET signal demonstrated better quantification than the fluorescence signal emitting from QDot655, the core of this BRET particle. These advantages of BRET-QDot allowed us to perform real-time, quantitative lymphatic imaging without image processing. BRET-Qdots have the potential to be a robust nano-material platform for developing optical molecular imaging probes. Copyright © 2010 John Wiley & Sons, Ltd.

  1. Self-illuminating in vivo lymphatic imaging using a bioluminescence resonance energy transfer quantum dot nano-particle

    PubMed Central

    Kosaka, Nobuyuki; Mitsunaga, Makoto; Bhattacharyya, Sukanta; Miller, Steven C.; Choyke, Peter L.; Kobayashi, Hisataka

    2012-01-01

    Autofluorescence arising from normal tissues can compromise the sensitivity and specificity of in vivo fluorescence imaging by lowering the target-to-background signal ratio. Since bioluminescence resonance energy transfer quantum dot (BRET-QDot) nano-particles can self-illuminate in near-infrared in the presence of the substrate, coelenterazine, without irradiating excitation lights, imaging using BRET-QDots does not produce any autofluorescence. In this study, we applied this BRET-QDot nano-particle to the in vivo lymphatic imaging in mice in order to compare with BRET, fluorescence or bioluminescence lymphatic imaging. BRET-QDot655, in which QDot655 is contained as a core, was injected at different sites (e.g. chin, ear, forepaws and hind paws) in mice followed by the intravenous coelenterazine injection, and then bioluminescence and fluorescence imaging were serially performed. In all mice, each lymphatic basin was clearly visualized in the BRET imaging with minimal background signals. The BRETsignal in the lymph nodes lasted at least 30 min after coelenterazine injections. Furthermore, the BRETsignal demonstrated better quantification than the fluorescence signal emitting from QDot655, the core of this BRET particle. These advantages of BRET-QDot allowed us to perform real-time, quantitative lymphatic imaging without image processing. BRET-Qdots have the potential to be a robust nano-material platform for developing optical molecular imaging probes. PMID:21351373

  2. Framework for 3D histologic reconstruction and fusion with in vivo MRI: Preliminary results of characterizing pulmonary inflammation in a mouse model.

    PubMed

    Rusu, Mirabela; Golden, Thea; Wang, Haibo; Gow, Andrew; Madabhushi, Anant

    2015-08-01

    Pulmonary inflammation is associated with a variety of diseases. Assessing pulmonary inflammation on in vivo imaging may facilitate the early detection and treatment of lung diseases. Although routinely used in thoracic imaging, computed tomography has thus far not been compellingly shown to characterize inflammation in vivo. Alternatively, magnetic resonance imaging (MRI) is a nonionizing radiation technique to better visualize and characterize pulmonary tissue. Prior to routine adoption of MRI for early characterization of inflammation in humans, a rigorous and quantitative characterization of the utility of MRI to identify inflammation is required. Such characterization may be achieved by considering ex vivo histology as the ground truth, since it enables the definitive spatial assessment of inflammation. In this study, the authors introduce a novel framework to integrate 2D histology, ex vivo and in vivo imaging to enable the mapping of the extent of disease from ex vivo histology onto in vivo imaging, with the goal of facilitating computerized feature analysis and interrogation of disease appearance on in vivo imaging. The authors' framework was evaluated in a preclinical preliminary study aimed to identify computer extracted features on in vivo MRI associated with chronic pulmonary inflammation. The authors' image analytics framework first involves reconstructing the histologic volume in 3D from individual histology slices. Second, the authors map the disease ground truth onto in vivo MRI via coregistration with 3D histology using the ex vivo lung MRI as a conduit. Finally, computerized feature analysis of the disease extent is performed to identify candidate in vivo imaging signatures of disease presence and extent. The authors evaluated the framework by assessing the quality of the 3D histology reconstruction and the histology-MRI fusion, in the context of an initial use case involving characterization of chronic inflammation in a mouse model. The authors' evaluation considered three mice, two with an inflammation phenotype and one control. The authors' iterative 3D histology reconstruction yielded a 70.1% ± 2.7% overlap with the ex vivo MRI volume. Across a total of 17 anatomic landmarks manually delineated at the division of airways, the target registration error between the ex vivo MRI and 3D histology reconstruction was 0.85 ± 0.44 mm, suggesting that a good alignment of the ex vivo 3D histology and ex vivo MRI had been achieved. The 3D histology-in vivo MRI coregistered volumes resulted in an overlap of 73.7% ± 0.9%. Preliminary computerized feature analysis was performed on an additional four control mice, for a total of seven mice considered in this study. Gabor texture filters appeared to best capture differences between the inflamed and noninflamed regions on MRI. The authors' 3D histology reconstruction and multimodal registration framework were successfully employed to reconstruct the histology volume of the lung and fuse it with in vivo MRI to create a ground truth map for inflammation on in vivo MRI. The analytic platform presented here lays the framework for a rigorous validation of the identified imaging features for chronic lung inflammation on MRI in a large prospective cohort.

  3. Monitoring Bacterial Burden, Inflammation and Bone Damage Longitudinally Using Optical and μCT Imaging in an Orthopaedic Implant Infection in Mice

    PubMed Central

    Niska, Jared A.; Meganck, Jeffrey A.; Pribaz, Jonathan R.; Shahbazian, Jonathan H.; Lim, Ed; Zhang, Ning; Rice, Brad W.; Akin, Ali; Ramos, Romela Irene; Bernthal, Nicholas M.; Francis, Kevin P.; Miller, Lloyd S.

    2012-01-01

    Background Recent advances in non-invasive optical, radiographic and μCT imaging provide an opportunity to monitor biological processes longitudinally in an anatomical context. One particularly relevant application for combining these modalities is to study orthopaedic implant infections. These infections are characterized by the formation of persistent bacterial biofilms on the implanted materials, causing inflammation, periprosthetic osteolysis, osteomyelitis, and bone damage, resulting in implant loosening and failure. Methodology/Principal Findings An orthopaedic implant infection model was used in which a titanium Kirshner-wire was surgically placed in femurs of LysEGFP mice, which possess EGFP-fluorescent neutrophils, and a bioluminescent S. aureus strain (Xen29; 1×103 CFUs) was inoculated in the knee joint before closure. In vivo bioluminescent, fluorescent, X-ray and μCT imaging were performed on various postoperative days. The bacterial bioluminescent signals of the S. aureus-infected mice peaked on day 19, before decreasing to a basal level of light, which remained measurable for the entire 48 day experiment. Neutrophil EGFP-fluorescent signals of the S. aureus-infected mice were statistically greater than uninfected mice on days 2 and 5, but afterwards the signals for both groups approached background levels of detection. To visualize the three-dimensional location of the bacterial infection and neutrophil infiltration, a diffuse optical tomography reconstruction algorithm was used to co-register the bioluminescent and fluorescent signals with μCT images. To quantify the anatomical bone changes on the μCT images, the outer bone volume of the distal femurs were measured using a semi-automated contour based segmentation process. The outer bone volume increased through day 48, indicating that bone damage continued during the implant infection. Conclusions/Significance Bioluminescent and fluorescent optical imaging was combined with X-ray and μCT imaging to provide noninvasive and longitudinal measurements of the dynamic changes in bacterial burden, neutrophil recruitment and bone damage in a mouse orthopaedic implant infection model. PMID:23082163

  4. Imaging the urinary pathways in mice by liposomal indocyanine green.

    PubMed

    Portnoy, Emma; Nizri, Eran; Golenser, Jacob; Shmuel, Miriam; Magdassi, Shlomo; Eyal, Sara

    2015-07-01

    Intraoperative ureter identification can assist in the prevention of ureteral injury and consequently improve surgery outcomes. Our aim was to take advantage of the altered pharmacokinetics of liposomal indocyanine green (ICG), the only FDA-approved near-infrared (NIR) dye, for imaging of ureters during surgeries. ICG was passively adsorbed to liposomes. NIR whole mice body and isolated tissue imaging were used to study liposomal ICG properties vs. free ICG. In vivo, the urinary bladder could be clearly observed in most of the liposome-treated mice. Liposomal encapsulation of ICG enhanced ureteral emission up to 1.9 fold compared to free ICG (P<0.01). Increase in liposomal micropolarity and microviscosity and differential scanning calorimetry supported ICG localization within the liposomal bilayer. Our findings suggest that liposomal ICG could be utilized for ureteral imaging intra-operatively, thus potentially improving surgical outcomes. Iatrogenic ureteral injury is a serious complication of abdominal surgery and intra-operative recognition of the ureters is usually the best method of injury prevention. In this article, the authors developed liposomal indocyanine green, which could be excreted via the urinary system and investigated its in-vivo use in mice. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. A Fluorescence-Guided Laser Ablation System for Removal of Residual Cancer in a Mouse Model of Soft Tissue Sarcoma.

    PubMed

    Lazarides, Alexander L; Whitley, Melodi J; Strasfeld, David B; Cardona, Diana M; Ferrer, Jorge M; Mueller, Jenna L; Fu, Henry L; Bartholf DeWitt, Suzanne; Brigman, Brian E; Ramanujam, Nimmi; Kirsch, David G; Eward, William C

    2016-01-01

    The treatment of soft tissue sarcoma (STS) generally involves tumor excision with a wide margin. Although advances in fluorescence imaging make real-time detection of cancer possible, removal is limited by the precision of the human eye and hand. Here, we describe a novel pulsed Nd:YAG laser ablation system that, when used in conjunction with a previously described molecular imaging system, can identify and ablate cancer in vivo. Mice with primary STS were injected with the protease-activatable probe LUM015 to label tumors. Resected tissues from the mice were then imaged and treated with the laser using the paired fluorescence-imaging/ laser ablation device, generating ablation clefts with sub-millimeter precision and minimal underlying tissue damage. Laser ablation was guided by fluorescence to target tumor tissues, avoiding normal structures. The selective ablation of tumor implants in vivo improved recurrence-free survival after tumor resection in a cohort of 14 mice compared to 12 mice that received no ablative therapy. This prototype system has the potential to be modified so that it can be used during surgery to improve recurrence-free survival in patients with cancer.

  6. Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.

    PubMed Central

    Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P

    1986-01-01

    Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations. Images PMID:3003377

  7. Detection of early primary colorectal cancer with upconversion luminescent NP-based molecular probes

    NASA Astrophysics Data System (ADS)

    Liu, Chunyan; Qi, Yifei; Qiao, Ruirui; Hou, Yi; Chan, Kaying; Li, Ziqian; Huang, Jiayi; Jing, Lihong; Du, Jun; Gao, Mingyuan

    2016-06-01

    Early detection and diagnosis of cancers is extremely beneficial for improving the survival rate of cancer patients and molecular imaging techniques are believed to be relevant for offering clinical solutions. Towards early cancer detection, we developed a primary animal colorectal cancer model and constructed a tumor-specific imaging probe by using biocompatible NaGdF4:Yb,Er@NaGdF4 upconversion luminescent NPs for establishing a sensitive early tumor imaging method. The primary animal tumor model, which can better mimic the human colorectal cancer, was built upon continual administration of 1,2-dimethylhydrazine in Kunming mice and the tumor development was carefully monitored through histopathological and immunohistochemical analyses to reveal the pathophysiological processes and molecular features of the cancer microenvironment. The upconversion imaging probe was constructed through covalent coupling of PEGylated core-shell NPs with folic acid whose receptor is highly expressed in the primary tumors. Upon 980 nm laser excitation, the primary colorectal tumors in the complex abdominal environment were sensitively imaged owing to the ultralow background of the upconversion luminescence and the high tumor-targeting specificity of the nanoprobe. We believe that the current studies provide a highly effective and potential approach for early colorectal cancer diagnosis and tumor surgical navigation.Early detection and diagnosis of cancers is extremely beneficial for improving the survival rate of cancer patients and molecular imaging techniques are believed to be relevant for offering clinical solutions. Towards early cancer detection, we developed a primary animal colorectal cancer model and constructed a tumor-specific imaging probe by using biocompatible NaGdF4:Yb,Er@NaGdF4 upconversion luminescent NPs for establishing a sensitive early tumor imaging method. The primary animal tumor model, which can better mimic the human colorectal cancer, was built upon continual administration of 1,2-dimethylhydrazine in Kunming mice and the tumor development was carefully monitored through histopathological and immunohistochemical analyses to reveal the pathophysiological processes and molecular features of the cancer microenvironment. The upconversion imaging probe was constructed through covalent coupling of PEGylated core-shell NPs with folic acid whose receptor is highly expressed in the primary tumors. Upon 980 nm laser excitation, the primary colorectal tumors in the complex abdominal environment were sensitively imaged owing to the ultralow background of the upconversion luminescence and the high tumor-targeting specificity of the nanoprobe. We believe that the current studies provide a highly effective and potential approach for early colorectal cancer diagnosis and tumor surgical navigation. Electronic supplementary information (ESI) available: (1) Molecular structure of Jeffamine-modified FA; (2) immunohistochemical analysis of FR expression in the colorectal tissue derived from mice treated with NaCl at different weeks; (3) biodistributions of probes of NP-FA and NP-IgG in the main organs of mice. See DOI: 10.1039/c5nr07858j

  8. In- and ex-vivo molecular imaging of apoptosis to assess sensitivity of non-small cell lung cancer to EGFR inhibitors using probe-based confocal laser endomicroscopy.

    PubMed

    Guisier, Florian; Bohn, Pierre; Patout, Maxime; Piton, Nicolas; Farah, Insaf; Vera, Pierre; Thiberville, Luc; Salaün, Mathieu

    2017-01-01

    Prediction of treatment outcome of non-small cell lung cancer (NSCLC) with EGFR inhibitors on the basis of the genetic analysis of the tumor can be incorrect in case of rare or complex mutations, bypass molecular activation pathways, or pharmacodynamic variations. The aim of this study was to develop an ex vivo and in vivo real-time quantitative imaging test for EGFR inhibitors sensitivity assessment. Erlotinib resistant (A549, H460, H1975), insensitive (H1650) and hypersensitive (HCC827) cell lines were injected subcutaneously in Nude mice. Tumor xenografts from mice treated with Erlotinib were imaged ex vivo and in vivo using probe-based confocal laser endomicroscopy (pCLE) and NucView 488 Caspase 3 substrate, a fluorescent probe specific for the activated caspase 3. Assessment of apoptosis at 24h post treatment, both ex vivo in explanted tumor xenografts and in vivo, showed a significant difference between resistant cell lines (A549, H460 and H1975) and insensitive (H1650) or hypersensitive (HCC827) ones (p<0.05 for ex vivo imaging, p≤0.02 for in vivo imaging). There was also a significant difference between insensitive and hypersensitive cell lines, both ex vivo (p<0.05) and in vivo (p = 0.01). Real-time in vivo and ex vivo assessment of apoptosis using pCLE differentiates resistant from sensitive NSCLC xenografts to Erlotinib.

  9. FIB-SEM imaging of carbon nanotubes in mouse lung tissue.

    PubMed

    Købler, Carsten; Saber, Anne Thoustrup; Jacobsen, Nicklas Raun; Wallin, Håkan; Vogel, Ulla; Qvortrup, Klaus; Mølhave, Kristian

    2014-06-01

    Ultrastructural characterisation is important for understanding carbon nanotube (CNT) toxicity and how the CNTs interact with cells and tissues. The standard method for this involves using transmission electron microscopy (TEM). However, in particular, the sample preparation, using a microtome to cut thin sample sections for TEM, can be challenging for investigation of regions with agglomerations of large and stiff CNTs because the CNTs cut with difficulty. As a consequence, the sectioning diamond knife may be damaged and the uncut CNTs are left protruding from the embedded block surface excluding them from TEM analysis. To provide an alternative to ultramicrotomy and subsequent TEM imaging, we studied focused ion beam scanning electron microscopy (FIB-SEM) of CNTs in the lungs of mice, and we evaluated the applicability of the method compared to TEM. FIB-SEM can provide serial section volume imaging not easily obtained with TEM, but it is time-consuming to locate CNTs in the tissue. We demonstrate that protruding CNTs after ultramicrotomy can be used to locate the region of interest, and we present FIB-SEM images of CNTs in lung tissue. FIB-SEM imaging was applied to lung tissue from mice which had been intratracheally instilled with two different multiwalled CNTs; one being short and thin, and the other longer and thicker. FIB-SEM was found to be most suitable for detection of the large CNTs (Ø ca. 70 nm), and to be well suited for studying CNT agglomerates in biological samples which is challenging using standard TEM techniques.

  10. Attenuating trabecular morphology associated with low magnesium diet evaluated using micro computed tomography.

    PubMed

    Tu, Shu-Ju; Wang, Shun-Ping; Cheng, Fu-Chou; Weng, Chia-En; Huang, Wei-Tzu; Chang, Wei-Jeng; Chen, Ying-Ju

    2017-01-01

    The literature shows that bone mineral density (BMD) and the geometric architecture of trabecular bone in the femur may be affected by inadequate dietary intake of Mg. In this study, we used microcomputed tomography (micro-CT) to characterize and quantify the impact of a low-Mg diet on femoral trabecular bones in mice. Four-week-old C57BL/6J male mice were randomly assigned to 2 groups and supplied either a normal or low-Mg diet for 8weeks. Samples of plasma and urine were collected for biochemical analysis, and femur tissues were removed for micro-CT imaging. In addition to considering standard parameters, we regarded trabecular bone as a cylindrical rod and used computational algorithms for a technical assessment of the morphological characteristics of the bones. BMD (mg-HA/cm3) was obtained using a standard phantom. We observed a decline in the total tissue volume, bone volume, percent bone volume, fractal dimension, number of trabecular segments, number of connecting nodes, bone mineral content (mg-HA), and BMD, as well as an increase in the structural model index and surface-area-to-volume ratio in low-Mg mice. Subsequently, we examined the distributions of the trabecular segment length and radius, and a series of specific local maximums were identified. The biochemical analysis revealed a 43% (96%) decrease in Mg and a 40% (71%) decrease in Ca in plasma (urine excretion). This technical assessment performed using micro-CT revealed a lower population of femoral trabecular bones and a decrease in BMD at the distal metaphysis in the low-Mg mice. Examining the distributions of the length and radius of trabecular segments showed that the average length and radius of the trabecular segments in low-Mg mice are similar to those in normal mice.

  11. Hyaluronan Deficiency Due to Has3 Knock-Out Causes Altered Neuronal Activity and Seizures via Reduction in Brain Extracellular Space

    PubMed Central

    Arranz, Amaia M.; Perkins, Katherine L.; Irie, Fumitoshi; Lewis, David P.; Hrabe, Jan; Xiao, Fanrong; Itano, Naoki; Kimata, Koji

    2014-01-01

    Hyaluronan (HA), a large anionic polysaccharide (glycosaminoglycan), is a major constituent of the extracellular matrix of the adult brain. To address its function, we examined the neurophysiology of knock-out mice deficient in hyaluronan synthase (Has) genes. Here we report that these Has mutant mice are prone to epileptic seizures, and that in Has3−/− mice, this phenotype is likely derived from a reduction in the size of the brain extracellular space (ECS). Among the three Has knock-out models, namely Has3−/−, Has1−/−, and Has2CKO, the seizures were most prevalent in Has3−/− mice, which also showed the greatest HA reduction in the hippocampus. Electrophysiology in Has3−/− brain slices demonstrated spontaneous epileptiform activity in CA1 pyramidal neurons, while histological analysis revealed an increase in cell packing in the CA1 stratum pyramidale. Imaging of the diffusion of a fluorescent marker revealed that the transit of molecules through the ECS of this layer was reduced. Quantitative analysis of ECS by the real-time iontophoretic method demonstrated that ECS volume was selectively reduced in the stratum pyramidale by ∼40% in Has3−/− mice. Finally, osmotic manipulation experiments in brain slices from Has3−/− and wild-type mice provided evidence for a causal link between ECS volume and epileptiform activity. Our results provide the first direct evidence for the physiological role of HA in the regulation of ECS volume, and suggest that HA-based preservation of ECS volume may offer a novel avenue for development of antiepileptogenic treatments. PMID:24790187

  12. Procedures for Behavioral Experiments in Head-Fixed Mice

    PubMed Central

    Guo, Zengcai V.; Hires, S. Andrew; Li, Nuo; O'Connor, Daniel H.; Komiyama, Takaki; Ophir, Eran; Huber, Daniel; Bonardi, Claudia; Morandell, Karin; Gutnisky, Diego; Peron, Simon; Xu, Ning-long; Cox, James; Svoboda, Karel

    2014-01-01

    The mouse is an increasingly prominent model for the analysis of mammalian neuronal circuits. Neural circuits ultimately have to be probed during behaviors that engage the circuits. Linking circuit dynamics to behavior requires precise control of sensory stimuli and measurement of body movements. Head-fixation has been used for behavioral research, particularly in non-human primates, to facilitate precise stimulus control, behavioral monitoring and neural recording. However, choice-based, perceptual decision tasks by head-fixed mice have only recently been introduced. Training mice relies on motivating mice using water restriction. Here we describe procedures for head-fixation, water restriction and behavioral training for head-fixed mice, with a focus on active, whisker-based tactile behaviors. In these experiments mice had restricted access to water (typically 1 ml/day). After ten days of water restriction, body weight stabilized at approximately 80% of initial weight. At that point mice were trained to discriminate sensory stimuli using operant conditioning. Head-fixed mice reported stimuli by licking in go/no-go tasks and also using a forced choice paradigm using a dual lickport. In some cases mice learned to discriminate sensory stimuli in a few trials within the first behavioral session. Delay epochs lasting a second or more were used to separate sensation (e.g. tactile exploration) and action (i.e. licking). Mice performed a variety of perceptual decision tasks with high performance for hundreds of trials per behavioral session. Up to four months of continuous water restriction showed no adverse health effects. Behavioral performance correlated with the degree of water restriction, supporting the importance of controlling access to water. These behavioral paradigms can be combined with cellular resolution imaging, random access photostimulation, and whole cell recordings. PMID:24520413

  13. A step-wise approach for analysis of the mouse embryonic heart using 17.6 Tesla MRI

    PubMed Central

    Gabbay-Benziv, Rinat; Reece, E. Albert; Wang, Fang; Bar-Shir, Amnon; Harman, Chris; Turan, Ozhan M.; Yang, Peixin; Turan, Sifa

    2018-01-01

    Background The mouse embryo is ideal for studying human cardiac development. However, laboratory discoveries do not easily translate into clinical findings partially because of histological diagnostic techniques that induce artifacts and lack standardization. Aim To present a step-wise approach using 17.6 T MRI, for evaluation of mice embryonic heart and accurate identification of congenital heart defects. Subjects 17.5-embryonic days embryos from low-risk (non-diabetic) and high-risk (diabetic) model dams. Study design Embryos were imaged using 17.6 Tesla MRI. Three-dimensional volumes were analyzed using ImageJ software. Outcome measures Embryonic hearts were evaluated utilizing anatomic landmarks to locate the four-chamber view, the left- and right-outflow tracts, and the arrangement of the great arteries. Inter- and intra-observer agreement were calculated using kappa scores by comparing two researchers’ evaluations independently analyzing all hearts, blinded to the model, on three different, timed occasions. Each evaluated 16 imaging volumes of 16 embryos: 4 embryos from normal dams, and 12 embryos from diabetic dams. Results Inter-observer agreement and reproducibility were 0.779 (95% CI 0.653–0.905) and 0.763 (95% CI 0.605–0.921), respectively. Embryonic hearts were structurally normal in 4/4 and 7/12 embryos from normal and diabetic dams, respectively. Five embryos from diabetic dams had defects: ventricular septal defects (n = 2), transposition of great arteries (n = 2) and Tetralogy of Fallot (n = 1). Both researchers identified all cardiac lesions. Conclusion A step-wise approach for analysis of MRI-derived 3D imaging provides reproducible detailed cardiac evaluation of normal and abnormal mice embryonic hearts. This approach can accurately reveal cardiac structure and, thus, increases the yield of animal model in congenital heart defect research. PMID:27569369

  14. IV Administered Gadodiamide Enters the Lumen of the Prostatic Glands: X-Ray Fluorescence Microscopy Examination of a Mouse Model

    DOE PAGES

    Mustafi, Devkumar; Gleber, Sophie-Charlotte; Ward, Jesse; ...

    2015-09-01

    In our objective, we descibe how dynamic contrast-enhanced MRI (DCE-MRI) has become a standard component of multiparametric protocols for MRI examination of the prostate, and its use is incorporated into current guidelines for prostate MRI examination. Analysis of DCE-MRI data for the prostate is usually based on the distribution of gadolinium-based agents, such as gadodiamide, into two well-mixed compartments, and it assumes that gadodiamide does not enter into the glandular lumen. However, this assumption has not been directly tested. The purpose of this study was to use x-ray fluorescence microscopy (XFM) imaging in situ to measure the concentration of gadodiamidemore » in the epithelia and lumens of the prostate of healthy mice after IV injection of the contrast agent. For our materials and methods, six C57Bl6 male mice (age, 28 weeks) were sacrificed 10 minutes after IV injection of gadodiamide (0.13 mmol/kg), and three mice were sacrificed after saline injection. Prostate tissue samples obtained from each mouse were harvested and frozen; 7-μm-thick slices were sectioned for XFM imaging, and adjacent 5-μm-thick slices were sectioned for H and E staining. Elemental concentrations were determined from XFM images. Our results show mean (± SD) baseline concentration of gadolinium of 0.01 ± 0.01 mM was determined from XFM measurements of prostatic tissue samples when no gadodiamide was administered, and it was used to determine the measurement error. When gadodiamide was added, the mean concentrations of gadolinium in the epithelia and lumens in 32 prostatic glands from six mice were 1.00 ± 0.13 and 0.36 ± 0.09 mM, respectively. In conclusion, our data suggest that IV administration of gadodiamide results in uptake of contrast agent by the glandular lumens of the mouse prostate. We were able to quantitatively determine gadodiamide distributions in mouse prostatic epithelia and lumens.« less

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mustafi, Devkumar; Gleber, Sophie-Charlotte; Ward, Jesse

    In our objective, we descibe how dynamic contrast-enhanced MRI (DCE-MRI) has become a standard component of multiparametric protocols for MRI examination of the prostate, and its use is incorporated into current guidelines for prostate MRI examination. Analysis of DCE-MRI data for the prostate is usually based on the distribution of gadolinium-based agents, such as gadodiamide, into two well-mixed compartments, and it assumes that gadodiamide does not enter into the glandular lumen. However, this assumption has not been directly tested. The purpose of this study was to use x-ray fluorescence microscopy (XFM) imaging in situ to measure the concentration of gadodiamidemore » in the epithelia and lumens of the prostate of healthy mice after IV injection of the contrast agent. For our materials and methods, six C57Bl6 male mice (age, 28 weeks) were sacrificed 10 minutes after IV injection of gadodiamide (0.13 mmol/kg), and three mice were sacrificed after saline injection. Prostate tissue samples obtained from each mouse were harvested and frozen; 7-μm-thick slices were sectioned for XFM imaging, and adjacent 5-μm-thick slices were sectioned for H and E staining. Elemental concentrations were determined from XFM images. Our results show mean (± SD) baseline concentration of gadolinium of 0.01 ± 0.01 mM was determined from XFM measurements of prostatic tissue samples when no gadodiamide was administered, and it was used to determine the measurement error. When gadodiamide was added, the mean concentrations of gadolinium in the epithelia and lumens in 32 prostatic glands from six mice were 1.00 ± 0.13 and 0.36 ± 0.09 mM, respectively. In conclusion, our data suggest that IV administration of gadodiamide results in uptake of contrast agent by the glandular lumens of the mouse prostate. We were able to quantitatively determine gadodiamide distributions in mouse prostatic epithelia and lumens.« less

  16. Neuronal Deletion of Caspase 8 Protects against Brain Injury in Mouse Models of Controlled Cortical Impact and Kainic Acid-Induced Excitotoxicity

    PubMed Central

    Krajewska, Maryla; You, Zerong; Rong, Juan; Kress, Christina; Huang, Xianshu; Yang, Jinsheng; Kyoda, Tiffany; Leyva, Ricardo; Banares, Steven; Hu, Yue; Sze, Chia-Hung; Whalen, Michael J.; Salmena, Leonardo; Hakem, Razqallah; Head, Brian P.; Reed, John C.; Krajewski, Stan

    2011-01-01

    Background Acute brain injury is an important health problem. Given the critical position of caspase 8 at the crossroads of cell death pathways, we generated a new viable mouse line (Ncasp8 −/−), in which the gene encoding caspase 8 was selectively deleted in neurons by cre-lox system. Methodology/Principal Findings Caspase 8 deletion reduced rates of neuronal cell death in primary neuronal cultures and in whole brain organotypic coronal slice cultures prepared from 4 and 8 month old mice and cultivated up to 14 days in vitro. Treatments of cultures with recombinant murine TNFα (100 ng/ml) or TRAIL (250 ng/mL) plus cyclohexamide significantly protected neurons against cell death induced by these apoptosis-inducing ligands. A protective role of caspase 8 deletion in vivo was also demonstrated using a controlled cortical impact (CCI) model of traumatic brain injury (TBI) and seizure-induced brain injury caused by kainic acid (KA). Morphometric analyses were performed using digital imaging in conjunction with image analysis algorithms. By employing virtual images of hundreds of brain sections, we were able to perform quantitative morphometry of histological and immunohistochemical staining data in an unbiased manner. In the TBI model, homozygous deletion of caspase 8 resulted in reduced lesion volumes, improved post-injury motor performance, superior learning and memory retention, decreased apoptosis, diminished proteolytic processing of caspases and caspase substrates, and less neuronal degeneration, compared to wild type, homozygous cre, and caspase 8-floxed control mice. In the KA model, Ncasp8 −/− mice demonstrated superior survival, reduced seizure severity, less apoptosis, and reduced caspase 3 processing. Uninjured aged knockout mice showed improved learning and memory, implicating a possible role for caspase 8 in cognitive decline with aging. Conclusions Neuron-specific deletion of caspase 8 reduces brain damage and improves post-traumatic functional outcomes, suggesting an important role for this caspase in pathophysiology of acute brain trauma. PMID:21957448

  17. Comparative therapeutic efficacy of rhenium-188 radiolabeled-liposome and 5-fluorouracil in LS-174T human colon carcinoma solid tumor xenografts.

    PubMed

    Hsu, Chin-Wei; Chang, Ya-Jen; Chang, Chih-Hsien; Chen, Liang-Cheng; Lan, Keng-Li; Ting, Gann; Lee, Te-Wei

    2012-10-01

    Nanoliposomes are important carriers capable of packaging drugs for various delivery applications. Rhenium-188-radiolabeled liposome ((188)Re-liposome) has potential for radiotherapy and diagnostic imaging. To evaluate the targeting of (188)Re-liposome, biodistribution, microSPECT/CT, whole-body autoradiography (WBAR), and pharmacokinetics were performed in LS-174T human tumor-bearing mice. The comparative therapeutic efficacy of (188)Re-liposome and 5-fluorouracil (5-FU) was assessed according to inhibition of tumor growth and the survival ratio. The highest uptake of (188)Re-liposome in LS-174T tumor was found at 24 hours by biodistribution and microSPECT/CT imaging, showing a positive correlation for tumor targeting of (188)Re-liposome using the Pearson's correlation analysis (r=0.997). Pharmacokinetics of (188)Re-liposome showed the properties of high circulation time and high bioavailability (mean residence time [MRT]=18.8 hours, area under the curve [AUC]=1371%ID/g·h). For therapeutic efficacy, the tumor-bearing mice treated with (188)Re-liposome (80% maximum tolerated dose [MTD], 23.7 MBq) showed better tumor growth inhibition and longer survival time than those treated with 5-FU (80% MTD, 144 mg/kg). The median survival time for mice treated with (188)Re-liposome (58.5 days; p<0.05) was significantly better than those of 5-FU (48.25 days; p>0.05) and normal saline-treated mice (43.63 days). Dosimetry study revealed that the (188)Re-liposome did not lead to high absorbed doses in normal tissue, but did in small tumors. These results of imaging and biodistribution indicated the highly specific accumulation of tumor after intravenous (i.v.) injection of (188)Re-liposome. The therapeutic efficacy of radiotherapeutics of (188)Re-liposome have been confirmed in a LS-174T solid tumor animal model, which points to the potential benefit and promise of passive nanoliposome delivered radiotherapeutics for cancer treatment.

  18. Rehabilitation-triggered cortical plasticity after stroke: in vivo imaging at multiple scales (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Allegra Mascaro, Anna Letizia; Conti, Emilia; Lai, Stefano; Spalletti, Cristina; Di Giovanna, Antonino Paolo; Alia, Claudia; Panarese, Alessandro; Sacconi, Leonardo; Micera, Silvestro; Caleo, Matteo; Pavone, Francesco S.

    2017-02-01

    Neurorehabilitation protocols based on the use of robotic devices provide a highly repeatable therapy and have recently shown promising clinical results. Little is known about how rehabilitation molds the brain to promote motor recovery of the affected limb. We used a custom-made robotic platform that provides quantitative assessment of forelimb function in a retraction test. Complementary imaging techniques allowed us to access to the multiple facets of robotic rehabilitation-induced cortical plasticity after unilateral photothrombotic stroke in mice Primary Motor Cortex (Caudal Forelimb Area - CFA). First, we analyzed structural features of vasculature and dendritic reshaping in the peri-infarct area with two-photon fluorescence microscopy. Longitudinal analysis of dendritic branches and spines of pyramidal neurons suggests that robotic rehabilitation promotes the stabilization of peri-infarct cortical excitatory circuits, which is not accompanied by consistent vascular reorganization towards pre-stroke conditions. To investigate if this structural stabilization was linked to functional remapping, we performed mesoscale wide-field imaging on GCaMP6 mice while performing the motor task on the robotic platform. We revealed temporal and spatial features of the motor-triggered cortical activation, shining new light on rehabilitation-induced functional remapping of the ipsilesional cortex. Finally, by using an all-optical approach that combines optogenetic activation of the contralesional hemisphere and wide-field functional imaging of peri-infarct area, we dissected the effect of robotic rehabilitation on inter-hemispheric cortico-cortical connectivity.

  19. In vivo Proton Electron Double Resonance Imaging of Mice with Fast Spin Echo Pulse Sequence

    PubMed Central

    Sun, Ziqi; Li, Haihong; Petryakov, Sergey; Samouilov, Alex; Zweier, Jay L.

    2011-01-01

    Purpose To develop and evaluate a 2D fast spin echo (FSE) pulse sequence for enhancing temporal resolution and reducing tissue heating for in vivo proton electron double resonance imaging (PEDRI) of mice. Materials and Methods A four-compartment phantom containing 2 mM TEMPONE was imaged at 20.1 mT using 2D FSE-PEDRI and regular gradient echo (GRE)-PEDRI pulse sequences. Control mice were infused with TEMPONE over ∼1 min followed by time-course imaging using the 2D FSE-PEDRI sequence at intervals of 10 – 30 s between image acquisitions. The average signal intensity from the time-course images was analyzed using a first-order kinetics model. Results Phantom experiments demonstrated that EPR power deposition can be greatly reduced using the FSE-PEDRI pulse sequence compared to the conventional gradient echo pulse sequence. High temporal resolution was achieved at ∼4 s per image acquisition using the FSE-PEDRI sequence with a good image SNR in the range of 233-266 in the phantom study. The TEMPONE half-life measured in vivo was ∼72 s. Conclusion Thus, the FSE-PEDRI pulse sequence enables fast in vivo functional imaging of free radical probes in small animals greatly reducing EPR irradiation time with decreased power deposition and provides increased temporal resolution. PMID:22147559

  20. In vivo imaging of the mouse model of X-linked juvenile retinoschisis with fourier domain optical coherence tomography.

    PubMed

    Xu, Jing; Molday, Laurie L; Molday, Robert S; Sarunic, Marinko V

    2009-06-01

    The purpose of this study was to investigate Fourier domain optical coherence tomography (FD OCT) as a noninvasive tool for retinal imaging in the Rs1h-knockout mouse (model for X-linked juvenile retinoschisis). A prototype spectrometer-based FD OCT system was used in combination with a custom optical beam-scanning platform. Images of the retinas from wild-type and Rs1h-knockout mice were acquired noninvasively with FD OCT with the specimen anesthetized. At the completion of the noninvasive FD OCT imaging, invasive retinal cross-sectional images (histology) were acquired from a nearby region for comparison to the FD OCT images. The retinal layers were identifiable in the FD OCT images, permitting delineation and thickness measurement of the outer nuclear layer (ONL). During FD OCT in vivo imaging of the Rs1h-knockout mouse, holes were observed in the inner nuclear layer (INL), and retinal cell disorganization was observed as a change in the backscattering intensity profile. Comparison of the ONL measurements acquired noninvasively with FD OCT to measurements taken using histology at nearby locations showed a degeneration of roughly 30% of the ONL by the age of 2 months in Rs1h-knockout mice relative to wild-type. FD OCT was demonstrated to be effective for noninvasive imaging of retinal degeneration and observation of retinal holes in Rs1h-knockout mice.

  1. A novel nitroxide is an effective brain redox imaging contrast agent and in vivo radioprotector.

    PubMed

    Davis, Ryan M; Sowers, Anastasia L; DeGraff, William; Bernardo, Marcelino; Thetford, Angela; Krishna, Murali C; Mitchell, James B

    2011-08-01

    Individuals are exposed to ionizing radiation during medical procedures and nuclear disasters, and this exposure can be carcinogenic, toxic, and sometimes fatal. Drugs that protect individuals from the adverse effects of radiation may therefore be valuable countermeasures against the health risks of exposure. In the current study, the LD(50/30) (the dose resulting in 50% of exposed mice surviving 30 days after exposure) was determined in control C3H mice and mice treated with the nitroxide radioprotectors Tempol, 3-CP, 16c, 22c, and 23c. The pharmacokinetics of 22c and 23c were measured with magnetic resonance imaging (MRI) in the brain, blood, submandibular salivary gland, liver, muscle, tongue, and myocardium. It was found that 23c was the most effective radioprotector of the five studied: 23c increased the LD(50/30) in mice from 7.9±0.15Gy (treated with saline) to 11.47±0.13Gy (an increase of 45%). Additionally, MRI-based pharmacokinetic studies revealed that 23c is an effective redox imaging agent in the mouse brain, and that 23c may allow functional imaging of the myocardium. The data in this report suggest that 23c is currently the most potent known nitroxide radioprotector, and that it may also be useful as a contrast agent for functional imaging. Published by Elsevier Inc.

  2. Development of bioluminescence imaging of respiratory syncytial virus (RSV) in virus-infected live mice and its use for evaluation of therapeutics and vaccines.

    PubMed

    Fuentes, Sandra; Arenas, Diego; Moore, Martin M; Golding, Hana; Khurana, Surender

    2017-01-23

    Respiratory Syncytial virus (RSV) is one of the leading causes of pneumonia among infants with no human vaccine or efficient curative treatments. Efforts are underway to develop new RSV vaccines and therapeutics. There is a dire need for animal models for preclinical evaluation and selection of products against RSV. Herein, we developed a whole body bioluminescence imaging to follow replication of RSV A2 virus strain expressing firefly luciferase (RSVA2-line19-FFL) in live BALB/c mice that can be used as an extremely sensitive readout for studying effects of antiviral and vaccines in living mice. Strong bioluminescence signal was detected in the nasal cavity and in the lungs following intranasal infection of mice with RSVA2-line19-FFL. The kinetics of viral replication in lungs quantified by daily live imaging strongly correlated with viral titers measured by ex-vivo plaque assay and by assessing viral RNA by qRT-PCR. Vaccination of mice with a pre-fusion F protein elicited high neutralizing antibody titers conferring strong protective immunity against virus replication in the nasal cavity and lungs. In contrast, post-challenge treatment of mice with the monoclonal antibody Palivizumab two days after infection reduced viral replication in the nasal cavity at day 4, but only modestly reduced virus loads in the lungs by day 5. In contrast to RSV bioluminescence, plaque assay did not detect viral titers in lungs on day 5 in Palivizumab-treated animals. This difference between viral loads measured by the two assays was found to be due to coating of virions with the Palivizumab that blocked infection of target cells in vitro and shows importance of live imaging in evaluation of RSV therapeutics. This recombinant RSV based live imaging animal model is convenient and valuable tool that can be used to study host dissemination of RSV and evaluation of antiviral compounds and vaccines against RSV. Published by Elsevier Ltd.

  3. In vivo imaging of induction of heat-shock protein-70 gene expression with fluorescence reflectance imaging and intravital confocal microscopy following brain ischaemia in reporter mice.

    PubMed

    de la Rosa, Xavier; Santalucía, Tomàs; Fortin, Pierre-Yves; Purroy, Jesús; Calvo, Maria; Salas-Perdomo, Angélica; Justicia, Carles; Couillaud, Franck; Planas, Anna M

    2013-02-01

    Stroke induces strong expression of the 72-kDa heat-shock protein (HSP-70) in the ischaemic brain, and neuronal expression of HSP-70 is associated with the ischaemic penumbra. The aim of this study was to image induction of Hsp-70 gene expression in vivo after brain ischaemia using reporter mice. A genomic DNA sequence of the Hspa1b promoter was used to generate an Hsp70-mPlum far-red fluorescence reporter vector. The construct was tested in cellular systems (NIH3T3 mouse fibroblast cell line) by transient transfection and examining mPlum and Hsp-70 induction under a challenge. After construct validation, mPlum transgenic mice were generated. Focal brain ischaemia was induced by transient intraluminal occlusion of the middle cerebral artery and the mice were imaged in vivo with fluorescence reflectance imaging (FRI) with an intact skull, and with confocal microscopy after opening a cranial window. Cells transfected with the Hsp70-mPlum construct showed mPlum fluorescence after stimulation. One day after induction of ischaemia, reporter mice showed a FRI signal located in the HSP-70-positive zone within the ipsilateral hemisphere, as validated by immunohistochemistry. Live confocal microscopy allowed brain tissue to be visualized at the cellular level. mPlum fluorescence was observed in vivo in the ipsilateral cortex 1 day after induction of ischaemia in neurons, where it is compatible with penumbra and neuronal viability, and in blood vessels in the core of the infarction. This study showed in vivo induction of Hsp-70 gene expression in ischaemic brain using reporter mice. The fluorescence signal showed in vivo the induction of Hsp-70 in penumbra neurons and in the vasculature within the ischaemic core.

  4. A comparative uptake study of multiplexed PET tracers in mice with turpentine-induced inflammation.

    PubMed

    Huang, Tingting; Wang, Hongliang; Tang, Ganghua; Liang, Xiang; Nie, Dahong; Yi, Chang; Wu, Kening

    2012-11-26

    The potential value of multiplexed positron emission tomography (PET) tracers in mice with turpentine-induced inflammation was evaluated and compared with 2-[¹⁸F]fluoro-2-deoxy-D-glucose ([¹⁸F]FDG) for glucose metabolism imaging. These PET tracers included [¹⁸F]fluoromethylcholine ([¹⁸F]FCH) for choline metabolism imaging, (S-[¹¹C]methyl)-D-cysteine ([¹¹C]DMCYS) for amino acid metabolism imaging, [¹¹C]bis(zinc(II)-dipicolylamine) ([¹¹C]DPA-Zn²⁺) for apoptosis imaging, 2-(4-N-[¹¹C]-methylaminophenyl)-6-hydroxybenzothiazole ([¹¹C]PIB) for β amyloid binding imaging, and [¹⁸F]fluoride (¹⁸F⁻) for bone metabolism imaging. In mice with turpentine-induced inflammation mice, the biodistribution of all the tracers mentioned above at 5, 15, 30, 45, and 60 min postinjection was determined. Also, the time-course curves of the tracer uptake ratios for inflammatory thigh muscle (IM) to normal uninflammatory thigh muscle (NM), IM to blood (BL), IM to brain (BR), and IM to liver (LI) were acquired, respectively. Moreover, PET imaging with the tracers within 60 min postinjection on a clinical PET/CT scanner was also conducted. [¹⁸F]FDG and ¹⁸F⁻ showed relatively higher uptake ratios for IM to NM, IM to BL, IM to BR, and IM to LI than [¹⁸F]FCH, [¹¹C]DPA-Zn²⁺, [¹¹C]DMCYS and [¹¹C]PIB, which were highly consistent with the results delineated in PET images. The results demonstrate that ¹⁸F⁻ seems to be a potential PET tracer for inflammation imaging. [¹⁸F]FCH and [¹¹C]DMCYS, with lower accumulation in inflammatory tissue than [¹⁸F]FDG, are not good PET tracers for inflammation imaging. As a promising inflammatory tracer, the chemical structure of [¹¹C]DPA-Zn²⁺ needs to be further optimized.

  5. In vivo analysis of the time and spatial activation pattern of microglia in the retina following laser-induced choroidal neovascularization.

    PubMed

    Crespo-Garcia, Sergio; Reichhart, Nadine; Hernandez-Matas, Carlos; Zabulis, Xenophon; Kociok, Norbert; Brockmann, Claudia; Joussen, Antonia M; Strauss, Olaf

    2015-10-01

    Microglia play a major role in retinal neovascularization and degeneration and are thus potential targets for therapeutic intervention. In vivo assessment of microglia behavior in disease models can provide important information to understand patho-mechanisms and develop therapeutic strategies. Although scanning laser ophthalmoscope (SLO) permits the monitoring of microglia in transgenic mice with microglia-specific GFP expression, there are fundamental limitations in reliable identification and quantification of activated cells. Therefore, we aimed to improve the SLO-based analysis of microglia using enhanced image processing with subsequent testing in laser-induced neovascularization (CNV). CNV was induced by argon laser in MacGreen mice. Microglia was visualized in vivo by SLO in the fundus auto-fluorescence (FAF) mode and verified ex vivo using retinal preparations. Three image processing algorithms based on different analysis of sequences of images were tested. The amount of recorded frames was limiting the effectiveness of the different algorithms. Best results from short recordings were obtained with a pixel averaging algorithm, further used to quantify spatial and temporal distribution of activated microglia in CNV. Morphologically, different microglia populations were detected in the inner and outer retinal layers. In CNV, the peak of microglia activation occurred in the inner layer at day 4 after laser, lacking an acute reaction. Besides, the spatial distribution of the activation changed by the time over the inner retina. No significant time and spatial changes were observed in the outer layer. An increase in laser power did not increase number of activated microglia. The SLO, in conjunction with enhanced image processing, is suitable for in vivo quantification of microglia activation. This surprisingly revealed that laser damage at the outer retina led to more reactive microglia in the inner retina, shedding light upon a new perspective to approach the immune response in the retina in vivo. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Shedding Light on the Molecular Pathology of Amyloid Plaques in Transgenic Alzheimer's Disease Mice Using Multimodal MALDI Imaging Mass Spectrometry.

    PubMed

    Kaya, Ibrahim; Zetterberg, Henrik; Blennow, Kaj; Hanrieder, Jörg

    2018-05-04

    Senile plaques formed by aggregated amyloid β peptides are one of the major pathological hallmarks of Alzheimer's disease (AD) which have been suggested to be the primary influence triggering the AD pathogenesis and the rest of the disease process. However, neurotoxic Aβ aggregation and progression are associated with a wide range of enigmatic biochemical, biophysical and genetic processes. MALDI imaging mass spectrometry (IMS) is a label-free method to elucidate the spatial distribution patterns of intact molecules in biological tissue sections. In this communication, we utilized multimodal MALDI-IMS analysis on 18 month old transgenic AD mice (tgArcSwe) brain tissue sections to enhance molecular information correlated to individual amyloid aggregates on the very same tissue section. Dual polarity MALDI-IMS analysis of lipids on the same pixel points revealed high throughput lipid molecular information including sphingolipids, phospholipids, and lysophospholipids which can be correlated to the ion images of individual amyloid β peptide isoforms at high spatial resolutions (10 μm). Further, multivariate image analysis was applied in order to probe the multimodal MALDI-IMS data in an unbiased way which verified the correlative accumulations of lipid species with dual polarity and Aβ peptides. This was followed by the lipid fragmentation obtained directly on plaque aggregates at higher laser pulse energies which provided tandem MS information useful for structural elucidation of several lipid species. Majority of the amyloid plaque-associated alterations of lipid species are for the first time reported here. The significance of this technique is that it allows correlating the biological discussion of all detected plaque-associated molecules to the very same individual amyloid plaques which can give novel insights into the molecular pathology of even a single amyloid plaque microenvironment in a specific brain region. Therefore, this allowed us to interpret the possible roles of lipids and amyloid peptides in amyloid plaque-associated pathological events such as focal demyelination, autophagic/lysosomal dysfunction, astrogliosis, inflammation, oxidative stress, and cell death.

  7. Hand-gesture-based sterile interface for the operating room using contextual cues for the navigation of radiological images

    PubMed Central

    Jacob, Mithun George; Wachs, Juan Pablo; Packer, Rebecca A

    2013-01-01

    This paper presents a method to improve the navigation and manipulation of radiological images through a sterile hand gesture recognition interface based on attentional contextual cues. Computer vision algorithms were developed to extract intention and attention cues from the surgeon's behavior and combine them with sensory data from a commodity depth camera. The developed interface was tested in a usability experiment to assess the effectiveness of the new interface. An image navigation and manipulation task was performed, and the gesture recognition accuracy, false positives and task completion times were computed to evaluate system performance. Experimental results show that gesture interaction and surgeon behavior analysis can be used to accurately navigate, manipulate and access MRI images, and therefore this modality could replace the use of keyboard and mice-based interfaces. PMID:23250787

  8. Hand-gesture-based sterile interface for the operating room using contextual cues for the navigation of radiological images.

    PubMed

    Jacob, Mithun George; Wachs, Juan Pablo; Packer, Rebecca A

    2013-06-01

    This paper presents a method to improve the navigation and manipulation of radiological images through a sterile hand gesture recognition interface based on attentional contextual cues. Computer vision algorithms were developed to extract intention and attention cues from the surgeon's behavior and combine them with sensory data from a commodity depth camera. The developed interface was tested in a usability experiment to assess the effectiveness of the new interface. An image navigation and manipulation task was performed, and the gesture recognition accuracy, false positives and task completion times were computed to evaluate system performance. Experimental results show that gesture interaction and surgeon behavior analysis can be used to accurately navigate, manipulate and access MRI images, and therefore this modality could replace the use of keyboard and mice-based interfaces.

  9. Image-guided intraocular injection using multimodality optical coherence tomography and fluorescence confocal scanning laser ophthalmoscopy in rodent ophthalmological models

    NASA Astrophysics Data System (ADS)

    Terrones, Benjamin D.; Benavides, Oscar R.; Leeburg, Kelsey C.; Mehanathan, Sankarathi B.; Levine, Edward M.; Tao, Yuankai K.

    2018-02-01

    Intraocular injections are routinely performed for delivery of anti-VEGF and anti-inflammatory therapies in humans. While these injections are also performed in mice to develop novel models of ophthalmic diseases and screen novel therapeutics, the injection location and volume are not well-controlled and reproducible. We overcome limitations of conventional injections methods by developing a multimodality, long working distance, non-contact optical coherence tomography (OCT) and fluorescence confocal scanning laser ophthalmoscopy (cSLO) system for retinal imaging before and after injections. Our OCT+cSLO system combines a custom-built spectraldomain OCT engine (875+/-85 nm) with 125 kHz line-rate with a modified commercial cSLO with a maximum frame-rate of 30 fps (512 x 512 pix.). The system was designed for an overlapping OCT+cSLO field-of-view of 1.1 mm with a 7.76 mm working distance to the pupil. cSLO excitation light sources and filters were optimized for simultaneous GFP and tdTomato imaging. Lateral resolution was 3.02 µm for OCT and 2.74 μm for cSLO. Intravitreal injections of 5%, 10%, and 20% intralipid with Alex Fluor 488 were manually injected intraocularly in C57BL/6 mice. Post-injection imaging showed structural changes associated with retinal puncture, including the injection track, a retinal elevation, and detachment of the posterior hyaloid. OCT enables quantitative analysis of injection location and volumes whereas complementary cSLO improves specificity for identifying fluorescently labeled injected compounds and transgenic cells. The long working distance of our non-contact OCT+cSLO system is uniquely-suited for concurrent imaging with intraocular injections and may be applied for imaging of ophthalmic surgical dynamics and real-time image-guided injections.

  10. Imaging of experimental amyloidosis with /sup 131/I-labeled serum amyloid P component

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caspi, D.; Zalzman, S.; Baratz, M.

    1987-11-01

    /sup 131/I-labeled human serum amyloid P component, which was injected into mice with experimentally induced systemic AA amyloidosis and into controls, became specifically localized and was retained in amyloidotic organs. In comparison, it was rapidly and completely eliminated from unaffected tissues and from control animals. Distinctive images of this amyloid-specific deposition of labeled serum amyloid P component were derived from whole body scanning, in vivo, of amyloidotic mice. These findings suggest that such imaging may have applications for the diagnosis and quantitation of amyloid deposits in humans.

  11. In vivo multi-modality photoacoustic and pulse echo tracking of prostate tumor growth using a window chamber

    NASA Astrophysics Data System (ADS)

    Bauer, Daniel R.; Olafsson, Ragnar; Montilla, Leonardo G.; Witte, Russell S.

    2010-02-01

    Understanding the tumor microenvironment is critical to characterizing how cancers operate and predicting how they will eventually respond to treatment. The mouse window chamber model is an excellent tool for cancer research, because it enables high resolution tumor imaging and cross-validation using multiple modalities. We describe a novel multimodality imaging system that incorporates three dimensional (3D) photoacoustics with pulse echo ultrasound for imaging the tumor microenvironment and tracking tissue growth in mice. Three mice were implanted with a dorsal skin flap window chamber. PC-3 prostate tumor cells, expressing green fluorescent protein (GFP), were injected into the skin. The ensuing tumor invasion was mapped using photoacoustic and pulse echo imaging, as well as optical and fluorescent imaging for comparison and cross validation. The photoacoustic imaging and spectroscopy system, consisting of a tunable (680-1000nm) pulsed laser and 25 MHz ultrasound transducer, revealed near infrared absorbing regions, primarily blood vessels. Pulse echo images, obtained simultaneously, provided details of the tumor microstructure and growth with 100-μm3 resolution. The tumor size in all three mice increased between three and five fold during 3+ weeks of imaging. Results were consistent with the optical and fluorescent images. Photoacoustic imaging revealed detailed maps of the tumor vasculature, whereas photoacoustic spectroscopy identified regions of oxygenated and deoxygenated blood vessels. The 3D photoacoustic and pulse echo imaging system provided complementary information to track the tumor microenvironment, evaluate new cancer therapies, and develop molecular imaging agents in vivo. Finally, these safe and noninvasive techniques are potentially applicable for human cancer imaging.

  12. Impaired Clearance And Enhanced Pulmonary Inflammatory/Fibrotic Response To Carbon Nanotubes In Myeloperoxidase-Deficient Mice

    DTIC Science & Technology

    2012-03-30

    utilized SWCNT, it is highly likely that multi-walled carbon nanotubes, fullerenes , graphene and other carbonaceous particles may also undergo MPO...screening and analysis system to distinguish between the organic tissue and the inorganic SWCNT (under bright field imaging settings). Optically...Cytotoxicity of carbon nanomaterials: single-wall nanotube, multi-wall nanotube, and fullerene . Environ Sci Technol 39: 1378–1383. 7. Kisin ER, Murray

  13. Comparison of monkeypox viruses pathogenesis in mice by in vivo imaging

    USGS Publications Warehouse

    Osorio, Jorge E.; Iams, Keith P.; Meteyer, Carol U.; Rocke, Tonie E.

    2009-01-01

    Monkeypox viruses (MPXV) cause human monkeypox, a zoonotic smallpox-like disease endemic to Africa, and are of worldwide public health and biodefense concern. Using viruses from the Congo (MPXV-2003-Congo-358) and West African (MPXV-2003-USA-044) clades, we constructed recombinant viruses that express the luciferase gene (MPXV-Congo/Luc+and MPXV-USA-Luc+) and compared their viral infection in mice by biophotonic imaging. BALB/c mice became infected by both MPXV clades, but they recovered and cleared the infection within 10 days post-infection (PI). However, infection in severe combined immune deficient (SCID) BALB/c mice resulted in 100% lethality. Intraperitoneal (IP) injection of both MPXV-Congo and MPXV-Congo/Luc+resulted in a systemic clinical disease and the same mean time-to-death at 9 (??0) days post-infection. Likewise, IP injection of SCID-BALB/c mice with MPXV-USA or the MPXV-USA-Luc+, resulted in similar disease but longer (P<0.05) mean time-to-death (11??0 days) for both viruses compared to the Congo strains. Imaging studies in SCID mice showed luminescence in the abdomen within 24 hours PI with subsequent spread elsewhere. Animals infected with the MPXV-USA/Luc+had less intense luminescence in tissues than those inoculated with MPXV-Congo/Luc+, and systemic spread of the MPXV-USA/Luc+virus occurred approximately two days later than the MPXV-Congo/Luc+. The ovary was an important target for viral replication as evidenced by the high viral titers and immunohistochemistry. These studies demonstrate the suitability of a mouse model and biophotonic imaging to compare the disease progression and tissue tropism of MPX viruses.

  14. Integrated sensor biopsy device for real time tissue metabolism analysis

    NASA Astrophysics Data System (ADS)

    Delgado Alonso, Jesus; Lieberman, Robert A.; DiCarmine, Paul M.; Berry, David; Guzman, Narciso; Marpu, Sreekar B.

    2018-02-01

    Current methods for guiding cancer biopsies rely almost exclusively on images derived from X-ray, ultrasound, or magnetic resonance, which essentially characterize suspected lesions based only on tissue density. This paper presents a sensor integrated biopsy device for in situ tissue analysis that will enable biopsy teams to measure local tissue chemistry in real time during biopsy procedures, adding a valuable new set of parameters to augment and extend conventional image guidance. A first demonstrator integrating three chemical and biochemical sensors was tested in a mice strain that is a spontaneous breast cancer model. In all cases, the multisensory probe was able to discriminate between healthy tissue, the edge of the tumor, and total insertion inside the cancer tissue, recording real-time information about tissue metabolism.

  15. Quantitative imaging of fibrotic and morphological changes in liver of non-alcoholic steatohepatitis (NASH) model mice by second harmonic generation (SHG) and auto-fluorescence (AF) imaging using two-photon excitation microscopy (TPEM).

    PubMed

    Yamamoto, Shin; Oshima, Yusuke; Saitou, Takashi; Watanabe, Takao; Miyake, Teruki; Yoshida, Osamu; Tokumoto, Yoshio; Abe, Masanori; Matsuura, Bunzo; Hiasa, Yoichi; Imamura, Takeshi

    2016-12-01

    Non-alcoholic steatohepatitis (NASH) is a common liver disorder caused by fatty liver. Because NASH is associated with fibrotic and morphological changes in liver tissue, a direct imaging technique is required for accurate staging of liver tissue. For this purpose, in this study we took advantage of two label-free optical imaging techniques, second harmonic generation (SHG) and auto-fluorescence (AF), using two-photon excitation microscopy (TPEM). Three-dimensional ex vivo imaging of tissues from NASH model mice, followed by image processing, revealed that SHG and AF are sufficient to quantitatively characterize the hepatic capsule at an early stage and parenchymal morphologies associated with liver disease progression, respectively.

  16. Acid Sphingomyelinase Gene Deficiency Ameliorates the Hyperhomocysteinemia-Induced Glomerular Injury in Mice

    PubMed Central

    Boini, Krishna M.; Xia, Min; Li, Caixia; Zhang, Chun; Payne, Lori P.; Abais, Justine M.; Poklis, Justin L.; Hylemon, Philip B.; Li, Pin-Lan

    2011-01-01

    Hyperhomocysteinemia (hHcys) enhances ceramide production, leading to the activation of NADPH oxidase and consequent glomerular oxidative stress and sclerosis. The present study was performed to determine whether acid sphingomyelinase (Asm), a ceramide-producing enzyme, is implicated in the development of hHcys-induced glomerular oxidative stress and injury. Uninephrectomized Asm-knockout (Asm−/−) and wild-type (Asm+/+) mice, with or without Asm short hairpin RNA (shRNA) transfection, were fed a folate-free (FF) diet for 8 weeks, which significantly elevated the plasma Hcys level compared with mice fed normal chow. By using in vivo molecular imaging, we found that transfected shRNAs were expressed in the renal cortex starting on day 3 and continued for 24 days. The FF diet significantly increased renal ceramide production, Asm mRNA and activity, urinary total protein and albumin excretion, glomerular damage index, and NADPH-dependent superoxide production in the renal cortex from Asm+/+ mice compared with that from Asm−/− or Asm shRNA-transfected wild-type mice. Immunofluorescence analysis showed that the FF diet decreased the expression of podocin but increased desmin and ceramide levels in glomeruli from Asm+/+ mice but not in those from Asm−/− and Asm shRNA-transfected wild-type mice. In conclusion, our observations reveal that Asm plays a pivotal role in mediating podocyte injury and glomerular sclerosis associated with NADPH oxidase–associated local oxidative stress during hHcys. PMID:21893018

  17. Combined optical tomographic and magnetic resonance imaging of tumor bearing mice

    NASA Astrophysics Data System (ADS)

    Masciotti, J.; Abdoulaev, G.; Hur, J.; Papa, J.; Bae, J.; Huang, J.; Yamashiro, D.; Kandel, J.; Hielscher, A. H.

    2005-04-01

    With the advent of small animal imaging systems, it has become possible to non-invasively monitor the progression of diseases in living small animals and study the efficacy of drugs and treatment protocols. Magnetic resonance imaging (MRI) is an established imaging modality capable of obtaining high resolution anatomical images as well as studying cerebral blood volume (CBV), cerebral blood flow (CBF), and cerebral metabolic rate of oxygen (CMRO2). Optical tomography, on the other hand, is an emerging imaging modality, which, while much lower in spatial resolution and insensitive to CBF, can separate the effects of oxyhemoglobin, deoxyhemoglobin, and CBV with high temporal resolution. In this study we present our first results concerning coregistration of MRI and optical data. By applying both modalities to imaging of kidney tumors in mice that undergo VEGF treatment, we illustrate how these imaging modalities can supplement each other and cross validation can be performed.

  18. Time Courses of Cortical Glucose Metabolism and Microglial Activity Across the Life Span of Wild-Type Mice: A PET Study.

    PubMed

    Brendel, Matthias; Focke, Carola; Blume, Tanja; Peters, Finn; Deussing, Maximilian; Probst, Federico; Jaworska, Anna; Overhoff, Felix; Albert, Nathalie; Lindner, Simon; von Ungern-Sternberg, Barbara; Bartenstein, Peter; Haass, Christian; Kleinberger, Gernot; Herms, Jochen; Rominger, Axel

    2017-12-01

    Contrary to findings in the human brain, 18 F-FDG PET shows cerebral hypermetabolism of aged wild-type (WT) mice relative to younger animals, supposedly due to microglial activation. Therefore, we used dual-tracer small-animal PET to examine directly the link between neuroinflammation and hypermetabolism in aged mice. Methods: WT mice (5-20 mo) were investigated in a cross-sectional design using 18 F-FDG ( n = 43) and translocator protein (TSPO) ( 18 F-GE180; n = 58) small-animal PET, with volume-of-interest and voxelwise analyses. Biochemical analysis of plasma cytokine levels and immunohistochemical confirmation of microglial activity were also performed. Results: Age-dependent cortical hypermetabolism in WT mice relative to young animals aged 5 mo peaked at 14.5 mo (+16%, P < 0.001) and declined to baseline at 20 mo. Similarly, cortical TSPO binding increased to a maximum at 14.5 mo (+15%, P < 0.001) and remained high to 20 mo, resulting in an overall correlation between 18 F-FDG uptake and TSPO binding (R = 0.69, P < 0.005). Biochemical and immunohistochemical analyses confirmed the TSPO small-animal PET findings. Conclusion: Age-dependent neuroinflammation is associated with the controversial observation of cerebral hypermetabolism in aging WT mice. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  19. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    PubMed Central

    Cohen, Gadi; Lecht, Shimon; Oron-Herman, Mor; Momic, Tatjana; Nissan, Aviram; Lazarovici, Philip

    2013-01-01

    In this study, we present the applicability of imaging epidermal growth factor (EGF) receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR). The near infrared (NIR) bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner. PMID:23857061

  20. Near infrared optical visualization of epidermal growth factor receptors levels in COLO205 colorectal cell line, orthotopic tumor in mice and human biopsies.

    PubMed

    Cohen, Gadi; Lecht, Shimon; Oron-Herman, Mor; Momic, Tatjana; Nissan, Aviram; Lazarovici, Philip

    2013-07-12

    In this study, we present the applicability of imaging epidermal growth factor (EGF) receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR). The near infrared (NIR) bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6-9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  1. Effects of a Sativex-Like Combination of Phytocannabinoids on Disease Progression in R6/2 Mice, an Experimental Model of Huntington’s Disease

    PubMed Central

    Valdeolivas, Sara; Sagredo, Onintza; Delgado, Mercedes; Pozo, Miguel A.; Fernández-Ruiz, Javier

    2017-01-01

    Several cannabinoids afforded neuroprotection in experimental models of Huntington’s disease (HD). We investigated whether a 1:1 combination of botanical extracts enriched in either ∆9-tetrahydrocannabinol (∆9-THC) or cannabidiol (CBD), which are the main constituents of the cannabis-based medicine Sativex®, is beneficial in R6/2 mice (a transgenic model of HD), as it was previously shown to have positive effects in neurotoxin-based models of HD. We recorded the progression of neurological deficits and the extent of striatal deterioration, using behavioral, in vivo imaging, and biochemical methods in R6/2 mice and their corresponding wild-type mice. The mice were daily treated, starting at 4 weeks after birth, with a Sativex-like combination of phytocannabinoids (equivalent to 3 mg/kg weight of pure CBD + ∆9-THC) or vehicle. R6/2 mice exhibited the characteristic deterioration in rotarod performance that initiated at 6 weeks and progressed up to 10 weeks, and elevated clasping behavior reflecting dystonia. Treatment with the Sativex-like combination of phytocannabinoids did not recover rotarod performance, but markedly attenuated clasping behavior. The in vivo positron emission tomography (PET) analysis of R6/2 animals at 10 weeks revealed a reduced metabolic activity in the basal ganglia, which was partially attenuated by treatment with the Sativex-like combination of phytocannabinoids. Proton nuclear magnetic resonance spectroscopy (H+-MRS) analysis of the ex vivo striatum of R6/2 mice at 12 weeks revealed changes in various prognostic markers reflecting events typically found in HD patients and animal models, such as energy failure, mitochondrial dysfunction, and excitotoxicity. Some of these changes (taurine/creatine, taurine/N-acetylaspartate, and N-acetylaspartate/choline ratios) were completely reversed by treatment with the Sativex-like combination of phytocannabinoids. A Sativex-like combination of phytocannabinoids administered to R6/2 mice at the onset of motor symptoms produced certain benefits on the progression of striatal deterioration in these mice, which supports the interest of this cannabinoid-based medicine for the treatment of disease progression in HD patients. PMID:28333097

  2. Effects of a Sativex-Like Combination of Phytocannabinoids on Disease Progression in R6/2 Mice, an Experimental Model of Huntington's Disease.

    PubMed

    Valdeolivas, Sara; Sagredo, Onintza; Delgado, Mercedes; Pozo, Miguel A; Fernández-Ruiz, Javier

    2017-03-23

    Several cannabinoids afforded neuroprotection in experimental models of Huntington's disease (HD). We investigated whether a 1:1 combination of botanical extracts enriched in either ∆⁸-tetrahydrocannabinol (∆⁸-THC) or cannabidiol (CBD), which are the main constituents of the cannabis-based medicine Sativex ® , is beneficial in R6/2 mice (a transgenic model of HD), as it was previously shown to have positive effects in neurotoxin-based models of HD. We recorded the progression of neurological deficits and the extent of striatal deterioration, using behavioral, in vivo imaging, and biochemical methods in R6/2 mice and their corresponding wild-type mice. The mice were daily treated, starting at 4 weeks after birth, with a Sativex-like combination of phytocannabinoids (equivalent to 3 mg/kg weight of pure CBD + ∆⁸-THC) or vehicle. R6/2 mice exhibited the characteristic deterioration in rotarod performance that initiated at 6 weeks and progressed up to 10 weeks, and elevated clasping behavior reflecting dystonia. Treatment with the Sativex-like combination of phytocannabinoids did not recover rotarod performance, but markedly attenuated clasping behavior. The in vivo positron emission tomography (PET) analysis of R6/2 animals at 10 weeks revealed a reduced metabolic activity in the basal ganglia, which was partially attenuated by treatment with the Sativex-like combination of phytocannabinoids. Proton nuclear magnetic resonance spectroscopy (H⁺-MRS) analysis of the ex vivo striatum of R6/2 mice at 12 weeks revealed changes in various prognostic markers reflecting events typically found in HD patients and animal models, such as energy failure, mitochondrial dysfunction, and excitotoxicity. Some of these changes (taurine/creatine, taurine/ N -acetylaspartate, and N -acetylaspartate/choline ratios) were completely reversed by treatment with the Sativex-like combination of phytocannabinoids. A Sativex-like combination of phytocannabinoids administered to R6/2 mice at the onset of motor symptoms produced certain benefits on the progression of striatal deterioration in these mice, which supports the interest of this cannabinoid-based medicine for the treatment of disease progression in HD patients.

  3. Novel molecular imaging ligands targeting matrix metalloproteinases 2 and 9 for imaging of unstable atherosclerotic plaques

    PubMed Central

    Molenaar, Ger; de Waard, Vivian; Lutgens, Esther; van Eck-Smit, Berthe L. F.; de Bruin, Kora; Piek, Jan J.; Eersels, Jos L. H.; Booij, Jan; Verberne, Hein J.; Windhorst, Albert D.

    2017-01-01

    Molecular imaging of matrix metalloproteinases (MMPs) may allow detection of atherosclerotic lesions vulnerable to rupture. In this study, we develop a novel radiolabelled compound that can target gelatinase MMP subtypes (MMP2/9) with high selectivity and inhibitory potency. Inhibitory potencies of several halogenated analogues of MMP subtype-selective inhibitors (N-benzenesulfonyliminodiacetyl monohydroxamates and N-halophenoxy-benzenesulfonyl iminodiacetyl monohydroxamates) were in the nanomolar range for MMP2/9. The analogue with highest inhibitory potency and selectivity was radiolabelled with [123I], resulting in moderate radiochemical yield, and high radiochemical purity. Biodistribution studies in mice, revealed stabilization in blood 1 hour after intravenous bolus injection. Intravenous infusion of the radioligand and subsequent autoradiography of excised aortas showed tracer uptake in atheroprone mice. Distribution of the radioligand showed co-localization with MMP2/9 immunohistochemical staining. In conclusion, we have developed a novel selective radiolabeled MMP2/9 inhibitor, suitable for single photon emission computed tomography (SPECT) imaging that effectively targets atherosclerotic lesions in mice. PMID:29190653

  4. Dedicated low-field MRI in mice

    NASA Astrophysics Data System (ADS)

    Choquet, P.; Breton, E.; Goetz, C.; Marin, C.; Constantinesco, A.

    2009-09-01

    The rationale of this work is to point out the relevance of in vivo MR images of mice obtained using a dedicated low-field system. For this purpose a small 0.1 T water-cooled electro-magnet and solenoidal radio frequency (RF) transmit-receive coils were used. All MR images were acquired in three-dimensional (3D) mode. An isolation cell was designed allowing easy placement of the RF coils and simple delivery of gaseous anesthesia as well as warming of the animal. Images with and without contrast agent were obtained in total acquisition times on the order of half an hour to four hours on normal mice as well as on animals bearing tumors. Typical in plane pixel dimensions range from 200 × 200 to 500 × 500 µm2 with slice thicknesses ranging between 0.65 and 1.50 mm. This work shows that, besides light installation and low cost, dedicated low-field MR systems are suitable for small rodents imaging, opening this technique even to small research units.

  5. Gold nanoparticle imaging and radiotherapy of brain tumors in mice

    PubMed Central

    Hainfeld, James F; Smilowitz, Henry M; O'Connor, Michael J; Dilmanian, Farrokh Avraham; Slatkin, Daniel N

    2013-01-01

    Aim To test intravenously injected gold nanoparticles for x-ray imaging and radiotherapy enhancement of large, imminently lethal, intracerebral malignant gliomas. Materials & methods Gold nanoparticles approximately 11 nm in size were injected intravenously and brains imaged using microcomputed tomography. A total of 15 h after an intravenous dose of 4 g Au/kg was administered, brains were irradiated with 30 Gy 100 kVp x-rays. Results Gold uptake gave a 19:1 tumor-to-normal brain ratio with 1.5% w/w gold in tumor, calculated to increase local radiation dose by approximately 300%. Mice receiving gold and radiation (30 Gy) demonstrated 50% long term (>1 year) tumor-free survival, whereas all mice receiving radiation only died. Conclusion Intravenously injected gold nanoparticles cross the blood–tumor barrier, but are largely blocked by the normal blood–brain barrier, enabling high-resolution computed tomography tumor imaging. Gold radiation enhancement significantly improved long-term survival compared with radiotherapy alone. This approach holds promise to improve therapy of human brain tumors and other cancers. PMID:23265347

  6. Additive effects of nicotine and high-fat diet on hepatic steatosis in male mice.

    PubMed

    Friedman, Theodore C; Sinha-Hikim, Indrani; Parveen, Meher; Najjar, Sonia M; Liu, Yanjun; Mangubat, Michael; Shin, Chang-Sung; Lyzlov, Alexei; Ivey, Rasheed; Shaheen, Magda; French, Samuel W; Sinha-Hikim, Amiya P

    2012-12-01

    Smoking is a major risk factor for diabetes and cardiovascular disease and may contribute to nonalcoholic fatty liver disease. We hypothesize that in the presence of nicotine, high-fat diet (HFD) causes more severe hepatic steatosis in obese mice. Adult C57BL6 male mice were fed a normal chow diet or HFD and received twice daily injections of nicotine (0.75 mg/kg body weight, ip) or saline for 10 wk. Light microscopic image analysis revealed significantly higher lipid accumulation in livers from mice on HFD plus nicotine (190 ± 19 μm(2)), compared with mice on HFD alone (28 ± 1.2 μm(2)). A significant reduction in the percent volume of endoplasmic reticulum (67.8%) and glycogen (49.2%) was also noted in hepatocytes from mice on HFD plus nicotine, compared with mice on HFD alone. The additive effects of nicotine on the severity of HFD-induced hepatic steatosis was associated with significantly greater oxidative stress, increased hepatic triglyceride levels, higher incidence of hepatocellular apoptosis, inactivation (dephosphorylation) of AMP-activated protein kinase, and activation of its downstream target acetyl-coenzyme A-carboxylase. Treatment with acipimox, an inhibitor of lipolysis, significantly reduced nicotine plus HFD-induced hepatic lipid accumulation. We conclude that: 1) greater oxidative stress coupled with inactivation of AMP-activated protein kinase mediate the additive effects of nicotine and HFD on hepatic steatosis in obese mice and 2) increased lipolysis is an important contributor to hepatic steatosis. We surmise that nicotine exposure is likely to exacerbate the metabolic abnormalities induced by high-fat intake in obese patients.

  7. New insight into the role of MMP14 in metabolic balance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mori, Hidetoshi; Bhat, Ramray; Bruni-Cardoso, Alexandre

    Membrane-anchored matrix metalloproteinase 14 (MMP14) is involved broadly in organ development through both its proteolytic and signal-transducing functions. Knockout of Mmp14 (KO) in mice results in a dramatic reduction of body size and wasting followed by premature death, the mechanism of which is poorly understood. Since the mammary gland develops after birth and is thus dependent for its functional progression on systemic and local cues, we chose it as an organ model for understanding why KO mice fail to thrive. A global analysis of the mammary glands’ proteome in the wild type (WT) and KO mice provided insight into anmore » unexpected role of MMP14 in maintaining metabolism and homeostasis. We performed mass spectrometry and quantitative proteomics to determine the protein signatures of mammary glands from 7 to 11 days old WT and KO mice and found that KO rudiments had a significantly higher level of rate-limiting enzymes involved in catabolic pathways. Glycogen and lipid levels in KO rudiments were reduced, and the circulating levels of triglycerides and glucose were lower. Analysis of the ultrastructure of mammary glands imaged by electron microscopy revealed a significant increase in autophagy signatures in KO mice. Finally, Mmp14 silenced mammary epithelial cells displayed enhanced autophagy. Applied to a systemic level, these findings indicate that MMP14 is a crucial regulator of tissue homeostasis. If operative on a systemic level, these findings could explain how Mmp14KO litter fail to thrive due to disorder in metabolism.« less

  8. New insight into the role of MMP14 in metabolic balance

    DOE PAGES

    Mori, Hidetoshi; Bhat, Ramray; Bruni-Cardoso, Alexandre; ...

    2016-07-13

    Membrane-anchored matrix metalloproteinase 14 (MMP14) is involved broadly in organ development through both its proteolytic and signal-transducing functions. Knockout of Mmp14 (KO) in mice results in a dramatic reduction of body size and wasting followed by premature death, the mechanism of which is poorly understood. Since the mammary gland develops after birth and is thus dependent for its functional progression on systemic and local cues, we chose it as an organ model for understanding why KO mice fail to thrive. A global analysis of the mammary glands’ proteome in the wild type (WT) and KO mice provided insight into anmore » unexpected role of MMP14 in maintaining metabolism and homeostasis. We performed mass spectrometry and quantitative proteomics to determine the protein signatures of mammary glands from 7 to 11 days old WT and KO mice and found that KO rudiments had a significantly higher level of rate-limiting enzymes involved in catabolic pathways. Glycogen and lipid levels in KO rudiments were reduced, and the circulating levels of triglycerides and glucose were lower. Analysis of the ultrastructure of mammary glands imaged by electron microscopy revealed a significant increase in autophagy signatures in KO mice. Finally, Mmp14 silenced mammary epithelial cells displayed enhanced autophagy. Applied to a systemic level, these findings indicate that MMP14 is a crucial regulator of tissue homeostasis. If operative on a systemic level, these findings could explain how Mmp14KO litter fail to thrive due to disorder in metabolism.« less

  9. Hybrid of two-photon microscopy and optical multimodality imaging for multi-scale imaging of small animals

    NASA Astrophysics Data System (ADS)

    Li, Tianmeng; Hui, Hui; Ma, He; Yang, Xin; Tian, Jie

    2018-02-01

    Non-invasive imaging technologies, such as magnetic resonance imaging (MRI) and optical multimodality imaging methods, are commonly used for diagnosing and supervising the development of inflammatory bowel disease (IBD). These in vivo imaging methods can provide morphology changes information of IBD in macro-scale. However, it is difficult to investigate the intestinal wall in molecular and cellular level. State-of-art light-sheet and two-photon microscopy have the ability to acquire the changes for IBD in micro-scale. The aim of this work is to evaluate the size of the enterocoel and the thickness of colon wall using both MRI for in vivo imaging, and light-sheet and two-photon microscope for in vitro imaging. C57BL/6 mice were received 3.5% Dextran sodium sulfate (DSS) in the drinking water for 5 days to build IBD model. Mice were imaged with MRI on days 0, 6 to observe colitis progression. After MRI imaging, the mice were sacrificed to take colons for tissue clearing. Then, light-sheet and two-photon microscopies are used for in vitro imaging of the cleared samples. The experimental group showed symptoms of bloody stools, sluggishness and weight loss. It showed that the colon wall was thicker while the enterocoel was narrower compare to control group. The more details are observed using light-sheet and two-photon microscope. It is demonstrated that hybrid of MRI in macro-scale and light-sheet and two-photon microscopy in micro-scale imaging is feasible for colon inflammation diagnosing and supervising.

  10. Redox Indicator Mice Stably Expressing Genetically Encoded Neuronal roGFP: Versatile Tools to Decipher Subcellular Redox Dynamics in Neuropathophysiology.

    PubMed

    Wagener, Kerstin C; Kolbrink, Benedikt; Dietrich, Katharina; Kizina, Kathrin M; Terwitte, Lukas S; Kempkes, Belinda; Bao, Guobin; Müller, Michael

    2016-07-01

    Reactive oxygen species (ROS) and downstream redox alterations not only mediate physiological signaling but also neuropathology. For long, ROS/redox imaging was hampered by a lack of reliable probes. Genetically encoded redox sensors overcame this gap and revolutionized (sub)cellular redox imaging. Yet, the successful delivery of sensor-coding DNA, which demands transfection/transduction of cultured preparations or stereotaxic microinjections of each subject, remains challenging. By generating transgenic mice, we aimed to overcome limiting cultured preparations, circumvent surgical interventions, and to extend effectively redox imaging to complex and adult preparations. Our redox indicator mice widely express Thy1-driven roGFP1 (reduction-oxidation-sensitive green fluorescent protein 1) in neuronal cytosol or mitochondria. Negative phenotypic effects of roGFP1 were excluded and its proper targeting and functionality confirmed. Redox mapping by ratiometric wide-field imaging reveals most oxidizing conditions in CA3 neurons. Furthermore, mitochondria are more oxidized than cytosol. Cytosolic and mitochondrial roGFP1s reliably report cell endogenous redox dynamics upon metabolic challenge or stimulation. Fluorescence lifetime imaging yields stable, but marginal, response ranges. We therefore developed automated excitation ratiometric 2-photon imaging. It offers superior sensitivity, spatial resolution, and response dynamics. Redox indicator mice enable quantitative analyses of subcellular redox dynamics in a multitude of preparations and at all postnatal stages. This will uncover cell- and compartment-specific cerebral redox signals and their defined alterations during development, maturation, and aging. Cross-breeding with other disease models will reveal molecular details on compartmental redox homeostasis in neuropathology. Combined with ratiometric 2-photon imaging, this will foster our mechanistic understanding of cellular redox signals in their full complexity. Antioxid. Redox Signal. 25, 41-58.

  11. Redox Indicator Mice Stably Expressing Genetically Encoded Neuronal roGFP: Versatile Tools to Decipher Subcellular Redox Dynamics in Neuropathophysiology

    PubMed Central

    Wagener, Kerstin C.; Kolbrink, Benedikt; Dietrich, Katharina; Kizina, Kathrin M.; Terwitte, Lukas S.; Kempkes, Belinda; Bao, Guobin

    2016-01-01

    Abstract Aims: Reactive oxygen species (ROS) and downstream redox alterations not only mediate physiological signaling but also neuropathology. For long, ROS/redox imaging was hampered by a lack of reliable probes. Genetically encoded redox sensors overcame this gap and revolutionized (sub)cellular redox imaging. Yet, the successful delivery of sensor-coding DNA, which demands transfection/transduction of cultured preparations or stereotaxic microinjections of each subject, remains challenging. By generating transgenic mice, we aimed to overcome limiting cultured preparations, circumvent surgical interventions, and to extend effectively redox imaging to complex and adult preparations. Results: Our redox indicator mice widely express Thy1-driven roGFP1 (reduction–oxidation-sensitive green fluorescent protein 1) in neuronal cytosol or mitochondria. Negative phenotypic effects of roGFP1 were excluded and its proper targeting and functionality confirmed. Redox mapping by ratiometric wide-field imaging reveals most oxidizing conditions in CA3 neurons. Furthermore, mitochondria are more oxidized than cytosol. Cytosolic and mitochondrial roGFP1s reliably report cell endogenous redox dynamics upon metabolic challenge or stimulation. Fluorescence lifetime imaging yields stable, but marginal, response ranges. We therefore developed automated excitation ratiometric 2-photon imaging. It offers superior sensitivity, spatial resolution, and response dynamics. Innovation and Conclusion: Redox indicator mice enable quantitative analyses of subcellular redox dynamics in a multitude of preparations and at all postnatal stages. This will uncover cell- and compartment-specific cerebral redox signals and their defined alterations during development, maturation, and aging. Cross-breeding with other disease models will reveal molecular details on compartmental redox homeostasis in neuropathology. Combined with ratiometric 2-photon imaging, this will foster our mechanistic understanding of cellular redox signals in their full complexity. Antioxid. Redox Signal. 25, 41–58. PMID:27059697

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Americo, Jeffrey L.; Sood, Cindy L.; Cotter, Catherine A.

    Classical inbred mice are extensively used for virus research. However, we recently found that some wild-derived inbred mouse strains are more susceptible than classical strains to monkeypox virus. Experiments described here indicated that the 50% lethal dose of vaccinia virus (VACV) and cowpox virus (CPXV) were two logs lower in wild-derived inbred CAST/Ei mice than classical inbred BALB/c mice, whereas there was little difference in the susceptibility of the mouse strains to herpes simplex virus. Live bioluminescence imaging was used to follow spread of pathogenic and attenuated VACV strains and CPXV virus from nasal passages to organs in the chestmore » and abdomen of CAST/Ei mice. Luminescence increased first in the head and then simultaneously in the chest and abdomen in a dose-dependent manner. The spreading kinetics was more rapid with VACV than CPXV although the peak photon flux was similar. These data suggest advantages of CAST/Ei mice for orthopoxvirus studies. - Highlights: • Wild-derived inbred CAST/Ei mice are susceptible to vaccinia virus and cowpox virus. • Morbidity and mortality from orthopoxviruses are greater in CAST/Ei than BALB/c mice. • Morbidity and mortality from herpes simplex virus type 1 are similar in both mice. • Imaging shows virus spread from nose to lungs, abdominal organs and brain. • Vaccinia virus spreads more rapidly than cowpox virus.« less

  13. SU-F-J-225: Histology Study of MR Guided Pulsed Focused Ultrasound On Treatment of Prostate Cancer in Vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, L; Cvetkovic, D; Chen, X

    Purpose: Our previous study demonstrated significant tumor growth delay in the mice treated with pulsed high intensity focused ultrasound (pHIFU). The purpose of this study is to understand the cell killing mechanisms of pHIFU. Methods: Prostate cancer cells (LNCaP), were grown orthotopically in 17 nude mice. Tumor-bearing mice were treated using pHIFU with an acoustic power of 25W, pulse width 100msec and 300 pulses in one sonication under MR guidance. Mutiple sonications were used to cover the whole tumor volume. The temperature (less than 40 degree centigrade in the focal spot) was monitored using MR thermometry. Animals were euthanized atmore » pre-determined time points (n=2) after treatment: 0 hours; 6 hrs; 24 hrs; 48 hrs; 4 days and 7 days. Two tumorbearing mice were used as control. Three tumor-bearing mice were treated with radiation (RT, 2 Gy) using 6 MV photon beams. RT treated mice were euthanized at 0 hr, 6 hrs and 24 hrs. The tumors were processed for immunohistochemical (IHC) staining for PARP (a surrogate of apoptosis). A multispectral imaging analysis system was used to quantify the expression of PARP staining. Cell apoptosis was calculated based on the PARP expression level using the DAB analysis software. Results: Our data showed that PARP related apoptosis peaked at 48 hrs and 7 days in pHIFU treated mice, which is comparable to that for the RT group at 24 hrs. The preliminary results from this study were consistent with our previous study on tumor growth delay using pHIFU. Conclusion: Our results demonstrated that non-thermal pHIFU increased apoptotic tumor cell death through the PARP related pathway. MR guided pHIFU may have a great potential as a safe, noninvasive treatment modality for cancer therapy. This treatment modality may synergize with PARP inhibitors to achieve better therapeutic result.« less

  14. Role of innate immunity and altered intestinal motility in LPS- and MnCl2-induced intestinal intussusception in mice

    PubMed Central

    Killoran, Kristin E.; Miller, Amber D.; Uray, Karen S.; Weisbrodt, Norman W.; Pautler, Robia G.; Goyert, Sanna M.; van Rooijen, Nico

    2014-01-01

    Intestinal intussusception (ISS) commonly causes intestinal obstruction in children. One mechanism that has been proposed to cause ISS is inflammation-induced alteration of intestinal motility. We investigated whether innate inflammatory factors or altered motility is required for induction of ISS by LPS. We compared rates of ISS among BALB/c and C57BL/6 mice, mice lacking lymphocytes or depleted of phagocytes, or mice with defects in the Toll-like receptor 4 (TLR4) signaling pathway following administration of LPS or the Ca2+ analog MnCl2. At 6 or 2 h after administration of LPS or MnCl2, respectively, mice underwent image analysis to assess intestinal contraction rate or laparotomy to identify ISS. LPS-induced ISS (LPS-ISS) was observed in BALB/c mice, but not in C57BL/6 mice or any BALB/c mice with disruptions of TLR4 signaling. LPS-induced serum TNF-α, IL-6, and nitric oxide (NO) and intestinal NO levels were similar in BALB/c and C57BL/6 mice. The rate of LPS-ISS was significantly reduced in phagocyte-depleted, but not lymphocyte-deficient, mice. Intestinal contraction rates were reduced in LPS-ISS-susceptible BALB/c mice, but not in LPS-ISS-resistant C57BL/6 or TLR4 mutant mice, suggesting a role for reduced intestinal contraction rate in LPS-ISS susceptibility. This was tested with MnCl2, a Ca2+ antagonist that reduced intestinal contraction rates and induced ISS, irrespective of mouse strain. Therefore, LPS-ISS is initiated by innate immune signaling that requires TLR4 and phagocytes but may be independent of TNF-α, IL-6, and NO levels. Furthermore, alteration of intestinal motility, specifically, reduced intestinal contraction rate, is a key factor in the development of ISS. PMID:24407593

  15. Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male infertility.

    PubMed Central

    Dix, D J; Allen, J W; Collins, B W; Mori, C; Nakamura, N; Poorman-Allen, P; Goulding, E H; Eddy, E M

    1996-01-01

    In addition to the five 70-kDa heat shock proteins (HSP70) common to germ cells and somatic tissues of mammals, spermatogenic cells synthesize HSP70-2 during meiosis. To determine if this unique stress protein has a critical role in meiosis, we used gene-targeting techniques to disrupt Hsp70-2 in mice. Male mice homozygous for the mutant allele (Hsp70-2 -/-) did not synthesize HSP70-2, lacked postmeiotic spermatids and mature sperm, and were infertile. However, neither meiosis nor fertility was affected in female Hsp70-2 -/- mice. We previously found that HSP70-2 is associated with synaptonemal complexes in the nucleus of meiotic spermatocytes from mice and hamsters. While synaptonemal complexes assembled in Hsp70-2 -/- spermatocytes, structural abnormalities became apparent in these cells by late prophase, and development rarely progressed to the meiotic divisions. Furthermore, analysis of nuclei and genomic DNA indicated that the failure of meiosis in Hsp70-2 -/- mice was coincident with a dramatic increase in spermatocyte apoptosis. These results suggest that HSP70-2 participates in synaptonemal complex function during meiosis in male germ cells and is linked to mechanisms that inhibit apoptosis. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8622925

  16. Neonatal monosodium glutamate treatment causes obesity, diabetes, and macrovesicular steatohepatitis with liver nodules in DIAR mice.

    PubMed

    Tsuneyama, Koichi; Nishida, Takeshi; Baba, Hayato; Taira, Shu; Fujimoto, Makoto; Nomoto, Kazuhiro; Hayashi, Shinichi; Miwa, Shigeharu; Nakajima, Takahiko; Sutoh, Mitsuko; Oda, Emu; Hokao, Ryoji; Imura, Johji

    2014-09-01

    Non-alcoholic steatohepatitis (NASH) is the hepatic manifestation of metabolic syndrome (MS). Monosodium glutamate (MSG)-treated ICR mice is a useful model of MS and NASH, but it shows the different patterns of steatosis from human NASH. Because inbred aged DIAR (ddY, Institute for Animal Reproduction) mice spontaneously show the similar pattern of steatosis as NASH, we analyzed their liver pathology after administering MSG. MSG-treated DIAR mice (DIAR-MSG) and untreated DIAR mice (DIAR-controls) were sacrificed and assessed histopathologically at 29, 32, 40, 48, and 54 weeks of age. The NASH activity score, body mass index, blood glucose level, and oral glucose tolerance test were also assessed. The body mass index and blood glucose levels of DIAR-MSG were significantly higher than controls. The oral glucose tolerance test revealed a type 2 diabetes pattern in DIAR-MSG. The livers of DIAR-MSG mice showed macrovesicular steatosis, lobular inflammation with neutrophils, and ballooning degeneration after 29 weeks. At 54 weeks, mild fibrosis was observed in 5/6 DIAR-MSG and 2/5 DIAR-control mice. In imaging mass spectrometry analysis, cholesterol as well as triglyceride accumulated in the liver of DIAR-MSG mice. Atypical liver nodules were also observed after 32 weeks in DIAR-MSG, some with cellular and structural atypia mimicking human hepatocellular carcinoma. The NASH activity score of DIAR-MSG after 29 weeks was higher than that of control mice, suggesting the development of NASH. DIAR-MSG had NASH-like liver pathology and liver nodules typically associated with MS symptoms. DIAR-MSG provides a valuable animal model to analyze NASH pathogenesis and carcinogenesis. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  17. In vivo characterization of the electrophysiological and astrocytic responses to a silicon neuroprobe implanted in the mouse neocortex.

    PubMed

    Mols, Katrien; Musa, Silke; Nuttin, Bart; Lagae, Liesbet; Bonin, Vincent

    2017-11-15

    Silicon neuroprobes hold great potential for studies of large-scale neural activity and brain computer interfaces, but data on brain response in chronic implants is limited. Here we explored with in vivo cellular imaging the response to multisite silicon probes for neural recordings. We tested a chronic implant for mice consisting of a CMOS-compatible silicon probe rigidly implanted in the cortex under a cranial imaging window. Multiunit recordings of cortical neurons with the implant showed no degradation of electrophysiological signals weeks after implantation (mean spike and noise amplitudes of 186 ± 42 µV pp and 16 ± 3.2 µV rms , respectively, n = 5 mice). Two-photon imaging through the cranial window allowed longitudinal monitoring of fluorescently-labeled astrocytes from the second week post implantation for 8 weeks (n = 3 mice). The imaging showed a local increase in astrocyte-related fluorescence that remained stable from the second to the tenth week post implantation. These results demonstrate that, in a standard electrophysiology protocol in mice, rigidly implanted silicon probes can provide good short to medium term chronic recording performance with a limited astrocyte inflammatory response. The precise factors influencing the response to silicon probe implants remain to be elucidated.

  18. Knock-In Mice with NOP-eGFP Receptors Identify Receptor Cellular and Regional Localization.

    PubMed

    Ozawa, Akihiko; Brunori, Gloria; Mercatelli, Daniela; Wu, Jinhua; Cippitelli, Andrea; Zou, Bende; Xie, Xinmin Simon; Williams, Melissa; Zaveri, Nurulain T; Low, Sarah; Scherrer, Grégory; Kieffer, Brigitte L; Toll, Lawrence

    2015-08-19

    The nociceptin/orphanin FQ (NOP) receptor, the fourth member of the opioid receptor family, is involved in many processes common to the opioid receptors including pain and drug abuse. To better characterize receptor location and trafficking, knock-in mice were created by inserting the gene encoding enhanced green fluorescent protein (eGFP) into the NOP receptor gene (Oprl1) and producing mice expressing a functional NOP-eGFP C-terminal fusion in place of the native NOP receptor. The NOP-eGFP receptor was present in brain of homozygous knock-in animals in concentrations somewhat higher than in wild-type mice and was functional when tested for stimulation of [(35)S]GTPγS binding in vitro and in patch-clamp electrophysiology in dorsal root ganglia (DRG) neurons and hippocampal slices. Inhibition of morphine analgesia was equivalent when tested in knock-in and wild-type mice. Imaging revealed detailed neuroanatomy in brain, spinal cord, and DRG and was generally consistent with in vitro autoradiographic imaging of receptor location. Multicolor immunohistochemistry identified cells coexpressing various spinal cord and DRG cellular markers, as well as coexpression with μ-opioid receptors in DRG and brain regions. Both in tissue slices and primary cultures, the NOP-eGFP receptors appear throughout the cell body and in processes. These knock-in mice have NOP receptors that function both in vitro and in vivo and appear to be an exceptional tool to study receptor neuroanatomy and correlate with NOP receptor function. The NOP receptor, the fourth member of the opioid receptor family, is involved in pain, drug abuse, and a number of other CNS processes. The regional and cellular distribution has been difficult to determine due to lack of validated antibodies for immunohistochemical analysis. To provide a new tool for the investigation of receptor localization, we have produced knock-in mice with a fluorescent-tagged NOP receptor in place of the native NOP receptor. These knock-in mice have NOP receptors that function both in vitro and in vivo and have provided a detailed characterization of NOP receptors in brain, spinal cord, and DRG neurons. They appear to be an exceptional tool to study receptor neuroanatomy and correlate with NOP receptor function. Copyright © 2015 the authors 0270-6474/15/3511683-12$15.00/0.

  19. Adrenergic pathway activation enhances brown adipose tissue metabolism: A [18F]FDG PET/CT study in mice

    PubMed Central

    Mirbolooki, M. Reza; Upadhyay, Sanjeev Kumar; Constantinescu, Cristian C.; Pan, Min-Liang; Mukherjee, Jogeshwar

    2013-01-01

    Objective Pharmacologic approaches to study brown adipocyte activation in vivo with a potential of being translational to humans are desired. The aim of this study was to examine pre- and postsynaptic targeting of adrenergic system for enhancing brown adipose tissue (BAT) metabolism quantifiable by [18F]fluoro-2-deoxyglucose ([18F]FDG) positron emission tomography (PET)/ computed tomography (CT) in mice. Methods A β3-adrenoreceptor selective agonist (CL 316243), an adenylyl cyclase enzyme activator (forskolin) and a potent blocker of presynaptic norepinephrine transporter (atomoxetine) were injected through the tail vein of Swiss Webster mice 30 minutes before intravenous (iv) administration of [18F]FDG. The mice were placed on the PET/CT bed for 30 min PET acquisition followed by 10 min CT acquisition for attenuation correction and anatomical delineation of PET images. Results Activated interscapular (IBAT), cervical, periaortic and intercostal BAT were observed in 3-dimentional analysis of [18F]FDG PET images. CL 316243 increased the total [18F]FDG standard uptake value (SUV) of IBAT 5-fold greater compared to that in placebo-treated mice. It also increased the [18F]FDG SUV of white adipose tissue (2.4-fold), and muscle (2.7-fold), as compared to the control. There was no significant difference in heart, brain, spleen and liver uptakes between groups. Forskolin increased [18F]FDG SUV of IBAT 1.9-fold greater than that in placebo-treated mice. It also increased the [18F]FDG SUV of white adipose tissue (2.2-fold) and heart (5.4-fold) compared to control. There was no significant difference in muscle, brain, spleen, and liver uptakes between groups. Atomoxetine increased [18F]FDG SUV of IBAT 1.7-fold greater than that in placebo-treated mice. There were no significant differences in all other organs compared to placebo-treated mice except liver (1.6 fold increase). A positive correlation between SUV levels of IBAT and CT hounsfiled unit (HU) (R2=0.55, p<0.001) and between CT HU levels of IBAT and liver (R2=0.69, p<0.006) was observed. Conclusions The three pharmacologic approaches reported here enhanced BAT metabolism by targeting different sites in adrenergic system as measured by [18F]FDG PET/CT. PMID:24090673

  20. Superpixel-based segmentation of muscle fibers in multi-channel microscopy.

    PubMed

    Nguyen, Binh P; Heemskerk, Hans; So, Peter T C; Tucker-Kellogg, Lisa

    2016-12-05

    Confetti fluorescence and other multi-color genetic labelling strategies are useful for observing stem cell regeneration and for other problems of cell lineage tracing. One difficulty of such strategies is segmenting the cell boundaries, which is a very different problem from segmenting color images from the real world. This paper addresses the difficulties and presents a superpixel-based framework for segmentation of regenerated muscle fibers in mice. We propose to integrate an edge detector into a superpixel algorithm and customize the method for multi-channel images. The enhanced superpixel method outperforms the original and another advanced superpixel algorithm in terms of both boundary recall and under-segmentation error. Our framework was applied to cross-section and lateral section images of regenerated muscle fibers from confetti-fluorescent mice. Compared with "ground-truth" segmentations, our framework yielded median Dice similarity coefficients of 0.92 and higher. Our segmentation framework is flexible and provides very good segmentations of multi-color muscle fibers. We anticipate our methods will be useful for segmenting a variety of tissues in confetti fluorecent mice and in mice with similar multi-color labels.

  1. An entirely automated method to score DSS-induced colitis in mice by digital image analysis of pathology slides

    PubMed Central

    Kozlowski, Cleopatra; Jeet, Surinder; Beyer, Joseph; Guerrero, Steve; Lesch, Justin; Wang, Xiaoting; DeVoss, Jason; Diehl, Lauri

    2013-01-01

    SUMMARY The DSS (dextran sulfate sodium) model of colitis is a mouse model of inflammatory bowel disease. Microscopic symptoms include loss of crypt cells from the gut lining and infiltration of inflammatory cells into the colon. An experienced pathologist requires several hours per study to score histological changes in selected regions of the mouse gut. In order to increase the efficiency of scoring, Definiens Developer software was used to devise an entirely automated method to quantify histological changes in the whole H&E slide. When the algorithm was applied to slides from historical drug-discovery studies, automated scores classified 88% of drug candidates in the same way as pathologists’ scores. In addition, another automated image analysis method was developed to quantify colon-infiltrating macrophages, neutrophils, B cells and T cells in immunohistochemical stains of serial sections of the H&E slides. The timing of neutrophil and macrophage infiltration had the highest correlation to pathological changes, whereas T and B cell infiltration occurred later. Thus, automated image analysis enables quantitative comparisons between tissue morphology changes and cell-infiltration dynamics. PMID:23580198

  2. Selective Imaging of Vascular Endothelial Growth Factor Receptor-1 and Receptor-2 in Atherosclerotic Lesions in Diabetic and Non-diabetic ApoE-/- Mice.

    PubMed

    Tekabe, Yared; Johnson, Lynne L; Rodriquez, Krissy; Li, Qing; Backer, Marina; Backer, Joseph M

    2018-02-01

    Plaque vulnerability is associated with inflammation and angiogenesis, processes that rely on vascular endothelial growth factor (VEGF) signaling via two receptors, VEGFR-1 and VEGFR-2. We have recently reported that enhanced uptake of scVEGF-PEG-DOTA/Tc-99m (scV/Tc) single photon emission computed tomography (SPECT) tracer that targets both VEGFR-1 and VEGFR-2, identifies accelerated atherosclerosis in diabetic relative to non-diabetic ApoE -/- mice. Since VEGFR-1 and VEGFR-2 may play different roles in atherosclerotic plaques, we reasoned that selective imaging of each receptor can provide more detailed information on plaque biology. Recently described VEGFR-1 and VEGFR-2 selective mutants of scVEGF, named scVR1 and scVR2, were site-specifically derivatized with Tc-99m chelator DOTA via 3.4 kDa PEG linker, and their selectivity to the cognate receptors was confirmed in vitro. scVR1 and scVR2 conjugates were radiolabeled with Tc-99m to specific activity of 110 ± 11 MBq/nmol, yielding tracers named scVR1/Tc and scVR2/Tc. 34-40 week old diabetic and age-matched non-diabetic ApoE -/- mice were injected with tracers, 2-3 h later injected with x-ray computed tomography (CT) contrast agent and underwent hybrid SPECT/CT imaging. Tracer uptake, localized to proximal aorta and brachiocephalic vessels, was quantified as %ID from. Tracer uptake was also quantified as %ID/g from gamma counting of harvested plaques. Harvested atherosclerotic arterial tissue was used for immunofluorescent analyses of VEGFR-1 and VEGFR-2 and various lineage-specific markers. Focal, receptor-mediated uptake in proximal aorta and brachiocephalic vessels was detected for both scVR1/Tc and scVR2/Tc tracers. Uptake of scVR1/Tc and scVR2/Tc was efficiently inhibited only by "cold" proteins of the same receptor selectivity. Tracer uptake in this area, expressed as %ID, was higher in diabetic vs. non- diabetic mice for scVR1/Tc (p = 0.01) but not for scVR2/Tc. Immunofluorescent analysis revealed enhanced VEGFR-1 prevalence in and around plaque area in diabetic mice. Selective VEGFR-1 and VEGFR-2 imaging of atherosclerotic lesions may be useful to explore plaque biology and identify vulnerability.

  3. Cytokine Response to Diet and Exercise Affects Atheromatous Matrix Metalloproteinase-2/9 Activity in Mice.

    PubMed

    Shon, Soo-Min; Jang, Hee Jeong; Schellingerhout, Dawid; Kim, Jeong-Yeon; Ryu, Wi-Sun; Lee, Su-Kyoung; Kim, Jiwon; Park, Jin-Yong; Oh, Ji Hye; Kang, Jeong Wook; Je, Kang-Hoon; Park, Jung E; Kim, Kwangmeyung; Kwon, Ick Chan; Lee, Juneyoung; Nahrendorf, Matthias; Park, Jong-Ho; Kim, Dong-Eog

    2017-09-25

    The aim of this study is to identify the principal circulating factors that modulate atheromatous matrix metalloproteinase (MMP) activity in response to diet and exercise.Methods and Results:Apolipoprotein-E knock-out (ApoE -/- ) mice (n=56) with pre-existing plaque, fed either a Western diet (WD) or normal diet (ND), underwent either 10 weeks of treadmill exercise or had no treatment. Atheromatous MMP activity was visualized using molecular imaging with a MMP-2/9 activatable near-infrared fluorescent (NIRF) probe. Exercise did not significantly reduce body weight, visceral fat, and plaque size in either WD-fed animals or ND-fed animals. However, atheromatous MMP-activity was different; ND animals that did or did not exercise had similarly low MMP activities, WD animals that did not exercise had high MMP activity, and WD animals that did exercise had reduced levels of MMP activity, close to the levels of ND animals. Factor analysis and path analysis showed that soluble vascular cell adhesion molecule (sVCAM)-1 was directly positively correlated to atheromatous MMP activity. Adiponectin was indirectly negatively related to atheromatous MMP activity by way of sVCAM-1. Resistin was indirectly positively related to atheromatous MMP activity by way of sVCAM-1. Visceral fat amount was indirectly positively associated with atheromatous MMP activity, by way of adiponectin reduction and resistin elevation. MMP-2/9 imaging of additional mice (n=18) supported the diet/exercise-related anti-atherosclerotic roles for sVCAM-1. Diet and exercise affect atheromatous MMP activity by modulating the systemic inflammatory milieu, with sVCAM-1, resistin, and adiponectin closely interacting with each other and with visceral fat.

  4. Label-free in vivo optical micro-angiography imaging of cerebral capillary blood flow within meninges and cortex in mice with the skull left intact

    NASA Astrophysics Data System (ADS)

    Jia, Yali; Wang, Ruikang K.

    2011-03-01

    Abnormal microcirculation within meninges is common in many neurological diseases. There is a need for an imaging method that is capable of visualizing functional meningeal microcirculations alone, preferably decoupled from the cortical blood flow. Optical microangiography (OMAG) is a recently developed label-free imaging method capable of producing 3D images of dynamic blood perfusion within micro-circulatory tissue beds at an imaging depth up to ~2 mm, with an unprecedented imaging sensitivity to the blood flow at ~4 μm/s. In this study, we demonstrate the utility of ultra-high sensitive OMAG in imaging the detailed blood flow distributions, at a capillary level resolution, within meninges and cortex in mice with the cranium left intact. The results indicate that OMAG can be a valuable tool for the study of meningeal circulations.

  5. Enhancement of the efficiency of photodynamic therapy by combination with the microtubule inhibitor vincristine

    NASA Astrophysics Data System (ADS)

    Ma, Li Wei; Berg, Kristian; Danielsen, Havard E.; Iani, Vladimir; Moan, Johan

    1996-01-01

    Combination effects of photodynamic therapy (PDT) with meso-tetra (di-adjacent- sulfonatophenyl) porphine (TPPS2a) and the microtubule (MT) inhibitor, vincristine (VCR), were studied in the CaD2 mouse tumor model in mice. A synergistic effect was found when VCR, at an almost nontoxic dose (1 mg/kg), was injected i.p. into the mice 6 hr before PDT. The data on mitotic index show a 4 - 5 fold accumulation of the cells in mitosis 6 hr after injection of VCR into the mice. Cell cycle and ploidy distributions in tumor tissues were determined by means of image analysis with measurement of integrated optical density after Feulgen reaction on monolayers. Ploidy distribution of the tumors was not significantly changed 6 and 12 hr after administration of VCR only, while an increasing aneuploidy was observed 24 and 48 hr after VCR treatment. No prominent changes of the cell cycle and ploidy distributions were found in the tumor tissues after PDT or PDT combined with VCR.

  6. Dynamic Contrast-Enhanced Magnetic Resonance Imaging Reveals Stress-Induced Angiogenesis in MCF7 Human Breast Tumors

    NASA Astrophysics Data System (ADS)

    Furman-Haran, Edna; Margalit, Raanan; Grobgeld, Dov; Degani, Hadassa

    1996-06-01

    The mechanism of contrast enhancement of tumors using magnetic resonance imaging was investigated in MCF7 human breast cancer implanted in nude mice. Dynamic contrast-enhanced images recorded at high spatial resolution were analyzed by an image analysis method based on a physiological model, which included the blood circulation, the tumor, the remaining tissues, and clearance via the kidneys. This analysis enabled us to map in rapidly enhancing regions within the tumor, the capillary permeability factor (capillary permeability times surface area per voxel volume) and the fraction of leakage space. Correlation of these maps with T2-weighted spin echo images, with histopathology, and with immunohistochemical staining of endothelial cells demonstrated the presence of dense permeable microcapillaries in the tumor periphery and in intratumoral regions that surrounded necrotic loci. The high leakage from the intratumoral permeable capillaries indicated an induction of a specific angiogenic process associated with stress conditions that cause necrosis. This induction was augmented in tumors responding to tamoxifen treatment. Determination of the distribution and extent of this stress-induced angiogenic activity by contrast-enhanced MRI might be of diagnostic and of prognostic value.

  7. In vivo imaging of the Mouse Model of X-Linked Juvenile Retinoschisis Using Fourier Domain Optical Coherence Tomography

    PubMed Central

    Xu, Jing; Molday, Laurie L.; Molday, Robert S.; Sarunic, Marinko V.

    2009-01-01

    Purpose The purpose of this study is to investigate Fourier Domain Optical Coherence Tomography (FD OCT) as a non-invasive tool for retinal imaging in the Rs1h knockout mouse (model for X-linked Juvenile Retinoschisis). Methods A prototype spectrometer based FD OCT system was used in combination with a custom optical beam-scanning platform. Images of the retinas from wild type and Rs1h knockout mice were acquired non-invasively using FD OCT with the specimen anesthetized. At the completion of the non-invasive FD OCT imaging, invasive retinal cross sectional images (histology) were acquired from a nearby region for comparison to the FD OCT images. Results The retinal layers could be identified in the FD OCT images, permitting delineation and thickness measurement of the outer nuclear layer (ONL). During FD OCT in vivo imaging of the Rs1h knockout mouse, holes were observed in the inner nuclear layer (INL) and retinal cell disorganization was observed as a change in the backscattering intensity profile. Comparison of the ONL measurements acquired non-invasively using FD OCT to measurements taken using histology at nearby locations showed a degeneration of roughly thirty percent of the ONL by the age of two months in Rs1h knockout mice relative to wild type. Conclusions FD OCT has been demonstrated for non-invasive imaging of retinal degeneration and observation of retinal holes in Rs1h knockout mice. PMID:19182246

  8. Simultaneous two-photon imaging of cerebral oxygenation and capillary blood flow in atherosclerotic mice

    NASA Astrophysics Data System (ADS)

    Lu, Xuecong; Li, Baoqiang; Moeini, Mohammad; Lesage, Frédéric

    2017-02-01

    Gradual changes in brain microvasculature and cerebral capillary blood flow occurring with atherosclerosis may significantly contribute to cognition decline due to their role in brain tissue oxygenation. However, previous stud- ies of the relationship between cerebral capillary blood flow and brain tissue oxygenation are limited. This study aimed to investigate vascular and concomitant changes in brain tissue pO2 with atherosclerosis. Experiments in young healthy C57B1/6 mice (n=6 , WT), young atherosclerotic mice (n=6 , ATX Y) and old atherosclerotic mice (n=6 , ATX O) were performed imaging on the left sensory-motor cortex at resting state under urethane (1.5 g/kg) anesthesia using two-photon fluorescence microscopy. The results showed that pO2 around capillaries, correlated with red blood cell (RBC) flux, increased with atherosclerosis.

  9. HER2 expression in breast cancer cells is downregulated upon active targeting by antibody-engineered multifunctional nanoparticles in mice.

    PubMed

    Corsi, Fabio; Fiandra, Luisa; De Palma, Clara; Colombo, Miriam; Mazzucchelli, Serena; Verderio, Paolo; Allevi, Raffaele; Tosoni, Antonella; Nebuloni, Manuela; Clementi, Emilio; Prosperi, Davide

    2011-08-23

    Subcellular destiny of targeted nanoparticles in cancer cells within living organisms is still an open matter of debate. By in vivo and ex vivo experiments on tumor-bearing mice treated with antibody-engineered magnetofluorescent nanocrystals, in which we combined fluorescence imaging, magnetic relaxation, and trasmission electron microscopy approaches, we provide evidence that nanoparticles are effectively delivered to the tumor by active targeting. These nanocrystals were demonstrated to enable contrast enhancement of the tumor in magnetic resonance imaging. In addition, we were able to discriminate between the fate of the organic corona and the metallic core upon cell internalization. Accurate immunohistochemical analysis confirmed that hybrid nanoparticle endocytosis is mediated by the complex formation with HER2 receptor, leading to a substantial downregulation of HER2 protein expression on the cell surface. These results provide a direct insight into the pathway of internalization and degradation of targeted hybrid nanoparticles in cancer cells in vivo and suggest a potential application of this immunotheranostic nanoagent in neoadjuvant therapy of cancer. © 2011 American Chemical Society

  10. Simulated microsurgery monitoring using intraoperative multimodal surgical microscopy

    NASA Astrophysics Data System (ADS)

    Lee, Donghyun; Lee, Changho; Kim, Sehui; Zhou, Qifa; Kim, Jeehyun; Kim, Chulhong

    2016-03-01

    We have developed an intraoperative multimodal surgical microscopy system that provides simultaneous real-time enlarged surface views and subsurface anatomic information during surgeries by integrating spectral domain optical coherence tomography (SD-OCT), optical-resolution photoacoustic microscopy (OR-PAM), and conventional surgical microscopy. By sharing the same optical path, both OCT and PAM images were simultaneously acquired. Additionally, the custom-made needle-type transducer received the generated PA signals enabling convenient surgical operation without using a water bath. Using a simple augmented device, the OCT and PAM images were projected on the view plane of the surgical microscope. To quantify the performance of our system, we measured spatial resolutions of our system. Then, three microsurgery simulation and analysis were processed: (1) ex vivo needle tracking and monitoring injection of carbon particles in biological tissues, (2) in vivo needle tracking and monitoring injection of carbon particles in tumor-bearing mice, and (3) in vivo guiding of melanoma removal in melanoma-bearing mice. The results indicate that this triple modal system is useful for intraoperative purposes, and can potentially be a vital tool in microsurgeries.

  11. Slow Disease Progression in a C57BL/6 Pten-Deficient Mouse Model of Prostate Cancer

    PubMed Central

    Svensson, Robert U.; Haverkamp, Jessica M.; Thedens, Daniel R.; Cohen, Michael B.; Ratliff, Timothy L.; Henry, Michael D.

    2011-01-01

    Prostate-specific deletion of Pten in mice has been reported to recapitulate histological progression of human prostate cancer. To improve on this model, we introduced the conditional ROSA26 luciferase reporter allele to monitor prostate cancer progression via bioluminescence imaging and extensively backcrossed mice onto the albino C57BL/6 genetic background to address variability in tumor kinetics and to enhance imaging sensitivity. Bioluminescence signal increased rapidly in Ptenp−/− mice from 3 to 11 weeks, but was much slower from 11 to 52 weeks. Changes in bioluminescence signal were correlated with epithelial proliferation. Magnetic resonance imaging revealed progressive increases in prostate volume, which were attributed to excessive fluid retention in the anterior prostate and to expansion of the stroma. Development of invasive prostate cancer in 52-week-old Ptenp−/− mice was rare, indicating that disease progression was slowed relative to that in previous reports. Tumors in these mice exhibited a spontaneous inflammatory phenotype and were rapidly infiltrated by myeloid-derived suppressor cells. Although Ptenp−/− tumors responded to androgen withdrawal, they failed to exhibit relapsed growth for up to 1 year. Taken together, these data identify a mild prostate cancer phenotype in C57BL/6 prostate-specific Pten-deficient mice, reflecting effects of the C57BL/6 genetic background on cancer progression. This model provides a platform for noninvasive assessment of how genetic and environmental risk factors may affect disease progression. PMID:21703427

  12. Real-time chirp-coded imaging with a programmable ultrasound biomicroscope.

    PubMed

    Bosisio, Mattéo R; Hasquenoph, Jean-Michel; Sandrin, Laurent; Laugier, Pascal; Bridal, S Lori; Yon, Sylvain

    2010-03-01

    Ultrasound biomicroscopy (UBM) of mice can provide a testing ground for new imaging strategies. The UBM system presented in this paper facilitates the development of imaging and measurement methods with programmable design, arbitrary waveform coding, broad bandwidth (2-80 MHz), digital filtering, programmable processing, RF data acquisition, multithread/multicore real-time display, and rapid mechanical scanning (

  13. Framework for 3D histologic reconstruction and fusion with in vivo MRI: Preliminary results of characterizing pulmonary inflammation in a mouse model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rusu, Mirabela, E-mail: mirabela.rusu@gmail.com; Wang, Haibo; Madabhushi, Anant

    Purpose: Pulmonary inflammation is associated with a variety of diseases. Assessing pulmonary inflammation on in vivo imaging may facilitate the early detection and treatment of lung diseases. Although routinely used in thoracic imaging, computed tomography has thus far not been compellingly shown to characterize inflammation in vivo. Alternatively, magnetic resonance imaging (MRI) is a nonionizing radiation technique to better visualize and characterize pulmonary tissue. Prior to routine adoption of MRI for early characterization of inflammation in humans, a rigorous and quantitative characterization of the utility of MRI to identify inflammation is required. Such characterization may be achieved by considering exmore » vivo histology as the ground truth, since it enables the definitive spatial assessment of inflammation. In this study, the authors introduce a novel framework to integrate 2D histology, ex vivo and in vivo imaging to enable the mapping of the extent of disease from ex vivo histology onto in vivo imaging, with the goal of facilitating computerized feature analysis and interrogation of disease appearance on in vivo imaging. The authors’ framework was evaluated in a preclinical preliminary study aimed to identify computer extracted features on in vivo MRI associated with chronic pulmonary inflammation. Methods: The authors’ image analytics framework first involves reconstructing the histologic volume in 3D from individual histology slices. Second, the authors map the disease ground truth onto in vivo MRI via coregistration with 3D histology using the ex vivo lung MRI as a conduit. Finally, computerized feature analysis of the disease extent is performed to identify candidate in vivo imaging signatures of disease presence and extent. Results: The authors evaluated the framework by assessing the quality of the 3D histology reconstruction and the histology—MRI fusion, in the context of an initial use case involving characterization of chronic inflammation in a mouse model. The authors’ evaluation considered three mice, two with an inflammation phenotype and one control. The authors’ iterative 3D histology reconstruction yielded a 70.1% ± 2.7% overlap with the ex vivo MRI volume. Across a total of 17 anatomic landmarks manually delineated at the division of airways, the target registration error between the ex vivo MRI and 3D histology reconstruction was 0.85 ± 0.44 mm, suggesting that a good alignment of the ex vivo 3D histology and ex vivo MRI had been achieved. The 3D histology-in vivo MRI coregistered volumes resulted in an overlap of 73.7% ± 0.9%. Preliminary computerized feature analysis was performed on an additional four control mice, for a total of seven mice considered in this study. Gabor texture filters appeared to best capture differences between the inflamed and noninflamed regions on MRI. Conclusions: The authors’ 3D histology reconstruction and multimodal registration framework were successfully employed to reconstruct the histology volume of the lung and fuse it with in vivo MRI to create a ground truth map for inflammation on in vivo MRI. The analytic platform presented here lays the framework for a rigorous validation of the identified imaging features for chronic lung inflammation on MRI in a large prospective cohort.« less

  14. Protection by an oral disubstituted hydroxylamine derivative against loss of retinal ganglion cell differentiation following optic nerve crush.

    PubMed

    Lindsey, James D; Duong-Polk, Karen X; Dai, Yi; Nguyen, Duy H; Leung, Christopher K; Weinreb, Robert N

    2013-01-01

    Thy-1 is a cell surface protein that is expressed during the differentiation of retinal ganglion cells (RGCs). Optic nerve injury induces progressive loss in the number of RGCs expressing Thy-1. The rate of this loss is fastest during the first week after optic nerve injury and slower in subsequent weeks. This study was undertaken to determine whether oral treatment with a water-soluble N-hydroxy-2,2,6,6-tetramethylpiperidine derivative (OT-440) protects against loss of Thy-1 promoter activation following optic nerve crush and whether this effect targets the earlier quick phase or the later slow phase. The retina of mice expressing cyan fluorescent protein under control of the Thy-1 promoter (Thy1-CFP mice) was imaged using a blue-light confocal scanning laser ophthalmoscope (bCSLO). These mice then received oral OT-440 prepared in cream cheese or dissolved in water, or plain vehicle, for two weeks and were imaged again prior to unilateral optic nerve crush. Treatments and weekly imaging continued for four more weeks. Fluorescent neurons were counted in the same defined retinal areas imaged at each time point in a masked fashion. When the counts at each time point were directly compared, the numbers of fluorescent cells at each time point were greater in the animals that received OT-440 in cream cheese by 8%, 27%, 52% and 60% than in corresponding control animals at 1, 2, 3 and 4 weeks after optic nerve crush. Similar results were obtained when the vehicle was water. Rate analysis indicated the protective effect of OT-440 was greatest during the first two weeks and was maintained in the second two weeks after crush for both the cream cheese vehicle study and water vehicle study. Because most of the fluorescent cells detected by bCSLO are RGCs, these findings suggest that oral OT-440 can either protect against or delay early degenerative responses occurring in RGCs following optic nerve injury.

  15. Combining hard and soft magnetism into a single core-shell nanoparticle to achieve both hyperthermia and image contrast

    PubMed Central

    Yang, Qiuhong; Gong, Maogang; Cai, Shuang; Zhang, Ti; Douglas, Justin T; Chikan, Viktor; Davies, Neal M; Lee, Phil; Choi, In-Young; Ren, Shenqiang; Forrest, M Laird

    2015-01-01

    Background A biocompatible core/shell structured magnetic nanoparticles (MNPs) was developed to mediate simultaneous cancer therapy and imaging. Methods & results A 22-nm MNP was first synthesized via magnetically coupling hard (FePt) and soft (Fe3O4) materials to produce high relative energy transfer. Colloidal stability of the FePt@Fe3O4 MNPs was achieved through surface modification with silane-polyethylene glycol (PEG). Intravenous administration of PEG-MNPs into tumor-bearing mice resulted in a sustained particle accumulation in the tumor region, and the tumor burden of treated mice was a third that of the mice in control groups 2 weeks after a local hyperthermia treatment. In vivo magnetic resonance imaging exhibited enhanced T2 contrast in the tumor region. Conclusion This work has demonstrated the feasibility of cancer theranostics with PEG-MNPs. PMID:26606855

  16. Predicting therapeutic nanomedicine efficacy using a companion magnetic resonance imaging nanoparticle.

    PubMed

    Miller, Miles A; Gadde, Suresh; Pfirschke, Christina; Engblom, Camilla; Sprachman, Melissa M; Kohler, Rainer H; Yang, Katherine S; Laughney, Ashley M; Wojtkiewicz, Gregory; Kamaly, Nazila; Bhonagiri, Sushma; Pittet, Mikael J; Farokhzad, Omid C; Weissleder, Ralph

    2015-11-18

    Therapeutic nanoparticles (TNPs) have shown heterogeneous responses in human clinical trials, raising questions of whether imaging should be used to identify patients with a higher likelihood of NP accumulation and thus therapeutic response. Despite extensive debate about the enhanced permeability and retention (EPR) effect in tumors, it is increasingly clear that EPR is extremely variable; yet, little experimental data exist to predict the clinical utility of EPR and its influence on TNP efficacy. We hypothesized that a 30-nm magnetic NP (MNP) in clinical use could predict colocalization of TNPs by magnetic resonance imaging (MRI). To this end, we performed single-cell resolution imaging of fluorescently labeled MNPs and TNPs and studied their intratumoral distribution in mice. MNPs circulated in the tumor microvasculature and demonstrated sustained uptake into cells of the tumor microenvironment within minutes. MNPs could predictably demonstrate areas of colocalization for a model TNP, poly(d,l-lactic-co-glycolic acid)-b-polyethylene glycol (PLGA-PEG), within the tumor microenvironment with >85% accuracy and circulating within the microvasculature with >95% accuracy, despite their markedly different sizes and compositions. Computational analysis of NP transport enabled predictive modeling of TNP distribution based on imaging data and identified key parameters governing intratumoral NP accumulation and macrophage uptake. Finally, MRI accurately predicted initial treatment response and drug accumulation in a preclinical efficacy study using a paclitaxel-encapsulated NP in tumor-bearing mice. These approaches yield valuable insight into the in vivo kinetics of NP distribution and suggest that clinically relevant imaging modalities and agents can be used to select patients with high EPR for treatment with TNPs. Copyright © 2015, American Association for the Advancement of Science.

  17. High-throughput multiple-mouse imaging with micro-PET/CT for whole-skeleton assessment.

    PubMed

    Yagi, Masashi; Arentsen, Luke; Shanley, Ryan M; Hui, Susanta K

    2014-11-01

    Recent studies have proven that skeleton-wide functional assessment is essential to comprehensively understand physiological aspects of the skeletal system. Therefore, in contrast to regional imaging studies utilizing a multiple-animal holder (mouse hotel), we attempted to develop and characterize a multiple-mouse imaging system with micro-PET/CT for high-throughput whole-skeleton assessment. Using items found in a laboratory, a simple mouse hotel that houses four mice linked with gas anesthesia was constructed. A mouse-simulating phantom was used to measure uniformity in a cross sectional area and flatness (Amax/Amin*100) along the axial, radial and tangential directions, where Amax and Amin are maximum and minimum activity concentration in the profile, respectively. Fourteen mice were used for single- or multiple-micro-PET/CT scans. NaF uptake was measured at eight skeletal sites (skull to tibia). Skeletal (18)F activities measured with mice in the mouse hotel were within 1.6 ± 4% (mean ± standard deviation) of those measured with mice in the single-mouse holder. Single-holder scanning yields slightly better uniformity and flatness over the hotel. Compared to use of the single-mouse holder, scanning with the mouse hotel reduced study time (by 65%), decreased the number of scans (four-fold), reduced cost, required less computer storage space (40%), and maximized (18)F usage. The mouse hotel allows high-throughput, quantitatively equivalent scanning compared to the single-mouse holder for micro-PET/CT imaging for whole-skeleton assessment of mice. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  18. Fractal Geometry Enables Classification of Different Lung Morphologies in a Model of Experimental Asthma

    NASA Astrophysics Data System (ADS)

    Obert, Martin; Hagner, Stefanie; Krombach, Gabriele A.; Inan, Selcuk; Renz, Harald

    2015-06-01

    Animal models represent the basis of our current understanding of the pathophysiology of asthma and are of central importance in the preclinical development of drug therapies. The characterization of irregular lung shapes is a major issue in radiological imaging of mice in these models. The aim of this study was to find out whether differences in lung morphology can be described by fractal geometry. Healthy and asthmatic mouse groups, before and after an acute asthma attack induced by methacholine, were studied. In vivo flat-panel-based high-resolution Computed Tomography (CT) was used for mice's thorax imaging. The digital image data of the mice's lungs were segmented from the surrounding tissue. After that, the lungs were divided by image gray-level thresholds into two additional subsets. One subset contained basically the air transporting bronchial system. The other subset corresponds mainly to the blood vessel system. We estimated the fractal dimension of all sets of the different mouse groups using the mass radius relation (mrr). We found that the air transporting subset of the bronchial lung tissue enables a complete and significant differentiation between all four mouse groups (mean D of control mice before methacholine treatment: 2.64 ± 0.06; after treatment: 2.76 ± 0.03; asthma mice before methacholine treatment: 2.37 ± 0.16; after treatment: 2.71 ± 0.03; p < 0.05). We conclude that the concept of fractal geometry allows a well-defined, quantitative numerical and objective differentiation of lung shapes — applicable most likely also in human asthma diagnostics.

  19. Preclinical Imaging for the Study of Mouse Models of Thyroid Cancer

    PubMed Central

    Greco, Adelaide; Orlandella, Francesca Maria; Iervolino, Paola Lucia Chiara; Klain, Michele; Salvatore, Giuliana

    2017-01-01

    Thyroid cancer, which represents the most common tumors among endocrine malignancies, comprises a wide range of neoplasms with different clinical aggressiveness. One of the most important challenges in research is to identify mouse models that most closely resemble human pathology; other goals include finding a way to detect markers of disease that common to humans and mice and to identify the most appropriate and least invasive therapeutic strategies for specific tumor types. Preclinical thyroid imaging includes a wide range of techniques that allow for morphological and functional characterization of thyroid disease as well as targeting and in most cases, this imaging allows quantitative analysis of the molecular pattern of the thyroid cancer. The aim of this review paper is to provide an overview of all of the imaging techniques used to date both for diagnosis and theranostic purposes in mouse models of thyroid cancer. PMID:29258188

  20. Comparison of a chimeric anti-carcinoembryonic antigen antibody conjugated with visible or near-infrared fluorescent dyes for imaging pancreatic cancer in orthotopic nude mouse models

    NASA Astrophysics Data System (ADS)

    Maawy, Ali A.; Hiroshima, Yukihiko; Kaushal, Sharmeela; Luiken, George A.; Hoffman, Robert M.; Bouvet, Michael

    2013-12-01

    The aim of this study was to evaluate a set of visible and near-infrared dyes conjugated to a tumor-specific chimeric antibody for high-resolution tumor imaging in orthotopic models of pancreatic cancer. BxPC-3 human pancreatic cancer was orthotopically implanted into pancreata of nude mice. Mice received a single intravenous injection of a chimeric anti-carcinoembryonic antigen antibody conjugated to one of the following fluorophores: 488-nm group (Alexa Fluor 488 or DyLight 488); 550-nm group (Alexa Fluor 555 or DyLight 550); 650-nm group (Alexa Fluor 660 or DyLight 650), or the 750-nm group (Alexa Fluor 750 or DyLight 755). After 24 h, the Olympus OV100 small-animal imaging system was used for noninvasive and intravital fluorescence imaging of mice. Dyes were compared with respect to depth of imaging, resolution, tumor-to-background ratio (TBR), photobleaching, and hemoglobin quenching. The longer wavelength dyes had increased depth of penetration and ability to detect the smallest tumor deposits and provided the highest TBRs, resistance to hemoglobin quenching, and specificity. The shorter wavelength dyes were more photostable. This study showed unique advantages of each dye for specific cancer imaging in a clinically relevant orthotopic model.

  1. Intact skull chronic windows for mesoscopic wide-field imaging in awake mice

    PubMed Central

    Silasi, Gergely; Xiao, Dongsheng; Vanni, Matthieu P.; Chen, Andrew C. N.; Murphy, Timothy H.

    2016-01-01

    Background Craniotomy-based window implants are commonly used for microscopic imaging, in head-fixed rodents, however their field of view is typically small and incompatible with mesoscopic functional mapping of cortex. New Method We describe a reproducible and simple procedure for chronic through-bone wide-field imaging in awake head-fixed mice providing stable optical access for chronic imaging over large areas of the cortex for months. Results The preparation is produced by applying clear-drying dental cement to the intact mouse skull, followed by a glass coverslip to create a partially transparent imaging surface. Surgery time takes about 30 minutes. A single set-screw provides a stable means of attachment for mesoscale assessment without obscuring the cortical field of view. Comparison with Existing Methods We demonstrate the utility of this method by showing seed-pixel functional connectivity maps generated from spontaneous cortical activity of GCAMP6 signals in both awake and anesthetized mice. Conclusions We propose that the intact skull preparation described here may be used for most longitudinal studies that do not require micron scale resolution and where cortical neural or vascular signals are recorded with intrinsic sensors. PMID:27102043

  2. 3D map of theranostic nanoparticles distribution in mice brain and liver by means of X-ray Phase Contrast Tomography

    NASA Astrophysics Data System (ADS)

    Longo, E.; Bravin, A.; Brun, F.; Bukreeva, I.; Cedola, A.; Fratini, M.; Le Guevel, X.; Massimi, L.; Sancey, L.; Tillement, O.; Zeitoun, P.; de La Rochefoucauld, O.

    2018-01-01

    The word "theranostic" derives from the fusion of two terms: therapeutic and diagnostic. It is a promising research field that aims to develop innovative therapies with high target specificity by exploiting the therapeutic and diagnostic properties, in particular for metal-based nanoparticles (NPs) developed to erase cancer. In the framework of a combined research program on low dose X-ray imaging and theranostic nanoparticles (NPs), high resolution Phase-Contrast Tomography images of mice organs injected with gadolinium and gold-NPs were acquired at the European Synchrotron Radiation Facility (ESRF). Both compounds are good X-ray contrast agents due to their high attenuation coefficient with respect to biological tissues, especially immediately above K-edge energy. X-ray tomography is a powerful non-invasive technique to image the 3D vasculature network in order to detect abnormalities. Phase contrast methods provide more detailed anatomical information with higher discrimination among soft tissues. We present the images of mice liver and brain injected with gold and gadolinium NPs, respectively. We discuss different image processing methods used aiming at enhancing the accuracy on localizing nanoparticles.

  3. Inhibitory effect of bacopasides on spontaneous morphine withdrawal induced depression in mice.

    PubMed

    Rauf, Khalid; Subhan, Fazal; Abbas, Muzaffar; Ali, Syed Mobasher; Ali, Gowhar; Ashfaq, Muhammad; Abbas, Ghulam

    2014-06-01

    Bacopa monnieri is a perennial herb with a world known image as a nootropic. We investigated the effect of Bacopa monnieri methanolic extract (Mt Ext BM) 10, 20, and 30 mg/kg body weight (b.w) on acquisition and expression of morphine withdrawal induced depression in mice. Locally available Bacopa monnieri (BM) was screened for contents of Bacoside A3, Bacopasaponin C, and Bacopaside II using HPLC with UV. Morphine dependence was induced in mice using twice daily escalating chronic morphine treatments (20-65 mg/kg b.w) for eight consecutive days. Morphine withdrawal induced depression was assayed in animals using forced swimming test (FST), three days after last morphine injection. The HPLC analysis revealed that Mt-ext BM contained Bacoside A3 as major component, i.e. 4 µg in each mg of extract. The chronic treatment with Met Ext BM 10, 20, and 30 mg/kg b.w. dosing significantly inhibited opioid withdrawal induced depression in mice. These findings imply a newer potential role of Bacopa monnieri in the clinical management of opioid withdrawal induced depression which can be attributed to Bacoside A3. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Comparative assessments of the effects of alcohol exposure on fetal brain development using optical coherence tomography and ultrasound imaging

    NASA Astrophysics Data System (ADS)

    Sudheendran, Narendran; Bake, Shameena; Miranda, Rajesh C.; Larin, Kirill V.

    2013-02-01

    The developing fetal brain is vulnerable to a variety of environmental agents including maternal ethanol consumption. Preclinical studies on the development and amelioration of fetal teratology would be significantly facilitated by the application of high resolution imaging technologies like optical coherence tomography (OCT) and high-frequency ultrasound (US). This study investigates the ability of these imaging technologies to measure the effects of maternal ethanol exposure on brain development, ex vivo, in fetal mice. Pregnant mice at gestational day 12.5 were administered ethanol (3 g/Kg b.wt.) or water by intragastric gavage, twice daily for three consecutive days. On gestational day 14.5, fetuses were collected and imaged. Three-dimensional images of the mice fetus brains were obtained by OCT and high-resolution US, and the volumes of the left and right ventricles of the brain were measured. Ethanol-exposed fetuses exhibited a statistically significant, 2-fold increase in average left and right ventricular volumes compared with the ventricular volume of control fetuses, with OCT-derived measures of 0.38 and 0.18 mm3, respectively, whereas the boundaries of the fetal mouse lateral ventricles were not clearly definable with US imaging. Our results indicate that OCT is a useful technology for assessing ventriculomegaly accompanying alcohol-induced developmental delay. This study clearly demonstrated advantages of using OCT for quantitative assessment of embryonic development compared with US imaging.

  5. Detection of early changes in renal function using 99mTc-MAG3 imaging in a murine model of ischemia-reperfusion injury

    PubMed Central

    Roberts, John; Chen, Bo; Curtis, Lisa M.; Agarwal, Anupam; Sanders, Paul W.; Zinn, Kurt R.

    2012-01-01

    Accurate determination of renal function in mice is a major impediment to the use of murine models in acute kidney injury. The purpose of this study was to determine whether early changes in renal function could be detected using dynamic gamma camera imaging in a mouse model of ischemia-reperfusion (I/R) injury. C57BL/6 mice (n = 5/group) underwent a right nephrectomy, followed by either 30 min of I/R injury or sham surgery of the remaining kidney. Dynamic renal studies (21 min, 10 s/frame) were conducted before surgery (baseline) and at 5, 24, and 48 h by injection of 99mTc-mercaptoacetyltriglycine (MAG3; ~1.0 mCi/mouse) via the tail vein. The percentage of injected dose (%ID) in the kidney was calculated for each 10-s interval after MAG3 injection, using standard region of interest analyses. A defect in renal function in I/R-treated mice was detected as early as 5 h after surgery compared with sham-treated mice, identified by the increased %ID (at peak) in the I/R-treated kidneys at 100 s (P < 0.01) that remained significantly higher than sham-treated mice for the duration of the scan until 600 s (P < 0.05). At 48 h, the renal scan demonstrated functional renal recovery of the I/R mice and was comparable to sham-treated mice. Our study shows that using dynamic imaging, renal dysfunction can be detected and quantified reliably as early as 5 h after I/R insult, allowing for evaluation of early treatment interventions. PMID:17634403

  6. Ligation of the Jugular Veins Does Not Result in Brain Inflammation or Demyelination in Mice

    PubMed Central

    Wojtkiewicz, Gregory R.; Pulli, Benjamin; Iwamoto, Yoshiko; Ueno, Takuya; Waterman, Peter; Truelove, Jessica; Oklu, Rahmi; Chen, John W.

    2012-01-01

    An alternative hypothesis has been proposed implicating chronic cerebrospinal venous insufficiency (CCSVI) as a potential cause of multiple sclerosis (MS). We aimed to evaluate the validity of this hypothesis in a controlled animal model. Animal experiments were approved by the institutional animal care committee. The jugular veins in SJL mice were ligated bilaterally (n = 20), and the mice were observed for up to six months after ligation. Sham-operated mice (n = 15) and mice induced with experimental autoimmune encephalomyelitis (n = 8) were used as negative and positive controls, respectively. The animals were evaluated using CT venography and 99mTc-exametazime to assess for structural and hemodynamic changes. Imaging was performed to evaluate for signs of blood-brain barrier (BBB) breakdown and neuroinflammation. Flow cytometry and histopathology were performed to assess inflammatory cell populations and demyelination. There were both structural changes (stenosis, collaterals) in the jugular venous drainage and hemodynamic disturbances in the brain on Tc99m-exametazime scintigraphy (p = 0.024). In the JVL mice, gadolinium MRI and immunofluorescence imaging for barrier molecules did not reveal evidence of BBB breakdown (p = 0.58). Myeloperoxidase, matrix metalloproteinase, and protease molecular imaging did not reveal signs of increased neuroinflammation (all p>0.05). Flow cytometry and histopathology also did not reveal increase in inflammatory cell infiltration or population shifts. No evidence of demyelination was found, and the mice remained without clinical signs. Despite the structural and hemodynamic changes, we did not identify changes in the BBB permeability, neuroinflammation, demyelination, or clinical signs in the JVL group compared to the sham group. Therefore, our murine model does not support CCSVI as a cause of demyelinating diseases such as multiple sclerosis. PMID:22457780

  7. Preclinical Kinetic Analysis of the Caspase-3/7 PET Tracer 18F-C-SNAT: Quantifying the Changes in Blood Flow and Tumor Retention After Chemotherapy.

    PubMed

    Palner, Mikael; Shen, Bin; Jeon, Jongho; Lin, Jianguo; Chin, Frederick T; Rao, Jianghong

    2015-09-01

    Early detection of tumor response to therapy is crucial to the timely identification of the most efficacious treatments. We recently developed a novel apoptosis imaging tracer, (18)F-C-SNAT (C-SNAT is caspase-sensitive nanoaggregation tracer), that undergoes an intramolecular cyclization reaction after cleavage by caspase-3/7, a biomarker of apoptosis. This caspase-3/7-dependent reaction leads to an enhanced accumulation and retention of (18)F activity in apoptotic tumors. This study aimed to fully examine in vivo pharmacokinetics of the tracer through PET imaging and kinetic modeling in a preclinical mouse model of tumor response to systemic anticancer chemotherapy. Tumor-bearing nude mice were treated 3 times with intravenous injections of doxorubicin before undergoing a 120-min dynamic (18)F-C-SNAT PET/CT scan. Time-activity curves were extracted from the tumor and selected organs. A 2-tissue-compartment model was fitted to the time-activity curves from tumor and muscle, using the left ventricle of the heart as input function, and the pharmacokinetic rate constants were calculated. Both tumor uptake (percentage injected dose per gram) and the tumor-to-muscle activity ratio were significantly higher in the treated mice than untreated mice. Pharmacokinetic rate constants calculated by the 2-tissue-compartment model showed a significant increase in delivery and accumulation of the tracer after the systemic chemotherapeutic treatment. Delivery of (18)F-C-SNAT to the tumor tissue, quantified as K1, increased from 0.31 g⋅(mL⋅min)(-1) in untreated mice to 1.03 g⋅(mL⋅min)(-1) in treated mice, a measurement closely related to changes in blood flow. Accumulation of (18)F-C-SNAT, quantified as k3, increased from 0.03 to 0.12 min(-1), proving a higher retention of (18)F-C-SNAT in treated tumors independent from changes in blood flow. An increase in delivery was also found in the muscular tissue of treated mice without increasing accumulation. (18)F-C-SNAT has significantly increased tumor uptake and significantly increased tumor-to-muscle ratio in a preclinical mouse model of tumor therapy. Furthermore, our kinetic modeling of (18)F-C-SNAT shows that chemotherapeutic treatment increased accumulation (k3) in the treated tumors, independent of increased delivery (K1). © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  8. Rare-earth Nanoparticle-induced Cytotoxicity on Spatial Cognition Memory of Mouse Brain.

    PubMed

    Lin, Cai-Hou; Liu, Gui-Fen; Chen, Jing; Chen, Yan; Lin, Ru-Hui; He, Hong-Xing; Chen, Jian-Ping

    2017-11-20

    Luminescent rare-earth-based nanoparticles have been increasingly used in nanomedicine due to their excellent physicochemical properties, such as biomedical imaging agents, drug carriers, and biomarkers. However, biological safety of the rare-earth-based nanomedicine is of great significance for future development in practical applications. In particular, biological effects of rare-earth nanoparticles on human's central nervous system are still unclear. This study aimed to investigate the potential toxicity of rare-earth nanoparticles in nervous system function in the case of continuous exposure. Adult ICR mice were randomly divided into seven groups, including control group (receiving 0.9% normal saline) and six experimental groups (10 mice in each group). Luminescent rare-earth-based nanoparticles were synthesized by a reported co-precipitation method. Two different sizes of the nanoparticles were obtained, and then exposed to ICR mice through caudal vein injection at 0.5, 1.0, and 1.5 mg/kg body weight in each day for 7 days. Next, a Morris water maze test was employed to evaluate impaired behaviors of their spatial recognition memory. Finally, histopathological examination was implemented to study how the nanoparticles can affect the brain tissue of the ICR mice. Two different sizes of rare-earth nanoparticles have been successfully obtained, and their physical properties including luminescence spectra and nanoparticle sizes have been characterized. In these experiments, the rare-earth nanoparticles were taken up in the mouse liver using the magnetic resonance imaging characterization. Most importantly, the experimental results of the Morris water maze tests and histopathological analysis clearly showed that rare-earth nanoparticles could induce toxicity on mouse brain and impair the behaviors of spatial recognition memory. Finally, the mechanism of adenosine triphosphate quenching by the rare-earth nanoparticles was provided to illustrate the toxicity on the mouse brain. This study suggested that long-term exposure of high-dose bare rare-earth nanoparticles caused an obvious damage on the spatial recognition memory in the mice.

  9. Age-dependent changes of cerebral copper metabolism in Atp7b -/- knockout mouse model of Wilson's disease by [64Cu]CuCl2-PET/CT.

    PubMed

    Xie, Fang; Xi, Yin; Pascual, Juan M; Muzik, Otto; Peng, Fangyu

    2017-06-01

    Copper is a nutritional metal required for brain development and function. Wilson's disease (WD), or hepatolenticular degeneration, is an inherited human copper metabolism disorder caused by a mutation of the ATP7B gene. Many WD patients present with variable neurological and psychiatric symptoms, which may be related to neurodegeneration secondary to copper metabolism imbalance. The objective of this study was to explore the feasibility and use of copper-64 chloride ([ 64 C]CuCl 2 ) as a tracer for noninvasive assessment of age-dependent changes of cerebral copper metabolism in WD using an Atp7b -/- knockout mouse model of WD and positron emission tomography/computed tomography (PET/CT) imaging. Continuing from our recent study of biodistribution and radiation dosimetry of [ 64 C]CuCl 2 in Atp7b -/- knockout mice, PET quantitative analysis revealed low 64 Cu radioactivity in the brains of Atp7b -/- knockout mice at 7th weeks of age, compared with 64 Cu radioactivity in the brains of age- and gender-matched wild type C57BL/6 mice, at 24 h (h) post intravenous injection of [ 64 C]CuCl 2 as a tracer. Furthermore, age-dependent increase of 64 Cu radioactivity was detected in the brains of Atp7b -/- knockout mice from the 13th to 21th weeks of age, based on the data derived from a longitudinal [ 64 C]CuCl 2 -PET/CT study of Atp7b -/- knockout mice with orally administered [ 64 Cu]CuCl 2 as a tracer. The findings of this study support clinical use of [ 64 Cu]CuCl 2 -PET/CT imaging as a tool for noninvasive assessment of age-dependent changes of cerebral copper metabolism in WD patients presenting with variable neurological and psychiatric symptoms.

  10. Feasibility of speckle variance OCT for imaging cutaneous microvasculature regeneration during healing of wounds in diabetic mice

    NASA Astrophysics Data System (ADS)

    Sharma, P.; Kumawat, J.; Kumar, S.; Sahu, K.; Verma, Y.; Gupta, P. K.; Rao, K. D.

    2018-02-01

    We report on a study to assess the feasibility of a swept source-based speckle variance optical coherence tomography setup for monitoring cutaneous microvasculature. Punch wounds created in the ear pinnae of diabetic mice were monitored at different times post wounding to assess the structural and vascular changes. It was observed that the epithelium thickness increases post wounding and continues to be thick even after healing. Also, the wound size assessed by vascular images is larger than the physical wound size. The results show that the developed speckle variance optical coherence tomography system can be used to monitor vascular regeneration during wound healing in diabetic mice.

  11. Quantification of aortic and cutaneous elastin and collagen morphology in Marfan syndrome by multiphoton microscopy.

    PubMed

    Cui, Jason Z; Tehrani, Arash Y; Jett, Kimberly A; Bernatchez, Pascal; van Breemen, Cornelis; Esfandiarei, Mitra

    2014-09-01

    In a mouse model of Marfan syndrome, conventional Verhoeff-Van Gieson staining displays severe fragmentation, disorganization and loss of the aortic elastic fiber integrity. However, this method involves chemical fixatives and staining, which may alter the native morphology of elastin and collagen. Thus far, quantitative analysis of fiber damage in aorta and skin in Marfan syndrome has not yet been explored. In this study, we have used an advanced noninvasive and label-free imaging technique, multiphoton microscopy to quantify fiber fragmentation, disorganization, and total volumetric density of aortic and cutaneous elastin and collagen in a mouse model of Marfan syndrome. Aorta and skin samples were harvested from Marfan and control mice aged 3-, 6- and 9-month. Elastin and collagen were identified based on two-photon excitation fluorescence and second-harmonic-generation signals, respectively, without exogenous label. Measurement of fiber length indicated significant fragmentation in Marfan vs. control. Fast Fourier transform algorithm analysis demonstrated markedly lower fiber organization in Marfan mice. Significantly reduced volumetric density of elastin and collagen and thinner skin dermis were observed in Marfan mice. Cutaneous content of elastic fibers and thickness of dermis in 3-month Marfan resembled those in the oldest control mice. Our findings of early signs of fiber degradation and thinning of skin dermis support the potential development of a novel non-invasive approach for early diagnosis of Marfan syndrome. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Structural and functional cardiac cholinergic deficits in adult neurturin knockout mice.

    PubMed

    Mabe, Abigail M; Hoover, Donald B

    2009-04-01

    Previous work provided indirect evidence that the neurotrophic factor neurturin (NRTN) is required for normal cholinergic innervation of the heart. This study used nrtn knockout (KO) and wild-type (WT) mice to determine the effect of nrtn deletion on cardiac cholinergic innervation and function in the adult heart. Immunohistochemistry, confocal microscopy, and quantitative image analysis were used to directly evaluate intrinsic cardiac neuronal development. Atrial acetylcholine (ACh) levels were determined as an indirect index of cholinergic innervation. Cholinergic function was evaluated by measuring negative chronotropic responses to right vagal nerve stimulation in anaesthetized mice and responses of isolated atria to muscarinic agonists. KO hearts contained only 35% the normal number of cholinergic neurons, and the residual cholinergic neurons were 15% smaller than in WT. Cholinergic nerve density at the sinoatrial node was reduced by 87% in KOs, but noradrenergic nerve density was unaffected. Atrial ACh levels were substantially lower in KO mice (0.013 +/- 0.004 vs. 0.050 +/- 0.011 pmol/microg protein; P < 0.02) as expected from cholinergic neuron and nerve fibre deficits. Maximum bradycardia evoked by vagal stimulation was reduced in KO mice (38 +/- 6% vs. 69 +/- 3% decrease at 20 Hz; P < 0.001), and chronotropic responses took longer to develop and fade. In contrast to these deficits, isolated atria from KO mice had normal post-junctional sensitivity to carbachol and bethanechol. These findings demonstrate that NRTN is essential for normal cardiac cholinergic innervation and cholinergic control of heart rate. The presence of residual cardiac cholinergic neurons and vagal bradycardia in KO mice suggests that additional neurotrophic factors may influence this system.

  13. An excitation wavelength-scanning spectral imaging system for preclinical imaging

    NASA Astrophysics Data System (ADS)

    Leavesley, Silas; Jiang, Yanan; Patsekin, Valery; Rajwa, Bartek; Robinson, J. Paul

    2008-02-01

    Small-animal fluorescence imaging is a rapidly growing field, driven by applications in cancer detection and pharmaceutical therapies. However, the practical use of this imaging technology is limited by image-quality issues related to autofluorescence background from animal tissues, as well as attenuation of the fluorescence signal due to scatter and absorption. To combat these problems, spectral imaging and analysis techniques are being employed to separate the fluorescence signal from background autofluorescence. To date, these technologies have focused on detecting the fluorescence emission spectrum at a fixed excitation wavelength. We present an alternative to this technique, an imaging spectrometer that detects the fluorescence excitation spectrum at a fixed emission wavelength. The advantages of this approach include increased available information for discrimination of fluorescent dyes, decreased optical radiation dose to the animal, and ability to scan a continuous wavelength range instead of discrete wavelength sampling. This excitation-scanning imager utilizes an acousto-optic tunable filter (AOTF), with supporting optics, to scan the excitation spectrum. Advanced image acquisition and analysis software has also been developed for classification and unmixing of the spectral image sets. Filtering has been implemented in a single-pass configuration with a bandwidth (full width at half maximum) of 16nm at 550nm central diffracted wavelength. We have characterized AOTF filtering over a wide range of incident light angles, much wider than has been previously reported in the literature, and we show how changes in incident light angle can be used to attenuate AOTF side lobes and alter bandwidth. A new parameter, in-band to out-of-band ratio, was defined to assess the quality of the filtered excitation light. Additional parameters were measured to allow objective characterization of the AOTF and the imager as a whole. This is necessary for comparing the excitation-scanning imager to other spectral and fluorescence imaging technologies. The effectiveness of the hyperspectral imager was tested by imaging and analysis of mice with injected fluorescent dyes. Finally, a discussion of the optimization of spectral fluorescence imagers is given, relating the effects of filter quality on fluorescence images collected and the analysis outcome.

  14. Exploration of target molecules for molecular imaging of inflammatory bowel disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Higashikawa, Kei; Akada, Naoki; Yagi, Katsuharu

    2011-07-08

    Highlights: {sup {yields}18}F-FDG PET could discriminate each inflamed area of IBD model mice clearly. {sup {yields}18}F-FDG PET could not discriminate the difference of pathogenic mechanism. {yields} Cytokines and cytokine receptors expression was different by pathogenic mechanism. {yields} Cytokines and cytokine receptors would be new target molecules for IBD imaging. -- Abstract: Molecular imaging technology is a powerful tool for the diagnosis of inflammatory bowel disease (IBD) and the efficacy evaluation of various drug therapies for it. However, it is difficult to elucidate directly the relationships between the responsible molecules and IBD using existing probes. Therefore, the development of an alternativemore » probe that is able to elucidate the pathogenic mechanism and provide information on the appropriate guidelines for treatment is earnestly awaited. In this study, we investigated pathognomonic molecules in the intestines of model mice. The accumulation of fluorine-18 fluorodeoxyglucose ({sup 18}F-FDG) in the inflamed area of the intestines of dextran sulfate sodium (DSS)- or indomethacin (IND)-induced IBD model mice was measured by positron emission tomography (PET) and autoradiography to confirm the inflamed area. The results suggested that the inflammation was selectively induced in the colons of mice by the administration of DSS, whereas it was induced mainly in the ilea and the proximal colons of mice by the administration of IND. To explore attractive target molecules for the molecular imaging of IBD, we evaluated the gene expression levels of cytokines and cytokine receptors in the inflamed area of the intestines of both model mice. We found that the expression levels of cytokines and cytokine receptors were significantly increased during the progression of IBD, whereas the expression levels were decreased as the mucosa began to heal. In particular, the expression levels of these molecules had already changed before the symptoms of IBD appeared. In addition, the alterations of cytokine and cytokine receptor expression levels indicated differences in the expression pattern depending on the pathogenic mechanism or the region of inflammation (e.g., TNF-{alpha}). Our results suggest that these cytokines or cytokine receptors participate in the pathogenesis of IBD and are valuable biomarkers for the detection of the different circumstances underlying inflammation by the molecular imaging method. Finally, the development of an imaging probe for our target molecules is expected to improve our understanding of the inflammatory conditions of IBD.« less

  15. A new bioluminescent reporter system to study the biodistribution of systematically injected tumor-derived bioluminescent extracellular vesicles in mice

    PubMed Central

    Gangadaran, Prakash; Li, Xiu Juan; Lee, Ho Won; Oh, Ji Min; Kalimuthu, Senthilkumar; Rajendran, Ramya Lakshmi; Son, Seung Hyun; Baek, Se Hwan; Singh, Thoudam Debraj; Zhu, Liya; Jeong, Shin Young; Lee, Sang-Woo; Lee, Jaetae; Ahn, Byeong-Cheol

    2017-01-01

    In vivo biodistribution and fate of extracellular vesicles (EVs) are still largely unknown and require reliable in vivo tracking techniques. In this study, in vivo bioluminescence imaging (BLI) using Renilla luciferase (Rluc) was developed and applied to monitoring of EVs derived from thyroid cancer (CAL-62 cells) and breast cancer (MDA-MB-231) in nude mice after intravenous administration and was compared with a dye-based labeling method for EV derived from CAL-62 cells. The EVs were successfully labeled with Rluc and visualized by BLI in mice. In vivo distribution of the EVs, as measured by BLI, was consistent with the results of ex vivo organ analysis. EV-CAL-62/Rluc showed strong signals at lung followed by liver, spleen & kidney (P < 0.05). EV-MDA-MB-231/Rluc showed strong signals at liver followed by lung, spleen & kidney (P < 0.05). EV-CAL-62/Rluc and EV-MDA-MB-231/Rluc stayed in animal till day 9 and 3, respectively; showed a differential distribution. Spontaneous EV-CAL-62/Rluc shown distributed mostly to lung followed by liver, spleen & kidney. The new BLI system used to show spontaneous distribution of EV-CAL-62/Rluc in subcutaneous CAL-62/Rluc bearing mice. Dye (DiR)-labeled EV-CAL-62/Rluc showed a different distribution in vivo & ex vivo compared to EV-CAL-62/Rluc. Fluorescent signals were predominately detected in the liver (P < 0.05) and spleen (P < 0.05) regions. The bioluminescent EVs developed in this study may be used for monitoring of EVs in vivo. This novel reporter-imaging approach to visualization of EVs in real time is expected to pave the way for monitoring of EVs in EV-based treatments. PMID:29299117

  16. Hypothalamic gliosis associated with high-fat diet feeding is reversible in mice: a combined immunohistochemical and magnetic resonance imaging study.

    PubMed

    Berkseth, Kathryn E; Guyenet, Stephan J; Melhorn, Susan J; Lee, Donghoon; Thaler, Joshua P; Schur, Ellen A; Schwartz, Michael W

    2014-08-01

    Gliosis, the activation of astrocyte and microglial cell populations, is a hallmark of central nervous system injury and is detectable using either immunohistochemistry or in vivo magnetic resonance imaging (MRI). Obesity in rodents and humans is associated with gliosis of the arcuate nucleus, a key hypothalamic region for the regulation of energy homeostasis and adiposity, but whether this response is permanent or reversible is unknown. Here we combine terminal immunohistochemistry analysis with serial, noninvasive MRI to characterize the progression and reversibility of hypothalamic gliosis in high-fat diet (HFD)-fed mice. The effects of HFD feeding for 16 weeks to increase body weight and adiposity relative to chow were nearly normalized after the return to chow feeding for an additional 4 weeks in the diet-reversal group. Mice maintained on the HFD for the full 20-week study period experienced continued weight gain associated with the expected increases of astrocyte and microglial activation in the arcuate nucleus, but these changes were not observed in the diet-reversal group. The proopiomelanocortin neuron number did not differ between groups. Although MRI demonstrated a positive correlation between body weight, adiposity, and the gliosis-associated T2 signal in the mediobasal hypothalamus, it did not detect the reversal of gliosis among the HFD-fed mice after the return to chow diet. We conclude that hypothalamic gliosis associated with 16-week HFD feeding is largely reversible in rodents, consistent with the reversal of the HFD-induced obesity phenotype, and extend published evidence regarding the utility of MRI as a tool for studying obesity-associated hypothalamic gliosis in vivo.

  17. Monitoring Blood-Brain Barrier Integrity Following Amyloid-β Immunotherapy Using Gadolinium-Enhanced MRI in a PDAPP Mouse Model.

    PubMed

    Blockx, Ines; Einstein, Steve; Guns, Pieter-Jan; Van Audekerke, Johan; Guglielmetti, Caroline; Zago, Wagner; Roose, Dimitri; Verhoye, Marleen; Van der Linden, Annemie; Bard, Frederique

    2016-09-06

    Amyloid-related imaging abnormalities (ARIA) have been reported with some anti-amyloid-β (Aβ) immunotherapy trials. They are detected with magnetic resonance imaging (MRI) and thought to represent transient accumulation of fluid/edema (ARIA-E) or microhemorrhages (ARIA-H). Although the clinical significance and pathophysiology are unknown, it has been proposed that anti-Aβimmunotherapy may affect blood-brain barrier (BBB) integrity. To examine vascular integrity in aged (12-16 months) PDAPP and wild type mice (WT), we performed a series of longitudinal in vivo MRI studies. Mice were treated on a weekly basis using anti-Aβimmunotherapy (3D6) and follow up was done longitudinally from 1-12 weeks after treatment. BBB-integrity was assessed using both visual assessment of T1-weighted scans and repeated T1 mapping in combination with gadolinium (Gd-DOTA). A subset of 3D6 treated PDAPP mice displayed numerous BBB disruptions, whereas WT and saline-treated PDAPP mice showed intact BBB integrity under the conditions tested. In addition, the contrast induced decrease in T1 value was observed in the meningeal and midline area. BBB disruption events occurred early during treatment (between 1 and 5 weeks), were transient, and resolved quickly. Finally, BBB-leakages associated with microhemorrhages were confirmed by Perls'Prussian blue histopathological analysis. Our preclinical findings support the hypothesis that 3D6 leads to transient leakage from amyloid-positive vessels. The current study has provided valuable insights on the time course of vascular alterations during immunization treatment and supports further research in relation to the nature of ARIA and the utility of in vivo repeated T1 MRI as a translational tool.

  18. Efficient clearance of Aβ protofibrils in AβPP-transgenic mice treated with a brain-penetrating bifunctional antibody.

    PubMed

    Syvänen, Stina; Hultqvist, Greta; Gustavsson, Tobias; Gumucio, Astrid; Laudon, Hanna; Söderberg, Linda; Ingelsson, Martin; Lannfelt, Lars; Sehlin, Dag

    2018-05-24

    Amyloid-β (Aβ) immunotherapy is one of the most promising disease-modifying strategies for Alzheimer's disease (AD). Despite recent progress targeting aggregated forms of Aβ, low antibody brain penetrance remains a challenge. In the present study, we used transferrin receptor (TfR)-mediated transcytosis to facilitate brain uptake of our previously developed Aβ protofibril-selective mAb158, with the aim of increasing the efficacy of immunotherapy directed toward soluble Aβ protofibrils. Aβ protein precursor (AβPP)-transgenic mice (tg-ArcSwe) were given a single dose of mAb158, modified for TfR-mediated transcytosis (RmAb158-scFv8D3), in comparison with an equimolar dose or a tenfold higher dose of unmodified recombinant mAb158 (RmAb158). Soluble Aβ protofibrils and total Aβ in the brain were measured by enzyme-linked immunosorbent assay (ELISA). Brain distribution of radiolabeled antibodies was visualized by positron emission tomography (PET) and ex vivo autoradiography. ELISA analysis of Tris-buffered saline brain extracts demonstrated a 40% reduction of soluble Aβ protofibrils in both RmAb158-scFv8D3- and high-dose RmAb158-treated mice, whereas there was no Aβ protofibril reduction in mice treated with a low dose of RmAb158. Further, ex vivo autoradiography and PET imaging revealed different brain distribution patterns of RmAb158-scFv8D3 and RmAb158, suggesting that these antibodies may affect Aβ levels by different mechanisms. With a combination of biochemical and imaging analyses, this study demonstrates that antibodies engineered to be transported across the blood-brain barrier can be used to increase the efficacy of Aβ immunotherapy. This strategy may allow for decreased antibody doses and thereby reduced side effects and treatment costs.

  19. Revisiting the physiological roles of SGLTs and GLUTs using positron emission tomography in mice

    PubMed Central

    Sala‐Rabanal, Monica; Hirayama, Bruce A.; Ghezzi, Chiara; Liu, Jie; Huang, Sung‐Cheng; Kepe, Vladimir; Koepsell, Hermann; Yu, Amy; Powell, David R.; Thorens, Bernard; Barrio, Jorge R.

    2016-01-01

    Key points Glucose transporters are central players in glucose homeostasis.There are two major classes of glucose transporters in the body, the passive facilitative glucose transporters (GLUTs) and the secondary active sodium‐coupled glucose transporters (SGLTs).In the present study, we report the use of a non‐invasive imaging technique, positron emission tomography, in mice aiming to evaluate the role of GLUTs and SGLTs in controlling glucose distribution and utilization.We show that GLUTs are most significant for glucose uptake into the brain and liver, whereas SGLTs are important in glucose recovery in the kidney.This work provides further support for the use of SGLT imaging in the investigation of the role of SGLT transporters in human physiology and diseases such as diabetes and cancer. Abstract The importance of sodium‐coupled glucose transporters (SGLTs) and facilitative glucose transporters (GLUTs) in glucose homeostasis was studied in mice using fluorine‐18 labelled glucose molecular imaging probes and non‐invasive positron emission tomography (PET) imaging. The probes were: α‐methyl‐4‐[F‐18]‐fluoro‐4‐deoxy‐d‐glucopyranoside (Me‐4FDG), a substrate for SGLTs; 4‐deoxy‐4‐[F‐18]‐fluoro‐d‐glucose (4‐FDG), a substrate for SGLTs and GLUTs; and 2‐deoxy‐2‐[F‐18]‐fluoro‐d–glucose (2‐FDG), a substrate for GLUTs. These radiolabelled imaging probes were injected i.v. into wild‐type, Sglt1–/–, Sglt2–/– and Glut2–/– mice and their dynamic whole‐body distribution was determined using microPET. The distribution of 2‐FDG was similar to that reported earlier (i.e. it accumulated in the brain, heart, liver and kidney, and was excreted into the urinary bladder). There was little change in the distribution of 2‐FDG in Glut2–/– mice, apart from a reduction in the rate of uptake into liver. The major differences between Me‐4FDG and 2‐FDG were that Me‐4FDG did not enter the brain and was not excreted into the urinary bladder. There was urinary excretion of Me‐4FDG in Sglt1–/– and Sglt2–/– mice. However, Me‐4FDG was not reabsorbed in the kidney in Glut2–/– mice. There were no differences in Me‐4FDG uptake into the heart of wild‐type, Sglt1–/– and Sglt2–/– mice. We conclude that GLUT2 is important in glucose liver transport and reabsorption of glucose in the kidney along with SGLT2 and SGLT1. Complete reabsorption of Me‐4FDG from the glomerular filtrate in wild‐type mice and the absence of reabsorption in the kidney in Glut2–/– mice confirm the importance of GLUT2 in glucose absorption across the proximal tubule. PMID:27018980

  20. Comparison of multiple enzyme activatable near infrared fluorescent molecular probes for detection and quantification of inflammation in murine colitis models

    PubMed Central

    Ding, Shengli; Blue, Randal E.; Morgan, Douglas R.; Lund, Pauline K.

    2015-01-01

    Background Activatable near-infrared fluorescent (NIRF) probes have been used for ex vivo and in vivo detection of intestinal tumors in animal models. We hypothesized that NIRF probes activatable by cathepsins or MMPs will detect and quantify dextran sulphate sodium (DSS) induced acute colonic inflammation in wild type (WT) mice or chronic colitis in IL-10 null mice ex vivo or in vivo. Methods WT mice given DSS, water controls and IL-10 null mice with chronic colitis were administered probes by retro-orbital injection. FMT2500 LX system imaged fresh and fixed intestine ex vivo and mice in vivo. Inflammation detected by probes was verified by histology and colitis scoring. NIRF signal intensity was quantified using 2D region of interest (ROI) ex vivo or 3D ROI-analysis in vivo. Results Ex vivo, seven probes tested yielded significant higher NIRF signals in colon of DSS treated mice versus controls. A subset of probes was tested in IL-10 null mice and yielded strong ex vivo signals. Ex vivo fluorescence signal with 680 series probes was preserved after formalin fixation. In DSS and IL-10 null models, ex vivo NIRF signal strongly and significantly correlated with colitis scores. In vivo, ProSense680, CatK680FAST and MMPsense680 yielded significantly higher NIRF signals in DSS treated mice than controls but background was high in controls. Conclusion Both cathepsin or MMP-activated NIRF-probes can detect and quantify colonic inflammation ex vivo. ProSense680 yielded the strongest signals in DSS colitis ex vivo and in vivo, but background remains a problem for in vivo quantification of colitis. PMID:24374874

  1. A study of quantification of aortic compliance in mice using radial acquisition phase contrast MRI

    NASA Astrophysics Data System (ADS)

    Zhao, Xuandong

    Spatiotemporal changes in blood flow velocity measured using Phase contrast Magnetic Resonance Imaging (MRI) can be used to quantify Pulse Wave Velocity (PWV) and Wall Shear Stress (WSS), well known indices of vessel compliance. A study was conducted to measure the PWV in the aortic arch in young healthy children using conventional phase contrast MRI and a post processing algorithm that automatically track the peak velocity in phase contrast images. It is shown that the PWV calculated using peak velocity-time data has less variability compared to that using mean velocity and flow. Conventional MR data acquisition techniques lack both the spatial and temporal resolution needed to accurately calculate PWV and WSS in in vivo studies using transgenic animal models of arterial diseases. Radial k-space acquisition can improve both spatial and temporal resolution. A major part of this thesis was devoted to developing technology for Radial Phase Contrast Magnetic Resonance (RPCMR) cine imaging on a 7 Tesla Animal scanner. A pulse sequence with asymmetric radial k-space acquisition was designed and implemented. Software developed to reconstruct the RPCMR images include gridding, density compensation and centering of k-Space that corrects the image ghosting introduced by hardware response time. Image processing software was developed to automatically segment the vessel lumen and correct for phase offset due to eddy currents. Finally, in vivo and ex vivo aortic compliance measurements were conducted in a well-established mouse model for atherosclerosis: Apolipoprotein E-knockout (ApoE-KO). Using RPCMR technique, a significantly higher PWV value as well as a higher average WSS was detected among 9 months old ApoE-KO mice compare to in wild type mice. A follow up ex-vivo test of tissue elasticity confirmed the impaired distensibility of aortic arteries among ApoE-KO mice.

  2. Radionuclide and Fluorescence Imaging of Clear Cell Renal Cell Carcinoma Using Dual Labeled Anti-Carbonic Anhydrase IX Antibody G250.

    PubMed

    Muselaers, Constantijn H J; Rijpkema, Mark; Bos, Desirée L; Langenhuijsen, Johan F; Oyen, Wim J G; Mulders, Peter F A; Oosterwijk, Egbert; Boerman, Otto C

    2015-08-01

    Tumor targeted optical imaging using antibodies labeled with near infrared fluorophores is a sensitive imaging modality that might be used during surgery to assure complete removal of malignant tissue. We evaluated the feasibility of dual modality imaging and image guided surgery with the dual labeled anti-carbonic anhydrase IX antibody preparation (111)In-DTPA-G250-IRDye800CW in mice with intraperitoneal clear cell renal cell carcinoma. BALB/c nu/nu mice with intraperitoneal SK-RC-52 lesions received 10 μg DTPA-G250-IRDye800CW labeled with 15 MBq (111)In or 10 μg of the dual labeled irrelevant control antibody NUH-82 (20 mice each). To evaluate when tumors could be detected, 4 mice per group were imaged weekly during 5 weeks with single photon emission computerized tomography/computerized tomography and the fluorescence imaging followed by ex vivo biodistribution studies. As early as 1 week after tumor cell inoculation single photon emission computerized tomography and fluorescence images showed clear delineation of intraperitoneal clear cell renal cell carcinoma with good concordance between single photon emission computerized tomography/computerized tomography and fluorescence images. The high and specific accumulation of the dual labeled antibody conjugate in tumors was confirmed in the biodistribution studies. Maximum tumor uptake was observed 1 week after inoculation (mean ± SD 58.5% ± 18.7% vs 5.6% ± 2.3% injected dose per gm for DTPA-G250-IRDye800CW vs NUH-82, respectively). High tumor uptake was also observed at other time points. This study demonstrates the feasibility of dual modality imaging with dual labeled antibody (111)In-DTPA-G250-IRDye800CW in a clear cell renal cell carcinoma model. Results indicate that preoperative and intraoperative detection of carbonic anhydrase IX expressing tumors, positive resection margins and metastasis might be feasible with this approach. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  3. Live small-animal X-ray lung velocimetry and lung micro-tomography at the Australian Synchrotron Imaging and Medical Beamline.

    PubMed

    Murrie, Rhiannon P; Morgan, Kaye S; Maksimenko, Anton; Fouras, Andreas; Paganin, David M; Hall, Chris; Siu, Karen K W; Parsons, David W; Donnelley, Martin

    2015-07-01

    The high flux and coherence produced at long synchrotron beamlines makes them well suited to performing phase-contrast X-ray imaging of the airways and lungs of live small animals. Here, findings of the first live-animal imaging on the Imaging and Medical Beamline (IMBL) at the Australian Synchrotron are reported, demonstrating the feasibility of performing dynamic lung motion measurement and high-resolution micro-tomography. Live anaesthetized mice were imaged using 30 keV monochromatic X-rays at a range of sample-to-detector propagation distances. A frame rate of 100 frames s(-1) allowed lung motion to be determined using X-ray velocimetry. A separate group of humanely killed mice and rats were imaged by computed tomography at high resolution. Images were reconstructed and rendered to demonstrate the capacity for detailed, user-directed display of relevant respiratory anatomy. The ability to perform X-ray velocimetry on live mice at the IMBL was successfully demonstrated. High-quality renderings of the head and lungs visualized both large structures and fine details of the nasal and respiratory anatomy. The effect of sample-to-detector propagation distance on contrast and resolution was also investigated, demonstrating that soft tissue contrast increases, and resolution decreases, with increasing propagation distance. This new capability to perform live-animal imaging and high-resolution micro-tomography at the IMBL enhances the capability for investigation of respiratory diseases and the acceleration of treatment development in Australia.

  4. Enhanced delivery of paclitaxel liposomes using focused ultrasound with microbubbles for treating nude mice bearing intracranial glioblastoma xenografts

    PubMed Central

    Shen, Yuanyuan; Pi, Zhaoke; Yan, Fei; Yeh, Chih-Kuang; Zeng, Xiaojun; Diao, Xianfen; Hu, Yaxin; Chen, Siping; Chen, Xin; Zheng, Hairong

    2017-01-01

    Paclitaxel liposomes (PTX-LIPO) are a clinically promising antineoplastic drug formulation for the treatment of various extracranial cancers, excluding glioblastoma. A main reason for this is the presence of the blood–brain barrier (BBB) or blood–tumor barrier (BTB), preventing liposomal drugs from crossing at a therapeutically meaningful level. Focused ultrasound (FUS) in conjunction with microbubbles (MBs) has been suggested in many studies to be an effective approach to increase the BBB or BTB permeability. In this study, we investigated the feasibility of enhancing the delivery of PTX-LIPO in intracranial glioblastoma-bearing nude mice using pulsed low-intensity FUS exposure in the presence of MBs. Our results showed that the delivery efficiency of PTX-LIPO could be effectively improved in terms of the penetration of both the BBB in vitro and BTB in vivo by pulsed FUS sonication with a 10 ms pulse length and 1 Hz pulse repetition frequency at 0.64 MPa peak-rarefactional pressure in the presence of MBs. Quantitative analysis showed that a 2-fold higher drug concentration had accumulated in the glioblastoma 3 h after FUS treatment, with 7.20±1.18 µg PTX per g glioma tissue. Longitudinal magnetic resonance imaging analysis illustrated that the intracranial glioblastoma progression in nude mice treated with PTX-LIPO delivered via FUS with MBs was suppressed consistently for 4 weeks compared to the untreated group. The medium survival time of these tumor-bearing nude mice was significantly prolonged by 20.8%, compared to the untreated nude mice. Immunohistochemical analysis further confirmed the antiproliferation effect and cell apoptosis induction. Our study demonstrated that noninvasive low-intensity FUS with MBs can be used as an effective approach to deliver PTX-LIPO in order to improve their chemotherapy efficacy toward glioblastoma. PMID:28848341

  5. Effects of administration route, dietary condition, and blood glucose level on kinetics and uptake of 18F-FDG in mice.

    PubMed

    Wong, Koon-Pong; Sha, Wei; Zhang, Xiaoli; Huang, Sung-Cheng

    2011-05-01

    The effects of dietary condition and blood glucose level on the kinetics and uptake of (18)F-FDG in mice were systematically investigated using intraperitoneal and tail-vein injection. Dynamic PET was performed for 60 min on 23 isoflurane-anesthetized male C57BL/6 mice after intravenous (n = 11) or intraperitoneal (n = 12) injection of (18)F-FDG. Five and 6 mice in the intravenous and intraperitoneal groups, respectively, were kept fasting overnight (18 ± 2 h), and the others were fed ad libitum. Serial blood samples were collected from the femoral artery to measure (18)F-FDG and glucose concentrations. Image data were reconstructed using filtered backprojection with CT-based attenuation correction. The standardized uptake value (SUV) was estimated from the 45- to 60-min image. The metabolic rate of glucose (MRGlu) and (18)F-FDG uptake constant (K(i)) were derived by Patlak graphical analysis. In the brain, SUV and K(i) were significantly higher in fasting mice with intraperitoneal injection, but MRGlu did not differ significantly under different dietary states and administration routes. Cerebral K(i) was inversely related to elevated blood glucose levels, irrespective of administration route or dietary state. In myocardium, SUV, K(i), and MRGlu were significantly lower in fasting than in nonfasting mice for both routes of injection. Myocardial SUV and K(i) were strongly dependent on the dietary state, and K(i) did not correlate with the blood glucose level. Similar results were obtained for skeletal muscle, although the differences were not as pronounced. Intraperitoneal injection is a valid alternative route, providing pharmacokinetic data equivalent to data from tail-vein injection for small-animal (18)F-FDG PET. Cerebral K(i) varies inversely with blood glucose level, but the measured cerebral MRGlu does not correlate with blood glucose level or dietary condition. Conversely, the K(i) values of the myocardium and skeletal muscle are strongly dependent on dietary condition but not on blood glucose level. In tissue in which (18)F-FDG uptake declines with increasing blood glucose, correction for blood glucose level will make SUV a more robust outcome measure of MRGlu.

  6. Three-dimensional microCT imaging of murine embryonic development from immediate post-implantation to organogenesis: application for phenotyping analysis of early embryonic lethality in mutant animals.

    PubMed

    Ermakova, Olga; Orsini, Tiziana; Gambadoro, Alessia; Chiani, Francesco; Tocchini-Valentini, Glauco P

    2018-04-01

    In this work, we applied three-dimensional microCT imaging to study murine embryogenesis in the range from immediate post-implantation period (embryonic day 5.5) to mid-gestation (embryonic day 12.5) with the resolution up to 1.4 µm/voxel. Also, we introduce an imaging procedure for non-invasive volumetric estimation of an entire litter of embryos within the maternal uterine structures. This method allows for an accurate, detailed and systematic morphometric analysis of both embryonic and extra-embryonic components during embryogenesis. Three-dimensional imaging of unperturbed embryos was performed to visualize the egg cylinder, primitive streak, gastrulation and early organogenesis stages of murine development in the C57Bl6/N mouse reference strain. Further, we applied our microCT imaging protocol to determine the earliest point when embryonic development is arrested in a mouse line with knockout for tRNA splicing endonuclease subunit Tsen54 gene. Our analysis determined that the embryonic development in Tsen54 null embryos does not proceed beyond implantation. We demonstrated that application of microCT imaging to entire litter of non-perturbed embryos greatly facilitate studies to unravel gene function during early embryogenesis and to determine the precise point at which embryonic development is arrested in mutant animals. The described method is inexpensive, does not require lengthy embryos dissection and can be applicable for detailed analysis of mutant mice at laboratory scale as well as for high-throughput projects.

  7. Labeling transplanted mice islet with polyvinylpyrrolidone coated superparamagnetic iron oxide nanoparticles for in vivo detection by magnetic resonance imaging

    NASA Astrophysics Data System (ADS)

    Huang, Hai; Xie, Qiuping; Kang, Muxing; Zhang, Bo; Zhang, Hui; Chen, Jin; Zhai, Chuanxin; Yang, Deren; Jiang, Biao; Wu, Yulian

    2009-09-01

    Superparamagnetic iron oxide nanoparticles (SPIO) are emerging as a novel probe for noninvasive cell tracking with magnetic resonance imaging (MRI) and have potential wide usage in medical research. In this study, we have developed a method using high-temperature hydrolysis of chelate metal alkoxide complexes to synthesize polyvinylpyrrolidone coated iron oxide nanoparticles (PVP-SPIO), as a biocompatible magnetic agent that can efficiently label mice islet β-cells. The size, crystal structure and magnetic properties of the as-synthesized nanoparticles have been characterized. The newly synthesized PVP-SPIO with high stability, crystallinity and saturation magnetization can be efficiently internalized into β-cells, without affecting viability and function. The imaging of 100 PVP-SPIO-labeled mice islets in the syngeneic renal subcapsular model of transplantation under a clinical 3.0 T MR imager showed high spatial resolution in vivo. These results indicated the great potential application of the PVP-SPIO as an MRI contrast agent for monitoring transplanted islet grafts in the clinical management of diabetes in the near future.

  8. Diagnosing and Mapping Pulmonary Emphysema on X-Ray Projection Images: Incremental Value of Grating-Based X-Ray Dark-Field Imaging

    PubMed Central

    Meinel, Felix G.; Schwab, Felix; Schleede, Simone; Bech, Martin; Herzen, Julia; Achterhold, Klaus; Auweter, Sigrid; Bamberg, Fabian; Yildirim, Ali Ö.; Bohla, Alexander; Eickelberg, Oliver; Loewen, Rod; Gifford, Martin; Ruth, Ronald; Reiser, Maximilian F.; Pfeiffer, Franz; Nikolaou, Konstantin

    2013-01-01

    Purpose To assess whether grating-based X-ray dark-field imaging can increase the sensitivity of X-ray projection images in the diagnosis of pulmonary emphysema and allow for a more accurate assessment of emphysema distribution. Materials and Methods Lungs from three mice with pulmonary emphysema and three healthy mice were imaged ex vivo using a laser-driven compact synchrotron X-ray source. Median signal intensities of transmission (T), dark-field (V) and a combined parameter (normalized scatter) were compared between emphysema and control group. To determine the diagnostic value of each parameter in differentiating between healthy and emphysematous lung tissue, a receiver-operating-characteristic (ROC) curve analysis was performed both on a per-pixel and a per-individual basis. Parametric maps of emphysema distribution were generated using transmission, dark-field and normalized scatter signal and correlated with histopathology. Results Transmission values relative to water were higher for emphysematous lungs than for control lungs (1.11 vs. 1.06, p<0.001). There was no difference in median dark-field signal intensities between both groups (0.66 vs. 0.66). Median normalized scatter was significantly lower in the emphysematous lungs compared to controls (4.9 vs. 10.8, p<0.001), and was the best parameter for differentiation of healthy vs. emphysematous lung tissue. In a per-pixel analysis, the area under the ROC curve (AUC) for the normalized scatter value was significantly higher than for transmission (0.86 vs. 0.78, p<0.001) and dark-field value (0.86 vs. 0.52, p<0.001) alone. Normalized scatter showed very high sensitivity for a wide range of specificity values (94% sensitivity at 75% specificity). Using the normalized scatter signal to display the regional distribution of emphysema provides color-coded parametric maps, which show the best correlation with histopathology. Conclusion In a murine model, the complementary information provided by X-ray transmission and dark-field images adds incremental diagnostic value in detecting pulmonary emphysema and visualizing its regional distribution as compared to conventional X-ray projections. PMID:23555692

  9. Diagnosing and mapping pulmonary emphysema on X-ray projection images: incremental value of grating-based X-ray dark-field imaging.

    PubMed

    Meinel, Felix G; Schwab, Felix; Schleede, Simone; Bech, Martin; Herzen, Julia; Achterhold, Klaus; Auweter, Sigrid; Bamberg, Fabian; Yildirim, Ali Ö; Bohla, Alexander; Eickelberg, Oliver; Loewen, Rod; Gifford, Martin; Ruth, Ronald; Reiser, Maximilian F; Pfeiffer, Franz; Nikolaou, Konstantin

    2013-01-01

    To assess whether grating-based X-ray dark-field imaging can increase the sensitivity of X-ray projection images in the diagnosis of pulmonary emphysema and allow for a more accurate assessment of emphysema distribution. Lungs from three mice with pulmonary emphysema and three healthy mice were imaged ex vivo using a laser-driven compact synchrotron X-ray source. Median signal intensities of transmission (T), dark-field (V) and a combined parameter (normalized scatter) were compared between emphysema and control group. To determine the diagnostic value of each parameter in differentiating between healthy and emphysematous lung tissue, a receiver-operating-characteristic (ROC) curve analysis was performed both on a per-pixel and a per-individual basis. Parametric maps of emphysema distribution were generated using transmission, dark-field and normalized scatter signal and correlated with histopathology. Transmission values relative to water were higher for emphysematous lungs than for control lungs (1.11 vs. 1.06, p<0.001). There was no difference in median dark-field signal intensities between both groups (0.66 vs. 0.66). Median normalized scatter was significantly lower in the emphysematous lungs compared to controls (4.9 vs. 10.8, p<0.001), and was the best parameter for differentiation of healthy vs. emphysematous lung tissue. In a per-pixel analysis, the area under the ROC curve (AUC) for the normalized scatter value was significantly higher than for transmission (0.86 vs. 0.78, p<0.001) and dark-field value (0.86 vs. 0.52, p<0.001) alone. Normalized scatter showed very high sensitivity for a wide range of specificity values (94% sensitivity at 75% specificity). Using the normalized scatter signal to display the regional distribution of emphysema provides color-coded parametric maps, which show the best correlation with histopathology. In a murine model, the complementary information provided by X-ray transmission and dark-field images adds incremental diagnostic value in detecting pulmonary emphysema and visualizing its regional distribution as compared to conventional X-ray projections.

  10. Anti-tumor bioactivities of curcumin on mice loaded with gastric carcinoma.

    PubMed

    Wang, Xiao-Ping; Wang, Qiao-Xia; Lin, Huan-Ping; Chang, Na

    2017-09-20

    Curcumin, a derivative from the dried rhizome of curcuma longa, has been proven to possess anti-tumor effects. However, the detailed molecular mechanisms have not been fully elucidated. In this study, we aimed to explore the anti-tumor mechanisms of curcumin in treating gastric cancer. BALB/C mice grafted with a mouse gastric adenocarcinoma cell line (MFC) were used as the experimental model. Mice received different doses of curcumin after grafting. Tumor size was measured and tumor weight was determined after tumor inoculation. TUNEL assay and flow cytometric analysis were applied to evaluate the apoptosis of the cancer cells. Serum cytokines IFN-γ, TNF-α, granzyme B and perforin were detected by ELISA assay. The anti-tumor effect was determined using cytotoxic T-lymphocyte (CTL) assays and in vivo tumor prevention tests. The expression of DEC1, HIF-1α, STAT3 and VEGF in tumor tissues was examined by immunostaining and analyzed using an Image J analysis system. Compared with controls, tumor growth (size and weight) was significantly inhibited by curcumin treatment (P < 0.05). The apoptotic index in gastric cancer cells was significantly increased in the curcumin treatment group. Splenocyte cells from mice treated with curcumin exhibited higher cytolytic effects on MFC cancer cells than those from mice treated with saline (P < 0.01). The expression of DEC1, HIF-1α, STAT3 and VEGF in tumor tissues was down-regulated after curcumin treatment. Our results indicate that curcumin inhibits the proliferation of gastric carcinoma by inducing the apoptosis of tumor cells, activating immune cells to secrete a large amount of cytokines, and down-regulating the DEC1, HIF-1α, VEGF and STAT3 signal transduction pathways.

  11. Grating coupled SPR microarray analysis of proteins and cells in blood from mice with breast cancer.

    PubMed

    Mendoza, A; Torrisi, D M; Sell, S; Cady, N C; Lawrence, D A

    2016-01-21

    Biomarker discovery for early disease diagnosis is highly important. Of late, much effort has been made to analyze complex biological fluids in an effort to develop new markers specific for different cancer types. Recent advancements in label-free technologies such as surface plasmon resonance (SPR)-based biosensors have shown promise as a diagnostic tool since there is no need for labeling or separation of cells. Furthermore, SPR can provide rapid, real-time detection of antigens from biological samples since SPR is highly sensitive to changes in surface-associated molecular and cellular interactions. Herein, we report a lab-on-a-chip microarray biosensor that utilizes grating-coupled surface plasmon resonance (GCSPR) and grating-coupled surface plasmon coupled fluorescence (GCSPCF) imaging to detect circulating tumor cells (CTCs) from a mouse model (FVB-MMTV-PyVT). GCSPR and GCSPCF analysis was accomplished by spotting antibodies to surface cell markers, cytokines and stress proteins on a nanofabricated GCSPR microchip and screening blood samples from FVB control mice or FVB-MMTV-PyVT mice with developing mammary carcinomas. A transgenic MMTV-PyVT mouse derived cancer cell line was also analyzed. The analyses indicated that CD24, CD44, CD326, CD133 and CD49b were expressed in both cell lines and in blood from MMTV-PyVT mice. Furthermore, cytokines such as IL-6, IL-10 and TNF-α, along with heat shock proteins HSP60, HSP27, HSc70(HSP73), HSP90 total, HSP70/HSc70, HSP90, HSP70, HSP90 alpha, phosphotyrosine and HSF-1 were overexpressed in MMTV-PyVT mice.

  12. Targeting SRC Family Kinases and HSP90 in Lung Cancer

    DTIC Science & Technology

    2016-12-01

    inhalation of Adeno-Cre, followed by MRI imaging at regular intervals to detect tumor initiation and growth, followed by euthanasia and processing of...experimental endpoint. 10 mice were used per time point Representative MRI data describing tumor volume (TV) are shown in Figure 1. Quantification of data is...dasatinib, we were able to make several conclusions. Figure 1. Representative MRI images from Nedd9wt or Nedd9 null Kras mutant mice, treated with

  13. Cardiac MRI in mice at 9.4 Tesla with a transmit-receive surface coil and a cardiac-tailored intensity-correction algorithm.

    PubMed

    Sosnovik, David E; Dai, Guangping; Nahrendorf, Matthias; Rosen, Bruce R; Seethamraju, Ravi

    2007-08-01

    To evaluate the use of a transmit-receive surface (TRS) coil and a cardiac-tailored intensity-correction algorithm for cardiac MRI in mice at 9.4 Tesla (9.4T). Fast low-angle shot (FLASH) cines, with and without delays alternating with nutations for tailored excitation (DANTE) tagging, were acquired in 13 mice. An intensity-correction algorithm was developed to compensate for the sensitivity profile of the surface coil, and was tailored to account for the unique distribution of noise and flow artifacts in cardiac MR images. Image quality was extremely high and allowed fine structures such as trabeculations, valve cusps, and coronary arteries to be clearly visualized. The tag lines created with the surface coil were also sharp and clearly visible. Application of the intensity-correction algorithm improved signal intensity, tissue contrast, and image quality even further. Importantly, the cardiac-tailored properties of the correction algorithm prevented noise and flow artifacts from being significantly amplified. The feasibility and value of cardiac MRI in mice with a TRS coil has been demonstrated. In addition, a cardiac-tailored intensity-correction algorithm has been developed and shown to improve image quality even further. The use of these techniques could produce significant potential benefits over a broad range of scanners, coil configurations, and field strengths. (c) 2007 Wiley-Liss, Inc.

  14. Optical imaging of head and neck squamous cell carcinoma in vivo using arginine-glycine-aspartic acid peptide conjugated near-infrared quantum dots.

    PubMed

    Huang, Hao; Bai, Yun-Long; Yang, Kai; Tang, Hong; Wang, You-Wei

    2013-01-01

    Molecular imaging plays a key role in personalized medicine and tumor diagnosis. Quantum dots with near-infrared emission spectra demonstrate excellent tissue penetration and photostability, and have recently emerged as important tools for in vivo tumor imaging. Integrin αvβ3 has been shown to be highly and specifically expressed in endothelial cells of tumor angiogenic vessels in almost all types of tumors, and specifically binds to the peptide containing arginine-glycine-aspartic acid (RGD). In this study, we conjugated RGD with quantum dots with emission wavelength of 800 nm (QD800) to generate QD800-RGD, and used it via intravenous injection as a probe to image tumors in nude mice bearing head and neck squamous cell carcinoma (HNSCC). Twelve hours after the injection, the mice were still alive and were sacrificed to isolate tumors and ten major organs for ex vivo analysis to localize the probe in these tissues. The results showed that QD800-RGD was specifically targeted to integrin αvβ3 in vitro and in vivo, producing clear tumor fluorescence images after the intravenous injection. The tumor-to-background ratio and size of tumor image were highest within 6 hours of the injection and declined significantly at 9 hours after the injection, but there was still a clearly visible tumor image at 12 hours. The greatest amount of QD800-RGD was found in liver and spleen, followed by tumor and lung, and a weak fluorescence signal was seen in tibia. No detectable signal of QD800-RGD was found in brain, heart, kidney, testis, stomach, or intestine. Our study demonstrated that using integrin αvβ3 as target, it is possible to use intravenously injected QD800-RGD to generate high quality images of HNSCC, and the technique offers great potential in the diagnosis and personalized therapy for HNSCC.

  15. Multimodal molecular 3D imaging for the tumoral volumetric distribution assessment of folate-based biosensors.

    PubMed

    Ramírez-Nava, Gerardo J; Santos-Cuevas, Clara L; Chairez, Isaac; Aranda-Lara, Liliana

    2017-12-01

    The aim of this study was to characterize the in vivo volumetric distribution of three folate-based biosensors by different imaging modalities (X-ray, fluorescence, Cerenkov luminescence, and radioisotopic imaging) through the development of a tridimensional image reconstruction algorithm. The preclinical and multimodal Xtreme imaging system, with a Multimodal Animal Rotation System (MARS), was used to acquire bidimensional images, which were processed to obtain the tridimensional reconstruction. Images of mice at different times (biosensor distribution) were simultaneously obtained from the four imaging modalities. The filtered back projection and inverse Radon transformation were used as main image-processing techniques. The algorithm developed in Matlab was able to calculate the volumetric profiles of 99m Tc-Folate-Bombesin (radioisotopic image), 177 Lu-Folate-Bombesin (Cerenkov image), and FolateRSense™ 680 (fluorescence image) in tumors and kidneys of mice, and no significant differences were detected in the volumetric quantifications among measurement techniques. The imaging tridimensional reconstruction algorithm can be easily extrapolated to different 2D acquisition-type images. This characteristic flexibility of the algorithm developed in this study is a remarkable advantage in comparison to similar reconstruction methods.

  16. In vivo magnetic resonance imaging of atherosclerotic lesions with a newly developed Evans blue-DTPA-gadolinium contrast medium in apolipoprotein-E-deficient mice.

    PubMed

    Yasuda, Satoshi; Ikuta, Kenjiro; Uwatoku, Toyokazu; Oi, Keiji; Abe, Kohtaro; Hyodo, Fuminori; Yoshimitsu, Kengo; Sugimura, Kohtaro; Utsumi, Hideo; Katayama, Yoshiki; Shimokawa, Hiroaki

    2008-01-01

    Magnetic resonance imaging (MRI) contrast agents that specifically detect atherosclerotic plaque may be useful for the noninvasive detection of the plaque. We have recently developed a new contrast agent, Evans blue-DTPA-gadolinium (EB-DTPA-Gd), which selectively accumulates vascular lesions with endothelial removal. In this study, we examined whether EB-DTPA-Gd is also useful for in vivo imaging of atherosclerotic plaques. We used male apolipoprotein-E-deficient (ApoE-/-) mice of different ages (3, 6 and 12 months old) and age-matched male wild-type mice. After a single intravenous administration of EB-DTPA-Gd (160 microM/kg body weight), MRI T(1) signal was obtained in vivo. Increased signal intensity in the aortic wall was noted within 10-20 min after intravenous injection of EB-DTPA-Gd and was maintained for 30 min. The MRI enhancement in the aorta of ApoE-/- mice was increased in accordance with age, whereas no such enhancement was noted in wild-type mice. Histological examination demonstrated that there was a topological correlation between the site of MRI enhancement and that of atherosclerotic plaque. These results indicate that EB-DTPA-Gd is a useful MRI contrast medium for the in vivo detection of atherosclerotic plaques. Copyright (c) 2007 S. Karger AG, Basel.

  17. Comparative analysis of allyl isothiocyanate (AITC)-induced carbohydrate oxidation changes via TRPV1 between mice and chickens.

    PubMed

    Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji

    2017-01-01

    Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.

  18. In vivo imaging of the inflammatory receptor CD40 after cerebral ischemia using a fluorescent antibody.

    PubMed

    Klohs, Jan; Gräfe, Michael; Graf, Kristof; Steinbrink, Jens; Dietrich, Thore; Stibenz, Dietger; Bahmani, Peyman; Kronenberg, Golo; Harms, Christoph; Endres, Matthias; Lindauer, Ute; Greger, Klaus; Stelzer, Ernst H K; Dirnagl, Ulrich; Wunder, Andreas

    2008-10-01

    Brain inflammation is a hallmark of stroke, where it has been implicated in tissue damage as well as in repair. Imaging technologies that specifically visualize these processes are highly desirable. In this study, we explored whether the inflammatory receptor CD40 can be noninvasively and specifically visualized in mice after cerebral ischemia using a fluorescent monoclonal antibody, which we labeled with the near-infrared fluorescence dye Cy5.5 (Cy5.5-CD40MAb). Wild-type and CD40-deficient mice were subjected to transient middle cerebral artery occlusion. Mice were either intravenously injected with Cy5.5-CD40MAb or control Cy5.5-IgGMAb. Noninvasive and ex vivo near-infrared fluorescence imaging was performed after injection of the compounds. Probe distribution and specificity was further assessed with single-plane illumination microscopy, immunohistochemistry, and confocal microscopy. Significantly higher fluorescence intensities over the stroke-affected hemisphere, compared to the contralateral side, were only detected noninvasively in wild-type mice that received Cy5.5-CD40MAb, but not in CD40-deficient mice injected with Cy5.5-CD40MAb or in wild-type mice that were injected with Cy5.5-IgGMAb. Ex vivo near-infrared fluorescence showed an intense fluorescence within the ischemic territory only in wild-type mice injected with Cy5.5-CD40MAb. In the brains of these mice, single-plane illumination microscopy demonstrated vascular and parenchymal distribution, and confocal microscopy revealed a partial colocalization of parenchymal fluorescence from the injected Cy5.5-CD40MAb with activated microglia and blood-derived cells in the ischemic region. The study demonstrates that a CD40-targeted fluorescent antibody enables specific noninvasive detection of the inflammatory receptor CD40 after cerebral ischemia using optical techniques.

  19. Imaging Biomarker Dynamics in an Intracranial Murine Glioma Study of Radiation and Antiangiogenic Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chung, Caroline, E-mail: caroline.chung@rmp.uhn.on.ca; Jalali, Shahrzad; Foltz, Warren

    2013-03-01

    Purpose: There is a growing need for noninvasive biomarkers to guide individualized spatiotemporal delivery of radiation therapy (RT) and antiangiogenic (AA) therapy for brain tumors. This study explored early biomarkers of response to RT and the AA agent sunitinib (SU), in a murine intracranial glioma model, using serial magnetic resonance imaging (MRI). Methods and Materials: Mice with MRI-visible tumors were stratified by tumor size into 4 therapy arms: control, RT, SU, and SU plus RT (SURT). Single-fraction conformal RT was delivered using MRI and on-line cone beam computed tomography (CT) guidance. Serial MR images (T2-weighted, diffusion, dynamic contrast-enhanced and gadolinium-enhancedmore » T1-weighted scans) were acquired biweekly to evaluate tumor volume, apparent diffusion coefficient (ADC), and tumor perfusion and permeability responses (K{sub trans}, K{sub ep}). Results: Mice in all treatment arms survived longer than those in control, with a median survival of 35 days for SURT (P<.0001) and 30 days for RT (P=.009) and SU (P=.01) mice vs 26 days for control mice. At Day 3, ADC rise was greater with RT than without (P=.002). Sunitinib treatment reduced tumor perfusion/permeability values with mean K{sub trans} reduction of 27.6% for SU (P=.04) and 26.3% for SURT (P=.04) mice and mean K{sub ep} reduction of 38.1% for SU (P=.01) and 27.3% for SURT (P=.02) mice. The magnitude of individual mouse ADC responses at Days 3 and 7 correlated with subsequent tumor growth rate R values of −0.878 (P=.002) and −0.80 (P=.01), respectively. Conclusions: Early quantitative changes in diffusion and perfusion MRI measures reflect treatment responses soon after starting therapy and thereby raise the potential for these imaging biomarkers to guide adaptive and potentially individualized therapy approaches in the future.« less

  20. Longitudinal in vivo muscle function analysis of the DMSXL mouse model of myotonic dystrophy type 1.

    PubMed

    Decostre, Valérie; Vignaud, Alban; Matot, Béatrice; Huguet, Aline; Ledoux, Isabelle; Bertil, Emilie; Gjata, Bernard; Carlier, Pierre G; Gourdon, Geneviève; Hogrel, Jean-Yves

    2013-12-01

    Myotonic dystrophy is the most common adult muscle dystrophy. In view of emerging therapies, which use animal models as a proof of principle, the development of reliable outcome measures for in vivo longitudinal study of mouse skeletal muscle function is becoming crucial. To satisfy this need, we have developed a device to measure ankle dorsi- and plantarflexion torque in rodents. We present an in vivo 8-month longitudinal study of the contractile properties of the skeletal muscles of the DMSXL mouse model of myotonic dystrophy type 1. Between 4 and 12 months of age, we observed a reduction in muscle strength in the ankle dorsi- and plantarflexors of DMSXL compared to control mice although the strength per muscle cross-section was normal. Mild steady myotonia but no abnormal muscle fatigue was also observed in the DMSXL mice. Magnetic resonance imaging and histological analysis performed at the end of the study showed respectively reduced muscle cross-section area and smaller muscle fibre diameter in DMSXL mice. In conclusion, our study demonstrates the feasibility of carrying out longitudinal in vivo studies of muscle function over several months in a mouse model of myotonic dystrophy confirming the feasibility of this method to test preclinical therapeutics. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Matrix metalloproteinase inhibitor, doxycycline and progression of calcific aortic valve disease in hyperlipidemic mice.

    PubMed

    Jung, Jae-Joon; Razavian, Mahmoud; Kim, Hye-Yeong; Ye, Yunpeng; Golestani, Reza; Toczek, Jakub; Zhang, Jiasheng; Sadeghi, Mehran M

    2016-09-13

    Calcific aortic valve disease (CAVD) is the most common cause of aortic stenosis. Currently, there is no non-invasive medical therapy for CAVD. Matrix metalloproteinases (MMPs) are upregulated in CAVD and play a role in its pathogenesis. Here, we evaluated the effect of doxycycline, a nonselective MMP inhibitor on CAVD progression in the mouse. Apolipoprotein (apo)E(-/-) mice (n = 20) were fed a Western diet (WD) to induce CAVD. After 3 months, half of the animals was treated with doxycycline, while the others continued WD alone. After 6 months, we evaluated the effect of doxycycline on CAVD progression by echocardiography, MMP-targeted micro single photon emission computed tomography (SPECT)/computed tomography (CT), and tissue analysis. Despite therapeutic blood levels, doxycycline had no significant effect on MMP activation, aortic valve leaflet separation or flow velocity. This lack of effect on in vivo images was confirmed on tissue analysis which showed a similar level of aortic valve gelatinase activity, and inflammation between the two groups of animals. In conclusion, doxycycline (100 mg/kg/day) had no effect on CAVD progression in apoE(-/-) mice with early disease. Studies with more potent and specific inhibitors are needed to establish any potential role of MMP inhibition in CAVD development and progression.

  2. Evaluation of state-of-the-art imaging systems for in vivo monitoring of retinal structure in mice: current capabilities and limitations

    NASA Astrophysics Data System (ADS)

    Zhang, Pengfei; Zam, Azhar; Pugh, Edward N.; Zawadzki, Robert J.

    2014-02-01

    Animal models of human diseases play an important role in studying and advancing our understanding of these conditions, allowing molecular level studies of pathogenesis as well as testing of new therapies. Recently several non-invasive imaging modalities including Fundus Camera, Scanning Laser Ophthalmoscopy (SLO) and Optical Coherence Tomography (OCT) have been successfully applied to monitor changes in the retinas of the living animals in experiments in which a single animal is followed over a portion of its lifespan. Here we evaluate the capabilities and limitations of these three imaging modalities for visualization of specific structures in the mouse eye. Example images acquired from different types of mice are presented. Future directions of development for these instruments and potential advantages of multi-modal imaging systems are discussed as well.

  3. Sensitivity and accuracy of hybrid fluorescence-mediated tomography in deep tissue regions.

    PubMed

    Rosenhain, Stefanie; Al Rawashdeh, Wa'el; Kiessling, Fabian; Gremse, Felix

    2017-09-01

    Fluorescence-mediated tomography (FMT) enables noninvasive assessment of the three-dimensional distribution of near-infrared fluorescence in mice. The combination with micro-computed tomography (µCT) provides anatomical data, enabling improved fluorescence reconstruction and image analysis. The aim of our study was to assess sensitivity and accuracy of µCT-FMT under realistic in vivo conditions in deeply-seated regions. Accordingly, we acquired fluorescence reflectance images (FRI) and µCT-FMT scans of mice which were prepared with rectal insertions with different amounts of fluorescent dye. Default and high-sensitivity scans were acquired and background signal was analyzed for three FMT channels (670 nm, 745 nm, and 790 nm). Analysis was performed for the original and an improved FMT reconstruction using the µCT data. While FRI and the original FMT reconstruction could detect 100 pmol, the improved FMT reconstruction could detect 10 pmol and significantly improved signal localization. By using a finer sampling grid and increasing the exposure time, the sensitivity could be further improved to detect 0.5 pmol. Background signal was highest in the 670 nm channel and most prominent in the gastro-intestinal tract and in organs with high relative amounts of blood. In conclusion, we show that µCT-FMT allows sensitive and accurate assessment of fluorescence in deep tissue regions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Airway segmentation and analysis for the study of mouse models of lung disease using micro-CT

    NASA Astrophysics Data System (ADS)

    Artaechevarria, X.; Pérez-Martín, D.; Ceresa, M.; de Biurrun, G.; Blanco, D.; Montuenga, L. M.; van Ginneken, B.; Ortiz-de-Solorzano, C.; Muñoz-Barrutia, A.

    2009-11-01

    Animal models of lung disease are gaining importance in understanding the underlying mechanisms of diseases such as emphysema and lung cancer. Micro-CT allows in vivo imaging of these models, thus permitting the study of the progression of the disease or the effect of therapeutic drugs in longitudinal studies. Automated analysis of micro-CT images can be helpful to understand the physiology of diseased lungs, especially when combined with measurements of respiratory system input impedance. In this work, we present a fast and robust murine airway segmentation and reconstruction algorithm. The algorithm is based on a propagating fast marching wavefront that, as it grows, divides the tree into segments. We devised a number of specific rules to guarantee that the front propagates only inside the airways and to avoid leaking into the parenchyma. The algorithm was tested on normal mice, a mouse model of chronic inflammation and a mouse model of emphysema. A comparison with manual segmentations of two independent observers shows that the specificity and sensitivity values of our method are comparable to the inter-observer variability, and radius measurements of the mainstem bronchi reveal significant differences between healthy and diseased mice. Combining measurements of the automatically segmented airways with the parameters of the constant phase model provides extra information on how disease affects lung function.

  5. Non-invasive dynamic near-infrared imaging and quantification of vascular leakage in vivo.

    PubMed

    Proulx, Steven T; Luciani, Paola; Alitalo, Annamari; Mumprecht, Viviane; Christiansen, Ailsa J; Huggenberger, Reto; Leroux, Jean-Christophe; Detmar, Michael

    2013-07-01

    Preclinical vascular research has been hindered by a lack of methods that can sensitively image and quantify vascular perfusion and leakage in vivo. In this study, we have developed dynamic near-infrared imaging methods to repeatedly visualize and quantify vascular leakage in mouse skin in vivo, and we have applied these methods to transgenic mice with overexpression of vascular endothelial growth factors VEGF-A or -C. Near-infrared dye conjugates were developed to identify a suitable vascular tracer that had a prolonged circulation lifetime and slow leakage into normal tissue after intravenous injection. Dynamic simultaneous imaging of ear skin and a large blood vessel in the leg enabled determination of the intravascular signal (blood volume fraction) from the tissue signal shortly after injection and quantifications of vascular leakage into the extravascular tissue over time. This method allowed for the sensitive detection of increased blood vascularity and leakage rates in K14-VEGF-A transgenic mice and also reliably measured inflammation-induced changes of vascularity and leakage over time in the same mice. Measurements after injection of recombinant VEGF-A surprisingly revealed increased blood vascular leakage and lymphatic clearance in K14-VEGF-C transgenic mice which have an expanded cutaneous lymphatic vessel network, potentially indicating unanticipated effects of lymphatic drainage on vascular leakage. Increased vascular leakage was also detected in subcutaneous tumors, confirming that the method can also be applied to deeper tissues. This new imaging method might facilitate longitudinal investigations of the in vivo effects of drug candidates, including angiogenesis inhibitors, in preclinical disease models.

  6. Non-invasive dynamic near-infrared imaging and quantification of vascular leakage in vivo

    PubMed Central

    Proulx, Steven T.; Luciani, Paola; Alitalo, Annamari; Mumprecht, Viviane; Christiansen, Ailsa J.; Huggenberger, Reto

    2013-01-01

    Preclinical vascular research has been hindered by a lack of methods that can sensitively image and quantify vascular perfusion and leakage in vivo. In this study, we have developed dynamic near-infrared imaging methods to repeatedly visualize and quantify vascular leakage in mouse skin in vivo, and we have applied these methods to transgenic mice with overexpression of vascular endothelial growth factors VEGF-A or -C. Near-infrared dye conjugates were developed to identify a suitable vascular tracer that had a prolonged circulation lifetime and slow leakage into normal tissue after intravenous injection. Dynamic simultaneous imaging of ear skin and a large blood vessel in the leg enabled determination of the intravascular signal (blood volume fraction) from the tissue signal shortly after injection and quantifications of vascular leakage into the extravascular tissue over time. This method allowed for the sensitive detection of increased blood vascularity and leakage rates in K14-VEGF-A transgenic mice and also reliably measured inflammation-induced changes of vascularity and leakage over time in the same mice. Measurements after injection of recombinant VEGF-A surprisingly revealed increased blood vascular leakage and lymphatic clearance in K14-VEGF-C transgenic mice which have an expanded cutaneous lymphatic vessel network, potentially indicating unanticipated effects of lymphatic drainage on vascular leakage. Increased vascular leakage was also detected in subcutaneous tumors, confirming that the method can also be applied to deeper tissues. This new imaging method might facilitate longitudinal investigations of the in vivo effects of drug candidates, including angiogenesis inhibitors, in preclinical disease models. PMID:23325334

  7. Nuclear imaging of iodine uptake in mouse tissues

    NASA Astrophysics Data System (ADS)

    Hammond, W. T.; Bradley, E. L.; Qian, J.; Majewski, S.

    2005-04-01

    We have designed and employed a compact gamma camera based on pixellated scintillators and position-sensitive photomultipliers to obtain in vivo images in mice of biological substances tagged with 125-I. Biomedical imaging studies make use of radioactive isotopes of iodine. In these applications, protection of the thyroid from the effects of the radioactive material can be important. We have studied in vivo the effectiveness in mice of pre-administration of KI in various concentrations to evaluate both the biologically effective doses for thyroid protection and the potential for use in general sodium iodide symporter studies. These findings have important implications for both intentional and accidental exposure to radioiodine.

  8. Regional registration of [6-14C]glucose metabolism during brain activation of α-syntrophin knockout mice

    PubMed Central

    Cruz, Nancy F.; Ball, Kelly K.; Froehner, Stanley C.; Adams, Marvin E.; Dienel, Gerald A.

    2013-01-01

    α-Syntrophin is a component of the dystrophin scaffold-protein complex that serves as an adaptor for recruitment of key proteins to the cytoplasmic side of plasma membranes. α-Syntrophin knockout (KO) causes loss of the polarized localization of aquaporin4 (AQP4) at astrocytic endfeet and interferes with water and K+ homeostasis. During brain activation, release of ions and metabolites from endfeet is anticipated to increase perivascular fluid osmolarity, AQP4-mediated osmotic water flow from endfeet, and metabolite washout from brain. This study tests the hypothesis that reduced levels of endfoot AQP4 increase retention of [14C]metabolites during sensory stimulation. Conscious KO and wildtype mice were pulse-labeled with [6-14C]glucose during unilateral acoustic stimulation or bilateral acoustic plus whisker stimulation, and label retention was assayed by computer-assisted brain imaging or analysis of [14C]metabolites in extracts, respectively. High-resolution autoradiographic assays detected a 17% side-to-side difference (P<0.05) in inferior colliculus of KO mice, not wildtype mice. However, there were no labeling differences between KO and wildtype mice for five major HPLC fractions from four dissected regions, presumably due to insufficient anatomical resolution. The results suggest a role for AQP4-mediated water flow in support of washout of metabolites, and underscore the need for greater understanding of astrocytic water and metabolite fluxes. PMID:23346911

  9. In vivo axonal transport deficits in a mouse model of fronto-temporal dementia.

    PubMed

    Majid, Tabassum; Ali, Yousuf O; Venkitaramani, Deepa V; Jang, Ming-Kuei; Lu, Hui-Chen; Pautler, Robia G

    2014-01-01

    Axonal transport is vital for neurons and deficits in this process have been previously reported in a few mouse models of Alzheimer's disease prior to the appearance of plaques and tangles. However, it remains to be determined whether axonal transport is defective prior to the onset of neurodegeneration. The rTg4510 mouse, a fronto-temporal dementia and parkinsonism-17 (FTDP-17) tauopathy model, over-express tau-P301L mutation found in familial forms of FTDP-17, in the forebrain driven by the calcium-calmodulin kinase II promoter. This mouse model exhibits tau pathology, neurodegeneration in the forebrain, and associated behavioral deficits beginning at 4-5 months of age. rTg4510 transgenic mice were used in these studies. Mice were given 2 μL of MnCl2 in each nostril 1 h prior to Magnetic Resonance Imaging (MRI). Following MnCl2 nasal lavage, mice were imaged using Manganese enhanced Magnetic Resonance Imaging (MEMRI) Protocol with TE = 8.5 ms, TR = 504 ms, FOV = 3.0 cm, matrix size = 128 × 128 × 128, number of cycles = 15 with each cycle taking approximately 2 min, 9 s, and 24 ms using Paravision software (BrukerBioSpin, Billerica, MA). During imaging, body temperature was maintained at 37.0 °C using an animal heating system (SA Instruments, Stony Brook, NY). Resulting images were analyzed using Paravision software. Regions of interest (ROI) within the olfactory neuronal layer (ONL) and the water phantom consisting of one pixel (ONL) and 9 pixels (water) were selected and copied across each of the 15 cycles. Signal intensities (SI) of ONL and water phantom ROIs were measured. SI values obtained for ONL were then normalized the water phantom SI values. The correlation between normalized signal intensity in the ONL and time were assessed using Prism (GraphPad Software, San Diego, CA). Using the MEMRI technique on 1.5, 3, 5, and 10-month old rTg4510 mice and littermate controls, we found significant axonal transport deficits present in the rTg4510 mice beginning at 3 months of age in an age-dependent manner. Using linear regression analysis, we measured rates of axonal transport at 1.5, 3, 5, and 10 months of age in rTg4510 and WT mice. Axonal transport rates were observed in rTg4510 mice at 48% of WT levels at 3 months, 40% of WT levels at 5 months, and 30% of WT levels at 10 months of age. In order to determine the point at which tau appears in the cortex, we probed for phosphorylated tau levels, and found that pSer262 is present at 3 months of age, not earlier at 1.5 months of age, but observed no pathological tau species until 6 months of age, months after the onset of the transport deficits. In addition, we saw localization of tau in the ONL at 6 months of age. In our study, we identified the presence of age-dependent axonal transport deficits beginning at 3 months of age in rTg4510 mice. We correlated these deficits at 3 months to the presence of hyperphosphorylated tau in the brain and the presence within the olfactory epithelium. We observed tau pathology not only in the soma of these neurons but also within the axons and processes of these neurons. Our characterization of axonal transport in this tauopathy model provides a functional time point that can be used for future therapeutic interventions.

  10. Coordinated Activation of VEGF/VEGFR-2 and PPARδ Pathways by a Multi-Component Chinese Medicine DHI Accelerated Recovery from Peripheral Arterial Disease in Type 2 Diabetic Mice

    PubMed Central

    He, Shuang; Zhao, Tiechan; Guo, Hao; Meng, Yanzhi; Qin, Gangjian; Goukassian, David A.; Han, Jihong; Gao, Xuimei; Zhu, Yan

    2016-01-01

    Diabetic mellitus (DM) patients are at an increased risk of developing peripheral arterial disease (PAD). Danhong injection (DHI) is a Chinese patent medicine widely used for several cardiovascular indications but the mechanism of action is not well-understood. We investigated the therapeutic potential of DHI on experimental PAD in mice with chemically induced as well as genetic (KKAy) type 2 DM and the overlapping signaling pathways regulating both therapeutic angiogenesis and glucose homeostasis. Compared with normal genetic background wild type (WT) mice, both DM mice showed impaired perfusion recovery in hind-limb ischemia (HLI) model. DHI treatment significantly accelerated perfusion recovery, lowered blood glucose and improved glucose tolerance in both DM models. Bioluminescent imaging demonstrated a continuous ischemia-induced vascular endothelial growth factor receptor 2 (VEGFR-2) gene expressions with a peak time coincident with the maximal DHI stimulation. Flow cytometry analysis showed a DHI-mediated increase in endothelial progenitor cell (EPC) mobilization from bone marrow to circulating peripheral blood. DHI administration upregulated the expression of vascular endothelial growth factor A (VEGF-A) and VEGF receptor-2 (VEGFR-2) in ischemic muscle. A cross talk between ischemia-induced angiogenesis and glucose tolerance pathways was analyzed by Ingenuity Pathway Analysis (IPA) which suggested an interaction of VEGF-A/VEGFR-2 and peroxisome proliferator-activated receptor δ (PPARδ)/peroxisome proliferator-activated receptor γ (PPARγ) genes. We confirmed that upregulation of VEGF-A/VEGFR-2 by DHI promoted PPARδ gene expression in both type 2 diabetic mice. Our findings demonstrated that a multi-component Chinese medicine DHI effectively increased blood flow recovery after tissue ischemia in diabetic mice by promoting angiogenesis and improving glucose tolerance through a concomitant activation of VEGF-A/VEGFR-2 and PPARδ signaling pathways. PMID:27930695

  11. Coordinated Activation of VEGF/VEGFR-2 and PPARδ Pathways by a Multi-Component Chinese Medicine DHI Accelerated Recovery from Peripheral Arterial Disease in Type 2 Diabetic Mice.

    PubMed

    He, Shuang; Zhao, Tiechan; Guo, Hao; Meng, Yanzhi; Qin, Gangjian; Goukassian, David A; Han, Jihong; Gao, Xuimei; Zhu, Yan

    2016-01-01

    Diabetic mellitus (DM) patients are at an increased risk of developing peripheral arterial disease (PAD). Danhong injection (DHI) is a Chinese patent medicine widely used for several cardiovascular indications but the mechanism of action is not well-understood. We investigated the therapeutic potential of DHI on experimental PAD in mice with chemically induced as well as genetic (KKAy) type 2 DM and the overlapping signaling pathways regulating both therapeutic angiogenesis and glucose homeostasis. Compared with normal genetic background wild type (WT) mice, both DM mice showed impaired perfusion recovery in hind-limb ischemia (HLI) model. DHI treatment significantly accelerated perfusion recovery, lowered blood glucose and improved glucose tolerance in both DM models. Bioluminescent imaging demonstrated a continuous ischemia-induced vascular endothelial growth factor receptor 2 (VEGFR-2) gene expressions with a peak time coincident with the maximal DHI stimulation. Flow cytometry analysis showed a DHI-mediated increase in endothelial progenitor cell (EPC) mobilization from bone marrow to circulating peripheral blood. DHI administration upregulated the expression of vascular endothelial growth factor A (VEGF-A) and VEGF receptor-2 (VEGFR-2) in ischemic muscle. A cross talk between ischemia-induced angiogenesis and glucose tolerance pathways was analyzed by Ingenuity Pathway Analysis (IPA) which suggested an interaction of VEGF-A/VEGFR-2 and peroxisome proliferator-activated receptor δ (PPARδ)/peroxisome proliferator-activated receptor γ (PPARγ) genes. We confirmed that upregulation of VEGF-A/VEGFR-2 by DHI promoted PPARδ gene expression in both type 2 diabetic mice. Our findings demonstrated that a multi-component Chinese medicine DHI effectively increased blood flow recovery after tissue ischemia in diabetic mice by promoting angiogenesis and improving glucose tolerance through a concomitant activation of VEGF-A/VEGFR-2 and PPARδ signaling pathways.

  12. Studies of copper trafficking in a mouse model of Alzheimer's disease by positron emission tomography: comparison of 64Cu acetate and 64CuGTSM.

    PubMed

    Andreozzi, Erica M; Torres, Julia Baguña; Sunassee, Kavitha; Dunn, Joel; Walker-Samuel, Simon; Szanda, Istvan; Blower, Philip J

    2017-11-15

    Alzheimer's disease can involve brain copper dyshomeostasis. We aimed to determine the effect of AD-like pathology on 64 Cu trafficking in mice, using positron emission tomography (PET imaging), during 24 hours after intravenous administration of ionic 64 Cu (Cu(ii) acetate) and 64 Cu-GTSM (GTSMH 2 = glyoxalbis(thiosemicarbazone)). Copper trafficking was evaluated in 6-8-month-old and 13-15 month-old TASTPM transgenic and wild-type mice, by imaging 0-30 min and 24-25 h after intravenous administration of 64 Cu tracer. Regional 64 Cu distribution in brains was compared by ex vivo autoradiography to that of amyloid-β plaque. 64 Cu-acetate showed uptake in, and excretion through, liver and kidneys. There was minimal uptake in other tissues by 30 minutes, and little further change after 24 h. Radioactivity within brain was focussed in and around the ventricles and was significantly greater in younger mice. 64 CuGTSM was taken up in all tissues by 30 min, remaining high in brain but clearing substantially from other tissues by 24 h. Distribution in brain was not localised to specific regions. TASTPM mice showed no major changes in global or regional 64 Cu brain uptake compared to wildtype after administration of 64 Cu acetate (unlike 64 Cu-GTSM) but efflux of 64 Cu from brain by 24 h was slightly greater in 6-8 month-old TASTPM mice than in wildtype controls. Changes in copper trafficking associated with Alzheimer's-like pathology after administration of ionic 64 Cu are minor compared to those observed after administration of 64 Cu-GTSM. PET imaging with 64 Cu could help understand changes in brain copper dynamics in AD and underpin new clinical diagnostic imaging methods.

  13. Synthesis and evaluation of novel radioiodinated nicotinamides for malignant melanoma.

    PubMed

    Liu, Xiang; Pham, Tien Q; Berghofer, Paula; Chapman, Janette; Greguric, Ivan; Mitchell, Peter; Mattner, Filomena; Loc'h, Christian; Katsifis, Andrew

    2008-10-01

    A series of iodonicotinamides based on the melanin-binding iodobenzamide compound N-2-diethylaminoethyl-4-iodobenzamide was prepared and evaluated for the potential imaging and staging of disseminated metastatic melanoma. [(123)I]Iodonicotinamides were prepared by iododestannylation reactions using no-carrier-added iodine-123 and evaluated in vivo by biodistribution and competition studies and by single photon emission computed tomography (SPECT) imaging in black and albino nude mice bearing B16F0 murine melanotic and A375 human amelanotic melanoma tumours, respectively. The iodonicotinamides displayed low-affinity binding for sigma(1)-sigma(2) receptors (K(i)>300 nM). In biodistribution studies in mice, N-(2-(diethylamino)ethyl)-5-[(123)I]iodonicotinamide ([(123)I]1) exhibited the fastest and highest uptake of the nicotinamide series in the B16F0 tumour at 1 h ( approximately 8% ID/g), decreasing slowly over time. No uptake was observed in the A375 tumour. Clearance from the animals by urinary excretion was more rapid for N-alkyl-nicotinamides than for piperazinyl derivatives. At 1 h postinjection, the urinary excretion was 66% ID for [(123)I]1, while the gastrointestinal tract amounted to 17% ID. Haloperidol was unable to reduce the uptake of [(123)I]1 in pigmented mice, indicating that this uptake was likely due to an interaction with melanin. SPECT imaging of [(123)I]1 in black mice bearing the B16F0 melanoma indicated that the radioactivity was predominately located in the tumour and eyes. No specific localisation was observed in nude mice bearing A375 amelanotic tumours. These findings suggest that [(123)I]1, which displays high tumour uptake with rapid clearance from the body, could be a promising imaging agent for the detection of melanotic tumours.

  14. Improved diagnosis of pulmonary emphysema using in vivo dark-field radiography.

    PubMed

    Meinel, Felix G; Yaroshenko, Andre; Hellbach, Katharina; Bech, Martin; Müller, Mark; Velroyen, Astrid; Bamberg, Fabian; Eickelberg, Oliver; Nikolaou, Konstantin; Reiser, Maximilian F; Pfeiffer, Franz; Yildirim, Ali Ö

    2014-10-01

    The purpose of this study was to assess whether the recently developed method of grating-based x-ray dark-field radiography can improve the diagnosis of pulmonary emphysema in vivo. Pulmonary emphysema was induced in female C57BL/6N mice using endotracheal instillation of porcine pancreatic elastase and confirmed by in vivo pulmonary function tests, histopathology, and quantitative morphometry. The mice were anesthetized but breathing freely during imaging. Experiments were performed using a prototype small-animal x-ray dark-field scanner that was operated at 35 kilovolt (peak) with an exposure time of 5 seconds for each of the 10 grating steps. Images were compared visually. For quantitative comparison of signal characteristics, regions of interest were placed in the upper, middle, and lower zones of each lung. Receiver-operating-characteristic statistics were performed to compare the effectiveness of transmission and dark-field signal intensities and the combined parameter "normalized scatter" to differentiate between healthy and emphysematous lungs. A clear visual difference between healthy and emphysematous mice was found for the dark-field images. Quantitative measurements of x-ray dark-field signal and normalized scatter were significantly different between the mice with pulmonary emphysema and the control mice and showed good agreement with pulmonary function tests and quantitative histology. The normalized scatter showed a significantly higher discriminatory power (area under the receiver-operating-characteristic curve [AUC], 0.99) than dark-field (AUC, 0.90; P = 0.01) or transmission signal (AUC, 0.69; P < 0.001) alone did, allowing for an excellent discrimination of healthy and emphysematous lung regions. In a murine model, x-ray dark-field radiography is technically feasible in vivo and represents a substantial improvement over conventional transmission-based x-ray imaging for the diagnosis of pulmonary emphysema.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCarroll, R; Rubinstein, A; Kingsley, C

    Purpose: New small-animal irradiators include extremely precise IGRT capabilities. However, mouse immobilization and localization remains a challenge. In particular, unlike week-to-week translational displacements, rotational changes in positioning are not easily corrected for in subject setup. Using two methods of setup, we aim to quantify week-to-week rotational variation in mice for the purpose of IGRT planning in small animal studies. Methods: Ten mice were imaged weekly using breath-hold CBCT (X-RAD 225 Cx), with the mouse positioned in a half-pipe support, providing 40 scans. A second group of two mice were positioned in a 3D printed immobilization device, which was created usingmore » a CT from a similarly shaped mouse, providing 10 scans. For each mouse, the first image was taken to be the reference image. Subsequent CT images were then rigidly registered, based on bony anatomy. Rotations in the axial (roll), sagittal (pitch), and coronal (yaw) planes were recorded and used to quantify variation in angular setup. Results: For the mice imaged in the half pipe, average magnitude of roll was found to be 5.4±4.6° (range: −12.9:18.86°), of pitch 1.6±1.3° (range: −1.4:4.7°), and of yaw 1.9±1.5° (range −5.4:1.1°). For the mice imaged in the printed setup; average magnitude of roll was found to be 0.64±0.6° (range: −2.1:1.0°), of pitch 0.6±0.4° (range: 0.0:1.3°), and of yaw 0.2±0.1° (range: 0.0:0.4°). The printed setup provided reduction in roll, pitch, and yaw by 88, 62, and 90 percent, respectively. Conclusion: For the typical setup routine, roll in mouse position is the dominant source of rotational variation. However, when a printed device was used, drastic improvements in mouse immobilization were seen. This work provides a promising foundation for mouse immobilization, required for full scale small animal IGRT. Currently, we are making improvements to allo±w the use of a similar system for MR, PET, and bioluminescence.« less

  16. The use of fractography to supplement analysis of bone mechanical properties in different strains of mice.

    PubMed

    Wise, L M; Wang, Z; Grynpas, M D

    2007-10-01

    Fractography has not been fully developed as a useful technique in assessing failure mechanisms of bone. While fracture surfaces of osteonal bone have been explored, this may not apply to conventional mechanical testing of mouse bone. Thus, the focus of this work was to develop and evaluate the efficacy of a fractography protocol for use in supplementing the interpretation of failure mechanisms in mouse bone. Micro-computed tomography and three-point bending were performed on femora of two groups of 6-month-old mice (C57BL/6 and a mixed strain background of 129SV/C57BL6). SEM images of fracture surfaces were collected, and areas of "tension", "compression" and "transition" were identified. Percent areas of roughness were identified and estimated within areas of "tension" and "compression" and subsequently compared to surface roughness measurements generated from an optical profiler. Porosity parameters were determined on the tensile side. Linear regression analysis was performed to evaluate correlations between certain parameters. Results show that 129 mice exhibit significantly increased bone mineral density (BMD), number of "large" pores, failure strength, elastic modulus and energy to failure compared to B6 mice (p<0.001). Both 129 and B6 mice exhibit significantly (p<0.01) more percent areas of tension (49+/-1%, 42+/-2%; respectively) compared to compression (26+/-2%, 31+/-1%; respectively). In terms of "roughness", B6 mice exhibit significantly less "rough" areas (30+/-4%) compared to "smooth" areas (70+/-4%) on the tensile side only (p<0.001). Qualitatively, 129 mice demonstrate more evidence of bone toughening through fiber bridging and loosely connected fiber bundles. The number of large pores is positively correlated with failure strength (p=0.004), elastic modulus (p=0.002) and energy to failure (p=0.041). Percent area of tensile surfaces is positively correlated with failure strength (p<0.001), elastic modulus (p=0.016) and BMD (p=0.037). Percent area of rough compressive surfaces is positively correlated with energy to failure (p=0.039). Evaluation of fracture surfaces has helped to explain why 129 mice have increased mechanical properties compared to B6 mice, namely via toughening mechanisms on the compressive side of failure. Several correlations exist between fractography parameters and mechanical behavior, supporting the utility of fractography with skeletal mouse models.

  17. Imaging B Cells in a Mouse Model of Multiple Sclerosis Using 64Cu-Rituximab PET.

    PubMed

    James, Michelle L; Hoehne, Aileen; Mayer, Aaron T; Lechtenberg, Kendra; Moreno, Monica; Gowrishankar, Gayatri; Ilovich, Ohad; Natarajan, Arutselvan; Johnson, Emily M; Nguyen, Joujou; Quach, Lisa; Han, May; Buckwalter, Marion; Chandra, Sudeep; Gambhir, Sanjiv S

    2017-11-01

    B lymphocytes are a key pathologic feature of multiple sclerosis (MS) and are becoming an important therapeutic target for this condition. Currently, there is no approved technique to noninvasively visualize B cells in the central nervous system (CNS) to monitor MS disease progression and response to therapies. Here, we evaluated 64 Cu-rituximab, a radiolabeled antibody specifically targeting the human B cell marker CD20, for its ability to image B cells in a mouse model of MS using PET. Methods: To model CNS infiltration by B cells, experimental autoimmune encephalomyelitis (EAE) was induced in transgenic mice that express human CD20 on B cells. EAE mice were given subcutaneous injections of myelin oligodendrocyte glycoprotein fragment 1-125 emulsified in complete Freund adjuvant. Control mice received complete Freund adjuvant alone. PET imaging of EAE and control mice was performed 1, 4, and 19 h after 64 Cu-rituximab administration. Mice were perfused and sacrificed after the final PET scan, and radioactivity in dissected tissues was measured with a γ-counter. CNS tissues from these mice were immunostained to quantify B cells or were further analyzed via digital autoradiography. Results: Lumbar spinal cord PET signal was significantly higher in EAE mice than in controls at all evaluated time points (e.g., 1 h after injection: 5.44 ± 0.37 vs. 3.33 ± 0.20 percentage injected dose [%ID]/g, P < 0.05). 64 Cu-rituximab PET signal in brain regions ranged between 1.74 ± 0.11 and 2.93 ± 0.15 %ID/g for EAE mice, compared with 1.25 ± 0.08 and 2.24 ± 0.11 %ID/g for controls ( P < 0.05 for all regions except striatum and thalamus at 1 h after injection). Similarly, ex vivo biodistribution results revealed notably higher 64 Cu-rituximab uptake in the brain and spinal cord of huCD20tg EAE, and B220 immunostaining verified that increased 64 Cu-rituximab uptake in CNS tissues corresponded with elevated B cells. Conclusion: B cells can be detected in the CNS of EAE mice using 64 Cu-rituximab PET. Results from these studies warrant further investigation of 64 Cu-rituximab in EAE models and consideration of use in MS patients to evaluate its potential for detecting and monitoring B cells in the progression and treatment of this disease. These results represent an initial step toward generating a platform to evaluate B cell-targeted therapeutics en route to the clinic. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  18. Monitoring tumor metastases and osteolytic lesions with bioluminescence and micro CT imaging.

    PubMed

    Lim, Ed; Modi, Kshitij; Christensen, Anna; Meganck, Jeff; Oldfield, Stephen; Zhang, Ning

    2011-04-14

    Following intracardiac delivery of MDA-MB-231-luc-D3H2LN cells to Nu/Nu mice, systemic metastases developed in the injected animals. Bioluminescence imaging using IVIS Spectrum was employed to monitor the distribution and development of the tumor cells following the delivery procedure including DLIT reconstruction to measure the tumor signal and its location. Development of metastatic lesions to the bone tissues triggers osteolytic activity and lesions to tibia and femur were evaluated longitudinally using micro CT. Imaging was performed using a Quantum FX micro CT system with fast imaging and low X-ray dose. The low radiation dose allows multiple imaging sessions to be performed with a cumulative X-ray dosage far below LD50. A mouse imaging shuttle device was used to sequentially image the mice with both IVIS Spectrum and Quantum FX achieving accurate animal positioning in both the bioluminescence and CT images. The optical and CT data sets were co-registered in 3-dimentions using the Living Image 4.1 software. This multi-mode approach allows close monitoring of tumor growth and development simultaneously with osteolytic activity.

  19. 64Cu-PSMA-617: A novel PSMA-targeted radio-tracer for PET imaging in gastric adenocarcinoma xenografted mice model.

    PubMed

    Han, Xue-Di; Liu, Chen; Liu, Fei; Xie, Qing-Hua; Liu, Te-Li; Guo, Xiao-Yi; Xu, Xiao-Xia; Yang, Xing; Zhu, Hua; Yang, Zhi

    2017-09-26

    Here, we report that it's feasible for imaging gastric adenocarcinoma mice model with prostate-specific membrane antigen (PSMA) targeting imaging agents, which could potentially provide an alternate and readily translational tool for managing gastric adenocarcinoma. DKFZ-PSMA-617, a PSMA targeting ligand reported recently, was chosen to be radio-labeled with nuclide 64 Cu. 64 Cu-PSMA-617 was radio-synthesized in high radio-chemical yield and specific activity up to 19.3 GBq/µmol. It showed good stability in vitro . The specificity of 64 Cu-PSMA-617 was confirmed by cell uptake experiments in PSMA (+) LNCaP cell and PSMA (-) PC-3 and gastric adenocarcinoma BGC-823 cells. Micro-PET imaging in BGC-823 and PC-3 xenografts nude mice was evaluated ( n = 4). And the tumors were visualized and better tumor-to-background achieved till 24 h. Co-administration of N- [[[(1S)-1-Carboxy-3-methylbutyl]amino]-carbonyl]-L-glutamic acid (ZJ-43) can substantially block the uptake in those tumors. Dissected tumor tissues were analyzed by auto-radiography and immunohistochemistry, and these results confirmed the PSMA expression in neo-vasculature which explained the target molecular imaging of 64 Cu-PSMA-617. All those results suggested 64 Cu-PSMA-617 may serve as a novel radio-tracer for tumor imaging more than prostate cancer.

  20. 64Cu-PSMA-617: A novel PSMA-targeted radio-tracer for PET imaging in gastric adenocarcinoma xenografted mice model

    PubMed Central

    Han, Xue-Di; Liu, Chen; Liu, Fei; Xie, Qing-Hua; Liu, Te-Li; Guo, Xiao-Yi; Xu, Xiao-Xia; Yang, Xing; Zhu, Hua; Yang, Zhi

    2017-01-01

    Here, we report that it’s feasible for imaging gastric adenocarcinoma mice model with prostate-specific membrane antigen (PSMA) targeting imaging agents, which could potentially provide an alternate and readily translational tool for managing gastric adenocarcinoma. DKFZ-PSMA-617, a PSMA targeting ligand reported recently, was chosen to be radio-labeled with nuclide 64Cu. 64Cu-PSMA-617 was radio-synthesized in high radio-chemical yield and specific activity up to 19.3 GBq/µmol. It showed good stability in vitro. The specificity of 64Cu-PSMA-617 was confirmed by cell uptake experiments in PSMA (+) LNCaP cell and PSMA (-) PC-3 and gastric adenocarcinoma BGC-823 cells. Micro-PET imaging in BGC-823 and PC-3 xenografts nude mice was evaluated (n = 4). And the tumors were visualized and better tumor-to-background achieved till 24 h. Co-administration of N- [[[(1S)-1-Carboxy-3-methylbutyl]amino]-carbonyl]-L-glutamic acid (ZJ-43) can substantially block the uptake in those tumors. Dissected tumor tissues were analyzed by auto-radiography and immunohistochemistry, and these results confirmed the PSMA expression in neo-vasculature which explained the target molecular imaging of 64Cu-PSMA-617. All those results suggested 64Cu-PSMA-617 may serve as a novel radio-tracer for tumor imaging more than prostate cancer. PMID:29088775

  1. Single-wall carbon nanohorns inhibited activation of microglia induced by lipopolysaccharide through blocking of Sirt3

    NASA Astrophysics Data System (ADS)

    Li, Lihong; Zhang, Jinqian; Yang, Yang; Wang, Qiang; Gao, Li; Yang, Yanlong; Chang, Tao; Zhang, Xingye; Xiang, Guoan; Cao, Yongmei; Shi, Zujin; Zhao, Ming; Gao, Guodong

    2013-02-01

    Single-wall carbon nanohorns (SWNHs) have been demonstrated to accumulate in cytotoxic levels within organs of various animal models and cell types, which emerge as a wide range of promising biomedical imaging. Septic encephalopathy (SE) is an early sign of sepsis and associated with an increased rate of morbidity and mortality. Microglia activation plays an important role in neuroinflammation, which contributes to neuronal damage. Inhibition of microglia activation may have therapeutic benefits, which can alleviate the progression of neurodegeneration. Therefore, we investigated the functional changes of mice microglia cell lines pre-treated with or without lipopolysaccharide (LPS) induced by SWNHs. To address this question, the research about direct role of SWNHs on the growth, proliferation, and apoptosis of microglia cell lines in mice (N9 and BV2) pre-treated with or without LPS had been performed. Our results indicate that the particle diameter of SWNHs in water is between 342 to 712 nm. The images in scanning electron microscope showed that SWNHs on polystyrene surface are individual particles. LPS induced activation of mice microglia, promoted its growth and proliferation, and inhibited its apoptosis. SWNHs inhibited proliferation, delayed mitotic entry, and promoted apoptosis of mice microglia cells. The effects followed gradually increasing cultured time and concentrations of SWNHs, especially in cells pre-treated with LPS. SWNHs induced a significantly increase in G1 phase and inhibition of S phase of mice microglia cells in a dose-manner dependent of SWNHs, especially in cells pre-treated with LPS. The transmission electron microscope images showed that individual spherical SWNH particles smaller than 100 nm in diameters were localized inside lysosomes of mice microglia cells. SWNHs inhibited mitotic entry, growth and proliferation of mice microglia cells, and promoted its apoptosis, especially in cells pre-treated with LPS. SWNHs inhibited expression of Sirt3 and energy metabolism related with Sirt3 in mice microglia cells in a dose-dependent manner, especially in cells pre-treated with LPS. The role of SWNHs on mice microglia was implicating Sirt3 and energy metabolism associated with it.

  2. Intravital multiphoton fluorescence imaging and optical manipulation of spinal cord in mice, using a compact fiber laser system.

    PubMed

    Oshima, Yusuke; Horiuch, Hideki; Honkura, Naoki; Hikita, Atsuhiko; Ogata, Tadanori; Miura, Hiromasa; Imamura, Takeshi

    2014-09-01

    Near-infrared ultrafast lasers are widely used for multiphoton excited fluorescence microscopy in living animals. Ti:Sapphire lasers are typically used for multiphoton excitation, but their emission wavelength is restricted below 1,000 nm. The aim of this study is to evaluate the performance of a compact Ytterbium-(Yb-) fiber laser at 1,045 nm for multiphoton excited fluorescence microscopy in spinal cord injury. In this study, we employed a custom-designed microscopy system with a compact Yb-fiber laser and evaluated the performance of this system in in vivo imaging of brain cortex and spinal cord in YFP-H transgenic mice. For in vivo imaging of brain cortex, sharp images of basal dendrites, and pyramidal cells expressing EYFP were successfully captured using the Yb-fiber laser in our microscopy system. We also performed in vivo imaging of axon fibers of spinal cord in the transgenic mice. The obtained images were almost as sharp as those obtained using a conventional ultrafast laser system. In addition, laser ablation and multi-color imaging could be performed simultaneously using the Yb-fiber laser. The high-peak pulse Yb-fiber laser is potentially useful for multimodal bioimaging methods based on a multiphoton excited fluorescence microscopy system that incorporates laser ablation techniques. Our results suggest that microscopy systems of this type could be utilized in studies of neuroscience and clinical use in diagnostics and therapeutic tool for spinal cord injury in the future. © 2014 Wiley Periodicals, Inc.

  3. Nanoparticle encapsulation in red blood cells enables blood-pool magnetic particle imaging hours after injection

    NASA Astrophysics Data System (ADS)

    Rahmer, J.; Antonelli, A.; Sfara, C.; Tiemann, B.; Gleich, B.; Magnani, M.; Weizenecker, J.; Borgert, J.

    2013-06-01

    Magnetic particle imaging (MPI) is a new medical imaging approach that is based on the nonlinear magnetization response of super-paramagnetic iron oxide nanoparticles (SPIOs) injected into the blood stream. To date, real-time MPI of the bolus passage of an approved MRI SPIO contrast agent injected into the tail vein of living mice has been demonstrated. However, nanoparticles are rapidly removed from the blood stream by the mononuclear phagocyte system. Therefore, imaging applications for long-term monitoring require the repeated administration of bolus injections, which complicates quantitative comparisons due to the temporal variations in concentration. Encapsulation of SPIOs into red blood cells (RBCs) has been suggested to increase the blood circulation time of nanoparticles. This work presents first evidence that SPIO-loaded RBCs can be imaged in the blood pool of mice several hours after injection using MPI. This finding is supported by magnetic particle spectroscopy performed to quantify the iron concentration in blood samples extracted from the mice 3 and 24 h after injection of SPIO-loaded RBCs. Based on these results, new MPI applications can be envisioned, such as permanent 3D real-time visualization of the vessel tree during interventional procedures, bleeding monitoring after stroke, or long-term monitoring and treatment control of cardiovascular diseases.

  4. Integrin-Targeted Hybrid Fluorescence Molecular Tomography/X-ray Computed Tomography for Imaging Tumor Progression and Early Response in Non-Small Cell Lung Cancer.

    PubMed

    Ma, Xiaopeng; Phi Van, Valerie; Kimm, Melanie A; Prakash, Jaya; Kessler, Horst; Kosanke, Katja; Feuchtinger, Annette; Aichler, Michaela; Gupta, Aayush; Rummeny, Ernst J; Eisenblätter, Michel; Siveke, Jens; Walch, Axel K; Braren, Rickmer; Ntziachristos, Vasilis; Wildgruber, Moritz

    2017-01-01

    Integrins play an important role in tumor progression, invasion and metastasis. Therefore we aimed to evaluate a preclinical imaging approach applying ανβ3 integrin targeted hybrid Fluorescence Molecular Tomography/X-ray Computed Tomography (FMT-XCT) for monitoring tumor progression as well as early therapy response in a syngeneic murine Non-Small Cell Lung Cancer (NSCLC) model. Lewis Lung Carcinomas were grown orthotopically in C57BL/6 J mice and imaged in-vivo using a ανβ3 targeted near-infrared fluorescence (NIRF) probe. ανβ3-targeted FMT-XCT was able to track tumor progression. Cilengitide was able to substantially block the binding of the NIRF probe and suppress the imaging signal. Additionally mice were treated with an established chemotherapy regimen of Cisplatin and Bevacizumab or with a novel MEK inhibitor (Refametinib) for 2 weeks. While μCT revealed only a moderate slowdown of tumor growth, ανβ3 dependent signal decreased significantly compared to non-treated mice already at one week post treatment. ανβ3 targeted imaging might therefore become a promising tool for assessment of early therapy response in the future. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Synthesis and evaluation of (99m)Tc chelate-conjugated bevacizumab.

    PubMed

    Camacho, Ximena; García, María Fernanda; Calzada, Victoria; Fernández, Marcelo; Porcal, Williams; Alonso, Omar; Gambini, Juan Pablo; Cabral, Pablo

    2013-03-01

    Vascular endothelial growth factor (VEGF) is one of the classic factors involved in tumor-induced angiognesis in several solid tumors. Bevacizumab, a monoclonal antibody against VEGF, can be used as an imaging tool in preclinical studies. The aim of this study was to radiolabel Bevacizumab with (99m)Tc and to evaluate in vivo its imaging properties in an adenocarcinoma animal model. For this purpose, Bevacizumab was derivatized with Suc-HYNIC as a bifunctional coupling agent. A mixture of Tricine/SnCl(2).2H(2)O was added to Bevacizumab-HYNIC and radiolabeled with (99m)TcO(4)(-). The radiochemical stability of the radiolabeled antibody was assessed. Biodistribution and scintigraphy imaging were performed in normal CD1 female mice and in spontaneous adenocarcinoma tumor bearing CD1 mice (n = 5). We demonstrated that 99mTc-HYNIC-Bevacizumab was stable. In vivo biodistribution studies revealed that tumor uptake of (99m)Tc-HYNIC-Bevacizumab was 1.37 ± 0.51% and 5.33 ± 2.13% at 4 and 24 h postinjection, respectively. Scintigraphy image studies showed tumor selective uptake of (99m)Tc-HYNIC-Bevacizumab in the tumor-bearing mice. We conclude that (99m)Tc-HYNIC-Bevacizumb has the potential to be used as a tracer for tumor imaging in preclinical studies.

  6. T Cells Prevent Hemorrhagic Transformation in Ischemic Stroke by P-Selectin Binding.

    PubMed

    Salas-Perdomo, Angélica; Miró-Mur, Francesc; Urra, Xabier; Justicia, Carles; Gallizioli, Mattia; Zhao, Yashu; Brait, Vanessa H; Laredo, Carlos; Tudela, Raúl; Hidalgo, Andrés; Chamorro, Ángel; Planas, Anna M

    2018-06-14

    Hemorrhagic transformation is a serious complication of ischemic stroke after recanalization therapies. This study aims to identify mechanisms underlying hemorrhagic transformation after cerebral ischemia/reperfusion. We used wild-type mice and Selplg -/- and Fut7 -/- mice defective in P-selectin binding and lymphopenic Rag2 -/- mice. We induced 30-minute or 45-minute ischemia by intraluminal occlusion of the middle cerebral artery and assessed hemorrhagic transformation at 48 hours with a hemorrhage grading score, histological means, brain hemoglobin content, or magnetic resonance imaging. We depleted platelets and adoptively transferred T cells of the different genotypes to lymphopenic mice. Interactions of T cells with platelets in blood were studied by flow cytometry and image stream technology. We show that platelet depletion increased the bleeding risk only after large infarcts. Lymphopenia predisposed to hemorrhagic transformation after severe stroke, and adoptive transfer of T cells prevented hemorrhagic transformation in lymphopenic mice. CD4 + memory T cells were the subset of T cells binding P-selectin and platelets through functional P-selectin glycoprotein ligand-1. Mice defective in P-selectin binding had a higher hemorrhagic score than wild-type mice. Adoptive transfer of T cells defective in P-selectin binding into lymphopenic mice did not prevent hemorrhagic transformation. The study identifies lymphopenia as a previously unrecognized risk factor for secondary hemorrhagic transformation in mice after severe ischemic stroke. T cells prevent hemorrhagic transformation by their capacity to bind platelets through P-selectin. The results highlight the role of T cells in bridging immunity and hemostasis in ischemic stroke. © 2018 American Heart Association, Inc.

  7. Single photon emission computed tomography imaging for temporal dynamics of thyroidal and salivary radionuclide accumulation in 17-allyamino-17-demothoxygeldanamycin-treated thyroid cancer mouse model

    PubMed Central

    Liu, Yu-Yu; Brandt, Michael P; Shen, Daniel H; Kloos, Richard T; Zhang, Xiaoli; Jhiang, Sissy M

    2014-01-01

    Selective iodide uptake and prolonged iodine retention in the thyroid is the basis for targeted radioiodine therapy for thyroid cancer patients; however, salivary gland dysfunction is the most frequent nonthyroidal complications. In this study, we have used noninvasive single photon emission computed tomography functional imaging to quantify the temporal dynamics of thyroidal and salivary radioiodine accumulation in mice. At 60 min post radionuclide injection, radionuclide accumulation in the salivary gland was generally higher than that in thyroid due to much larger volume of the salivary gland. However, radionuclide accumulation per anatomic unit in the salivary gland was lower than that in thyroid and was comparable among mice of different age and gender. Differently, radionuclide accumulation per anatomic unit in thyroid varied greatly among mice. The extent of thyroidal radioiodine accumulation stimulated by a single dose of exogenous bovine TSH (bTSH) in triiodothyronine (T3)-supplemented mice was much less than that in mice received neither bTSH nor T3 (nontreated mice), suggesting that the duration of elevated serum TSH level is important to maximize thyroidal radioiodine accumulation. Furthermore, the extent and duration of radioiodine accumulation stimulated by bTSH was less in the thyroids of the thyroid-targeted RET/PTC1 (thyroglobulin (Tg)-PTC1) mice bearing thyroid tumors compared with the thyroids in wild-type (WT) mice. Finally, the effect of 17-allyamino-17-demothoxygeldanamycin on increasing thyroidal, but not salivary, radioiodine accumulation was validated in both WT mice and Tg-PTC1 preclinical thyroid cancer mouse model. PMID:20943721

  8. Preclinical imaging characteristics and quantification of Platinum-195m SPECT.

    PubMed

    Aalbersberg, E A; de Wit-van der Veen, B J; Zwaagstra, O; Codée-van der Schilden, K; Vegt, E; Vogel, Wouter V

    2017-08-01

    In vivo biodistribution imaging of platinum-based compounds may allow better patient selection for treatment with chemo(radio)therapy. Radiolabeling with Platinum-195m ( 195m Pt) allows SPECT imaging, without altering the chemical structure or biological activity of the compound. We have assessed the feasibility of 195m Pt SPECT imaging in mice, with the aim to determine the image quality and accuracy of quantification for current preclinical imaging equipment. Enriched (>96%) 194 Pt was irradiated in the High Flux Reactor (HFR) in Petten, The Netherlands (NRG). A 0.05 M HCl 195m Pt-solution with a specific activity of 33 MBq/mg was obtained. Image quality was assessed for the NanoSPECT/CT (Bioscan Inc., Washington DC, USA) and U-SPECT + /CT (MILabs BV, Utrecht, the Netherlands) scanners. A radioactivity-filled rod phantom (rod diameter 0.85-1.7 mm) filled with 1 MBq 195m Pt was scanned with different acquisition durations (10-120 min). Four healthy mice were injected intravenously with 3-4 MBq 195m Pt. Mouse images were acquired with the NanoSPECT for 120 min at 0, 2, 4, or 24 h after injection. Organs were delineated to quantify 195m Pt concentrations. Immediately after scanning, the mice were sacrificed, and the platinum concentration was determined in organs using a gamma counter and graphite furnace - atomic absorption spectroscopy (GF-AAS) as reference standards. A 30-min acquisition of the phantom provided visually adequate image quality for both scanners. The smallest visible rods were 0.95 mm in diameter on the NanoSPECT and 0.85 mm in diameter on the U-SPECT + . The image quality in mice was visually adequate. Uptake was seen in the kidneys with excretion to the bladder, and in the liver, blood, and intestine. No uptake was seen in the brain. The Spearman correlation between SPECT and gamma counter was 0.92, between SPECT and GF-AAS it was 0.84, and between GF-AAS and gamma counter it was0.97 (all p < 0.0001). Preclinical 195m Pt SPECT is feasible with acceptable tracer doses and acquisition times, and provides good image quality and accurate signal quantification.

  9. Evaluation of green pepper (Capsicum annuum L.) juice on the weight gain and changes in lipid profile in C57BL/6 mice fed a high-fat diet.

    PubMed

    Kim, Na-Hyung; Park, Seong Hoon

    2015-01-01

    Capsicum pepper (green pepper, Capsicum annuum L.), a natural product available in many countries, is considered to be a food additive, with healthful or medical applications. The aim of this study was to evaluate green pepper juice for its potential to reduce weight gain and to determine its effects on lipid profiles in C57BL/6 mice fed a high-fat diet. Mice given a high-fat diet with green pepper juice gained significantly less weight and showed a significant decrease in serum triglycerides, total cholesterol, low density lipoproteins, and alanine aminotransferase compared to mice given only a high-fat diet (P < 0.05). Systolic and diastolic blood pressure, heart rate, and blood glucose levels (determined by using the intraperitoneal glucose tolerance test) in mice administered green pepper juice were similar to those in mice in the control group. In addition, abdominal fat volume (subcutaneous and visceral), which was quantified by using 4.7 T magnetic resonance imaging, including multi-slice spin-echo T2-weighted images, in mice administered a high-fat diet with green pepper juice tended to decrease compared to the fat volume of mice administered only a high-fat diet. These results suggest that green pepper juice, as a drink, may possibly be helpful in reducing weight gain by regulating the levels of serum lipids. © 2014 Society of Chemical Industry.

  10. Micro-computed Tomography Provides High Accuracy Congenital Heart Disease Diagnosis in Neonatal and Fetal Mice

    PubMed Central

    Kim, Andrew J.; Francis, Richard; Liu, Xiaoqin; Devine, William A.; Ramirez, Ricardo; Anderton, Shane J.; Wong, Li Yin; Faruque, Fahim; Gabriel, George C.; Leatherbury, Linda; Tobita, Kimimasa; Lo, Cecilia W.

    2013-01-01

    Background Mice are well suited for modeling human congenital heart defects (CHD), given their four-chamber cardiac anatomy. However, mice with CHD invariably die prenatally/neonatally, causing CHD phenotypes to be missed. Therefore, we investigated the efficacy of noninvasive micro-computed tomography (micro-CT) to screen for CHD in stillborn/fetal mice. These studies were carried out using chemically mutagenized mice expected to be enriched for birth defects including CHD. Methods and Results Stillborn/fetal mice obtained from the breeding of N-ethyl-N-nitrosourea (ENU) mutagenized mice were formalin-fixed and stained with iodine, then micro-CT scanned. Those diagnosed with CHD and some CHD-negative pups were necropsied. A subset of these were further analyzed by histopathology to confirm the CHD/no-CHD diagnosis. Micro-CT scanning of 2105 fetal/newborn mice revealed an abundance of ventricular septal defects (VSD) (n=307). Overall, we observed an accuracy of 89.8% for VSD diagnosis. Outflow tract anomalies identified by micro-CT included double outlet right ventricle (n=36), transposition of the great arteries (n=14), and persistent truncus arteriosus (n=3). These were diagnosed with a 97.4% accuracy. Aortic arch anomalies also were readily detected with an overall 99.6% accuracy. This included right aortic arch (n=28) and coarctation/interrupted aortic arch (n=12). Also detected by micro-CT were atrioventricular septal defects (n=22), tricuspid hypoplasia/atresia (n=13), and coronary artery fistulas (n=16). They yielded accuracies of 98.9%, 100%, and 97.8% respectively. Conclusions Contrast enhanced micro-CT imaging in neonatal/fetal mice can reliably detect a wide spectrum of CHD. We conclude micro-CT imaging can be used for routine rapid assessments of structural heart defects in fetal/newborn mice. PMID:23759365

  11. Dynamic subcellular imaging of cancer cell mitosis in the brain of live mice.

    PubMed

    Momiyama, Masashi; Suetsugu, Atsushi; Kimura, Hiroaki; Chishima, Takashi; Bouvet, Michael; Endo, Itaru; Hoffman, Robert M

    2013-04-01

    The ability to visualize cancer cell mitosis and apoptosis in the brain in real time would be of great utility in testing novel therapies. In order to achieve this goal, the cancer cells were labeled with green fluorescent protein (GFP) in the nucleus and red fluorescent protein (RFP) in the cytoplasm, such that mitosis and apoptosis could be clearly imaged. A craniotomy open window was made in athymic nude mice for real-time fluorescence imaging of implanted cancer cells growing in the brain. The craniotomy window was reversibly closed with a skin flap. Mitosis of the individual cancer cells were imaged dynamically in real time through the craniotomy-open window. This model can be used to evaluate brain metastasis and brain cancer at the subcellular level.

  12. Selective Breeding and Short-Term Access to a Running Wheel Alter Stride Characteristics in House Mice.

    PubMed

    Claghorn, Gerald C; Thompson, Zoe; Kay, Jarren C; Ordonez, Genesis; Hampton, Thomas G; Garland, Theodore

    Postural and kinematic aspects of running may have evolved to support high runner (HR) mice to run approximately threefold farther than control mice. Mice from four replicate HR lines selectively bred for high levels of voluntary wheel running show many differences in locomotor behavior and morphology as compared with four nonselected control (C) lines. We hypothesized that HR mice would show stride alterations that have coadapted with locomotor behavior, morphology, and physiology. More specifically, we predicted that HR mice would have stride characteristics that differed from those of C mice in ways that parallel some of the adaptations seen in highly cursorial animals. For example, we predicted that limbs of HR mice would swing closer to the parasagittal plane, resulting in a two-dimensional measurement of narrowed stance width. We also expected that some differences between HR and C mice might be amplified by 6 d of wheel access, as is used to select breeders each generation. We used the DigiGait Imaging System (Mouse Specifics) to capture high-speed videos in ventral view as mice ran on a motorized treadmill across a range of speeds and then to automatically calculate several aspects of strides. Young adults of both sexes were tested both before and after 6 d of wheel access. Stride length, stride frequency, stance width, stance time, brake time, propel time, swing time, duty factor, and paw contact area were analyzed using a nested analysis of covariance, with body mass as a covariate. As expected, body mass and treadmill speed affected nearly every analyzed metric. Six days of wheel access also affected nearly every measure, indicating pervasive training effects, in both HR and C mice. As predicted, stance width was significantly narrower in HR than C mice. Paw contact area and duty factor were significantly greater in minimuscle individuals (subset of HR mice with 50%-reduced hind limb muscle mass) than in normal-muscled HR or C mice. We conclude that stride characteristics of house mice are adaptable in response to both selective breeding and changes in daily locomotor behavior (activity levels) that occur during as few as 6 d. These results have important implications for understanding the evolution and coadaptation of locomotor behavior and performance.

  13. Visualization of chorioretinal vasculature in mice in vivo using a combined OCT/SLO imaging system

    NASA Astrophysics Data System (ADS)

    Goswami, Mayank; Zhang, Pengfei; Pugh, Edward N.; Zawadzki, Robert J.

    2016-03-01

    Chorioretinal blood vessel morphology in mice is of great interest to researchers studying eye disease mechanisms in animal models. Two leading retinal imaging modalities -- Optical Coherence Tomography (OCT) and Scanning Laser Ophthalmoscopy (SLO) -- have offered much insight into vascular morphology and blood flow. OCT "flow-contrast" methods have provided detailed mapping of vascular morphology with micrometer depth resolution, while OCT Doppler methods have enabled the measurement of local flow velocities. SLO remains indispensable in studying blood leakage, microaneurysms, and the clearance time of contrast agents of different sizes. In this manuscript we present results obtained with a custom OCT/SLO system applied to visualize the chorioretinal vascular morphology of pigmented C57Bl/6J and albino nude (Nu/Nu) mice. Blood perfusion maps of choroidal vessels and choricapillaris created by OCT and SLO are presented, along with detailed evaluation of different OCT imaging parameters, including the use of the scattering contrast agent Intralipid. Future applications are discussed.

  14. In vivo optical imaging of dihydroethidium oxidation in the mouse brain employing fluorescence intensity and lifetime contrast

    NASA Astrophysics Data System (ADS)

    Hall, David J.; Han, Sung-Ho; Dugan, Laura

    2009-02-01

    Reactive oxygen species (ROS) are believed to be involved in many diseases and injuries to the brain, but the molecular processes are not well understood due to a lack of in vivo imaging techniques to evaluate ROS. The fluorescent oxidation products of dihydroethidium (DHE) can monitor ROS production in vivo. Here we demonstrate the novel optical imaging of brain in live mice to measure ROS production via generation of fluorescent DHE oxidation products (ox-DHE) by ROS. We show that in Sod2+/- mice, which have partial loss of a key antioxidant enzyme, superoxide dismutase-2, that ox-DHE fluorescence intensity was significantly higher than in hSOD1 mice, which have four-fold overexpression of superoxide dismutase-1 activity, which had almost no ox-DHE fluorescence, confirming specificity of ox-DHE to ROS production. The DHE oxidation products were also confirmed by detecting a characteristic fluorescence lifetime of the oxidation product, which was validated with ex vivo measurements.

  15. Effect of disease progression on liver apparent diffusion coefficient values in a murine model of NASH at 11.7 Tesla MRI.

    PubMed

    Anderson, Stephan W; Soto, Jorge A; Milch, Holly N; Ozonoff, Al; O'Brien, Michael; Hamilton, James A; Jara, Hernan J

    2011-04-01

    To evaluate the apparent diffusion coefficient (ADC) values of liver in a murine model of non-alcoholic steatohepatitis using 11.7 Tesla (T) MRI. This animal study was IACUC approved. Seventeen male C57BL/6 mice were divided into control (n = 3) and experimental groups (n = 14) fed a methionine-deficient choline-deficient (MCD) diet to induce steatohepatitis. Livers underwent ex vivo diffusion-weighted MR imaging and ADC maps were calculated. A pathologist determined subjective scores of steatosis, classified from 0 to 3. Digital image analysis was used to determine percentage areas of steatosis. Graphs comparing ADC to subjective and digital image analysis (DIA) determinations of steatosis were plotted. Subjective assessments of steatosis ranged up to values of 3 and DIA determined areas of steatosis to range up to approximately 16%. ADC values approximated 800 × 10(-6) mm(2) /s (range, 749-811 × 10(-6) mm(2) /s, mean 786 × 10(-6) mm(2) /s) in controls and 500 × 10(-6) mm(2) /s (range, 478-733 × 10(-6) mm(2) /s, mean 625 × 10(-6) mm(2) /s) in experimental mice. Moderate correlation between ADC and subjective scores of steatosis (R = -0.56) was observed. Strong correlation between ADC values and percentage areas of steatosis was between ADC values and percentage areas of steatosis was observed greater (R = -0.81) and very strong correlation was observed with the exclusion of a single outlying data point (R = -0.91). Based on the comparison of ADC values and steatosis determinations by DIA, increasing degrees of steatosis are seen to result in decreased hepatic ADC values. Copyright © 2011 Wiley-Liss, Inc.

  16. Photodynamic therapy using nanoparticle loaded with indocyanine green for experimental peritoneal dissemination of gastric cancer

    PubMed Central

    Tsujimoto, Hironori; Morimoto, Yuji; Takahata, Risa; Nomura, Shinsuke; Yoshida, Kazumichi; Horiguchi, Hiroyuki; Hiraki, Shuichi; Ono, Satoshi; Miyazaki, Hiromi; Saito, Daizo; Hara, Isao; Ozeki, Eiichi; Yamamoto, Junji; Hase, Kazuo

    2014-01-01

    Although there have been multiple advances in the development of novel anticancer agents and operative procedures, prognosis of patients with advanced gastric cancer remains poor, especially in patients with peritoneal metastasis. In this study, we established nanoparticles loaded with indocyanine green (ICG) derivatives: ICG loaded lactosomes (ICGm) and investigated the diagnostic and therapeutic value of photodynamic therapy (PDT) using ICGm for experimental peritoneal dissemination of gastric cancer. Experimental peritoneal disseminated xenografts of human gastric cancer were established in nude mice. Three weeks after intraperitoneal injection of the cancer cells, either ICGm (ICGm-treated mice) or ICG solution (ICG-treated mice) was injected through the tail vein. Forty-eight hours after injection of the photosensitizer, in vivo and ex vivo imaging was carried out. For PDT, 48 h after injection of the photosensitizer, other mice were irradiated through the abdominal wall, and the body weight and survival rate were monitored. In vivo imaging revealed that peritoneal tumors were visualized through the abdominal wall in ICGm-treated mice, whereas only non-specific fluorescence was observed in ICG-treated mice. The PDT reduced the total weight of the disseminated nodules and significantly improved weight loss and survival rate in ICGm-treated mice. In conclusion, ICGm can be used as a novel diagnostic and therapeutic nanodevice in peritoneal dissemination of gastric cancer. PMID:25287817

  17. In vivo PET imaging of beta-amyloid deposition in mouse models of Alzheimer's disease with a high specific activity PET imaging agent [(18)F]flutemetamol.

    PubMed

    Snellman, Anniina; Rokka, Johanna; López-Picón, Francisco R; Eskola, Olli; Salmona, Mario; Forloni, Gianluigi; Scheinin, Mika; Solin, Olof; Rinne, Juha O; Haaparanta-Solin, Merja

    2014-01-01

    The purpose of the study was to evaluate the applicability of (18) F-labelled amyloid imaging positron emission tomography (PET) agent [ (18) F]flutemetamol to detect changes in brain beta-amyloid (Aβ) deposition in vivo in APP23, Tg2576 and APPswe-PS1dE9 mouse models of Alzheimer's disease. We expected that the high specific activity of [ (18) F]flutemetamol would make it an attractive small animal Aβ imaging agent. [ (18) F]flutemetamol uptake in the mouse brain was evaluated in vivo at 9 to 22 months of age with an Inveon Multimodality PET/CT camera (Siemens Medical Solutions USA, Knoxville, TN, USA). Retention in the frontal cortex (FC) was evaluated by Logan distribution volume ratios (DVR) and FC/cerebellum (CB) ratios during the late washout phase (50 to 60 min). [ (18) F]flutemetamol binding to Aβ was also evaluated in brain slices by in vitro and ex vivo autoradiography. The amount of Aβ in the brain slices was determined with Thioflavin S and anti-Aβ1-40 immunohistochemistry. In APP23 mice, [ (18) F]flutemetamol retention in the FC increased from 9 to 18 months. In younger mice, DVR and FC/CB50-60 were 0.88 (0.81) and 0.88 (0.89) at 9 months (N = 2), and 0.98 (0.93) at 12 months (N = 1), respectively. In older mice, DVR and FC/CB50-60 were 1.16 (1.15) at 15 months (N = 1), 1.13 (1.16) and 1.35 (1.35) at 18 months (N = 2), and 1.05 (1.31) at 21 months (N = 1). In Tg2576 mice, DVR and FC/CB50-60 showed modest increasing trends but also high variability. In APPswe-PS1dE9 mice, DVR and FC/CB50-60 did not increase with age. Thioflavin S and anti-Aβ1-40 positive Aβ deposits were present in all transgenic mice at 19 to 22 months, and they co-localized with [ (18) F]flutemetamol binding in the brain slices examined with in vitro and ex vivo autoradiography. Increased [ (18) F]flutemetamol retention in the brain was detected in old APP23 mice in vivo. However, the high specific activity of [ (18) F]flutemetamol did not provide a notable advantage in Tg2576 and APPswe-PS1dE9 mice compared to the previously evaluated structural analogue [(11)C]PIB. For its practical benefits, [ (18) F]flutemetamol imaging with a suitable mouse model like APP23 is an attractive alternative.

  18. In vivo PET imaging of beta-amyloid deposition in mouse models of Alzheimer's disease with a high specific activity PET imaging agent [18F]flutemetamol

    PubMed Central

    2014-01-01

    Background The purpose of the study was to evaluate the applicability of 18F-labelled amyloid imaging positron emission tomography (PET) agent [18F]flutemetamol to detect changes in brain beta-amyloid (Aβ) deposition in vivo in APP23, Tg2576 and APPswe-PS1dE9 mouse models of Alzheimer's disease. We expected that the high specific activity of [18F]flutemetamol would make it an attractive small animal Aβ imaging agent. Methods [18F]flutemetamol uptake in the mouse brain was evaluated in vivo at 9 to 22 months of age with an Inveon Multimodality PET/CT camera (Siemens Medical Solutions USA, Knoxville, TN, USA). Retention in the frontal cortex (FC) was evaluated by Logan distribution volume ratios (DVR) and FC/cerebellum (CB) ratios during the late washout phase (50 to 60 min). [18F]flutemetamol binding to Aβ was also evaluated in brain slices by in vitro and ex vivo autoradiography. The amount of Aβ in the brain slices was determined with Thioflavin S and anti-Aβ1−40 immunohistochemistry. Results In APP23 mice, [18F]flutemetamol retention in the FC increased from 9 to 18 months. In younger mice, DVR and FC/CB50-60 were 0.88 (0.81) and 0.88 (0.89) at 9 months (N = 2), and 0.98 (0.93) at 12 months (N = 1), respectively. In older mice, DVR and FC/CB50-60 were 1.16 (1.15) at 15 months (N = 1), 1.13 (1.16) and 1.35 (1.35) at 18 months (N = 2), and 1.05 (1.31) at 21 months (N = 1). In Tg2576 mice, DVR and FC/CB50-60 showed modest increasing trends but also high variability. In APPswe-PS1dE9 mice, DVR and FC/CB50-60 did not increase with age. Thioflavin S and anti-Aβ1−40 positive Aβ deposits were present in all transgenic mice at 19 to 22 months, and they co-localized with [18F]flutemetamol binding in the brain slices examined with in vitro and ex vivo autoradiography. Conclusions Increased [18F]flutemetamol retention in the brain was detected in old APP23 mice in vivo. However, the high specific activity of [18F]flutemetamol did not provide a notable advantage in Tg2576 and APPswe-PS1dE9 mice compared to the previously evaluated structural analogue [11C]PIB. For its practical benefits, [18F]flutemetamol imaging with a suitable mouse model like APP23 is an attractive alternative. PMID:25977876

  19. Monitoring therapy with MEK inhibitor U0126 in a novel Wilms tumor model in Wt1 knockout Igf2 transgenic mice using 18F-FDG PET with dual-contrast enhanced CT and MRI: early metabolic response without inhibition of tumor growth.

    PubMed

    Flores, Leo G; Yeh, Hsin-Hsien; Soghomonyan, Suren; Young, Daniel; Bankson, James; Hu, Qianghua; Alauddin, Mian; Huff, Vicki; Gelovani, Juri G

    2013-04-01

    The understanding of the role of genetic alterations in Wilms tumor development could be greatly advanced using a genetically engineered mouse models that can replicate the development and progression of this disease in human patients and can be monitored using non-invasive structural and molecular imaging optimized for renal tumors. Repetitive dual-contrast computed tomography (CT; intravenous and intraperitoneal contrast), T2-weighted magnetic resonance imaging (MRI), and delayed 2-deoxy-2-[(18)F]fluoro-D-glucose ((18)F-FDG) positron emission tomography (PET) were utilized for characterization of Igf2 biallelic expression/Wt1 knockout mouse model of Wilms tumor. For CT imaging, Ioversol 678 mg/ml in 200 μl was administered i.p. followed by 100 μl injected intravenously at 20 and 15 min prior to imaging, respectively. Static PET imaging studies were acquired at 1, 2, and 3 h after i.v. administration of (18)F-FDG (400 μCi). Coronal and sagittal T1-weighted images (TE/TR 8.5/620 ms) were acquired before and immediately after i.v. injection of 0.4 ml/kg gadopentetate dimeglumine followed by T2-weighted images (TE/TR 60/300 ms). Tumor tissue samples were characterized by histopathology and immunohistochemistry for Glut1, FASN, Ki67, and CD34. In addition, six Wt1-Igf2 mice were treated with a mitogen-activated protein kinase (MEK) inhibitor U0126 (50 μmol/kg i.p.) every 4 days for 6 weeks. (18)F-FDG PET/CT imaging was repeated at different days after initiation of therapy with U0126. The percent change of initial tumor volume and SUV was compared to non-treated historic control animals. Overall, the best tumor-to-adjacent kidney contrast as well as soft tissue contrast for other abdominal organs was achieved using T2-weighted MRI. Delayed (18)F-FDG PET (3-h post (18)F-FDG administration) and dual-contrast CT (intravenous and intraperitoneal contrast) provided a more accurate anatomic and metabolic characterization of Wilms tumors in Wt1-Igf2 mice during early development and progression of renal tumors. Over the 8-month period, 46 Wt1-Igf2 mice and 8 littermate control mice were studied. Renal tumors were identified in 54.3 % of Wt1-Igf2 mice between post-natal 50-100 days. In 35.6 % of Wt1-Igf2 mice, tumors were localized in the right kidney; in 24 %, in the left kidney, while 40.4 % of Wt1-Igf2 mice had bilateral kidney tumors. Metastatic lesions were identified in 15.4 % of Wt1-Igf2 mice. Increased levels of Glut1 and IGF1R expression, high Ki67 labeling index, and a dense network of CD34+ microvessels in renal tumors was consistent with increased (18)F-FDG accumulation. Treatment with a MEK 1/2 inhibitor U0126 did not cause the inhibition of tumor growth as compared to untreated animals. However, after the first three to four doses (~2 weeks of treatment), a decrease in (18)F-FDG SUV was observed, as compared to pre-treatment levels (p < 0.05, paired Student t test), which constitutes a metabolic response. Six weeks later, despite continuing therapy, the (18)F-FDG SUV increased again to previous levels. The optimized dual contrast PET/CT imaging with early post i.v. and i.p. contrast CT and 3 h delayed PET imaging after (18)F-FDG administration provides a sensitive and reliable method for detecting early tumor lesions in this endogenous mouse model of Wilms tumor and for monitoring their growth in response to targeted therapies. Therapy with MEK inhibitor U0126 produces only a transient inhibition of tumor glycolytic activity but does not inhibit tumor growth, which is due to continuing IGF2-induced signaling from IGF1R through the PI3K-AKT-mTOR pathway.

  20. Analysis of the microvascular morphology and hemodynamics of breast cancer in mice using SPring-8 synchrotron radiation microangiography

    PubMed Central

    Torii, Masae; Fukui, Toshifumi; Inoue, Masashi; Umetani, Keiji; Shirai, Mikiyasu; Inagaki, Tadakatsu; Tsuchimochi, Hirotsugu; Toi, Masakazu

    2017-01-01

    Tumor vasculature is characterized by morphological and functional abnormalities. However, analysis of the dynamics in blood flow is still challenging because of limited spatial and temporal resolution. Synchrotron radiation (SR) microangiography above the K-edge of the iodine contrast agent can provide high-contrast imaging of microvessels in time orders of milliseconds. In this study, mice bearing the human breast cancer cell lines MDAMB231 and NOTCH4 overexpression in MDAMB231 (MDAMB231NOTCH4+) and normal mice were assessed using SR microangiography. NOTCH is transmembrane protein that has crucial roles for vasculogenesis, angiogenesis and tumorigenesis, and NOTCH4 is considered to be a cause of high-flow arteriovenous shunting. A subgroup of mice received intravenous eribulin treatment, which is known to improve intratumor core circulation (MDAMB231_eribulin). Microvessel branches from approximately 200 µm to less than 20 µm in diameter were observed within the same visual field. The mean transition time (MTT) was measured as a dynamic parameter and quantitative analysis was performed. MTT in MDAMB231 was longer than that in normal tissue, and MDAMB231NOTCH4+ showed shorter MTT [5.0 ± 1.4 s, 3.6 ± 1.0 s and 3.6 ± 1.1 s (mean ± standard deviation), respectively]. After treatment, average MTT was correlated to tumor volume (r = 0.999) in MDAMB231_eribulin, while in contrast there was no correlation in MDAMB231 (r = −0.026). These changes in MTT profile are considered to be driven by the modulation of intratumoral circulation dynamics. These results demonstrate that a SR microangiography approach enables quantitative analysis of morphological and dynamic characteristics of tumor vasculature in vivo. Further studies will reveal new findings concerning vessel function in tumors. PMID:28862627

  1. Effects of photoacoustic imaging and photothermal ablation therapy mediated by targeted hollow gold nanospheres in an orthotopic mouse xenograft model of glioma

    PubMed Central

    Lu, Wei; Melancon, Marites P.; Xiong, Chiyi; Huang, Qian; Elliott, Andrew; Song, Shaoli; Zhang, Rui; Flores, Leo G.; Gelovani, Juri G.; Wang, Lihong V.; Ku, Geng; Stafford, R. Jason; Li, Chun

    2011-01-01

    Advancements in nanotechnology have made it possible to create multifunctional nanostructures that can be used simultaneously to image and treat cancers. For example, hollow gold nanospheres (HAuNS) have been shown to generate intense photoacoustic signals and induce efficient photothermal ablation (PTA) therapy. In this study, we used photoacoustic tomography (PAT), a hybrid imaging modality, to assess the intravenous delivery of HAuNS targeted to integrins that are overexpressed in both glioma and angiogenic blood vessels in a mouse model of glioma. Mice were then treated with near-infrared laser, which elevated tumor temperature by 20.7 °C. We found that PTA treatment significantly prolonged the survival of tumor-bearing mice. Taken together, these results demonstrate the feasibility of using a single nanostructure for image-guided local tumor PTA therapy using photoacoustic molecular imaging. PMID:21856744

  2. Design, Synthesis, and Biological Evaluation of 68Ga-DOTA-PA1 for Lung Cancer: A Novel PET Tracer for Multiple Somatostatin Receptor Imaging.

    PubMed

    Liu, Fei; Liu, Teli; Xu, Xiaoxia; Guo, Xiaoyi; Li, Nan; Xiong, Chiyi; Li, Chun; Zhu, Hua; Yang, Zhi

    2018-02-05

    Most of the radiolabeled somatostatin analogues (SSAs) are specific for subtype somatostatin receptor 2 (SSTR 2 ). Lack of ligands targeting other subtypes of SSTRs, especially SSTR 1, SSTR 3 , and SSTR 5 , limited their applications in tumors of low SSTR 2 expression, including lung tumor. In this study, we aimed to design and synthesize a positron emission tomography (PET) radiotracer targeting multi-subtypes of SSTRs for PET imaging. PA1 peptide and its conjugate with 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) chelator or fluorescein isothiocyanate (FITC) at the N-terminal of the lysine position were synthesized. 68 Ga was chelated to DOTA-PA1 to obtain 68 Ga-DOTA-PA1 radiotracer. The stability, lipophilicity, binding affinity, and binding specificity of 68 Ga-DOTA-PA1 and FITC-PA1 were evaluated by various in vitro experiments. Micro-PET imaging of 68 Ga-DOTA-PA1 was performed in nude mice bearing A549 lung adenocarcinoma, as compared with 68 Ga-DOTA-(Tyr3)-octreotate ( 68 Ga-DOTA-TATE). Histological analysis of SSTR expression in A549 tumor tissues and human tumor tissues was conducted using immunofluorescence staining and immunohistochemical assay. 68 Ga-DOTA-PA1 had high radiochemical yield and radiochemical purity of over 95% and 99%, respectively. The radiotracer was stable in vitro in different buffers over a 2 h incubation period. Cell uptake of 68 Ga-DOTA-PA1 was 1.31-, 1.33-, and 1.90-fold that of 68 Ga-DOTA-TATE, which has high binding affinity only for SSTR 2 , after 2 h incubation in H520, PG, and A549 lung cancer cell lines, respectively. Micro-PET images of 68 Ga-DOTA-PA1 showed that the PET imaging signal correlated with the total expression of SSTRs, instead of SSTR 2 only, which was measured by Western blotting and immunofluorescence analysis in mice bearing A549 tumors. In summary, a novel PET radiotracer, 68 Ga-DOTA-PA1, targeting multi-subtypes of SSTRs, was successfully synthesized and was confirmed to be useful for PET imaging. It may have potential as a noninvasive PET radiotracer for imaging SSTR-positive tumors.

  3. Regulated Apoptosis and Immunogene Therapy for Prostate Cancer

    DTIC Science & Technology

    2006-04-01

    was sutured. The castrated mice were put on a heating pad until recovery and were given injectable Buprenex (buprenorphine hydrochloride; Reckitt ... Benckiser Healthcare UK, Ltd., England, United Kingdom). Sham-operated, age-matched males were used as controls. The orchiectomized mice were imaged

  4. Effect of sodium aurothiomalate on carrageenan induced inflammation of the air pouch in mice.

    PubMed Central

    Sin, Y M; Wong, M K

    1992-01-01

    Acute inflammation was induced by injecting carrageenan into a 6 day old air pouch in mice. Sodium aurothiomalate was then given twice to each of three groups of mice via different routes. It was found that the mice injected intravenously with sodium aurothiomalate showed the most striking reduction in the number of exudate leucocytes in the inflammatory cavity, although the amount of gold found in their inflamed pouch lining tissue was the least. The amount of gold in plasma was highest in the mice injected intravenously with sodium aurothiomalate and the least amount of gold was found in the mice injected directly into the air pouch with sodium aurothiomalate. The amount of gold in the inflamed pouch lining tissue reached its peak at 24 hours after injection and a significant decrease of exudate leucocytes was only seen 24 and 72 hours after injection. The amount of gold in the exudate fluid was negligible at all the times studied. No significant difference was noted in the degree of inflammatory suppression when increasing doses of sodium aurothiomalate were injected into the air pouch. These findings show that there is no direct correlation between the gold concentration in the inflamed tissue and suppression of the inflammatory reactions in the cavity. Chemotactic and phagocytic analysis of leucocytes in the exudate showed that there was a significant suppression of the neutrophil activities in all the mice treated with sodium aurothiomalate. It is therefore concluded that the significant reduction in the number of exudate leucocytes at the carrageenan induced inflammatory site after treatment with sodium aurothiomalate is most likely due to the direct action of gold on the functional activities of circulating neutrophils. Images PMID:1540014

  5. Pro416Arg cherubism mutation in Sh3bp2 knock-in mice affects osteoblasts and alters bone mineral and matrix properties

    PubMed Central

    Wang, Chiachien J.; Chen, I-Ping; Koczon-Jaremko, Boguslawa; Boskey, Adele L.; Ueki, Yasuyoshi; Kuhn, Liisa; Reichenberger, Ernst J.

    2010-01-01

    Cherubism is an autosomal dominant disorder in children characterized by unwarranted symmetrical bone resorption of the jaws with fibrous tissue deposition. Mutations causing cherubism have been identified in the adaptor protein SH3BP2. Knock-in mice with a Pro416Arg mutation in Sh3bp2 exhibit a generalized osteoporotic bone phenotype. In this study, we examined the effects of this “cherubism” mutation on spectroscopic indices of “bone quality” and on osteoblast differentiation. Fourier-transform infrared imaging (FTIRI) analysis of femurs from wild-type and Sh3bp2 knock-in mice showed decreased mineral content, decreased mineral crystallinity/crystal size, and increased collagen maturity in homozygous mutants. To assess osteoblast maturation in vivo, knock-in mice were crossed with transgenic mice over-expressing GFP driven by 3.6-kb or 2.3-kb Col1a1 promoter fragments. Reduced numbers of mature osteoblasts were observed in homozygous mice. Neonatal calvarial cultures, which were enriched for osteoblasts by depletion of hematopoietic cells (negative selection for Ter119- and CD45-positive cells) were investigated for osteoblast-specific gene expression and differentiation, which demonstrated that differentiation and mineralization in homozygous osteoblast cultures was impaired. Co-cultures with calvarial osteoblasts and bone marrow macrophages showed that mutant osteoblasts appear to increase osteoclastogenesis resulting in increased bone resorption on bone chips. In summary, the Sh3bp2 mutation in cherubism mice alters bone quality, reduces osteoblast function, and may contribute to excessive bone resorption by osteoclasts. Our data, together with previous osteoclast studies, demonstrate a critical role of Sh3bp2 in bone remodeling and osteoblast differentiation. PMID:20117257

  6. Roles of steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF) 2 in androgen receptor activity in mice

    PubMed Central

    Ye, Xiangcang; Han, Sang Jun; Tsai, Sophia Y.; DeMayo, Francesco J.; Xu, Jianming; Tsai, Ming-Jer; O'Malley, Bert W.

    2005-01-01

    Genetic disruption of the steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)2/SRC-2 in mouse resulted in distinctive mutant phenotypes. To quantify their roles in the function of androgen receptor (AR) transcriptional activity in vivo, we generated a unique transgenic AR-reporter mouse and analyzed the cell-specific contributions of SRC-1 and TIF2 to the activity of AR in mouse testis. Transgenic AR-luciferase and transgenic AR-lacZ mice harbor a recombinant mouse AR gene, ARGAL4DBD, which is functionally coupled with a upstream activation sequence-mediated reporter gene (AR activity indicator). After characterization of these mice in terms of AR function, we further derived bigenic mice by crossing AR activity indicator mice with the SRC-1-/- or TIF2+/- mutant mice. Analyses of the resultant bigenic mice by in vivo imaging and luciferase assays showed that testicular AR activity was decreased significantly in those with the TIF2+/- mutation but not in the SRC-1+/- background, suggesting that TIF2 serves as the preferential coactivator for AR in testis. Immunohistological analysis confirmed that AR and TIF2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although SRC-1 concentrates in Sertoli cell nuclei in the absence of TIF2, nuclear SRC-1 is not able to rescue AR activity in the TIF2 mutant background. Interestingly, SRC-1 appears to negatively influence AR activity, thereby counterbalancing the TIF2-stimulated AR activity. Our results provide unique in vivo insights to the multidimensional cell-type-specific interactions between AR and coregulators. PMID:15983373

  7. Roles of steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF) 2 in androgen receptor activity in mice.

    PubMed

    Ye, Xiangcang; Han, Sang Jun; Tsai, Sophia Y; DeMayo, Francesco J; Xu, Jianming; Tsai, Ming-Jer; O'Malley, Bert W

    2005-07-05

    Genetic disruption of the steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)2/SRC-2 in mouse resulted in distinctive mutant phenotypes. To quantify their roles in the function of androgen receptor (AR) transcriptional activity in vivo, we generated a unique transgenic AR-reporter mouse and analyzed the cell-specific contributions of SRC-1 and TIF2 to the activity of AR in mouse testis. Transgenic AR-luciferase and transgenic AR-lacZ mice harbor a recombinant mouse AR gene, AR(GAL4DBD), which is functionally coupled with a upstream activation sequence-mediated reporter gene (AR activity indicator). After characterization of these mice in terms of AR function, we further derived bigenic mice by crossing AR activity indicator mice with the SRC-1-/- or TIF2+/- mutant mice. Analyses of the resultant bigenic mice by in vivo imaging and luciferase assays showed that testicular AR activity was decreased significantly in those with the TIF2+/- mutation but not in the SRC-1+/- background, suggesting that TIF2 serves as the preferential coactivator for AR in testis. Immunohistological analysis confirmed that AR and TIF2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although SRC-1 concentrates in Sertoli cell nuclei in the absence of TIF2, nuclear SRC-1 is not able to rescue AR activity in the TIF2 mutant background. Interestingly, SRC-1 appears to negatively influence AR activity, thereby counterbalancing the TIF2-stimulated AR activity. Our results provide unique in vivo insights to the multidimensional cell-type-specific interactions between AR and coregulators.

  8. Human umbilical cord mesenchymal stem cells ameliorate mice trinitrobenzene sulfonic acid (TNBS)-induced colitis.

    PubMed

    Liang, Lu; Dong, Chunlan; Chen, Xiaojun; Fang, Zhihong; Xu, Jie; Liu, Meng; Zhang, Xiaoguang; Gu, Dong Sheng; Wang, Ding; Du, Weiting; Zhu, Delin; Han, Zhong Chao

    2011-01-01

    Mesenchymal stem cells (MSCs), which are poorly immunogenic and have potent immunosuppressive activities, have emerged as a promising candidate for cellular therapeutics for the treatment of disorders caused by abnormal immune responses. In this study we investigated whether human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) could ameliorate colitis in a trinitrobenzene sulfonic acid (TNBS)-induced colitis model. TNBS-treated colitic mice were infused with hUC-MSCs or vehicle control. The mice were sacrificed on day 1, 3, and 5 after infusion, and their clinical and pathological conditions were evaluated by body weight, colon length, and histological analysis. The expression levels of proinflammatory cytokine proteins in colon were examined by ELISA. The homing of hUC-MSCs was studied by live in vivo imaging and immunofluorescent microscopy. hUC-MSCs were found to migrate to the inflamed colon and effectively treated the colitic mice with improved clinical and pathological signs. The levels of IL-17 and IL-23 as well as IFN-γ and IL-6 were significantly lower in the colon tissues of the hUC-MSC-treated mice in comparison with the vehicle-treated mice. Coculture experiments showed that hUC-MSCs not only could inhibit IFN-γ expression but also significantly inhibit IL-17 production by lamina propria mononuclear cells (LPMCs) or splenocytes of the colitic mice or by those isolated from normal animals and stimulated with IL-23. Systemically infused hUC-MSCs could home to the inflamed colon and effectively ameliorate colitis. In addition to the known suppressive effects on Th1-type immune responses, hUC-MSC-mediated modulation of IL-23/IL-17 regulated inflammatory reactions also plays an important role in the amelioration of colitis.

  9. Differential Regulatory Role of Pituitary Adenylate Cyclase–Activating Polypeptide in the Serum-Transfer Arthritis Model

    PubMed Central

    Botz, Bálint; Bölcskei, Kata; Kereskai, László; Kovács, Miklós; Németh, Tamás; Szigeti, Krisztián; Horváth, Ildikó; Máthé, Domokos; Kovács, Noémi; Hashimoto, Hitoshi; Reglődi, Dóra; Szolcsányi, János; Pintér, Erika; Mócsai, Attila; Helyes, Zsuzsanna

    2014-01-01

    Objective Pituitary adenylate cyclase–activating polypeptide (PACAP) expressed in capsaicin-sensitive sensory neurons and immune cells has divergent functions in inflammatory and pain processes. This study was undertaken to investigate the involvement of PACAP in a mouse model of rheumatoid arthritis. Methods Arthritis was induced in PACAP−/− and wild-type (PACAP+/+) mice by K/BxN serum transfer. General features of the disease were investigated by semiquantitative scoring, plethysmometry, and histopathologic analysis. Mechano- and thermonociceptive thresholds and motor functions were also evaluated. Metabolic activity was assessed by positron emission tomography. Bone morphology was measured by in vivo micro–computed tomography, myeloperoxidase activity and superoxide production by bioluminescence imaging with luminol and lucigenin, respectively, and vascular permeability by fluorescent indocyanine green dye study. Results PACAP+/+ mice developed notable joint swelling, reduced grasping ability, and mechanical (but not thermal) hyperalgesia after K/BxN serum transfer. In PACAP−/− mice clinical scores and edema were significantly reduced, and mechanical hyperalgesia and motor impairment were absent, throughout the 2-week period of observation. Metabolic activity and superoxide production increased in the tibiotarsal joints of wild-type mice but were significantly lower in PACAP−/− animals. Myeloperoxidase activity in the ankle joints of PACAP−/− mice was significantly reduced in the early phase of arthritis, but increased in the late phase. Synovial hyperplasia was also significantly increased, and progressive bone spur formation was observed in PACAP-deficient mice only. Conclusion In PACAP-deficient mice with serum-transfer arthritis, joint swelling, vascular leakage, hyperalgesia, and early inflammatory cell accumulation are reduced; in the later phase of the disease, immune cell function and bone neoformation are increased. Elucidation of the underlying pathways of PACAP activity may open promising new avenues for development of therapy in inflammatory arthritis. PMID:25048575

  10. In-vivo wound healing modulation after irradiation with a blue LED photocoagulator

    NASA Astrophysics Data System (ADS)

    Rossi, Francesca; Cicchi, Riccardo; Magni, Giada; Tatini, Francesca; Bacci, Stefano; Paroli, Gaia; Alfieri, Domenico; Tripodi, Cristina; De Siena, Gaetano; Pavone, Francesco S.; Pini, Roberto

    2017-07-01

    A faster healing process was observed in superficial skin wounds after irradiation with a blue LED (EmoLED) photocoagulator. EmoLED is a compact handheld device, used to induce a thermal effect and thus coagulation in superficial abrasions. We present the results of an in vivo study, conducted in different mouse model, to analyze the induced wound healing. Two superficial abrasions were produced on the back of the mice: one area was treated with EmoLED (1.4 W/cm2, 30 s treatment time), while the other one was left naturally recovering. During the treatment, a temperature around 40-45°C was induced on the abrasion surface. Mice back healthy skin was used as a control. We compared the treatment in black mice, healthy albino mice, diabetic albino mice and albino mice with coagulation problem. The animals underwent a follow up study and were sacrificed at 0, 3, 6, 9, 18, 24 hours p.o.. Samples from the two abraded areas were harvested and examined by histopathological and immunofluorescence analysis, SHG imaging and confocal microscopy. The aim of the study was to compare the effects in the different target groups and to investigate the early phase of the wound healing process. Our results show that the effects are comparable in all the treated groups and that the healing process appears to be faster in respect to the naturally recovered wounds. This study confirms the previous results obtained in a study on a rat model an in a study on healthy albino mice: the selective photothermal effect we used for inducing immediate coagulation in superficial wounds seems to be associated to a faster and improved healing process.

  11. Increased bone formation in mice lacking apolipoprotein E.

    PubMed

    Schilling, Arndt F; Schinke, Thorsten; Münch, Christian; Gebauer, Matthias; Niemeier, Andreas; Priemel, Matthias; Streichert, Thomas; Rueger, Johannes M; Amling, Michael

    2005-02-01

    ApoE is a plasma protein that plays a major role in lipoprotein metabolism. Here we describe that ApoE expression is strongly induced on mineralization of primary osteoblast cultures. ApoE-deficient mice display an increased bone formation rate compared with wildtype controls, thereby showing that ApoE has a physiologic function in bone remodeling. Apolipoprotein E (ApoE) is a protein component of lipoproteins and facilitates their clearance from the circulation. This is confirmed by the phenotype of ApoE-deficient mice that have high plasma cholesterol levels and spontaneously develop atherosclerotic lesions. The bone phenotype of these mice has not been analyzed to date, although an association between certain ApoE alleles and BMD has been reported. Primary osteoblasts were isolated from newborn mouse calvariae and mineralized ex vivo. A genome-wide expression analysis was performed during the course of differentiation using the Affymetrix gene chip system. Bones from ApoE-deficient mice and wildtype controls were analyzed using radiography, micro CT imaging, and undecalcified histology. Cellular activities were assessed using dynamic histomorphometry and by measuring urinary collagen degradation products. Lipoprotein uptake assays were performed with (125)I-labeled triglyceride-rich lipoprotein-remnants (TRL-R) using primary osteoblasts from wildtype and ApoE-deficient mice. Serum concentrations of osteocalcin were determined by radioimmunoassay after hydroxyapatite chromatography. ApoE expression is strongly induced on mineralization of primary osteoblast cultures ex vivo. Mice lacking ApoE display a high bone mass phenotype that is caused by an increased bone formation rate, whereas bone resorption is not affected. This phenotype may be explained by a decreased uptake of triglyceride-rich lipoproteins by osteoblasts, resulting in elevated levels of undercarboxylated osteocalcin in the serum of ApoE-deficient mice. The specific induction of ApoE gene expression during osteoblast differentiation along with the increased bone formation rate observed in ApoE-deficient mice shows that ApoE has a physiologic role as a regulator of osteoblast function.

  12. Genetic studies on experimental autoimmune gastritis induced by neonatal thymectomy using recombinant inbred strains between a high-incidence strain, BALB/c, and a low-incidence strain, DBA/2.

    PubMed Central

    Mori, Y; Hosono, M; Murakami, K; Katoh, H; Yoshikawa, Y; Kuribayashi, K; Kannagi, R; Sakai, M; Okuma, M; Masuda, T

    1991-01-01

    Thymectomy on day 3 after birth induced autoimmune gastritis (AIG) at the age of 2 months in 51-73% of BALB/c mice, and in only 3-5% of DBA/2 mice. AIG was detected by histological and serological (immunofluorescence staining for detecting anti-parietal cell autoantibody) examination. However, autoantibody was weakly positive in almost all of these DBA/2 mice when measured by ELISA using extract of murine gastric mucosa as the antigen. To investigate genetically the mechanism controlling the incidence of AIG, II recombinant inbred strains established by brother-sister mating of (BALB/c x DBA/2) F2 mice (C x D2 strains) were used. Among 26 markers tested, the Mls-1 locus on BALB/c chromosome 1 and the Hc locus coding a complement component (C5) on BALB/c chromosome 2 were found to be associated with high susceptibility to AIG. However, if one or both of the loci were of DBA/2 origin, mice showed medium or low susceptibility to AIG. For further analysis, F1, F2 and back-cross generations of these two strains were tested, but segregation of a single susceptibility or insusceptibility gene was not obtained. Taken together, it seems probable that two or more genes are involved in the induction mechanism of AIG. We did not detect C5 deposition in AIG lesions, nor complement-dependent cytotoxic antibody to parietal cells in serum from AIG mice. However, injection of irradiated spleen cells of DBA/2 mice into BALB/c mice thymectomized on day 3 augmented the incidence of AIG from 71 to 100%, but not that of oophoritis (33%). A relationship between Mls-1a determinants and the pathogenesis of AIG was further suggested from the fact that V beta 6 TcR-expressing T cells increased in number in AIG-bearing compared with normal BALB/c mice. Images Fig. 1 PMID:1901777

  13. Genetic sphingosine kinase 1 deficiency significantly decreases synovial inflammation and joint erosions in murine TNF-alpha-induced arthritis.

    PubMed

    Baker, DeAnna A; Barth, Jeremy; Chang, Raymond; Obeid, Lina M; Gilkeson, Gary S

    2010-08-15

    Sphingosine kinase 1 (SphK1) is an enzyme that converts sphingosine to bioactive sphingosine-1-phosphate. Recent in vitro data suggest a potential role of SphK1 in TNF-alpha-mediated inflammation. Our aims in this study were to determine the in vivo significance of SphK1 in TNF-alpha-mediated chronic inflammation and to define which pathogenic mechanisms induced by TNF-alpha are SphK1 dependent. To pursue these aims, we studied the effect of SphK1 deficiency in an in vivo model of TNF-alpha-induced chronic inflammatory arthritis. Transgenic hTNF-alpha mice, which develop spontaneous inflammatory erosive arthritis beginning at 14-16 wk, were crossed with SphK1 null mice (SphK1(-/-)), on the C57BL6 genetic background. Beginning at 4 mo of age, hTNF/SphK1(-/-) mice had significantly less severe clinically evident paw swelling and deformity, less synovial and periarticular inflammation, and markedly decreased bone erosions as measured quantitatively through micro-CT images. Mechanistically, the mice lacking SphK1 had less articular cyclooxygenase 2 protein and fewer synovial Th17 cells than did hTNF/SphK1(+/+) littermates. Microarray analysis and real-time RT-PCR of the ankle synovial tissue demonstrated that hTNF/SphK1(-/-) mice had increased transcript levels of suppressor of cytokine signaling 3 compared with hTNF/SphK1(+/+) mice, likely also contributing to the decreased inflammation in the SphK1-deficient mice. Finally, significantly fewer mature osteoclasts were detected in the ankle joints of hTNF/SphK1(-/-) mice compared with hTNF/SphK1(+/+) mice. These data indicate that SphK1 plays a key role in hTNF-alpha-induced inflammatory arthritis via impacting synovial inflammation and osteoclast number.

  14. Development of a novel immunoPET tracer to image human PD-1 checkpoint expression on tumor infiltrating lymphocytes in a humanized mouse model

    PubMed Central

    Natarajan, Arutselvan; Mayer, Aaron T; Reeves, Robert E; Nagamine, Claude M; Gambhir, Sanjiv S.

    2017-01-01

    Purpose It is well known that cancers exploit immune checkpoints (programmed death 1 receptor (PD-1) and its ligand (PD-L1)) to evade anti-tumor immune responses. Although immune checkpoint (IC) blockade is a promising approach, not all patients respond. Hence, the purpose of this study is imaging of tumor infiltrating lymphocytes (TILs), as they are known to express PD-1 during activation and subsequent exhaustion in the tumor microenvironment and are thought to be potentially predictive of therapeutic responses to IC blockade. Procedures We developed immunoPET tracers to image hPD-1 status of human peripheral blood mononuclear cells (hPBMC) adoptively transferred to NOD-scid IL-2Rγnull (NSG) mice (hNSG) bearing A375 human skin melanoma tumors. The anti-PD-1 human antibody (IgG; keytruda) labeled with either [89Zr]- or [64Cu]- radiometals to image PD-1 expressing human TILs in vivo. Results [89Zr]keytruda (groups = 2; NSG-ctl [control] and hNSG-nblk [non-blocking], n=3-5, 3.2 ± 0.4 MBq/15-16 μg/200 μL, and [64Cu]keytruda (groups = 3; NSG-ctl, NSG-blk [blocking], and hNSG-nblk) n=4, 7.4 ± 0.4 MBq /20-25μg/200 μL) were administered in mice. PET-CT scans were performed over 1-144 h ([89Zr]keytruda) and 1-48 h ([64Cu]keytruda) on mice. hNSG mice exhibited a high tracer uptake in the spleen lymphoid organs and tumors. At 24h, human TILs homing into melanoma of hNSG-nblk mice exhibited high signal (mean %ID/g ± SD) of 3.8 ± 0.4 ([89Zr]keytruda), and 6.4 ± 0.7 ([64Cu]keytruda), which was 1.5- and 3-fold higher uptake compared to NSG-ctl mice (p = 0.01), respectively. Biodistribution measurements of hNSG-nblk mice performed at 144 h ([89Zr]keytruda), and 48 h ([64Cu]keytruda) p.i. revealed tumor to muscle ratios as high as 45 and 12-fold, respectively. Conclusion This study clearly demonstrates specific imaging of human PD-1 expressing TILs within the tumor and lymphoid tissues. This suggests anti-human-PD-1 tracer could be clinically translatable to monitor cancer treatment response to IC blockade therapy. PMID:28247187

  15. Endoscopic spectral domain optical coherence tomography of murine colonic morphology to determine effectiveness of chemopreventive and chemotherapeutic agents in colorectal cancer

    NASA Astrophysics Data System (ADS)

    LeGendre-McGhee, Susan; Rice, Photini F. S.; Wall, R. Andrew; Klein, Justin; Luttman, Amber; Sprute, Kyle; Gerner, Eugene; Barton, Jennifer K.

    2012-02-01

    Optical coherence tomography (OCT) is a minimally-invasive imaging modality capable of tracking the development of individual colonic adenomas. As such, OCT can be used to evaluate the mechanisms and effectiveness of chemopreventive and chemotherapeutic agents in colorectal cancer models. The data presented here represent part of a larger study evaluating α-difluoromethylornithine (DFMO) and Sulindac as chemopreventive and chemotherapeutic agents using mice treated with the carcinogen azoxymethane (AOM). 27 A/J mice were included in the chemoprevention study, subdivided into four treatment groups (No Drug, DFMO, Sulindac, DFMO/Sulindac). 30 mm lateral images of each colon at eight different rotations were obtained at five different time points using a 2 mm diameter spectral domain OCT endoscopy system centered at 890 nm with 3.5 μm axial resolution in air and 5 μm lateral resolution. Images were visually analyzed to determine number and size of adenomas. Gross photos of the excised colons and histology provided gold standard confirmation of the final imaging time point. Preliminary results show that 100% of mice in the No Drug group developed adenomas over the course of the chemoprevention study. Incidence was reduced to 71.43% in mice given DFMO, 85.71% for Sulindac and 0% for DFMO/Sulindac. Discrete adenoma size did not vary significantly between experimental groups. Additional experiments are currently under way to verify these results and evaluate DFMO and Sulindac for chemotherapeutic applications.

  16. Multimodal assessment of SERS nanoparticle biodistribution post ingestion reveals new potential for clinical translation of Raman imaging.

    PubMed

    Campbell, Jos L; SoRelle, Elliott D; Ilovich, Ohad; Liba, Orly; James, Michelle L; Qiu, Zhen; Perez, Valerie; Chan, Carmel T; de la Zerda, Adam; Zavaleta, Cristina

    2017-08-01

    Despite extensive research and development, new nano-based diagnostic contrast agents have faced major barriers in gaining regulatory approval due to their potential systemic toxicity and prolonged retention in vital organs. Here we use five independent biodistribution techniques to demonstrate that oral ingestion of one such agent, gold-silica Raman nanoparticles, results in complete clearance with no systemic toxicity in living mice. The oral delivery mimics topical administration to the oral cavity and gastrointestinal (GI) tract as an alternative to intravenous injection. Biodistribution and clearance profiles of orally (OR) vs. intravenously (IV) administered Raman nanoparticles were assayed over the course of 48 h. Mice given either an IV or oral dose of Raman nanoparticles radiolabeled with approximately 100 μCi (3.7MBq) of 64 Cu were imaged with dynamic microPET immediately post nanoparticle administration. Static microPET images were also acquired at 2 h, 5 h, 24 h and 48 h. Mice were sacrificed post imaging and various analyses were performed on the excised organs to determine nanoparticle localization. The results from microPET imaging, gamma counting, Raman imaging, ICP-MS, and hyperspectral imaging of tissue sections all correlated to reveal no evidence of systemic distribution of Raman nanoparticles after oral administration and complete clearance from the GI tract within 24 h. Paired with the unique signals and multiplexing potential of Raman nanoparticles, this approach holds great promise for realizing targeted imaging of tumors and dysplastic tissues within the oral cavity and GI-tract. Moreover, these results suggest a viable path for the first translation of high-sensitivity Raman contrast imaging into clinical practice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Whole-body optical imaging of green fluorescent protein-expressing tumors and metastases

    PubMed Central

    Yang, Meng; Baranov, Eugene; Jiang, Ping; Sun, Fang-Xian; Li, Xiao-Ming; Li, Lingna; Hasegawa, Satoshi; Bouvet, Michael; Al-Tuwaijri, Maraya; Chishima, Takashi; Shimada, Hiroshi; Moossa, A. R.; Penman, Sheldon; Hoffman, Robert M.

    2000-01-01

    We have imaged, in real time, fluorescent tumors growing and metastasizing in live mice. The whole-body optical imaging system is external and noninvasive. It affords unprecedented continuous visual monitoring of malignant growth and spread within intact animals. We have established new human and rodent tumors that stably express very high levels of the Aequorea victoria green fluorescent protein (GFP) and transplanted these to appropriate animals. B16F0-GFP mouse melanoma cells were injected into the tail vein or portal vein of 6-week-old C57BL/6 and nude mice. Whole-body optical images showed metastatic lesions in the brain, liver, and bone of B16F0-GFP that were used for real time, quantitative measurement of tumor growth in each of these organs. The AC3488-GFP human colon cancer was surgically implanted orthotopically into nude mice. Whole-body optical images showed, in real time, growth of the primary colon tumor and its metastatic lesions in the liver and skeleton. Imaging was with either a trans-illuminated epifluorescence microscope or a fluorescence light box and thermoelectrically cooled color charge-coupled device camera. The depth to which metastasis and micrometastasis could be imaged depended on their size. A 60-μm diameter tumor was detectable at a depth of 0.5 mm whereas a 1,800-μm tumor could be visualized at 2.2-mm depth. The simple, noninvasive, and highly selective imaging of growing tumors, made possible by strong GFP fluorescence, enables the detailed imaging of tumor growth and metastasis formation. This should facilitate studies of modulators of cancer growth including inhibition by potential chemotherapeutic agents. PMID:10655509

  18. Detection of ultrastructural changes in genetically altered and exercised skeletal muscle using PS-OCT

    NASA Astrophysics Data System (ADS)

    Pasquesi, James J.; Schlachter, Simon C.; Boppart, Marni D.; Chaney, Eric; Kaufman, Stephen J.; Boppart, Stephen A.

    2006-02-01

    Birefringence of skeletal muscle has been associated with the ultrastructure of individual sarcomeres, specifically the arrangement of A-bands corresponding to the thick myosin filaments. Murine skeletal muscle (gastrocnemius) was imaged with a fiber-based PS-OCT imaging system to determine the level of birefringence present in the tissue under various conditions. In addition to muscle controls from wild-type mice, muscle from abnormal mice included: genetically-modified (mdx) mice which model human muscular dystrophy, transgenic mice exhibiting an overexpression of integrin (α7β1), and transgenic integrin (α7β1)knockout mice. Comparisons were also made between rested and exercised muscles to determine the effects of exercise on muscle birefringence for each of these normal and abnormal conditions. The PS-OCT images revealed that the presence of birefringence was similar in the rested muscle with dystrophy-like features (i.e., lacking the structural protein dystrophin - mdx) and in the integrin (α7β1)knockout muscle when compared to the normal (wild-type) control. However, exercising these abnormal muscle tissues drastically reduced the presence of birefringence detected by the PS-OCT system. The muscle exhibiting an overexpression of integrin (α7β1) remained heavily birefringent before and after exercise, similar to the normal (wild-type) muscle. These results suggest that there is a distinct relationship between the degree of birefringence detected using PS-OCT and the sarcomeric ultrastructure present within skeletal muscle.

  19. Two-photon voltage imaging using a genetically encoded voltage indicator

    PubMed Central

    Akemann, Walther; Sasaki, Mari; Mutoh, Hiroki; Imamura, Takeshi; Honkura, Naoki; Knöpfel, Thomas

    2013-01-01

    Voltage-sensitive fluorescent proteins (VSFPs) are a family of genetically-encoded voltage indicators (GEVIs) reporting membrane voltage fluctuation from genetically-targeted cells in cell cultures to whole brains in awake mice as demonstrated earlier using 1-photon (1P) fluorescence excitation imaging. However, in-vivo 1P imaging captures optical signals only from superficial layers and does not optically resolve single neurons. Two-photon excitation (2P) imaging, on the other hand, has not yet been convincingly applied to GEVI experiments. Here we show that 2P imaging of VSFP Butterfly 1.2 expresssing pyramidal neurons in layer 2/3 reports optical membrane voltage in brain slices consistent with 1P imaging but with a 2–3 larger ΔR/R value. 2P imaging of mouse cortex in-vivo achieved cellular resolution throughout layer 2/3. In somatosensory cortex we recorded sensory responses to single whisker deflections in anesthetized mice at full frame video rate. Our results demonstrate the feasibility of GEVI-based functional 2P imaging in mouse cortex. PMID:23868559

  20. Two-Photon Microscopy Imaging of thy1GFP-M Transgenic Mice: A Novel Animal Model to Investigate Brain Dendritic Cell Subsets In Vivo

    PubMed Central

    Laperchia, Claudia; Allegra Mascaro, Anna L.; Sacconi, Leonardo; Andrioli, Anna; Mattè, Alessandro; De Franceschi, Lucia; Grassi-Zucconi, Gigliola; Bentivoglio, Marina; Buffelli, Mario; Pavone, Francesco S.

    2013-01-01

    Transgenic mice expressing fluorescent proteins in specific cell populations are widely used for in vivo brain studies with two-photon fluorescence (TPF) microscopy. Mice of the thy1GFP-M line have been engineered for selective expression of green fluorescent protein (GFP) in neuronal populations. Here, we report that TPF microscopy reveals, at the brain surface of these mice, also motile non-neuronal GFP+ cells. We have analyzed the behavior of these cells in vivo and characterized in brain sections their immunophenotype. With TPF imaging, motile GFP+ cells were found in the meninges, subarachnoid space and upper cortical layers. The striking feature of these cells was their ability to move across the brain parenchyma, exhibiting evident shape changes during their scanning-like motion. In brain sections, GFP+ cells were immunonegative to antigens recognizing motile cells such as migratory neuroblasts, neuronal and glial precursors, mast cells, and fibroblasts. GFP+ non-neuronal cells exhibited instead the characteristic features and immunophenotype (CD11c and major histocompatibility complex molecule class II immunopositivity) of dendritic cells (DCs), and were immunonegative to the microglial marker Iba-1. GFP+ cells were also identified in lymph nodes and blood of thy1GFP-M mice, supporting their identity as DCs. Thus, TPF microscopy has here allowed the visualization for the first time of the motile behavior of brain DCs in situ. The results indicate that the thy1GFP-M mouse line provides a novel animal model for the study of subsets of these professional antigen-presenting cells in the brain. Information on brain DCs is still very limited and imaging in thy1GFP-M mice has a great potential for analyses of DC-neuron interaction in normal and pathological conditions. PMID:23409142

Top