Modulation of host immunity by beneficial microbes.
Zamioudis, Christos; Pieterse, Corné M J
2012-02-01
In nature, plants abundantly form beneficial associations with soilborne microbes that are important for plant survival and, as such, affect plant biodiversity and ecosystem functioning. Classical examples of symbiotic microbes are mycorrhizal fungi that aid in the uptake of water and minerals, and Rhizobium bacteria that fix atmospheric nitrogen for the plant. Several other types of beneficial soilborne microbes, such as plant-growth-promoting rhizobacteria and fungi with biological control activity, can stimulate plant growth by directly suppressing deleterious soilborne pathogens or by priming aboveground plant parts for enhanced defense against foliar pathogens or insect herbivores. The establishment of beneficial associations requires mutual recognition and substantial coordination of plant and microbial responses. A growing body of evidence suggests that beneficial microbes are initially recognized as potential invaders, after which an immune response is triggered, whereas, at later stages of the interaction, mutualists are able to short-circuit plant defense responses to enable successful colonization of host roots. Here, we review our current understanding of how symbiotic and nonsymbiotic beneficial soil microbes modulate the plant immune system and discuss the role of local and systemic defense responses in establishing the delicate balance between the two partners.
Innate immunity and gut-microbe mutualism in Drosophila.
Ryu, Ji-Hwan; Ha, Eun-Mi; Lee, Won-Jae
2010-04-01
Metazoan guts face a wide variety of microorganisms upon exposure to the environment, including beneficial symbionts, non-symbionts, food-borne microbes and life-threatening pathogens. Recent evidence has shown that the innate immunity of gut epithelia, such as anti-microbial peptide- and reactive oxygen species-based immune systems, actively participate in gut-microbe homeostasis by shaping the commensal community while efficiently eliminating unwanted bacteria. Therefore, elucidation of the regulatory mechanism by which gut innate immunity occurs at the molecular level will provide a novel perspective of gut-microbe mutualisms as well as of gut diseases caused by alterations in the innate immunity.
Candida albicans Pathogenesis: Fitting within the Host-Microbe Damage Response Framework
Kong, Eric F.; Tsui, Christina; Nguyen, M. Hong; Clancy, Cornelius J.; Fidel, Paul L.; Noverr, Mairi
2016-01-01
Historically, the nature and extent of host damage by a microbe were considered highly dependent on virulence attributes of the microbe. However, it has become clear that disease is a complex outcome which can arise because of pathogen-mediated damage, host-mediated damage, or both, with active participation from the host microbiota. This awareness led to the formulation of the damage response framework (DRF), a revolutionary concept that defined microbial virulence as a function of host immunity. The DRF outlines six classifications of host damage outcomes based on the microbe and the strength of the immune response. In this review, we revisit this concept from the perspective of Candida albicans, a microbial pathogen uniquely adapted to its human host. This fungus commonly colonizes various anatomical sites without causing notable damage. However, depending on environmental conditions, a diverse array of diseases may occur, ranging from mucosal to invasive systemic infections resulting in microbe-mediated and/or host-mediated damage. Remarkably, C. albicans infections can fit into all six DRF classifications, depending on the anatomical site and associated host immune response. Here, we highlight some of these diverse and site-specific diseases and how they fit the DRF classifications, and we describe the animal models available to uncover pathogenic mechanisms and related host immune responses. PMID:27430274
Fungal innate immunity induced by bacterial microbe-associated molecular patterns (MAMPs)
USDA-ARS?s Scientific Manuscript database
Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal-bacterial interaction at the molecular level is still in its infancy and very little is known about fungal molecular responses to bacteria, a...
Broderick, Nichole A
2016-05-26
Drosophila melanogaster lives, breeds and feeds on fermenting fruit, an environment that supports a high density, and often a diversity, of microorganisms. This association with such dense microbe-rich environments has been proposed as a reason that D. melanogaster evolved a diverse and potent antimicrobial peptide (AMP) response to microorganisms, especially to combat potential pathogens that might occupy this niche. Yet, like most animals, D. melanogaster also lives in close association with the beneficial microbes that comprise its microbiota, or microbiome, and recent studies have shown that antimicrobial peptides (AMPs) of the epithelial immune response play an important role in dictating these interactions and controlling the host response to gut microbiota. Moreover, D. melanogaster also eats microbes for food, consuming fermentative microbes of decaying plant material and their by-products as both larvae and adults. The processes of nutrient acquisition and host defence are remarkably similar and use shared functions for microbe detection and response, an observation that has led to the proposal that the digestive and immune systems have a common evolutionary origin. In this manner, D. melanogaster provides a powerful model to understand how, and whether, hosts differentiate between the microbes they encounter across this spectrum of associations.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'. © 2016 The Author(s).
2016-01-01
Drosophila melanogaster lives, breeds and feeds on fermenting fruit, an environment that supports a high density, and often a diversity, of microorganisms. This association with such dense microbe-rich environments has been proposed as a reason that D. melanogaster evolved a diverse and potent antimicrobial peptide (AMP) response to microorganisms, especially to combat potential pathogens that might occupy this niche. Yet, like most animals, D. melanogaster also lives in close association with the beneficial microbes that comprise its microbiota, or microbiome, and recent studies have shown that antimicrobial peptides (AMPs) of the epithelial immune response play an important role in dictating these interactions and controlling the host response to gut microbiota. Moreover, D. melanogaster also eats microbes for food, consuming fermentative microbes of decaying plant material and their by-products as both larvae and adults. The processes of nutrient acquisition and host defence are remarkably similar and use shared functions for microbe detection and response, an observation that has led to the proposal that the digestive and immune systems have a common evolutionary origin. In this manner, D. melanogaster provides a powerful model to understand how, and whether, hosts differentiate between the microbes they encounter across this spectrum of associations. This article is part of the themed issue ‘Evolutionary ecology of arthropod antimicrobial peptides’. PMID:27160597
Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)
Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan
2016-01-01
Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188
The influence of the microbiota on the immune response to transplantation
Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa
2015-01-01
Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985
Burke, D S
1993-01-01
A review of the history of 'vaccine therapy' for infectious diseases is presented. The concept originated when Auzias-Turenne introduced 'syphilitic vaccination' or 'syphilization' as a treatment for syphilis in Paris in the mid-1800s; his clinical studies probably influenced Pasteur's successful rabies postexposure vaccine trials. Robert Koch in Berlin in the 1890s observed that inoculation of tuberculin into patients with tuberculosis induced an inflammatory response in affected tissues, and advocated 'tuberculin therapy'. Sir Almroth Wright in London in the early 20th century devised methods to measure changes in serum 'opsonizing' activity in response to therapeutic inoculations with microbe-derived vaccines. Since the advent of antibiotics, active specific immunization with microbe-derived antigens (vaccine therapy) has been largely forgotten as a strategy for treatment of infectious diseases. Advances in antigen production and in molecular immunology now permit new tactics to probe, analyse and selectively alter in vivo human immune responses to infectious microbes. Our recent demonstration that vaccine therapy can boost natural immunity to HIV in infected patients should rekindle interest in this approach.
Bivalve immunity and response to infections: Are we looking at the right place?
Allam, Bassem; Pales Espinosa, Emmanuelle
2016-06-01
Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.
Microbes, Immunity, and Behavior: Psychoneuroimmunology Meets the Microbiome
Dinan, Timothy G; Cryan, John F
2017-01-01
There is now a large volume of evidence to support the view that the immune system is a key communication pathway between the gut and brain, which plays an important role in stress-related psychopathologies and thus provides a potentially fruitful target for psychotropic intervention. The gut microbiota is a complex ecosystem with a diverse range of organisms and a sophisticated genomic structure. Bacteria within the gut are estimated to weigh in excess of 1 kg in the adult human and the microbes within not only produce antimicrobial peptides, short chain fatty acids, and vitamins, but also most of the common neurotransmitters found in the human brain. That the microbial content of the gut plays a key role in immune development is now beyond doubt. Early disruption of the host-microbe interplay can have lifelong consequences, not just in terms of intestinal function but in distal organs including the brain. It is clear that the immune system and nervous system are in continuous communication in order to maintain a state of homeostasis. Significant gaps in knowledge remain about the effect of the gut microbiota in coordinating the immune-nervous systems dialogue. However, studies using germ-free animals, infective models, prebiotics, probiotics, and antibiotics have increased our understanding of the interplay. Early life stress can have a lifelong impact on the microbial content of the intestine and permanently alter immune functioning. That early life stress can also impact adult psychopathology has long been appreciated in psychiatry. The challenge now is to fully decipher the molecular mechanisms that link the gut microbiota, immune, and central nervous systems in a network of communication that impacts behavior patterns and psychopathology, to eventually translate these findings to the human situation both in health and disease. Even at this juncture, there is evidence to pinpoint key sites of communication where gut microbial interventions either with drugs
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Tailoring the Immune Response via Customization of Pathogen Gene Expression
Runco, Lisa M.; Stauft, Charles B.
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769
Cnidarian-microbe interactions and the origin of innate immunity in metazoans.
Bosch, Thomas C G
2013-01-01
Most epithelia in animals are colonized by microbial communities. These resident microbes influence fitness and thus ecologically important traits of their hosts, ultimately forming a metaorganism consisting of a multicellular host and a community of associated microorganisms. Recent discoveries in the cnidarian Hydra show that components of the innate immune system as well as transcriptional regulators of stem cells are involved in maintaining homeostasis between animals and their resident microbiota. Here I argue that components of the innate immune system with its host-specific antimicrobial peptides and a rich repertoire of pattern recognition receptors evolved in early-branching metazoans because of the need to control the resident beneficial microbes, not because of invasive pathogens. I also propose a mutual intertwinement between the stem cell regulatory machinery of the host and the resident microbiota composition, such that disturbances in one trigger a restructuring and resetting of the other.
The coral immune response facilitates protection against microbes during tissue regeneration.
van de Water, Jeroen A J M; Ainsworth, Tracy D; Leggat, William; Bourne, David G; Willis, Bette L; van Oppen, Madeleine J H
2015-07-01
Increasing physical damage on coral reefs from predation, storms and anthropogenic disturbances highlights the need to understand the impact of injury on the coral immune system. In this study, we examined the regulation of the coral immune response over 10 days following physical trauma artificially inflicted on in situ colonies of the coral Acropora aspera, simultaneously with bacterial colonization of the lesions. Corals responded to injury by increasing the expression of immune system-related genes involved in the Toll-like and NOD-like receptor signalling pathways and the lectin-complement system in three phases (<2, 4 and 10 days post-injury). Phenoloxidase activity was also significantly upregulated in two phases (<3 and 10 days post-injury), as were levels of non-fluorescent chromoprotein. In addition, green fluorescent protein expression was upregulated in response to injury from 4 days post-injury, while cyan fluorescent protein expression was reduced. No shifts in the composition of coral-associated bacterial communities were evident following injury based on 16S rRNA gene amplicon pyrosequencing. Bacteria-specific fluorescence in situ hybridization also showed no evidence of bacterial colonization of the wound or regenerating tissues. Coral tissues showed near-complete regeneration of lesions within 10 days. This study demonstrates that corals exhibit immune responses that support rapid recovery following physical injury, maintain coral microbial homeostasis and prevent bacterial infestation that may compromise coral fitness. © 2015 John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
Microbe associated molecular pattern (MAMP)-triggered immunity (MTI) is an important component of the plant innate immunity response to invading pathogens. However, most of our knowledge of MTI comes from studies of model systems with relatively little work done with crop plants. In this work, we re...
Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard
2016-01-01
Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.
Plant Microbe Interactions in Post Genomic Era: Perspectives and Applications
Imam, Jahangir; Singh, Puneet K.; Shukla, Pratyoosh
2016-01-01
Deciphering plant–microbe interactions is a promising aspect to understand the benefits and the pathogenic effect of microbes and crop improvement. The advancement in sequencing technologies and various ‘omics’ tool has impressively accelerated the research in biological sciences in this area. The recent and ongoing developments provide a unique approach to describing these intricate interactions and test hypotheses. In the present review, we discuss the role of plant-pathogen interaction in crop improvement. The plant innate immunity has always been an important aspect of research and leads to some interesting information like the adaptation of unique immune mechanisms of plants against pathogens. The development of new techniques in the post - genomic era has greatly enhanced our understanding of the regulation of plant defense mechanisms against pathogens. The present review also provides an overview of beneficial plant–microbe interactions with special reference to Agrobacterium tumefaciens-plant interactions where plant derived signal molecules and plant immune responses are important in pathogenicity and transformation efficiency. The construction of various Genome-scale metabolic models of microorganisms and plants presented a better understanding of all metabolic interactions activated during the interactions. This review also lists the emerging repertoire of phytopathogens and its impact on plant disease resistance. Outline of different aspects of plant-pathogen interactions is presented in this review to bridge the gap between plant microbial ecology and their immune responses. PMID:27725809
Immune and stress responses in oysters with insights on adaptation.
Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude
2015-09-01
Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Host-microbe interactions in microgravity: assessment and implications.
Foster, Jamie S; Wheeler, Raymond M; Pamphile, Regine
2014-05-26
Spaceflight imposes several unique stresses on biological life that together can have a profound impact on the homeostasis between eukaryotes and their associated microbes. One such stressor, microgravity, has been shown to alter host-microbe interactions at the genetic and physiological levels. Recent sequencing of the microbiomes associated with plants and animals have shown that these interactions are essential for maintaining host health through the regulation of several metabolic and immune responses. Disruptions to various environmental parameters or community characteristics may impact the resiliency of the microbiome, thus potentially driving host-microbe associations towards disease. In this review, we discuss our current understanding of host-microbe interactions in microgravity and assess the impact of this unique environmental stress on the normal physiological and genetic responses of both pathogenic and mutualistic associations. As humans move beyond our biosphere and undergo longer duration space flights, it will be essential to more fully understand microbial fitness in microgravity conditions in order to maintain a healthy homeostasis between humans, plants and their respective microbiomes.
Host-Microbe Interactions in Microgravity: Assessment and Implications
Foster, Jamie S.; Wheeler, Raymond M.; Pamphile, Regine
2014-01-01
Spaceflight imposes several unique stresses on biological life that together can have a profound impact on the homeostasis between eukaryotes and their associated microbes. One such stressor, microgravity, has been shown to alter host-microbe interactions at the genetic and physiological levels. Recent sequencing of the microbiomes associated with plants and animals have shown that these interactions are essential for maintaining host health through the regulation of several metabolic and immune responses. Disruptions to various environmental parameters or community characteristics may impact the resiliency of the microbiome, thus potentially driving host-microbe associations towards disease. In this review, we discuss our current understanding of host-microbe interactions in microgravity and assess the impact of this unique environmental stress on the normal physiological and genetic responses of both pathogenic and mutualistic associations. As humans move beyond our biosphere and undergo longer duration space flights, it will be essential to more fully understand microbial fitness in microgravity conditions in order to maintain a healthy homeostasis between humans, plants and their respective microbiomes. PMID:25370197
Interplay Between Innate Immunity and the Plant Microbiota.
Hacquard, Stéphane; Spaepen, Stijn; Garrido-Oter, Ruben; Schulze-Lefert, Paul
2017-08-04
The innate immune system of plants recognizes microbial pathogens and terminates their growth. However, recent findings suggest that at least one layer of this system is also engaged in cooperative plant-microbe interactions and influences host colonization by beneficial microbial communities. This immune layer involves sensing of microbe-associated molecular patterns (MAMPs) by pattern recognition receptors (PRRs) that initiate quantitative immune responses to control host-microbial load, whereas diversification of MAMPs and PRRs emerges as a mechanism that locally sculpts microbial assemblages in plant populations. This suggests a more complex microbial management role of the innate immune system for controlled accommodation of beneficial microbes and in pathogen elimination. The finding that similar molecular strategies are deployed by symbionts and pathogens to dampen immune responses is consistent with this hypothesis but implies different selective pressures on the immune system due to contrasting outcomes on plant fitness. The reciprocal interplay between microbiota and the immune system likely plays a critical role in shaping beneficial plant-microbiota combinations and maintaining microbial homeostasis.
Freitak, Dalial; Wheat, Christopher W; Heckel, David G; Vogel, Heiko
2007-01-01
Background Insects helped pioneer, and persist as model organisms for, the study of specific aspects of immunity. Although they lack an adaptive immune system, insects possess an innate immune system that recognizes and destroys intruding microorganisms. Its operation under natural conditions has not been well studied, as most studies have introduced microbes to laboratory-reared insects via artificial mechanical wounding. One of the most common routes of natural exposure and infection, however, is via food; thus, the role of dietary microbial communities in herbivorous insect immune system evolution invites study. Here, we examine the immune system response and consequences of exposing a lepidopteran agricultural pest to non-infectious microorganisms via simple oral consumption. Results Immune system response was compared between Trichoplusia ni larvae reared on diets with or without non-pathogenic bacteria (Escherichia coli and Micrococcus luteus). Two major immune response-related enzymatic activities responded to diets differently – phenoloxidase activity was inhibited in the bacteria-fed larvae, whereas general antibacterial activity was enhanced. Eight proteins were highly expressed in the hemolymph of the bacteria fed larvae, among them immune response related proteins arylphorin, apolipophorin III and gloverin. Expression response among 25 putative immune response-related genes were assayed via RT-qPCR. Seven showed more than fivefold up regulation in the presence of bacterial diet, with 22 in total being differentially expressed, among them apolipophorin III, cecropin, gallerimycin, gloverin, lysozyme, and phenoloxidase inhibiting enzyme. Finally, potential life-history trade-offs were studied, with pupation time and pupal mass being negatively affected in bacteria fed larvae. Conclusion The presence of bacteria in food, even if non-pathogenic, can trigger an immune response cascade with life history tradeoffs. Trichoplusia ni larvae are able to detect
Innate and adaptive immune responses to cell death
Rock, Kenneth L.; Lai, Jiann-Jyh; Kono, Hajime
2011-01-01
Summary The immune system plays an essential role in protecting the host against infections and to accomplish this task has evolved mechanisms to recognize microbes and destroy them. In addition, it monitors the health of cells and responds to ones that have been injured and die, even if this occurs under sterile conditions. This process is initiated when dying cells expose intracellular molecules that can be recognized by cells of the innate immune system. As a consequence of this recognition, dendritic cells are activated in ways that help to promote T-cell responses to antigens associated with the dying cells. In addition, macrophages are stimulated to produce the cytokine interleukin-1 that then acts on radioresistant parenchymal cells in the host in ways that drive a robust inflammatory response. In addition to dead cells, a number of other sterile particles and altered physiological states can similarly stimulate an inflammatory response and do so through common pathways involving the inflammasome and interleukin-1. These pathways underlie the pathogenesis of a number of diseases. PMID:21884177
Yersinia vs. host Immunity: how a pathogen evades or triggers a protective response
Chung, Lawton K.; Bliska, James B.
2015-01-01
The human pathogenic Yersinia species cause diseases that represent a significant source of morbidity and mortality. Despite this, specific mechanisms underlying Yersinia pathogenesis and protective host responses remain poorly understood. Recent studies have shown that Yersinia disrupt cell death pathways, perturb inflammatory processes and exploit immune cells to promote disease. The ensuing host responses following Yersinia infection include coordination of innate and adaptive immune responses in an attempt to control bacterial replication. Here, we highlight current advances in our understanding of the interactions between the pathogenic yersiniae and host cells, as well as the protective host responses mobilized to counteract these pathogens. Together, these studies enhance our understanding of Yersinia pathogenesis and highlight the ongoing battle between host and microbe. PMID:26638030
Host genetics affect microbial ecosystems via host immunity.
El Kafsi, Hela; Gorochov, Guy; Larsen, Martin
2016-10-01
Genetic evolution of multicellular organisms has occurred in response to environmental challenges, including competition for nutrients, climate change, physical and chemical stressors, and pathogens. However, fitness of an organism is dependent not only on defense efficacy, but also on the ability to take advantage of symbiotic organisms. Indeed, microbes not only encompass pathogenicity, but also enable efficient nutrient uptake from diets nondegradable by the host itself. Moreover, microbes play important roles in the development of host immunity. Here we review associations between specific host genes and variance in microbiota composition and compare with interactions between microbes and host immunity. Recent genome-wide association studies reveal that symbiosis between host and microbiota is the exquisite result of genetic coevolution. Moreover, a subset of microbes from human and mouse microbiota have been identified to interact with humoral and cellular immunity. Interestingly, microbes associated with both host genetics and host immunity are taxonomically related. Most involved are Bifidobacterium, Lactobacillus, and Akkermansia, which are dually associated with both host immunity and host genetics. We conclude that future therapeutics targeting microbiota in the context of chronic inflammatory diseases need to consider both immune and genetic host features associated with microbiota homeostasis.
Insights into the Roles of Gut Microbes in Obesity
Sanz, Yolanda; Santacruz, Arlette; De Palma, Giada
2008-01-01
Obesity is a major public health issue as it enhances the risk of suffering several chronic diseases of increasing prevalence. Obesity results from an imbalance between energy intake and expenditure, associated with a chronic low-grade inflammation. Gut microbes are considered to contribute to body weight regulation and related disorders by influencing metabolic and immune host functions. The gut microbiota as a whole improves the host's ability to extract and store energy from the diet leading to body weight gain, while specific commensal microbes seem to exert beneficial effects on bile salt, lipoprotein, and cholesterol metabolism. The gut microbiota and some probiotics also regulate immune functions, protecting the host form infections and chronic inflammation. In contrast, dysbiosis and endotoxaemia may be inflammatory factors responsible for developing insulin resistance and body weight gain. In the light of the link between the gut microbiota, metabolism, and immunity, the use of dietary strategies to modulate microbiota composition is likely to be effective in controlling metabolic disorders. Although so far only a few preclinical and clinical trials have demonstrated the effects of specific gut microbes and prebiotics on biological markers of these disorders, the findings indicate that advances in this field could be of value in the struggle against obesity and its associated-metabolic disorders. PMID:19259329
Pickle Flavors Relish in Drosophila Immunity.
Salminen, Tiina Susanna; Rämet, Mika
2016-09-14
Immune responses must be tightly controlled to avoid host damage. In Drosophila, two NF-κB signaling pathways, Toll and Imd, mediate host immune responses. In this issue of Cell Host & Microbe, Morris et al. (2016) introduce Pickle, a nuclear IκB that inhibits Drosophila immune signaling by modulating the NF-κB Relish. Copyright © 2016 Elsevier Inc. All rights reserved.
Yersinia versus host immunity: how a pathogen evades or triggers a protective response.
Chung, Lawton K; Bliska, James B
2016-02-01
The human pathogenic Yersinia species cause diseases that represent a significant source of morbidity and mortality. Despite this, specific mechanisms underlying Yersinia pathogenesis and protective host responses remain poorly understood. Recent studies have shown that Yersinia disrupt cell death pathways, perturb inflammatory processes and exploit immune cells to promote disease. The ensuing host responses following Yersinia infection include coordination of innate and adaptive immune responses in an attempt to control bacterial replication. Here, we highlight current advances in our understanding of the interactions between the pathogenic yersiniae and host cells, as well as the protective host responses mobilized to counteract these pathogens. Together, these studies enhance our understanding of Yersinia pathogenesis and highlight the ongoing battle between host and microbe. Copyright © 2015 Elsevier Ltd. All rights reserved.
Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...
Immune and genetic gardening of the intestinal microbiome
Jacobs, Jonathan P.; Braun, Jonathan
2014-01-01
The mucosal immune system – consisting of adaptive and innate immune cells as well as the epithelium – is profoundly influenced by its microbial environment. There is now growing evidence that the converse is also true, that the immune system shapes the composition of the intestinal microbiome. During conditions of health, this bidirectional interaction achieves a homeostasis in which inappropriate immune responses to nonpathogenic microbes are averted and immune activity suppresses blooms of potentially pathogenic microbes (pathobionts). Genetic alteration in immune/epithelial function can affect host gardening of the intestinal microbiome, contributing to the diversity of intestinal microbiota within a population and in some cases allowing for unfavorable microbial ecologies (dysbiosis) that confer disease susceptibility. PMID:24613921
Endogenous egg immune defenses in the yellow mealworm beetle (Tenebrio molitor).
Jacobs, Chris G C; Gallagher, Joe D; Evison, Sophie E F; Heckel, David G; Vilcinskas, Andreas; Vogel, Heiko
2017-05-01
In order to survive microbe encounters, insects rely on both physical barriers as well as local and systemic immune responses. Most research focusses on adult or larval defenses however, whereas insect eggs are also in need of protection. Lately, the defense of eggs against microbes has received an increasing amount of attention, be it through endogenous egg defenses, trans-generational immune priming (TGIP) or parental investment. Here we studied the endogenous immune response in eggs and adults of Tenebrio molitor. We show that many immune genes are induced in both adults and eggs. Furthermore, we show that eggs reach comparable levels of immune gene expression as adults. These findings show that the eggs of Tenebrio are capable of an impressive endogenous immune response, and indicate that such inducible egg defenses are likely common in insects. Copyright © 2016 Elsevier Ltd. All rights reserved.
Innate immune memory in plants.
Reimer-Michalski, Eva-Maria; Conrath, Uwe
2016-08-01
The plant innate immune system comprises local and systemic immune responses. Systemic plant immunity develops after foliar infection by microbial pathogens, upon root colonization by certain microbes, or in response to physical injury. The systemic plant immune response to localized foliar infection is associated with elevated levels of pattern-recognition receptors, accumulation of dormant signaling enzymes, and alterations in chromatin state. Together, these systemic responses provide a memory to the initial infection by priming the remote leaves for enhanced defense and immunity to reinfection. The plant innate immune system thus builds immunological memory by utilizing mechanisms and components that are similar to those employed in the trained innate immune response of jawed vertebrates. Therefore, there seems to be conservation, or convergence, in the evolution of innate immune memory in plants and vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.
[Plant immune system: the basal immunity].
Shamraĭ, S N
2014-01-01
Plants have an efficient system of innate immunity which is based on the effective detection of potentially harmful microorganisms and rapid induction of defense responses. The first level of plant immunity is the basal immunity which is induced by the conserved molecular structures of microbes such as bacterial flagellins or fungal chitin, or molecules that result from the interaction of plants with pathogens, for example oligosaccharides and peptides ("danger signals"). Plants recognize these inducers through receptors localized to the plasma membrane, represented mainly receptor-like protein kinases or receptor-like proteins. Activation of the receptor by a ligand triggers a complex network of signaling events which eventually cause an array of plant defense responses to prevent further spread of the pathogen.
Modulating airway defenses against microbes.
Reynolds, Herbert Y
2002-05-01
Prevention and treatment of respiratory infections remain an important health care challenge as the US population ages, contains more susceptible or high-risk people, and encounters new pathogens or antibiotic resistant bacteria. Reasonably protective vaccines against very common microbes are available for childhood and adult immunization, but, generally, these are underutilized. A broader definition of higher risk individuals is evolving, which will include more for immunization. Different approaches to vaccine development through design of new component vaccines are necessary. This review has updated host defense mechanisms at three levels in the human respiratory tract: naso-oropharynx (upper airways), conducting airways, and alveolar space. Examples of representative pathogenic microbes have been inserted at the respective airway segment where they may colonize or create infection (influenza, measles virus, Porphyromonas gingivalis causing periodontitis, Bordetella pertussis, Chlamydia pneumoniae, Streptococcus pneumoniae, and Bacillus anthracis ). Hopefully, microbe-host interactions will suggest new approaches for preventing these kinds of infections.
Reciprocal Interactions of the Intestinal Microbiota and Immune System
Maynard, Craig L.; Elson, Charles O.; Hatton, Robin D.; Weaver, Casey T.
2013-01-01
Preface Emergence of the adaptive immune system in vertebrates set the stage for evolution of an advanced symbiotic relationship with the intestinal microbiota. The defining features of specificity and memory that characterize adaptive immunity have afforded vertebrates mechanisms for efficiently tailoring immune responses to diverse types of microbes, whether to promote mutualism or host defense. These same attributes carry risk for immune-mediated diseases that are increasingly linked to the intestinal microbiota. Understanding how the adaptive immune system copes with the remarkable number and diversity of microbes that colonize the digestive tract, and how it integrates with more primitive innate immune mechanisms to maintain immune homeostasis, holds considerable promise for new approaches to modulate immune networks in order to treat and prevent disease. PMID:22972296
Lee, Kyung-Ah; Kim, Sung-Hee; Kim, Eun-Kyoung; Ha, Eun-Mi; You, Hyejin; Kim, Boram; Kim, Min-Ji; Kwon, Youngjoo; Ryu, Ji-Hwan; Lee, Won-Jae
2013-05-09
All metazoan guts are subjected to immunologically unique conditions in which an efficient antimicrobial system operates to eliminate pathogens while tolerating symbiotic commensal microbiota. However, the molecular mechanisms controlling this process are only partially understood. Here, we show that bacterial-derived uracil acts as a ligand for dual oxidase (DUOX)-dependent reactive oxygen species generation in Drosophila gut and that the uracil production in bacteria causes inflammation in the gut. The acute and controlled uracil-induced immune response is required for efficient elimination of bacteria, intestinal cell repair, and host survival during infection of nonresident species. Among resident gut microbiota, uracil production is absent in symbionts, allowing harmonious colonization without DUOX activation, whereas uracil release from opportunistic pathobionts provokes chronic inflammation. These results reveal that bacteria with distinct abilities to activate uracil-induced gut inflammation, in terms of intensity and duration, act as critical factors that determine homeostasis or pathogenesis in gut-microbe interactions. Copyright © 2013 Elsevier Inc. All rights reserved.
Infections in MS: An innate immunity perspective.
Hänninen, A
2017-11-01
Multiple sclerosis is a multifaceted inflammatory-autoimmune disease, which shows remarkable heterogeneity in its clinical presentation, disease progression and in tissue lesions in the CNS. Focal lesions in white matter consist of immune effector cells, antibodies, and complement deposits in varying combinations, suggesting that immune mechanisms related to CNS pathology are multiple. Although adaptive immunity to myelin antigens is essential in MS pathogenesis, innate immune mechanisms are likely involved in its initiation and perpetuation. One key question is if recognition of infectious agents and microbial products by innate immune mechanisms impacts on MS and if so, how and where? This short review aims at conceptualizing how interactions between microbes and innate immune mechanisms could contribute to MS pathogenesis. Consideration is given to initiation of local inflammation and to myelin-specific immune responses, and how innate immunity and microbes may contribute to these. Recent advances in our understanding of lymphatic drainage of CNS, its immune surveillance and effects of gut microbiota and obesity on systemic endotoxin levels and T-cell priming may open new perspectives to understanding the roles that infectious agents and microbes may have in MS. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Nosratababadi, Reza; Bagheri, Vahid; Zare-Bidaki, Mohammad; Hakimi, Hamid; Zainodini, Nahid; Kazemi Arababadi, Mohammad
2017-04-01
Chlamydia species are obligate intracellular pathogens causing different infectious diseases particularly asymptomatic genital infections and are also responsible for a wide range of complications. Previous studies showed that there are different immune responses to Chlamydia species and their infections are limited to some cases. Moreover, Chlamydia species are able to alter immune responses through modulating the expression of some immune system related molecules including cytokines. Toll like receptors (TLRs) belonge to pathogen recognition receptors (PRRs) and play vital roles in recognition of microbes and stimulation of appropriate immune responses. Therefore, it appears that TLRs may be considered as important sensors for recognition of Chlamydia and promotion of immune responses against these bacterial infections. Accordingly, TLR4 detects several microbial PAMPs such as bacterial lipopolysacharide (LPS) and subsequently activates transcription from pro-inflammatory cytokines in both MYD88 and TRIF pathways dependent manner. The purpose of this review is to provide the recent data about the status and major roles played by TLR4 in Chlamydia species recognition and promotion of immune responses against these infections and also the relationship between TLR4 activities and pathogenesis of Chlamydia infections. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fluorogenic Cell-Based Biosensors for Monitoring Microbes
NASA Technical Reports Server (NTRS)
Curtis, Theresa; Salazar, Noe; Tabb, Joel; Chase, Chris
2010-01-01
Fluorogenic cell-based sensor systems for detecting microbes (especially pathogenic ones) and some toxins and allergens are undergoing development. These systems harness the natural signaltransduction and amplification cascades that occur in mast cells upon activation with antigens. These systems include (1) fluidic biochips for automated containment of samples, reagents, and wastes and (2) sensitive, compact fluorometers for monitoring the fluorescent responses of mast cells engineered to contain fluorescent dyes. It should be possible to observe responses within minutes of adding immune complexes. The systems have been shown to work when utilizing either immunoglobulin E (IgE) antibodies or traditionally generated rat antibodies - a promising result in that it indicates that the systems could be developed to detect many target microbes. Chimeric IgE antibodies and rat immunoglobulin G (IgG) antibodies could be genetically engineered for recognizing biological and chemical warfare agents and airborne and food-borne allergens. Genetic engineering efforts thus far have yielded (1) CD14 chimeric antibodies that recognize both Grampositive and Gram-negative bacteria and bind to the surfaces of mast cells, eliciting a degranulation response and (2) rat IgG2a antibodies that act similarly in response to low levels of canine parvovirus.
Valdés-López, Oswaldo; Thibivilliers, Sandra; Qiu, Jing; Xu, Wayne Wenzhong; Nguyen, Tran H.N.; Libault, Marc; Le, Brandon H.; Goldberg, Robert B.; Hill, Curtis B.; Hartman, Glen L.; Diers, Brian; Stacey, Gary
2011-01-01
Microbe-associated molecular pattern-triggered immunity (MTI) is an important component of the plant innate immunity response to invading pathogens. However, most of our knowledge of MTI comes from studies of model systems with relatively little work done with crop plants. In this work, we report on variation in both the microbe-associated molecular pattern-triggered oxidative burst and gene expression across four soybean (Glycine max) genotypes. Variation in MTI correlated with the level of pathogen resistance for each genotype. A quantitative trait locus analysis on these traits identified four loci that appeared to regulate gene expression during MTI in soybean. Likewise, we observed that both MTI variation and pathogen resistance were quantitatively inherited. The approach utilized in this study may have utility for identifying key resistance loci useful for developing improved soybean cultivars. PMID:21963820
Parasite-specific immune response in adult Drosophila melanogaster: a genomic study
Roxström-Lindquist, Katarina; Terenius, Olle; Faye, Ingrid
2004-01-01
Insects of the order Diptera are vectors for parasitic diseases such as malaria, sleeping sickness and leishmania. In the search for genes encoding proteins involved in the antiparasitic response, we have used the protozoan parasite Octosporea muscaedomesticae for oral infections of adult Drosophila melanogaster. To identify parasite-specific response molecules, other flies were exposed to virus, bacteria or fungi in parallel. Analysis of gene expression patterns after 24 h of microbial challenge, using Affymetrix oligonucleotide microarrays, revealed a high degree of microbe specificity. Many serine proteases, key intermediates in the induction of insect immune responses, were uniquely expressed following infection of the different organisms. Several lysozyme genes were induced in response to Octosporea infection, while in other treatments they were not induced or downregulated. This suggests that lysozymes are important in antiparasitic defence. PMID:14749722
Homeostatic Immunity and the Microbiota.
Belkaid, Yasmine; Harrison, Oliver J
2017-04-18
The microbiota plays a fundamental role in the induction, education, and function of the host immune system. In return, the host immune system has evolved multiple means by which to maintain its symbiotic relationship with the microbiota. The maintenance of this dialogue allows the induction of protective responses to pathogens and the utilization of regulatory pathways involved in the sustained tolerance to innocuous antigens. The ability of microbes to set the immunological tone of tissues, both locally and systemically, requires tonic sensing of microbes and complex feedback loops between innate and adaptive components of the immune system. Here we review the dominant cellular mediators of these interactions and discuss emerging themes associated with our current understanding of the homeostatic immunological dialogue between the host and its microbiota. Published by Elsevier Inc.
Homeostatic immunity and the microbiota
Belkaid, Yasmine; Harrison, Oliver J.
2017-01-01
The microbiota plays a fundamental role in the induction, education and function of the host immune system. In return, the host immune system has evolved multiple means by which to maintain its symbiotic relationship with the microbiota. The maintenance of this dialogue allows the induction of protective responses to pathogens and the utilization of regulatory pathways involved in the sustained tolerance to innocuous antigens. The ability of microbes to set the immunological tone of tissues, both locally and systemically, requires tonic sensing of microbes and complex feedback loops between innate and adaptive components of the immune system. In this review, we will highlight the dominant cellular mediators of these interactions and discuss emerging themes associated with our current understanding of the homeostatic immunological dialogue between the host and its microbiota. PMID:28423337
Mannala, Gopala K.; Izar, Benjamin; Rupp, Oliver; Schultze, Tilman; Goesmann, Alexander; Chakraborty, Trinad; Hain, Torsten
2017-01-01
microRNAs (miRNAs) coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth), a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated) in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates. PMID:29312175
The developing immune system - from foetus to toddler.
Ygberg, Sofia; Nilsson, Anna
2012-02-01
During foetal development, neonatal period and childhood, the immune system is constantly maturing. In the foetus, infection responsiveness is low and associates with spontaneous abortion. During the neonatal period, the infection response shifts towards a more pro-inflammatory response. The immune system of the newborn acquires adaptive features as a result of exposure to microbes. The development of the human immune system is a continuous process where both accelerated and retarded development is deleterious. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.
Spiering, Martin J
2015-01-01
The human body regularly encounters and combats many pathogenic organisms and toxic molecules. Its ensuing responses to these disease-causing agents involve two interrelated systems: innate immunity and adaptive (or acquired) immunity. Innate immunity is active at several levels, both at potential points of entry and inside the body (see figure). For example, the skin represents a physical barrier preventing pathogens from invading internal tissues. Digestive enzymes destroy microbes that enter the stomach with food. Macrophages and lymphocytes, equipped with molecular detectors, such as Toll-like receptors (TLRs), which latch onto foreign structures and activate cellular defenses, patrol the inside of the body. These immune cells sense and devour microbes, damaged cells, and other foreign materials in the body. Certain proteins in the blood (such as proteins of the complement system and those released by natural killer cells, along with antimicrobial host-defense peptides) attach to foreign organisms and toxins to initiate their destruction.
Brown, Aisling F.; Leech, John M.; Rogers, Thomas R.; McLoughlin, Rachel M.
2014-01-01
In apparent contrast to its invasive potential Staphylococcus aureus colonizes the anterior nares of 20–80% of the human population. The relationship between host and microbe appears particularly individualized and colonization status seems somehow predetermined. After decolonization, persistent carriers often become re-colonized with their prior S. aureus strain, whereas non-carriers resist experimental colonization. Efforts to identify factors facilitating colonization have thus far largely focused on the microorganism rather than on the human host. The host responds to S. aureus nasal colonization via local expression of anti-microbial peptides, lipids, and cytokines. Interplay with the co-existing microbiota also influences colonization and immune regulation. Transient or persistent S. aureus colonization induces specific systemic immune responses. Humoral responses are the most studied of these and little is known of cellular responses induced by colonization. Intriguingly, colonized patients who develop bacteremia may have a lower S. aureus-attributable mortality than their non-colonized counterparts. This could imply a staphylococcal-specific immune “priming” or immunomodulation occurring as a consequence of colonization and impacting on the outcome of infection. This has yet to be fully explored. An effective vaccine remains elusive. Anti-S. aureus vaccine strategies may need to drive both humoral and cellular immune responses to confer efficient protection. Understanding the influence of colonization on adaptive response is essential to intelligent vaccine design, and may determine the efficacy of vaccine-mediated immunity. Clinical trials should consider colonization status and the resulting impact of this on individual patient responses. We urgently need an increased appreciation of colonization and its modulation of host immunity. PMID:24409186
A newly evolved Drosophila Cytorace-9 shows trade-off between longevity and immune response.
Sinam, Yoirentomba Meetei; Chatterjee, Arunita; Ranjini, Mysore S; Poojari, Adarsh; Nagarajan, Aarthi; Ramachandra, Nallur B; Nongthomba, Upendra
2016-10-01
Species with an efficient immune system would be at an advantage to evade pathogenic challenges and adapt to an ever changing ecological niche. The upkeep of immunity is a costly affair, thus trade-offs between immunity and other life history traits are expected. However, studies on the relation between immunity and life span have yielded paradoxical results. Drosophila Cytoraces, being at different stages of evolutionary divergence, provide an excellent experimental model system to study how evolving populations gain novel traits in the absence of selection. We found that in the absence of pathogenic infections, the Cytorace-9 flies lived longer than those of Cytorace-3. However, when these Cytoraces were challenged with different pathogenic microbes, the trend was opposite. After infection with pathogens, the long-lived Cytorace-9 survived worse than the short lived Cytorace-3, which can be attributed to a reduction in its immune response. This study provides evidence to support the existence of a trade-off between life span and immunity. Copyright © 2016 Elsevier B.V. All rights reserved.
Pattern Recognition Receptors in Innate Immunity, Host Defense, and Immunopathology
ERIC Educational Resources Information Center
Suresh, Rahul; Mosser, David M.
2013-01-01
Infection by pathogenic microbes initiates a set of complex interactions between the pathogen and the host mediated by pattern recognition receptors. Innate immune responses play direct roles in host defense during the early stages of infection, and they also exert a profound influence on the generation of the adaptive immune responses that ensue.…
YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.
Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio
2018-04-01
Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.
Kronsteiner, Barbara; Bassaganya-Riera, Josep; Philipson, Casandra; Viladomiu, Monica; Carbo, Adria; Abedi, Vida; Hontecillas, Raquel
2016-01-01
Abstract Helicobacter pylori is the dominant member of the gastric microbiota in over half of the human population of which 5–15% develop gastritis or gastric malignancies. Immune responses to H. pylori are characterized by mixed T helper cell, cytotoxic T cell and NK cell responses. The presence of Tregs is essential for the control of gastritis and together with regulatory CX3CR1+ mononuclear phagocytes and immune-evasion strategies they enable life-long persistence of H. pylori. This H. pylori-induced regulatory environment might contribute to its cross-protective effect in inflammatory bowel disease and obesity. Here we review host-microbe interactions, the development of pro- and anti-inflammatory immune responses and how the latter contribute to H. pylori's role as beneficial member of the gut microbiota. Furthermore, we present the integration of existing and new data into a computational/mathematical model and its use for the investigation of immunological mechanisms underlying initiation, progression and outcomes of H. pylori infection. PMID:26939848
Probiotics and Innate and Adaptive Immune Responses in Premature Infants
Underwood, Mark A.
2017-01-01
Premature infants are at increased risk for morbidity and mortality due to necrotizing enterocolitis (NEC) and sepsis. Probiotics decrease the risk of NEC and death in premature infants; however, mechanisms of action are unclear. A wide variety of probiotic species have been evaluated for potential beneficial properties in vitro, in animal models, and in clinical trials of premature infants. Although there is variation by species and even strain, common mechanisms of protection include attenuation of intestinal inflammation, apoptosis, dysmotility, permeability, supplanting other gut microbes through production of bacteriocins, and more effective use of available nutrients. Here, we review the most promising probiotics and what is known about their impact on the innate and adaptive immune response. PMID:28966796
Feliform carnivores have a distinguished constitutive innate immune response
Heinrich, Sonja K.; Wachter, Bettina; Aschenborn, Ortwin H. K.; Thalwitzer, Susanne; Melzheimer, Jörg; Hofer, Heribert; Czirják, Gábor Á.
2016-01-01
ABSTRACT Determining the immunological phenotype of endangered and threatened populations is important to identify those vulnerable to novel pathogens. Among mammals, members of the order Carnivora are particularly threatened by diseases. We therefore examined the constitutive innate immune system, the first line of protection against invading microbes, of six free-ranging carnivore species; the black-backed jackal (Canis mesomelas), the brown hyena (Hyena brunnea), the caracal (Caracal caracal), the cheetah (Acinonyx jubatus), the leopard (Panthera pardus) and the lion (Panthera leo) using a bacterial killing assay. The differences in immune responses amongst the six species were independent of their foraging behaviour, body mass or social organisation but reflected their phylogenetic relatedness. The bacterial killing capacity of black-backed jackals, a member of the suborder Caniformia, followed the pattern established for a wide variety of vertebrates. In contrast, the five representatives of the suborder Feliformia demonstrated a killing capacity at least an order of magnitude higher than any species reported previously, with a particularly high capacity in caracals and cheetahs. Our results suggest that the immunocompetence of threatened felids such as the cheetah has been underestimated and its assessment ought to consider both innate and adaptive components of the immune system. PMID:27044323
Feliform carnivores have a distinguished constitutive innate immune response.
Heinrich, Sonja K; Wachter, Bettina; Aschenborn, Ortwin H K; Thalwitzer, Susanne; Melzheimer, Jörg; Hofer, Heribert; Czirják, Gábor Á
2016-05-15
Determining the immunological phenotype of endangered and threatened populations is important to identify those vulnerable to novel pathogens. Among mammals, members of the order Carnivora are particularly threatened by diseases. We therefore examined the constitutive innate immune system, the first line of protection against invading microbes, of six free-ranging carnivore species; the black-backed jackal (Canis mesomelas), the brown hyena (Hyena brunnea), the caracal (Caracal caracal), the cheetah (Acinonyx jubatus), the leopard (Panthera pardus) and the lion (Panthera leo) using a bacterial killing assay. The differences in immune responses amongst the six species were independent of their foraging behaviour, body mass or social organisation but reflected their phylogenetic relatedness. The bacterial killing capacity of black-backed jackals, a member of the suborder Caniformia, followed the pattern established for a wide variety of vertebrates. In contrast, the five representatives of the suborder Feliformia demonstrated a killing capacity at least an order of magnitude higher than any species reported previously, with a particularly high capacity in caracals and cheetahs. Our results suggest that the immunocompetence of threatened felids such as the cheetah has been underestimated and its assessment ought to consider both innate and adaptive components of the immune system. © 2016. Published by The Company of Biologists Ltd.
[IMMUNE SYSTEM INTERNSHIP WITH SYMBIOTIC MICROORGANISMS IN GNOTOBIOTIC ANIMAL'S INTESTINUM ILEUM].
Kochlamasashvili, B; Gogiashvili, L; Jandieri, K
2017-11-01
Structures, responsible for acceptive (comensaling relation) and protective (pathogenic defense) immunity, were studied and compared in small intestine - to ileum mucosa. Data shown, that main application of the both domains of immune system is to support the correlation between body and foreign microbes, but they response is different. Most significant differences are as follows: in acceptive reactions presented only in aseptic animals - gnotobionts, inflammatory changes absent, so immune reaction complex develops into physiological condition. Symbiotic reactions release in mucosa epithelial cells, also in cells, responsible for adaptive and congenital immune reactivity. Thus, acceptive immune reactions contribute symbiotic biocenosis versus elimination; which is function of protective immunity.
Antigenic Variation and Immune Escape in the MTBC
2017-01-01
Microbes that infect other organisms encounter host immune responses, and must overcome or evade innate and adaptive immune responses to successfully establish infection. Highly successful microbial pathogens, including M. tuberculosis, are able to evade adaptive immune responses (mediated by antibodies and/or T lymphocytes) and thereby establish long-term chronic infection. One mechanism that diverse pathogens use to evade adaptive immunity is antigenic variation, in which structural variants emerge that alter recognition by established immune responses and allow those pathogens to persist and/or to infect previously-immune hosts. Despite the wide use of antigenic variation by diverse pathogens, this mechanism appears to be infrequent in M. tuberculosis, as indicated by findings that known and predicted human T cell epitopes in this organism are highly conserved, although there are exceptions. These findings have implications for diagnostic tests that are based on measuring host immune responses, and for vaccine design and development. PMID:29116635
The Plant Actin Cytoskeleton Responds to Signals from Microbe-Associated Molecular Patterns
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henty-Ridilla, Jessica L.; Shimono, Masaki; Li, Jiejie
2013-04-04
Plants are constantly exposed to a large and diverse array of microbes; however, most plants are immune to the majority of potential invaders and susceptible to only a small subset of pathogens. The cytoskeleton comprises a dynamic intracellular framework that responds rapidly to biotic stresses and supports numerous fundamental cellular processes including vesicle trafficking, endocytosis and the spatial distribution of organelles and protein complexes. For years, the actin cytoskeleton has been assumed to play a role in plant innate immunity against fungi and oomycetes, based largely on static images and pharmacological studies. To date, however, there is little evidence thatmore » the host-cell actin cytoskeleton participates in responses to phytopathogenic bacteria. Here, we quantified the spatiotemporal changes in host-cell cytoskeletal architecture during the immune response to pathogenic and non-pathogenic strains of Pseudomonas syringae pv. tomato DC3000. Two distinct changes to host cytoskeletal arrays were observed that correspond to distinct phases of plant-bacterial interactions i.e. the perception of microbe-associated molecular patterns (MAMPs) during pattern-triggered immunity (PTI) and perturbations by effector proteins during effector-triggered susceptibility (ETS). We demonstrate that an immediate increase in actin filament abundance is a conserved and novel component of PTI. Notably, treatment of leaves with a MAMP peptide mimic was sufficient to elicit a rapid change in actin organization in epidermal cells, and this actin response required the host-cell MAMP receptor kinase complex, including FLS2, BAK1 and BIK1. Finally, we found that actin polymerization is necessary for the increase in actin filament density and that blocking this increase with the actin-disrupting drug latrunculin B leads to enhanced susceptibility of host plants to pathogenic and non-pathogenic bacteria.« less
Intestinal commensal microbes as immune modulators
Ivanov, Ivaylo I.; Honda, Kenya
2012-01-01
Commensal bacteria are necessary for the development and maintenance of a healthy immune system. Harnessing the ability of microbiota to affect host immunity is considered an important therapeutic strategy for many mucosal and non-mucosal immune-related conditions, such as inflammatory bowel diseases (IBD), celiac disease, metabolic syndrome, diabetes and microbial infections. In addition to well-established immunostimulatory effects of the microbiota, the presence of individual mutualistic commensal bacteria with immunomodulatory effects has been described. These organisms are permanent members of the commensal microbiota and affect host immune homeostasis in specific ways. Identification of individual examples of such immunomodulatory commensals and understanding their mechanisms of interaction with the host will be invaluable in designing therapeutic strategies to reverse intestinal dysbiosis and recover immunological homeostasis. PMID:23084918
A novel mode of induction of the humoral innate immune response in Drosophila larvae
Kenmoku, Hiroyuki
2017-01-01
ABSTRACT Drosophila adults have been utilized as a genetically tractable model organism to decipher the molecular mechanisms of humoral innate immune responses. In an effort to promote the utility of Drosophila larvae as an additional model system, in this study, we describe a novel aspect of an induction mechanism for innate immunity in these larvae. By using a fine tungsten needle created for manipulating semi-conductor devices, larvae were subjected to septic injury. However, although Toll pathway mutants were susceptible to infection with Gram-positive bacteria as had been shown for Drosophila adults, microbe clearance was not affected in the mutants. In addition, Drosophila larvae were found to be sensitive to mechanical stimuli with respect to the activation of a sterile humoral response. In particular, pinching with forceps to a degree that might cause minor damage to larval tissues could induce the expression of the antifungal peptide gene Drosomycin; notably, this induction was partially independent of the Toll and immune deficiency pathways. We therefore propose that Drosophila larvae might serve as a useful model to analyze the infectious and non-infectious inflammation that underlies various inflammatory diseases such as ischemia, atherosclerosis and cancer. PMID:28250052
Intestinal commensal microbes as immune modulators.
Ivanov, Ivaylo I; Honda, Kenya
2012-10-18
Commensal bacteria are necessary for the development and maintenance of a healthy immune system. Harnessing the ability of microbiota to affect host immunity is considered an important therapeutic strategy for many mucosal and nonmucosal immune-related conditions, such as inflammatory bowel diseases (IBDs), celiac disease, metabolic syndrome, diabetes, and microbial infections. In addition to well-established immunostimulatory effects of the microbiota, the presence of individual mutualistic commensal bacteria with immunomodulatory effects has been described. These organisms are permanent members of the commensal microbiota and affect host immune homeostasis in specific ways. Identification of individual examples of such immunomodulatory commensals and understanding their mechanisms of interaction with the host will be invaluable in designing therapeutic strategies to reverse intestinal dysbiosis and recover immunological homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.
Towards engineering of hormonal crosstalk in plant immunity.
Shigenaga, Alexandra M; Berens, Matthias L; Tsuda, Kenichi; Argueso, Cristiana T
2017-08-01
Plant hormones regulate physiological responses in plants, including responses to pathogens and beneficial microbes. The last decades have provided a vast amount of evidence about the contribution of different plant hormones to plant immunity, and also of how they cooperate to orchestrate immunity activation, in a process known as hormone crosstalk. In this review we highlight the complexity of hormonal crosstalk in immunity and approaches currently being used to further understand this process, as well as perspectives to engineer hormone crosstalk for enhanced pathogen resistance and overall plant fitness. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bacterial-modulated host immunity and stem cell activation for gut homeostasis.
Lee, Won-Jae
2009-10-01
Although it is widely accepted that dynamic cross-talk between gut epithelia and microorganisms must occur to achieve gut homeostasis, the critical mechanisms by which gut-microbe interactions are regulated remain uncertain. In this issue of Genes & Development, Buchon and colleagues (pp. 2333-2344) revealed that the reaction of the gut to microorganisms is not restricted to activating immune systems, but extends to integrated responses essential for gut tissue homeostasis, including self-renewal and the differentiation of stem cells. Further investigation of the connection between immune response and stem cell regulation at the molecular level in the microbe-laden mucosal epithelia will accelerate our understanding of the regulatory mechanisms of gut homeostasis and of the pathogenesis of diseases such as chronic inflammatory diseases and colorectal cancers.
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Lipid Catabolism Fuels Drosophila Gut Immunity.
Masuzzo, Ambra; Royet, Julien
2018-03-14
Immune responses and metabolic regulation are tightly coupled in animals, but the underlying mechanistic connections are not fully understood. In this issue of Cell Host & Microbe, Lee et al. (2018) reveal how sustained ROS production in the gut depends on an upstream metabolic switch. Copyright © 2018 Elsevier Inc. All rights reserved.
A novel mode of induction of the humoral innate immune response in Drosophila larvae.
Kenmoku, Hiroyuki; Hori, Aki; Kuraishi, Takayuki; Kurata, Shoichiro
2017-03-01
Drosophila adults have been utilized as a genetically tractable model organism to decipher the molecular mechanisms of humoral innate immune responses. In an effort to promote the utility of Drosophila larvae as an additional model system, in this study, we describe a novel aspect of an induction mechanism for innate immunity in these larvae. By using a fine tungsten needle created for manipulating semi-conductor devices, larvae were subjected to septic injury. However, although Toll pathway mutants were susceptible to infection with Gram-positive bacteria as had been shown for Drosophila adults, microbe clearance was not affected in the mutants. In addition, Drosophila larvae were found to be sensitive to mechanical stimuli with respect to the activation of a sterile humoral response. In particular, pinching with forceps to a degree that might cause minor damage to larval tissues could induce the expression of the antifungal peptide gene Drosomycin ; notably, this induction was partially independent of the Toll and immune deficiency pathways. We therefore propose that Drosophila larvae might serve as a useful model to analyze the infectious and non-infectious inflammation that underlies various inflammatory diseases such as ischemia, atherosclerosis and cancer. © 2017. Published by The Company of Biologists Ltd.
SMAD regulatory networks construct a balanced immune system.
Malhotra, Nidhi; Kang, Joonsoo
2013-05-01
A balanced immune response requires combating infectious assaults while striving to maintain quiescence towards the self. One of the central players in this process is the pleiotropic cytokine transforming growth factor-β (TGF-β), whose deficiency results in spontaneous systemic autoimmunity in mice. The dominant function of TGF-β is to regulate the peripheral immune homeostasis, particularly in the microbe-rich and antigen-rich environment of the gut. To maintain intestinal integrity, the epithelial cells, myeloid cells and lymphocytes that inhabit the gut secrete TGF-β, which acts in both paracrine and autocrine fashions to activate its signal transducers, the SMAD transcription factors. The SMAD pathway regulates the production of IgA by B cells, maintains the protective mucosal barrier and promotes the balanced differentiation of CD4(+) T cells into inflammatory T helper type 17 cells and suppressive FOXP3(+) T regulatory cells. While encounters with pathogenic microbes activate SMAD proteins to evoke a protective inflammatory immune response, SMAD activation and synergism with immunoregulatory factors such as the vitamin A metabolite retinoic acid enforce immunosuppression toward commensal microbes and innocuous food antigens. Such complementary context-dependent functions of TGF-β are achieved by the co-operation of SMAD proteins with distinct dominant transcription activators and accessory chromatin modifiers. This review highlights recent advances in unravelling the molecular basis for the multi-faceted functions of TGF-β in the gut that are dictacted by fluid orchestrations of SMADs and their myriad partners. © 2013 Blackwell Publishing Ltd.
Adaptive immune education by gut microbiota antigens.
Zhao, Qing; Elson, Charles O
2018-05-01
Host-microbiota mutualism has been established during long-term co-evolution. A diverse and rich gut microbiota plays an essential role in the development and maturation of the host immune system. Education of the adaptive immune compartment by gut microbiota antigens is important in establishing immune balance. In particular, a critical time frame immediately after birth provides a 'window of opportunity' for the development of lymphoid structures, differentiation and maturation of T and B cells and, most importantly, establishment of immune tolerance to gut commensals. Depending on the colonization niche, antigen type and metabolic property of different gut microbes, CD4 T-cell responses vary greatly, which results in differentiation into distinct subsets. As a consequence, certain bacteria elicit effector-like immune responses by promoting the production of pro-inflammatory cytokines such as interferon-γ and interleukin-17A, whereas other bacteria favour the generation of regulatory CD4 T cells and provide help with gut homeostasis. The microbiota have profound effects on B cells also. Gut microbial exposure leads to a continuous diversification of B-cell repertoire and the production of T-dependent and -independent antibodies, especially IgA. These combined effects of the gut microbes provide an elegant educational process to the adaptive immune network. Contrariwise, failure of this process results in a reduced homeostasis with the gut microbiota, and an increased susceptibility to various immune disorders, both inside and outside the gut. With more definitive microbial-immune relations waiting to be discovered, modulation of the host gut microbiota has a promising future for disease intervention. © 2018 John Wiley & Sons Ltd.
Immune oncology, immune responsiveness and the theory of everything.
Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue
2018-06-05
Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.
Molecular Mechanisms for Microbe Recognition and Defense by the Red Seaweed Laurencia dendroidea.
de Oliveira, Louisi Souza; Tschoeke, Diogo Antonio; Magalhães Lopes, Ana Carolina Rubem; Sudatti, Daniela Bueno; Meirelles, Pedro Milet; Thompson, Cristiane C; Pereira, Renato Crespo; Thompson, Fabiano L
2017-01-01
The ability to recognize and respond to the presence of microbes is an essential strategy for seaweeds to survive in the marine environment, but understanding of molecular seaweed-microbe interactions is limited. Laurencia dendroidea clones were inoculated with the marine bacterium Vibrio madracius . The seaweed RNA was sequenced, providing an unprecedentedly high coverage of the transcriptome of Laurencia , and the gene expression levels were compared between control and inoculated samples after 24, 48, and 72 h. Transcriptomic changes in L. dendroidea in the presence of V. madracius include the upregulation of genes that participate in signaling pathways described here for the first time as a response of seaweeds to microbes. Genes coding for defense-related transcription activators, reactive oxygen species metabolism, terpene biosynthesis, and energy conversion pathways were upregulated in inoculated samples of L. dendroidea , indicating an integrated defensive system in seaweeds. This report contributes significantly to the current knowledge about the molecular mechanisms involved in the highly dynamic seaweed-bacterium interactions. IMPORTANCE Marine bacteria are part of the healthy microbiota associated with seaweeds, but some species, such as Vibrio spp., are frequently associated with disease outbreaks, especially in economically valuable cultures. In this context, the ability of seaweeds to recognize microbes and, when necessary, activate defense mechanisms is essential for their survival. However, studies dedicated to understanding the molecular components of the immune response in seaweeds are rare and restricted to indirect stimulus. This work provides an unprecedentedly large-scale evaluation of the transcriptional changes involved in microbe recognition, cellular signaling, and defense in the red seaweed Laurencia dendroidea in response to the marine bacterium Vibrio madracius . By expanding knowledge about seaweed-bacterium interactions and about the
Skin microbiota and allergic symptoms associate with exposure to environmental microbes
Sinkko, Hanna; Hielm-Björkman, Anna; Tiira, Katriina; Laatikainen, Tiina; Mäkeläinen, Sanna; Kaukonen, Maria; Uusitalo, Liisa; Hanski, Ilkka; Lohi, Hannes; Ruokolainen, Lasse
2018-01-01
A rural environment and farming lifestyle are known to provide protection against allergic diseases. This protective effect is expected to be mediated via exposure to environmental microbes that are needed to support a normal immune tolerance. However, the triangle of interactions between environmental microbes, host microbiota, and immune system remains poorly understood. Here, we have studied these interactions using a canine model (two breeds, n = 169), providing an intermediate approach between complex human studies and artificial mouse model studies. We show that the skin microbiota reflects both the living environment and the lifestyle of a dog. Remarkably, the prevalence of spontaneous allergies is also associated with residential environment and lifestyle, such that allergies are most common among urban dogs living in single-person families without other animal contacts, and least common among rural dogs having opposite lifestyle features. Thus, we show that living environment and lifestyle concurrently associate with skin microbiota and allergies, suggesting that these factors might be causally related. Moreover, microbes commonly found on human skin tend to dominate the urban canine skin microbiota, while environmental microbes are rich in the rural canine skin microbiota. This in turn suggests that skin microbiota is a feasible indicator of exposure to environmental microbes. As short-term exposure to environmental microbes via exercise is not associated with allergies, we conclude that prominent and sustained exposure to environmental microbiotas should be promoted by urban planning and lifestyle changes to support health of urban populations. PMID:29686089
Belmonte, Rodrigo; Wang, Tiehui; Duncan, Gary J.; Skaar, Ida; Mélida, Hugo; Bulone, Vincent; van West, Pieter
2014-01-01
Saprolegnia parasitica is a freshwater oomycete that is capable of infecting several species of fin fish. Saprolegniosis, the disease caused by this microbe, has a substantial impact on Atlantic salmon aquaculture. No sustainable treatment against saprolegniosis is available, and little is known regarding the host response. In this study, we examined the immune response of Atlantic salmon to S. parasitica infection and to its cell wall carbohydrates. Saprolegnia triggers a strong inflammatory response in its host (i.e., induction of interleukin-1β1 [IL-1β1], IL-6, and tumor necrosis factor alpha), while severely suppressing the expression of genes associated with adaptive immunity in fish, through downregulation of T-helper cell cytokines, antigen presentation machinery, and immunoglobulins. Oomycete cell wall carbohydrates were recognized by fish leukocytes, triggering upregulation of genes involved in the inflammatory response, similar to what is observed during infection. Our data suggest that S. parasitica is capable of producing prostaglanding E2 (PGE2) in vitro, a metabolite not previously shown to be produced by oomycetes, and two proteins with homology to vertebrate enzymes known to play a role in prostaglandin biosynthesis have been identified in the oomycete genome. Exogenous PGE2 was shown to increase the inflammatory response in fish leukocytes incubated with cell wall carbohydrates while suppressing genes involved in cellular immunity (gamma interferon [IFN-γ] and the IFN-γ-inducible protein [γ-IP]). Inhibition of S. parasitica zoospore germination and mycelial growth by two cyclooxygenase inhibitors (aspirin and indomethacin) also suggests that prostaglandins may be involved in oomycete development. PMID:25114122
Microbial Invasion vs. Tick Immune Regulation.
Sonenshine, Daniel E; Macaluso, Kevin R
2017-01-01
Ticks transmit a greater variety of pathogenic agents that cause disease in humans and animals than any other haematophagous arthropod, including Lyme disease, Rocky Mountain spotted fever, human granulocytic anaplasmosis, babesiosis, tick-borne encephalitis, Crimean Congo haemorhagic fever, and many others (Gulia-Nuss et al., 2016). Although diverse explanations have been proposed to explain their remarkable vectorial capacity, among the most important are their blood feeding habit, their long term off-host survival, the diverse array of bioactive molecules that disrupt the host's natural hemostatic mechanisms, facilitate blood flow, pain inhibitors, and minimize inflammation to prevent immune rejection (Hajdušek et al., 2013). Moreover, the tick's unique intracellular digestive processes allow the midgut to provide a relatively permissive microenvironment for survival of invading microbes. Although tick-host-pathogen interactions have evolved over more than 300 million years (Barker and Murrell, 2008), few microbes have been able to overcome the tick's innate immune system, comprising both humoral and cellular processes that reject them. Similar to most eukaryotes, the signaling pathways that regulate the innate immune response, i.e., the Toll, IMD (Immunodeficiency) and JAK-STAT (Janus Kinase/ Signal Transducers and Activators of Transcription) also occur in ticks (Gulia-Nuss et al., 2016). Recognition of pathogen-associated molecular patterns (PAMPs) on the microbial surface triggers one or the other of these pathways. Consequently, ticks are able to mount an impressive array of humoral and cellular responses to microbial challenge, including anti-microbial peptides (AMPs), e.g., defensins, lysozymes, microplusins, etc., that directly kill, entrap or inhibit the invaders. Equally important are cellular processes, primarily phagocytosis, that capture, ingest, or encapsulate invading microbes, regulated by a primordial system of thioester-containing proteins
Gewirtz, Andrew T; Vijay-Kumar, Matam; Brant, Steven R; Duerr, Richard H; Nicolae, Dan L; Cho, Judy H
2006-06-01
Crohn's disease (CD) is associated with elevated adaptive immunity to commensal microbes, with flagellin being a dominant antigen. In light of heightened awareness of the importance of innate immunity in regulating adaptive immunity and ambiguity as to the role of CD-associated immune responses in CD pathophysiology, we sought to determine whether natural acquisition of immune responses to flagellin were regulated by the innate immune flagellin receptor toll-like receptor 5 (TLR5) and determine whether persons carrying a recently defined common dominant-negative TLR5 polymorphism (TLR5-stop) might be protected from developing CD. Carriage rates of a recently defined dominant-negative TLR5 polymorphism (TLR5-stop) and levels of serum immunoreactivity to bacterial products were measured in inflammatory bowel disease patients, first-degree relatives, and unrelated controls. We observed that, in healthy subjects, persons carrying TLR5-stop had significantly lower levels of flagellin-specific IgG and IgA but had similar levels of total and LPS-specific Ig. Moreover, we observed that, among Jewish subjects, the carriage rate of TLR5-stop (in heterozygous state) was significantly less in CD patients, but not ulcerative colitis (UC) patients, compared with unaffected relatives and unrelated controls (5.4, 0.9, 6.0, and 6.5% for unaffected relatives, CD, UC, and unrelated Jewish controls, respectively, n = 296, 215, 185, and 416, respectively; P = 0.037 by likelihood calculation for CD vs. controls), indicating that TLR5-stop can protect persons of Jewish ethnicity against CD. We did not observe a significant association of TLR5-stop with CD in a non-Jewish cohort (11.1, 10.4, and 11.7% for unaffected relatives, CD, and UC, respectively; n = 841, 543, and 300 for unaffected relatives, respectively). These results demonstrate that natural acquisition of immune responses to flagellin are regulated by TLR5 and suggest that immune responses to flagellin are not merely
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Responses to Microbial Challenges by SLAMF Receptors
van Driel, Boaz Job; Liao, Gongxian; Engel, Pablo; Terhorst, Cox
2016-01-01
The SLAMF family (SLAMF) of cell surface glycoproteins is comprised of nine glycoproteins and while SLAMF1, 3, 5, 6, 7, 8, and 9 are self-ligand receptors, SLAMF2 and SLAMF4 interact with each other. Their interactions induce signal transduction networks in trans, thereby shaping immune cell–cell communications. Collectively, these receptors modulate a wide range of functions, such as myeloid cell and lymphocyte development, and T and B cell responses to microbes and parasites. In addition, several SLAMF receptors serve as microbial sensors, which either positively or negatively modulate the function of macrophages, dendritic cells, neutrophils, and NK cells in response to microbial challenges. The SLAMF receptor–microbe interactions contribute both to intracellular microbicidal activity as well as to migration of phagocytes to the site of inflammation. In this review, we describe the current knowledge on how the SLAMF receptors and their specific adapters SLAM-associated protein and EAT-2 regulate innate and adaptive immune responses to microbes. PMID:26834746
Immune responses in space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1998-01-01
Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological
Activation of the innate immune receptor Dectin-1 upon formation of a “phagocytic synapse”
Goodridge, Helen S.; Reyes, Christopher N.; Becker, Courtney A.; Katsumoto, Tamiko R.; Ma, Jun; Wolf, Andrea J.; Bose, Nandita; Chan, Anissa S. H.; Magee, Andrew S.; Danielson, Michael E.; Weiss, Arthur; Vasilakos, John P.; Underhill, David M.
2011-01-01
Innate immune cells must be able to distinguish between direct binding to microbes and detection of components shed from the surface of microbes located at a distance. Dectin-1 is a pattern recognition receptor expressed by myeloid phagocytes (macrophages, dendritic cells and neutrophils) that detects β-glucans in fungal cell walls and triggers direct cellular anti-microbial activity, including phagocytosis and production of reactive oxygen species1, 2. In contrast to inflammatory responses stimulated upon detection of soluble ligands by other pattern recognition receptors, such as Toll-like receptors (TLRs), these responses are only useful when a cell comes into direct contact with a microbe and must not be spuriously activated by soluble stimuli. In this study we show that despite its ability to bind both soluble and particulate β-glucan polymers, Dectin-1 signalling is only activated by particulate β-glucans, which cluster the receptor in synapse-like structures from which regulatory tyrosine phosphatases CD45 and CD148 are excluded (Supplementary Figure 1). The “phagocytic synapse” now provides a model mechanism by which innate immune receptors can distinguish direct microbial contact from detection of microbes at a distance, thereby initiating direct cellular anti-microbial responses only when they are required. PMID:21525931
Plant cell wall-mediated immunity: cell wall changes trigger disease resistance responses.
Bacete, Laura; Mélida, Hugo; Miedes, Eva; Molina, Antonio
2018-02-01
Plants have evolved a repertoire of monitoring systems to sense plant morphogenesis and to face environmental changes and threats caused by different attackers. These systems integrate different signals into overreaching triggering pathways which coordinate developmental and defence-associated responses. The plant cell wall, a dynamic and complex structure surrounding every plant cell, has emerged recently as an essential component of plant monitoring systems, thus expanding its function as a passive defensive barrier. Plants have a dedicated mechanism for maintaining cell wall integrity (CWI) which comprises a diverse set of plasma membrane-resident sensors and pattern recognition receptors (PRRs). The PRRs perceive plant-derived ligands, such as peptides or wall glycans, known as damage-associated molecular patterns (DAMPs). These DAMPs function as 'danger' alert signals activating DAMP-triggered immunity (DTI), which shares signalling components and responses with the immune pathways triggered by non-self microbe-associated molecular patterns that mediate disease resistance. Alteration of CWI by impairment of the expression or activity of proteins involved in cell wall biosynthesis and/or remodelling, as occurs in some plant cell wall mutants, or by wall damage due to colonization by pathogens/pests, activates specific defensive and growth responses. Our current understanding of how these alterations of CWI are perceived by the wall monitoring systems is scarce and few plant sensors/PRRs and DAMPs have been characterized. The identification of these CWI sensors and PRR-DAMP pairs will help us to understand the immune functions of the wall monitoring system, and might allow the breeding of crop varieties and the design of agricultural strategies that would enhance crop disease resistance. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Innate immune response to Burkholderia mallei.
Saikh, Kamal U; Mott, Tiffany M
2017-06-01
Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.
Innate immune response to Burkholderia mallei
Saikh, Kamal U.; Mott, Tiffany M.
2017-01-01
Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960
Skin microbiota and allergic symptoms associate with exposure to environmental microbes.
Lehtimäki, Jenni; Sinkko, Hanna; Hielm-Björkman, Anna; Salmela, Elina; Tiira, Katriina; Laatikainen, Tiina; Mäkeläinen, Sanna; Kaukonen, Maria; Uusitalo, Liisa; Hanski, Ilkka; Lohi, Hannes; Ruokolainen, Lasse
2018-05-08
A rural environment and farming lifestyle are known to provide protection against allergic diseases. This protective effect is expected to be mediated via exposure to environmental microbes that are needed to support a normal immune tolerance. However, the triangle of interactions between environmental microbes, host microbiota, and immune system remains poorly understood. Here, we have studied these interactions using a canine model (two breeds, n = 169), providing an intermediate approach between complex human studies and artificial mouse model studies. We show that the skin microbiota reflects both the living environment and the lifestyle of a dog. Remarkably, the prevalence of spontaneous allergies is also associated with residential environment and lifestyle, such that allergies are most common among urban dogs living in single-person families without other animal contacts, and least common among rural dogs having opposite lifestyle features. Thus, we show that living environment and lifestyle concurrently associate with skin microbiota and allergies, suggesting that these factors might be causally related. Moreover, microbes commonly found on human skin tend to dominate the urban canine skin microbiota, while environmental microbes are rich in the rural canine skin microbiota. This in turn suggests that skin microbiota is a feasible indicator of exposure to environmental microbes. As short-term exposure to environmental microbes via exercise is not associated with allergies, we conclude that prominent and sustained exposure to environmental microbiotas should be promoted by urban planning and lifestyle changes to support health of urban populations. Copyright © 2018 the Author(s). Published by PNAS.
Tilapia show immunization response against Ich
USDA-ARS?s Scientific Manuscript database
This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...
The immune response to human CMV
La Rosa, Corinna; Diamond, Don J
2012-01-01
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079
Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying
2007-01-01
BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844
Graft-versus-host disease: regulation by microbe-associated molecules and innate immune receptors.
Penack, Olaf; Holler, Ernst; van den Brink, Marcel R M
2010-03-11
Acute graft-versus-host disease (GVHD) remains the major obstacle to a more favorable therapeutic outcome of allogeneic hematopoietic stem cell transplantation (HSCT). GVHD is characterized by tissue damage in gut, liver, and skin, caused by donor T cells that are critical for antitumor and antimicrobial immunity after HSCT. One obstacle in combating GVHD used to be the lack of understanding the molecular mechanisms that are involved in the initiation phase of this syndrome. Recent research has demonstrated that interactions between microbial-associated molecules (pathogen-associated molecular patterns [PAMPs]) and innate immune receptors (pathogen recognition receptors [PRRs]), such as NOD-like receptors (NLRs) and Toll-like receptors (TLRs), control adaptive immune responses in inflammatory disorders. Polymorphisms of the genes encoding NOD2 and TLR4 are associated with a higher incidence of GVHD in HSC transplant recipients. Interestingly, NOD2 regulates GVHD through its inhibitory effect on antigen-presenting cell (APC) function. These insights identify important mechanisms regarding the induction of GVHD through the interplay of microbial molecules and innate immunity, thus opening a new area for future therapeutic approaches. This review covers current knowledge of the role of PAMPs and PRRs in the control of adaptive immune responses during inflammatory diseases, particularly GVHD.
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
Unsolved Puzzles Surrounding HCV Immunity: Heterologous Immunity Adds Another Dimension.
Agrawal, Babita; Singh, Shakti; Gupta, Nancy; Li, Wen; Vedi, Satish; Kumar, Rakesh
2017-07-27
Chronic infection with hepatitis C virus (HCV) afflicts 3% of the world's population and can lead to serious and late-stage liver diseases. Developing a vaccine for HCV is challenging because the correlates of protection are uncertain and traditional vaccine approaches do not work. Studies of natural immunity to HCV in humans have resulted in many enigmas. Human beings are not immunologically naïve because they are continually exposed to various environmental microbes and antigens, creating large populations of memory T cells. Heterologous immunity occurs when this pool of memory T cells cross-react against a new pathogen in an individual. Such heterologous immunity could influence the outcome when an individual is infected by a pathogen. We have recently made an unexpected finding that adenoviruses, a common environmental pathogen and an experimental vaccine vector, can induce robust cross-reactive immune responses against multiple antigens of HCV. Our unique finding of previously uncharacterized heterologous immunity against HCV opens new avenues to understand HCV pathogenesis and develop effective vaccines.
Belmonte, Rodrigo; Wang, Tiehui; Duncan, Gary J; Skaar, Ida; Mélida, Hugo; Bulone, Vincent; van West, Pieter; Secombes, Christopher J
2014-11-01
Saprolegnia parasitica is a freshwater oomycete that is capable of infecting several species of fin fish. Saprolegniosis, the disease caused by this microbe, has a substantial impact on Atlantic salmon aquaculture. No sustainable treatment against saprolegniosis is available, and little is known regarding the host response. In this study, we examined the immune response of Atlantic salmon to S. parasitica infection and to its cell wall carbohydrates. Saprolegnia triggers a strong inflammatory response in its host (i.e., induction of interleukin-1β1 [IL-1β1], IL-6, and tumor necrosis factor alpha), while severely suppressing the expression of genes associated with adaptive immunity in fish, through downregulation of T-helper cell cytokines, antigen presentation machinery, and immunoglobulins. Oomycete cell wall carbohydrates were recognized by fish leukocytes, triggering upregulation of genes involved in the inflammatory response, similar to what is observed during infection. Our data suggest that S. parasitica is capable of producing prostaglandin [corrected] E2 (PGE2) in vitro, a metabolite not previously shown to be produced by oomycetes, and two proteins with homology to vertebrate enzymes known to play a role in prostaglandin biosynthesis have been identified in the oomycete genome. Exogenous PGE2 was shown to increase the inflammatory response in fish leukocytes incubated with cell wall carbohydrates while suppressing genes involved in cellular immunity (gamma interferon [IFN-γ] and the IFN-γ-inducible protein [γ-IP]). Inhibition of S. parasitica zoospore germination and mycelial growth by two cyclooxygenase inhibitors (aspirin and indomethacin) also suggests that prostaglandins may be involved in oomycete development. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges.
Cooper, Dustin; Eleftherianos, Ioannis
2017-01-01
The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a "loitering" innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.
Innate immunity in vertebrates: an overview.
Riera Romo, Mario; Pérez-Martínez, Dayana; Castillo Ferrer, Camila
2016-06-01
Innate immunity is a semi-specific and widely distributed form of immunity, which represents the first line of defence against pathogens. This type of immunity is critical to maintain homeostasis and prevent microbe invasion, eliminating a great variety of pathogens and contributing with the activation of the adaptive immune response. The components of innate immunity include physical and chemical barriers, humoral and cell-mediated components, which are present in all jawed vertebrates. The understanding of innate defence mechanisms in non-mammalian vertebrates is the key to comprehend the general picture of vertebrate innate immunity and its evolutionary history. This is also essential for the identification of new molecules with applications in immunopharmacology and immunotherapy. In this review, we describe and discuss the main elements of vertebrate innate immunity, presenting core findings in this field and identifying areas that need further investigation. © 2016 John Wiley & Sons Ltd.
Asymmetric T lymphocyte division in the initiation of adaptive immune responses.
Chang, John T; Palanivel, Vikram R; Kinjyo, Ichiko; Schambach, Felix; Intlekofer, Andrew M; Banerjee, Arnob; Longworth, Sarah A; Vinup, Kristine E; Mrass, Paul; Oliaro, Jane; Killeen, Nigel; Orange, Jordan S; Russell, Sarah M; Weninger, Wolfgang; Reiner, Steven L
2007-03-23
A hallmark of mammalian immunity is the heterogeneity of cell fate that exists among pathogen-experienced lymphocytes. We show that a dividing T lymphocyte initially responding to a microbe exhibits unequal partitioning of proteins that mediate signaling, cell fate specification, and asymmetric cell division. Asymmetric segregation of determinants appears to be coordinated by prolonged interaction between the T cell and its antigen-presenting cell before division. Additionally, the first two daughter T cells displayed phenotypic and functional indicators of being differentially fated toward effector and memory lineages. These results suggest a mechanism by which a single lymphocyte can apportion diverse cell fates necessary for adaptive immunity.
A new synthesis for antibody-mediated immunity
Casadevall, Arturo; Pirofski, Liise-anne
2013-01-01
The view that immunoglobulins function largely by potentiating neutralization, cytotoxicity or phagocytosis is being replaced by a new synthesis whereby antibodies participate in all aspects of the immune response, from protecting the host at the earliest time of encounter with a microbe to later challenges. Perhaps the most transformative concept is that immunoglobulins manifest emergent properties, from their structure and function as individual molecules to their interactions with microbial targets and the host immune system. Given that emergent properties are neither reducible to first principles nor predictable, there is a need for new conceptual approaches for understanding antibody function and mechanisms of antibody immunity. PMID:22179281
Immune Dysfunction in Cirrhosis
Noor, Mohd Talha; Manoria, Piyush
2017-01-01
Abstract Cirrhosis due to any etiology disrupts the homeostatic role of liver in the body. Cirrhosis-associated immune dysfunction leads to alterations in both innate and acquired immunity, due to defects in the local immunity of liver as well as in systemic immunity. Cirrhosis-associated immune dysfunction is a dynamic phenomenon, comprised of both increased systemic inflammation and immunodeficiency, and is responsible for 30% mortality. It also plays an important role in acute as well as chronic decompensation. Immune paralysis can accompany it, which is characterized by increase in anti-inflammatory cytokines and suppression of proinflammatory cytokines. There is also presence of increased gut permeability, reduced gut motility and altered gut flora, all of which leads to increased bacterial translocation. This increased bacterial translocation and consequent endotoxemia leads to increased blood stream bacterial infections that cause systemic inflammatory response syndrome, sepsis, multiorgan failure and death. The gut microbiota of cirrhotic patients has more pathogenic microbes than that of non-cirrhotic individuals, and this disturbs the homeostasis and favors gut translocation. Prompt diagnosis and treatment of such infections are necessary for better survival. We have reviewed the various mechanisms of immune dysfunction and its consequences in cirrhosis. Recognizing the exact pathophysiology of immune dysfunction will help treating clinicians in avoiding its complications in their patients and can lead to newer therapeutic interventions and reducing the morbidity and mortality rates. PMID:28507927
Heterogeneity of Human CD4(+) T Cells Against Microbes.
Sallusto, Federica
2016-05-20
CD4(+) T helper (Th) cells play a central role in the adaptive immune response by providing help to B cells and cytotoxic T cells and by releasing different types of cytokines in tissues to mediate protection against a wide range of pathogenic microorganisms. These functions are performed by different types of Th cells endowed with distinct migratory capacities and effector functions. Here we discuss how studies of the human T cell response to microbes have advanced our understanding of Th cell functional heterogeneity, in particular with the discovery of a distinct Th1 subset involved in the response to Mycobacteria and the characterization of two types of Th17 cells specific for extracellular bacteria or fungi. We also review new approaches to dissect at the clonal level the human CD4(+) T cell response induced by pathogens or vaccines that have revealed an unexpected degree of intraclonal diversification and propose a progressive and selective model of CD4(+) T cell differentiation.
Non-branched β-1,3-glucan oligosaccharides trigger immune responses in Arabidopsis.
Mélida, Hugo; Sopeña-Torres, Sara; Bacete, Laura; Garrido-Arandia, María; Jordá, Lucía; López, Gemma; Muñoz-Barrios, Antonio; Pacios, Luis F; Molina, Antonio
2018-01-01
Fungal cell walls, which are essential for environmental adaptation and host colonization by the fungus, have been evolutionarily selected by plants and animals as a source of microbe-associated molecular patterns (MAMPs) that, upon recognition by host pattern recognition receptors (PRRs), trigger immune responses conferring disease resistance. Chito-oligosaccharides [β-1,4-N-acetylglucosamine oligomers, (GlcNAc) n ] are the only glycosidic structures from fungal walls that have been well-demonstrated to function as MAMPs in plants. Perception of (GlcNAc) 4-8 by Arabidopsis involves CERK1, LYK4 and LYK5, three of the eight members of the LysM PRR family. We found that a glucan-enriched wall fraction from the pathogenic fungus Plectosphaerella cucumerina which was devoid of GlcNAc activated immune responses in Arabidopsis wild-type plants but not in the cerk1 mutant. Using this differential response, we identified the non-branched 1,3-β-d-(Glc) hexasaccharide as a major fungal MAMP. Recognition of 1,3-β-d-(Glc) 6 was impaired in cerk1 but not in mutants defective in either each of the LysM PRR family members or in the PRR-co-receptor BAK1. Transcriptomic analyses of Arabidopsis plants treated with 1,3-β-d-(Glc) 6 further demonstrated that this fungal MAMP triggers the expression of immunity-associated genes. In silico docking analyses with molecular mechanics and solvation energy calculations corroborated that CERK1 can bind 1,3-β-d-(Glc) 6 at effective concentrations similar to those of (GlcNAc) 4 . These data support that plants, like animals, have selected as MAMPs the linear 1,3-β-d-glucans present in the walls of fungi and oomycetes. Our data also suggest that CERK1 functions as an immune co-receptor for linear 1,3-β-d-glucans in a similar way to its proposed function in the recognition of fungal chito-oligosaccharides and bacterial peptidoglycan MAMPs. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
NetCooperate: a network-based tool for inferring host-microbe and microbe-microbe cooperation.
Levy, Roie; Carr, Rogan; Kreimer, Anat; Freilich, Shiri; Borenstein, Elhanan
2015-05-17
Host-microbe and microbe-microbe interactions are often governed by the complex exchange of metabolites. Such interactions play a key role in determining the way pathogenic and commensal species impact their host and in the assembly of complex microbial communities. Recently, several studies have demonstrated how such interactions are reflected in the organization of the metabolic networks of the interacting species, and introduced various graph theory-based methods to predict host-microbe and microbe-microbe interactions directly from network topology. Using these methods, such studies have revealed evolutionary and ecological processes that shape species interactions and community assembly, highlighting the potential of this reverse-ecology research paradigm. NetCooperate is a web-based tool and a software package for determining host-microbe and microbe-microbe cooperative potential. It specifically calculates two previously developed and validated metrics for species interaction: the Biosynthetic Support Score which quantifies the ability of a host species to supply the nutritional requirements of a parasitic or a commensal species, and the Metabolic Complementarity Index which quantifies the complementarity of a pair of microbial organisms' niches. NetCooperate takes as input a pair of metabolic networks, and returns the pairwise metrics as well as a list of potential syntrophic metabolic compounds. The Biosynthetic Support Score and Metabolic Complementarity Index provide insight into host-microbe and microbe-microbe metabolic interactions. NetCooperate determines these interaction indices from metabolic network topology, and can be used for small- or large-scale analyses. NetCooperate is provided as both a web-based tool and an open-source Python module; both are freely available online at http://elbo.gs.washington.edu/software_netcooperate.html.
Abiotic Stress Responses and Microbe-Mediated Mitigation in Plants: The Omics Strategies
Meena, Kamlesh K.; Sorty, Ajay M.; Bitla, Utkarsh M.; Choudhary, Khushboo; Gupta, Priyanka; Pareek, Ashwani; Singh, Dhananjaya P.; Prabha, Ratna; Sahu, Pramod K.; Gupta, Vijai K.; Singh, Harikesh B.; Krishanani, Kishor K.; Minhas, Paramjit S.
2017-01-01
Abiotic stresses are the foremost limiting factors for agricultural productivity. Crop plants need to cope up adverse external pressure created by environmental and edaphic conditions with their intrinsic biological mechanisms, failing which their growth, development, and productivity suffer. Microorganisms, the most natural inhabitants of diverse environments exhibit enormous metabolic capabilities to mitigate abiotic stresses. Since microbial interactions with plants are an integral part of the living ecosystem, they are believed to be the natural partners that modulate local and systemic mechanisms in plants to offer defense under adverse external conditions. Plant-microbe interactions comprise complex mechanisms within the plant cellular system. Biochemical, molecular and physiological studies are paving the way in understanding the complex but integrated cellular processes. Under the continuous pressure of increasing climatic alterations, it now becomes more imperative to define and interpret plant-microbe relationships in terms of protection against abiotic stresses. At the same time, it also becomes essential to generate deeper insights into the stress-mitigating mechanisms in crop plants for their translation in higher productivity. Multi-omics approaches comprising genomics, transcriptomics, proteomics, metabolomics and phenomics integrate studies on the interaction of plants with microbes and their external environment and generate multi-layered information that can answer what is happening in real-time within the cells. Integration, analysis and decipherization of the big-data can lead to a massive outcome that has significant chance for implementation in the fields. This review summarizes abiotic stresses responses in plants in-terms of biochemical and molecular mechanisms followed by the microbe-mediated stress mitigation phenomenon. We describe the role of multi-omics approaches in generating multi-pronged information to provide a better understanding
Abiotic Stress Responses and Microbe-Mediated Mitigation in Plants: The Omics Strategies.
Meena, Kamlesh K; Sorty, Ajay M; Bitla, Utkarsh M; Choudhary, Khushboo; Gupta, Priyanka; Pareek, Ashwani; Singh, Dhananjaya P; Prabha, Ratna; Sahu, Pramod K; Gupta, Vijai K; Singh, Harikesh B; Krishanani, Kishor K; Minhas, Paramjit S
2017-01-01
Abiotic stresses are the foremost limiting factors for agricultural productivity. Crop plants need to cope up adverse external pressure created by environmental and edaphic conditions with their intrinsic biological mechanisms, failing which their growth, development, and productivity suffer. Microorganisms, the most natural inhabitants of diverse environments exhibit enormous metabolic capabilities to mitigate abiotic stresses. Since microbial interactions with plants are an integral part of the living ecosystem, they are believed to be the natural partners that modulate local and systemic mechanisms in plants to offer defense under adverse external conditions. Plant-microbe interactions comprise complex mechanisms within the plant cellular system. Biochemical, molecular and physiological studies are paving the way in understanding the complex but integrated cellular processes. Under the continuous pressure of increasing climatic alterations, it now becomes more imperative to define and interpret plant-microbe relationships in terms of protection against abiotic stresses. At the same time, it also becomes essential to generate deeper insights into the stress-mitigating mechanisms in crop plants for their translation in higher productivity. Multi-omics approaches comprising genomics, transcriptomics, proteomics, metabolomics and phenomics integrate studies on the interaction of plants with microbes and their external environment and generate multi-layered information that can answer what is happening in real-time within the cells. Integration, analysis and decipherization of the big-data can lead to a massive outcome that has significant chance for implementation in the fields. This review summarizes abiotic stresses responses in plants in-terms of biochemical and molecular mechanisms followed by the microbe-mediated stress mitigation phenomenon. We describe the role of multi-omics approaches in generating multi-pronged information to provide a better understanding
Wang, Erlong; Chen, Xia; Wang, Kaiyu; Wang, Jun; Chen, Defang; Geng, Yi; Lai, Weimin; Wei, Xianchao
2016-12-01
Plant polysaccharides (PPS) are an important medicinal plant product, and play a major role in preventing and controlling infectious microbes in aquaculture. The present study investigated the effect of three PPS; Ficus carica polysaccharides (FCPS), Radix isatidis polysaccharides (RIPS), and Schisandra chinensis polysaccharides (SCPS), used as feed additives, on innate immune responses and disease resistance against Aeromonas hydrophila in crucian carp. Results show that crucian carp fed with these PPS showed significant (p < 0.05) enhancement of their innate immune response including leukocyte phagocytosis activity, serum bactericidal activity, lysozyme activity, total protein level, complement C3, and superoxide dismutase activity compared with the control group. Their degree of influence on these immune parameters was in the order of FCPS > RIPS > SCPS, except for lysozyme activity (RIPS > FCPS > SCPS). In addition, fish cumulative mortalities in the three treatment groups were remarkably lower than in the control group (95%) when challenged with A. hydrophila, relative percent survivals were 57.9%, 47.4%, and 42.1% in FCPS, RIPS, and SCPS groups, respectively. These results suggest that FCPS, RIPS, and SCPS used as immunostimulants are capable of enhancing immune responses and disease resistance against A. hydrophila in crucian carp, and that FCPS was the most effective. The findings from this study will help accelerate research of this topic, and promote the application and development of immunostimulants, such as Chinese herbs, in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Recognition of bacterial plant pathogens: local, systemic and transgenerational immunity.
Henry, Elizabeth; Yadeta, Koste A; Coaker, Gitta
2013-09-01
Bacterial pathogens can cause multiple plant diseases and plants rely on their innate immune system to recognize and actively respond to these microbes. The plant innate immune system comprises extracellular pattern recognition receptors that recognize conserved microbial patterns and intracellular nucleotide binding leucine-rich repeat (NLR) proteins that recognize specific bacterial effectors delivered into host cells. Plants lack the adaptive immune branch present in animals, but still afford flexibility to pathogen attack through systemic and transgenerational resistance. Here, we focus on current research in plant immune responses against bacterial pathogens. Recent studies shed light onto the activation and inactivation of pattern recognition receptors and systemic acquired resistance. New research has also uncovered additional layers of complexity surrounding NLR immune receptor activation, cooperation and sub-cellular localizations. Taken together, these recent advances bring us closer to understanding the web of molecular interactions responsible for coordinating defense responses and ultimately resistance. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.
The role of lipids in host microbe interactions.
Lang, Roland; Mattner, Jochen
2017-06-01
Lipids are one of the major subcellular constituents and serve as signal molecules, energy sources, metabolic precursors and structural membrane components in various organisms. The function of lipids can be modified by multiple biochemical processes such as (de-)phosphorylation or (de-)glycosylation, and the organization of fatty acids into distinct cellular pools and subcellular compartments plays a pivotal role for the morphology and function of various cell populations. Thus, lipids regulate, for example, phagosome formation and maturation within host cells and thus, are critical for the elimination of microbial pathogens. Vice versa, microbial pathogens can manipulate the lipid composition of phagosomal membranes in host cells, and thus avoid their delivery to phagolysosomes. Lipids of microbial origin belong also to the strongest and most versatile inducers of mammalian immune responses upon engagement of distinct receptors on myeloid and lymphoid cells. Furthermore, microbial lipid toxins can induce membrane injuries and cell death. Thus, we will review here selected examples for mutual host-microbe interactions within the broad and divergent universe of lipids in microbial defense, tissue injury and immune evasion.
Hallmarks of response to immune checkpoint blockade
Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A
2017-01-01
Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159
Role of the Microbiota in Immunity and inflammation
Belkaid, Yasmine; Hand, Timothy
2014-01-01
The microbiota plays a fundamental role on the induction, training and function of the host immune system. In return, the immune system has largely evolved as a means to maintain the symbiotic relationship of the host with these highly diverse and evolving microbes. When operating optimally this immune system–microbiota alliance allows the induction of protective responses to pathogens and the maintenance of regulatory pathways involved in the maintenance of tolerance to innocuous antigens. However, in high-income countries overuse of antibiotics, changes in diet, and elimination of constitutive partners such as nematodes has selected for a microbiota that lack the resilience and diversity required to establish balanced immune responses. This phenomenon is proposed to account for some of the dramatic rise in autoimmune and inflammatory disorders in parts of the world where our symbiotic relationship with the microbiota has been the most affected. PMID:24679531
Siblings Promote a Type 1/Type 17-oriented immune response in the airways of asymptomatic neonates.
Wolsk, H M; Chawes, B L; Følsgaard, N V; Rasmussen, M A; Brix, S; Bisgaard, H
2016-06-01
Siblings have been shown to reduce the risk of childhood asthma and allergy, but the mechanism driving this association is unknown. The objective was to study whether siblings affect the airway immune response in healthy neonates, which could represent an underlying immune modulatory pathway. We measured 20 immune mediators related to the Type 1, Type 2, Type 17, or regulatory immune pathways in the airway mucosa of 571 one-month-old asymptomatic neonates from the Copenhagen Prospective Studies on Asthma in Childhood2010 birth cohort (COPSAC2010 ). The association between airway mediator levels and presence of siblings was investigated using conventional statistics and principle component analysis (PCA). Neonates with siblings had an upregulated level of airway immune mediators, with predominance of Type 1- and Type 17-related mediators. This was supported by the PCA showing a highly significant difference between children with vs without siblings: P < 10(-10) , which persisted after adjustment for potential confounders including pathogenic airway bacteria and viruses: P < 0.0001. The immune priming effect was inversely associated with time since last childbirth: P = 0.0015. Siblings mediate a Type 1/Type 17-related immune-stimulatory effect in the airways of asymptomatic neonates, also after adjustment for pathogenic bacteria and viruses, indicating that siblings exert a transferable early immune modulatory effect. These findings may represent an in utero immune priming effect of the fetal immune system caused by previous pregnancies as the effect was attenuated with time since last childbirth, or it could relate to the presence of unidentified microbes, but further studies are needed to confirm our findings. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Spaceflight and immune responses of Rhesus monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1994-01-01
Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.
Shokal, Upasana; Yadav, Shruti; Atri, Jaishri; Accetta, Julia; Kenney, Eric; Banks, Katherine; Katakam, Akash; Jaenike, John; Eleftherianos, Ioannis
2016-02-09
Symbiotic interactions between microbes and animals are common in nature. Symbiotic organisms are particularly common in insects and, in some cases, they may protect their hosts from pathogenic infections. Wolbachia and Spiroplasma endosymbionts naturally inhabit various insects including Drosophila melanogaster fruit flies. Therefore, this symbiotic association is considered an excellent model to investigate whether endosymbiotic bacteria participate in host immune processes against certain pathogens. Here we have investigated whether the presence of Wolbachia alone or together with Spiroplasma endosymbionts in D. melanogaster adult flies affects the immune response against the virulent insect pathogen Photorhabdus luminescens and against non-pathogenic Escherichia coli bacteria. We found that D. melanogaster flies carrying no endosymbionts, those carrying both Wolbachia and Spiroplasma, and those containing Wolbachia only had similar survival rates after infection with P. luminescens or Escherichia coli bacteria. However, flies carrying both endosymbionts or Wolbachia only contained higher numbers of E. coli cells at early time-points post infection than flies without endosymbiotic bacteria. Interestingly, flies containing Wolbachia only had lower titers of this endosymbiont upon infection with the pathogen P. luminescens than uninfected flies of the same strain. We further found that the presence of Wolbachia and Spiroplasma in D. melanogaster up-regulated certain immune-related genes upon infection with P. luminescens or E. coli bacteria, but it failed to alter the phagocytic ability of the flies toward E. coli inactive bioparticles. Our results suggest that the presence of Wolbachia and Spiroplasma in D. melanogaster can modulate immune signaling against infection by certain insect pathogenic and non-pathogenic bacteria. Results from such studies are important for understanding the molecular basis of the interactions between endosymbiotic bacteria of insects
Virus-like nanostructures for tuning immune response
NASA Astrophysics Data System (ADS)
Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.
2015-11-01
Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.
Poole, Angela Z.; Kitchen, Sheila A.; Weis, Virginia M.
2016-01-01
The complement system is an innate immune pathway that in vertebrates, is responsible for initial recognition and ultimately phagocytosis and destruction of microbes. Several complement molecules including C3, Factor B, and mannose binding lectin associated serine proteases (MASP) have been characterized in invertebrates and while most studies have focused on their conserved role in defense against pathogens, little is known about their role in managing beneficial microbes. The purpose of this study was to (1) characterize complement pathway genes in the symbiotic sea anemone Aiptasia pallida, (2) investigate the evolution of complement genes in invertebrates, and (3) examine the potential dual role of complement genes Factor B and MASP in the onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge using qPCR based studies. The results demonstrate that A. pallida has multiple Factor B genes (Ap_Bf-1, Ap_Bf-2a, and Ap_Bf-2b) and one MASP gene (Ap_MASP). Phylogenetic analysis indicates that the evolutionary history of complement genes is complex, and there have been many gene duplications or gene loss events, even within members of the same phylum. Gene expression analyses revealed a potential role for complement in both onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge. Specifically, Ap_Bf-1 and Ap_MASP are significantly upregulated in the light at the onset of symbiosis and in response to challenge with the pathogen Serratia marcescens suggesting that they play a role in the initial recognition of both beneficial and harmful microbes. Ap_Bf-2b in contrast, was generally downregulated during the onset and maintenance of symbiosis and in response to challenge with S. marcescens. Therefore, the exact role of Ap_Bf-2b in response to microbes remains unclear, but the results suggest that the presence of microbes leads to repressed expression. Together, these results indicate functional divergence between Ap_Bf-1
Poole, Angela Z; Kitchen, Sheila A; Weis, Virginia M
2016-01-01
The complement system is an innate immune pathway that in vertebrates, is responsible for initial recognition and ultimately phagocytosis and destruction of microbes. Several complement molecules including C3, Factor B, and mannose binding lectin associated serine proteases (MASP) have been characterized in invertebrates and while most studies have focused on their conserved role in defense against pathogens, little is known about their role in managing beneficial microbes. The purpose of this study was to (1) characterize complement pathway genes in the symbiotic sea anemone Aiptasia pallida, (2) investigate the evolution of complement genes in invertebrates, and (3) examine the potential dual role of complement genes Factor B and MASP in the onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge using qPCR based studies. The results demonstrate that A. pallida has multiple Factor B genes (Ap_Bf-1, Ap_Bf-2a, and Ap_Bf-2b) and one MASP gene (Ap_MASP). Phylogenetic analysis indicates that the evolutionary history of complement genes is complex, and there have been many gene duplications or gene loss events, even within members of the same phylum. Gene expression analyses revealed a potential role for complement in both onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge. Specifically, Ap_Bf-1 and Ap_MASP are significantly upregulated in the light at the onset of symbiosis and in response to challenge with the pathogen Serratia marcescens suggesting that they play a role in the initial recognition of both beneficial and harmful microbes. Ap_Bf-2b in contrast, was generally downregulated during the onset and maintenance of symbiosis and in response to challenge with S. marcescens. Therefore, the exact role of Ap_Bf-2b in response to microbes remains unclear, but the results suggest that the presence of microbes leads to repressed expression. Together, these results indicate functional divergence between Ap_Bf-1
Immune Response in Thyroid Cancer: Widening the Boundaries
Ward, Laura Sterian
2014-01-01
The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756
Frencher, James T.; Shen, Hongbo; Yan, Lin; Wilson, Jessica O.; Freitag, Nancy E.; Rizzo, Alicia N.; Chen, Crystal Y.; Chen, Zheng W.
2014-01-01
Whereas infection or immunization of humans/primates with microbes coproducing HMBPP/IPP can remarkably activate Vγ2Vδ2 T cells, in vivo studies have not been done to dissect HMBPP- and IPP-driven expansion, pulmonary trafficking, effector functions, and memory polarization of Vγ2Vδ2 T cells. We define these phosphoantigen-host interplays by comparative immunizations of macaques with the HMBPP/IPP-coproducing Listeria ΔactA prfA* and HMBPP-deficient Listeria ΔactAΔgcpE prfA* mutant. The HMBPP-deficient ΔgcpE mutant shows lower ability to expand Vγ2Vδ2 T cells in vitro than the parental HMBPP-producing strain but displays comparably attenuated infectivity or immunogenicity. Respiratory immunization of macaques with the HMBPP-deficient mutant elicits lower pulmonary and systemic responses of Vγ2Vδ2 T cells compared with the HMBPP-producing vaccine strain. Interestingly, HMBPP-deficient mutant reimmunization or boosting elicits enhanced responses of Vγ2Vδ2 T cells, but the magnitude is lower than that by HMBPP-producing listeria. HMBPP-deficient listeria differentiated fewer Vγ2Vδ2 T effector cells capable of coproducing IFN-γ and TNF-α and inhibiting intracellular listeria than HMBPP-producing listeria. Furthermore, HMBPP deficiency in listerial immunization influences memory polarization of Vγ2Vδ2 T cells. Thus, both HMBPP and IPP production in listerial immunization or infection elicit systemic/pulmonary responses and differentiation of Vγ2Vδ2 T cells, but a role for HMBPP is more dominant. Findings may help devise immune intervention. PMID:25114162
Measles virus-induced suppression of immune responses.
Griffin, Diane E
2010-07-01
Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.
Immune Responses to HCV and Other Hepatitis Viruses
Park, Su-Hyung; Rehermann, Barbara
2014-01-01
Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Does plant immunity play a critical role during initiation of the legume-rhizobium symbiosis?
Tóth, Katalin; Stacey, Gary
2015-01-01
Plants are exposed to many different microbes in their habitats. These microbes may be benign or pathogenic, but in some cases they are beneficial for the host. The rhizosphere provides an especially rich palette for colonization by beneficial (associative and symbiotic) microorganisms, which raises the question as to how roots can distinguish such 'friends' from possible 'foes' (i.e., pathogens). Plants possess an innate immune system that can recognize pathogens, through an arsenal of protein receptors, including receptor-like kinases (RLKs) and receptor-like proteins (RLPs) located at the plasma membrane. In addition, the plant host has intracellular receptors (so called NBS-LRR proteins or R proteins) that directly or indirectly recognize molecules released by microbes into the plant cell. A successful cooperation between legume plants and rhizobia leads to beneficial symbiotic interaction. The key rhizobial, symbiotic signaling molecules [lipo-chitooligosaccharide Nod factors (NF)] are perceived by the host legume plant using lysin motif-domain containing RLKs. Perception of the symbiotic NFs trigger signaling cascades leading to bacterial infection and accommodation of the symbiont in a newly formed root organ, the nodule, resulting in a nitrogen-fixing root nodule symbiosis. The net result of this symbiosis is the intracellular colonization of the plant with thousands of bacteria; a process that seems to occur in spite of the immune ability of plants to prevent pathogen infection. In this review, we discuss the potential of the invading rhizobial symbiont to actively avoid this innate immune response, as well as specific examples of where the plant immune response may modulate rhizobial infection and host range.
Ganesan, Balasubramanian; Martini, Silvana; Solorio, Jonathan; Walsh, Marie K
2015-01-01
This study investigated the effects of high intensity ultrasound (temperature, amplitude, and time) on the inactivation of indigenous bacteria in pasteurized milk, Bacillus atrophaeus spores inoculated into sterile milk, and Saccharomyces cerevisiae inoculated into sterile orange juice using response surface methodology. The variables investigated were sonication temperature (range from 0 to 84°C), amplitude (range from 0 to 216 μm), and time (range from 0.17 to 5 min) on the response, log microbe reduction. Data were analyzed by statistical analysis system software and three models were developed, each for bacteria, spore, and yeast reduction. Regression analysis identified sonication temperature and amplitude to be significant variables on microbe reduction. Optimization of the inactivation of microbes was found to be at 84.8°C, 216 μm amplitude, and 5.8 min. In addition, the predicted log reductions of microbes at common processing conditions (72°C for 20 sec) using 216 μm amplitude were computed. The experimental responses for bacteria, spore, and yeast reductions fell within the predicted levels, confirming the accuracy of the models.
Martini, Silvana; Solorio, Jonathan; Walsh, Marie K.
2015-01-01
This study investigated the effects of high intensity ultrasound (temperature, amplitude, and time) on the inactivation of indigenous bacteria in pasteurized milk, Bacillus atrophaeus spores inoculated into sterile milk, and Saccharomyces cerevisiae inoculated into sterile orange juice using response surface methodology. The variables investigated were sonication temperature (range from 0 to 84°C), amplitude (range from 0 to 216 μm), and time (range from 0.17 to 5 min) on the response, log microbe reduction. Data were analyzed by statistical analysis system software and three models were developed, each for bacteria, spore, and yeast reduction. Regression analysis identified sonication temperature and amplitude to be significant variables on microbe reduction. Optimization of the inactivation of microbes was found to be at 84.8°C, 216 μm amplitude, and 5.8 min. In addition, the predicted log reductions of microbes at common processing conditions (72°C for 20 sec) using 216 μm amplitude were computed. The experimental responses for bacteria, spore, and yeast reductions fell within the predicted levels, confirming the accuracy of the models. PMID:26904659
Farrer, Emily C; Suding, Katharine N
2016-10-01
Although ecologists have documented the effects of nitrogen enrichment on productivity, diversity and species composition, we know little about the relative importance of the mechanisms driving these effects. We propose that distinct aspects of environmental change associated with N enrichment (resource limitation, asymmetric competition, and interactions with soil microbes) drive different aspects of plant response. We test this in greenhouse mesocosms, experimentally manipulating each factor across three ecosystems: tallgrass prairie, alpine tundra and desert grassland. We found that resource limitation controlled productivity responses to N enrichment in all systems. Asymmetric competition was responsible for diversity declines in two systems. Plant community composition was impacted by both asymmetric competition and altered soil microbes, with some contributions from resource limitation. Results suggest there may be generality in the mechanisms of plant community change with N enrichment. Understanding these links can help us better predict N response across a wide range of ecosystems. © 2016 John Wiley & Sons Ltd/CNRS.
Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.
Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M
2017-09-04
Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.
Microbial modulation of host immunity with the small molecule phosphorylcholine.
Clark, Sarah E; Weiser, Jeffrey N
2013-02-01
All microorganisms dependent on persistence in a host for survival rely on either hiding from or modulating host responses to infection. The small molecule phosphorylcholine, or choline phosphate (ChoP), is used for both of these purposes by a wide array of bacterial and parasitic microbes. While the mechanisms underlying ChoP acquisition and expression are diverse, a unifying theme is the use of ChoP to reduce the immune response to infection, creating an advantage for ChoP-expressing microorganisms. In this minireview, we discuss several benefits of ChoP expression during infection as well as how the immune system fights back against ChoP-expressing pathogens.
Cabinian, Allison; Sinsimer, Daniel; Tang, May; Jang, Youngsoon; Choi, Bongkum; Laouar, Yasmina; Laouar, Amale
2018-01-01
Background Interactions between host immune cells and gut microbiota are crucial for the integrity and function of the intestine. How these interactions regulate immune cell responses in the intestine remains a major gap in the field. Aim We have identified the signalling lymphocyte activation molecule family member 4 (SLAMF4) as an immunomodulator of the intestinal immunity. The aim is to determine how SLAMF4 is acquired in the gut and what its contribution to intestinal immunity is. Methods Expression of SLAMF4 was assessed in mice and humans. The mechanism of induction was studied using GFPtg bone marrow chimaera mice, lymphotoxin α and TNLG8A-deficient mice, as well as gnotobiotic mice. Role in immune protection was revealed using oral infection with Listeria monocytogenes and Cytobacter rodentium. Results SLAMF4 is a selective marker of intestinal immune cells of mice and humans. SLAMF4 induction occurs directly in the intestinal mucosa without the involvement of the gut-associated lymphoid tissue. Gut bacterial products, particularly those of gut anaerobes, and gut-resident antigen-presenting cell (APC)TNLG8A are key contributors of SLAMF4 induction in the intestine. Importantly, lack of SLAMF4 expression leads the increased susceptibility of mice to infection by oral pathogens culminating in their premature death. Conclusions SLAMF4 is a marker of intestinal immune cells which contributes to the protection against enteric pathogens and whose expression is dependent on the presence of the gut microbiota. This discovery provides a possible mechanism for answering the long-standing question of how the intertwining of the host and gut microbial biology regulates immune cell responses in the gut. PMID:28341747
Innate immunity is not related to the sex of adult Tree Swallows during the nestling period
Houdek, Bradley J.; Lombardo, Michael P.; Thorpe, Patrick A.; Hahn, D. Caldwell
2011-01-01
Evolutionary theory predicts that exposure to more diverse pathogens will result in the evolution of a more robust immune response. We predicted that during the breeding season the innate immune function of female Tree Swallows (Tachycineta bicolor) should be more effective than that of males because (1) the transmission of sexually transmitted microbes during copulation puts females at greater risk because ejaculates move from males to females, (2) females copulate with multiple males, exposing them to the potentially pathogenic microbes in semen, and (3) females spend more time in the nest than do males so may be more exposed to nest microbes and ectoparasites that can be vectors of bacterial and viral pathogens. In addition, elevated testosterone in males may suppress immune function. We tested our prediction during the 2009 breeding season with microbicidal assays in vitro to assess the ability of the innate immune system to kill Escherichia coli. The sexes did not differ in the ability of their whole blood to kill E. coli. We also found no significant relationships between the ability of whole blood to kill E. coli and the reproductive performance or the physical condition of males or females. These results indicate that during the nestling period there are no sexual differences in this component of the innate immune system. In addition, they suggest that there is little association between this component of innate immunity and the reproductive performance and physical condition during the nestling period of adult Tree Swallows.
Zogli, Prince; Libault, Marc
2017-10-01
Plants constantly interact with pathogenic and symbiotic microorganisms. Recent studies have revealed several regulatory mechanisms controlling these interactions. Among them, the plant defense system is activated not only in response to pathogenic, but also in response to symbiotic microbes. Interestingly, shortly after symbiotic microbial recognition, the plant defense system is suppressed to promote plant infection by symbionts. Research studies have demonstrated the influence of the plant epigenome in modulating both pathogenic and symbiotic plant-microbe interactions, thereby influencing plant survival, adaptation and evolution of the plant response to microbial infections. It is however unclear if plant pathogenic and symbiotic responses share similar epigenomic profiles or if epigenomic changes differentially regulate plant-microbe symbiosis and pathogenesis. In this mini-review, we provide an update of the current knowledge of epigenomic control on plant immune responses and symbiosis, with a special attention being paid to knowledge gap and potential strategies to fill-in the missing links. Copyright © 2017 Elsevier B.V. All rights reserved.
The role of B cells and humoral immunity in Mycobacterium tuberculosis infection.
Chan, John; Mehta, Simren; Bharrhan, Sushma; Chen, Yong; Achkar, Jacqueline M; Casadevall, Arturo; Flynn, JoAnne
2014-12-01
Mycobacterium tuberculosis remains a major public health burden. It is generally thought that while B cell- and antibody-mediated immunity plays an important role in host defense against extracellular pathogens, the primary control of intracellular microbes derives from cellular immune mechanisms. Studies on the immune regulatory mechanisms during infection with M. tuberculosis, a facultative intracellular organism, has established the importance of cell-mediated immunity in host defense during tuberculous infection. Emerging evidence suggest a role for B cell and humoral immunity in the control of intracellular pathogens, including obligatory species, through interactions with the cell-mediated immune compartment. Recent studies have shown that B cells and antibodies can significantly impact on the development of immune responses to the tubercle bacillus. In this review, we present experimental evidence supporting the notion that the importance of humoral and cellular immunity in host defense may not be entirely determined by the niche of the pathogen. A comprehensive approach that examines both humoral and cellular immunity could lead to better understanding of the immune response to M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.
The role of B cells and humoral immunity in Mycobacterium tuberculosis infection
Chan, John; Mehta, Simren; Bharrhan, Sushma; Chen, Yong; Achkar, Jacqueline M.; Casadevall, Arturo; Flynn, JoAnne
2014-01-01
Mycobacterium tuberculosis remains a major public health burden. It is generally thought that while B cell- and antibody-mediated immunity plays an important role in host defense against extracellular pathogens, the primary control of intracellular microbes derives from cellular immune mechanisms. Studies on the immune regulatory mechanisms during infection with M. tuberculosis, a facultative intracellular organism, has established the importance of cell-mediated immunity in host defense during tuberculous infection. Emerging evidence suggest a role for B cell and humoral immunity in the control of intracellular pathogens, including obligatory species, through interactions with the cell-mediated immune compartment. Recent studies have shown that B cells and antibodies can significantly impact on the development of immune responses to the tubercle bacillus. In this review, we present experimental evidence supporting the notion that the importance of humoral and cellular immunity in host defense may not be entirely determined by the niche of the pathogen. A comprehensive approach that examines both humoral and cellular immunity could lead to better understanding of the immune response to M. tuberculosis. PMID:25458990
Foetal immune programming: hormones, cytokines, microbes and regulatory T cells.
Hsu, Peter; Nanan, Ralph
2014-10-01
In addition to genetic factors, environmental cues play important roles in shaping the immune system. The first environment that the developing foetal immune system encounters is the uterus. Although physically the mother and the foetus are separated by the placental membranes, various factors such as hormones and cytokines may provide "environmental cues" to the foetal immune system. Additionally, increasing evidence suggests that prenatal maternal environmental factors, particularly microbial exposure, might significantly influence the foetal immune system, affecting long-term outcomes, a concept termed foetal immune programming. Here we discuss the potential mediators of foetal immune programming, focusing on the role of pregnancy-related hormones, cytokines and regulatory T cells, which play a critical role in immune tolerance. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Spatial heterogeneity in soil microbes alters outcomes of plant competition.
Abbott, Karen C; Karst, Justine; Biederman, Lori A; Borrett, Stuart R; Hastings, Alan; Walsh, Vonda; Bever, James D
2015-01-01
Plant species vary greatly in their responsiveness to nutritional soil mutualists, such as mycorrhizal fungi and rhizobia, and this responsiveness is associated with a trade-off in allocation to root structures for resource uptake. As a result, the outcome of plant competition can change with the density of mutualists, with microbe-responsive plant species having high competitive ability when mutualists are abundant and non-responsive plants having high competitive ability with low densities of mutualists. When responsive plant species also allow mutualists to grow to greater densities, changes in mutualist density can generate a positive feedback, reinforcing an initial advantage to either plant type. We study a model of mutualist-mediated competition to understand outcomes of plant-plant interactions within a patchy environment. We find that a microbe-responsive plant can exclude a non-responsive plant from some initial conditions, but it must do so across the landscape including in the microbe-free areas where it is a poorer competitor. Otherwise, the non-responsive plant will persist in both mutualist-free and mutualist-rich regions. We apply our general findings to two different biological scenarios: invasion of a non-responsive plant into an established microbe-responsive native population, and successional replacement of non-responders by microbe-responsive species. We find that resistance to invasion is greatest when seed dispersal by the native plant is modest and dispersal by the invader is greater. Nonetheless, a native plant that relies on microbial mutualists for competitive dominance may be particularly vulnerable to invasion because any disturbance that temporarily reduces its density or that of the mutualist creates a window for a non-responsive invader to establish dominance. We further find that the positive feedbacks from associations with beneficial soil microbes create resistance to successional turnover. Our theoretical results constitute an
Spatial Heterogeneity in Soil Microbes Alters Outcomes of Plant Competition
Abbott, Karen C.; Karst, Justine; Biederman, Lori A.; Borrett, Stuart R.; Hastings, Alan; Walsh, Vonda; Bever, James D.
2015-01-01
Plant species vary greatly in their responsiveness to nutritional soil mutualists, such as mycorrhizal fungi and rhizobia, and this responsiveness is associated with a trade-off in allocation to root structures for resource uptake. As a result, the outcome of plant competition can change with the density of mutualists, with microbe-responsive plant species having high competitive ability when mutualists are abundant and non-responsive plants having high competitive ability with low densities of mutualists. When responsive plant species also allow mutualists to grow to greater densities, changes in mutualist density can generate a positive feedback, reinforcing an initial advantage to either plant type. We study a model of mutualist-mediated competition to understand outcomes of plant-plant interactions within a patchy environment. We find that a microbe-responsive plant can exclude a non-responsive plant from some initial conditions, but it must do so across the landscape including in the microbe-free areas where it is a poorer competitor. Otherwise, the non-responsive plant will persist in both mutualist-free and mutualist-rich regions. We apply our general findings to two different biological scenarios: invasion of a non-responsive plant into an established microbe-responsive native population, and successional replacement of non-responders by microbe-responsive species. We find that resistance to invasion is greatest when seed dispersal by the native plant is modest and dispersal by the invader is greater. Nonetheless, a native plant that relies on microbial mutualists for competitive dominance may be particularly vulnerable to invasion because any disturbance that temporarily reduces its density or that of the mutualist creates a window for a non-responsive invader to establish dominance. We further find that the positive feedbacks from associations with beneficial soil microbes create resistance to successional turnover. Our theoretical results constitute an
DAMPs, MAMPs, and NAMPs in plant innate immunity.
Choi, Hyong Woo; Klessig, Daniel F
2016-10-26
Multicellular organisms have evolved systems/mechanisms to detect various forms of danger, including attack by microbial pathogens and a variety of pests, as well as tissue and cellular damage. Detection via cell-surface receptors activates an ancient and evolutionarily conserved innate immune system. Potentially harmful microorganisms are recognized by the presence of molecules or parts of molecules that have structures or chemical patterns unique to microbes and thus are perceived as non-self/foreign. They are referred to as Microbe-Associated Molecular Patterns (MAMPs). Recently, a class of small molecules that is made only by nematodes, and that functions as pheromones in these organisms, was shown to be recognized by a wide range of plants. In the presence of these molecules, termed Nematode-Associated Molecular Patterns (NAMPs), plants activate innate immune responses and display enhanced resistance to a broad spectrum of microbial and nematode pathogens. In addition to pathogen attack, the relocation of various endogenous molecules or parts of molecules, generally to the extracellular milieu, as a result of tissue or cellular damage is perceived as a danger signal, and it leads to the induction of innate immune responses. These relocated endogenous inducers are called Damage-Associated Molecular Patterns (DAMPs). This mini-review is focused on plant DAMPs, including the recently discovered Arabidopsis HMGB3, which is the counterpart of the prototypic animal DAMP HMGB1. The plant DAMPs will be presented in the context of plant MAMPs and NAMPs, as well as animal DAMPs.
Cabinian, Allison; Sinsimer, Daniel; Tang, May; Jang, Youngsoon; Choi, Bongkum; Laouar, Yasmina; Laouar, Amale
2018-05-01
Interactions between host immune cells and gut microbiota are crucial for the integrity and function of the intestine. How these interactions regulate immune cell responses in the intestine remains a major gap in the field. We have identified the signalling lymphocyte activation molecule family member 4 (SLAMF4) as an immunomodulator of the intestinal immunity. The aim is to determine how SLAMF4 is acquired in the gut and what its contribution to intestinal immunity is. Expression of SLAMF4 was assessed in mice and humans. The mechanism of induction was studied using GFP tg bone marrow chimaera mice, lymphotoxin α and TNLG8A-deficient mice, as well as gnotobiotic mice. Role in immune protection was revealed using oral infection with Listeria monocytogenes and Cytobacter rodentium . SLAMF4 is a selective marker of intestinal immune cells of mice and humans. SLAMF4 induction occurs directly in the intestinal mucosa without the involvement of the gut-associated lymphoid tissue. Gut bacterial products, particularly those of gut anaerobes, and gut-resident antigen-presenting cell (APC) TNLG8A are key contributors of SLAMF4 induction in the intestine. Importantly, lack of SLAMF4 expression leads the increased susceptibility of mice to infection by oral pathogens culminating in their premature death. SLAMF4 is a marker of intestinal immune cells which contributes to the protection against enteric pathogens and whose expression is dependent on the presence of the gut microbiota. This discovery provides a possible mechanism for answering the long-standing question of how the intertwining of the host and gut microbial biology regulates immune cell responses in the gut. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Protein trafficking during plant innate immunity.
Wang, Wen-Ming; Liu, Peng-Qiang; Xu, Yong-Ju; Xiao, Shunyuan
2016-04-01
Plants have evolved a sophisticated immune system to fight against pathogenic microbes. Upon detection of pathogen invasion by immune receptors, the immune system is turned on, resulting in production of antimicrobial molecules including pathogenesis-related (PR) proteins. Conceivably, an efficient immune response depends on the capacity of the plant cell's protein/membrane trafficking network to deploy the right defense-associated molecules in the right place at the right time. Recent research in this area shows that while the abundance of cell surface immune receptors is regulated by endocytosis, many intracellular immune receptors, when activated, are partitioned between the cytoplasm and the nucleus for induction of defense genes and activation of programmed cell death, respectively. Vesicle transport is an essential process for secretion of PR proteins to the apoplastic space and targeting of defense-related proteins to the plasma membrane or other endomembrane compartments. In this review, we discuss the various aspects of protein trafficking during plant immunity, with a focus on the immunity proteins on the move and the major components of the trafficking machineries engaged. © 2015 Institute of Botany, Chinese Academy of Sciences.
Genomic dissection of host-microbe and microbe-microbe interactions for advanced plant breeding.
Kroll, Samuel; Agler, Matthew T; Kemen, Eric
2017-04-01
Agriculture faces many emerging challenges to sustainability, including limited nutrient resources, losses from diseases caused by current and emerging pathogens and environmental degradation. Microorganisms have great importance for plant growth and performance, including the potential to increase yields, nutrient uptake and pathogen resistance. An urgent need is therefore to understand and engineer plants and their associated microbial communities. Recent massive genomic sequencing of host plants and associated microbes offers resources to identify novel mechanisms of communal assembly mediated by the host. For example, host-microbe and microbe-microbe interactions are involved in niche formation, thereby contributing to colonization. By leveraging genomic resources, genetic traits underlying those mechanisms will become important resources to design plants selecting and hosting beneficial microbial communities. Copyright © 2017 Elsevier Ltd. All rights reserved.
ENGINEERING NANO- AND MICRO-PARTICLES TO TUNE IMMUNITY
Moon, James J.; Irvine, Darrell J.; Huang, Bonnie
2013-01-01
The immune system can be a cure or cause of disease, fulfilling a protective role in attacking cancer or pathogenic microbes but also causing tissue destruction in autoimmune disorders. Thus, therapies aimed to amplify or suppress immune reactions are of great interest. However, the complex regulation of the immune system, coupled with the potential systemic side effects associated with traditional systemic drug therapies, has presented a major hurdle for the development of successful immunotherapies,. Recent progress in the design of synthetic micro- and nano-particles that can target drugs, deliver imaging agents, or stimulate immune cells directly through their physical and chemical properties is leading to new approaches to deliver vaccines, promote immune responses against tumors, and suppress autoimmunity. In addition, novel strategies, such as the use of particle-laden immune cells as living targeting agents for drugs, are providing exciting new approaches for immunotherapy. This progress report describes recent advances in the design of micro- and nano-particles in immunotherapies and diagnostics. PMID:22641380
Self/nonself perception in plants in innate immunity and defense
Sanabria, Natasha M; Huang, Ju-Chi
2010-01-01
The ability to distinguish ‘self’ from ‘nonself’ is the most fundamental aspect of any immune system. The evolutionary solution in plants to the problems of perceiving and responding to pathogens involves surveillance of nonself, damaged-self and altered-self as danger signals. This is reflected in basal resistance or non-host resistance, which is the innate immune response that protects plants against the majority of pathogens. In the case of surveillance of nonself, plants utilize receptor-like proteins or -kinases (RLP/Ks) as pattern recognition receptors (PRRs), which can detect conserved pathogen/microbe-associated molecular pattern (P/MAMP) molecules. P/MAMP detection serves as an early warning system for the presence of a wide range of potential pathogens and the timely activation of plant defense mechanisms. However, adapted microbes express a suite of effector proteins that often interfere or act as suppressors of these defenses. In response, plants have evolved a second line of defense that includes intracellular nucleotide binding leucine-rich repeat (NB-LRR)-containing resistance proteins, which recognize isolate-specific pathogen effectors once the cell wall has been compromised. This host-immunity acts within the species level and is controlled by polymorphic host genes, where resistance protein-mediated activation of defense is based on an ‘altered-self’ recognition mechanism. PMID:21559176
Dawadi, Bishnu; Wang, Xinghong; Xiao, Rong; Muhammad, Abrar; Hou, Youming; Shi, Zhanghong
2018-09-01
Many notorious insect pests live in the symbiotic associations with gut microbiota. However, the mechanisms underlying how they host their gut microbiota are unknown. Most gut bacteria can release peptidoglycan (PGN) which is an important antigen to activate the immune response. Therefore, how to keep the appropriate gut immune intensity to host commensals while to efficiently remove enteropathogens is vital for insect health. This study is aimed at elucidating the roles of an amidase PGRP, Rf PGRP-LB, in maintaining the gut-microbe symbiosis of Red palm weevil (RPW), Rhynchophorus ferrugineus Olivier. RfPGRP-LB is a secreted protein containing a typical PGRP domain. The existence of five conservative amino acid residues, being required for amidase activity, showed that RfPGRP-LB is a catalytic protein. Expression analysis revealed abundance of RfPGRP-LB transcripts in gut was dramatically higher than those in other tissues. RfPGRP-LB could be significantly induced against the infection of Escherichia coli. In vitro assays revealed that rRfPGRP-LB impaired the growth of E. coli and agglutinated bacteria cells obviously, suggesting RfPGRP-LB is a pathogen recognition receptor and bactericidal molecule. RfPGRP-LB knockdown reduced the persistence of E. coli in gut and load of indigenous gut microbiota significantly. Furthermore, the community structure of indigenous gut microbiota was also intensively altered by RfPGRP-LB silence. Higher levels of the antimicrobial peptide, attacin, were detected in guts of RfPGRP-LB silenced larvae than controls. Collectively, RfPGRP-LB plays multiple roles in modulating the homeostasis of RPW gut microbiota not only by acting as a negative regulator of mucosal immunity through PGN degradation but also as a bactericidal effector to prevent overgrowth of commensals and persistence of noncommensals. Copyright © 2018 Elsevier Ltd. All rights reserved.
Neuropeptide Substance P and the Immune Response
Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza
2016-01-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883
Neuropeptide substance P and the immune response.
Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza
2016-11-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.
Vogelweith, Fanny; Moreau, Jérôme; Thiéry, Denis; Moret, Yannick
2015-06-01
Inherent to the cost of immunity, the immune system itself can exhibit tradeoffs between its arms. Phytophagous insects face a wide range of microbial and eukaryotic parasites, each activating different immune pathways that could compromise the activity of the others. Feeding larvae are primarily exposed to microbes, which growth is controlled by antibiotic secondary metabolites produced by the host plant. The resulting variation in abundance of microbes on plants is expected to differentially stimulate the insect antimicrobial immune defenses. Under the above tradeoff hypothesis, stimulation of the insect antimicrobial defenses is expected to compromise immune activity against eukaryote parasites. In the European grape berry moth, Eupoecilia ambiguella, immune effectors directed towards microbes are negatively correlated to those directed towards eukaryotic parasites among host plants. Here, we hypothesize this relationship is caused by a variable control of the microbial community among host plants by their antibiotic metabolites. To test this hypothesis, we first quantified antimicrobial activity in berries of several grape varieties. We then measured immune defenses of E. ambiguella larvae raised on artificial diets in which we mimicked levels of antimicrobial activity of grape berries using tetracycline to control the abundance of growing microbes. Another group of larvae was raised on artificial diets made of berry extracts only to control for the effect of nutrition. We found that controlling microbe abundance with tetracycline in diets did not explain variation in the immune function whereas the presence of berry extracts did. This suggests that variation in immune defenses of E. ambiguella among grape varieties is caused by nutritional difference among host plants rather than microbe abundance. Further study of the effects of berry compounds on larval immune parameters will be needed to explain the observed tradeoff among immune system components
Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation
Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.
1978-01-01
A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
Immunomodulator-based enhancement of anti smallpox immune responses.
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.
Stress proteins and the immune response.
Moseley, P
2000-07-25
The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61
Human Immune Responses to Dengue Viruses.
1984-08-01
ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON
Candida innate immunity at the mucosa.
Richardson, Jonathan P; Moyes, David L; Ho, Jemima; Naglik, Julian R
2018-03-09
The tremendous diversity in microbial species that colonise the mucosal surfaces of the human body is only now beginning to be fully appreciated. Distinguishing between the behaviour of commensal microbes and harmful pathogens that reside at mucosal sites in the body is a complex, and exquisitely fine-tuned process central to mucosal health. The fungal pathobiont Candida albicans is frequently isolated from mucosal surfaces with an asymptomatic carriage rate of approximately 60% in the human population. While normally a benign member of the microbiota, overgrowth of C. albicans often results in localised mucosal infection causing morbidity in otherwise healthy individuals, and invasive infection that often causes death in the absence of effective immune defence. C. albicans triggers numerous innate immune responses at mucosal surfaces, and detection of C. albicans hyphae in particular, stimulates the production of antimicrobial peptides, danger-associated molecular patterns and cytokines that function to reduce fungal burdens during infection. This review will summarise our current understanding of innate immune responses to C. albicans at mucosal surfaces. Copyright © 2018. Published by Elsevier Ltd.
The Environment-Immune Route to Chronic Disease
Specific environmental factors including chemicals, drugs, microbes and both physical and psychological factors can affect the immune system producing dysfunction and, ultimately, an increased risk ofchronic disease. Several different types of immune alterations can result from e...
Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran
2016-01-01
Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population
The unfolded protein response in immunity and inflammation
Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.
2017-01-01
The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803
The effects of commensal bacteria on innate immune responses in the female genital tract
Mirmonsef, P; Gilbert, D; Zariffard, MR; Hamaker, BR; Kaur, A; Landay, AL; Spear, GT
2013-01-01
The innate and adaptive immune systems are important mechanisms for resistance to pathogens in the female lower genital tract. Lactobacilli at this site help maintain a healthy vagina by producing several factors including lactic acid. Indeed, bacterial vaginosis, a condition in which the genital microbiota is altered, is strongly associated with increased rates of a number of infections including HIV. However, the precise factors that contribute to increased rates of microbial and viral infections in bacterial vaginosis remain to be elucidated. We have studied the effects of bacterial microbiota in the lower genital tract on innate immunity and have found that Toll-like receptor ligands and short chain fatty acids, produced by bacterial microbiota, have dramatic effects on immune function. In this review, we will discuss these results, in addition to some recent articles that we believe will enhance our understanding of how microbes might interact with the immune system. PMID:21143335
Injury-induced immune responses in Hydra.
Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte
2014-08-01
The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights
B cell function in the immune response to helminths
Harris, Nicola
2010-01-01
Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556
Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833
Mucosal immune response to poliovirus vaccines in childhood.
Ogra, P L
1984-01-01
Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.
Effect of antipyretic analgesics on immune responses to vaccination.
Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B
2016-09-01
While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.
Gut microbiota recovery and immune response in ampicillin-treated mice.
Castro-Mejía, Josué L; Jakesevic, Maja; Fabricius, Niels F; Krych, Łukasz; Nielsen, Dennis S; Kot, Witold; Bendtsen, Katja M; Vogensen, Finn K; Hansen, Camilla H F; Hansen, Axel K
2018-06-01
Ampicillin is applied in rodents to induce a temporarily depleted microbiota. To elucidate whether bacteria are just temporarily suppressed or fully eliminated, and how this affects the re-colonisation process, we compared the microbiota and immune system in conventionally housed untreated mice with newly weaned ampicillin treated mice subsequently housed in either a microbe containing environment or in an isolator with only host associated suppressed bacteria to recolonize the gut. Two weeks ampicillin treatment induced a seemingly germ-free state with no bacterial DNA to reveal. Four weeks after treatment caeca were still significantly enlarged in both treated groups, but bacteria re-appeared even in isolator housed mice. While some suppressed bacteria were able to recover and even dominate the community, the abundances and composition were far from the untreated mice and differed between isolator and conventional housing. The treatment reduced the innate cytokine expressions at least for three weeks after treatment, and had a non-lasting reducing impact on the regulatory T cells, and a more lasting impact on the natural killer T cells. We conclude that temporary ampicillin treatment suppresses the majority but does not eliminate all the gut microbiota members. The re-colonisation process is as such influenced by both suppressed host associated bacteria and by environmental bacteria. Treated mice do not re-obtain a complex gut microbiota comparable to untreated mice, and the immune response and gut morphology reflect this. This is a concern when comparing host parameters sensitive to microbial regulation after an antibiotic-induced temporarily "germ-free" state. Copyright © 2018 Elsevier Ltd. All rights reserved.
The Role of Immune and Inflammatory Cells in Idiopathic Pulmonary Fibrosis
Desai, Omkar; Winkler, Julia; Minasyan, Maksym; Herzog, Erica L.
2018-01-01
The contribution of the immune system to idiopathic pulmonary fibrosis (IPF) remains poorly understood. While most sources agree that IPF does not result from a primary immunopathogenic mechanism, evidence gleaned from animal modeling and human studies suggests that innate and adaptive immune processes can orchestrate existing fibrotic responses. This review will synthesize the available data regarding the complex role of professional immune cells in IPF. The role of innate immune populations such as monocytes, macrophages, myeloid suppressor cells, and innate lymphoid cells will be discussed, as will the activation of these cells via pathogen-associated molecular patterns derived from invading or commensural microbes, and danger-associated molecular patterns derived from injured cells and tissues. The contribution of adaptive immune responses driven by T-helper cells and B cells will be reviewed as well. Each form of immune activation will be discussed in the context of its relationship to environmental and genetic factors, disease outcomes, and potential therapies. We conclude with discussion of unanswered questions and opportunities for future study in this area. PMID:29616220
Mathematical modeling the radiation effects on humoral immunity
NASA Astrophysics Data System (ADS)
Smirnova, O. A.
A mathematical model of humoral immune response in nonirradiated and irradiated mammals is developed. It is based on conventional theories and experimental facts in this field. The model is a system of nonlinear differential equations which describe the dynamics of concentrations of antibody and antigen molecules, immunocompetent B lymphocytes, and the rest blood lymphocytes, as well as the bone-marrow lymphocyte precursors. The interaction of antigen molecules with antibodies and with antibody-like receptors on immunocompetent cells is also incorporated. The model quantitatively reproduces the dynamics of the humoral immune response to the T-independent antigen (capsular antigen of plague microbe) in nonirradiated mammals (CBA mice). It describes the peculiarities of the humoral immune response in CBA mice exposed to acute radiation before or after introducing antigen. The model predicts an adaptation of humoral immune system to low dose rate chronic irradiation in the result of which the intensity of immune response relaxes to a new, lower than normal, stable level. The mechanisms of this phenomenon are revealed. The results obtained show that the developed model, after the appropriate identification, can be used to predict the effects of acute and low-level long-term irradiation on the system of humoral immunity in humans. Employment of the mathematical model identified in the proper way should be important in estimating the radiation risk for cosmonauts and astronauts on long space missions such as a voyage to Mars or a lunar colony.
Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke
2013-01-01
Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066
Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B
2014-01-01
Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.
Diet, gut microbes, and the pathogenesis of inflammatory bowel diseases.
Dolan, Kyle T; Chang, Eugene B
2017-01-01
The rising incidence of inflammatory bowel diseases in recent decades has notably paralleled changing lifestyle habits in Western nations, which are now making their way into more traditional societies. Diet plays a key role in IBD pathogenesis, and there is a growing appreciation that the interaction between diet and microbes in a susceptible person contributes significantly to the onset of disease. In this review, we examine what is known about dietary and microbial factors that promote IBD. We summarize recent findings regarding the effects of diet in IBD epidemiology from prospective population cohort studies, as well as new insights into IBD-associated dysbiosis. Microbial metabolism of dietary components can influence the epithelial barrier and the mucosal immune system, and understanding how these interactions generate or suppress inflammation will be a significant focus of IBD research. Our knowledge of dietary and microbial risk factors for IBD provides important considerations for developing therapeutic approaches through dietary modification or re-shaping the microbiota. We conclude by calling for increased sophistication in designing studies on the role of diet and microbes in IBD pathogenesis and disease resolution in order to accelerate progress in response to the growing challenge posed by these complex disorders. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K
2014-01-01
We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.
Antitumor immune responses mediated by dendritic cells
Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne
2013-01-01
Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744
Effect of antipyretic analgesics on immune responses to vaccination
Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.
2016-01-01
ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296
Transcriptional Regulation of Pattern-Triggered Immunity in Plants.
Li, Bo; Meng, Xiangzong; Shan, Libo; He, Ping
2016-05-11
Perception of microbe-associated molecular patterns (MAMPs) by cell-surface-resident pattern recognition receptors (PRRs) induces rapid, robust, and selective transcriptional reprogramming, which is central for launching effective pattern-triggered immunity (PTI) in plants. Signal relay from PRR complexes to the nuclear transcriptional machinery via intracellular kinase cascades rapidly activates primary immune response genes. The coordinated action of gene-specific transcription factors and the general transcriptional machinery contribute to the selectivity of immune gene activation. In addition, PRR complexes and signaling components are often transcriptionally upregulated upon MAMP perception to ensure the robustness and sustainability of PTI outputs. In this review, we discuss recent advances in deciphering the signaling pathways and regulatory mechanisms that coordinately lead to timely and accurate MAMP-induced gene expression in plants. Copyright © 2016 Elsevier Inc. All rights reserved.
2013-01-01
Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half
Damage signals in the insect immune response
Krautz, Robert; Arefin, Badrul; Theopold, Ulrich
2014-01-01
Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815
Interplay between behavioural thermoregulation and immune response in mealworms.
Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco
2012-11-01
Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.
2014-01-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276
Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C
2015-03-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Immune Response to Giardia duodenalis
Faubert, Gaétan
2000-01-01
The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490
Q fever in pregnant goats: humoral and cellular immune responses
2013-01-01
Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213
The innate and adaptive immune response to avian influenza virus
USDA-ARS?s Scientific Manuscript database
Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...
Human Immune Responses to Dengue Viruses.
1986-07-01
0-1 NO- 3K1- INO. "o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in
SUMO-Enriched Proteome for Drosophila Innate Immune Response
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.
2015-01-01
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570
SUMO-Enriched Proteome for Drosophila Innate Immune Response.
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S
2015-08-18
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.
Role of Osmolytes in Regulating Immune System.
Kumar, Tarun; Yadav, Manisha; Singh, Laishram Rajendrakumar
2016-01-01
The immune system has evolved to protect the host organism from diverse range of pathogenic microbes that are themselves constantly evolving. It is a complex network of cells, humoral factors, chemokines and cytokines. Dysregulation of immune system results in various kinds of immunological disorders. There are several external agents which govern the regulation of immune system. Recent studies have indicated the role of osmolytes in regulation of various immunological processes such as Ag-Ab interaction, Ig assembly, Ag presentation etc. In this present review, we have systematically discussed the role of osmolytes involved in regulation of several key immunological processes. Osmolytes are involved in the regulation of several key immunological processes such as immunoglobulin assembly and folding, immune cells proliferation, regulation of immune cells function, Ag-Ab interaction, antigen presentation, inflammatory response and protection against photo-immunosuppression. Hence, osmolytes and their transporters might be used as potential drug and drug targets respectively. This review is therefore designed to help clinicians in development of osmolyte based therapeutic strategies in the treatment of various immunological disorders. Appropriate future perspectives have also been included.
Immune function trade-offs in response to parasite threats.
Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W
2017-04-01
Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Innate immune sensing and response to influenza.
Pulendran, Bali; Maddur, Mohan S
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.
Control of antiviral immunity by pattern recognition and the microbiome
Pang, Iris K.; Iwasaki, Akiko
2013-01-01
Summary Human skin and mucosal surfaces are in constant contact with resident and invasive microbes. Recognition of microbial products by receptors of the innate immune system triggers rapid innate defense and transduces signals necessary for initiating and maintaining the adaptive immune responses. Microbial sensing by innate pattern recognition receptors is not restricted to pathogens. Rather, proper development, function, and maintenance of innate and adaptive immunity rely on continuous recognition of products derived from the microorganisms indigenous to the internal and external surfaces of mammalian host. Tonic immune activation by the resident microbiota governs host susceptibility to intestinal and extra-intestinal infections including those caused by viruses. This review highlights recent developments in innate viral recognition leading to adaptive immunity, and discusses potential link between viruses, microbiota and the host immune system. Further, we discuss the possible roles of microbiome in chronic viral infection and pathogenesis of autoimmune disease, and speculate on the benefit for probiotic therapies against such diseases. PMID:22168422
Control of epithelial immune-response genes and implications for airway immunity and inflammation.
Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J
1998-01-01
A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.
Innate immune response development in nestling tree swallows
Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.
2011-01-01
We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.
Modeling Systems-Level Regulation of Host Immune Responses
Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka
2007-01-01
Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Gang; Xu, Zhenjiang; Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceaemore » of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.« less
Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.
Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C
2016-05-01
Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.
Ramsey, J S; Chavez, J D; Johnson, R; Hosseinzadeh, S; Mahoney, J E; Mohr, J P; Robison, F; Zhong, X; Hall, D G; MacCoss, M; Bruce, J; Cilia, M
2017-02-01
The Asian citrus psyllid ( Diaphorina citri) is the insect vector responsible for the worldwide spread of ' Candidatus Liberibacter asiaticus' (CLas), the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri transmission of CLas is more efficient when bacteria are acquired by nymphs when compared with adults. We hypothesize that expression changes in the D. citri immune system and commensal microbiota occur during development and regulate vector competency. In support of this hypothesis, more proteins, with greater fold changes, were differentially expressed in response to CLas in adults when compared with nymphs, including insect proteins involved in bacterial adhesion and immunity. Compared with nymphs, adult insects had a higher titre of CLas and the bacterial endosymbionts Wolbachia, Profftella and Carsonella. All Wolbachia and Profftella proteins differentially expressed between nymphs and adults are upregulated in adults, while most differentially expressed Carsonella proteins are upregulated in nymphs. Discovery of protein interaction networks has broad applicability to the study of host-microbe relationships. Using protein interaction reporter technology, a D. citri haemocyanin protein highly upregulated in response to CLas was found to physically interact with the CLas coenzyme A (CoA) biosynthesis enzyme phosphopantothenoylcysteine synthetase/decarboxylase. CLas pantothenate kinase, which catalyses the rate-limiting step of CoA biosynthesis, was found to interact with a D. citri myosin protein. Two Carsonella enzymes involved in histidine and tryptophan biosynthesis were found to physically interact with D. citri proteins. These co-evolved protein interaction networks at the host-microbe interface are highly specific targets for controlling the insect vector responsible for the spread of citrus greening.
Chavez, J. D.; Johnson, R.; Hosseinzadeh, S.; Mahoney, J. E.; Mohr, J. P.; Robison, F.; Zhong, X.; Hall, D. G.; MacCoss, M.; Bruce, J.; Cilia, M.
2017-01-01
The Asian citrus psyllid (Diaphorina citri) is the insect vector responsible for the worldwide spread of ‘Candidatus Liberibacter asiaticus’ (CLas), the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri transmission of CLas is more efficient when bacteria are acquired by nymphs when compared with adults. We hypothesize that expression changes in the D. citri immune system and commensal microbiota occur during development and regulate vector competency. In support of this hypothesis, more proteins, with greater fold changes, were differentially expressed in response to CLas in adults when compared with nymphs, including insect proteins involved in bacterial adhesion and immunity. Compared with nymphs, adult insects had a higher titre of CLas and the bacterial endosymbionts Wolbachia, Profftella and Carsonella. All Wolbachia and Profftella proteins differentially expressed between nymphs and adults are upregulated in adults, while most differentially expressed Carsonella proteins are upregulated in nymphs. Discovery of protein interaction networks has broad applicability to the study of host–microbe relationships. Using protein interaction reporter technology, a D. citri haemocyanin protein highly upregulated in response to CLas was found to physically interact with the CLas coenzyme A (CoA) biosynthesis enzyme phosphopantothenoylcysteine synthetase/decarboxylase. CLas pantothenate kinase, which catalyses the rate-limiting step of CoA biosynthesis, was found to interact with a D. citri myosin protein. Two Carsonella enzymes involved in histidine and tryptophan biosynthesis were found to physically interact with D. citri proteins. These co-evolved protein interaction networks at the host–microbe interface are highly specific targets for controlling the insect vector responsible for the spread of citrus greening. PMID:28386418
Agouron and immune response to commercialize remune immune-based treatment.
James, J S
1998-06-19
Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.
Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877
Modeling the interactions between pathogenic bacteria, bacteriophage and immune response
NASA Astrophysics Data System (ADS)
Leung, Chung Yin (Joey); Weitz, Joshua S.
The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.
Host plant associated enhancement of immunity and survival in virus infected caterpillars.
Smilanich, Angela M; Langus, Tara C; Doan, Lydia; Dyer, Lee A; Harrison, Joshua G; Hsueh, Jennifer; Teglas, Mike B
2018-01-01
Understanding the interaction between host plant chemistry, the immune response, and insect pathogens can shed light on host plant use by insect herbivores. In this study, we focused on how interactions between the insect immune response and plant secondary metabolites affect the response to a viral pathogen. Based upon prior research, we asked whether the buckeye caterpillar, Junonia coenia (Nymphalidae), which specializes on plants containing iridoid glycosides (IGs), is less able to resist the pathogenic effects of a densovirus infection when feeding on plants with high concentrations of IGs. In a fully factorial design, individuals were randomly assigned to three treatments, each of which had two levels: (1) exposed to the densovirus versus control, (2) placed on a plant species with high concentrations of IGs (Plantago lanceolata, Plantaginaceae) versus low concentrations of IGs (P. major), and (3) control versus surface sterilized to exclude surface microbes that may contribute to viral resistance. We measured phenoloxidase (PO) activity, hemocyte counts, and gut bacterial diversity (16S ribosomal RNA) during the fourth larval instar, as well as development time, pupal weight, and survival to adult. Individuals infected with the virus were immune-suppressed (as measured by PO response and hemocyte count) and developed significantly faster than virus-free individuals. Contrary to our predictions,mortality was significantly less for virus challengedindividuals reared on the high IG plant compared to the low IG plant.This suggests that plant secondary metabolites can influence survival from viral infection and may be associated with activation of PO. Removing egg microbes did not affect the immune response or survival of the larvae. In summary, these results suggest that plant secondary metabolites are important for survival against a viral pathogen. Even though the PO response was better on the high IG plant, the extent to which this result contributes to
Hennessy, Rosanna C; Glaring, Mikkel A; Olsson, Stefan; Stougaard, Peter
2017-08-10
Few studies to date report the transcriptional response of biocontrol bacteria toward phytopathogens. In order to gain insights into the potential mechanism underlying the antagonism of the antimicrobial producing strain P. fluorescens In5 against the phytopathogens Rhizoctonia solani and Pythium aphanidermatum, global RNA sequencing was performed. Differential gene expression profiling of P. fluorescens In5 in response to either R. solani or P. aphanidermatum was investigated using transcriptome sequencing (RNA-seq). Total RNA was isolated from single bacterial cultures of P. fluorescens In5 or bacterial cultures in dual-culture for 48 h with each pathogen in biological triplicates. RNA-seq libraries were constructed following a default Illumina stranded RNA protocol including rRNA depletion and were sequenced 2 × 100 bases on Illumina HiSeq generating approximately 10 million reads per sample. No significant changes in global gene expression were recorded during dual-culture of P. fluorescens In5 with any of the two pathogens but rather each pathogen appeared to induce expression of a specific set of genes. A particularly strong transcriptional response to R. solani was observed and notably several genes possibly associated with secondary metabolite detoxification and metabolism were highly upregulated in response to the fungus. A total of 23 genes were significantly upregulated and seven genes were significantly downregulated with at least respectively a threefold change in expression level in response to R. solani compared to the no fungus control. In contrast, only one gene was significantly upregulated over threefold and three transcripts were significantly downregulated over threefold in response to P. aphanidermatum. Genes known to be involved in synthesis of secondary metabolites, e.g. non-ribosomal synthetases and hydrogen cyanide were not differentially expressed at the time points studied. This study demonstrates that genes possibly involved in
The Microbe Directory: An annotated, searchable inventory of microbes' characteristics.
Shaaban, Heba; Westfall, David A; Mohammad, Rawhi; Danko, David; Bezdan, Daniela; Afshinnekoo, Ebrahim; Segata, Nicola; Mason, Christopher E
2018-01-05
The Microbe Directory is a collective research effort to profile and annotate more than 7,500 unique microbial species from the MetaPhlAn2 database that includes bacteria, archaea, viruses, fungi, and protozoa. By collecting and summarizing data on various microbes' characteristics, the project comprises a database that can be used downstream of large-scale metagenomic taxonomic analyses, allowing one to interpret and explore their taxonomic classifications to have a deeper understanding of the microbial ecosystem they are studying. Such characteristics include, but are not limited to: optimal pH, optimal temperature, Gram stain, biofilm-formation, spore-formation, antimicrobial resistance, and COGEM class risk rating. The database has been manually curated by trained student-researchers from Weill Cornell Medicine and CUNY-Hunter College, and its analysis remains an ongoing effort with open-source capabilities so others can contribute. Available in SQL, JSON, and CSV (i.e. Excel) formats, the Microbe Directory can be queried for the aforementioned parameters by a microorganism's taxonomy. In addition to the raw database, The Microbe Directory has an online counterpart ( https://microbe.directory/) that provides a user-friendly interface for storage, retrieval, and analysis into which other microbial database projects could be incorporated. The Microbe Directory was primarily designed to serve as a resource for researchers conducting metagenomic analyses, but its online web interface should also prove useful to any individual who wishes to learn more about any particular microbe.
Protein Poly(ADP-ribosyl)ation Regulates Arabidopsis Immune Gene Expression and Defense Responses
Feng, Baomin; Liu, Chenglong; de Oliveira, Marcos V. V.; Intorne, Aline C.; Li, Bo; Babilonia, Kevin; de Souza Filho, Gonçalo A.; Shan, Libo; He, Ping
2015-01-01
Perception of microbe-associated molecular patterns (MAMPs) elicits transcriptional reprogramming in hosts and activates defense to pathogen attacks. The molecular mechanisms underlying plant pattern-triggered immunity remain elusive. A genetic screen identified Arabidopsis poly(ADP-ribose) glycohydrolase 1 (atparg1) mutant with elevated immune gene expression upon multiple MAMP and pathogen treatments. Poly(ADP-ribose) glycohydrolase (PARG) is predicted to remove poly(ADP-ribose) polymers on acceptor proteins modified by poly(ADP-ribose) polymerases (PARPs) with three PARPs and two PARGs in Arabidopsis genome. AtPARP1 and AtPARP2 possess poly(ADP-ribose) polymerase activity, and the activity of AtPARP2 was enhanced by MAMP treatment. AtPARG1, but not AtPARG2, carries glycohydrolase activity in vivo and in vitro. Importantly, mutation (G450R) in atparg1 blocks its activity and the corresponding residue is highly conserved and essential for human HsPARG activity. Consistently, mutant atparp1atparp2 plants exhibited compromised immune gene activation and enhanced susceptibility to pathogen infections. Our study indicates that protein poly(ADP-ribosyl)ation plays critical roles in plant immune gene expression and defense to pathogen attacks. PMID:25569773
Miyata, Kana; Kozaki, Toshinori; Kouzai, Yusuke; Ozawa, Kenjirou; Ishii, Kazuo; Asamizu, Erika; Okabe, Yoshihiro; Umehara, Yosuke; Miyamoto, Ayano; Kobae, Yoshihiro; Akiyama, Kohki; Kaku, Hanae; Nishizawa, Yoko; Shibuya, Naoto; Nakagawa, Tomomi
2014-11-01
Plants are constantly exposed to threats from pathogenic microbes and thus developed an innate immune system to protect themselves. On the other hand, many plants also have the ability to establish endosymbiosis with beneficial microbes such as arbuscular mycorrhizal (AM) fungi or rhizobial bacteria, which improves the growth of host plants. How plants evolved these systems managing such opposite plant-microbe interactions is unclear. We show here that knockout (KO) mutants of OsCERK1, a rice receptor kinase essential for chitin signaling, were impaired not only for chitin-triggered defense responses but also for AM symbiosis, indicating the bifunctionality of OsCERK1 in defense and symbiosis. On the other hand, a KO mutant of OsCEBiP, which forms a receptor complex with OsCERK1 and is essential for chitin-triggered immunity, established mycorrhizal symbiosis normally. Therefore, OsCERK1 but not chitin-triggered immunity is required for AM symbiosis. Furthermore, experiments with chimeric receptors showed that the kinase domains of OsCERK1 and homologs from non-leguminous, mycorrhizal plants could trigger nodulation signaling in legume-rhizobium interactions as the kinase domain of Nod factor receptor1 (NFR1), which is essential for triggering the nodulation program in leguminous plants, did. Because leguminous plants are believed to have developed the rhizobial symbiosis on the basis of AM symbiosis, our results suggest that the symbiotic function of ancestral CERK1 in AM symbiosis enabled the molecular evolution to leguminous NFR1 and resulted in the establishment of legume-rhizobia symbiosis. These results also suggest that OsCERK1 and homologs serve as a molecular switch that activates defense or symbiotic responses depending on the infecting microbes. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor
2008-04-01
Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.
Peroxiredoxin 5 modulates immune response in Drosophila
Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.
2010-01-01
Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624
The innate immune response during urinary tract infection and pyelonephritis
Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.
2013-01-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397
The innate immune response during urinary tract infection and pyelonephritis.
Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S
2014-07-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.
Building the interaction interfaces: host responses upon infection with microorganisms.
Yamazaki, Akihiro; Hayashi, Makoto
2015-02-01
Research fields of plant symbiosis and plant immunity were relatively ignorant with each other until a little while ago. Recently, however, increasing intercommunications between those two fields have begun to provide novel aspects and knowledge for understanding relationships between plants and microorganisms. Here, we review recent reports on plant-microbe interactions, focusing on the infection processes, in order to elucidate plant cellular responses that are triggered by both symbionts and pathogens. Highlighting the core elements of host responses over biotic interactions will provide insights into general mechanisms of plant-microbe interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas
Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.
2000-01-01
Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a
Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.
Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M
2013-04-16
Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.
Innate Immune Sensing and Response to Influenza
Pulendran, Bali; Maddur, Mohan S.
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919
Receptor-like kinases in plant innate immunity.
Wu, Ying; Zhou, Jian-Min
2013-12-01
Plants employ a highly effective surveillance system to detect potential pathogens, which is critical for the success of land plants in an environment surrounded by numerous microbes. Recent efforts have led to the identification of a number of immune receptors and components of immune receptor complexes. It is now clear that receptor-like kinases (RLKs) and receptor-like proteins (RLPs) are key pattern-recognition receptors (PRRs) for microbe- and plant-derived molecular patterns that are associated with pathogen invasion. RLKs and RLPs involved in immune signaling belong to large gene families in plants and have undergone lineage specific expansion. Molecular evolution and population studies on phytopathogenic molecular signatures and their receptors have provided crucial insight into the co-evolution between plants and pathogens. [Figure: see text] Jian-Min Zhou (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Probiotics, antibiotics and the immune responses to vaccines
Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep
2015-01-01
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456
Probiotics, antibiotics and the immune responses to vaccines.
Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep
2015-06-19
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Characterization of host immune responses in Ebola virus infections.
Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo
2014-06-01
Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.
Compartmentalized and systemic control of tissue immunity by commensals
Belkaid, Yasmine; Naik, Shruti
2013-01-01
The body is composed of various tissue microenvironments with finely tuned local immunosurveillance systems, many of which are in close apposition with distinct commensal niches. Mammals have formed an evolutionary partnership with the microbiota that is critical for metabolism, tissue development and host defense. Despite our growing understanding of the impact of this host-microbe alliance on immunity in the gastrointestinal tract, the extent to which individual microenvironments are controlled by resident microbiota remains unclear. In this Perspective we discuss how resident commensals outside the gastrointestinal tract can control unique physiological niches and the potential implications of the dialog between these commensals and the host for the establishment of immune homeostasis, protective responses and tissue pathology. PMID:23778791
Nuclear processes associated with plant immunity and pathogen susceptibility
Motion, Graham B.; Amaro, Tiago M.M.M.; Kulagina, Natalja
2015-01-01
Plants are sessile organisms that have evolved exquisite and sophisticated mechanisms to adapt to their biotic and abiotic environment. Plants deploy receptors and vast signalling networks to detect, transmit and respond to a given biotic threat by inducing properly dosed defence responses. Genetic analyses and, more recently, next-generation -omics approaches have allowed unprecedented insights into the mechanisms that drive immunity. Similarly, functional genomics and the emergence of pathogen genomes have allowed reciprocal studies on the mechanisms governing pathogen virulence and host susceptibility, collectively allowing more comprehensive views on the processes that govern disease and resistance. Among others, the identification of secreted pathogen molecules (effectors) that modify immunity-associated processes has changed the plant–microbe interactions conceptual landscape. Effectors are now considered both important factors facilitating disease and novel probes, suited to study immunity in plants. In this review, we will describe the various mechanisms and processes that take place in the nucleus and help regulate immune responses in plants. Based on the premise that any process required for immunity could be targeted by pathogen effectors, we highlight and describe a number of functional assays that should help determine effector functions and their impact on immune-related processes. The identification of new effector functions that modify nuclear processes will help dissect nuclear signalling further and assist us in our bid to bolster immunity in crop plants. PMID:25846755
Arginine and Citrulline and the Immune Response in Sepsis
Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn
2015-01-01
Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985
The immune response to Nipah virus infection.
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J
2012-09-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.
Chemokine-mediated immune responses in the female genital tract mucosa.
Deruaz, Maud; Luster, Andrew D
2015-04-01
The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.
Functional metagenomics to decipher food-microbe-host crosstalk.
Larraufie, Pierre; de Wouters, Tomas; Potocki-Veronese, Gabrielle; Blottière, Hervé M; Doré, Joël
2015-02-01
The recent developments of metagenomics permit an extremely high-resolution molecular scan of the intestinal microbiota giving new insights and opening perspectives for clinical applications. Beyond the unprecedented vision of the intestinal microbiota given by large-scale quantitative metagenomics studies, such as the EU MetaHIT project, functional metagenomics tools allow the exploration of fine interactions between food constituents, microbiota and host, leading to the identification of signals and intimate mechanisms of crosstalk, especially between bacteria and human cells. Cloning of large genome fragments, either from complex intestinal communities or from selected bacteria, allows the screening of these biological resources for bioactivity towards complex plant polymers or functional food such as prebiotics. This permitted identification of novel carbohydrate-active enzyme families involved in dietary fibre and host glycan breakdown, and highlighted unsuspected bacterial players at the top of the intestinal microbial food chain. Similarly, exposure of fractions from genomic and metagenomic clones onto human cells engineered with reporter systems to track modulation of immune response, cell proliferation or cell metabolism has allowed the identification of bioactive clones modulating key cell signalling pathways or the induction of specific genes. This opens the possibility to decipher mechanisms by which commensal bacteria or candidate probiotics can modulate the activity of cells in the intestinal epithelium or even in distal organs such as the liver, adipose tissue or the brain. Hence, in spite of our inability to culture many of the dominant microbes of the human intestine, functional metagenomics open a new window for the exploration of food-microbe-host crosstalk.
Wang, Mengqiang; Wang, Lingling; Huang, Mengmeng; Yi, Qilin; Guo, Ying; Gai, Yunchao; Wang, Hao; Zhang, Huan; Song, Linsheng
2016-08-01
Galectins are a family of β-galactoside binding lectins that function as pattern recognition receptors (PRRs) in innate immune system of both vertebrates and invertebrates. The cDNA of Chinese mitten crab Eriocheir sinensis galectin (designated as EsGal) was cloned via rapid amplification of cDNA ends (RACE) technique based on expressed sequence tags (ESTs) analysis. The full-length cDNA of EsGal was 999 bp. Its open reading frame encoded a polypeptide of 218 amino acids containing a GLECT/Gal-bind_lectin domain and a proline/glycine rich low complexity region. The deduced amino acid sequence and domain organization of EsGal were highly similar to those of crustacean galectins. The mRNA transcripts of EsGal were found to be constitutively expressed in a wide range of tissues and mainly in hepatopancreas, gill and haemocytes. The mRNA expression level of EsGal increased rapidly and significantly after crabs were stimulated by different microbes. The recombinant EsGal (rEsGal) could bind various pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (GLU), and exhibited strong activity to agglutinate Escherichia coli, Vibrio anguillarum, Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus and Pichia pastoris, and such agglutinating activity could be inhibited by both d-galactose and α-lactose. The in vitro encapsulation assay revealed that rEsGal could enhance the encapsulation of haemocytes towards agarose beads. These results collectively suggested that EsGal played crucial roles in the immune recognition and elimination of pathogens and contributed to the innate immune response against various microbes in crabs. Copyright © 2016 Elsevier Ltd. All rights reserved.
Influence of ionizing radiation on the immune response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brocadeszaalberg, O.
1974-01-01
The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)
Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K
2011-08-01
The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.
Po-Wen, Chen; Singh, Prashant; Zimmerli, Laurent
2013-01-01
Boosted responsiveness of plant cells to stress at the onset of pathogen- or chemically induced resistance is called priming. The chemical β-aminobutyric acid (BABA) enhances Arabidopsis thaliana resistance to hemibiotrophic bacteria through the priming of the salicylic acid (SA) defence response. Whether BABA increases Arabidopsis resistance to the necrotrophic bacterium Pectobacterium carotovorum ssp. carotovorum (Pcc) is not clear. In this work, we show that treatment with BABA protects Arabidopsis against the soft-rot pathogen Pcc. BABA did not prime the expression of the jasmonate/ethylene-responsive gene PLANT DEFENSIN 1.2 (PDF1.2), the up-regulation of which is usually associated with resistance to necrotrophic pathogens. Expression of the SA marker gene PATHOGENESIS RELATED 1 (PR1) on Pcc infection was primed by BABA treatment, but SA-defective mutants demonstrated a wild-type level of BABA-induced resistance against Pcc. BABA primed the expression of the pattern-triggered immunity (PTI)-responsive genes FLG22-INDUCED RECEPTOR-LIKE KINASE 1 (FRK1), ARABIDOPSIS NON-RACE SPECIFIC DISEASE RESISTANCE GENE (NDR1)/HAIRPIN-INDUCED GENE (HIN1)-LIKE 10 (NHL10) and CYTOCHROME P450, FAMILY 81 (CYP81F2) after inoculation with Pcc or after treatment with purified bacterial microbe-associated molecular patterns, such as flg22 or elf26. PTI-mediated callose deposition was also potentiated in BABA-treated Arabidopsis, and BABA boosted Arabidopsis stomatal immunity to Pcc. BABA treatment primed the PTI response in the SA-defective mutants SA induction deficient 2-1 (sid2-1) and phytoalexin deficient 4-1 (pad4-1). In addition, BABA priming was associated with open chromatin configurations in the promoter region of PTI marker genes. Our data indicate that BABA primes the PTI response upon necrotrophic bacterial infection and suggest a role for the PTI response in BABA-induced resistance. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.
Ihara, Sozaburo; Hirata, Yoshihiro; Koike, Kazuhiko
2017-07-01
Inflammatory bowel disease (IBD) is defined as chronic intestinal inflammation, and includes ulcerative colitis and Crohn's disease. Multiple factors are involved in the pathogenesis of IBD, and the condition is characterized by aberrant mucosal immune reactions to intestinal microbes in genetically susceptible hosts. Transforming growth factor-β (TGF-β) is an immune-suppressive cytokine produced by many cell types and activated by integrins. Active TGF-β binds to its receptor and regulates mucosal immune reactions through the TGF-β signaling pathway. Dysregulated TGF-β signaling is observed in the intestines of IBD patients. TGF-β signal impairment in specific cell types, such as T-cells and dendritic cells, results in spontaneous colitis in mouse models. In addition, specific intestinal microbes contribute to immune homeostasis by modulating TGF-β production. In this review, we describe the role of TGF-β in intestinal immunity, focusing on immune cells, epithelium, and intestinal microbes. In addition, we present potential therapeutic strategies for IBD that target TGF-β.
Onchocerciasis modulates the immune response to mycobacterial antigens
Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E
1999-01-01
Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056
Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID
Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.
Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis
2017-02-01
Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.
Enhancing the Immune Response to Recombinant Plague Antigens
2006-05-01
Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant
Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens
Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.
2007-01-01
In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440
Costs of mounting an immune response during pregnancy in a lizard.
Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald
2013-01-01
Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.
Multiscale modeling of mucosal immune responses
2015-01-01
Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut
Multiscale modeling of mucosal immune responses.
Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep
2015-01-01
Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
The immune response to Nipah virus infection
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.
2012-01-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317
Cytomegalovirus infection enhances the immune response to influenza.
Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M
2015-04-01
Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.
Cellular immune response experiment MA-031
NASA Technical Reports Server (NTRS)
Criswell, B. S.
1976-01-01
Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.
Suppressive influences in the immune response to cancer.
Bronte, Vincenzo; Mocellin, Simone
2009-01-01
Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.
Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar
2017-12-24
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis
Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar
2017-01-01
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550
Fetal immune response to chorioamnionitis
Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.
2014-01-01
Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922
Human Immune Response to Dengue Infections
1989-07-31
antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8
Early-life inflammation, immune response and ageing.
Khan, Imroze; Agashe, Deepa; Rolff, Jens
2017-03-15
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).
Early-life inflammation, immune response and ageing
2017-01-01
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145
Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu
2017-01-01
While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733
Protective Cellular Immunity Against Influenza Virus Induced by Plasmid Inoculation of Newborn Mice
Bot, Adrian; Bot, Simona; García-Sastre, Adolfo
1998-01-01
Neonate organisms display an intrinsic disability to mount effective immune responses to infectious agents or conventional vaccines. Whereas low. doses of antigens trigger a suboptimal response, higher doses are frequently associated with tolerance induction. We investigated the ability of a plasmid-expressing nucleoprotein of influenza virus to prime a specific cellular immune response when administered to newborn mice. We found that persistent exposure to antigen following plasmid inoculation of neonates leads to a vigorous priming of specific CTLs rather than tolerance induction. The CTLs were cross-reactive against multiple strains of type A influenza viruses and produced IFNγ but no IL-4. The immunity triggered by plasmid inoculation of neonates was protective in terms of pulmonary virus clearance as well as survival rate following lethal challenge with influenza virus. Whereas the persistence of the plasmid at the site of injection was readily demonstrable in adult mice at 3 months after inoculation, mice immunized as newborns displayed no plasmid at 3 months and very little at 1 month after injection. Thus, DNA-based immunization of neonates may prove an effective and safe vaccination strategy for induction of cellular immunity against microbes that cause serious infectious diseases in the early period of life. PMID:9851359
The Origin of Mucosal Immunity: Lessons from the Holobiont Hydra.
Schröder, Katja; Bosch, Thomas C G
2016-11-01
Historically, mucosal immunity-i.e., the portion of the immune system that protects an organism's various mucous membranes from invasion by potentially pathogenic microbes-has been studied in single-cell epithelia in the gastrointestinal and upper respiratory tracts of vertebrates. Phylogenetically, mucosal surfaces appeared for the first time about 560 million years ago in members of the phylum Cnidaria. There are remarkable similarities and shared functions of mucosal immunity in vertebrates and innate immunity in cnidarians, such as Hydra species. Here, we propose a common origin for both systems and review observations that indicate that the ultimately simple holobiont Hydra provides both a new perspective on the relationship between bacteria and animal cells and a new prism for viewing the emergence and evolution of epithelial tissue-based innate immunity. In addition, recent breakthroughs in our understanding of immune responses in Hydra polyps reared under defined short-term gnotobiotic conditions open up the potential of Hydra as an animal research model for the study of common mucosal disorders. Copyright © 2016 Schröder and Bosch.
Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam
2017-01-01
Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086
Gilchuk, Pavlo; Knight, Frances C; Wilson, John T; Joyce, Sebastian
2017-01-01
CD8+ cytotoxic T lymphocytes confer protection against infectious diseases caused by viruses, bacteria, and parasites. Hence, significant efforts have been invested into devising ways to generate CD8+ T cell-targeted vaccines. Generation of microbe-free protein subunit vaccines requires a thorough knowledge of protective target antigens. Such antigens are proteolytically processed peptides presented by MHC class I molecules. To induce a robust antigen-specific CD8+ T cell response through vaccination, it is essential to formulate the antigen with an effective adjuvant. Here, we describe a versatile method for generating high-frequency antigen-specific CD8+ T cells through immunization of mice using the invariant natural killer T cell agonist α-galactosylceramide as the adjuvant.
Microbe-Induced Inflammatory Signals Triggering Acquired Bone Marrow Failure Syndromes.
Espinoza, J Luis; Kotecha, Ritesh; Nakao, Shinji
2017-01-01
Acquired bone marrow failure syndromes encompass a unique set of disorders characterized by a reduction in the effective production of mature cells by the bone marrow (BM). In the majority of cases, these syndromes are the result of the immune-mediated destruction of hematopoietic stem cells or their progenitors at various stages of differentiation. Microbial infection has also been associated with hematopoietic stem cell injury and may lead to associated transient or persistent BM failure, and recent evidence has highlighted the potential impact of commensal microbes and their metabolites on hematopoiesis. We summarize the interactions between microorganisms and the host immune system and emphasize how they may impact the development of acquired BM failure.
Microbe-Induced Inflammatory Signals Triggering Acquired Bone Marrow Failure Syndromes
Espinoza, J. Luis; Kotecha, Ritesh; Nakao, Shinji
2017-01-01
Acquired bone marrow failure syndromes encompass a unique set of disorders characterized by a reduction in the effective production of mature cells by the bone marrow (BM). In the majority of cases, these syndromes are the result of the immune-mediated destruction of hematopoietic stem cells or their progenitors at various stages of differentiation. Microbial infection has also been associated with hematopoietic stem cell injury and may lead to associated transient or persistent BM failure, and recent evidence has highlighted the potential impact of commensal microbes and their metabolites on hematopoiesis. We summarize the interactions between microorganisms and the host immune system and emphasize how they may impact the development of acquired BM failure. PMID:28286502
Strain difference in the immune response to hydralazine in inbred guinea-pigs
Ellman, L.; Inman, J.; Green, Ira
1971-01-01
Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639
Factors that deregulate the protective immune response in tuberculosis.
Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana
2009-01-01
Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.
NASA Astrophysics Data System (ADS)
Srivastava, Jatin K.; Chandra, Harish; Kalra, Swinder J. S.; Mishra, Pratibha; Khan, Hena; Yadav, Poonam
2017-06-01
Microbial assemblage as biofilm around the aquatic plant forms a firm association that largely depends upon the mutual supplies of nutrients, e.g., microbes interact with plants in an aquatic system most likely for organic carbon and oxygen, whereas plants receive defensive immunity and mineral exchange. Apart from the mutual benefits, plant-microbe interactions also influence the water quality especially at rhizosphere providing inherent ability to the aquatic system for the mitigation of pollution from the water column. The review presents and in-depth information along with certain research advancements made in the field of ecological and bio/chemical aspects of plant-microbe interactions and the underlying potential to improve water quality.
Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan
2014-01-01
Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443
2013-01-01
Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to
Innate Immune Responses in Leprosy
Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes
2018-01-01
Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852
Transcriptional Profiling of the Immune Response to Marburg Virus Infection.
Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J
2015-10-01
Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells
Policing the intestinal epithelial barrier: Innate immune functions of intraepithelial lymphocytes.
Hu, Madeleine D; Jia, Luo; Edelblum, Karen L
2018-03-01
This review will explore the contribution of IELs to mucosal innate immunity and highlight the similarities in IEL functional responses to bacteria, viruses and protozoan parasite invasion. IELs rapidly respond to microbial invasion by activating host defense responses, including the production of mucus and antimicrobial peptides to prevent microbes from reaching the epithelial surface. During active infection, IELs promote epithelial cytolysis, cytokine and chemokine production to limit pathogen invasion, replication and dissemination. Commensal-induced priming of IEL effector function or continuous surveillance of the epithelium may be important contributing factors to the rapidity of response. Impaired microbial recognition, dysregulated innate immune signaling or microbial dysbiosis may limit the protective function of IELs and increase susceptibility to disease. Further understanding of the mechanisms regulating IEL surveillance and sentinel function may provide insight into the development of more effective targeted therapies designed to reinforce the mucosal barrier.
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight
Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila
2011-01-01
Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297
Innate Immune Responses to Cryptococcus.
Heung, Lena J
2017-09-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.
Leptospirosis in human: Biomarkers in host immune responses.
Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha
2018-03-01
Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.
Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.
Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi
2018-04-16
While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A basic mathematical model of the immune response
NASA Astrophysics Data System (ADS)
Mayer, H.; Zaenker, K. S.; an der Heiden, U.
1995-03-01
Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.
Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira
2016-01-01
ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel
Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores
Lampert, Evan
2012-01-01
Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545
Photodynamic therapy for cancer and activation of immune response
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.
2010-02-01
Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.
Proteomic contributions to our understanding of vaccine and immune responses
Galassie, Allison C.; Link, Andrew J.
2015-01-01
Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619
Innate Immune Response to Burkholderia mallei
2017-02-16
stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the
Nuclear processes associated with plant immunity and pathogen susceptibility.
Motion, Graham B; Amaro, Tiago M M M; Kulagina, Natalja; Huitema, Edgar
2015-07-01
Plants are sessile organisms that have evolved exquisite and sophisticated mechanisms to adapt to their biotic and abiotic environment. Plants deploy receptors and vast signalling networks to detect, transmit and respond to a given biotic threat by inducing properly dosed defence responses. Genetic analyses and, more recently, next-generation -omics approaches have allowed unprecedented insights into the mechanisms that drive immunity. Similarly, functional genomics and the emergence of pathogen genomes have allowed reciprocal studies on the mechanisms governing pathogen virulence and host susceptibility, collectively allowing more comprehensive views on the processes that govern disease and resistance. Among others, the identification of secreted pathogen molecules (effectors) that modify immunity-associated processes has changed the plant-microbe interactions conceptual landscape. Effectors are now considered both important factors facilitating disease and novel probes, suited to study immunity in plants. In this review, we will describe the various mechanisms and processes that take place in the nucleus and help regulate immune responses in plants. Based on the premise that any process required for immunity could be targeted by pathogen effectors, we highlight and describe a number of functional assays that should help determine effector functions and their impact on immune-related processes. The identification of new effector functions that modify nuclear processes will help dissect nuclear signalling further and assist us in our bid to bolster immunity in crop plants. © The Author 2015. Published by Oxford University Press.
Immune Responses in Rhinovirus-Induced Asthma Exacerbations.
Steinke, John W; Borish, Larry
2016-11-01
Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.
Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses
van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.
2012-01-01
The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167
Interaction of the tick immune system with transmitted pathogens
Hajdušek, Ondřej; Šíma, Radek; Ayllón, Nieves; Jalovecká, Marie; Perner, Jan; de la Fuente, José; Kopáček, Petr
2013-01-01
Ticks are hematophagous arachnids transmitting a wide variety of pathogens including viruses, bacteria, and protozoans to their vertebrate hosts. The tick vector competence has to be intimately linked to the ability of transmitted pathogens to evade tick defense mechanisms encountered on their route through the tick body comprising midgut, hemolymph, salivary glands or ovaries. Tick innate immunity is, like in other invertebrates, based on an orchestrated action of humoral and cellular immune responses. The direct antimicrobial defense in ticks is accomplished by a variety of small molecules such as defensins, lysozymes or by tick-specific antimicrobial compounds such as microplusin/hebraein or 5.3-kDa family proteins. Phagocytosis of the invading microbes by tick hemocytes is likely mediated by the primordial complement-like system composed of thioester-containing proteins, fibrinogen-related lectins and convertase-like factors. Moreover, an important role in survival of the ingested microbes seems to be played by host proteins and redox balance maintenance in the tick midgut. Here, we summarize recent knowledge about the major components of tick immune system and focus on their interaction with the relevant tick-transmitted pathogens, represented by spirochetes (Borrelia), rickettsiae (Anaplasma), and protozoans (Babesia). Availability of the tick genomic database and feasibility of functional genomics based on RNA interference greatly contribute to the understanding of molecular and cellular interplay at the tick-pathogen interface and may provide new targets for blocking the transmission of tick pathogens. PMID:23875177
McMahon, K. Wyatt; Chang, David; Brashears, Mindy M.
2014-01-01
Differences between microbial pathogenesis in male and female hosts are well characterized in disease conditions connected to sexual transmission. However, limited biological insight is available on variances attributed to sex specificity in host-microbe interactions, and it is most often a minimized variable outside these transmission events. In this work, we studied two gut microbes—a pathogen, Mycobacterium avium subsp. paratuberculosis, and a probiotic, Lactobacillus animalis NP-51—and the interaction between each agent and the male and female gastrointestinal systems. This trial was conducted in BALB/c mice (n = 5 per experimental group and per sex at a given time point), with analysis at four time points over 180 days. Host responses to M. avium subsp. paratuberculosis and L. animalis were sensitive to sex. Cytokines that were significantly different (P ≤ 0.05) between the sexes included interleukin-1α/β (IL-1α/β), IL-17, IL-6, IL-10, IL-12, and gamma interferon (IFN-γ) and were dependent on experimental conditions. However, granulocyte-macrophage colony-stimulating factor (GM-CSF), vascular endothelial growth factor (VEGF), and IL-13/23 showed no sex specificity. A metabolomics study indicated a 0.5- to 2.0-fold (log2 scale) increase in short-chain fatty acids (butyrate and acetate) in males and greater increases in o-phosphocholine or histidine from female colon tissues; variances distinct to each sex were observed with age or long-term probiotic consumption. Two genera, Staphylococcus and Roseburia, were consistently overrepresented in females compared to males; other species were specific to one sex but fluctuated depending on experimental conditions. The differences observed suggest that male and female gut tissues and microbiota respond to newly introduced microorganisms differently and that gut-associated microorganisms with host immune system responses and metabolic activity are supported by biology distinct to the host sex. PMID:24814797
Nitric oxide and redox mechanisms in the immune response
Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.
2011-01-01
The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414
Innate Immune Responses to Cryptococcus
Heung, Lena J.
2017-01-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream
Verification of immune response optimality through cybernetic modeling.
Batt, B C; Kompala, D S
1990-02-09
An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.
Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E
2016-10-01
Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
Immune Response to Dengue and Zika.
Ngono, Annie Elong; Shresta, Sujan
2018-04-26
Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.
Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.
Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy
2018-02-01
We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.
Eosinophils in mucosal immune responses
Travers, J; Rothenberg, M E
2015-01-01
Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184
Spaceflight and Development of Immune Responses
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1996-01-01
Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.
Effect of gender and sex hormones on immune responses following shock.
Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H
2000-08-01
Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.
A multiherbal formulation influencing immune response in vitro.
Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L
2012-02-01
Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.
Wu, Richard Y; Määttänen, Pekka; Napper, Scott; Scruten, Erin; Li, Bo; Koike, Yuhki; Johnson-Henry, Kathene C; Pierro, Agostino; Rossi, Laura; Botts, Steven R; Surette, Michael G; Sherman, Philip M
2017-10-10
Prebiotics are non-digestible food ingredients that enhance the growth of certain microbes within the gut microbiota. Prebiotic consumption generates immune-modulatory effects that are traditionally thought to reflect microbial interactions within the gut. However, recent evidence suggests they may also impart direct microbe-independent effects on the host, though the mechanisms of which are currently unclear. Kinome arrays were used to profile the host intestinal signaling responses to prebiotic exposures in the absence of microbes. Identified pathways were functionally validated in Caco-2Bbe1 intestinal cell line and in vivo model of murine endotoxemia. We found that prebiotics directly regulate host mucosal signaling to alter response to bacterial infection. Intestinal epithelial cells (IECs) exposed to prebiotics are hyporesponsive to pathogen-induced mitogen-activated protein kinase (MAPK) and nuclear factor kappa B (NF-κB) activations, and have a kinome profile distinct from non-treated cells pertaining to multiple innate immune signaling pathways. Consistent with this finding, mice orally gavaged with prebiotics showed dampened inflammatory response to lipopolysaccharide (LPS) without alterations in the gut microbiota. These findings provide molecular mechanisms of direct host-prebiotic interactions to support prebiotics as potent modulators of host inflammation.
Pathogen recognition in the innate immune response.
Kumar, Himanshu; Kawai, Taro; Akira, Shizuo
2009-04-28
Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.
NASA Astrophysics Data System (ADS)
Billings, S. A.; Ballantyne, F.; Lehmeier, C.; Min, K.
2014-12-01
Soil organic matter (SOM) transformation rates generally increase with temperature, but whether this is realized depends on soil-specific features. To develop predictive models applicable to all soils, we must understand two key, ubiquitous features of SOM transformation: the temperature sensitivity of myriad enzyme-substrate combinations and temperature responses of microbial physiology and metabolism, in isolation from soil-specific conditions. Predicting temperature responses of production of CO2 vs. biomass is also difficult due to soil-specific features: we cannot know the identity of active microbes nor the substrates they employ. We highlight how recent empirical advances describing SOM decay can help develop theoretical tools relevant across diverse spatial and temporal scales. At a molecular level, temperature effects on purified enzyme kinetics reveal distinct temperature sensitivities of decay of diverse SOM substrates. Such data help quantify the influence of microbial adaptations and edaphic conditions on decay, have permitted computation of the relative availability of carbon (C) and nitrogen (N) liberated upon decay, and can be used with recent theoretical advances to predict changes in mass specific respiration rates as microbes maintain biomass C:N with changing temperature. Enhancing system complexity, we can subject microbes to temperature changes while controlling growth rate and without altering substrate availability or identity of the active population, permitting calculation of variables typically inferred in soils: microbial C use efficiency (CUE) and isotopic discrimination during C transformations. Quantified declines in CUE with rising temperature are critical for constraining model CUE estimates, and known changes in δ13C of respired CO2 with temperature is useful for interpreting δ13C-CO2 at diverse scales. We suggest empirical studies important for advancing knowledge of how microbes respond to temperature, and ideas for theoretical
Ben Khaled, Sara; Postma, Jelle; Robatzek, Silke
2015-01-01
A significant challenge for plants is to induce localized defense responses at sites of pathogen attack. Therefore, host subcellular trafficking processes enable accumulation and exchange of defense compounds, which contributes to the plant on-site defenses in response to pathogen perception. This review summarizes our current understanding of the transport processes that facilitate immunity, the significance of which is highlighted by pathogens reprogramming membrane trafficking through host cell translocated effectors. Prominent immune-related cargos of plant trafficking pathways are the pattern recognition receptors (PRRs), which must be present at the plasma membrane to sense microbes in the apoplast. We focus on the dynamic localization of the FLS2 receptor and discuss the pathways that regulate receptor transport within the cell and their link to FLS2-mediated immunity. One emerging theme is that ligand-induced late endocytic trafficking is conserved across different PRR protein families as well as across different plant species.
Inflammatory cytokines in the brain: does the CNS shape immune responses?
Owens, T; Renno, T; Taupin, V; Krakowski, M
1994-12-01
Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.
Drosophila blood cells and their role in immune responses.
Vlisidou, Isabella; Wood, Will
2015-04-01
Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.
Visceral Inflammation and Immune Activation Stress the Brain
Holzer, Peter; Farzi, Aitak; Hassan, Ahmed M.; Zenz, Geraldine; Jačan, Angela; Reichmann, Florian
2017-01-01
Stress refers to a dynamic process in which the homeostasis of an organism is challenged, the outcome depending on the type, severity, and duration of stressors involved, the stress responses triggered, and the stress resilience of the organism. Importantly, the relationship between stress and the immune system is bidirectional, as not only stressors have an impact on immune function, but alterations in immune function themselves can elicit stress responses. Such bidirectional interactions have been prominently identified to occur in the gastrointestinal tract in which there is a close cross-talk between the gut microbiota and the local immune system, governed by the permeability of the intestinal mucosa. External stressors disturb the homeostasis between microbiota and gut, these disturbances being signaled to the brain via multiple communication pathways constituting the gut–brain axis, ultimately eliciting stress responses and perturbations of brain function. In view of these relationships, the present article sets out to highlight some of the interactions between peripheral immune activation, especially in the visceral system, and brain function, behavior, and stress coping. These issues are exemplified by the way through which the intestinal microbiota as well as microbe-associated molecular patterns including lipopolysaccharide communicate with the immune system and brain, and the mechanisms whereby overt inflammation in the GI tract impacts on emotional-affective behavior, pain sensitivity, and stress coping. The interactions between the peripheral immune system and the brain take place along the gut–brain axis, the major communication pathways of which comprise microbial metabolites, gut hormones, immune mediators, and sensory neurons. Through these signaling systems, several transmitter and neuropeptide systems within the brain are altered under conditions of peripheral immune stress, enabling adaptive processes related to stress coping and resilience
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Influence of bedding type on mucosal immune responses.
Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E
2002-10-01
The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.
Malnutrition: Modulator of Immune Responses in Tuberculosis
Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth
2017-01-01
Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710
CELLS INVOLVED IN THE IMMUNE RESPONSE
Singhal, Sharwan K.; Richter, Maxwell
1968-01-01
Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID
EVOLUTION OF THE IMMUNE RESPONSE
Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.
1964-01-01
1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
The host immune response to Clostridium difficile infection
2013-01-01
Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542
Intravital imaging of cutaneous immune responses.
Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji
2018-05-25
Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.
Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.
Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier
2009-03-23
Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.
Cook, Marc D; Allen, Jacob M; Pence, Brandt D; Wallig, Matthew A; Gaskins, H Rex; White, Bryan A; Woods, Jeffrey A
2016-02-01
There is robust evidence that habitual physical activity is anti-inflammatory and protective against developing chronic inflammatory disease. Much less is known about the effects of habitual moderate exercise in the gut, the compartment that has the greatest immunological responsibility and interactions with the intestinal microbiota. The link between the two has become evident, as recent studies have linked intestinal dysbiosis, or the disproportionate balance of beneficial to pathogenic microbes, with increased inflammatory disease susceptibility. Limited animal and human research findings imply that exercise may have a beneficial role in preventing and ameliorating such diseases by having an effect on gut immune function and, recently, microbiome characteristics. Emerging data from our laboratory show that different forms of exercise training differentially impact the severity of intestinal inflammation during an inflammatory insult (for example, ulcerative colitis) and may be jointly related to gut immune cell homeostasis and microbiota-immune interactions. The evidence we review and present will provide data in support of rigorous investigations concerning the effects of habitual exercise on gut health and disease.
Interplay of parasite-driven immune responses and autoimmunity.
Zaccone, Paola; Burton, Oliver T; Cooke, Anne
2008-01-01
As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.
Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis
2007-03-07
The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.
Anti-tumor immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.
2009-06-01
Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp
Radiation-induced immune responses: mechanisms and therapeutic perspectives.
Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One
2016-09-01
Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.
The role of dehydroepiandrosterone on functional innate immune responses to acute stress.
Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P
2017-12-01
The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.
RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes
Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.
2011-01-01
Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response
Zhong, Hong; Ma, Minjuan
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304
Allometry of animal-microbe interactions and global census of animal-associated microbes.
Kieft, Thomas L; Simmons, Karen A
2015-07-07
Animals live in close association with microorganisms, mostly prokaryotes, living in or on them as commensals, mutualists or parasites, and profoundly affecting host fitness. Most animal-microbe studies focus on microbial community structure; for this project, allometry (scaling of animal attributes with animal size) was applied to animal-microbe relationships across a range of species spanning 12 orders of magnitude in animal mass, from nematodes to whales. Microbial abundances per individual animal were gleaned from published literature and also microscopically counted in three species. Abundance of prokaryotes/individual versus animal mass scales as a nearly linear power function (exponent = 1.07, R(2) = 0.94). Combining this power function with allometry of animal abundance indicates that macrofauna have an outsized share of animal-associated microorganisms. The total number of animal-associated prokaryotes in Earth's land animals was calculated to be 1.3-1.4 × 10(25) cells and the total of marine animal-associated microbes was calculated to be 8.6-9.0 × 10(24) cells. Animal-associated microbes thus total 2.1-2.3 × 10(25) of the approximately 10(30) prokaryotes on the Earth. Microbes associated with humans comprise 3.3-3.5% of Earth's animal-associated microbes, and domestic animals harbour 14-20% of all animal-associated microbes, adding a new dimension to the scale of human impact on the biosphere. This novel allometric power function may reflect underlying mechanisms involving the transfer of energy and materials between microorganisms and their animal hosts. Microbial diversity indices of animal gut communities and gut microbial species richness for 60 mammals did not indicate significant scaling relationships with animal body mass; however, further research in this area is warranted. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Role of muscarinic receptors in the regulation of immune and inflammatory responses
Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.
2008-01-01
Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972
A comparative study of an innate immune response in Lamprologine cichlid fishes.
O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
A comparative study of an innate immune response in Lamprologine cichlid fishes
NASA Astrophysics Data System (ADS)
O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
Immune response to measles vaccine in Peruvian children.
Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.
2001-01-01
OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811
The host immune response to gastrointestinal nematode infection in sheep.
McRae, K M; Stear, M J; Good, B; Keane, O M
2015-12-01
Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.
[Bone marrow stromal damage mediated by immune response activity].
Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H
1994-01-01
The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.
NASA Astrophysics Data System (ADS)
Sugino, Tomohiro; Yokobori, Shin-Ichi; Yang, Yinjie; Kawaguchi, Yuko; Okudaira, Kyoko; Tabata, Makoto; Kawai, Hideyuki; Hasegawa, Sunao; Yamagishi, Akihiko
Microbes have been collected at the altitude up to about 70 km in the sampling experiment done by several groups[1]. We have also collected high altitude microbes, by using an airplane and balloons[2][3][4][5]. We collected new deinococcal strain (Deinococcus aetherius and Deinococ-cus aerius) and several strains of spore-forming bacilli from stratosphere[2][4][5]. However, microbe sampling in space has never been reported. On the other hand, "Panspermia" hy-pothesis, where terrestrial life is originated from outside of Earth, has been proposed[6][7][8][9]. Recent report suggesting existence of the possible microbe fossils in the meteorite of Mars origin opened the serious debate on the possibility of migration of life embedded in meteorites (and cosmic dusts)[10][11]. If we were able to find terrestrial microbes in space, it would suggest that the terrestrial life can travel between astronomical bodies. We proposed a mission "Tanpopo: Astrobiology Exposure and Micrometeoroid Capture Experiments" to examine possible inter-planetary migration of microbes, organic compounds and meteoroids on Japan Experimental Module of the International Space Station (ISS)[12]. Two of six sub themes in this mission are directly related to interplanetary migration of microbes. One is the direct capturing experi-ment of microbes (probably within the particles such as clay) in space by the exposed ultra-low density aerogel. Another is the exposure experiment to examine survivability of the microbes in harsh space environment. They will tell us the possibility of interplanetary migration of microbes (life) from Earth to outside of Earth (or vise versa). In this report, we will report whether aerogel that have been used for the collection of space debris and cosmic dusts can be used for microbe sampling in space. We will discuss how captured particles by aerogel can be detected with DNA-specific fluorescent dye, and how to distinguish microbes from other mate-rials (i.e. aerogel and
The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)
King, Paul T.; Sharma, Roleen
2015-01-01
Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124
Radiation induces an antitumour immune response to mouse melanoma.
Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling
2009-12-01
Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.
Defining dysbiosis and its influence on host immunity and disease
Petersen, Charisse; Round, June L
2014-01-01
Mammalian immune system development depends on instruction from resident commensal microorganisms. Diseases associated with abnormal immune responses towards environmental and self antigens have been rapidly increasing over the last 50 years. These diseases include inflammatory bowel disease (IBD), multiple sclerosis (MS), type I diabetes (T1D), allergies and asthma. The observation that people with immune mediated diseases house a different microbial community when compared to healthy individuals suggests that pathogenesis arises from improper training of the immune system by the microbiota. However, with hundreds of different microorganisms on our bodies it is hard to know which of these contribute to health and more importantly how? Microbiologists studying pathogenic organisms have long adhered to Koch's postulates to directly relate a certain disease to a specific microbe, raising the question of whether this might be true of commensal–host relationships as well. Emerging evidence supports that rather than one or two dominant organisms inducing host health, the composition of the entire community of microbial residents influences a balanced immune response. Thus, perturbations to the structure of complex commensal communities (referred to as dysbiosis) can lead to deficient education of the host immune system and subsequent development of immune mediated diseases. Here we will overview the literature that describes the causes of dysbiosis and the mechanisms evolved by the host to prevent these changes to community structure. Building off these studies, we will categorize the different types of dysbiosis and define how collections of microorganisms can influence the host response. This research has broad implications for future therapies that go beyond the introduction of a single organism to induce health. We propose that identifying mechanisms to re-establish a healthy complex microbiota after dysbiosis has occurred, a process we will refer to as rebiosis
NK cells interactions with dendritic cells shape innate and adaptive immunity.
Brilot, Fabienne; Strowig, Till; Munz, Christian
2008-05-01
While natural killer (NK) cells received their name from their ability to mediate spontaneous cytotoxicity, it has recently become clear that they require activation to target most transformed and infected cells. Dendritic cells (DCs) have been shown to mediate NK cell activation during innate immune responses. Surprisingly, this interaction was recently reported to be required to restrict infections by NK cells, and to take place in secondary lymphoid organs. Here we review these recent studies on NK cell interactions with DCs, discuss the molecular mechanisms underlying the cross-talk between these two innate lymphocyte populations, and out-line how DCs and NK cells synergize to enhance innate immunity against microbes and tumors as well as shape the adaptive immune system. Based on this better understanding, we propose that NK cells should be targeted for their protective functions and as an adjuvant during immunotherapy development.
Adjuvant effects of saponins on animal immune responses*
Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.
2007-01-01
Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426
Ubiquitin enzymes in the regulation of immune responses.
Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo
2017-08-01
Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses
Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.
Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.
Current views on the mechanisms of immune responses to trauma and infection
Michalak, Grzegorz; Słotwiński, Robert
2015-01-01
According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036
Sex-specific consequences of an induced immune response on reproduction in a moth.
Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T
2015-12-16
Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-01-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-03-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.
Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.
Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon
2018-01-01
Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.
A cognitive computational model inspired by the immune system response.
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.
Xue, Xiaoguang; Wu, Jin; Ricklin, Daniel; Forneris, Federico; Di Crescenzio, Patrizia; Schmidt, Christoph Q; Granneman, Joke; Sharp, Thomas H; Lambris, John D; Gros, Piet
2017-08-01
The complement system labels microbes and host debris for clearance. Degradation of surface-bound C3b is pivotal to direct immune responses and protect host cells. How the serine protease factor I (FI), assisted by regulators, cleaves either two or three distant peptide bonds in the CUB domain of C3b remains unclear. We present a crystal structure of C3b in complex with FI and regulator factor H (FH; domains 1-4 with 19-20). FI binds C3b-FH between FH domains 2 and 3 and a reoriented C3b C-terminal domain and docks onto the first scissile bond, while stabilizing its catalytic domain for proteolytic activity. One cleavage in C3b does not affect its overall structure, whereas two cleavages unfold CUB and dislodge the thioester-containing domain (TED), affecting binding of regulators and thereby determining the number of cleavages. These data explain how FI generates late-stage opsonins iC3b or C3dg in a context-dependent manner, to react to foreign, danger or healthy self signals.
Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery
NASA Astrophysics Data System (ADS)
Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole
2015-12-01
Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized
Dietary astaxanthin enhances immune response in dogs.
Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon
2011-04-15
No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.
Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M
2004-03-01
Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.
Effect of nanovaccine chemistry on humoral immune response kinetics and maturation
NASA Astrophysics Data System (ADS)
Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji
2014-10-01
Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry
Mattner, Jochen
2016-01-01
Primary biliary cirrhosis (PBC) and primary sclerosing cholangitis (PSC) represent the major clinical entities of chronic cholestatic liver diseases. Both disorders are characterized by portal inflammation and slowly progress to obliterative fibrosis and eventually liver cirrhosis. Although immune-pathogenic mechanisms have been implicated in the pathogenesis of PBC and PSC, neither disorder is considered to be a classical autoimmune disease, as PSC and PBC patients do not respond to immune-suppressants. Furthermore, the decreased bile flow resulting from the immune-mediated tissue assault and the subsequent accumulation of toxic bile products in PBC and PSC not only perpetuates biliary epithelial damage, but also alters the composition of the intestinal and biliary microbiota and its mutual interactions with the host. Consistent with the close association of PSC and inflammatory bowel disease (IBD), the polyclonal hyper IgM response in PBC and (auto-)antibodies which cross-react to microbial antigens in both diseases, an expansion of individual microbes leads to shifts in the composition of the intestinal or biliary microbiota and a subsequent altered integrity of epithelial layers, promoting microbial translocation. These changes have been implicated in the pathogenesis of both devastating disorders. Thus, we will discuss here these recent findings in the context of novel and alternative therapeutic options. PMID:27834858
Phenytoin promotes Th2 type immune response in mice
Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U
2001-01-01
The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401
Ubiquitin enzymes in the regulation of immune responses
Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo
2017-01-01
Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749
IL-2 infusion abrogates humoral immune responses in humans.
Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K
1992-01-01
Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235
ERIC Educational Resources Information Center
Frame, Kathy, Ed.; Ryan, Karen, Ed.
The activities presented in this book are the product of the Community Outreach Initiative of the Microbial Literacy Collaborative (MLC). This activity book presents a balanced view of microbes, their benefits, and the diseases they cause. Each activity starts with an interesting introductory statement and includes goals, activity time, time to…
[Immune response to live influenza vaccine].
Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G
2002-01-01
Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.
Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids
Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe
2016-01-01
The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406
The weapon potential of a microbe.
Casadevall, Arturo; Pirofski, Liise-anne
2004-06-01
The designation of a microbe as a potential biological weapon poses the vexing question of how such a decision is made given the many pathogenic microbes that cause disease. Analysis of the properties of microbes that are currently considered biological weapons against humans revealed no obvious relationship to virulence, except that all are pathogenic for humans. Notably, the weapon potential of a microbe rather than its pathogenic properties or virulence appeared to be the major consideration when categorizing certain agents as biological weapons. In an effort to standardize the assessment of the risk that is posed by microbes as biological warfare agents using the basic principles of microbial communicability (defined here as a parameter of transmission) and virulence, a simple formula is proposed for estimating the weapon potential of a microbe.
Barth, Kenneth; Genco, Caroline Attardo
2016-01-01
The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456
Immune responses to bioengineered organs
Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.
2017-01-01
Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545
Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.
Luu, L; Coombes, J L
2015-03-01
Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.
The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides
Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria
2010-01-01
The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388
Immune response in asymptomatic smokers.
Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H
2002-09-01
It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production
CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL
Zhu, Yuwen; Yao, Sheng; Chen, Lieping
2011-01-01
Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182
The Role of Bitter and Sweet Taste Receptors in Upper Airway Immunity
Workman, Alan D.; Palmer, James N.; Adappa, Nithin D.
2016-01-01
Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors. A variety of bitter products secreted by microbes are detected with resultant downstream inflammation, increased mucous clearance, antimicrobial peptide secretion, and direct bacterial killing. Genetic variation of bitter taste receptors also appears to play a role in the susceptibility to infection in respiratory disease states, including that of chronic rhinosinusitis. Ongoing taste receptor research may yield new therapeutics that harness innate immune defenses in the respiratory tract and may offer alternatives to antibiotic treatment. The present review discusses taste receptor-protective responses and analyzes the role these receptors play in mediating airway immune function. PMID:26492878
Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA
Mandadi, Kranthi K.; Scholthof, Karen-Beth G.
2013-01-01
Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626
Immune response and immunopathology during toxoplasmosis1
Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.
2012-01-01
Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326
Perillyl alcohol suppresses antigen-induced immune responses in the lung
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide
Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
Mesenchymal stem cells: a double-edged sword in regulating immune responses
Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y
2012-01-01
Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969
The GSK3/Shaggy-Like Kinase ASKα Contributes to Pattern-Triggered Immunity1[OPEN
Fritz, Marion
2016-01-01
The first layer of immunity against pathogenic microbes relies on the detection of conserved pathogen-associated molecular patterns (PAMPs) that are recognized by pattern recognition receptors (PRRs) to activate pattern-triggered immunity (PTI). Despite the increasing knowledge of early PTI signaling mediated by PRRs and their associated proteins, many downstream signaling components remain elusive. Here, we identify the Arabidopsis (Arabidopsis thaliana) GLYCOGEN SYNTHASE KINASE3 (GSK3)/Shaggy-like kinase ASKα as a positive regulator of plant immune signaling. The perception of several unrelated PAMPs rapidly induced ASKα kinase activity. Loss of ASKα attenuated, whereas its overexpression enhanced, diverse PTI responses, ultimately affecting susceptibility to the bacterial pathogen Pseudomonas syringae. Glucose-6-phosphate dehydrogenase (G6PD), the key enzyme of the oxidative pentose phosphate pathway, provides reducing equivalents important for defense responses and is a direct target of ASKα. ASKα phosphorylates cytosolic G6PD6 on an evolutionarily conserved threonine residue, thereby stimulating its activity. Plants deficient for or overexpressing G6PD6 showed a modified immune response, and the insensitivity of g6pd6 mutant plants to PAMP-induced growth inhibition was complemented by a phosphomimetic but not by a phosphonegative G6PD6 version. Overall, our data provide evidence that ASKα and G6PD6 constitute an immune signaling module downstream of PRRs, linking protein phosphorylation cascades to metabolic regulation. PMID:27208232
Innate immune responses following Kawasaki disease and toxic shock syndrome
Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181
Innate immune responses following Kawasaki disease and toxic shock syndrome.
Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.
Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.
Fins, Joseph J
2015-04-01
Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.
A Cognitive Computational Model Inspired by the Immune System Response
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131
Angiotensin converting enzyme over expression in myelocytes enhances the immune response
Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.
2015-01-01
Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750
USDA-ARS?s Scientific Manuscript database
Interleukin (IL) 17 family cytokines are important mediators of mucosal immune responses, tightly regulated by signals from the complex milieu of pathogenic and commensal microbes, epithelial cells and innate and adaptive leukocytes found at tissue barriers. In mammals, IL17 ligand expression has be...
Induction of the immune response suppression in mice inoculated with Candida albicans.
Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G
1986-03-01
There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).
Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.
West, A Phillip
2017-11-01
A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J
2011-03-01
The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.
Surviving Sepsis: Taming a Deadly Immune Response
... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...
Respiratory tract immune response to microbial pathogens.
Wilkie, B N
1982-11-15
Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.
Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza
Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom
2015-01-01
The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761
Multiplex Identification of Microbes ▿ †
Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.
2010-01-01
We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427
Assessment of the innate immune response in the periparturient cow.
Trevisi, Erminio; Minuti, Andrea
2018-02-01
The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Selection for avian immune response: a commercial breeding company challenge.
Fulton, J E
2004-04-01
Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.
Differential Immune Responses to New World and Old World Mammalian Arenaviruses
Ly, Hinh
2017-01-01
Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311
Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses
Feng, Pinghui; Moses, Ashlee; Früh, Klaus
2015-01-01
γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E
2000-04-01
Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.
Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.
Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna
2014-01-01
Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.
Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine
Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.
1973-01-01
The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112
Modulation of Human Immune Response by Fungal Biocontrol Agents
Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane
2017-01-01
Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107
Work stress and innate immune response.
Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L
2011-01-01
Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.
Famakin, Bolanle M.
2014-01-01
It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490
Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.
Mack, Madison R; Kim, Brian S
2016-07-19
The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.
Collective decision-making in microbes
Ross-Gillespie, Adin; Kümmerli, Rolf
2014-01-01
Microbes are intensely social organisms that routinely cooperate and coordinate their activities to express elaborate population level phenotypes. Such coordination requires a process of collective decision-making, in which individuals detect and collate information not only from their physical environment, but also from their social environment, in order to arrive at an appropriately calibrated response. Here, we present a conceptual overview of collective decision-making as it applies to all group-living organisms; we introduce key concepts and principles developed in the context of animal and human group decisions; and we discuss, with appropriate examples, the applicability of each of these concepts in microbial contexts. In particular, we discuss the roles of information pooling, control skew, speed vs. accuracy trade-offs, local feedbacks, quorum thresholds, conflicts of interest, and the reliability of social information. We conclude that collective decision-making in microbes shares many features with collective decision-making in higher taxa, and we call for greater integration between this fledgling field and other allied areas of research, including in the humanities and the physical sciences. PMID:24624121
Immune Response in Mussels To Environmental Pollution.
ERIC Educational Resources Information Center
Pryor, Stephen C.; Facher, Evan
1997-01-01
Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)
... and their genes more than most of us thought. One of the most important things microbes do for us is to help with digestion. The mix of microbes in your gut can affect how well you use and store energy from food. In laboratory experiments, transferring bacteria from certain obese mice to normal ...
The Skin Microbiome: Is It Affected by UV-induced Immune Suppression?
Patra, VijayKumar; Byrne, Scott N.; Wolf, Peter
2016-01-01
Human skin apart from functioning as a physical barricade to stop the entry of pathogens, also hosts innumerable commensal organisms. The skin cells and the immune system constantly interact with microbes, to maintain cutaneous homeostasis, despite the challenges offered by various environmental factors. A major environmental factor affecting the skin is ultraviolet radiation (UV-R) from sunlight. UV-R is well known to modulate the immune system, which can be both beneficial and deleterious. By targeting the cells and molecules within skin, UV-R can trigger the production and release of antimicrobial peptides, affect the innate immune system and ultimately suppress the adaptive cellular immune response. This can contribute to skin carcinogenesis and the promotion of infectious agents such as herpes simplex virus and possibly others. On the other hand, a UV-established immunosuppressive environment may protect against the induction of immunologically mediated skin diseases including some of photodermatoses such as polymorphic light eruption. In this article, we share our perspective about the possibility that UV-induced immune suppression may alter the landscape of the skin’s microbiome and its components. Alternatively, or in concert with this, direct UV-induced DNA and membrane damage to the microbiome may result in pathogen associated molecular patterns (PAMPs) that interfere with UV-induced immune suppression. PMID:27559331
Effect of rituximab on human in vivo antibody immune responses.
Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana
2011-12-01
B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights
Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.
Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna
2017-12-11
Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.
Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J
2015-01-01
Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.
The Role of the Immune Response in the Pathogenesis of Bronchiectasis.
King, Paul T
2018-01-01
Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.
Microbes to Biomes at Berkeley Lab
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
2015-10-28
Microbes are the Earth's most abundant and diverse form of life. Berkeley Lab's Microbes to Biomes initiative -- which will take advantage of research expertise at the Joint Genome Institute, Advanced Light Source, Molecular Foundry, and the new computational science facility -- is designed to explore and reveal the interactions of microbes with one another and with their environment. Microbes power our planet’s biogeochemical cycles, provide nutrients to our plants, purify our water and are integral components in keeping the human body free of disease and may hold the key to the Earth’s future.
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
Neonatal innate TLR-mediated responses are distinct from those of adults.
Kollmann, Tobias R; Crabtree, Juliet; Rein-Weston, Annie; Blimkie, Darren; Thommai, Francis; Wang, Xiu Yu; Lavoie, Pascal M; Furlong, Jeff; Fortuno, Edgardo S; Hajjar, Adeline M; Hawkins, Natalie R; Self, Steven G; Wilson, Christopher B
2009-12-01
The human neonate and infant are unduly susceptible to infection with a wide variety of microbes. This susceptibility is thought to reflect differences from adults in innate and adaptive immunity, but the nature of these differences is incompletely characterized. The innate immune response directs the subsequent adaptive immune response after integrating information from TLRs and other environmental sensors. We set out to provide a comprehensive analysis defining differences in response to TLR ligation between human neonates and adults. In response to most TLR ligands, neonatal innate immune cells, including monocytes and conventional and plasmacytoid dendritic cells produced less IL-12p70 and IFN-alpha (and consequently induced less IFN-gamma), moderately less TNF-alpha, but as much or even more IL-1beta, IL-6, IL-23, and IL-10 than adult cells. At the single-cell level, neonatal innate cells generally were less capable of producing multiple cytokines simultaneously, i.e., were less polyfunctional. Overall, our data suggest a robust if not enhanced capacity of the neonate vs the adult white-blood cell TLR-mediated response to support Th17- and Th2-type immunity, which promotes defense against extracellular pathogens, but a reduced capacity to support Th1-type responses, which promote defense against intracellular pathogens.
Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric
2015-10-21
Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.
Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra
2016-06-01
Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection
2000-01-01
iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT
How might infant and paediatric immune responses influence malaria vaccine efficacy?
Moormann, A M
2009-09-01
Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.
Acquired immunity to amyloodiniosis is associated with an antibody response.
Cobb, C S; Levy, M G; Noga, E J
1998-10-08
The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.
Immunosuppressive activity of tilmicosin on the immune responses in mice.
Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming
2011-06-01
Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.
NASA Technical Reports Server (NTRS)
Wilson, J. W.; HonerzuBentrup, K,; Schurr, M. J.; Buchanan, K.; Morici, L.; Hammond, T.; Allen, P.; Baker, C.; Ott, C. M.; Nelman-Gonzalez M.;
2007-01-01
Human presence in space, whether permanent or temporary, is accompanied by the presence of microbes. However, the extent of microbial changes in response to spaceflight conditions and the corresponding changes to infectious disease risk is unclear. Previous studies have indicated that spaceflight weakens the immune system in humans and animals. In addition, preflight and in-flight monitoring of the International Space Station (ISS) and other spacecraft indicates the presence of opportunistic pathogens and the potential of obligate pathogens. Altered antibiotic resistance of microbes in flight has also been shown. As astronauts and cosmonauts live for longer periods in a closed environment, especially one using recycled water and air, there is an increased risk to crewmembers of infectious disease events occurring in-flight. Therefore, understanding how the space environment affects microorganisms and their disease potential is critically important for spaceflight missions and requires further study. The goal of this flight experiment, operationally called MICROBE, is to utilize three model microbial pathogens, Salmonella typhimurium, Pseudomonas aeruginosa, and Candida albicans to examine the global effects of spaceflight on microbial gene expression and virulence attributes. Specifically, the aims are (1) to perform microarray-mediated gene expression profiling of S. typhimurium, P. aeruginosa, and C. albicans, in response to spaceflight in comparison to ground controls and (2) to determine the effect of spaceflight on the virulence potential of these microorganisms immediately following their return from spaceflight using murine models. The model microorganisms were selected as they have been isolated from preflight or in-flight monitoring, represent different degrees of pathogenic behavior, are well characterized, and have sequenced genomes with available microarrays. In particular, extensive studies of S. typhimurium by the Principal Investigator, Dr. Nickerson
ERIC Educational Resources Information Center
Weersing, Kimberley; Padilla-Gamino, Jacqueline; Bruno, Barbara
2010-01-01
Students--and just about everyone else--tend to have a wide range of misconceptions about microbes. This article is aimed at changing how students view microbes by engaging them in two hands-on activities that are fun and creative and align with both the National Science Education Standards (NRC 1996) and the Essential Principles of Ocean Literacy…
Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.
Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host
Liu, Bing; Li, Jian-Feng; Ao, Ying; Qu, Jinwang; Li, Zhangqun; Su, Jianbin; Zhang, Yang; Liu, Jun; Feng, Dongru; Qi, Kangbiao; He, Yanming; Wang, Jinfa; Wang, Hong-Bin
2012-01-01
Plant innate immunity relies on successful detection of microbe-associated molecular patterns (MAMPs) of invading microbes via pattern recognition receptors (PRRs) at the plant cell surface. Here, we report two homologous rice (Oryza sativa) lysin motif–containing proteins, LYP4 and LYP6, as dual functional PRRs sensing bacterial peptidoglycan (PGN) and fungal chitin. Live cell imaging and microsomal fractionation consistently revealed the plasma membrane localization of these proteins in rice cells. Transcription of these two genes could be induced rapidly upon exposure to bacterial pathogens or diverse MAMPs. Both proteins selectively bound PGN and chitin but not lipopolysaccharide (LPS) in vitro. Accordingly, silencing of either LYP specifically impaired PGN- or chitin- but not LPS-induced defense responses in rice, including reactive oxygen species generation, defense gene activation, and callose deposition, leading to compromised resistance against bacterial pathogen Xanthomonas oryzae and fungal pathogen Magnaporthe oryzae. Interestingly, pretreatment with excess PGN dramatically attenuated the alkalinization response of rice cells to chitin but not to flagellin; vice versa, pretreatment with chitin attenuated the response to PGN, suggesting that PGN and chitin engage overlapping perception components in rice. Collectively, our data support the notion that LYP4 and LYP6 are promiscuous PRRs for PGN and chitin in rice innate immunity. PMID:22872757
Microbiota and Mucosal Immunity in Amphibians
Colombo, Bruno M.; Scalvenzi, Thibault; Benlamara, Sarah; Pollet, Nicolas
2015-01-01
We know that animals live in a world dominated by bacteria. In the last 20 years, we have learned that microbes are essential regulators of mucosal immunity. Bacteria, archeas, and viruses influence different aspects of mucosal development and function. Yet, the literature mainly covers findings obtained in mammals. In this review, we focus on two major themes that emerge from the comparative analysis of mammals and amphibians. These themes concern: (i) the structure and functions of lymphoid organs and immune cells in amphibians, with a focus on the gut mucosal immune system; and (ii) the characteristics of the amphibian microbiota and its influence on mucosal immunity. Lastly, we propose to use Xenopus tadpoles as an alternative small-animal model to improve the fundamental knowledge on immunological functions of gut microbiota. PMID:25821449
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.
2013-01-01
Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044
Ecosystem and immune systems: Hierarchial response provides resilience against invasions
Allen, Craig R.
2001-01-01
Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.
pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.
Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori
2017-11-04
(1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.
Reuben, C; Sundaram, K; Phondke, G P
1979-01-01
The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994
Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.
Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A
2013-04-01
A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.
Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S
2014-01-01
The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157
Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus.
Harris, Reid N; Brucker, Robert M; Walke, Jenifer B; Becker, Matthew H; Schwantes, Christian R; Flaherty, Devon C; Lam, Brianna A; Woodhams, Douglas C; Briggs, Cheryl J; Vredenburg, Vance T; Minbiole, Kevin P C
2009-07-01
Emerging infectious diseases threaten human and wildlife populations. Altered ecological interactions between mutualistic microbes and hosts can result in disease, but an understanding of interactions between host, microbes and disease-causing organisms may lead to management strategies to affect disease outcomes. Many amphibian species in relatively pristine habitats are experiencing dramatic population declines and extinctions due to the skin disease chytridiomycosis, which is caused by the chytrid fungus Batrachochytrium dendrobatidis. Using a randomized, replicated experiment, we show that adding an antifungal bacterial species, Janthinobacterium lividum, found on several species of amphibians to the skins of the frog Rana muscosa prevented morbidity and mortality caused by the pathogen. The bacterial species produces the anti-chytrid metabolite violacein, which was found in much higher concentrations on frog skins in the treatments where J. lividum was added. Our results show that cutaneous microbes are a part of amphibians' innate immune system, the microbial community structure on frog skins is a determinant of disease outcome and altering microbial interactions on frog skins can prevent a lethal disease outcome. A bioaugmentation strategy may be an effective management tool to control chytridiomycosis in amphibian survival assurance colonies and in nature.
How sex and age affect immune responses, susceptibility to infections, and response to vaccination
Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix
2015-01-01
Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438
NASA Astrophysics Data System (ADS)
Aguilera, Eduardo; Amat, Juan A.
2007-11-01
Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.
Interference of Aspergillus fumigatus with the immune response.
Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A
2015-03-01
Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.
Zhang, Jie; Liu, Huan; Wei, Bin
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*
Zhang, Jie; Liu, Huan; Wei, Bin
2017-01-01
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566
NASA Technical Reports Server (NTRS)
1977-01-01
The AutoMicrobic System (AMS) represents years of intensive research and development by McDonnell Douglas Corp. that originated with a NASA study aimed at development of a fully automated microbial detection and identification system for spacecraft use. A urine specimen is placed into the system, where it is subjected to different freeze-dried microbe nutrients for the nine most common pathogens. An electro-optical scanner studies each specimen once an hour through a 4-to-13 hour cycle, operating automatically. Changes in cell growths on each culture are monitored by computer. The presence of pathogens is indicated when growth reaches a predetermined level. The system also enumerates the pathogens and specifies the type. Developed initially to handle urine testing, AMS soon is expected to allow analyses of blood, spinal fluid, and other body fluids. An additional capability under development is "susceptibility testing," or the determination of which microbe-killing agents-such as penicillin or other antibiotics-would be most effective in eliminating the pathogens. The whole process of detecting, identifying, and enumerating the pathogens and determining susceptibility is accomplished in less half the time required for the manual procedure. The AMS minimizes human error, reduces technician time , and increases laboratory output.
Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes
Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen
2014-01-01
Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463
Antimicrobial autophagy: a conserved innate immune response in Drosophila.
Moy, Ryan H; Cherry, Sara
2013-01-01
Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.
Microbes to Biomes at Berkeley Lab
None
2018-06-21
Microbes are the Earth's most abundant and diverse form of life. Berkeley Lab's Microbes to Biomes initiative -- which will take advantage of research expertise at the Joint Genome Institute, Advanced Light Source, Molecular Foundry, and the new computational science facility -- is designed to explore and reveal the interactions of microbes with one another and with their environment. Microbes power our planetâs biogeochemical cycles, provide nutrients to our plants, purify our water and are integral components in keeping the human body free of disease and may hold the key to the Earthâs future.
Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses
Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.
2011-01-01
The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Responses of innate immune cells to group A Streptococcus
Fieber, Christina; Kovarik, Pavel
2014-01-01
Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020
Ip, WK Eddie; Sokolovska, Anna; Charriere, Guillaume M; Boyer, Laurent; Dejardin, Stephanie; Cappillino, Michael P; Yantosca, L Michael; Takahashi, Kazue; Moore, Kathryn J; Lacy-Hulbert, Adam; Stuart, Lynda M
2010-01-01
Innate immunity is vital for protection from microbes and is mediated by both humoral effectors, such as cytokines, and cellular immune defenses, including phagocytic cells such as macrophages. After internalization by phagocytes, microbes are delivered into a phagosome, a complex intracellular organelle with a well-established and important role in microbial killing. However, the role of this organelle in cytokine responses and microbial sensing is less well defined. Here we assess the role of the phagosome in innate immune sensing and demonstrate the critical interdependence of phagocytosis and pattern recognition receptor signaling during response to the Gram-positive bacteria Staphylococcus aureus. We show that phagocytosis is essential to initiate optimal MyD88-dependent response to Staphylococcus aureus. Prior to TLR-dependent cytokine production bacteria must not only be engulfed but also delivered into acidic phagosomes. Here acid-activated host enzymes digest the internalized bacteria to liberate otherwise cryptic bacterial-derived ligands that initiate responses from the vacuole. Importantly, in macrophages in which phagosome acidification is perturbed, the impaired response to Staphylococcus aureus can be rescued by addition of lysostaphin, a bacterial endopeptidase active at neutral pH that can substitute for the acid-activated host enzymes. Together these observations delineate the inter-dependence of phagocytosis with pattern recognition receptor signaling and suggest that therapeutics to augment functions and signaling from the vacuole may be useful strategies to increase host responses to Staphylococcus aureus. PMID:20483752
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.
Neuro-immune lessons from an annelid: The medicinal leech.
Tasiemski, Aurélie; Salzet, Michel
2017-01-01
An important question that remains unanswered is how the vertebrate neuroimmune system can be both friend and foe to the damaged nervous tissue. Some of the difficulty in obtaining responses in mammals probably lies in the conflation in the central nervous system (CNS), of the innate and adaptive immune responses, which makes the vertebrate neuroimmune response quite complex and difficult to dissect. An alternative strategy for understanding the relation between neural immunity and neural repair is to study an animal devoid of adaptive immunity and whose CNS is well described and regeneration competent. The medicinal leech offers such opportunity. If the nerve cord of this annelid is crushed or partially cut, axons grow across the lesion and conduction of signals through the damaged region is restored within a few days, even when the nerve cord is removed from the animal and maintained in culture. When the mammalian spinal cord is injured, regeneration of normal connections is more or less successful and implies multiple events that still remain difficult to resolve. Interestingly, the regenerative process of the leech lesioned nerve cord is even more successful under septic than under sterile conditions suggesting that a controlled initiation of an infectious response may be a critical event for the regeneration of normal CNS functions in the leech. Here are reviewed and discussed data explaining how the leech nerve cord sensu stricto (i.e. excluding microglia and infiltrated blood cells) recognizes and responds to microbes and mechanical damages. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li
2013-02-18
The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C
2011-10-01
A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease
NASA Astrophysics Data System (ADS)
Sun, Jun; Deem, Michael
2006-03-01
The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.
Immune–neural connections: how the immune system’s response to infectious agents influences behavior
McCusker, Robert H.; Kelley, Keith W.
2013-01-01
Summary Humans and animals use the classical five senses of sight, sound, touch, smell and taste to monitor their environment. The very survival of feral animals depends on these sensory perception systems, which is a central theme in scholarly research on comparative aspects of anatomy and physiology. But how do all of us sense and respond to an infection? We cannot see, hear, feel, smell or taste bacterial and viral pathogens, but humans and animals alike are fully aware of symptoms of sickness that are caused by these microbes. Pain, fatigue, altered sleep pattern, anorexia and fever are common symptoms in both sick animals and humans. Many of these physiological changes represent adaptive responses that are considered to promote animal survival, and this constellation of events results in sickness behavior. Infectious agents display a variety of pathogen-associated molecular patterns (PAMPs) that are recognized by pattern recognition receptors (PRRs). These PRR are expressed on both the surface [e.g. Toll-like receptor (TLR)-4] and in the cytoplasm [e.g. nucleotide-binding oligomerization domain (Nod)-like receptors] of cells of the innate immune system, primarily macrophages and dendritic cells. These cells initiate and propagate an inflammatory response by stimulating the synthesis and release of a variety of cytokines. Once an infection has occurred in the periphery, both cytokines and bacterial toxins deliver this information to the brain using both humoral and neuronal routes of communication. For example, binding of PRR can lead to activation of the afferent vagus nerve, which communicates neuronal signals via the lower brain stem (nucleus tractus solitarius) to higher brain centers such as the hypothalamus and amygdala. Blood-borne cytokines initiate a cytokine response from vascular endothelial cells that form the blood–brain barrier (BBB). Cytokines can also reach the brain directly by leakage through the BBB via circumventricular organs or by being
The nature of immune responses to urinary tract infections
Abraham, Soman N.; Miao, Yuxuan
2016-01-01
The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331
RNA Editing, ADAR1, and the Innate Immune Response.
Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy
2017-01-18
RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.
Ubiquitination in the antiviral immune response.
Davis, Meredith E; Gack, Michaela U
2015-05-01
Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.
VOC Metabolite Emissions from the Brachypodium/Soil/Microbe Ecosystem
NASA Astrophysics Data System (ADS)
Gu, D.; Shilling, J.; Guenther, A. B.; Lindenmaier, R.
2017-12-01
Volatile Organic Compounds (VOCs) emitted from plants and associated microbiota are important for understanding the plant responses to environmental perturbations. VOC emissions from plants are the largest source of hydrocarbons to the atmosphere, which influence oxidants and aerosols leading to complex feed backs and interactions between atmosphere and biosphere. The integrated Plant-Atmosphere-Soil Systems (iPASS) Initiative is a Pacific Northwest National Laboratory (PNNL) project aimed at deciphering fundamental principles that govern the plant ecosystem, from plant genotype through multiple scales to ecosystem traits and response. We take the opportunity of iPASS initiative, and measured VOC metabolite emissions from the Brachypodium/Soil/Microbe Ecosystem. In the experiments, we have been working on (1) identifying VOC metabolites emitted by Brachypodium plants using dynamic vegetation enclosure measurements, (2) understanding the relative contribution of plants, microbes, and soil to VOC emissions, (3) investigating changes that occur in these emissions under different induced stress, and (4) relating VOC emissions from the plant/soil/microbe ecosystem to plant genotype. Taking advantage of experiment results, we also can develop a noninvasive technique for quantifying plant stress by using VOC observations, use VOC observations to improve screening tool for identifying stress resistant phenotypes, and apply the measurements into earth system modeling for better understanding of the impacts of stress on ecosystems.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.
Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura
2011-10-13
Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Immune responses of poultry to Newcastle disease virus.
Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J
2013-11-01
Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be
Melo, Justine A.; Ruvkun, Gary
2012-01-01
Summary The nematode C. elegans consumes benign bacteria such as E. coli and is repelled by pathogens and toxins. Here we show that RNAi and toxin-mediated disruption of core cellular activities, including translation, respiration, and protein turnover, stimulates behavioral avoidance of attractive E. coli. RNAi of such essential processes also induces expression of detoxification and innate immune response genes in the absence of toxins or pathogens. Disruption of core processes in non-neuronal tissues can stimulate aversion behavior, revealing a neuroendocrine axis of control. Microbial avoidance requires serotonergic and Jnk kinase signaling. We propose that surveillance pathways oversee critical cellular activities to detect pathogens, many of which deploy toxins and virulence factors to disrupt these same host pathways. Variation in cellular surveillance and endocrine pathways controlling behavior, detoxification and immunity selected by past toxin or microbial interactions could underlie aberrant responses to foods, medicines, and microbes. PMID:22500807
Plant immunity triggered by microbial molecular signatures.
Zhang, Jie; Zhou, Jian-Min
2010-09-01
Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are recognized by host cell surface-localized pattern-recognition receptors (PRRs) to activate plant immunity. PAMP-triggered immunity (PTI) constitutes the first layer of plant immunity that restricts pathogen proliferation. PTI signaling components often are targeted by various Pseudomonas syringae virulence effector proteins, resulting in diminished plant defenses and increased bacterial virulence. Some of the proteins targeted by pathogen effectors have evolved to sense the effector activity by associating with cytoplasmic immune receptors classically known as resistance proteins. This allows plants to activate a second layer of immunity termed effector-triggered immunity (ETI). Recent studies on PTI regulation and P. syringae effector targets have uncovered new components in PTI signaling. Although MAP kinase (MAPK) cascades have been considered crucial for PTI, emerging evidence indicates that a MAPK-independent pathway also plays an important role in PTI signaling.
Plant immunity: unravelling the complexity of plant responses to biotic stresses.
Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne
2017-03-01
Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com
New CRISPR-Cas systems from uncultivated microbes
NASA Astrophysics Data System (ADS)
Burstein, David; Harrington, Lucas B.; Strutt, Steven C.; Probst, Alexander J.; Anantharaman, Karthik; Thomas, Brian C.; Doudna, Jennifer A.; Banfield, Jillian F.
2017-02-01
CRISPR-Cas systems provide microbes with adaptive immunity by employing short DNA sequences, termed spacers, that guide Cas proteins to cleave foreign DNA. Class 2 CRISPR-Cas systems are streamlined versions, in which a single RNA-bound Cas protein recognizes and cleaves target sequences. The programmable nature of these minimal systems has enabled researchers to repurpose them into a versatile technology that is broadly revolutionizing biological and clinical research. However, current CRISPR-Cas technologies are based solely on systems from isolated bacteria, leaving the vast majority of enzymes from organisms that have not been cultured untapped. Metagenomics, the sequencing of DNA extracted directly from natural microbial communities, provides access to the genetic material of a huge array of uncultivated organisms. Here, using genome-resolved metagenomics, we identify a number of CRISPR-Cas systems, including the first reported Cas9 in the archaeal domain of life, to our knowledge. This divergent Cas9 protein was found in little-studied nanoarchaea as part of an active CRISPR-Cas system. In bacteria, we discovered two previously unknown systems, CRISPR-CasX and CRISPR-CasY, which are among the most compact systems yet discovered. Notably, all required functional components were identified by metagenomics, enabling validation of robust in vivo RNA-guided DNA interference activity in Escherichia coli. Interrogation of environmental microbial communities combined with in vivo experiments allows us to access an unprecedented diversity of genomes, the content of which will expand the repertoire of microbe-based biotechnologies.
Host Immune Status and Response to Hepatitis E Virus Infection
Krain, Lisa J.; Nelson, Kenrad E.
2014-01-01
SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-01-01
BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-12-01
Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.
Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4
Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna
2017-01-01
Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.
Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia
2017-01-01
During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.
Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D
2002-06-21
NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.
Einstein, Mark H
2008-04-01
Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.
2014-01-01
Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively
Dissecting innate immune responses with the tools of systems biology.
Smith, Kelly D; Bolouri, Hamid
2005-02-01
Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.
Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.
Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T
2013-11-01
Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Buckley, Katherine M.; Rast, Jonathan P.
2017-01-01
The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720
Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina
2016-07-19
mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Orcutt, B. N.; Bowman, D.; Turner, A.; Inderbitzen, K. E.; Fisher, A. T.; Peart, L. W.; Iodp Expedition 327 Shipboard Party
2010-12-01
We launched the "Adopt a Microbe" project as part of Integrated Ocean Drilling Program (IODP) Expedition 327 in Summer 2010. This eight-week-long education and outreach effort was run by shipboard scientists and educators from the research vessel JOIDES Resolution, using a web site (https://sites.google.com/site/adoptamicrobe) to engage students of all ages in an exploration of the deep biosphere inhabiting the upper ocean crust. Participants were initially introduced to a cast of microbes (residing within an ‘Adoption Center’ on the project website) that live in the dark ocean and asked to select and virtually ‘adopt’ a microbe. A new educational activity was offered each week to encourage learning about microbiology, using the adopted microbe as a focal point. Activities included reading information and asking questions about the adopted microbes (with subsequent responses from shipboard scientists), writing haiku about the adopted microbes, making balloon and fabric models of the adopted microbes, answering math questions related to the study of microbes in the ocean, growing cultures of microbes, and examining the gases produced by microbes. In addition, the website featured regular text, photo and video updates about the science of the expedition using a toy microbe as narrator, as well as stories written by shipboard scientists from the perspective of deep ocean microbes accompanied by watercolor illustrations prepared by a shipboard artist. Assessment methods for evaluating the effectiveness of the Adopt a Microbe project included participant feedback via email and online surveys, website traffic monitoring, and online video viewing rates. Quantitative metrics suggest that the “Adope A Microbe” project was successful in reaching target audiences and helping to encourage and maintain interest in topics related to IODP Expedition 327. The “Adopt A Microbe” project mdel can be adapted for future oceanographic expeditions to help connect the
Kim, Ju Hyeon; Min, Jee Sun; Kang, Jae Soon; Kwon, Deok Ho; Yoon, Kyong Sup; Strycharz, Joseph; Koh, Young Ho; Pittendrigh, Barry Robert; Clark, J Marshall; Lee, Si Hyeock
2011-05-01
The differences in the immune response between body lice, Pediculus humanus humanus, and head lice, Pediculus humanus capitis, were investigated initially by measuring the proliferation rates of two model bacteria, a Gram-positive Staphylococcus aureus and a Gram-negative Escherichia coli, following challenge by injection. Body lice showed a significantly reduced immune response compared to head lice particularly to E. coli at the early stage of the immune challenge. Annotation of the body louse genome identified substantially fewer immune-related genes compared with other insects. Nevertheless, all required genetic components of the major immune pathways, except for the immune deficiency (Imd) pathway, are still retained in the body louse genome. Transcriptional profiling of representative genes involved in the humoral immune response, following bacterial challenge, revealed that both body and head lice, regardless of their developmental stages, exhibited an increased immune response to S. aureus but little to E. coli. Head lice, however, exhibited a significantly higher phagocytotic activity against E. coli than body lice, whereas the phagocytosis against S. aureus differed only slightly between body and head lice. These findings suggest that the greater immune response in head lice against E. coli is largely due to enhanced phagocytosis and not due to differences in the humoral immune response. The reduced phagocytotic activity in body lice could be responsible, in part, for their increased vector competence. Copyright © 2011 Elsevier Ltd. All rights reserved.
Hidden Worlds of Marine Microbes
NASA Astrophysics Data System (ADS)
Armbrust, E. V.
2016-12-01
Every drop of seawater contains fantastically diverse groups of microbes that control key biogeochemical processes in the ocean and determine the habitability of our planet. The challenge is to scale from this world of individual cells to ecosystem function and ultimately to ocean basin processes. Our work begins with microscopic marine diatoms because they are responsible for about twenty percent of the photosynthesis that occurs on Earth each year, they form the base of highly productive marine food webs, and they help regulate past and current fluxes of CO2 into the ocean. Diatoms evolved in a dilute environment where they are never free from the influences of other microbes. We explore the specifics of these interactions via model diatom/bacteria systems that can be manipulated in the laboratory - one includes an antagonistic bacterium that inhibits the growth of diatoms and a second includes a synergistic bacterium that enhances the growth of diatoms. We scale up from the cellular level to population-level interactions through use of our continuous flow cytometer, SeaFlow, which taps into a ship's seawater intake system to provide a continuous read-out of abundance, size and type of the smallest phytoplankton. We use this data to estimate division rates and mortality rates of these phytoplankton across thousands of kilometers of ocean basins. We tie these scales together with genomic approaches in both laboratory experiments and in open ocean field studies to document how interactions with the environment and between microbes drive specific adaptations. Our ultimate goal is to understand how microbial communities will respond to and will help shape future ocean conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Zhihong; China Institute of Veterinary Drug Control, Beijing 100081; Zhang, Quan
Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-Emore » on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.« less
Defective B cell response to T-dependent immunization in lupus-prone mice
Niu, Haitao; Sobel, Eric S.; Morel, Laurence
2009-01-01
Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209
The Pathogenic Potential of a Microbe
2017-01-01
ABSTRACT Virulence is a microbial property that is realized only in susceptible hosts. There is no absolute measurement for virulence, and consequently it is always measured relative to a standard, usually another microbe or host. This article introduces the concept of pathogenic potential, which provides a new approach to measuring the capacity of microbes for virulence. The pathogenic potential is proportional to the fraction of individuals who become symptomatic after infection with a defined inoculum and can include such attributes as mortality, communicability, and the time from infection to disease. The calculation of the pathogenic potential has significant advantages over the use of the lethal dose that kills 50% of infected individuals (LD50) and allows direct comparisons between individual microbes. An analysis of the pathogenic potential of several microbes for mice reveals a continuum, which in turn supports the view that there is no dividing line between pathogenic and nonpathogenic microbes. PMID:28251180
Trdá, Lucie; Boutrot, Freddy; Claverie, Justine; Brulé, Daphnée; Dorey, Stephan; Poinssot, Benoit
2015-01-01
Plants are continuously monitoring the presence of microorganisms to establish an adapted response. Plants commonly use pattern recognition receptors (PRRs) to perceive microbe- or pathogen-associated molecular patterns (MAMPs/PAMPs) which are microorganism molecular signatures. Located at the plant plasma membrane, the PRRs are generally receptor-like kinases (RLKs) or receptor-like proteins (RLPs). MAMP detection will lead to the establishment of a plant defense program called MAMP-triggered immunity (MTI). In this review, we overview the RLKs and RLPs that assure early recognition and control of pathogenic or beneficial bacteria. We also highlight the crucial function of PRRs during plant-microbe interactions, with a special emphasis on the receptors of the bacterial flagellin and peptidoglycan. In addition, we discuss the multiple strategies used by bacteria to evade PRR-mediated recognition. PMID:25904927
Neutrophil Apoptosis: Relevance to the Innate Immune Response and Inflammatory Disease
Fox, Sarah; Leitch, Andrew E.; Duffin, Rodger; Haslett, Christopher; Rossi, Adriano G.
2010-01-01
Neutrophils are the most abundant cell type involved in the innate immune response. They are rapidly recruited to sites of injury or infection where they engulf and kill invading microorganisms. Neutrophil apoptosis, the process of programmed cell death that prevents the release of neutrophil histotoxic contents, is tightly regulated and limits the destructive capacity of neutrophil products to surrounding tissue. The subsequent recognition and phagocytosis of apoptotic cells by phagocytic cells such as macrophages is central to the successful resolution of an inflammatory response and it is increasingly apparent that the dying neutrophil itself exerts an anti-inflammatory effect through modulation of surrounding cell responses, particularly macrophage inflammatory cytokine release. Apoptosis may be delayed, induced or enhanced by micro-organisms dependent on their immune evasion strategies and the health of the host they encounter. There is now an established field of research aimed at understanding the regulation of apoptosis and its potential as a target for therapeutic intervention in inflammatory and infective diseases. This review focuses on the physiological regulation of neutrophil apoptosis with respect to the innate immune system and highlights recent advances in mechanistic understanding of apoptotic pathways and their therapeutic manipulation in appropriate and excessive innate immune responses. PMID:20375550
Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response
Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann
2015-01-01
Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190
Immune response varies with rate of dispersal in invasive cane toads (Rhinella marina).
Brown, Gregory P; Shine, Richard
2014-01-01
What level of immunocompetence should an animal maintain while undertaking long-distance dispersal? Immune function (surveillance and response) might be down-regulated during prolonged physical exertion due to energy depletion, and/or to avoid autoimmune reactions arising from damaged tissue. On the other hand, heightened immune vigilance might be favored if the organism encounters novel pathogens as it enters novel environments. We assessed the links between immune defense and long-distance movement in a population of invasive cane toads (Rhinella marina) in Australia. Toads were radio-tracked for seven days to measure their activity levels and were then captured and subjected to a suite of immune assays. Toads that moved further showed decreased bacteria-killing ability in their plasma and decreased phagocytic activity in their whole blood, but a heightened skin-swelling response to phytohemagglutinin. Baseline and post-stress corticosterone levels were unrelated to distance moved. Thus, long-distance movement in cane toads is associated with a dampened response in some systems and enhanced response in another. This pattern suggests that sustained activity is accompanied by trade-offs among immune components rather than an overall down or up-regulation. The finding that high mobility is accompanied by modification of the immune system has important implications for animal invasions.
Shan, Libo; He, Ping; Li, Jianming; Heese, Antje; Peck, Scott C; Nürnberger, Thorsten; Martin, Gregory B; Sheen, Jen
2008-07-17
Successful pathogens have evolved strategies to interfere with host immune systems. For example, the ubiquitous plant pathogen Pseudomonas syringae injects two sequence-distinct effectors, AvrPto and AvrPtoB, to intercept convergent innate immune responses stimulated by multiple microbe-associated molecular patterns (MAMPs). However, the direct host targets and precise molecular mechanisms of bacterial effectors remain largely obscure. We show that AvrPto and AvrPtoB bind the Arabidopsis receptor-like kinase BAK1, a shared signaling partner of both the flagellin receptor FLS2 and the brassinosteroid receptor BRI1. This targeting interferes with ligand-dependent association of FLS2 with BAK1 during infection. It also impedes BAK1-dependent host immune responses to diverse other MAMPs and brassinosteroid signaling. Significantly, the structural basis of AvrPto-BAK1 interaction appears to be distinct from AvrPto-Pto association required for effector-triggered immunity. These findings uncover a unique strategy of bacterial pathogenesis where virulence effectors block signal transmission through a key common component of multiple MAMP-receptor complexes.
T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.
Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua
2018-05-09
B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.
Cold exposure down-regulates immune response pathways in ferret aortic perivascular adipose tissue.
Reynés, Bàrbara; van Schothorst, Evert M; García-Ruiz, Estefanía; Keijer, Jaap; Palou, Andreu; Oliver, Paula
2017-05-03
Perivascular adipose tissue (PVAT) surrounds blood vessels and releases paracrine factors, such as cytokines, which regulate local inflammation. The inflammatory state of PVAT has an important role in vascular disease; a pro-inflammatory state has been related with atherosclerosis development, whereas an anti-inflammatory one is protective. Cold exposure beneficially affects immune responses and, could thus impact the pathogenesis of cardiovascular diseases. In this study, we investigated the effects of one-week of cold exposure at 4°C of ferrets on aortic PVAT (aPVAT) versus subcutaneous adipose tissue. Ferrets were used because of the similarity of their adipose tissues to those of humans. A ferret-specific Agilent microarray was designed to cover the complete ferret genome and global gene expression analysis was performed. The data showed that cold exposure altered gene expression mainly in aPVAT. Most of the regulated genes were associated with cell cycle, immune response and gene expression regulation, and were mainly down-regulated. Regarding the effects on immune response, cold acclimation decreased the expression of genes involved in antigen recognition and presentation, cytokine signalling and immune system maturation and activation. This immunosuppressive gene expression pattern was depot-specific, as it was not observed in the inguinal subcutaneous depot. Interestingly, this depression in immune response related genes was also evident in peripheral blood mononuclear cells (PBMC). In conclusion, these results reveal that cold acclimation produces an inhibition of immune response-related pathways in aPVAT, reflected in PBMC, indicative of an anti-inflammatory response, which can potentially be exploited for the enhancement or maintenance of cardiovascular health.
Modulation of Specific and Allergy-Related Immune Responses by Helminths
Daniłowicz-Luebert, Emilia; O'Regan, Noëlle L.; Steinfelder, Svenja; Hartmann, Susanne
2011-01-01
Helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective Th2-type responses and favour long-term persistence. Such evasion mechanisms ensure mutual survival of both the parasite and the host. In this paper, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection. We discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation. We also examine recent findings on helminth-derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti-inflammatory therapeutics. PMID:22219659
Tetranychus urticae mites do not mount an induced immune response against bacteria
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E.; Zélé, Flore; Riga, Maria; Leitão, Alexandre B.; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara
2017-01-01
The genome of the spider mite Tetranychus urticae, a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae, infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila. Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei, a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae. This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei. We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum. Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. PMID:28592670
Tetranychus urticae mites do not mount an induced immune response against bacteria.
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio
2017-06-14
The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.
Babickova, Janka; Gardlik, Roman
2015-10-28
The intestinal microbiome is a dynamic system of interactions between the host and its microbes. Under physiological conditions, a fine balance and mutually beneficial relationship is present. Disruption of this balance is a hallmark of inflammatory bowel disease (IBD). Whether an altered microbiome is the consequence or the cause of IBD is currently not fully understood. The pathogenesis of IBD is believed to be a complex interaction between genetic predisposition, the immune system and environmental factors. In the recent years, metagenomic studies of the human microbiome have provided useful data that are helping to assemble the IBD puzzle. In this review, we summarize and discuss current knowledge on the composition of the intestinal microbiota in IBD, host-microbe interactions and therapeutic possibilities using bacteria in IBD. Moreover, an outlook on the possible contribution of bacteriophages in the pathogenesis and therapy of IBD is provided.
Where the Wild Microbes Are: Education and Outreach on Sub-Seafloor Microbes
NASA Astrophysics Data System (ADS)
Cooper, S. K.; Kurtz, K.; Orcutt, B.; Strong, L.; Collins, J.; Feagan, A.
2014-12-01
Sub-seafloor microbiology has the power to spark the imaginations of children, students and the general public with its mysterious nature, cutting-edge research, and connections to the search for extraterrestrial life. These factors have been utilized to create a number of educational and outreach products to bring subsurface microbes to non-scientist audiences in creative and innovative ways. The Adopt a Microbe curriculum for middle school students provides hands-on activities and investigations for students to learn about microbes and the on-going research about them, and provides opportunities to connect with active expeditions. A new series of videos engages non-scientists with stories about research expeditions and the scientists themselves. A poster and associated activities explore the nature of science using a microbiologist and her research as examples. A new e-book for young children will engage them with age-appropriate text and illustrations. These projects are multidisciplinary, involve science and engineering practices, are available to all audiences and provide examples of high level and meaningful partnerships between scientists and educators and the kinds of products that can result. Subseafloor microbiology projects such as these, aimed at K-12 students and the general public, have the potential to entice the interest of the next generation of microbe scientists and increase general awareness of this important science.
Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S.; Jiang, Daohong; He, Ping; Shan, Libo
2015-01-01
Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression. PMID:25770109
Genomics of immune response to typhoid and cholera vaccines
Majumder, Partha P.
2015-01-01
Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454
Zhang, Lawrence; Sun, Tiefeng
2017-01-01
Activation of mitogen-activated protein kinases (MAPKs) is one of the earliest responses after plants sense an invading pathogen. Here, we show that MPK3 and MPK6, two Arabidopsis thaliana pathogen-responsive MAPKs, and their upstream MAPK kinases, MKK4 and MKK5, are essential to both stomatal and apoplastic immunity. Loss of function of MPK3 and MPK6, or their upstream MKK4 and MKK5, abolishes pathogen/microbe-associated molecular pattern- and pathogen-induced stomatal closure. Gain-of-function activation of MPK3/MPK6 induces stomatal closure independently of abscisic acid (ABA) biosynthesis and signaling. In contrast, exogenously applied organic acids such as malate or citrate are able to reverse the stomatal closure induced by MPK3/MPK6 activation. Gene expression analysis and in situ enzyme activity staining revealed that malate metabolism increases in guard cells after activation of MPK3/MPK6 or inoculation of pathogen. In addition, pathogen-induced malate metabolism requires functional MKK4/MKK5 and MPK3/MPK6. We propose that the pathogen-responsive MPK3/MPK6 cascade and ABA are two essential signaling pathways that control, respectively, the organic acid metabolism and ion channels, two main branches of osmotic regulation in guard cells that function interdependently to control stomatal opening/closure. PMID:28254778
Pye, Ruth; Patchett, Amanda; McLennan, Elspeth; Thomson, Russell; Carver, Scott; Fox, Samantha; Pemberton, David; Kreiss, Alexandre; Baz Morelli, Adriana; Silva, Anabel; Pearse, Martin J.; Corcoran, Lynn M.; Belov, Katherine; Hogg, Carolyn J.; Woods, Gregory M; Lyons, A. Bruce
2018-01-01
Devil facial tumor disease (DFTD) is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I) on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33), these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol®) and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of devils in these anti
Immune response during space flight.
Criswell-Hudak, B S
1991-01-01
The health status of an astronaut prior to and following space flight has been a prime concern of NASA throughout the Apollo series of lunar landings, Skylab, Apollo-Soyuz Test Projects (ASTP), and the new Spacelab-Shuttle missions. Both humoral and cellular immunity has been studied using classical clinical procedures. Serum proteins show fluctuations that can be explained with adaptation to flight. Conversely, cellular immune responses of lymphocytes appear to be depressed in both in vivo as well as in vitro. If this depression in vivo and in vitro is a result of the same cause, then man's adaptation to outer space living will present interesting challenges in the future. Since the cause may be due to reduced gravity, perhaps the designs of the experiments for space flight will offer insights at the cellular levels that will facilitate development of mechanisms for adaptation. Further, if the aging process is viewed as an adaptational concept or model and not as a disease process then perhaps space flight could very easily interact to supply some information on our biological time clocks.
Obanewa, Olayinka; Newell, Marie-Louise
2017-09-01
To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.
Adaptive Immune Responses following Senecavirus A Infection in Pigs.
Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G
2018-02-01
Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease
Immune response and immunologic memory in medical personnel vaccinated with hepatitis B vaccine.
Kevorkyan, Ani K; Teoharov, Pavel B; Petrova, Nedyalka S; Baltadzhiev, Ivan G; Stoilova, Yordanka D; Angelova, Nevena G; Plachkova, Angelina D
2011-01-01
The occupation-related nature of Hepatitis B viral infection in medical personnel has been well documented in a lot of studies. The only reliable way of prevention of this infection is immunisation with hepatitis B vaccine. To follow-up the primary immune response after immunisation with recombinant vaccine and its duration in adult immunocompetent subjects. One hundred sixty-five health-care workers working at St. George University Hospital, Plovdiv in 2009/2010 were included in the study and allocated to two groups. Group 1 (N1 = 70) was followed up for the primary immune response after immunization; group 2 (N2 = 95) was with documented immunization in 1998/1999 (n = 81) and in 1994/1995 (n = 14). Tests based on ELISA for quantitative determination of anti-HBs in mIU/ml were used. The measurement were performed at the National Reference Laboratory of Viral Hepatitis at the NCIPD, Sofia. Descriptive statistics, non-parametric and parametric tests, qualitative correlation were used to analyse data. Group 1 mean age was 40.3 +/- 2.6 years; anti-HBs concentration of > or = 10 mIU/ ml was found in 92.8%. No association between the immune response and the commonly involved factors such as gender, age, overweight, smoking, etc., was found. In group 2, anti-HBs concentration of > or = 10 mIU/ml was found in 77.9%: it was in 75.3% in those immunized 10 years before, and in 92.9% in those immunized 15 years before (t = 0.24, p > 0.05). A booster dose of the vaccine was received by 15/21 subjects from group 2 (those immunized 10 years before that) with anti-HBs < 10 mIU/ml. After the booster, 9/15 produced anti-HBs in protective concentrations (anamnestic immune response). The actual level of seroprotection among the immunized more than 10 years ago was 92%. This study and the documentation of the primary postvaccinal immunity in high-risk medical personnel will help specify if additional hepatitis B vaccine shots are needed.
Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A
2004-12-01
The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid
Genes of innate immunity and the biological response to inhaled ozone
Li, Zhuowei; Tighe, Robert M.; Feng, Feifei; Ledford, Julie G.; Hollingsworth, John W.
2013-01-01
Ambient ozone has a significant impact on human health. We have made considerable progress in understanding the fundamental mechanisms that regulate the biological response to ozone. It is increasingly clear that genes of innate immunity play a central role in both infectious and non-infectious lung disease. The biological response to ambient ozone provides a clinically relevant environmental exposure that allows us to better understand the role of innate immunity in non-infectious airways disease. In this brief review, we focus on: (1) specific cell types in the lung modified by ozone; (2) ozone and oxidative stress; (3) the relationship between genes of innate immunity and ozone; (4) the role of extracellular matrix in reactive airways disease; and (5) the effect of ozone on the adaptive immune system. We summarize recent advances in understanding the mechanisms that ozone contributes to environmental airways disease. PMID:23169704
The immune response against Candida spp. and Sporothrix schenckii.
Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M
2014-01-01
Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Zimmermann, Michael T; Oberg, Ann L; Grill, Diane E; Ovsyannikova, Inna G; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A
2016-01-01
Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50-74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant's propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.
Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel
2017-10-27
For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27
Pathogenesis of graft-versus-host disease: innate immunity amplifying acute alloimmune responses.
Maeda, Yoshinobu
2013-09-01
In addition to reduced-intensity conditioning, which has expanded the eligibility for hematopoietic cell transplantation (HCT) to older patients, increased availability of alternative donors, including HLA-mismatched unrelated donors, has increased access to allogeneic HCT for more patients. However, acute graft-versus-host disease (GVHD) remains a lethal complication, even in HLA-matched donor-recipient pairs. The pathophysiology of GVHD depends on aspects of adaptive immunity and interactions between donor T-cells and host dendritic cells (DCs). Recent work has revealed that the role of other immune cells and endothelial cells and components of the innate immune response are also important. Tissue damage caused by the conditioning regimen leads to the release of exogenous and endogenous "danger signals". Exogenous danger signals called pathogen-associated molecular patterns and endogenous noninfectious molecules known as damage-associated molecular patterns (DAMPs) are responsible for initiating or amplifying acute GVHD by enhancing DC maturation and alloreactive T-cell responses. A significant association of innate immune receptor polymorphisms with outcomes, including GVHD severity, was observed in patients receiving allogeneic HCT. Understanding of the role of innate immunity in acute GVHD might offer new therapeutic approaches.
Gorantala, Jyotsna; Grover, Sonam; Rahi, Amit; Chaudhary, Prerna; Rajwanshi, Ravi; Sarin, Neera Bhalla; Bhatnagar, Rakesh
2014-04-20
In concern with frequent recurrence of anthrax in endemic areas and inadvertent use of its spores as biological weapon, the development of an effective anthrax vaccine suitable for both human and veterinary needs is highly desirable. A simple oral delivery through expression in plant system could offer promising alternative to the current methods that rely on injectable vaccines extracted from bacterial sources. In the present study, we have expressed protective antigen (PA) gene in Indian mustard by Agrobacterium-mediated transformation and in tobacco by plastid transformation. Putative transgenic lines were verified for the presence of transgene and its expression by molecular analysis. PA expressed in transgenic lines was biologically active as evidenced by macrophage lysis assay. Intraperitoneal (i.p.) and oral immunization with plant PA in murine model indicated high serum PA specific IgG and IgA antibody titers. PA specific mucosal immune response was noted in orally immunized groups. Further, antibodies indicated lethal toxin neutralizing potential in-vitro and conferred protection against in-vivo toxin challenge. Oral immunization experiments demonstrated generation of immunoprotective response in mice. Thus, our study examines the feasibility of oral PA vaccine expressed in an edible plant system against anthrax. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P
2016-10-01
The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.
Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System.
Withers, David R; Hepworth, Matthew R
2017-01-01
The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3) are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of "exogenous" signals, such as dietary metabolites and commensal microbes, and "endogenous" host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a "communications hub" in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell-cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases.
Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System
Withers, David R.; Hepworth, Matthew R.
2017-01-01
The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3) are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of “exogenous” signals, such as dietary metabolites and commensal microbes, and “endogenous” host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a “communications hub” in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell–cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases. PMID:29085366
Berg, Michael G; Adams, Robert J; Gambhira, Ratish; Siracusa, Mark C; Scott, Alan L; Roden, Richard B S; Ketner, Gary
2014-09-01
Immunization with human papillomavirus (HPV) L1 virus-like particles (VLPs) prevents infection with HPV. However, the expense and logistical demands of current VLP vaccines will limit their widespread use in resource-limited settings, where most HPV-induced cervical cancer occurs. Live oral adenovirus vaccines have properties that are well-suited for use in such settings. We have described a live recombinant adenovirus vaccine prototype that produces abundant HPV16 L1 protein from the adenovirus major late transcriptional unit and directs the assembly of HPV16 VLPs in tissue culture. Recombinant-derived VLPs potently elicit neutralizing antibodies in mice. Here, we characterize the immune response to the recombinant after dual oral and intranasal immunization of pigtail macaques, in which the virus replicates as it would in immunized humans. The immunization of macaques induced vigorous humoral responses to adenovirus capsid and nonstructural proteins, although, surprisingly, not against HPV L1. In contrast, immunization elicited strong T-cell responses to HPV VLPs as well as adenovirus virions. T-cell responses arose immediately after the primary immunization and were boosted by a second immunization with recombinant virus. T-cell immunity contributes to protection against a wide variety of pathogens, including many viruses. The induction of a strong cellular response by the recombinant indicates that live adenovirus recombinants have potential as vaccines for those agents. These studies encourage and will inform the continued development of viable recombinant adenovirus vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Inducible Defenses Stay Up Late: Temporal Patterns of Immune Gene Expression in Tenebrio molitor
Johnston, Paul R; Makarova, Olga; Rolff, Jens
2014-01-01
The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. PMID:24318927
Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.
Johnston, Paul R; Makarova, Olga; Rolff, Jens
2013-12-06
The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.